#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
NR3C2	4306	genome.wustl.edu	37	4	149356399	149356399	+	Silent	SNP	C	C	T	rs146153919		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr4:149356399C>T	ENST00000358102.3	-	2	1976	c.1614G>A	c.(1612-1614)tcG>tcA	p.S538S	NR3C2_ENST00000355292.3_Silent_p.S538S|NR3C2_ENST00000512865.1_Silent_p.S538S|NR3C2_ENST00000344721.4_Silent_p.S538S|NR3C2_ENST00000511528.1_Silent_p.S538S	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	538	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	GGTCTCTAGCCGATCGTGATA	0.478													ENSG00000151623																									Melanoma(27;428 957 40335 51025 51111)												0								C	,	0,4406		0,0,2203	117.0	109.0	111.0		1614,1614	-11.0	0.0	4	dbSNP_134	111	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	NR3C2	NM_000901.4,NM_001166104.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	538/985,538/868	149356399	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1614G>A	4.37:g.149356399C>T			B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S538	ENST00000358102.3	37	c.1614	CCDS3772.1	4																																																																																			rs146153919	NR3C2	-	NULL		0.478	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	HGNC	protein_coding	OTTHUMT00000364986.1	0	0		87	87		0.00		C			149356399	-1	30		84		tier1	no_errors	ENST00000355292	ensembl	human	known	74_37	silent	26.32		SNP	0.002	T	30	84
NKD2	85409	genome.wustl.edu	37	5	1038447	1038449	+	In_Frame_Del	DEL	CAC	CAC	-	rs3840989		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	CAC	CAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr5:1038447_1038449delCAC	ENST00000296849.5	+	10	1544_1546	c.1315_1317delCAC	c.(1315-1317)cacdel	p.H447del	NKD2_ENST00000274150.4_3'UTR|NKD2_ENST00000382730.2_In_Frame_Del_p.P86del	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	447	His-rich.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			ccaccacgagcaccaccaccacc	0.69													ENSG00000145506																																					0																																										SO:0001651	inframe_deletion	0				AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.1315_1317delCAC	5.37:g.1038456_1038458delCAC	ENSP00000296849:p.His447del		Q96EK8|Q9BSN0	In_Frame_Del	DEL	pfscan_EF_hand_dom	p.H442in_frame_del	ENST00000296849.5	37	c.1315_1317	CCDS3859.1	5																																																																																				NKD2	-	NULL		0.690	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	0	0		25	25		0.00		CAC	NM_033120		1038449	+1	5		35		tier1	no_errors	ENST00000296849	ensembl	human	known	74_37	in_frame_del	12.50		DEL	1.000:1.000:1.000	-	5	35
TIMP4	7079	genome.wustl.edu	37	3	12203603	12203603	+	5'Flank	SNP	C	C	T	rs552553854		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr3:12203603C>T	ENST00000287814.4	-	0	0				SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4						central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						TTCATTGACTCCAAGTATGAC	0.478													ENSG00000157152																									Melanoma(199;1446 2144 30617 38794 51714)												0													75.0	78.0	77.0					3																	12203603		2172	4293	6465	SO:0001631	upstream_gene_variant	0			-	U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763		3.37:g.12203603C>T	Exception_encountered		B2R7K6	R	SNP	-	NULL	ENST00000287814.4	37	NULL	CCDS2608.1	3	.	.	.	.	.	.	.	.	.	.	C	15.76	2.928295	0.52759	.	.	ENSG00000157152	ENST00000540660	.	.	.	4.95	4.95	0.65309	ATP-grasp fold, subdomain 2 (1);Synapsin, ATP-binding domain (1);	0.184059	0.48286	D	0.000194	T	0.74007	0.3660	M	0.73962	2.25	0.45718	D	0.998625	P;P	0.49783	0.928;0.829	P;B	0.52343	0.696;0.386	T	0.78460	-0.2195	9	0.87932	D	0	-8.0276	18.4057	0.90535	0.0:1.0:0.0:0.0	.	310;310	Q92777;Q92777-2	SYN2_HUMAN;.	F	242	.	ENSP00000442512:S242F	S	+	2	0	SYN2	12178603	1.000000	0.71417	0.995000	0.50966	0.944000	0.59088	7.646000	0.83445	2.576000	0.86940	0.655000	0.94253	TCC	-	SYN2	-	-		0.478	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYN2	HGNC	protein_coding	OTTHUMT00000251978.1	0	0		50	50		0.00		C	NM_003256		12203603	+1	9		55		tier1	no_errors	ENST00000425297	ensembl	human	known	74_37	rna	14.06		SNP	1.000	T	9	55
GMEB1	10691	genome.wustl.edu	37	1	29041385	29041386	+	3'UTR	INS	-	-	A	rs372271712|rs559808019|rs528044464	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:29041385_29041386insA	ENST00000294409.2	+	0	1912				GMEB1_ENST00000480454.1_3'UTR|GMEB1_ENST00000373816.1_3'UTR|GMEB1_ENST00000361872.4_3'UTR	NM_006582.3	NP_006573.2	Q9Y692	GMEB1_HUMAN	glucocorticoid modulatory element binding protein 1						transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)	11		Colorectal(325;3.46e-05)|Lung NSC(340;0.000451)|all_lung(284;0.00063)|Breast(348;0.00502)|Renal(390;0.00555)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		GACCCTTTTTTAAAAAAAAAAA	0.342													ENSG00000162419																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF099013	CCDS327.1, CCDS328.1	1p35	2008-02-05			ENSG00000162419	ENSG00000162419			4370	protein-coding gene	gene with protein product		604409				10386584, 10523663	Standard	NM_006582		Approved	P96PIF, PIF96	uc001bra.3	Q9Y692	OTTHUMG00000003647	ENST00000294409.2:c.*100->A	1.37:g.29041396_29041396dupA			B1AT48|Q9NWH1|Q9UKD0	R	INS	-	NULL	ENST00000294409.2	37	NULL	CCDS327.1	1																																																																																				GMEB1	-	-		0.342	GMEB1-003	KNOWN	basic|CCDS	protein_coding	GMEB1	HGNC	protein_coding	OTTHUMT00000010333.1	0	0		58	58		0.00		-	NM_006582		29041386	+1	7		58		tier1	no_errors	ENST00000480454	ensembl	human	known	74_37	rna	10.77		INS	0.437:0.252	A	7	58
ANKLE1	126549	genome.wustl.edu	37	19	17396619	17396619	+	Missense_Mutation	SNP	G	G	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:17396619G>A	ENST00000394458.3	+	8	1942	c.1666G>A	c.(1666-1668)Gaa>Aaa	p.E556K	ANKLE1_ENST00000404085.1_Missense_Mutation_p.E552K|ANKLE1_ENST00000594072.1_Missense_Mutation_p.E519K|ANKLE1_ENST00000433424.2_3'UTR|ANKLE1_ENST00000598347.1_Intron	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	556	GIY-YIG. {ECO:0000255|PROSITE- ProRule:PRU00977}.									large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						GTGTATTGTGGAAGCCCTAGG	0.527													ENSG00000160117																																					0													81.0	70.0	74.0					19																	17396619		2203	4300	6503	SO:0001583	missense	0			-	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.1666G>A	19.37:g.17396619G>A	ENSP00000377971:p.Glu556Lys		A8VU82|Q8N8J8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_LEM_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_LEM/LEM-like_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_LEM_dom	p.E556K	ENST00000394458.3	37	c.1666	CCDS12354.2	19	.	.	.	.	.	.	.	.	.	.	G	20.6	4.023019	0.75275	.	.	ENSG00000160117	ENST00000404261;ENST00000404085;ENST00000394458	T	0.73363	-0.74	5.19	5.19	0.71726	.	0.192252	0.43260	D	0.000600	T	0.73450	0.3588	L	0.54323	1.7	0.80722	D	1	P;P;P	0.44195	0.828;0.501;0.651	B;B;B	0.42771	0.397;0.054;0.165	T	0.77918	-0.2408	10	0.72032	D	0.01	.	16.1999	0.82063	0.0:0.0:1.0:0.0	.	516;556;519	Q8NAG6-1;Q8NAG6;A0JLW0	.;ANKL1_HUMAN;.	K	556;552;519	ENSP00000384008:E552K	ENSP00000377971:E519K	E	+	1	0	ANKLE1	17257619	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	8.848000	0.92172	2.424000	0.82194	0.491000	0.48974	GAA	-	ANKLE1	-	NULL		0.527	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	HGNC	protein_coding	OTTHUMT00000325392.2	0	0		52	52		0.00		G	NM_152363		17396619	+1	11		35		tier1	no_errors	ENST00000394458	ensembl	human	known	74_37	missense	23.91		SNP	1.000	A	11	35
CUL4B	8450	genome.wustl.edu	37	X	119694212	119694212	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chrX:119694212G>T	ENST00000404115.3	-	3	737	c.336C>A	c.(334-336)caC>caA	p.H112Q	CUL4B_ENST00000336592.6_Missense_Mutation_p.H99Q|CUL4B_ENST00000371322.5_Missense_Mutation_p.H94Q	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	112	Ser-rich.				cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTATCGGTACGTGGCTGGAAG	0.542													ENSG00000158290																																					0													73.0	60.0	64.0					X																	119694212		2203	4300	6503	SO:0001583	missense	0			-	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.336C>A	X.37:g.119694212G>T	ENSP00000384109:p.His112Gln		B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.H112Q	ENST00000404115.3	37	c.336	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950353	0.34377	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115	T;T;T	0.67698	-0.27;-0.28;-0.28	5.76	4.79	0.61399	.	0.181066	0.52532	D	0.000069	T	0.48352	0.1495	N	0.25647	0.755	0.33758	D	0.621508	B;B	0.26195	0.089;0.144	B;B	0.30943	0.057;0.122	T	0.53472	-0.8434	9	.	.	.	-4.9253	4.1864	0.10400	0.2484:0.0:0.7516:0.0	.	112;94	Q13620;Q13620-1	CUL4B_HUMAN;.	Q	94;99;112	ENSP00000360373:H94Q;ENSP00000338919:H99Q;ENSP00000384109:H112Q	.	H	-	3	2	CUL4B	119578240	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.213000	0.51153	2.436000	0.82500	0.523000	0.50628	CAC	-	CUL4B	-	NULL		0.542	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	HGNC	protein_coding	OTTHUMT00000058103.1	0	0		37	37		0.00		G	NM_003588		119694212	-1	4		35		tier1	no_errors	ENST00000404115	ensembl	human	known	74_37	missense	10.26		SNP	1.000	T	4	35
CEP83	51134	genome.wustl.edu	37	12	94772610	94772610	+	Missense_Mutation	SNP	A	A	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr12:94772610A>T	ENST00000397809.5	-	7	1307	c.758T>A	c.(757-759)gTg>gAg	p.V253E	CCDC41_ENST00000547575.1_Missense_Mutation_p.V253E|CCDC41_ENST00000549352.1_5'UTR|CCDC41_ENST00000339839.5_Missense_Mutation_p.V253E|CCDC41_ENST00000397807.2_Missense_Mutation_p.V220E	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN		245					cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						CAACTGCCGCACCTGTATTCT	0.423													ENSG00000173588																																					0													122.0	121.0	121.0					12																	94772610		1883	4127	6010	SO:0001583	missense	0			-																												ENST00000397809.5:c.758T>A	12.37:g.94772610A>T	ENSP00000380911:p.Val253Glu		A4FVB1|Q08AP1	Missense_Mutation	SNP	NULL	p.V253E	ENST00000397809.5	37	c.758	CCDS41820.1	12	.	.	.	.	.	.	.	.	.	.	A	18.45	3.627075	0.66901	.	.	ENSG00000173588	ENST00000339839;ENST00000397809;ENST00000397807;ENST00000547575	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.69	5.69	0.88448	.	.	.	.	.	T	0.22820	0.0551	M	0.61703	1.905	0.42729	D	0.993705	D;D;D	0.57571	0.98;0.958;0.96	P;P;P	0.51229	0.663;0.587;0.663	T	0.11665	-1.0578	9	0.02654	T	1	-10.0299	11.8105	0.52179	0.9296:0.0:0.0704:0.0	.	253;220;245	F8VYN8;Q9Y592-2;Q9Y592	.;.;CCD41_HUMAN	E	253;253;220;253	ENSP00000344655:V253E;ENSP00000380911:V253E;ENSP00000380909:V220E;ENSP00000448913:V253E	ENSP00000344655:V253E	V	-	2	0	CCDC41	93296741	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.094000	0.64523	2.173000	0.68751	0.477000	0.44152	GTG	-	CCDC41	-	NULL		0.423	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC41	HGNC	protein_coding	OTTHUMT00000408147.3	0	0		65	65		0.00		A			94772610	-1	11		48		tier1	no_errors	ENST00000339839	ensembl	human	known	74_37	missense	18.64		SNP	1.000	T	11	48
C6	729	genome.wustl.edu	37	5	41172432	41172432	+	Missense_Mutation	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr5:41172432C>A	ENST00000263413.3	-	9	1450	c.1186G>T	c.(1186-1188)Gcc>Tcc	p.A396S	C6_ENST00000337836.5_Missense_Mutation_p.A396S|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	396	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CAGTGTTTGGCTTCTTCCTCG	0.423													ENSG00000039537																																					0													168.0	144.0	152.0					5																	41172432		2203	4300	6503	SO:0001583	missense	0			-	J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1186G>T	5.37:g.41172432C>A	ENSP00000263413:p.Ala396Ser			Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal_dom,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt	p.A396S	ENST00000263413.3	37	c.1186	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	2.400	-0.337875	0.05278	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.84146	-1.81;-1.81	4.89	-9.78	0.00496	Membrane attack complex component/perforin (MACPF) domain (3);	1.779850	0.02509	N	0.091324	T	0.64649	0.2617	N	0.05124	-0.11	0.19575	N	0.999967	B	0.02656	0.0	B	0.06405	0.002	T	0.59627	-0.7419	10	0.08599	T	0.76	3.9864	10.7087	0.45971	0.2925:0.5281:0.0:0.1794	.	396	P13671	CO6_HUMAN	S	396	ENSP00000338861:A396S;ENSP00000263413:A396S	ENSP00000263413:A396S	A	-	1	0	C6	41208189	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.520000	0.06252	-3.142000	0.00233	-1.117000	0.02048	GCC	-	C6	-	pfam_MACPF,smart_MACPF		0.423	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	0	0		52	52		0.00		C			41172432	-1	24		89		tier1	no_errors	ENST00000263413	ensembl	human	known	74_37	missense	21.24		SNP	0.000	A	24	89
CHST8	64377	genome.wustl.edu	37	19	34263521	34263521	+	Missense_Mutation	SNP	C	C	G			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:34263521C>G	ENST00000262622.4	+	4	1586	c.828C>G	c.(826-828)aaC>aaG	p.N276K	CHST8_ENST00000434302.1_Missense_Mutation_p.N276K|CHST8_ENST00000438847.3_Missense_Mutation_p.N276K	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	276					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					AGCACCCCAACAGCTACTATC	0.632													ENSG00000124302																																					0													95.0	90.0	92.0					19																	34263521		2203	4300	6503	SO:0001583	missense	0			-	AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.828C>G	19.37:g.34263521C>G	ENSP00000262622:p.Asn276Lys		Q9H3N2	Missense_Mutation	SNP	pfam_Sulfotransferase	p.N276K	ENST00000262622.4	37	c.828	CCDS12433.1	19	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589114	0.66105	.	.	ENSG00000124302	ENST00000434302;ENST00000438847;ENST00000262622	T;T;T	0.73258	-0.73;-0.73;-0.73	5.15	-2.94	0.05581	.	0.000000	0.85682	D	0.000000	T	0.78457	0.4286	M	0.70842	2.15	0.36187	D	0.849804	D	0.69078	0.997	D	0.76071	0.987	T	0.79806	-0.1648	10	0.49607	T	0.09	-23.1987	11.755	0.51870	0.0:0.5311:0.0:0.4689	.	276	Q9H2A9	CHST8_HUMAN	K	276	ENSP00000392604:N276K;ENSP00000393879:N276K;ENSP00000262622:N276K	ENSP00000262622:N276K	N	+	3	2	CHST8	38955361	0.953000	0.32496	0.992000	0.48379	0.883000	0.51084	0.162000	0.16501	-0.261000	0.09405	0.297000	0.19635	AAC	-	CHST8	-	pfam_Sulfotransferase		0.632	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST8	HGNC	protein_coding	OTTHUMT00000451453.1	0	0		77	77		0.00		C	NM_022467		34263521	+1	22		53		tier1	no_errors	ENST00000262622	ensembl	human	known	74_37	missense	29.33		SNP	0.956	G	22	53
CPXM2	119587	genome.wustl.edu	37	10	125506534	125506534	+	Splice_Site	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr10:125506534C>T	ENST00000241305.3	-	14	2172		c.e14-1		CPXM2_ENST00000368854.3_Intron	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CCATCGTTGGCTGTGAAAAAG	0.552													ENSG00000121898																																					0													119.0	128.0	125.0					10																	125506534		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.2018-1G>A	10.37:g.125506534C>T			B4E3Q2	Splice_Site	SNP	-	e14-1	ENST00000241305.3	37	c.2018-1	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009160	0.54361	.	.	ENSG00000121898	ENST00000241305;ENST00000540123;ENST00000418782	.	.	.	4.95	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3701	0.60709	0.0:0.9241:0.0:0.0758	.	.	.	.	.	-1	.	.	.	-	.	.	CPXM2	125496524	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	7.645000	0.83430	1.307000	0.44944	-0.136000	0.14681	.	-	CPXM2	-	-		0.552	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	0	0		39	39		0.00		C	NM_198148	Intron	125506534	-1	3		15		tier1	no_errors	ENST00000241305	ensembl	human	known	74_37	splice_site	16.67		SNP	1.000	T	3	15
PRKD1	5587	genome.wustl.edu	37	14	30046656	30046656	+	Missense_Mutation	SNP	G	G	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr14:30046656G>C	ENST00000331968.5	-	18	2756	c.2527C>G	c.(2527-2529)Cag>Gag	p.Q843E	PRKD1_ENST00000415220.2_Missense_Mutation_p.Q851E	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	843					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		AACCAGGTCTGATAGTCCTGA	0.428													ENSG00000184304																																					0													80.0	76.0	77.0					14																	30046656		2203	4300	6503	SO:0001583	missense	0			-		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2527C>G	14.37:g.30046656G>C	ENSP00000333568:p.Gln843Glu		A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.Q843E	ENST00000331968.5	37	c.2527	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966780	0.53507	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.82344	-1.6;-1.6	6.17	5.25	0.73442	Protein kinase-like domain (1);	0.067021	0.64402	D	0.000016	T	0.81692	0.4876	L	0.60455	1.87	0.80722	D	1	B	0.13145	0.007	B	0.16722	0.016	T	0.76974	-0.2760	10	0.49607	T	0.09	-24.6786	17.6654	0.88201	0.0:0.1224:0.8776:0.0	.	843	Q15139	KPCD1_HUMAN	E	843;851	ENSP00000333568:Q843E;ENSP00000390535:Q851E	ENSP00000333568:Q843E	Q	-	1	0	PRKD1	29116407	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.995000	0.88328	2.941000	0.99782	0.655000	0.94253	CAG	-	PRKD1	-	superfamily_Kinase-like_dom		0.428	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	0	0		30	30		0.00		G	NM_002742		30046656	-1	5		55		tier1	no_errors	ENST00000331968	ensembl	human	known	74_37	missense	8.33		SNP	1.000	C	5	55
ANAPC15	25906	genome.wustl.edu	37	11	71818438	71818438	+	IGR	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr11:71818438T>C	ENST00000227618.4	-	0	886				ANAPC15_ENST00000502597.2_Missense_Mutation_p.T93A|LRTOMT_ENST00000439209.1_Intron|LRTOMT_ENST00000419228.1_Intron|LRTOMT_ENST00000307198.7_Intron|LRTOMT_ENST00000435085.1_Intron|ANAPC15_ENST00000543015.1_5'Flank|ANAPC15_ENST00000543050.1_Missense_Mutation_p.T178A	NM_001278487.1|NM_001278491.1|NM_014042.2	NP_001265416.1|NP_001265420.1|NP_054761.1	P60006	APC15_HUMAN	anaphase promoting complex subunit 15						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	anaphase-promoting complex (GO:0005680)|intracellular (GO:0005622)											AGGGTGGTTGTTTCTGCCTGG	0.433													ENSG00000110200																																					0																																										SO:0001628	intergenic_variant	0			-	AL080071	CCDS8210.1, CCDS60880.1	11q13.4	2012-10-17	2012-05-31	2012-05-31	ENSG00000110200	ENSG00000110200		"""Anaphase promoting complex subunits"""	24531	protein-coding gene	gene with protein product		614717	"""chromosome 11 open reading frame 51"""	C11orf51		21926987	Standard	NM_014042		Approved	HSPC020, DKFZP564M082, APC15	uc001orw.3	P60006	OTTHUMG00000167865		11.37:g.71818438T>C			G3V1Q3|Q9CXK2|Q9Y269	Missense_Mutation	SNP	NULL	p.T178A	ENST00000227618.4	37	c.532	CCDS8210.1	11	.	.	.	.	.	.	.	.	.	.	T	9.859	1.195721	0.22037	.	.	ENSG00000110200	ENST00000502597;ENST00000543050	.	.	.	3.31	2.18	0.27775	.	.	.	.	.	T	0.30727	0.0774	.	.	.	0.09310	N	0.999997	B	0.20780	0.048	B	0.21708	0.036	T	0.30736	-0.9968	7	0.87932	D	0	.	4.822	0.13396	0.0:0.2575:0.0:0.7425	.	178	G5EA39	.	A	93;178	.	ENSP00000441774:T93A	T	-	1	0	C11orf51	71496086	0.089000	0.21612	0.061000	0.19648	0.480000	0.33159	-0.476000	0.06591	0.666000	0.31087	0.379000	0.24179	ACA	-	APC15	-	NULL		0.433	ANAPC15-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	APC15	HGNC	protein_coding	OTTHUMT00000396695.1	0	0		57	57		0.00		T	NM_014042		71818438	-1	12		46		tier1	no_errors	ENST00000543050	ensembl	human	putative	74_37	missense	20.69		SNP	0.059	C	12	46
C2CD4D	100191040	genome.wustl.edu	37	1	151810481	151810481	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:151810481G>T	ENST00000454109.1	-	2	1570	c.985C>A	c.(985-987)Ctc>Atc	p.L329I		NM_001136003.1	NP_001129475.1	B7Z1M9	C2D4D_HUMAN	C2 calcium-dependent domain containing 4D	329										skin(1)	1						AGCGCAATGAGGGGCGTCTCG	0.716													ENSG00000225556																																					0													25.0	33.0	31.0					1																	151810481		692	1591	2283	SO:0001583	missense	0			-	BC171843	CCDS44224.1	1q21.3	2012-07-02			ENSG00000225556	ENSG00000225556			37210	protein-coding gene	gene with protein product	"""family with sequence similarity 148, member D"""						Standard	NM_001136003		Approved	FAM148D	uc010pdq.1	B7Z1M9	OTTHUMG00000167218	ENST00000454109.1:c.985C>A	1.37:g.151810481G>T	ENSP00000389554:p.Leu329Ile		B2RXG8	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L329I	ENST00000454109.1	37	c.985	CCDS44224.1	1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.315536	0.60524	.	.	ENSG00000225556	ENST00000454109	T	0.56444	0.46	3.44	3.44	0.39384	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.39682	0.1087	N	0.08118	0	0.32899	D	0.51298	D	0.76494	0.999	D	0.73708	0.981	T	0.51301	-0.8723	9	0.87932	D	0	.	12.4129	0.55478	0.0:0.0:1.0:0.0	.	329	B7Z1M9	C2D4D_HUMAN	I	329	ENSP00000389554:L329I	ENSP00000389554:L329I	L	-	1	0	C2CD4D	150077105	1.000000	0.71417	0.891000	0.34965	0.936000	0.57629	5.551000	0.67274	1.761000	0.52028	0.462000	0.41574	CTC	-	C2CD4D	-	superfamily_C2_dom,smart_C2_dom		0.716	C2CD4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD4D	HGNC	protein_coding	OTTHUMT00000393778.1	0	0		72	72		0.00		G	NM_001136003		151810481	-1	4		40		tier1	no_errors	ENST00000454109	ensembl	human	known	74_37	missense	9.09		SNP	0.988	T	4	40
TUBA4A	7277	genome.wustl.edu	37	2	220118077	220118077	+	Intron	DEL	G	G	-	rs60456844		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr2:220118077delG	ENST00000248437.4	-	1	177				TUBA4A_ENST00000498660.1_Intron|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Intron	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	GCTGAGTCACGGGGGGGGGGT	0.647													ENSG00000243910																																					0																																										SO:0001627	intron_variant	0				AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500C>-	2.37:g.220118077delG			A8MUB1|B3KNQ6|P05215	R	DEL	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																				TUBA4B	-	-		0.647	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	HGNC	protein_coding	OTTHUMT00000256816.3	0	0		21	21		0.00		G	NM_006000		220118077	+1	5		24		tier1	no_errors	ENST00000473885	ensembl	human	known	74_37	rna	17.24		DEL	0.000	-	5	24
NFASC	23114	genome.wustl.edu	37	1	204988603	204988604	+	3'UTR	INS	-	-	CATTCATTCATT	rs10528066|rs75073119|rs374821427|rs113491600	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:204988603_204988604insCATTCATTCATT	ENST00000401399.1	+	0	6858_6859				NFASC_ENST00000338515.6_3'UTR|NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000367172.4_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			TCtcatttgtccattcattcat	0.455													ENSG00000163531																																					0																																										SO:0001624	3_prime_UTR_variant	0				AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*2937->CATTCATTCATT	1.37:g.204988603_204988604insCATTCATTCATT			B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	R	INS	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																				NFASC	-	-		0.455	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1									-	NM_001005388		204988604	+1					tier1	no_errors	ENST00000495396	ensembl	human	known	74_37	rna			INS	0.007:0.075	CATTCATTCATT		
BX088651.1	0	genome.wustl.edu	37	9	44402023	44402023	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr9:44402023C>T	ENST00000540551.1	-	1	404	c.233G>A	c.(232-234)cGc>cAc	p.R78H	RP11-475I24.3_ENST00000435586.1_lincRNA																							GCCCGGCACGCGCCGACACTT	0.657													ENSG00000212952																																					0																																										SO:0001583	missense	0			-																												ENST00000540551.1:c.233G>A	9.37:g.44402023C>T	ENSP00000469774:p.Arg78His			Missense_Mutation	SNP	NULL	p.R78H	ENST00000540551.1	37	c.233		9																																																																																			-	BX088651.1	-	NULL		0.657	BX088651.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000212952	Clone_based_ensembl_gene	protein_coding		0	0		95	95		0.00		C			44402023	-1	19		65		tier1	no_errors	ENST00000540551	ensembl	human	known	74_37	missense	22.62		SNP	0.001	T	19	65
COPS4	51138	genome.wustl.edu	37	4	83978560	83978560	+	Splice_Site	SNP	A	A	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr4:83978560A>T	ENST00000264389.2	+	6	849	c.714A>T	c.(712-714)gcA>gcT	p.A238A	COPS4_ENST00000509093.1_Splice_Site_p.A238A|COPS4_ENST00000511653.1_Splice_Site_p.A238A|COPS4_ENST00000503682.1_Splice_Site_p.A238A	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	238	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				TAGCATCAGCAGGTAAACACG	0.348													ENSG00000138663																																					0													67.0	66.0	66.0					4																	83978560		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.715+1A>T	4.37:g.83978560A>T			B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Silent	SNP	pfam_PCI_dom,smart_PCI_dom	p.A238	ENST00000264389.2	37	c.714	CCDS3600.1	4																																																																																			-	COPS4	-	NULL		0.348	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	HGNC	protein_coding	OTTHUMT00000252643.1	0	0		52	52		0.00		A		Silent	83978560	+1	6		51		tier1	no_errors	ENST00000264389	ensembl	human	known	74_37	silent	10.53		SNP	1.000	T	6	51
FLRT2	23768	genome.wustl.edu	37	14	86088593	86088593	+	Silent	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr14:86088593T>C	ENST00000330753.4	+	2	1502	c.735T>C	c.(733-735)ccT>ccC	p.P245P	FLRT2_ENST00000554746.1_Silent_p.P245P	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	245					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TGTCCCACCCTCCTCCCGATC	0.512													ENSG00000185070																																					0													84.0	83.0	84.0					14																	86088593		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.735T>C	14.37:g.86088593T>C			A0AV84|B7ZLP3	Silent	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.P245	ENST00000330753.4	37	c.735	CCDS9877.1	14																																																																																			-	FLRT2	-	NULL		0.512	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	0	0		25	25		0.00		T			86088593	+1	7		14		tier1	no_errors	ENST00000330753	ensembl	human	known	74_37	silent	33.33		SNP	0.002	C	7	14
TBPL1	9519	genome.wustl.edu	37	6	134301277	134301277	+	Missense_Mutation	SNP	G	G	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr6:134301277G>C	ENST00000237264.4	+	2	289	c.14G>C	c.(13-15)aGt>aCt	p.S5T	TBPL1_ENST00000367871.1_Missense_Mutation_p.S5T	NM_001253676.1|NM_004865.3	NP_001240605.1|NP_004856.1	P62380	TBPL1_HUMAN	TBP-like 1	5					acrosome assembly (GO:0001675)|DNA-templated transcription, initiation (GO:0006352)|dTTP biosynthetic process (GO:0006235)|regulation of transcription, DNA-templated (GO:0006355)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	6	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00591)|OV - Ovarian serous cystadenocarcinoma(155;0.00848)		GATGCAGACAGTGATGTTGCA	0.328													ENSG00000028839																																					0													122.0	113.0	116.0					6																	134301277		2203	4300	6503	SO:0001583	missense	0			-	AB020881	CCDS5168.1	6q22.1-q22.3	2008-05-23			ENSG00000028839	ENSG00000028839			11589	protein-coding gene	gene with protein product		605521				10082669, 10220372, 15767669	Standard	NM_001253676		Approved	TLP, STUD, TRF2, TLF	uc010kgg.3	P62380	OTTHUMG00000015609	ENST00000237264.4:c.14G>C	6.37:g.134301277G>C	ENSP00000237264:p.Ser5Thr		A8K8F5|O95753|Q9BWD5|Q9Z2Z0	Missense_Mutation	SNP	pfam_TBP,prints_TBP	p.S5T	ENST00000237264.4	37	c.14	CCDS5168.1	6	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117650	0.56505	.	.	ENSG00000028839	ENST00000416965;ENST00000457715;ENST00000367871;ENST00000237264;ENST00000367869	.	.	.	5.9	5.9	0.94986	Transcription factor TFIID, C-terminal/DNA glycosylase, N-terminal (1);	0.037775	0.85682	D	0.000000	T	0.27524	0.0676	N	0.19112	0.55	0.46874	D	0.999235	B	0.31026	0.304	B	0.18871	0.023	T	0.11690	-1.0577	9	0.20046	T	0.44	-19.3454	19.2586	0.93957	0.0:0.0:1.0:0.0	.	5	P62380	TBPL1_HUMAN	T	5	.	ENSP00000237264:S5T	S	+	2	0	TBPL1	134342970	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.816000	0.75247	2.793000	0.96121	0.591000	0.81541	AGT	-	TBPL1	-	NULL		0.328	TBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBPL1	HGNC	protein_coding	OTTHUMT00000042294.2	0	0		100	100		0.00		G			134301277	+1	19		89		tier1	no_errors	ENST00000237264	ensembl	human	known	74_37	missense	17.59		SNP	1.000	C	19	89
NBPF10	100132406	genome.wustl.edu	37	1	145295521	145295521	+	Missense_Mutation	SNP	C	C	T	rs75821470		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:145295521C>T	ENST00000342960.5	+	2	309	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron|RP11-458D21.5_ENST00000468030.1_3'UTR	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	92						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGCTGAGGAGCTCAGGTGAGG	0.532													ENSG00000163386																																					0																																										SO:0001583	missense	0			-	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.274C>T	1.37:g.145295521C>T	ENSP00000345684:p.Leu92Phe		Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.L92F	ENST00000342960.5	37	c.274	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	11.09	1.536580	0.27475	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.03242	4.0	1.15	1.15	0.20763	.	.	.	.	.	T	0.02230	0.0069	L	0.59436	1.845	0.09310	N	1	.	.	.	.	.	.	T	0.45934	-0.9227	7	0.37606	T	0.19	.	5.8185	0.18514	0.0:1.0:0.0:0.0	.	.	.	.	F	92	ENSP00000345684:L92F	ENSP00000345684:L92F	L	+	1	0	NBPF10	144006878	0.000000	0.05858	0.004000	0.12327	0.055000	0.15305	-0.401000	0.07232	0.963000	0.38082	0.121000	0.15741	CTC	rs75821470	NBPF10	-	NULL		0.532	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		0	0		28	28		0.00		C	NM_001039703		145295521	+1	4		7		tier1	no_errors	ENST00000342960	ensembl	human	known	74_37	missense	36.36		SNP	0.005	T	4	7
IL21R	50615	genome.wustl.edu	37	16	27448886	27448886	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr16:27448886C>T	ENST00000337929.3	+	4	703	c.230C>T	c.(229-231)gCc>gTc	p.A77V	IL21R_ENST00000564089.1_Missense_Mutation_p.A77V|IL21R_ENST00000395755.1_Missense_Mutation_p.A77V|IL21R_ENST00000395754.4_Missense_Mutation_p.A77V	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	77	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						GCCACGCATGCCACCTACACC	0.562			T	BCL6	NHL								ENSG00000103522																												Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0													143.0	108.0	120.0					16																	27448886		2197	4300	6497	SO:0001583	missense	0			-	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.230C>T	16.37:g.27448886C>T	ENSP00000338010:p.Ala77Val		A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.A77V	ENST00000337929.3	37	c.230	CCDS10630.1	16	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.039581	0.00402	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	D;D;D	0.94650	-3.48;-3.48;-3.48	4.65	0.333	0.15943	Fibronectin, type III (1);	2.642770	0.01193	N	0.007374	D	0.89378	0.6698	L	0.27053	0.805	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.77501	-0.2564	10	0.17369	T	0.5	-0.7133	7.3116	0.26477	0.0:0.5763:0.0:0.4237	.	77	Q9HBE5	IL21R_HUMAN	V	77	ENSP00000338010:A77V;ENSP00000379104:A77V;ENSP00000379103:A77V	ENSP00000338010:A77V	A	+	2	0	IL21R	27356387	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.939000	0.28978	0.128000	0.18479	0.650000	0.86243	GCC	-	IL21R	-	superfamily_Fibronectin_type3		0.562	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	HGNC	protein_coding	OTTHUMT00000254578.2	0	0		56	56		0.00		C	NM_181078		27448886	+1	13		31		tier1	no_errors	ENST00000337929	ensembl	human	known	74_37	missense	29.55		SNP	0.000	T	13	31
RIPK1	8737	genome.wustl.edu	37	6	3105965	3105965	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr6:3105965C>T	ENST00000259808.4	+	9	1554	c.1256C>T	c.(1255-1257)cCt>cTt	p.P419L	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.P419L|RIPK1_ENST00000541791.1_Missense_Mutation_p.P373L			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	419	Interaction with SQSTM1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				TCCCATGACCCTTTTGCACAG	0.517													ENSG00000137275																																					0													61.0	63.0	62.0					6																	3105965		2203	4300	6503	SO:0001583	missense	0			-	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1256C>T	6.37:g.3105965C>T	ENSP00000259808:p.Pro419Leu		A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death_domain,pfscan_Death_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P419L	ENST00000259808.4	37	c.1256	CCDS4482.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.743848|4.743848	0.89663|0.89663	.|.	.|.	ENSG00000137275|ENSG00000137275	ENST00000453483|ENST00000259808;ENST00000541791;ENST00000380409	.|T;T;T	.|0.79554	.|-1.28;-0.93;-1.28	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.051124	.|0.85682	.|D	.|0.000000	D|D	0.87704|0.87704	0.6244|0.6244	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.998	.|D;D	.|0.72075	.|0.976;0.928	D|D	0.88251|0.88251	0.2916|0.2916	6|10	0.42905|0.87932	T|D	0.14|0	-16.2055|-16.2055	19.6085|19.6085	0.95589|0.95589	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|373;419	.|Q13546-2;Q13546	.|.;RIPK1_HUMAN	F|L	50|419;373;419	.|ENSP00000259808:P419L;ENSP00000442294:P373L;ENSP00000369773:P419L	ENSP00000415981:L50F|ENSP00000259808:P419L	L|P	+|+	1|2	0|0	RIPK1|RIPK1	3050964|3050964	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.006000|5.006000	0.63978|0.63978	2.641000|2.641000	0.89580|0.89580	0.655000|0.655000	0.94253|0.94253	CTT|CCT	-	RIPK1	-	NULL		0.517	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	0	0		29	29		0.00		C	NM_003804		3105965	+1	13		9		tier1	no_errors	ENST00000259808	ensembl	human	known	74_37	missense	59.09		SNP	1.000	T	13	9
TJP3	27134	genome.wustl.edu	37	19	3731993	3731993	+	Missense_Mutation	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:3731993C>A	ENST00000541714.2	+	6	1136	c.674C>A	c.(673-675)gCt>gAt	p.A225D	TJP3_ENST00000539908.2_Missense_Mutation_p.A189D|TJP3_ENST00000589378.1_Missense_Mutation_p.A234D|TJP3_ENST00000587686.1_Missense_Mutation_p.A244D|TJP3_ENST00000382008.3_Missense_Mutation_p.A225D|TJP3_ENST00000262968.9_Missense_Mutation_p.A244D	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	225	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGGGCCTGGCTGCCCGGCAC	0.597													ENSG00000105289																																					0													47.0	43.0	44.0					19																	3731993		2203	4300	6503	SO:0001583	missense	0			-	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.674C>A	19.37:g.3731993C>A	ENSP00000439278:p.Ala225Asp		A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	pfam_PDZ,pfam_SH3_2,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS3,prints_ZonOcculdens	p.A244D	ENST00000541714.2	37	c.731	CCDS32873.2	19	.	.	.	.	.	.	.	.	.	.	C	16.68	3.191248	0.58017	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	4.37	4.37	0.52481	PDZ/DHR/GLGF (4);	0.127275	0.51477	D	0.000092	D	0.89632	0.6771	H	0.94503	3.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.92245	0.5804	10	0.56958	D	0.05	.	16.0665	0.80887	0.0:1.0:0.0:0.0	.	244;244;225;225	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	D	225;189;225;244	ENSP00000439278:A225D;ENSP00000439991:A189D;ENSP00000371438:A225D;ENSP00000262968:A244D	ENSP00000262968:A244D	A	+	2	0	TJP3	3682993	1.000000	0.71417	0.957000	0.39632	0.076000	0.17211	7.166000	0.77553	2.257000	0.74773	0.313000	0.20887	GCT	-	TJP3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.597	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	0	0		45	45		0.00		C			3731993	+1	4		28		tier1	no_errors	ENST00000262968	ensembl	human	known	74_37	missense	12.50		SNP	0.998	A	4	28
MYO7A	4647	genome.wustl.edu	37	11	76918448	76918448	+	Splice_Site	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr11:76918448G>T	ENST00000409709.3	+	42	6128		c.e42+1		MYO7A_ENST00000409619.2_Splice_Site|MYO7A_ENST00000605744.1_Splice_Site|MYO7A_ENST00000458637.2_Splice_Site	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA						actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TGCAGACAAGGTGGGTCCTTT	0.562													ENSG00000137474																																					0													36.0	39.0	38.0					11																	76918448		2015	4168	6183	SO:0001630	splice_region_variant	0			-	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.5856+1G>T	11.37:g.76918448G>T			B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Splice_Site	SNP	-	e41+1	ENST00000409709.3	37	c.5856+1	CCDS53683.1	11	.	.	.	.	.	.	.	.	.	.	g	19.34	3.808802	0.70797	.	.	ENSG00000137474	ENST00000409709;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000458169;ENST00000544424	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3515	0.90339	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MYO7A	76596096	1.000000	0.71417	0.994000	0.49952	0.716000	0.41182	9.324000	0.96373	2.326000	0.78906	0.550000	0.68814	.	-	MYO7A	-	-		0.562	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	MYO7A	HGNC	protein_coding	OTTHUMT00000328133.1	0	0		41	41		0.00		G	NM_000260	Intron	76918448	+1	3		13		tier1	no_errors	ENST00000409709	ensembl	human	known	74_37	splice_site	18.75		SNP	1.000	T	3	13
TP53BP1	7158	genome.wustl.edu	37	15	43804395	43804395	+	5'Flank	SNP	C	C	G			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr15:43804395C>G	ENST00000263801.3	-	0	0				MAP1A_ENST00000382031.1_Silent_p.L82L	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		CAGGGATTCTCTCCTGGAACA	0.468								Other conserved DNA damage response genes					ENSG00000166963																																					0																																										SO:0001631	upstream_gene_variant	0			-	U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757		15.37:g.43804395C>G	Exception_encountered		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Silent	SNP	NULL	p.L82	ENST00000263801.3	37	c.246	CCDS10096.1	15																																																																																			-	MAP1A	-	NULL		0.468	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132897.3	0	0		69	69		0.00		C			43804395	+1	33		63		tier1	no_errors	ENST00000382031	ensembl	human	novel	74_37	silent	34.38		SNP	1.000	G	33	63
SOX1	6656	genome.wustl.edu	37	13	112722436	112722441	+	In_Frame_Del	DEL	TGGGCG	TGGGCG	-	rs554658976	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	TGGGCG	TGGGCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr13:112722436_112722441delTGGGCG	ENST00000330949.1	+	1	524_529	c.464_469delTGGGCG	c.(463-471)atgggcgtg>atg	p.GV160del		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	160					chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		gcTGTGGCCATGGGCGTGGGCGTGGG	0.786													ENSG00000182968		537	0.107228	0.1195	0.0692	5008	,	,		2991	0.0794		0.0895	False		,,,				2504	0.1646																0										29,551		13,3,274						-1.0	1.0			2	50,1202		20,10,596	no	coding	SOX1	NM_005986.2		33,13,870	A1A1,A1R,RR		3.9936,5.0,4.3122				79,1753				SO:0001651	inframe_deletion	0					CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.464_469delTGGGCG	13.37:g.112722442_112722447delTGGGCG	ENSP00000330218:p.Gly160_Val161del		Q5W0Q1	In_Frame_Del	DEL	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.VG159in_frame_del	ENST00000330949.1	37	c.464_469	CCDS9523.1	13																																																																																				SOX1	-	pfam_TF_SOX		0.786	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	HGNC	protein_coding	OTTHUMT00000045817.3									TGGGCG	NM_005986		112722441	+1					tier1	no_errors	ENST00000330949	ensembl	human	known	74_37	in_frame_del			DEL	0.985:0.996:1.000:1.000:0.975:0.961	-		
ANKRD18B	441459	genome.wustl.edu	37	9	33528762	33528762	+	Nonsense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr9:33528762C>T	ENST00000290943.6	+	2	340	c.244C>T	c.(244-246)Caa>Taa	p.Q82*		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	82										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						TGGCCGTGTGCAAGTGGTCAC	0.453													ENSG00000230453																																					0																																										SO:0001587	stop_gained	0			-			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.244C>T	9.37:g.33528762C>T	ENSP00000290943:p.Gln82*			Nonsense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q82*	ENST00000290943.6	37	c.244		9	.	.	.	.	.	.	.	.	.	.	c	15.43	2.830450	0.50845	.	.	ENSG00000230453	ENST00000290943	.	.	.	1.5	0.575	0.17374	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	5.7136	0.17948	0.0:0.3446:0.6554:0.0	.	.	.	.	X	82	.	ENSP00000290943:Q82X	Q	+	1	0	ANKRD18B	33518762	0.874000	0.30092	0.001000	0.08648	0.004000	0.04260	3.362000	0.52314	0.190000	0.20209	-0.714000	0.03626	CAA	-	ANKRD18B	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.453	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	0	0		88	88		0.00		C	XM_001718334		33528762	+1	39		83		tier1	no_errors	ENST00000290943	ensembl	human	known	74_37	nonsense	31.97		SNP	0.296	T	39	83
LOXHD1	125336	genome.wustl.edu	37	18	44181423	44181423	+	Silent	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr18:44181423C>T	ENST00000398722.4	-	1	56	c.57G>A	c.(55-57)acG>acA	p.T19T	LOXHD1_ENST00000536736.1_Silent_p.T297T|LOXHD1_ENST00000441551.2_Silent_p.T297T			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	19	PLAT 1. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TGACAATATACGTAATAGCTG	0.498													ENSG00000167210																																					0													58.0	51.0	53.0					18																	44181423		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.57G>A	18.37:g.44181423C>T			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.T297	ENST00000398722.4	37	c.891		18	.	.	.	.	.	.	.	.	.	.	C	11.63	1.697258	0.30142	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.46	-10.9	0.00192	.	.	.	.	.	T	0.34077	0.0885	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44205	-0.9343	4	.	.	.	.	3.6118	0.08063	0.1893:0.4688:0.2117:0.1302	.	.	.	.	I	278	.	.	V	-	1	0	LOXHD1	42435421	0.000000	0.05858	0.000000	0.03702	0.804000	0.45430	-2.674000	0.00842	-2.817000	0.00345	-0.258000	0.10820	GTA	-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.498	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0		45	45		0.00		C	NM_144612		44181423	-1	4		37		tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	9.76		SNP	0.001	T	4	37
PER1	5187	genome.wustl.edu	37	17	8048212	8048212	+	Missense_Mutation	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr17:8048212T>C	ENST00000317276.4	-	18	2555	c.2318A>G	c.(2317-2319)tAc>tGc	p.Y773C	PER1_ENST00000354903.5_Missense_Mutation_p.Y757C|PER1_ENST00000581082.1_Missense_Mutation_p.Y753C|PER1_ENST00000578089.1_Intron	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	773	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CACTGGACGGTAGGCGTctgg	0.672			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes					ENSG00000179094																												Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0													23.0	19.0	21.0					17																	8048212		2202	4297	6499	SO:0001583	missense	0			-	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2318A>G	17.37:g.8048212T>C	ENSP00000314420:p.Tyr773Cys		B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.Y773C	ENST00000317276.4	37	c.2318	CCDS11131.1	17	.	.	.	.	.	.	.	.	.	.	T	17.77	3.471206	0.63625	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.37915	2.56;1.17	5.38	5.38	0.77491	.	0.440302	0.23832	N	0.044131	T	0.57504	0.2058	M	0.72894	2.215	0.43118	D	0.994834	D;D	0.76494	0.997;0.999	P;D	0.79784	0.783;0.993	T	0.60895	-0.7172	10	0.59425	D	0.04	-16.9496	11.7859	0.52043	0.0:0.0:0.0:1.0	.	757;773	B4DI49;O15534	.;PER1_HUMAN	C	773;757	ENSP00000314420:Y773C;ENSP00000346979:Y757C	ENSP00000314420:Y773C	Y	-	2	0	PER1	7988937	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.711000	0.37930	2.052000	0.61016	0.533000	0.62120	TAC	-	PER1	-	NULL		0.672	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	0	0		78	78		0.00		T			8048212	-1	17		68		tier1	no_errors	ENST00000317276	ensembl	human	known	74_37	missense	20.00		SNP	1.000	C	17	68
WBSCR17	64409	genome.wustl.edu	37	7	71036308	71036308	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr7:71036308G>T	ENST00000333538.5	+	6	1635	c.1001G>T	c.(1000-1002)aGg>aTg	p.R334M	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	334	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				GTGGTCAACAGGAAGTTCTTC	0.502													ENSG00000185274																																					0													219.0	206.0	211.0					7																	71036308		2203	4300	6503	SO:0001583	missense	0			-	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1001G>T	7.37:g.71036308G>T	ENSP00000329654:p.Arg334Met		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R334M	ENST00000333538.5	37	c.1001	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681073	0.88542	.	.	ENSG00000185274	ENST00000333538	T	0.69306	-0.39	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.87176	0.6112	H	0.96365	3.81	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.90790	0.4686	10	0.87932	D	0	.	15.5099	0.75772	0.0:0.0:1.0:0.0	.	334	Q6IS24	GLTL3_HUMAN	M	334	ENSP00000329654:R334M	ENSP00000329654:R334M	R	+	2	0	WBSCR17	70674244	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.459000	0.90367	2.689000	0.91719	0.637000	0.83480	AGG	-	WBSCR17	-	NULL		0.502	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	0	0		96	96		0.00		G	NM_022479		71036308	+1	18		87		tier1	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	17.14		SNP	1.000	T	18	87
TNFRSF10C	8794	genome.wustl.edu	37	8	22960554	22960554	+	5'UTR	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr8:22960554T>C	ENST00000356864.3	+	0	452				TNFRSF10C_ENST00000520607.1_Intron|TNFRSF10C_ENST00000540813.1_5'UTR|TNFRSF10C_ENST00000397703.2_Missense_Mutation_p.S14P	NM_003841.3	NP_003832	O14798	TR10C_HUMAN	tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain						apoptotic process (GO:0006915)|signal transduction (GO:0007165)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|large_intestine(6)|lung(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	15		Prostate(55;0.0421)|Breast(100;0.067)		Colorectal(74;0.0147)|COAD - Colon adenocarcinoma(73;0.0612)		GTTAGGGAACTCTGGGGACAG	0.617													ENSG00000173535																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF012536	CCDS6037.1	8p22-p21	2006-02-22			ENSG00000173535	ENSG00000173535		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11906	protein-coding gene	gene with protein product		603613				9314565, 9325248	Standard	NM_003841		Approved	DcR1, TRAILR3, LIT, TRID, CD263	uc003xcy.3	O14798	OTTHUMG00000097844	ENST00000356864.3:c.-81T>C	8.37:g.22960554T>C			O14755|Q08AS6|Q6FH98|Q6UXM5	Missense_Mutation	SNP	NULL	p.S14P	ENST00000356864.3	37	c.40	CCDS6037.1	8	.	.	.	.	.	.	.	.	.	.	T	3.336	-0.135725	0.06711	.	.	ENSG00000173535	ENST00000397703	.	.	.	0.615	-1.23	0.09465	.	.	.	.	.	T	0.31513	0.0799	.	.	.	0.19300	N	0.99997	.	.	.	.	.	.	T	0.29941	-0.9995	4	0.41790	T	0.15	.	.	.	.	.	.	.	.	P	14	.	ENSP00000380815:S14P	S	+	1	0	TNFRSF10C	23016499	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.058000	0.03482	-0.518000	0.06452	0.172000	0.16884	TCT	-	TNFRSF10C	-	NULL		0.617	TNFRSF10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF10C	HGNC	protein_coding	OTTHUMT00000215134.3	0	0		92	92		0.00		T			22960554	+1	35		68		tier1	no_errors	ENST00000397703	ensembl	human	putative	74_37	missense	33.98		SNP	0.001	C	35	68
MCL1	4170	genome.wustl.edu	37	1	150549410	150549410	+	3'UTR	SNP	C	C	A	rs587658622		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:150549410C>A	ENST00000369026.2	-	0	1553				MCL1_ENST00000464132.1_5'UTR	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1						apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AGTCATAGTTCTATTACTTGT	0.378													ENSG00000143384																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.*441G>T	1.37:g.150549410C>A			B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	R	SNP	-	NULL	ENST00000369026.2	37	NULL	CCDS957.1	1																																																																																			-	MCL1	-	-		0.378	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCL1	HGNC	protein_coding	OTTHUMT00000084402.1	0	0		81	81		0.00		C	NM_021960		150549410	-1	23		25		tier1	no_errors	ENST00000464132	ensembl	human	known	74_37	rna	47.92		SNP	0.000	A	23	25
LMOD3	56203	genome.wustl.edu	37	3	69171266	69171266	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr3:69171266G>T	ENST00000420581.2	-	1	451	c.272C>A	c.(271-273)cCt>cAt	p.P91H	LMOD3_ENST00000475434.1_Missense_Mutation_p.P91H|LMOD3_ENST00000489031.1_Missense_Mutation_p.P91H	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	91	Glu-rich.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		AAAGGTGACAGGAACTCGTTC	0.453													ENSG00000163380																																					0													72.0	67.0	68.0					3																	69171266		1901	4119	6020	SO:0001583	missense	0			-	AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.272C>A	3.37:g.69171266G>T	ENSP00000414670:p.Pro91His		B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Missense_Mutation	SNP	pfam_Tropomodulin	p.P91H	ENST00000420581.2	37	c.272	CCDS46862.1	3	.	.	.	.	.	.	.	.	.	.	G	19.02	3.746485	0.69418	.	.	ENSG00000163380	ENST00000420581;ENST00000489031;ENST00000475434	T;T;T	0.59638	0.25;0.25;0.25	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.75796	0.3898	M	0.76574	2.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69654	-0.5087	10	0.18710	T	0.47	-10.8286	19.8051	0.96529	0.0:0.0:1.0:0.0	.	91	Q0VAK6	LMOD3_HUMAN	H	91	ENSP00000414670:P91H;ENSP00000417210:P91H;ENSP00000418645:P91H	ENSP00000414670:P91H	P	-	2	0	LMOD3	69253956	1.000000	0.71417	0.995000	0.50966	0.432000	0.31715	9.869000	0.99810	2.702000	0.92279	0.591000	0.81541	CCT	-	LMOD3	-	pfam_Tropomodulin		0.453	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD3	HGNC	protein_coding	OTTHUMT00000352138.1	0	0		66	66		0.00		G	XM_067529		69171266	-1	4		34		tier1	no_errors	ENST00000420581	ensembl	human	known	74_37	missense	10.53		SNP	1.000	T	4	34
GPR160	26996	genome.wustl.edu	37	3	169780490	169780490	+	Intron	SNP	G	G	A	rs370630905		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr3:169780490G>A	ENST00000355897.5	+	3	416				GPR160_ENST00000482813.1_3'UTR	NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			ACAGGCCCCCGAAAAAAAGCT	0.512													ENSG00000173890																																					0																																										SO:0001627	intron_variant	0			-	AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.-192-17072G>A	3.37:g.169780490G>A			D3DNQ2	R	SNP	-	NULL	ENST00000355897.5	37	NULL	CCDS3211.1	3																																																																																			-	GPR160	-	-		0.512	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR160	HGNC	protein_coding	OTTHUMT00000352167.1	0	0		19	19		0.00		G	NM_014373		169780490	+1	3		11		tier1	no_errors	ENST00000476668	ensembl	human	putative	74_37	rna	21.43		SNP	0.102	A	3	11
HTR2A	3356	genome.wustl.edu	37	13	47409498	47409498	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr13:47409498C>T	ENST00000378688.4	-	3	1021	c.890G>A	c.(889-891)cGg>cAg	p.R297Q	HTR2A_ENST00000542664.1_Missense_Mutation_p.R297Q|HTR2A_ENST00000543956.1_Missense_Mutation_p.R213Q			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	297					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATGGATCGACCGCTGGAAGAG	0.507													ENSG00000102468																																					0													91.0	79.0	83.0					13																	47409498		2203	4300	6503	SO:0001583	missense	0			-	X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.890G>A	13.37:g.47409498C>T	ENSP00000367959:p.Arg297Gln		B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt	p.R297Q	ENST00000378688.4	37	c.890	CCDS9405.1	13	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109251	0.56398	.	.	ENSG00000102468	ENST00000378688;ENST00000543956;ENST00000542664	T;T;T	0.61859	0.36;0.07;0.36	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.124540	0.53938	D	0.000048	T	0.48077	0.1480	L	0.39514	1.22	0.44500	D	0.997443	P;P	0.39601	0.476;0.68	B;B	0.34590	0.186;0.121	T	0.40327	-0.9569	10	0.13470	T	0.59	.	19.3632	0.94451	0.0:1.0:0.0:0.0	.	213;297	F5GWE8;P28223	.;5HT2A_HUMAN	Q	297;213;297	ENSP00000367959:R297Q;ENSP00000441861:R213Q;ENSP00000437737:R297Q	ENSP00000367959:R297Q	R	-	2	0	HTR2A	46307499	1.000000	0.71417	0.994000	0.49952	0.980000	0.70556	7.483000	0.81158	2.894000	0.99253	0.591000	0.81541	CGG	-	HTR2A	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT2A_rcpt		0.507	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	0	0		26	26		0.00		C	NM_000621		47409498	-1	14		39		tier1	no_errors	ENST00000378688	ensembl	human	known	74_37	missense	26.42		SNP	1.000	T	14	39
COL18A1	80781	genome.wustl.edu	37	21	46924426	46924434	+	In_Frame_Del	DEL	GGCCCCCCA	GGCCCCCCA	-	rs28696990|rs149296338|rs201180574|rs78227997	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	GGCCCCCCA	GGCCCCCCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr21:46924426_46924434delGGCCCCCCA	ENST00000359759.4	+	33	4090_4098	c.4069_4077delGGCCCCCCA	c.(4069-4077)ggccccccadel	p.GPP1360del	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000400337.2_In_Frame_Del_p.GPP945del|COL18A1_ENST00000355480.5_In_Frame_Del_p.GPP1125del			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1360	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		cggcccccccggccccccaggccccccag	0.708													ENSG00000182871																																					0																																										SO:0001651	inframe_deletion	0					CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4069_4077delGGCCCCCCA	21.37:g.46924435_46924443delGGCCCCCCA	ENSP00000352798:p.Gly1360_Pro1362del		A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	In_Frame_Del	DEL	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.GPP1360in_frame_del	ENST00000359759.4	37	c.4069_4077		21																																																																																				COL18A1	-	NULL		0.708	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1									GGCCCCCCA			46924434	+1					tier1	no_errors	ENST00000359759	ensembl	human	known	74_37	in_frame_del			DEL	0.307:0.391:0.336:0.964:0.952:0.917:0.918:0.919:0.837	-		
KLHL28	54813	genome.wustl.edu	37	14	45414684	45414684	+	Missense_Mutation	SNP	G	G	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr14:45414684G>A	ENST00000396128.4	-	2	567	c.448C>T	c.(448-450)Cgt>Tgt	p.R150C	KLHL28_ENST00000355081.2_Missense_Mutation_p.R164C	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	150										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TAAAGGTCACGGCAACCATAT	0.383													ENSG00000179454																																					0													62.0	62.0	62.0					14																	45414684		2203	4300	6503	SO:0001583	missense	0			-	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.448C>T	14.37:g.45414684G>A	ENSP00000379434:p.Arg150Cys		Q0VAL5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R150C	ENST00000396128.4	37	c.448	CCDS9680.1	14	.	.	.	.	.	.	.	.	.	.	G	16.04	3.011052	0.54361	.	.	ENSG00000179454	ENST00000396128;ENST00000355081;ENST00000556500	T;T;T	0.76578	-0.41;-0.41;-1.03	5.7	5.7	0.88788	BTB/Kelch-associated (2);	0.082747	0.85682	D	0.000000	T	0.73001	0.3531	L	0.39467	1.215	0.45087	D	0.998109	B;P	0.48640	0.001;0.913	B;B	0.40825	0.0;0.341	T	0.74976	-0.3480	10	0.46703	T	0.11	.	19.4198	0.94716	0.0:0.0:1.0:0.0	.	150;150	Q9NXS3-2;Q9NXS3	.;KLH28_HUMAN	C	150;164;150	ENSP00000379434:R150C;ENSP00000347193:R164C;ENSP00000452061:R150C	ENSP00000347193:R164C	R	-	1	0	KLHL28	44484434	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.415000	0.80131	2.696000	0.92011	0.655000	0.94253	CGT	-	KLHL28	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin		0.383	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL28	HGNC	protein_coding	OTTHUMT00000276790.3	0	0		63	63		0.00		G			45414684	-1	23		44		tier1	no_errors	ENST00000396128	ensembl	human	known	74_37	missense	34.33		SNP	1.000	A	23	44
SLC4A4	8671	genome.wustl.edu	37	4	72121054	72121054	+	Missense_Mutation	SNP	A	A	G			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr4:72121054A>G	ENST00000264485.5	+	3	308	c.191A>G	c.(190-192)tAc>tGc	p.Y64C	SLC4A4_ENST00000514331.1_3'UTR|SLC4A4_ENST00000351898.6_Missense_Mutation_p.Y64C|SLC4A4_ENST00000425175.1_Missense_Mutation_p.Y64C	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	64					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TCTGAGAACTACTCTGACAAA	0.463													ENSG00000080493																																					0													142.0	147.0	145.0					4																	72121054		1933	4131	6064	SO:0001583	missense	0			-	AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.191A>G	4.37:g.72121054A>G	ENSP00000264485:p.Tyr64Cys		C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.Y64C	ENST00000264485.5	37	c.191	CCDS43236.1	4	.	.	.	.	.	.	.	.	.	.	A	14.87	2.664450	0.47572	.	.	ENSG00000080493	ENST00000264485;ENST00000425175;ENST00000351898	T;T;T	0.77750	-1.12;-1.12;-0.74	5.7	5.7	0.88788	.	0.136545	0.49916	D	0.000140	T	0.60728	0.2291	N	0.03608	-0.345	0.80722	D	1	P;B;P	0.41265	0.744;0.32;0.744	B;B;B	0.40659	0.336;0.325;0.336	T	0.68891	-0.5289	10	0.48119	T	0.1	.	15.1587	0.72764	1.0:0.0:0.0:0.0	.	64;64;64	A5JJ20;Q9Y6R1-4;Q9Y6R1	.;.;S4A4_HUMAN	C	64	ENSP00000264485:Y64C;ENSP00000393557:Y64C;ENSP00000307349:Y64C	ENSP00000264485:Y64C	Y	+	2	0	SLC4A4	72339918	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.231000	0.58639	2.173000	0.68751	0.528000	0.53228	TAC	-	SLC4A4	-	NULL		0.463	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	0	0		50	50		0.00		A	NM_003759		72121054	+1	18		79		tier1	no_errors	ENST00000425175	ensembl	human	known	74_37	missense	18.56		SNP	1.000	G	18	79
TMEM191C	645426	genome.wustl.edu	37	22	21822385	21822390	+	lincRNA	DEL	TGGGGT	TGGGGT	-			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	TGGGGT	TGGGGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr22:21822385_21822390delTGGGGT	ENST00000449424.1	+	0	427_432							A6NGB0	T191C_HUMAN	transmembrane protein 191C							integral component of membrane (GO:0016021)											gatccgggggtggggtgaggtaggAC	0.699													ENSG00000206140																																					0																																												0						22q11.21	2013-04-03			ENSG00000206140	ENSG00000206140			33601	other	unknown							Standard	NM_001207052		Approved		uc021wmg.1	A6NGB0	OTTHUMG00000150780		22.37:g.21822385_21822390delTGGGGT				R	DEL	-	NULL	ENST00000449424.1	37	NULL		22																																																																																				TMEM191C	-	-		0.699	TMEM191C-004	KNOWN	basic|exp_conf	lincRNA	TMEM191C	HGNC	lincRNA	OTTHUMT00000320053.1									TGGGGT	NM_001207052		21822390	+1					tier1	no_errors	ENST00000449424	ensembl	human	known	74_37	rna			DEL	0.000:0.005:0.016:0.005:0.000:0.000	-		
MTCL1	23255	genome.wustl.edu	37	18	8825190	8825190	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr18:8825190G>T	ENST00000306329.11	+	13	4639	c.4639G>T	c.(4639-4641)Gga>Tga	p.G1547*	SOGA2_ENST00000306285.7_Nonsense_Mutation_p.G553*|SOGA2_ENST00000517570.1_Nonsense_Mutation_p.G1187*|SOGA2_ENST00000400050.3_Nonsense_Mutation_p.G1187*|SOGA2_ENST00000518815.1_Nonsense_Mutation_p.G553*|SOGA2_ENST00000359865.3_Nonsense_Mutation_p.G1228*																							AGACACCAAGGGAGGCCCTCC	0.687													ENSG00000168502																																					0													18.0	21.0	20.0					18																	8825190		2194	4291	6485	SO:0001587	stop_gained	0			-																												ENST00000306329.11:c.4639G>T	18.37:g.8825190G>T	ENSP00000305027:p.Gly1547*			Nonsense_Mutation	SNP	pfam_SOGA	p.G1228*	ENST00000306329.11	37	c.3682		18	.	.	.	.	.	.	.	.	.	.	G	37	6.315699	0.97467	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050;ENST00000306285	.	.	.	5.24	4.36	0.52297	.	0.000000	0.46758	D	0.000270	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-31.8832	8.6938	0.34282	0.0764:0.0:0.7737:0.15	.	.	.	.	X	1249;1187;1228;1187;553	.	ENSP00000303670:G553X	G	+	1	0	CCDC165	8815190	1.000000	0.71417	0.196000	0.23383	0.846000	0.48090	5.465000	0.66725	1.208000	0.43306	0.655000	0.94253	GGA	-	SOGA2	-	NULL		0.687	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	0	0		69	69		0.00		G			8825190	+1	27		123		tier1	no_errors	ENST00000359865	ensembl	human	known	74_37	nonsense	18.00		SNP	0.992	T	27	123
PIK3C2G	5288	genome.wustl.edu	37	12	18499601	18499601	+	Missense_Mutation	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr12:18499601C>A	ENST00000266497.5	+	10	1494	c.1456C>A	c.(1456-1458)Cta>Ata	p.L486I	PIK3C2G_ENST00000535651.1_Missense_Mutation_p.L486I|PIK3C2G_ENST00000433979.1_Missense_Mutation_p.L486I|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.L486I			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	486	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				AACAACTGAACTATCCACATC	0.383													ENSG00000139144																																					0													165.0	167.0	166.0					12																	18499601		1915	4124	6039	SO:0001583	missense	0			-	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1456C>A	12.37:g.18499601C>A	ENSP00000266497:p.Leu486Ile		A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L486I	ENST00000266497.5	37	c.1456	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	C	15.36	2.810711	0.50421	.	.	ENSG00000139144	ENST00000535651;ENST00000433979;ENST00000266497;ENST00000538779	T;T;T;T	0.74737	0.27;-0.87;-0.87;-0.59	3.98	2.06	0.26882	Phosphoinositide 3-kinase, C2 (1);	0.981870	0.08291	N	0.968395	D	0.83622	0.5294	M	0.76328	2.33	0.38645	D	0.951703	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.994;0.997;0.994	T	0.76228	-0.3036	10	0.35671	T	0.21	-10.4744	7.4208	0.27071	0.0:0.7804:0.0:0.2196	.	485;486;486	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	I	486	ENSP00000443850:L486I;ENSP00000404845:L486I;ENSP00000266497:L486I;ENSP00000445381:L486I	ENSP00000266497:L486I	L	+	1	2	PIK3C2G	18390868	1.000000	0.71417	0.872000	0.34217	0.768000	0.43524	2.923000	0.48868	0.579000	0.29504	-0.300000	0.09419	CTA	-	PIK3C2G	-	NULL		0.383	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	0	0		34	34		0.00		C	NM_004570		18499601	+1	8		65		tier1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	10.96		SNP	0.998	A	8	65
SDK1	221935	genome.wustl.edu	37	7	4153058	4153058	+	Missense_Mutation	SNP	G	G	A	rs377301442		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr7:4153058G>A	ENST00000404826.2	+	24	3711	c.3572G>A	c.(3571-3573)cGg>cAg	p.R1191Q	SDK1_ENST00000389531.3_Missense_Mutation_p.R1191Q	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1191	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ACCAGCCTGCGGCTTCGCTGG	0.637													ENSG00000146555																																					0								G	GLN/ARG	0,4406		0,0,2203	78.0	84.0	82.0		3572	5.2	1.0	7		82	1,8599	1.2+/-3.3	0,1,4299	no	missense	SDK1	NM_152744.3	43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	1191/2214	4153058	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3572G>A	7.37:g.4153058G>A	ENSP00000385899:p.Arg1191Gln		Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1191Q	ENST00000404826.2	37	c.3572	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243833	0.58995	0.0	1.16E-4	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.56444	0.46;0.46	5.22	5.22	0.72569	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.220091	0.32357	N	0.006210	T	0.53578	0.1805	M	0.67397	2.05	0.40876	D	0.98395	B;B	0.24092	0.05;0.097	B;B	0.20184	0.014;0.028	T	0.52351	-0.8587	10	0.30078	T	0.28	.	18.8007	0.92015	0.0:0.0:1.0:0.0	.	1191;1191	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	Q	1191	ENSP00000385899:R1191Q;ENSP00000374182:R1191Q	ENSP00000374182:R1191Q	R	+	2	0	SDK1	4119584	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.213000	0.72194	2.437000	0.82529	0.655000	0.94253	CGG	-	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.637	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	0	0		20	20		0.00		G	NM_152744		4153058	+1	6		12		tier1	no_errors	ENST00000404826	ensembl	human	known	74_37	missense	33.33		SNP	1.000	A	6	12
NCAN	1463	genome.wustl.edu	37	19	19349080	19349080	+	Missense_Mutation	SNP	G	G	A	rs564014772		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:19349080G>A	ENST00000252575.6	+	11	3368	c.3269G>A	c.(3268-3270)cGc>cAc	p.R1090H	NCAN_ENST00000538881.1_Missense_Mutation_p.R541H	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1090	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	GGCTGTGACCGCGGCTGGCAT	0.662													ENSG00000130287	G|||	1	0.000199681	0.0	0.0	5008	,	,		16299	0.0		0.0	False		,,,				2504	0.001																0													52.0	54.0	53.0					19																	19349080		2203	4300	6503	SO:0001583	missense	0			-	AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3269G>A	19.37:g.19349080G>A	ENSP00000252575:p.Arg1090His		Q9UPK6	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link,prints_AntifreezeII	p.R1090H	ENST00000252575.6	37	c.3269	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	G	0.441	-0.898454	0.02472	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.17213	2.29;2.29	4.75	-0.177	0.13307	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (1);	0.395872	0.18712	N	0.133272	T	0.06050	0.0157	N	0.04320	-0.23	0.28245	N	0.925504	B;B	0.24768	0.111;0.014	B;B	0.14578	0.011;0.004	T	0.33854	-0.9852	10	0.27082	T	0.32	.	7.3008	0.26420	0.4445:0.0:0.5555:0.0	.	1104;1090	Q4LE67;O14594	.;NCAN_HUMAN	H	1104;1090;541	ENSP00000252575:R1090H;ENSP00000442202:R541H	ENSP00000252575:R1090H	R	+	2	0	NCAN	19210080	0.716000	0.27956	0.266000	0.24541	0.645000	0.38454	1.442000	0.35046	0.160000	0.19432	0.561000	0.74099	CGC	-	NCAN	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII		0.662	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	HGNC	protein_coding	OTTHUMT00000460111.2	0	0		98	98		0.00		G	NM_004386		19349080	+1	13		75		tier1	no_errors	ENST00000252575	ensembl	human	known	74_37	missense	14.77		SNP	0.428	A	13	75
THOC5	8563	genome.wustl.edu	37	22	29927861	29927861	+	Missense_Mutation	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr22:29927861T>C	ENST00000490103.1	-	8	928	c.806A>G	c.(805-807)tAt>tGt	p.Y269C	THOC5_ENST00000397872.1_Missense_Mutation_p.Y269C|THOC5_ENST00000397873.2_Missense_Mutation_p.Y269C|THOC5_ENST00000397871.1_Missense_Mutation_p.Y269C|CTA-256D12.11_ENST00000411969.1_RNA	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	269					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AAAGAGGACATAGAGGGGAGG	0.597													ENSG00000100296																																					0													84.0	69.0	74.0					22																	29927861		2203	4300	6503	SO:0001583	missense	0			-	AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.806A>G	22.37:g.29927861T>C	ENSP00000420306:p.Tyr269Cys		O60839|Q9UPZ5	Missense_Mutation	SNP	pfam_THO_Thoc5	p.Y269C	ENST00000490103.1	37	c.806	CCDS13859.1	22	.	.	.	.	.	.	.	.	.	.	T	28.0	4.882206	0.91740	.	.	ENSG00000100296	ENST00000490103;ENST00000397872;ENST00000397871;ENST00000397873	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.70254	0.3203	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75665	-0.3239	10	0.72032	D	0.01	-32.9831	16.5885	0.84745	0.0:0.0:0.0:1.0	.	269	Q13769	THOC5_HUMAN	C	269	ENSP00000420306:Y269C;ENSP00000380970:Y269C;ENSP00000380969:Y269C;ENSP00000380971:Y269C	ENSP00000380969:Y269C	Y	-	2	0	THOC5	28257861	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	7.875000	0.87205	2.317000	0.78254	0.460000	0.39030	TAT	-	THOC5	-	pfam_THO_Thoc5		0.597	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	HGNC	protein_coding	OTTHUMT00000322097.1	0	0		48	48		0.00		T	NM_003678		29927861	-1	10		73		tier1	no_errors	ENST00000397871	ensembl	human	known	74_37	missense	12.05		SNP	1.000	C	10	73
BTBD11	121551	genome.wustl.edu	37	12	107974745	107974745	+	Intron	SNP	G	G	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr12:107974745G>A	ENST00000280758.5	+	4	2018				BTBD11_ENST00000420571.2_Intron|BTBD11_ENST00000490090.2_Intron|BTBD11_ENST00000357167.4_Missense_Mutation_p.G21E	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11							integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GTGCGGTCCGGATGTCTCCAA	0.617													ENSG00000151136																																					0													14.0	18.0	17.0					12																	107974745		1717	3776	5493	SO:0001627	intron_variant	0			-	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1491-184G>A	12.37:g.107974745G>A			A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.G21E	ENST00000280758.5	37	c.62	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	G	15.04	2.716282	0.48622	.	.	ENSG00000151136	ENST00000357167	T	0.42513	0.97	4.18	4.18	0.49190	.	.	.	.	.	T	0.44932	0.1317	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.41610	-0.9499	9	0.40728	T	0.16	.	12.7175	0.57123	0.0:0.0:1.0:0.0	.	21	E9PHS4	.	E	21	ENSP00000349690:G21E	ENSP00000349690:G21E	G	+	2	0	BTBD11	106498875	1.000000	0.71417	0.995000	0.50966	0.962000	0.63368	4.446000	0.60014	2.265000	0.75225	0.491000	0.48974	GGA	-	BTBD11	-	NULL		0.617	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	0	0		56	56		0.00		G	NM_152322		107974745	+1	20		58		tier1	no_errors	ENST00000357167	ensembl	human	known	74_37	missense	25.64		SNP	0.998	A	20	58
ZNF443	10224	genome.wustl.edu	37	19	12542630	12542630	+	Missense_Mutation	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:12542630T>C	ENST00000301547.5	-	4	553	c.356A>G	c.(355-357)aAt>aGt	p.N119S	CTD-3105H18.16_ENST00000595562.1_Intron	NM_005815.4	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	119					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|pancreas(1)|prostate(1)	28						GATGTAACAATTAAGGGATGA	0.433													ENSG00000180855																																					0													137.0	119.0	125.0					19																	12542630		2203	4300	6503	SO:0001583	missense	0			-	AB011414	CCDS32918.1	19p13.13	2013-01-08			ENSG00000180855	ENSG00000180855		"""Zinc fingers, C2H2-type"", ""-"""	20878	protein-coding gene	gene with protein product		606697				9731181	Standard	NM_005815		Approved	ZK1	uc002mtu.3	Q9Y2A4	OTTHUMG00000156404	ENST00000301547.5:c.356A>G	19.37:g.12542630T>C	ENSP00000301547:p.Asn119Ser			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N119S	ENST00000301547.5	37	c.356	CCDS32918.1	19	.	.	.	.	.	.	.	.	.	.	T	6.268	0.417547	0.11870	.	.	ENSG00000180855	ENST00000301547;ENST00000411622	T	0.07908	3.15	1.37	-1.12	0.09808	.	.	.	.	.	T	0.06096	0.0158	L	0.41710	1.295	0.09310	N	1	P	0.51147	0.942	P	0.44897	0.463	T	0.24261	-1.0165	9	0.08837	T	0.75	.	3.7012	0.08383	0.0:0.1497:0.221:0.6292	.	119	Q9Y2A4	ZN443_HUMAN	S	119	ENSP00000301547:N119S	ENSP00000301547:N119S	N	-	2	0	ZNF443	12403630	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.609000	0.05635	-0.408000	0.07565	0.378000	0.23410	AAT	-	ZNF443	-	NULL		0.433	ZNF443-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF443	HGNC	protein_coding	OTTHUMT00000344084.1	0	0		77	77		0.00		T	NM_005815		12542630	-1	17		30		tier1	no_errors	ENST00000301547	ensembl	human	known	74_37	missense	36.17		SNP	0.001	C	17	30
NLGN2	57555	genome.wustl.edu	37	17	7320563	7320563	+	Silent	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr17:7320563C>A	ENST00000302926.2	+	7	2026	c.1953C>A	c.(1951-1953)ccC>ccA	p.P651P	RP11-104H15.7_ENST00000575310.1_RNA|NLGN2_ENST00000575301.1_Silent_p.P651P	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	651					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				CCCTGCCTCCCGAGCCCGAGC	0.776													ENSG00000169992																																					0													6.0	6.0	6.0					17																	7320563		2096	4110	6206	SO:0001819	synonymous_variant	0			-	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1953C>A	17.37:g.7320563C>A			Q9P2I1	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P651	ENST00000302926.2	37	c.1953	CCDS11103.1	17																																																																																			-	NLGN2	-	NULL		0.776	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	0	0		33	33		0.00		C	NM_020795		7320563	+1	4		23		tier1	no_errors	ENST00000302926	ensembl	human	known	74_37	silent	14.81		SNP	0.121	A	4	23
CBS	875	genome.wustl.edu	37	21	44483184	44483184	+	Missense_Mutation	SNP	A	A	G	rs5742905		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr21:44483184A>G	ENST00000398165.3	-	10	1092	c.833T>C	c.(832-834)aTt>aCt	p.I278T	CBS_ENST00000359624.3_Missense_Mutation_p.I278T|CBS_ENST00000398168.1_Missense_Mutation_p.I278T|CBS_ENST00000352178.5_Missense_Mutation_p.I278T|CBS_ENST00000398158.1_Missense_Mutation_p.I278T|CBS_ENST00000544202.1_Missense_Mutation_p.I190T	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	278			I -> S (in CBSD; loss of activity). {ECO:0000269|PubMed:21520339}.|I -> T (in CBSD; mild to severe form; common mutation; loss of activity; severely affects tetramer formation by promoting formation of larger aggregates; dbSNP:rs5742905). {ECO:0000269|PubMed:11013450, ECO:0000269|PubMed:11359213, ECO:0000269|PubMed:12007221, ECO:0000269|PubMed:12124992, ECO:0000269|PubMed:1301198, ECO:0000269|PubMed:14635102, ECO:0000269|PubMed:15146473, ECO:0000269|PubMed:15993874, ECO:0000269|PubMed:21240075, ECO:0000269|PubMed:7506602, ECO:0000269|PubMed:7611293, ECO:0000269|PubMed:8528202, ECO:0000269|PubMed:8803779, ECO:0000269|PubMed:9156316, ECO:0000269|PubMed:9266356, ECO:0000269|PubMed:9361025, ECO:0000269|PubMed:9889017}.		cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	ATCCACCCCAATGATCTGCAG	0.587													ENSG00000160200	A|||	1	0.000199681	0.0	0.0	5008	,	,		18957	0.0		0.001	False		,,,				2504	0.0																0			GRCh37	CM920136	CBS	M	rs5742905	A	THR/ILE,THR/ILE,THR/ILE	16,4390	9.9+/-24.2	1,14,2188	82.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	833,833,833	3.5	0.3	21	dbSNP_114	75	24,8576	11.9+/-42.8	0,24,4276	yes	missense,missense,missense	CBS	NM_000071.2,NM_001178008.1,NM_001178009.1	89,89,89	1,38,6464	GG,GA,AA		0.2791,0.3631,0.3076	possibly-damaging,possibly-damaging,possibly-damaging	278/552,278/552,278/552	44483184	40,12966	2203	4300	6503	SO:0001583	missense	0			-	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.833T>C	21.37:g.44483184A>G	ENSP00000381231:p.Ile278Thr		B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,pfam_CBS_dom,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,smart_CBS_dom,tigrfam_Cysta_beta_synth	p.I278T	ENST00000398165.3	37	c.833	CCDS13693.1	21	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122269	0.37436	0.003631	0.002791	ENSG00000160200	ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202	D;D;D;D;D;D	0.97850	-4.57;-4.57;-4.57;-4.57;-4.57;-4.57	4.67	3.52	0.40303	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.175508	0.49305	D	0.000157	D	0.98134	0.9384	M	0.82823	2.61	0.37297	A	0.908532	D;D	0.54601	0.967;0.967	P;P	0.62382	0.901;0.901	D	0.99856	1.1077	9	0.56958	D	0.05	-11.7082	8.4981	0.33141	0.9096:0.0:0.0904:0.0	rs5742905;rs12329790;rs59005818;rs5742905	278;235	P35520;B7Z2D6	CBS_HUMAN;.	T	278;278;278;278;278;235;190	ENSP00000381225:I278T;ENSP00000381231:I278T;ENSP00000352643:I278T;ENSP00000344460:I278T;ENSP00000381234:I278T;ENSP00000439332:I190T	ENSP00000344460:I278T	I	-	2	0	CBS	43356253	1.000000	0.71417	0.290000	0.24890	0.036000	0.12997	7.928000	0.87587	0.653000	0.30826	-0.353000	0.07706	ATT	rs5742905	CBS	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Cysta_beta_synth		0.587	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CBS	HGNC	protein_coding	OTTHUMT00000195525.1	0	0		41	41		0.00		A	NM_000071		44483184	-1	5		25		tier1	no_errors	ENST00000398168	ensembl	human	known	74_37	missense	16.67		SNP	0.966	G	5	25
SEMA6D	80031	genome.wustl.edu	37	15	48055236	48055236	+	Nonsense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr15:48055236G>T	ENST00000316364.5	+	9	1121	c.682G>T	c.(682-684)Gaa>Taa	p.E228*	SEMA6D_ENST00000389425.3_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000389433.2_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000355997.3_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000389428.3_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000537942.1_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000358066.4_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000354744.4_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000558816.1_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000558014.1_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000389432.2_Nonsense_Mutation_p.E228*|SEMA6D_ENST00000536845.2_Nonsense_Mutation_p.E228*	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	228	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TCATGCCATAGAATATGGAAA	0.363													ENSG00000137872																																					0													79.0	75.0	76.0					15																	48055236		2198	4296	6494	SO:0001587	stop_gained	0			-	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.682G>T	15.37:g.48055236G>T	ENSP00000324857:p.Glu228*		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Nonsense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.E228*	ENST00000316364.5	37	c.682	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	G	41	9.023450	0.99040	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	.	.	.	5.8	5.8	0.92144	.	0.044796	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	.	.	.	X	228	.	ENSP00000324857:E228X	E	+	1	0	SEMA6D	45842528	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.476000	0.97823	2.744000	0.94065	0.655000	0.94253	GAA	-	SEMA6D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.363	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	0	0		29	29		0.00		G	NM_024966		48055236	+1	4		39		tier1	no_errors	ENST00000316364	ensembl	human	known	74_37	nonsense	9.30		SNP	1.000	T	4	39
ZNF638	27332	genome.wustl.edu	37	2	71651102	71651102	+	Silent	SNP	A	A	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr2:71651102A>C	ENST00000409544.1	+	22	5088	c.4458A>C	c.(4456-4458)atA>atC	p.I1486I	ZNF638_ENST00000264447.4_Silent_p.I1486I|ZNF638_ENST00000355812.3_Intron|ZNF638_ENST00000409407.1_Silent_p.I426I	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1486					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ACAGAGATATAACAAAACAAT	0.458													ENSG00000075292																																					0													56.0	54.0	54.0					2																	71651102		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.4458A>C	2.37:g.71651102A>C			B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Silent	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.I1486	ENST00000409544.1	37	c.4458	CCDS1917.1	2																																																																																			-	ZNF638	-	NULL		0.458	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	0	0		28	28		0.00		A	NM_014497		71651102	+1	11		30		tier1	no_errors	ENST00000264447	ensembl	human	known	74_37	silent	26.83		SNP	0.997	C	11	30
CBLC	23624	genome.wustl.edu	37	19	45285744	45285744	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:45285744G>T	ENST00000270279.3	+	4	838	c.775G>T	c.(775-777)Ggc>Tgc	p.G259C	CBLC_ENST00000341505.4_Missense_Mutation_p.G259C	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	259	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				GGACAAGCCAGGCAGGTAAAG	0.607			M		AML								ENSG00000142273																												Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													55.0	51.0	53.0					19																	45285744		2203	4300	6503	SO:0001583	missense	0			-	AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.775G>T	19.37:g.45285744G>T	ENSP00000270279:p.Gly259Cys		Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.G259C	ENST00000270279.3	37	c.775	CCDS12643.1	19	.	.	.	.	.	.	.	.	.	.	.	15.47	2.842180	0.51057	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.86956	-2.19;-1.96	4.7	4.7	0.59300	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.56097	D	0.000028	D	0.93074	0.7795	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93743	0.7052	10	0.87932	D	0	-32.6705	15.4982	0.75673	0.0:0.0:1.0:0.0	.	259;259	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	C	259	ENSP00000270279:G259C;ENSP00000340250:G259C	ENSP00000270279:G259C	G	+	1	0	CBLC	49977584	1.000000	0.71417	0.988000	0.46212	0.015000	0.08874	9.116000	0.94341	2.603000	0.88011	0.561000	0.74099	GGC	-	CBLC	-	pfam_Adaptor_Cbl_SH2-like		0.607	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2	0	0		28	28		0.00		G	NM_012116		45285744	+1	3		12		tier1	no_errors	ENST00000270279	ensembl	human	known	74_37	missense	20.00		SNP	0.999	T	3	12
FCRL1	115350	genome.wustl.edu	37	1	157776895	157776895	+	Missense_Mutation	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:157776895C>A	ENST00000368176.3	-	2	116	c.49G>T	c.(49-51)Gcc>Tcc	p.A17S	FCRL1_ENST00000489998.1_5'Flank|FCRL1_ENST00000358292.3_Missense_Mutation_p.A17S|FCRL1_ENST00000491942.1_Missense_Mutation_p.A17S	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	17	Ig-like C2-type 1.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			AACTCACCGGCAGGTTCACAG	0.483													ENSG00000163534																									GBM(54;482 1003 11223 30131 35730)												0													73.0	70.0	71.0					1																	157776895		2203	4300	6503	SO:0001583	missense	0			-	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.49G>T	1.37:g.157776895C>A	ENSP00000357158:p.Ala17Ser		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A17S	ENST00000368176.3	37	c.49	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	C	8.420	0.846234	0.16963	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.42513	0.97;1.16;1.16	4.56	-4.09	0.03951	Immunoglobulin-like (1);	4.483100	0.01863	U	0.036766	T	0.08268	0.0206	N	0.22421	0.69	0.09310	N	1	B;B;B	0.19073	0.019;0.033;0.004	B;B;B	0.12156	0.002;0.003;0.007	T	0.07366	-1.0776	10	0.07482	T	0.82	.	8.5577	0.33492	0.1531:0.6702:0.0:0.1767	.	17;17;17	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	S	17	ENSP00000351039:A17S;ENSP00000357158:A17S;ENSP00000418130:A17S	ENSP00000351039:A17S	A	-	1	0	FCRL1	156043519	0.000000	0.05858	0.000000	0.03702	0.771000	0.43674	-1.139000	0.03213	-0.499000	0.06623	-0.290000	0.09829	GCC	-	FCRL1	-	pfscan_Ig-like_dom		0.483	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	0	0		48	48		0.00		C	NM_052938		157776895	-1	4		37		tier1	no_errors	ENST00000368176	ensembl	human	known	74_37	missense	9.76		SNP	0.000	A	4	37
GNAT1	2779	genome.wustl.edu	37	3	50230725	50230725	+	Silent	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr3:50230725G>T	ENST00000433068.1	+	3	233	c.177G>T	c.(175-177)ctG>ctT	p.L59L	GNAT1_ENST00000232461.3_Silent_p.L59L	NM_000172.3	NP_000163.2	P11488	GNAT1_HUMAN	guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 1	59					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell proliferation (GO:0008283)|cellular response to electrical stimulus (GO:0071257)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|negative regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051344)|phototransduction, visible light (GO:0007603)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to light intensity (GO:0009642)|response to light stimulus (GO:0009416)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	acyl binding (GO:0000035)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		GGTACTCGCTGGAAGAGTGCC	0.602											OREG0015579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000114349																																					0													111.0	99.0	103.0					3																	50230725		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2812.1	3p21	2014-01-28			ENSG00000114349	ENSG00000114349			4393	protein-coding gene	gene with protein product		139330					Standard	NM_000172		Approved	CSNBAD3	uc003cyl.2	P11488	OTTHUMG00000156808	ENST00000433068.1:c.177G>T	3.37:g.50230725G>T		968	Q4VBN2	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_I	p.L59	ENST00000433068.1	37	c.177	CCDS2812.1	3																																																																																			-	GT1	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su		0.602	GNAT1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GT1	HGNC	protein_coding	OTTHUMT00000345957.1	0	0		43	43		0.00		G	NM_000172		50230725	+1	4		36		tier1	no_errors	ENST00000232461	ensembl	human	known	74_37	silent	10.00		SNP	1.000	T	4	36
METTL9	51108	genome.wustl.edu	37	16	21629371	21629371	+	Missense_Mutation	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr16:21629371G>T	ENST00000358154.3	+	3	800	c.542G>T	c.(541-543)tGg>tTg	p.W181L	METTL9_ENST00000396014.4_Missense_Mutation_p.W181L	NM_001077180.1|NM_016025.3	NP_001070648.1|NP_057109.3	Q9H1A3	METL9_HUMAN	methyltransferase like 9	181										endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	7				GBM - Glioblastoma multiforme(48;0.0759)		ACTATGATATGGCAGCTTCAG	0.318													ENSG00000197006																																					0													67.0	70.0	69.0					16																	21629371		2199	4300	6499	SO:0001583	missense	0			-	NM_016025, AF151839	CCDS10598.2, CCDS45440.1	16p12.2	2008-11-06			ENSG00000197006	ENSG00000197006			24586	protein-coding gene	gene with protein product	"""DORA reverse strand protein 1"""	609388				10810093, 11132146	Standard	NM_001077180		Approved	DREV1	uc002dje.3	Q9H1A3	OTTHUMG00000131584	ENST00000358154.3:c.542G>T	16.37:g.21629371G>T	ENSP00000350874:p.Trp181Leu		Q8NBT8|Q9BWJ7|Q9H1A2|Q9Y390	Missense_Mutation	SNP	pfam_DREV_MeTrfase,pfam_Methyltransf_12,pfam_Methyltransf_11	p.W181L	ENST00000358154.3	37	c.542	CCDS10598.2	16	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881813	0.91740	.	.	ENSG00000197006	ENST00000358154;ENST00000396014;ENST00000540294	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.78071	0.4226	M	0.66939	2.045	0.80722	D	1	D;D	0.67145	0.996;0.994	D;D	0.78314	0.991;0.918	T	0.74124	-0.3766	9	0.37606	T	0.19	-5.2864	18.3732	0.90420	0.0:0.0:1.0:0.0	.	181;181	Q9H1A3-2;Q9H1A3	.;METL9_HUMAN	L	181;181;145	.	ENSP00000350874:W181L	W	+	2	0	METTL9	21536872	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.500000	0.97977	2.941000	0.99782	0.655000	0.94253	TGG	-	METTL9	-	pfam_DREV_MeTrfase,pfam_Methyltransf_12,pfam_Methyltransf_11		0.318	METTL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	METTL9	HGNC	protein_coding	OTTHUMT00000254465.1	0	0		119	119		0.00		G	NM_016025		21629371	+1	18		122		tier1	no_errors	ENST00000358154	ensembl	human	known	74_37	missense	12.86		SNP	1.000	T	18	122
SLC5A3	6526	genome.wustl.edu	37	21	35469189	35469189	+	Silent	SNP	A	A	G	rs199799705		TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr21:35469189A>G	ENST00000381151.3	+	2	2204	c.1692A>G	c.(1690-1692)ccA>ccG	p.P564P	SLC5A3_ENST00000608209.1_Silent_p.P564P|AP000320.7_ENST00000362077.4_RNA|MRPS6_ENST00000399312.2_Intron			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	564					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						AAGAGGAACCATACCAAATGC	0.463													ENSG00000198743																																					0													106.0	95.0	99.0					21																	35469189		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1692A>G	21.37:g.35469189A>G			O43489	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.P564	ENST00000381151.3	37	c.1692	CCDS33549.1	21																																																																																			-	SLC5A3	-	NULL		0.463	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	0	0		34	34		0.00		A			35469189	+1	9		25		tier1	no_errors	ENST00000381151	ensembl	human	known	74_37	silent	26.47		SNP	0.000	G	9	25
ZNF776	284309	genome.wustl.edu	37	19	58264667	58264667	+	Missense_Mutation	SNP	T	T	C			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:58264667T>C	ENST00000317178.5	+	3	432	c.169T>C	c.(169-171)Tat>Cat	p.Y57H	AC003006.7_ENST00000594684.1_Missense_Mutation_p.Y57H|ZNF776_ENST00000431353.1_3'UTR	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		AGGTTGTTGGTATGGAGCAAA	0.428													ENSG00000152443																																					0													119.0	121.0	120.0					19																	58264667		2203	4300	6503	SO:0001583	missense	0			-	AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.169T>C	19.37:g.58264667T>C	ENSP00000321812:p.Tyr57His		Q6ZS36|Q8N968	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y57H	ENST00000317178.5	37	c.169	CCDS12962.2	19	.	.	.	.	.	.	.	.	.	.	T	4.605	0.112524	0.08831	.	.	ENSG00000152443	ENST00000317178	T	0.00784	5.7	2.08	-4.16	0.03869	Krueppel-associated box (3);	.	.	.	.	T	0.00328	0.0010	N	0.01874	-0.695	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.04013	0.001;0.001	T	0.40850	-0.9541	9	0.10111	T	0.7	.	3.9202	0.09240	0.1729:0.3999:0.0:0.4272	.	57;57	Q68DI1;B4DSC6	ZN776_HUMAN;.	H	57	ENSP00000321812:Y57H	ENSP00000321812:Y57H	Y	+	1	0	ZNF776	62956479	0.000000	0.05858	0.008000	0.14137	0.655000	0.38815	-2.267000	0.01170	-0.828000	0.04273	0.260000	0.18958	TAT	-	ZNF776	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.428	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF776	HGNC	protein_coding	OTTHUMT00000346722.2	0	0		94	94		0.00		T	NM_173632		58264667	+1	19		86		tier1	no_errors	ENST00000317178	ensembl	human	known	74_37	missense	18.10		SNP	0.000	C	19	86
GPR37L1	9283	genome.wustl.edu	37	1	202092707	202092722	+	Splice_Site	DEL	GTGCCCTTCATGGAGG	GTGCCCTTCATGGAGG	-	rs142090957	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	GTGCCCTTCATGGAGG	GTGCCCTTCATGGAGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:202092707_202092722delGTGCCCTTCATGGAGG	ENST00000367282.5	+	1	722_736	c.616_630delGTGCCCTTCATGGAGG	c.(616-630)gtgcccttcatggagdel	p.VPFME206fs		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	206					negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)	p.V206M(1)		central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						TTGTCGTGCCGTGCCCTTCATGGAGGTGAGTGTGTG	0.519													ENSG00000170075																																					1	Substitution - Missense(1)	prostate(1)																																								SO:0001630	splice_region_variant	0				AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.630+1GTGCCCTTCATGGAGG>-	1.37:g.202092707_202092722delGTGCCCTTCATGGAGG			B2R7M9|Q5SXP7|Q86VP7	Splice_Site	DEL	-	e2-1	ENST00000367282.5	37	c.630+16_630+1	CCDS1420.1	1																																																																																				GPR37L1	-	-		0.519	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37L1	HGNC	protein_coding	OTTHUMT00000087496.2									GTGCCCTTCATGGAGG	NM_004767	Frame_Shift_Del	202092722	+1					tier1	no_errors	ENST00000367282	ensembl	human	known	74_37	splice_site_del			DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:0.998:1.000:1.000:1.000:1.000:1.000:1.000	-		
COL28A1	340267	genome.wustl.edu	37	7	7571323	7571323	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr7:7571323C>T	ENST00000399429.3	-	3	477	c.337G>A	c.(337-339)Gac>Aac	p.D113N		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	113	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GTCTGCAGGTCCTTCCAGGAA	0.438													ENSG00000215018																																					0													68.0	64.0	65.0					7																	7571323		1884	4121	6005	SO:0001583	missense	0			-	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.337G>A	7.37:g.7571323C>T	ENSP00000382356:p.Asp113Asn		A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.D113N	ENST00000399429.3	37	c.337	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	C	15.49	2.847931	0.51164	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	T	0.55760	0.5	4.2	3.32	0.38043	von Willebrand factor, type A (3);	0.162448	0.37955	U	0.001869	T	0.32823	0.0842	L	0.31926	0.97	0.27738	N	0.944584	B	0.29552	0.248	B	0.29524	0.103	T	0.26189	-1.0110	10	0.05436	T	0.98	-9.1901	7.7814	0.29066	0.0:0.7545:0.0:0.2455	.	113	Q2UY09	COSA1_HUMAN	N	113	ENSP00000382356:D113N	ENSP00000382347:D113N	D	-	1	0	COL28A1	7537848	0.985000	0.35326	0.999000	0.59377	0.991000	0.79684	1.905000	0.39878	1.140000	0.42260	0.655000	0.94253	GAC	-	COL28A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.438	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	0	0		47	47		0.00		C	NM_001037763		7571323	-1	10		41		tier1	no_errors	ENST00000399429	ensembl	human	known	74_37	missense	19.61		SNP	0.999	T	10	41
SRRM4	84530	genome.wustl.edu	37	12	119554776	119554778	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr12:119554776_119554778delAAG	ENST00000267260.4	+	4	788_790	c.400_402delAAG	c.(400-402)aagdel	p.K137del	RP11-364C11.2_ENST00000537730.1_RNA	NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	137	Lys-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						TGTCAAGAAAAAGAAGAAGAAAA	0.488													ENSG00000139767																																					0																																										SO:0001651	inframe_deletion	0				AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.400_402delAAG	12.37:g.119554782_119554784delAAG	ENSP00000267260:p.Lys137del		A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	In_Frame_Del	DEL	NULL	p.K137in_frame_del	ENST00000267260.4	37	c.400_402	CCDS44994.1	12																																																																																				SRRM4	-	NULL		0.488	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	0	0		45	45		0.00		AAG	NM_194286		119554778	+1	8		59		tier1	no_errors	ENST00000267260	ensembl	human	known	74_37	in_frame_del	11.94		DEL	1.000:1.000:1.000	-	8	59
SOX2-OT	347689	genome.wustl.edu	37	3	181417762	181417763	+	RNA	INS	-	-	T	rs10712814|rs367608879	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr3:181417762_181417763insT	ENST00000410534.1	+	0	158									SOX2 overlapping transcript																		Gtttttctttcttttttttttt	0.401											OREG0015935	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000242808																																					0																																												0				AL157425, AK022826		3q26.33	2014-06-02	2014-06-02	2011-08-19	ENSG00000242808	ENSG00000242808		"""Long non-coding RNAs"", ""-"", ""-"""	20209	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 43"""		"""SOX2 overlapping transcript (non-protein coding)"""	SOX2OT		12612584, 19767420	Standard	NR_004053		Approved	DKFZp761J1324, NCRNA00043	uc003fkv.4		OTTHUMG00000158186		3.37:g.181417773_181417773dupT		1969		R	INS	-	NULL	ENST00000410534.1	37	NULL		3																																																																																				SOX2-OT	-	-		0.401	SOX2-OT-201	KNOWN	basic	miRNA	SOX2-OT	HGNC	sense_overlapping		0	0		11	11		0.00		-	NR_004053		181417763	+1	2		11		tier1	no_errors	ENST00000597347	ensembl	human	known	74_37	rna	15.38		INS	0.000:0.000	T	2	11
PROB1	389333	genome.wustl.edu	37	5	138729105	138729108	+	Frame_Shift_Del	DEL	TGCC	TGCC	-			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	TGCC	TGCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr5:138729105_138729108delTGCC	ENST00000434752.2	-	1	1777_1780	c.1663_1666delGGCA	c.(1663-1668)ggcactfs	p.GT555fs		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	555	Pro-rich.																GGTTCTGGAGTGCCGGGTGCGGAC	0.578													ENSG00000228672																																					0																																										SO:0001589	frameshift_variant	0				AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.1663_1666delGGCA	5.37:g.138729105_138729108delTGCC	ENSP00000416033:p.Gly555fs		B4E007	Frame_Shift_Del	DEL	NULL	p.G555fs	ENST00000434752.2	37	c.1666_1663	CCDS54909.1	5																																																																																				PROB1	-	NULL		0.578	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROB1	HGNC	protein_coding	OTTHUMT00000470735.1	0	0		63	63		0.00		TGCC	NM_001161546		138729108	-1	12		41		tier1	no_errors	ENST00000434752	ensembl	human	known	74_37	frame_shift_del	22.64		DEL	0.288:0.260:0.478:0.513	-	12	41
KIRREL	55243	genome.wustl.edu	37	1	158064643	158064643	+	Silent	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:158064643C>T	ENST00000359209.6	+	15	2074	c.2007C>T	c.(2005-2007)ggC>ggT	p.G669G	KIRREL_ENST00000360089.4_Silent_p.G505G|KIRREL_ENST00000368173.3_Silent_p.G685G|KIRREL_ENST00000416935.2_Silent_p.G569G|KIRREL_ENST00000368172.1_Silent_p.G483G|KIRREL_ENST00000392272.2_Silent_p.G566G			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	669					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CACCCCCTGGCCCTGCTGCCC	0.637													ENSG00000183853																																					0													48.0	49.0	49.0					1																	158064643		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.2007C>T	1.37:g.158064643C>T			Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G685	ENST00000359209.6	37	c.2055	CCDS1172.2	1																																																																																			-	KIRREL	-	NULL		0.637	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	0	0		81	81		0.00		C	NM_018240		158064643	+1	4		43		tier1	no_errors	ENST00000368173	ensembl	human	known	74_37	silent	8.51		SNP	0.932	T	4	43
PIEZO1	9780	genome.wustl.edu	37	16	88809563	88809563	+	Intron	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr16:88809563G>T	ENST00000301015.9	-	3	407				RP5-1142A6.7_ENST00000566114.1_RNA|RP5-1142A6.8_ENST00000333666.1_RNA|RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.8_ENST00000567588.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						ACTGGACTCAGCCCCCCAGCA	0.697													ENSG00000182376																																					0																																										SO:0001627	intron_variant	0			-	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.161-733C>A	16.37:g.88809563G>T			A6NHT9|A7E2B7|Q0KKZ9	R	SNP	-	NULL	ENST00000301015.9	37	NULL	CCDS54058.1	16	.	.	.	.	.	.	.	.	.	.	G	4.920	0.170912	0.09391	.	.	ENSG00000182376	ENST00000333666	.	.	.	1.46	0.0111	0.14085	.	.	.	.	.	T	0.36138	0.0956	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39440	-0.9614	5	0.87932	D	0	.	3.9066	0.09185	0.0:0.0:0.5824:0.4175	.	.	.	.	H	65	.	ENSP00000327620:Q65H	Q	+	3	2	AC138028.1	87337064	0.000000	0.05858	0.003000	0.11579	0.009000	0.06853	0.014000	0.13333	0.739000	0.32628	0.313000	0.20887	CAG	-	RP5-1142A6.8	-	-		0.697	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	FLJ40448	Clone_based_vega_gene	protein_coding	OTTHUMT00000345699.4	0	0		72	72		0.00		G	NM_014745		88809563	+1	4		26		tier1	no_errors	ENST00000333666	ensembl	human	known	74_37	rna	13.33		SNP	0.001	T	4	26
DCDC1	341019	genome.wustl.edu	37	11	31115595	31115595	+	Splice_Site	SNP	A	A	G			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr11:31115595A>G	ENST00000597505.1	-	14	2118		c.e14+1		DCDC1_ENST00000437348.1_Splice_Site			P59894	DCDC1_HUMAN	doublecortin domain containing 1						intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ACTCTTAGGTACCTTGGTGAT	0.537													ENSG00000170959																																					0													116.0	119.0	118.0					11																	31115595		2161	4263	6424	SO:0001630	splice_region_variant	0			-	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2118+1T>C	11.37:g.31115595A>G			A6PVL6|B7WNX6|Q6ZU04	Splice_Site	SNP	-	e5+2	ENST00000597505.1	37	c.813+2		11																																																																																			-	DCDC1	-	-		0.537	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	0	0		30	30		0.00		A	NM_181807	Intron	31115595	-1	16		21		tier1	no_errors	ENST00000342355	ensembl	human	known	74_37	splice_site	42.11		SNP	1.000	G	16	21
CACNG8	59283	genome.wustl.edu	37	19	54466532	54466532	+	Missense_Mutation	SNP	T	T	G			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:54466532T>G	ENST00000270458.2	+	1	239	c.136T>G	c.(136-138)Tac>Gac	p.Y46D		NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	46					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CTACTGGCTCTACACGCGCGC	0.701													ENSG00000142408																																					0													39.0	38.0	38.0					19																	54466532		2203	4299	6502	SO:0001583	missense	0			-	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.136T>G	19.37:g.54466532T>G	ENSP00000270458:p.Tyr46Asp		Q9BXT0|Q9BY23	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.Y46D	ENST00000270458.2	37	c.136	CCDS33104.1	19	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271520	0.80469	.	.	ENSG00000142408	ENST00000270458	D	0.89270	-2.49	3.66	3.66	0.41972	.	0.000000	0.64402	U	0.000003	D	0.93913	0.8052	M	0.85197	2.74	0.36917	D	0.891196	D	0.89917	1.0	D	0.79784	0.993	D	0.95959	0.8960	9	0.87932	D	0	-11.2159	10.5633	0.45159	0.0:0.0:0.0:1.0	.	46	Q8WXS5	CCG8_HUMAN	D	46	ENSP00000270458:Y46D	ENSP00000270458:Y46D	Y	+	1	0	CACNG8	59158344	1.000000	0.71417	0.993000	0.49108	0.967000	0.64934	7.161000	0.77505	1.451000	0.47736	0.247000	0.18012	TAC	-	CACNG8	-	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu		0.701	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	HGNC	protein_coding	OTTHUMT00000139361.3	0	0		30	30		0.00		T			54466532	+1	12		19		tier1	no_errors	ENST00000270458	ensembl	human	known	74_37	missense	38.71		SNP	1.000	G	12	19
C8B	732	genome.wustl.edu	37	1	57432008	57432008	+	5'Flank	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:57432008C>A	ENST00000371237.4	-	0	0				AL161740.1_ENST00000408664.1_RNA|C8B_ENST00000535057.1_5'Flank|RP5-1103B4.3_ENST00000417420.1_RNA|C8B_ENST00000494324.1_5'Flank|C8B_ENST00000543257.1_5'Flank	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						atggcaaaaaccacaattact	0.408													ENSG00000221591																																					0																																										SO:0001631	upstream_gene_variant	0			-	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305		1.37:g.57432008C>A	Exception_encountered		A1L4K7	R	SNP	-	NULL	ENST00000371237.4	37	NULL	CCDS30730.1	1																																																																																			-	AL161740.1	-	-		0.408	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221591	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000022886.2	0	0		31	31		0.00		C			57432008	+1	9		41		tier1	no_errors	ENST00000408664	ensembl	human	novel	74_37	rna	18.00		SNP	0.012	A	9	41
DGKK	139189	genome.wustl.edu	37	X	50213484	50213484	+	RNA	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chrX:50213484G>T	ENST00000376025.2	-	0	253							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					CTCTGGACAGGGACCTGGAGC	0.672													ENSG00000204466																																					0													52.0	61.0	58.0					X																	50213484		1924	4118	6042			0			-	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213484G>T			B2RP91	R	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			-	DGKK	-	-		0.672	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	0	0		78	78		0.00		G	NM_001013742		50213484	-1	44		66		tier1	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	40.00		SNP	0.001	T	44	66
AMY2B	280	genome.wustl.edu	37	1	104117892	104117892	+	Missense_Mutation	SNP	T	T	G	rs140209167	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr1:104117892T>G	ENST00000361355.4	+	8	1542	c.926T>G	c.(925-927)gTc>gGc	p.V309G	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	309					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		AGAGCACTTGTCTTTGTGGAT	0.408													ENSG00000240038																																					0													275.0	274.0	275.0					1																	104117892		2203	4298	6501	SO:0001583	missense	0			-	M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.926T>G	1.37:g.104117892T>G	ENSP00000354610:p.Val309Gly		B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.V309G	ENST00000361355.4	37	c.926	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.269586	0.80469	.	.	ENSG00000240038	ENST00000361355	D	0.98512	-4.97	5.26	4.12	0.48240	Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99296	0.9754	H	0.98351	4.21	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.98678	1.0691	10	0.87932	D	0	.	11.3322	0.49484	0.0:0.0734:0.0:0.9266	.	309	P19961	AMY2B_HUMAN	G	309	ENSP00000354610:V309G	ENSP00000354610:V309G	V	+	2	0	AMY2B	103919415	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.096000	0.64535	1.992000	0.58205	0.456000	0.33151	GTC	-	AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,prints_Alpha_amylase		0.408	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	0	0		187	187		0.00		T	NM_020978		104117892	+1	50		107		tier1	no_errors	ENST00000361355	ensembl	human	known	74_37	missense	31.85		SNP	1.000	G	50	107
ZNF732	654254	genome.wustl.edu	37	4	265156	265156	+	Missense_Mutation	SNP	G	G	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr4:265156G>A	ENST00000419098.1	-	4	1500	c.1490C>T	c.(1489-1491)aCt>aTt	p.T497I		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	497					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.T497S(1)		endometrium(1)|lung(2)	3						TTTCTCTCCAGTATGAATTGT	0.378													ENSG00000186777																																					1	Substitution - Missense(1)	kidney(1)											60.0	55.0	56.0					4																	265156		692	1591	2283	SO:0001583	missense	0			-	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1490C>T	4.37:g.265156G>A	ENSP00000415774:p.Thr497Ile			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T497I	ENST00000419098.1	37	c.1490	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	G	11.41	1.629873	0.28978	.	.	ENSG00000186777	ENST00000419098	T	0.25749	1.78	0.977	-0.566	0.11767	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23289	0.0563	M	0.63843	1.955	0.27926	N	0.938059	B	0.25105	0.118	B	0.24006	0.05	T	0.25047	-1.0143	9	0.72032	D	0.01	.	5.3022	0.15783	0.2526:0.0:0.7474:0.0	.	497	B4DXR9	ZN732_HUMAN	I	497	ENSP00000415774:T497I	ENSP00000415774:T497I	T	-	2	0	ZNF732	255156	0.044000	0.20184	0.073000	0.20177	0.068000	0.16541	1.088000	0.30877	-0.502000	0.06596	-0.497000	0.04613	ACT	-	ZNF732	-	pfscan_Znf_C2H2		0.378	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	0	0		56	56		0.00		G	NM_001137608		265156	-1	18		42		tier1	no_errors	ENST00000419098	ensembl	human	known	74_37	missense	30.00		SNP	0.996	A	18	42
IGHV1OR21-1	390530	genome.wustl.edu	37	21	10862639	10862639	+	RNA	SNP	G	G	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr21:10862639G>A	ENST00000559480.1	+	0	18							A6NJS3	IV1U1_HUMAN	immunoglobulin heavy variable 1/OR21-1 (non-functional)							extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|lung(20)|urinary_tract(1)	26						GGAATTGGAGGATCCTGTTTT	0.498													ENSG00000169861																																					0													352.0	328.0	336.0					21																	10862639		1952	4154	6106			0			-			21p11.2	2014-05-06	2010-11-09		ENSG00000169861	ENSG00000277282		"""Immunoglobulins / IGH orphons"""	38040	other	immunoglobulin gene			"""immunoglobulin heavy variable 1/OR21-1 pseudogene"""				Standard	NG_011680		Approved	IGHV1/OR21-1		A6NJS3	OTTHUMG00000188295		21.37:g.10862639G>A				Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.R6	ENST00000559480.1	37	c.18		21																																																																																			-	IGHV1OR21-1	-	NULL		0.498	IGHV1OR21-1-201	KNOWN	basic|appris_principal	IG_V_gene	IGHV1OR21-1	HGNC	IG_V_gene		0	0		190	190		0.00		G	NG_011680		10862639	+1	13		98		tier1	no_errors	ENST00000559480	ensembl	human	known	74_37	silent	11.71		SNP	0.000	A	13	98
FAM83C	128876	genome.wustl.edu	37	20	33879944	33879944	+	Missense_Mutation	SNP	C	C	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr20:33879944C>T	ENST00000374408.3	-	1	260	c.164G>A	c.(163-165)cGg>cAg	p.R55Q		NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	55										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			AGCCTCACCCCGCTCCAGGAG	0.711													ENSG00000125998																																					0																																										SO:0001583	missense	0			-	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.164G>A	20.37:g.33879944C>T	ENSP00000363529:p.Arg55Gln		Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	pfam_DUF1669	p.R55Q	ENST00000374408.3	37	c.164	CCDS13251.1	20	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429783	0.43122	.	.	ENSG00000125998	ENST00000374408	T	0.11821	2.74	5.09	2.06	0.26882	.	0.541532	0.19373	N	0.115859	T	0.07188	0.0182	N	0.17474	0.49	0.33091	D	0.537981	B	0.26120	0.142	B	0.19946	0.027	T	0.29366	-1.0014	10	0.18276	T	0.48	-6.0677	9.1969	0.37233	0.0:0.6782:0.0:0.3218	.	55	Q9BQN1	FA83C_HUMAN	Q	55	ENSP00000363529:R55Q	ENSP00000363529:R55Q	R	-	2	0	FAM83C	33343358	0.841000	0.29509	0.981000	0.43875	0.853000	0.48598	0.056000	0.14256	0.674000	0.31244	0.462000	0.41574	CGG	-	FAM83C	-	pfam_DUF1669		0.711	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83C	HGNC	protein_coding	OTTHUMT00000078854.3	0	0		41	41		0.00		C			33879944	-1	4		34		tier1	no_errors	ENST00000374408	ensembl	human	known	74_37	missense	10.53		SNP	0.826	T	4	34
LMAN2L	81562	genome.wustl.edu	37	2	97373089	97373089	+	Silent	SNP	G	G	T			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr2:97373089G>T	ENST00000264963.4	-	8	973	c.951C>A	c.(949-951)atC>atA	p.I317I	FER1L5_ENST00000457909.1_RNA|LMAN2L_ENST00000534882.1_Silent_p.I172I|LMAN2L_ENST00000537039.1_Silent_p.I179I|LMAN2L_ENST00000377079.4_Silent_p.I328I|LMAN2L_ENST00000426463.2_Silent_p.I183I	NM_030805.3	NP_110432.1	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like	317					ER to Golgi vesicle-mediated transport (GO:0006888)|protein folding (GO:0006457)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	mannose binding (GO:0005537)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|lung(2)|skin(1)|urinary_tract(1)	7						AGAAAAAGACGATGAGGAAGA	0.517													ENSG00000114988																																					0													48.0	43.0	45.0					2																	97373089		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL136617	CCDS2023.1, CCDS46365.1	2q11.1	2008-02-05			ENSG00000114988	ENSG00000114988			19263	protein-coding gene	gene with protein product		609552				12609988	Standard	NM_001142292		Approved	DKFZp564L2423, VIPL	uc002swv.3	Q9H0V9	OTTHUMG00000130453	ENST00000264963.4:c.951C>A	2.37:g.97373089G>T			B4DSH3|D3DXH6|Q53GV3|Q53S67|Q63HN6|Q8NBQ6|Q9BQ14	Silent	SNP	pfam_Lectin_leg,superfamily_ConA-like_lec_gl_sf	p.I328	ENST00000264963.4	37	c.984	CCDS2023.1	2																																																																																			-	LMAN2L	-	NULL		0.517	LMAN2L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMAN2L	HGNC	protein_coding	OTTHUMT00000252844.1	0	0		27	27		0.00		G	NM_030805		97373089	-1	4		28		tier1	no_errors	ENST00000377079	ensembl	human	known	74_37	silent	12.50		SNP	0.991	T	4	28
MUC12	10071	genome.wustl.edu	37	7	100644059	100644059	+	Missense_Mutation	SNP	G	G	C	rs144581449	byFrequency	TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr7:100644059G>C	ENST00000379442.3	+	5	10644	c.10644G>C	c.(10642-10644)gaG>gaC	p.E3548D	MUC12_ENST00000536621.1_Missense_Mutation_p.E3405D			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3548	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GCCGTAGTGAGGAATCAACAG	0.547													ENSG00000205277																																					0																																										SO:0001583	missense	0			-	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.10644G>C	7.37:g.100644059G>C	ENSP00000368755:p.Glu3548Asp		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.E3405D	ENST00000379442.3	37	c.10215		7	.	.	.	.	.	.	.	.	.	.	g	2.123	-0.401027	0.04865	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12361	2.7;2.69	.	.	.	.	.	.	.	.	T	0.05823	0.0152	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.44251	-0.9340	5	0.20046	T	0.44	.	.	.	.	.	.	.	.	D	3548;3405	ENSP00000368755:E3548D;ENSP00000441929:E3405D	ENSP00000368755:E3548D	E	+	3	2	MUC12	100430779	0.000000	0.05858	0.122000	0.21767	0.121000	0.20230	-0.821000	0.04452	0.159000	0.19401	0.162000	0.16502	GAG	rs144581449	MUC12	-	NULL		0.547	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	0	0		9	9		0.00		G	XM_379904		100644059	+1	7		7		tier1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	50.00		SNP	0.134	C	7	7
CHAF1A	10036	genome.wustl.edu	37	19	4428833	4428833	+	Missense_Mutation	SNP	C	C	A			TCGA-RN-AAAQ-01A-21D-A38Z-09	TCGA-RN-AAAQ-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	af916933-1e8c-423a-9d74-39fcb5a59e68	cb44b945-75a0-4ace-8e93-7593624f09eb	g.chr19:4428833C>A	ENST00000301280.5	+	8	1651	c.1550C>A	c.(1549-1551)cCc>cAc	p.P517H	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	517					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGGCAGCCCCTGAGGTCC	0.592								Chromatin Structure					ENSG00000167670																																					0													37.0	41.0	40.0					19																	4428833		2203	4300	6503	SO:0001583	missense	0			-	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1550C>A	19.37:g.4428833C>A	ENSP00000301280:p.Pro517His		Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A	p.P517H	ENST00000301280.5	37	c.1550	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	C	18.52	3.642632	0.67244	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.17854	2.25	5.24	5.24	0.73138	.	.	.	.	.	T	0.42630	0.1211	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.33420	-0.9869	9	0.87932	D	0	-29.7216	17.7889	0.88547	0.0:1.0:0.0:0.0	.	517	Q13111	CAF1A_HUMAN	H	517	ENSP00000301280:P517H	ENSP00000301280:P517H	P	+	2	0	CHAF1A	4379833	1.000000	0.71417	0.878000	0.34440	0.222000	0.24845	5.043000	0.64208	2.433000	0.82419	0.555000	0.69702	CCC	-	CHAF1A	-	NULL		0.592	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	0	0		13	13		0.00		C	NM_005483		4428833	+1	4		10		tier1	no_errors	ENST00000301280	ensembl	human	known	74_37	missense	28.57		SNP	1.000	A	4	10
