#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
LINC01378	103689918	genome.wustl.edu	37	4	118496711	118496711	+	lincRNA	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:118496711T>A	ENST00000422145.3	+	0	159				NT5C3AP1_ENST00000441170.1_RNA																							AAATTCTTCATATCTTTCTTT	0.378													ENSG00000213492																																					0																																												0			-																													4.37:g.118496711T>A				R	SNP	-	NULL	ENST00000422145.3	37	NULL		4																																																																																			-	NT5C3AP1	-	-		0.378	AC092661.1-002	KNOWN	basic	lincRNA	NT5C3AP1	HGNC	lincRNA	OTTHUMT00000291362.3	0	0	0	57	57	51	0.00	0.00	T			118496711	-1	16	52	31	46	tier1	no_errors	ENST00000441170	ensembl	human	known	74_37	rna	34.04	53.06	SNP	0.925	A	16	31
SF3A3	10946	genome.wustl.edu	37	1	38442606	38442606	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:38442606C>T	ENST00000373019.4	-	12	1910	c.955G>A	c.(955-957)Gac>Aac	p.D319N	SF3A3_ENST00000489537.1_5'Flank|SF3A3_ENST00000448721.2_Missense_Mutation_p.D266N	NM_006802.2	NP_006793.1	Q12874	SF3A3_HUMAN	splicing factor 3a, subunit 3, 60kDa	319					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|prostate(2)	12	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AAAGCAATGTCTTTGTTCCTT	0.388													ENSG00000183431																																					0													142.0	144.0	143.0					1																	38442606		2202	4300	6502	SO:0001583	missense	0			-	U08815	CCDS428.1	1p34.3	2012-06-07	2002-08-29		ENSG00000183431	ENSG00000183431			10767	protein-coding gene	gene with protein product		605596	"""splicing factor 3a, subunit 3, 60kD"""			7816610, 8022796	Standard	NM_006802		Approved	SF3a60, SAP61, PRP9, PRPF9	uc001cci.3	Q12874	OTTHUMG00000004438	ENST00000373019.4:c.955G>A	1.37:g.38442606C>T	ENSP00000362110:p.Asp319Asn		D3DPT5|Q15460|Q5VT87	Missense_Mutation	SNP	pfam_DUF3449,pfam_SF3a60_bindingd,pfscan_Znf_C2H2_matrin	p.D319N	ENST00000373019.4	37	c.955	CCDS428.1	1	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871834	0.72180	.	.	ENSG00000183431	ENST00000373019;ENST00000448721	.	.	.	5.69	4.78	0.61160	.	0.142736	0.64402	D	0.000007	T	0.51924	0.1703	L	0.39898	1.24	0.49130	D	0.999752	B;B	0.24258	0.014;0.1	B;B	0.15870	0.004;0.014	T	0.46512	-0.9186	9	0.28530	T	0.3	-21.6152	14.1002	0.65049	0.0:0.9273:0.0:0.0727	.	266;319	E7EUT8;Q12874	.;SF3A3_HUMAN	N	319;266	.	ENSP00000362110:D319N	D	-	1	0	SF3A3	38215193	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	1.426000	0.47256	0.585000	0.79938	GAC	-	SF3A3	-	NULL		0.388	SF3A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A3	HGNC	protein_coding	OTTHUMT00000012976.1	0	0	0	65	65	116	0.00	0.00	C	NM_006802		38442606	-1	31	45	41	45	tier1	no_errors	ENST00000373019	ensembl	human	known	74_37	missense	43.06	49.45	SNP	1.000	T	31	41
MUC5B	727897	genome.wustl.edu	37	11	1267347	1267347	+	Silent	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:1267347C>A	ENST00000529681.1	+	31	9295	c.9237C>A	c.(9235-9237)acC>acA	p.T3079T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Silent_p.T3082T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3079	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACCGGGACCCTCCCAGAAC	0.607													ENSG00000117983																																					0													154.0	174.0	167.0					11																	1267347		2100	4197	6297	SO:0001819	synonymous_variant	0			-	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9237C>A	11.37:g.1267347C>A			O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T3082	ENST00000529681.1	37	c.9246	CCDS44515.2	11																																																																																			-	MUC5B	-	NULL		0.607	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	0	0	0	75	75	40	0.00	0.00	C	XM_001126093		1267347	+1	5	6	18	18	tier1	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	21.74	24.00	SNP	0.031	A	5	18
BRINP3	339479	genome.wustl.edu	37	1	190067251	190067251	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:190067251T>A	ENST00000367462.3	-	8	2429	c.2198A>T	c.(2197-2199)aAg>aTg	p.K733M	BRINP3_ENST00000534846.1_Missense_Mutation_p.K631M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	733					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGTAGACAGCTTGAGTCTATG	0.443													ENSG00000162670																																					0													122.0	117.0	119.0					1																	190067251		2203	4300	6503	SO:0001583	missense	0			-	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.2198A>T	1.37:g.190067251T>A	ENSP00000356432:p.Lys733Met		B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.K733M	ENST00000367462.3	37	c.2198	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173536	0.57584	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.26373	1.99;1.74	5.54	5.54	0.83059	.	0.049414	0.85682	D	0.000000	T	0.50257	0.1605	M	0.73962	2.25	0.53005	D	0.999963	D;D	0.69078	0.997;0.995	D;D	0.71870	0.975;0.945	T	0.54437	-0.8294	10	0.87932	D	0	.	13.6231	0.62149	0.0:0.0:0.0:1.0	.	631;733	B7Z260;Q76B58	.;FAM5C_HUMAN	M	733;631	ENSP00000356432:K733M;ENSP00000438022:K631M	ENSP00000356432:K733M	K	-	2	0	FAM5C	188333874	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.208000	0.72165	2.096000	0.63516	0.528000	0.53228	AAG	-	BRINP3	-	NULL		0.443	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	HGNC	protein_coding	OTTHUMT00000086278.1	0	0	1	41	41	70	0.00	1.39	T	NM_199051		190067251	-1	35	93	0	11	tier1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	100.00	89.42	SNP	1.000	A	35	0
UGT3A1	133688	genome.wustl.edu	37	5	35965701	35965701	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:35965701G>A	ENST00000274278.3	-	4	987	c.630C>T	c.(628-630)ttC>ttT	p.F210F	UGT3A1_ENST00000513233.1_Intron|UGT3A1_ENST00000503189.1_Silent_p.F210F|UGT3A1_ENST00000507113.1_Silent_p.F176F|UGT3A1_ENST00000333811.4_Silent_p.F156F	NM_152404.3	NP_689617.3	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	210						integral component of membrane (GO:0016021)|UDP-N-acetylglucosamine transferase complex (GO:0043541)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|skin(4)	46	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGCTCCTGGAGAAACTAAAGA	0.458													ENSG00000145626																																					0													96.0	100.0	99.0					5																	35965701		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS3913.1, CCDS54841.1	5p13.2	2014-05-20			ENSG00000145626	ENSG00000145626		"""UDP glucuronosyltransferases"""	26625	protein-coding gene	gene with protein product							Standard	NM_152404		Approved	FLJ34658	uc003jjv.2	Q6NUS8	OTTHUMG00000131107	ENST00000274278.3:c.630C>T	5.37:g.35965701G>A			G5E961|Q8IYS9|Q8NAW4|Q96DM6	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.F210	ENST00000274278.3	37	c.630	CCDS3913.1	5																																																																																			-	UGT3A1	-	pfam_UDP_glucos_trans		0.458	UGT3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A1	HGNC	protein_coding	OTTHUMT00000253770.2	0	0	1	57	57	162	0.00	0.61	G	NM_152404		35965701	-1	47	62	30	39	tier1	no_errors	ENST00000274278	ensembl	human	known	74_37	silent	61.04	61.39	SNP	0.001	A	47	30
CCDC33	80125	genome.wustl.edu	37	15	74564053	74564053	+	Missense_Mutation	SNP	C	C	T	rs201603982	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:74564053C>T	ENST00000398814.3	+	6	987	c.556C>T	c.(556-558)Cgg>Tgg	p.R186W	CCDC33_ENST00000321288.5_Missense_Mutation_p.R389W	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	389										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GATCTTTCTCCGGGGAGTCAA	0.582													ENSG00000140481	c|||	2	0.000399361	0.0015	0.0	5008	,	,		17269	0.0		0.0	False		,,,				2504	0.0																0													35.0	38.0	37.0					15																	74564053		1999	4150	6149	SO:0001583	missense	0			-	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.556C>T	15.37:g.74564053C>T	ENSP00000381795:p.Arg186Trp		A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom	p.R389W	ENST00000398814.3	37	c.1165	CCDS42058.1	15	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179487	0.38511	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.26373	1.74;2.1	4.48	2.42	0.29668	.	0.773622	0.11104	N	0.599308	T	0.20577	0.0495	L	0.40543	1.245	0.22648	N	0.998893	B;B	0.19935	0.04;0.022	B;B	0.12837	0.008;0.007	T	0.20438	-1.0275	10	0.72032	D	0.01	.	7.2644	0.26222	0.1924:0.6212:0.1864:0.0	.	389;186	C9JFX2;Q8N5R6-6	.;.	W	389;186	ENSP00000325012:R389W;ENSP00000381795:R186W	ENSP00000325012:R389W	R	+	1	2	CCDC33	72351106	0.000000	0.05858	0.964000	0.40570	0.932000	0.56968	-0.024000	0.12435	1.062000	0.40625	0.558000	0.71614	CGG	rs201603982	CCDC33	-	NULL		0.582	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC33	HGNC	protein_coding	OTTHUMT00000419491.2	0	0	0	71	71	171	0.00	0.00	C	NM_182791		74564053	+1	17	21	51	119	tier1	no_errors	ENST00000321288	ensembl	human	known	74_37	missense	25.00	15.00	SNP	0.812	T	17	51
ZBTB41	360023	genome.wustl.edu	37	1	197127605	197127605	+	3'UTR	SNP	T	T	C	rs115447450		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:197127605T>C	ENST00000367405.4	-	0	3682				ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TTAAATTTCATTGAGTTACAA	0.299													ENSG00000177888	T|||	1	0.000199681	0.0	0.0	5008	,	,		18086	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			GMAF=0.0005		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.*884A>G	1.37:g.197127605T>C			A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	R	SNP	-	NULL	ENST00000367405.4	37	NULL	CCDS30960.1	1																																																																																			rs115447450	ZBTB41	-	-		0.299	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2	0	0	0	32	32	89	0.00	0.00	T	NM_194314		197127605	-1	58	154	9	10	tier1	no_errors	ENST00000467322	ensembl	human	known	74_37	rna	86.57	93.90	SNP	0.003	C	58	9
DCC	1630	genome.wustl.edu	37	18	50985606	50985606	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr18:50985606C>T	ENST00000442544.2	+	24	4013	c.3397C>T	c.(3397-3399)Cgg>Tgg	p.R1133W	DCC_ENST00000581580.1_Missense_Mutation_p.R768W	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1133					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCATAGGAAACGGGCCACCCA	0.443													ENSG00000187323																																					0													49.0	49.0	49.0					18																	50985606		2203	4300	6503	SO:0001583	missense	0			-	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3397C>T	18.37:g.50985606C>T	ENSP00000389140:p.Arg1133Trp			Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1133W	ENST00000442544.2	37	c.3397	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326766	0.24080	.	.	ENSG00000187323	ENST00000442544	T	0.55588	0.51	5.93	5.01	0.66863	.	0.148193	0.43260	D	0.000595	T	0.68568	0.3015	L	0.58101	1.795	0.45634	D	0.998562	D	0.89917	1.0	D	0.87578	0.998	T	0.70208	-0.4935	10	0.87932	D	0	-8.3898	14.8726	0.70471	0.1442:0.8558:0.0:0.0	.	1133	P43146	DCC_HUMAN	W	1133	ENSP00000389140:R1133W	ENSP00000389140:R1133W	R	+	1	2	DCC	49239604	1.000000	0.71417	1.000000	0.80357	0.505000	0.33919	3.604000	0.54081	2.826000	0.97356	0.655000	0.94253	CGG	-	DCC	-	pfam_Neogenin_C		0.443	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	0	0	0	52	52	121	0.00	0.00	C	NM_005215		50985606	+1	19	95	11	23	tier1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	63.33	79.83	SNP	1.000	T	19	11
RSPH1	89765	genome.wustl.edu	37	21	43905899	43905899	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr21:43905899G>A	ENST00000291536.3	-	5	548	c.381C>T	c.(379-381)acC>acT	p.T127T	RSPH1_ENST00000398352.3_Silent_p.T89T	NM_080860.2	NP_543136.1	Q8WYR4	RSPH1_HUMAN	radial spoke head 1 homolog (Chlamydomonas)	127					axoneme assembly (GO:0035082)|meiotic nuclear division (GO:0007126)	cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleus (GO:0005634)				large_intestine(7)|lung(2)|ovary(1)|prostate(1)|stomach(1)	12						CGTATAAATAGGTGCCTTGCC	0.517													ENSG00000160188																									Esophageal Squamous(23;63 706 6286 10288 12913)												0													152.0	132.0	139.0					21																	43905899		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB006536	CCDS13688.1, CCDS68210.1	21q22.3	2014-02-03	2007-06-25	2007-06-25	ENSG00000160188	ENSG00000160188			12371	protein-coding gene	gene with protein product	"""meichroacidin"""	609314	"""testis specific A2 homolog (mouse)"""	TSGA2		9403069, 9578619, 17451891	Standard	XM_005261208		Approved	FLJ32753, RSP44, RSPH10A, CILD24	uc002zbg.3	Q8WYR4	OTTHUMG00000086804	ENST00000291536.3:c.381C>T	21.37:g.43905899G>A			A8MWV0|B2RBN9|Q3MJA1	Silent	SNP	pfam_MORN,smart_MORN	p.T127	ENST00000291536.3	37	c.381	CCDS13688.1	21																																																																																			-	RSPH1	-	pfam_MORN,smart_MORN		0.517	RSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH1	HGNC	protein_coding	OTTHUMT00000195379.1	0	0	0	53	53	194	0.00	0.00	G			43905899	-1	5	38	33	95	tier1	no_errors	ENST00000291536	ensembl	human	known	74_37	silent	13.16	28.57	SNP	1.000	A	5	33
KRT77	374454	genome.wustl.edu	37	12	53086400	53086400	+	Missense_Mutation	SNP	G	G	A	rs201690097		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:53086400G>A	ENST00000341809.3	-	7	1260	c.1232C>T	c.(1231-1233)tCg>tTg	p.S411L	KRT77_ENST00000537195.1_Missense_Mutation_p.S178L|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	411	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						CTCAGCATCCGAAATGAGTGA	0.572													ENSG00000189182	G|||	1	0.000199681	0.0	0.0014	5008	,	,		21686	0.0		0.0	False		,,,				2504	0.0																0								G	LEU/SER	0,4404		0,0,2202	50.0	45.0	46.0		1232	2.6	0.1	12		46	2,8534	2.2+/-6.3	1,0,4267	yes	missense	KRT77	NM_175078.2	145	1,0,6469	AA,AG,GG		0.0234,0.0,0.0155	benign	411/579	53086400	2,12938	2202	4268	6470	SO:0001583	missense	0			GMAF=0.0005	BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1232C>T	12.37:g.53086400G>A	ENSP00000342710:p.Ser411Leu		Q7RTS8	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.S411L	ENST00000341809.3	37	c.1232	CCDS8837.1	12	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	10.63	1.402766	0.25291	0.0	2.34E-4	ENSG00000189182	ENST00000341809;ENST00000537195	T;D	0.83837	-0.96;-1.77	4.47	2.57	0.30868	Filament (1);	.	.	.	.	T	0.78541	0.4299	L	0.45698	1.435	0.23043	N	0.998387	B	0.28584	0.216	B	0.32928	0.155	T	0.69465	-0.5138	9	0.87932	D	0	.	9.6207	0.39719	0.079:0.1424:0.7786:0.0	.	411	Q7Z794	K2C1B_HUMAN	L	411;178	ENSP00000342710:S411L;ENSP00000440803:S178L	ENSP00000342710:S411L	S	-	2	0	KRT77	51372667	0.875000	0.30112	0.149000	0.22428	0.095000	0.18619	4.604000	0.61112	0.432000	0.26286	0.400000	0.26472	TCG	rs201690097	KRT77	-	pfam_IF		0.572	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	0	0	0	39	39	74	0.00	0.00	G	NM_175078		53086400	-1	13	21	11	35	tier1	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	54.17	37.50	SNP	0.560	A	13	11
DNAH8	1769	genome.wustl.edu	37	6	38816506	38816506	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:38816506G>A	ENST00000359357.3	+	35	4731	c.4477G>A	c.(4477-4479)Gta>Ata	p.V1493I	DNAH8_ENST00000449981.2_Missense_Mutation_p.V1710I|DNAH8_ENST00000441566.1_Missense_Mutation_p.V1493I			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1493					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGAGTGGCTCGTAGTACAGAA	0.368													ENSG00000124721																																					0													80.0	87.0	85.0					6																	38816506		2203	4300	6503	SO:0001583	missense	0			-	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.4477G>A	6.37:g.38816506G>A	ENSP00000352312:p.Val1493Ile		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V1493I	ENST00000359357.3	37	c.4477		6	.	.	.	.	.	.	.	.	.	.	G	6.451	0.451347	0.12223	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.60920	0.15;0.15;0.15	5.78	-3.56	0.04626	Dynein heavy chain, domain-2 (1);	0.798663	0.11567	N	0.551143	T	0.19167	0.0460	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17992	-1.0351	10	0.36615	T	0.2	.	14.7748	0.69724	0.6568:0.0:0.3432:0.0	.	1493	Q96JB1	DYH8_HUMAN	I	1698;1698;1493;1493	ENSP00000333363:V1698I;ENSP00000352312:V1493I;ENSP00000402294:V1493I	ENSP00000333363:V1698I	V	+	1	0	DNAH8	38924484	0.000000	0.05858	0.000000	0.03702	0.738000	0.42128	-0.162000	0.10012	-0.791000	0.04486	-1.105000	0.02106	GTA	-	DH8	-	pfam_Dynein_heavy_dom-2		0.368	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DH8	HGNC	protein_coding	OTTHUMT00000043574.1	0	0	0	29	29	139	0.00	0.00	G	NM_001206927		38816506	+1	43	54	46	105	tier1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	44.33	33.96	SNP	0.001	A	43	46
LRRTM4	80059	genome.wustl.edu	37	2	77746658	77746658	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:77746658C>T	ENST00000409093.1	-	3	673	c.337G>A	c.(337-339)Gaa>Aaa	p.E113K	LRRTM4_ENST00000409282.1_Missense_Mutation_p.E114K|LRRTM4_ENST00000409911.1_Missense_Mutation_p.E114K|LRRTM4_ENST00000409088.3_Missense_Mutation_p.E113K|LRRTM4_ENST00000409884.1_Missense_Mutation_p.E113K			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	113					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		AGAATTAATTCTTTCAGTCTA	0.393													ENSG00000176204																																					0													149.0	135.0	140.0					2																	77746658		1843	4088	5931	SO:0001583	missense	0			-	AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.337G>A	2.37:g.77746658C>T	ENSP00000386357:p.Glu113Lys		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E114K	ENST00000409093.1	37	c.340	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350664	0.82132	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37	5.96	5.96	0.96718	.	0.048793	0.85682	D	0.000000	T	0.65729	0.2719	L	0.37697	1.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.62709	-0.6797	10	0.45353	T	0.12	.	18.9646	0.92691	0.0:1.0:0.0:0.0	.	114;113;113	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	K	114;113;113;113;114	ENSP00000387228:E114K;ENSP00000387297:E113K;ENSP00000386357:E113K;ENSP00000386236:E113K;ENSP00000386286:E114K	ENSP00000386236:E113K	E	-	1	0	LRRTM4	77600166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.826000	0.97356	0.655000	0.94253	GAA	-	LRRTM4	-	smart_Leu-rich_rpt_typical-subtyp		0.393	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	0	0	0	33	33	126	0.00	0.00	C	NM_024993		77746658	-1	41	61	9	16	tier1	no_errors	ENST00000409911	ensembl	human	known	74_37	missense	82.00	79.22	SNP	1.000	T	41	9
HS3ST6	64711	genome.wustl.edu	37	16	1961876	1961876	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:1961876G>A	ENST00000293937.3	-	2	743	c.744C>T	c.(742-744)agC>agT	p.S248S	HS3ST6_ENST00000443547.1_Silent_p.S217S|HS3ST6_ENST00000454677.2_Silent_p.S265S			Q96QI5	HS3S6_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 6	248					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			endometrium(2)|lung(2)	4						GACGCTCCCCGCTGACGAACA	0.667													ENSG00000162040																																					0													44.0	54.0	50.0					16																	1961876		2190	4295	6485	SO:0001819	synonymous_variant	0			-			16p13.3	2008-10-30	2003-06-11	2003-06-13	ENSG00000162040	ENSG00000162040		"""Sulfotransferases, membrane-bound"""	14178	protein-coding gene	gene with protein product			"""heparan sulfate (glucosamine) 3-O-sulfotransferase 5"""	HS3ST5		11157797	Standard	NM_001009606		Approved		uc002cnf.3	Q96QI5	OTTHUMG00000047860	ENST00000293937.3:c.744C>T	16.37:g.1961876G>A			Q96RX7	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S248	ENST00000293937.3	37	c.744		16																																																																																			-	HS3ST6	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.667	HS3ST6-201	KNOWN	basic|appris_principal	protein_coding	HS3ST6	HGNC	protein_coding		1	1	0	131	131	31	0.76	0.00	G	NM_001009606		1961876	-1	45	3	59	18	tier1	no_errors	ENST00000293937	ensembl	human	known	74_37	silent	43.27	13.64	SNP	0.988	A	45	59
PKHD1	5314	genome.wustl.edu	37	6	51619707	51619707	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:51619707C>T	ENST00000371117.3	-	56	8947	c.8672G>A	c.(8671-8673)cGc>cAc	p.R2891H	PKHD1_ENST00000340994.4_Missense_Mutation_p.R2891H	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2891					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					GTCATGGGGGCGCCAATCCAC	0.433													ENSG00000170927																																					0													155.0	146.0	149.0					6																	51619707		2203	4300	6503	SO:0001583	missense	0			-	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8672G>A	6.37:g.51619707C>T	ENSP00000360158:p.Arg2891His		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.R2891H	ENST00000371117.3	37	c.8672	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	14.66	2.603129	0.46423	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.83755	-1.76;-1.76	5.63	-4.53	0.03462	.	0.940169	0.08899	N	0.877580	T	0.66896	0.2836	L	0.45051	1.395	0.09310	N	1	D;D;P	0.56521	0.976;0.975;0.947	B;P;B	0.45474	0.306;0.482;0.306	T	0.67601	-0.5629	10	0.62326	D	0.03	.	14.2904	0.66273	0.0:0.3183:0.0:0.6817	.	2891;2891;2891	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	H	2891	ENSP00000360158:R2891H;ENSP00000341097:R2891H	ENSP00000341097:R2891H	R	-	2	0	PKHD1	51727666	0.007000	0.16637	0.389000	0.26208	0.414000	0.31173	-0.412000	0.07132	-0.887000	0.03961	-0.123000	0.14984	CGC	-	PKHD1	-	NULL		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0	0	8	8	109	0.00	0.00	C	NM_138694		51619707	-1	21	28	9	46	tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	missense	70.00	37.84	SNP	0.009	T	21	9
GPR50	9248	genome.wustl.edu	37	X	150349083	150349083	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:150349083G>A	ENST00000218316.3	+	2	1097	c.1028G>A	c.(1027-1029)cGc>cAc	p.R343H	GPR50-AS1_ENST00000454196.1_RNA|AF003625.3_ENST00000602313.1_lincRNA	NM_004224.3	NP_004215.2	Q13585	MTR1L_HUMAN	G protein-coupled receptor 50	343	Pro-rich.				cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|identical protein binding (GO:0042802)|melatonin receptor activity (GO:0008502)			breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	38	Acute lymphoblastic leukemia(192;6.56e-05)					GCCCATGCTCGCGACCAAGCT	0.577													ENSG00000102195																																					0													98.0	102.0	101.0					X																	150349083		2130	4211	6341	SO:0001583	missense	0			-	U52219	CCDS44012.1	Xq28	2012-08-21			ENSG00000102195	ENSG00000102195		"""GPCR / Class A : Orphans"""	4506	protein-coding gene	gene with protein product		300207				9933574, 18400093	Standard	NM_004224		Approved	H9, Mel1c	uc010ntg.2	Q13585	OTTHUMG00000024166	ENST00000218316.3:c.1028G>A	X.37:g.150349083G>A	ENSP00000218316:p.Arg343His		Q0VGG3|Q3ZAR0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Mel_rcpt_1X,prints_GPCR_Rhodpsn,prints_Melatonin_rcpt,prints_NPY_rcpt	p.R343H	ENST00000218316.3	37	c.1028	CCDS44012.1	X	.	.	.	.	.	.	.	.	.	.	G	14.65	2.597722	0.46318	.	.	ENSG00000102195	ENST00000218316	T	0.59638	0.25	3.9	2.07	0.26955	.	0.962914	0.08481	N	0.939498	T	0.41442	0.1159	N	0.24115	0.695	0.09310	N	1	B	0.25486	0.127	B	0.17722	0.019	T	0.30995	-0.9959	10	0.54805	T	0.06	-1.4039	6.943	0.24502	0.1079:0.1733:0.7187:0.0	.	343	Q13585	MTR1L_HUMAN	H	343	ENSP00000218316:R343H	ENSP00000218316:R343H	R	+	2	0	GPR50	150099741	0.217000	0.23597	0.010000	0.14722	0.005000	0.04900	0.199000	0.17237	0.255000	0.21593	-0.344000	0.07964	CGC	-	GPR50	-	prints_Mel_rcpt_1X		0.577	GPR50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR50	HGNC	protein_coding	OTTHUMT00000060874.1	0	0	0	20	20	28	0.00	0.00	G	NM_004224		150349083	+1	33	28	0	12	tier1	no_errors	ENST00000218316	ensembl	human	known	74_37	missense	100.00	70.00	SNP	0.041	A	33	0
LOC100996291	100996291	genome.wustl.edu	37	17	76267801	76267801	+	lincRNA	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:76267801C>T	ENST00000374945.1	-	0	296					NR_073178.1																						TGTGGACCTGCGGAATGGGGG	0.572													ENSG00000204277																																					0																																												0			-																													17.37:g.76267801C>T				R	SNP	-	NULL	ENST00000374945.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	C	5.216	0.225366	0.09916	.	.	ENSG00000204277	ENST00000374945	.	.	.	1.96	-1.39	0.08997	.	.	.	.	.	T	0.35595	0.0937	.	.	.	.	.	.	.	.	.	.	.	.	T	0.45190	-0.9278	4	0.87932	D	0	.	2.7511	0.05281	0.3491:0.2592:0.3917:0.0	.	.	.	.	T	72	.	ENSP00000364083:A72T	A	-	1	0	AC087645.1	73779396	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	-0.111000	0.10807	-0.340000	0.08388	-0.702000	0.03669	GCA	-	RP11-219G17.4	-	-		0.572	RP11-219G17.4-001	KNOWN	basic	lincRNA	LOC100996291	Clone_based_vega_gene	lincRNA	OTTHUMT00000437286.1	0	0	0	32	32	175	0.00	0.00	C			76267801	-1	7	31	19	54	tier1	no_errors	ENST00000374945	ensembl	human	known	74_37	rna	26.92	36.47	SNP	0.001	T	7	19
RP11-65D24.2	0	genome.wustl.edu	37	13	112240744	112240744	+	3'UTR	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr13:112240744C>T	ENST00000607406.1	+	0	197				RP11-65D24.2_ENST00000375713.1_Intron																							ACCTCACAGCCGGGAGGAGAC	0.532													ENSG00000204398																																					0																																										SO:0001624	3_prime_UTR_variant	0			-																												ENST00000607406.1:c.*194C>T	13.37:g.112240744C>T				R	SNP	-	NULL	ENST00000607406.1	37	NULL		13																																																																																			-	RP11-65D24.2	-	-		0.532	RP11-65D24.2-002	KNOWN	basic	processed_transcript	ENSG00000204398	Clone_based_vega_gene	protein_coding	OTTHUMT00000471073.1	0	0	0	44	44	68	0.00	0.00	C			112240744	+1	12	26	35	75	tier1	no_errors	ENST00000607406	ensembl	human	known	74_37	rna	25.53	25.74	SNP	0.000	T	12	35
SCN10A	6336	genome.wustl.edu	37	3	38798178	38798178	+	Missense_Mutation	SNP	C	C	T	rs143033805	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:38798178C>T	ENST00000449082.2	-	9	1276	c.1277G>A	c.(1276-1278)cGg>cAg	p.R426Q		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	426					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	CTGCTCCTTCCGGAGCATCTC	0.502													ENSG00000185313	C|||	2	0.000399361	0.0	0.0	5008	,	,		19817	0.002		0.0	False		,,,				2504	0.0																0								C	GLN/ARG	0,4406		0,0,2203	126.0	124.0	124.0		1277	-1.6	0.9	3	dbSNP_134	124	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SCN10A	NM_006514.2	43	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	426/1957	38798178	2,13004	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.1277G>A	3.37:g.38798178C>T	ENSP00000390600:p.Arg426Gln		A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.R426Q	ENST00000449082.2	37	c.1277	CCDS33736.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.40	1.339362	0.24339	0.0	2.33E-4	ENSG00000185313	ENST00000449082	D	0.95588	-3.75	5.21	-1.65	0.08291	.	0.468395	0.19915	N	0.103210	D	0.89026	0.6598	N	0.17631	0.505	0.22034	N	0.999407	B	0.14012	0.009	B	0.04013	0.001	T	0.77446	-0.2585	10	0.44086	T	0.13	.	12.469	0.55775	0.0:0.2858:0.0:0.7142	.	426	Q9Y5Y9	SCNAA_HUMAN	Q	426	ENSP00000390600:R426Q	ENSP00000390600:R426Q	R	-	2	0	SCN10A	38773182	0.044000	0.20184	0.850000	0.33497	0.401000	0.30781	0.288000	0.18939	-0.431000	0.07307	-0.224000	0.12420	CGG	rs143033805	SCN10A	-	NULL		0.502	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	0	0	0	34	34	137	0.00	0.00	C	NM_006514		38798178	-1	15	33	31	76	tier1	no_errors	ENST00000449082	ensembl	human	known	74_37	missense	32.61	30.28	SNP	0.950	T	15	31
DUSP13	51207	genome.wustl.edu	37	10	76854531	76854531	+	Missense_Mutation	SNP	G	G	A	rs150329504		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:76854531G>A	ENST00000472493.2	-	4	578	c.500C>T	c.(499-501)aCg>aTg	p.T167M	DUSP13_ENST00000478873.2_Missense_Mutation_p.T303M|DUSP13_ENST00000605915.1_Missense_Mutation_p.T189M|DUSP13_ENST00000372702.3_3'UTR|DUSP13_ENST00000464872.1_Missense_Mutation_p.T116M|DUSP13_ENST00000607009.1_5'Flank|DUSP13_ENST00000607131.1_Missense_Mutation_p.T260M|DUSP13_ENST00000372700.3_Missense_Mutation_p.T217M|DUSP13_ENST00000491677.2_Missense_Mutation_p.T296M	NM_016364.3	NP_057448.3	Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	167	Tyrosine-protein phosphatase.				meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					GGCCTGCACCGTCTGGATGGC	0.607													ENSG00000079393																									NSCLC(174;1655 2059 12324 40663 42963)												0								G	,MET/THR,MET/THR,MET/THR	2,4404	4.2+/-10.8	0,2,2201	101.0	73.0	82.0		,650,779,500	1.6	1.0	10	dbSNP_134	82	0,8600		0,0,4300	no	utr-3,missense,missense,missense	DUSP13	NM_001007271.1,NM_001007272.1,NM_001007273.1,NM_016364.3	,81,81,81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,probably-damaging,probably-damaging,probably-damaging	,217/249,260/292,167/199	76854531	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000472493.2:c.500C>T	10.37:g.76854531G>A	ENSP00000444580:p.Thr167Met		A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.T296M	ENST00000472493.2	37	c.887	CCDS7346.1	10	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308733	0.60305	4.54E-4	0.0	ENSG00000079393	ENST00000308475;ENST00000472493;ENST00000491677;ENST00000372698;ENST00000464872;ENST00000372700	D;D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93;-1.93	5.52	1.56	0.23342	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.452569	0.27876	N	0.017486	D	0.82751	0.5105	N	0.26042	0.785	0.26901	N	0.967107	D;D;D	0.76494	0.998;0.999;0.987	P;D;P	0.67103	0.874;0.949;0.688	T	0.72228	-0.4354	10	0.34782	T	0.22	-5.5811	5.5206	0.16931	0.1743:0.0:0.576:0.2497	.	217;296;167	Q9UII6-4;F2Z2C4;Q9UII6	.;.;DUS13_HUMAN	M	167;167;296;260;116;217	ENSP00000311051:T167M;ENSP00000444580:T167M;ENSP00000436312:T296M;ENSP00000434041:T116M;ENSP00000361785:T217M	ENSP00000311051:T167M	T	-	2	0	DUSP13	76524537	0.944000	0.32072	0.994000	0.49952	0.995000	0.86356	2.308000	0.43690	0.025000	0.15241	-0.136000	0.14681	ACG	rs150329504	DUSP13	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.607	DUSP13-004	KNOWN	basic|CCDS	protein_coding	DUSP13	HGNC	protein_coding	OTTHUMT00000048786.3	0	0	0	49	49	58	0.00	0.00	G			76854531	-1	14	30	11	31	tier1	no_errors	ENST00000491677	ensembl	human	known	74_37	missense	56.00	49.18	SNP	0.897	A	14	11
AKAP6	9472	genome.wustl.edu	37	14	33014696	33014696	+	Silent	SNP	T	T	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:33014696T>C	ENST00000280979.4	+	4	1007	c.837T>C	c.(835-837)gcT>gcC	p.A279A	AKAP6_ENST00000557354.1_Silent_p.A279A|AKAP6_ENST00000557272.1_Silent_p.A279A	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	279					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CGGTAGCTGCTGACTCTATCT	0.453													ENSG00000151320																									Melanoma(49;821 1200 7288 13647 42351)												0													134.0	120.0	124.0					14																	33014696		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.837T>C	14.37:g.33014696T>C			A7E242|A7E2D4|O15028	Silent	SNP	smart_Spectrin/alpha-actinin	p.A279	ENST00000280979.4	37	c.837	CCDS9644.1	14																																																																																			-	AKAP6	-	NULL		0.453	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	0	0	0	18	18	164	0.00	0.00	T	NM_004274		33014696	+1	9	34	17	90	tier1	no_errors	ENST00000280979	ensembl	human	known	74_37	silent	34.62	27.42	SNP	0.977	C	9	17
ZNF823	55552	genome.wustl.edu	37	19	11832715	11832715	+	Missense_Mutation	SNP	T	T	C			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:11832715T>C	ENST00000341191.6	-	4	1787	c.1634A>G	c.(1633-1635)cAt>cGt	p.H545R	ZNF823_ENST00000545749.1_Missense_Mutation_p.H363R	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						AATTCTTTCATGTCGTAGAAG	0.413										HNSCC(68;0.2)			ENSG00000197933																																					0													74.0	75.0	75.0					19																	11832715		2203	4299	6502	SO:0001583	missense	0			-	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.1634A>G	19.37:g.11832715T>C	ENSP00000340683:p.His545Arg		A0PJL4|B7Z8D4|Q6P4A9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H545R	ENST00000341191.6	37	c.1634	CCDS45981.1	19	.	.	.	.	.	.	.	.	.	.	-	17.92	3.507361	0.64410	.	.	ENSG00000197933	ENST00000545749;ENST00000341191	D;D	0.86865	-2.18;-2.18	0.856	-0.266	0.12942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.91778	0.7399	H	0.95043	3.615	0.27262	N	0.958603	D	0.53312	0.959	P	0.52554	0.702	D	0.84236	0.0469	9	0.87932	D	0	.	5.0443	0.14475	0.0:0.1987:0.0:0.8013	.	545	P16415	ZN823_HUMAN	R	363;545	ENSP00000440162:H363R;ENSP00000340683:H545R	ENSP00000340683:H545R	H	-	2	0	ZNF823	11693715	0.998000	0.40836	0.004000	0.12327	0.752000	0.42762	3.387000	0.52501	-0.159000	0.11021	0.254000	0.18369	CAT	-	ZNF823	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF823	HGNC	protein_coding	OTTHUMT00000344516.2	0	0	0	82	82	60	0.00	0.00	T	NM_001080493		11832715	-1	41	10	27	14	tier1	no_errors	ENST00000341191	ensembl	human	known	74_37	missense	60.29	41.67	SNP	0.952	C	41	27
LOC285556	285556	genome.wustl.edu	37	4	100574097	100574097	+	Missense_Mutation	SNP	T	T	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr4:100574097T>A	ENST00000511828.1	-	1	1708	c.1709A>T	c.(1708-1710)aAc>aTc	p.N570I																								TGCAGCCGGGTTTTGCTTCAG	0.542													ENSG00000248713																																					0																																										SO:0001583	missense	0			-																												ENST00000511828.1:c.1709A>T	4.37:g.100574097T>A	ENSP00000427555:p.Asn570Ile			Missense_Mutation	SNP	NULL	p.N570I	ENST00000511828.1	37	c.1709		4	.	.	.	.	.	.	.	.	.	.	T	9.527	1.109940	0.20714	.	.	ENSG00000248713	ENST00000511828	T	0.17528	2.27	5.0	-3.27	0.05048	.	.	.	.	.	T	0.06554	0.0168	N	0.08118	0	.	.	.	.	.	.	.	.	.	T	0.33497	-0.9866	6	0.36615	T	0.2	.	2.2891	0.04134	0.3407:0.0677:0.3099:0.2816	.	.	.	.	I	570	ENSP00000427555:N570I	ENSP00000427555:N570I	N	-	2	0	RP11-766F14.2	100793120	0.916000	0.31088	0.131000	0.22000	0.996000	0.88848	0.807000	0.27140	-0.665000	0.05317	0.533000	0.62120	AAC	-	RP11-766F14.2	-	NULL		0.542	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	Clone_based_vega_gene	protein_coding	OTTHUMT00000365456.1	0	0	0	60	60	54	0.00	0.00	T			100574097	-1	26	54	27	59	tier1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	49.06	47.79	SNP	0.002	A	26	27
LINC01330	646168	genome.wustl.edu	37	3	167621200	167621200	+	lincRNA	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr3:167621200A>G	ENST00000481578.1	+	0	244																											AAGGAGAAGAACATTCCACCC	0.348													ENSG00000244227																																					0																																												0			-																													3.37:g.167621200A>G				R	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	RP11-298O21.5	-	-		0.348	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	0	0	0	40	40	137	0.00	0.00	A			167621200	+1	39	77	7	17	tier1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	84.78	81.91	SNP	0.053	G	39	7
MARCH11	441061	genome.wustl.edu	37	5	16067845	16067845	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:16067845A>G	ENST00000332432.8	-	4	1143	c.944T>C	c.(943-945)gTg>gCg	p.V315A		NM_001102562.1	NP_001096032.1	A6NNE9	MARHB_HUMAN	membrane-associated ring finger (C3HC4) 11	315					protein ubiquitination (GO:0016567)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)|urinary_tract(1)	20						GTGCAAATTCACAGCTCGCCA	0.418													ENSG00000183654																																					0													60.0	59.0	59.0					5																	16067845		1897	4134	6031	SO:0001583	missense	0			-	BC150513	CCDS47192.1	5p15.1	2013-01-09			ENSG00000183654	ENSG00000183654		"""RING-type (C3HC4) zinc fingers"", ""MARCH membrane-associated ring fingers"""	33609	protein-coding gene	gene with protein product		613338				17604280	Standard	NM_001102562		Approved	MARCH-XI	uc003jfo.2	A6NNE9	OTTHUMG00000161789	ENST00000332432.8:c.944T>C	5.37:g.16067845A>G	ENSP00000333181:p.Val315Ala		A7E2S6	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH	p.V315A	ENST00000332432.8	37	c.944	CCDS47192.1	5	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590370	0.66105	.	.	ENSG00000183654	ENST00000332432	T	0.23754	1.89	5.54	5.54	0.83059	.	0.000000	0.48767	D	0.000180	T	0.48466	0.1501	M	0.62723	1.935	0.80722	D	1	D	0.69078	0.997	D	0.68192	0.956	T	0.49523	-0.8931	10	0.87932	D	0	-15.3288	15.971	0.80019	1.0:0.0:0.0:0.0	.	315	A6NNE9	MARHB_HUMAN	A	315	ENSP00000333181:V315A	ENSP00000333181:V315A	V	-	2	0	MARCH11	16120845	1.000000	0.71417	0.949000	0.38748	0.980000	0.70556	8.673000	0.91186	2.223000	0.72356	0.533000	0.62120	GTG	-	MARCH11	-	NULL		0.418	MARCH11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MARCH11	HGNC	protein_coding	OTTHUMT00000366096.2	0	0	0	29	29	155	0.00	0.00	A	NM_001102562		16067845	-1	15	32	32	65	tier1	no_errors	ENST00000332432	ensembl	human	known	74_37	missense	31.91	32.99	SNP	0.999	G	15	32
LOC401286	401286	genome.wustl.edu	37	6	168069993	168069993	+	lincRNA	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:168069993G>A	ENST00000609107.1	-	0	2095																											TGCTCCCCATGAAGTGCATCT	0.637													ENSG00000272549																																					0																																												0			-																													6.37:g.168069993G>A				R	SNP	-	NULL	ENST00000609107.1	37	NULL		6																																																																																			-	RP11-351J23.2	-	-		0.637	RP11-351J23.2-001	KNOWN	basic	lincRNA	LOC401286	Clone_based_vega_gene	lincRNA	OTTHUMT00000471574.1	0	0	0	82	82	118	0.00	0.00	G			168069993	-1	12	18	43	50	tier1	no_errors	ENST00000609107	ensembl	human	known	74_37	rna	21.82	26.47	SNP	0.000	A	12	43
OTP	23440	genome.wustl.edu	37	5	76932753	76932753	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:76932753C>T	ENST00000306422.3	-	2	1478	c.340G>A	c.(340-342)Gca>Aca	p.A114T	OTP_ENST00000515716.1_5'UTR	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	114					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		TTGAGCTGTGCGGGGGTGAAG	0.667													ENSG00000171540																																					0													108.0	110.0	110.0					5																	76932753		2203	4300	6503	SO:0001583	missense	0			-		CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.340G>A	5.37:g.76932753C>T	ENSP00000302814:p.Ala114Thr			Missense_Mutation	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,prints_HTH_motif,pfscan_OAR_dom,pfscan_Homeobox_dom	p.A114T	ENST00000306422.3	37	c.340	CCDS4039.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.282106	0.95489	.	.	ENSG00000171540	ENST00000306422	D	0.96104	-3.91	5.18	5.18	0.71444	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	L	0.27975	0.815	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.95434	0.8519	10	0.39692	T	0.17	.	17.6239	0.88089	0.0:1.0:0.0:0.0	.	114	Q5XKR4	OTP_HUMAN	T	114	ENSP00000302814:A114T	ENSP00000302814:A114T	A	-	1	0	OTP	76968509	1.000000	0.71417	0.850000	0.33497	0.935000	0.57460	4.699000	0.61796	2.589000	0.87451	0.655000	0.94253	GCA	-	OTP	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.667	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTP	HGNC	protein_coding	OTTHUMT00000220016.2	0	0	0	82	82	43	0.00	0.00	C			76932753	-1	18	8	26	37	tier1	no_errors	ENST00000306422	ensembl	human	known	74_37	missense	40.91	17.78	SNP	1.000	T	18	26
SLCO1B3	28234	genome.wustl.edu	37	12	21028281	21028281	+	Silent	SNP	G	G	A	rs555631927		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr12:21028281G>A	ENST00000381545.3	+	9	1059	c.840G>A	c.(838-840)ccG>ccA	p.P280P	SLCO1B3_ENST00000553473.1_Silent_p.P280P|LST3_ENST00000381541.3_Intron|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000540229.1_Silent_p.P280P|SLCO1B3_ENST00000261196.2_Silent_p.P280P	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	280					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.P280P(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTTTCTTGCCGAAAAATCCAA	0.358													ENSG00000111700	.|||	1	0.000199681	0.0	0.0	5008	,	,		16452	0.0		0.001	False		,,,				2504	0.0																1	Substitution - coding silent(1)	lung(1)											115.0	112.0	113.0					12																	21028281		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.840G>A	12.37:g.21028281G>A			E7EMT8|Q5JAR4	Silent	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.P280	ENST00000381545.3	37	c.840	CCDS8684.1	12																																																																																			-	SLCO1B3	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.358	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	0	0	0	74	74	66	0.00	0.00	G	NM_019844		21028281	+1	17	5	51	18	tier1	no_errors	ENST00000553473	ensembl	human	known	74_37	silent	25.00	21.74	SNP	0.016	A	17	51
EPAS1	2034	genome.wustl.edu	37	2	46605046	46605046	+	Silent	SNP	C	C	T	rs142534349		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:46605046C>T	ENST00000263734.3	+	10	1773	c.1263C>T	c.(1261-1263)ttC>ttT	p.F421F		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	421					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			ATCAGAACTTCGAGGAGTCCT	0.637													ENSG00000116016																																					0													29.0	28.0	28.0					2																	46605046		2146	4196	6342	SO:0001819	synonymous_variant	0			-	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1263C>T	2.37:g.46605046C>T			Q86VA2|Q99630	Silent	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_bHLH_dom,tigrfam_PAS	p.F421	ENST00000263734.3	37	c.1263	CCDS1825.1	2																																																																																			-	EPAS1	-	NULL		0.637	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	0	0	0	66	66	50	0.00	0.00	C	NM_001430		46605046	+1	8	33	14	41	tier1	no_errors	ENST00000263734	ensembl	human	known	74_37	silent	36.36	44.59	SNP	0.731	T	8	14
DDX18	8886	genome.wustl.edu	37	2	118582579	118582579	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:118582579C>T	ENST00000263239.2	+	9	1398	c.1270C>T	c.(1270-1272)Cga>Tga	p.R424*		NM_006773.3	NP_006764.3	Q9NVP1	DDX18_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 18	424	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAAGAAGAACCGAAAGAAGAA	0.383													ENSG00000088205																																					0													119.0	116.0	117.0					2																	118582579		2203	4300	6503	SO:0001587	stop_gained	0			-	X98743	CCDS2120.1	2q21.2	2008-02-05	2003-06-13		ENSG00000088205	ENSG00000088205		"""DEAD-boxes"""	2741	protein-coding gene	gene with protein product		606355	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated)"""			8861962	Standard	NM_006773		Approved	MrDb	uc002tlh.1	Q9NVP1	OTTHUMG00000058521	ENST00000263239.2:c.1270C>T	2.37:g.118582579C>T	ENSP00000263239:p.Arg424*		Q6GTZ9|Q6IAU4|Q92732|Q9BQB7	Nonsense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R424*	ENST00000263239.2	37	c.1270	CCDS2120.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.174587	0.97348	.	.	ENSG00000088205	ENST00000263239;ENST00000539346;ENST00000415038	.	.	.	5.17	4.28	0.50868	.	0.290919	0.38605	N	0.001635	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	15.3142	0.74059	0.1412:0.8588:0.0:0.0	.	.	.	.	X	424;163;88	.	ENSP00000263239:R424X	R	+	1	2	DDX18	118299049	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.502000	0.66956	1.303000	0.44873	-0.188000	0.12872	CGA	-	DDX18	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.383	DDX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX18	HGNC	protein_coding	OTTHUMT00000129632.3	0	0	0	30	30	41	0.00	0.00	C	NM_006773		118582579	+1	4	3	23	25	tier1	no_errors	ENST00000263239	ensembl	human	known	74_37	nonsense	14.81	10.71	SNP	1.000	T	4	23
KLHL1	57626	genome.wustl.edu	37	13	70681572	70681572	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr13:70681572G>T	ENST00000377844.4	-	1	1019	c.260C>A	c.(259-261)tCt>tAt	p.S87Y	ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'UTR|ATXN8OS_ENST00000414504.2_RNA	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	87	Ser-rich.				actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ATTGAaggaagaggaggaaga	0.587													ENSG00000150361																																					0													67.0	70.0	69.0					13																	70681572		2203	4300	6503	SO:0001583	missense	0			-	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.260C>A	13.37:g.70681572G>T	ENSP00000367075:p.Ser87Tyr		A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.S87Y	ENST00000377844.4	37	c.260	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227491	0.39399	.	.	ENSG00000150361	ENST00000377844	T	0.73897	-0.79	5.3	5.3	0.74995	.	2.007420	0.02094	N	0.053415	T	0.69548	0.3123	L	0.36672	1.1	0.80722	D	1	P;P	0.38642	0.641;0.641	B;B	0.31614	0.087;0.133	T	0.58929	-0.7549	10	0.72032	D	0.01	.	13.7654	0.62992	0.0:0.1534:0.8466:0.0	.	87;87	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	Y	87	ENSP00000367075:S87Y	ENSP00000367075:S87Y	S	-	2	0	KLHL1	69579573	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.895000	0.56258	2.477000	0.83638	0.650000	0.86243	TCT	-	KLHL1	-	NULL		0.587	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	0	0	0	68	68	61	0.00	0.00	G	NM_020866		70681572	-1	11	13	46	103	tier1	no_errors	ENST00000377844	ensembl	human	known	74_37	missense	19.30	11.21	SNP	1.000	T	11	46
DACH2	117154	genome.wustl.edu	37	X	85404005	85404005	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:85404005G>T	ENST00000373125.4	+	1	381	c.381G>T	c.(379-381)caG>caT	p.Q127H	DACH2_ENST00000373131.1_Missense_Mutation_p.Q127H	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2	127	DACHbox-N.				development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						CTGTTGAGCAGGTCCGGATCC	0.542													ENSG00000126733																																					0													73.0	69.0	70.0					X																	85404005		2202	4300	6502	SO:0001583	missense	0			-	AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.381G>T	X.37:g.85404005G>T	ENSP00000362217:p.Gln127His		B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_D-bd_dom_put	p.Q127H	ENST00000373125.4	37	c.381	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208734	0.58343	.	.	ENSG00000126733	ENST00000344497;ENST00000373131;ENST00000373125	D;D	0.89746	-2.56;-2.56	4.5	3.41	0.39046	DNA binding domain, putative (1);Transforming protein Ski (2);	0.000000	0.48286	D	0.000194	D	0.93446	0.7909	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.92697	0.6171	10	0.87932	D	0	.	9.6764	0.40043	0.1291:0.0:0.8709:0.0	.	127;127	Q96NX9-2;Q96NX9	.;DACH2_HUMAN	H	127	ENSP00000362223:Q127H;ENSP00000362217:Q127H	ENSP00000345134:Q127H	Q	+	3	2	DACH2	85290661	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	6.949000	0.75971	0.659000	0.30945	0.544000	0.68410	CAG	-	DACH2	-	pfam_Transform_Ski,superfamily_D-bd_dom_put		0.542	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	0	0	0	67	67	64	0.00	0.00	G	NM_053281		85404005	+1	19	13	30	19	tier1	no_errors	ENST00000373125	ensembl	human	known	74_37	missense	38.78	40.62	SNP	1.000	T	19	30
CACNA1H	8912	genome.wustl.edu	37	16	1250294	1250294	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:1250294C>T	ENST00000348261.5	+	7	1090	c.842C>T	c.(841-843)aCg>aTg	p.T281M	CACNA1H_ENST00000358590.4_Missense_Mutation_p.T281M|CACNA1H_ENST00000565831.1_Missense_Mutation_p.T281M	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	281					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TACTACCAGACGGAGGAGGGC	0.642													ENSG00000196557																																					0													30.0	30.0	30.0					16																	1250294		2088	4201	6289	SO:0001583	missense	0			-	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.842C>T	16.37:g.1250294C>T	ENSP00000334198:p.Thr281Met		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.T281M	ENST00000348261.5	37	c.842	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356868	0.61293	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96913	-4.17;-4.11	4.4	4.4	0.53042	Ion transport (1);	1.387780	0.04533	N	0.386779	D	0.97489	0.9178	M	0.85462	2.755	0.09310	N	1	D;P	0.56287	0.975;0.956	P;P	0.51895	0.653;0.683	D	0.89417	0.3707	10	0.62326	D	0.03	.	9.8648	0.41136	0.0:0.906:0.0:0.094	.	281;281	O95180-2;O95180	.;CAC1H_HUMAN	M	281	ENSP00000334198:T281M;ENSP00000351401:T281M	ENSP00000334198:T281M	T	+	2	0	CACNA1H	1190295	0.015000	0.18098	1.000000	0.80357	0.998000	0.95712	2.693000	0.47027	2.275000	0.75901	0.586000	0.80456	ACG	-	CAC1H	-	pfam_Ion_trans_dom		0.642	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CAC1H	HGNC	protein_coding	OTTHUMT00000421601.1	0	0	0	122	122	182	0.00	0.00	C	NM_001005407		1250294	+1	23	23	65	86	tier1	no_errors	ENST00000348261	ensembl	human	known	74_37	missense	26.14	21.10	SNP	0.341	T	23	65
ATG5	9474	genome.wustl.edu	37	6	106696116	106696116	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:106696116C>A	ENST00000369076.3	-	6	805	c.482G>T	c.(481-483)aGa>aTa	p.R161I	ATG5_ENST00000343245.3_Missense_Mutation_p.R161I|ATG5_ENST00000369070.1_Missense_Mutation_p.R83I|ATG5_ENST00000360666.4_Missense_Mutation_p.D38Y	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	161					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		CTGGTCAAATCTGTCTGTAAT	0.313													ENSG00000057663																																					0													58.0	60.0	59.0					6																	106696116		2203	4300	6503	SO:0001583	missense	0			-	Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.482G>T	6.37:g.106696116C>A	ENSP00000358072:p.Arg161Ile		O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	pfam_Atg5	p.R161I	ENST00000369076.3	37	c.482	CCDS5055.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.75|16.75	3.208271|3.208271	0.58343|0.58343	.|.	.|.	ENSG00000057663|ENSG00000057663	ENST00000360666|ENST00000369076;ENST00000343245;ENST00000369070	.|.	.|.	.|.	5.88|5.88	3.87|3.87	0.44632|0.44632	.|.	.|0.042198	.|0.85682	.|D	.|0.000000	T|T	0.18718|0.18718	0.0449|0.0449	L|L	0.43152|0.43152	1.355|1.355	0.30630|0.30630	N|N	0.757555|0.757555	P|B;B	0.42649|0.15719	0.786|0.014;0.006	B|B;B	0.44044|0.16722	0.439|0.016;0.015	T|T	0.09640|0.09640	-1.0665|-1.0665	8|9	0.87932|0.56958	D|D	0|0.05	-4.8443|-4.8443	4.4552|4.4552	0.11640|0.11640	0.0:0.5706:0.0:0.4294|0.0:0.5706:0.0:0.4294	.|.	38|83;161	Q7Z3H3|Q9H1Y0-2;Q9H1Y0	.|.;ATG5_HUMAN	Y|I	38|161;161;83	.|.	ENSP00000353884:D38Y|ENSP00000343313:R161I	D|R	-|-	1|2	0|0	ATG5|ATG5	106802809|106802809	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	5.399000|5.399000	0.66314|0.66314	1.485000|1.485000	0.48380|0.48380	0.591000|0.591000	0.81541|0.81541	GAT|AGA	-	ATG5	-	pfam_Atg5		0.313	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	0	0	0	93	93	167	0.00	0.00	C	NM_004849		106696116	-1	71	77	110	78	tier1	no_errors	ENST00000343245	ensembl	human	known	74_37	missense	39.23	49.68	SNP	1.000	A	71	110
ADARB2	105	genome.wustl.edu	37	10	1313200	1313200	+	Missense_Mutation	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr10:1313200G>A	ENST00000381312.1	-	4	1467	c.1142C>T	c.(1141-1143)aCg>aTg	p.T381M		NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	381					mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GTGCATGGGCGTGAGGTCCGT	0.552													ENSG00000185736																																					0													102.0	80.0	87.0					10																	1313200		2203	4300	6503	SO:0001583	missense	0			-	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.1142C>T	10.37:g.1313200G>A	ENSP00000370713:p.Thr381Met		B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsR-bd_dom,smart_dsR-bd_dom,smart_A_deamin,pfscan_dsR-bd_dom,pfscan_A_deamin	p.T381M	ENST00000381312.1	37	c.1142	CCDS7058.1	10	.	.	.	.	.	.	.	.	.	.	G	11.53	1.667346	0.29604	.	.	ENSG00000185736	ENST00000381312	T	0.24350	1.86	5.42	4.52	0.55395	Adenosine deaminase/editase (1);	0.487597	0.23724	N	0.045194	T	0.42426	0.1202	M	0.66939	2.045	0.26398	N	0.976477	D	0.60160	0.987	P	0.55260	0.772	T	0.37009	-0.9724	10	0.66056	D	0.02	-8.9961	14.4261	0.67218	0.0711:0.0:0.9289:0.0	.	381	Q9NS39	RED2_HUMAN	M	381	ENSP00000370713:T381M	ENSP00000370713:T381M	T	-	2	0	ADARB2	1303200	0.979000	0.34478	0.040000	0.18447	0.008000	0.06430	2.505000	0.45424	1.300000	0.44818	-0.333000	0.08304	ACG	-	ADARB2	-	smart_A_deamin		0.552	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADARB2	HGNC	protein_coding	OTTHUMT00000046426.1	0	0	0	45	45	85	0.00	0.00	G	NM_018702		1313200	-1	21	37	16	68	tier1	no_errors	ENST00000381312	ensembl	human	known	74_37	missense	56.76	35.24	SNP	0.034	A	21	16
AP3D1	8943	genome.wustl.edu	37	19	2129394	2129394	+	Silent	SNP	G	G	A	rs199695826		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:2129394G>A	ENST00000345016.5	-	7	886	c.655C>T	c.(655-657)Ctg>Ttg	p.L219L	AP3D1_ENST00000350812.6_Intron|AP3D1_ENST00000355272.6_Silent_p.L219L|AP3D1_ENST00000356926.4_Intron|AP3D1_ENST00000590683.1_5'UTR	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	219					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCAGGGACAGGTAGTTCTTA	0.562													ENSG00000065000	G|||	1	0.000199681	0.0008	0.0	5008	,	,		16927	0.0		0.0	False		,,,				2504	0.0																0								G	,	4,3952		0,4,1974	137.0	141.0	140.0		,655	3.5	1.0	19		140	14,8306		0,14,4146	no	intron,coding-synonymous	AP3D1	NM_001077523.1,NM_003938.5	,	0,18,6120	AA,AG,GG		0.1683,0.1011,0.1466	,	,219/1154	2129394	18,12258	1978	4160	6138	SO:0001819	synonymous_variant	0			-	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.655C>T	19.37:g.2129394G>A			O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.L219	ENST00000345016.5	37	c.655	CCDS42459.1	19																																																																																			rs199695826	AP3D1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu		0.562	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	0	0	0	78	78	117	0.00	0.00	G			2129394	-1	19	30	22	58	tier1	no_errors	ENST00000355272	ensembl	human	known	74_37	silent	46.34	33.71	SNP	1.000	A	19	22
PRKCG	5582	genome.wustl.edu	37	19	54395787	54395787	+	Silent	SNP	G	G	A	rs116236420	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:54395787G>A	ENST00000263431.3	+	7	993	c.711G>A	c.(709-711)gaG>gaA	p.E237E	PRKCG_ENST00000540413.1_Silent_p.E237E|PRKCG_ENST00000536044.1_Silent_p.E237E|PRKCG_ENST00000542049.1_Silent_p.E124E	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	237	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	GGGATGTGGAGCGCCGGCTCA	0.667													ENSG00000126583																																					0													46.0	34.0	38.0					19																	54395787		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.711G>A	19.37:g.54395787G>A			B7Z8Q0	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.E237	ENST00000263431.3	37	c.711	CCDS12867.1	19																																																																																			-	PRKCG	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_dom		0.667	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	0	0	0	204	204	64	0.00	0.00	G	NM_002739		54395787	+1	35	11	79	33	tier1	no_errors	ENST00000540413	ensembl	human	known	74_37	silent	30.70	25.00	SNP	1.000	A	35	79
HECW1	23072	genome.wustl.edu	37	7	43351444	43351444	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr7:43351444A>G	ENST00000395891.2	+	4	715	c.110A>G	c.(109-111)gAg>gGg	p.E37G	HECW1_ENST00000453890.1_Missense_Mutation_p.E37G	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	37					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CGGTGCAAGGAGCCGCTCCGA	0.607													ENSG00000002746																																					0													53.0	61.0	59.0					7																	43351444		1985	4142	6127	SO:0001583	missense	0			-	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.110A>G	7.37:g.43351444A>G	ENSP00000379228:p.Glu37Gly		A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_WW_dom,superfamily_C2_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.E37G	ENST00000395891.2	37	c.110	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293083	0.80914	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.37411	1.2;1.2	5.96	5.96	0.96718	.	0.099811	0.64402	D	0.000002	T	0.45915	0.1366	L	0.47716	1.5	0.47214	D	0.999357	P;P;D	0.59767	0.919;0.877;0.986	B;B;P	0.53266	0.375;0.339;0.722	T	0.29305	-1.0016	10	0.40728	T	0.16	.	16.422	0.83766	1.0:0.0:0.0:0.0	.	37;69;37	B4DH42;B3KR18;Q76N89	.;.;HECW1_HUMAN	G	37;37;36	ENSP00000379228:E37G;ENSP00000407774:E37G	ENSP00000265522:E36G	E	+	2	0	HECW1	43317969	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.843000	0.69424	2.270000	0.75569	0.533000	0.62120	GAG	-	HECW1	-	NULL		0.607	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	0	0	0	27	27	130	0.00	0.00	A	NM_015052		43351444	+1	14	33	17	45	tier1	no_errors	ENST00000395891	ensembl	human	known	74_37	missense	45.16	42.31	SNP	1.000	G	14	17
POPDC3	64208	genome.wustl.edu	37	6	105614546	105614546	+	Intron	SNP	T	T	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:105614546T>G	ENST00000254765.3	-	2	28				POPDC3_ENST00000474760.1_Intron|BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|BVES-AS1_ENST00000580854.1_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3						regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)				NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				TGCAGCAGCCTTCCCTGACCA	0.448													ENSG00000203808																																					0																																										SO:0001627	intron_variant	0			-	BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.251-4511A>C	6.37:g.105614546T>G			B2RA98|Q5T3Y8|Q8TBW6	R	SNP	-	NULL	ENST00000254765.3	37	NULL	CCDS5052.1	6																																																																																			-	BVES-AS1	-	-		0.448	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BVES-AS1	HGNC	protein_coding	OTTHUMT00000041651.1	0	0	0	66	66	220	0.00	0.00	T	NM_022361		105614546	+1	11	27	79	135	tier1	no_errors	ENST00000369122	ensembl	human	known	74_37	rna	12.22	16.56	SNP	0.004	G	11	79
GSE1	23199	genome.wustl.edu	37	16	85694912	85694912	+	Nonsense_Mutation	SNP	G	G	T	rs528060260		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:85694912G>T	ENST00000253458.7	+	9	1977	c.1801G>T	c.(1801-1803)Gaa>Taa	p.E601*	GSE1_ENST00000405402.2_Nonsense_Mutation_p.E497*|RN7SL381P_ENST00000577658.1_RNA|GSE1_ENST00000393243.1_Nonsense_Mutation_p.E528*	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	601	Pro-rich.																GCGGCGGGCCGAAAGCCACTC	0.662													ENSG00000131149																																					0													30.0	34.0	33.0					16																	85694912		2180	4266	6446	SO:0001587	stop_gained	0			-	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1801G>T	16.37:g.85694912G>T	ENSP00000253458:p.Glu601*		D3DUM4|Q8IY61|Q96GA4|Q9BW09	Nonsense_Mutation	SNP	pfam_GSE-like	p.E601*	ENST00000253458.7	37	c.1801	CCDS10952.1	16	.	.	.	.	.	.	.	.	.	.	G	38	6.781875	0.97833	.	.	ENSG00000131149	ENST00000405402;ENST00000253458;ENST00000393243	.	.	.	5.17	5.17	0.71159	.	0.207319	0.49305	D	0.000152	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-15.9308	18.2613	0.90037	0.0:0.0:1.0:0.0	.	.	.	.	X	497;601;528	.	ENSP00000253458:E601X	E	+	1	0	KIAA0182	84252413	1.000000	0.71417	0.789000	0.31954	0.079000	0.17450	3.188000	0.50958	2.403000	0.81681	0.561000	0.74099	GAA	-	GSE1	-	NULL		0.662	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GSE1	HGNC	protein_coding	OTTHUMT00000325527.1	0	0	0	58	58	19	0.00	0.00	G	NM_014615		85694912	+1	14	4	32	10	tier1	no_errors	ENST00000253458	ensembl	human	known	74_37	nonsense	30.43	28.57	SNP	0.947	T	14	32
TP53	7157	genome.wustl.edu	37	17	7574034	7574034	+	Splice_Site	SNP	C	C	G	rs587782272		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:7574034C>G	ENST00000269305.4	-	10	1183		c.e10-1		TP53_ENST00000359597.4_Intron|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(9)|p.0?(8)|p.I332fs*49(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCCCACGGATCTGCAGCAACA	0.512		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	18	Unknown(9)|Whole gene deletion(8)|Insertion - Frameshift(1)	lung(5)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|endometrium(2)|stomach(1)|breast(1)|ovary(1)	GRCh37	CS002470|CS033842	TP53	S							44.0	36.0	39.0					17																	7574034		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.994-1G>C	17.37:g.7574034C>G			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e9-1	ENST00000269305.4	37	c.994-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051594	0.36181	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4323	0.83853	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7514759	1.000000	0.71417	0.997000	0.53966	0.143000	0.21401	6.410000	0.73294	2.549000	0.85964	0.561000	0.74099	.	-	TP53	-	-		0.512	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	43	43	12	0.00	0.00	C	NM_000546	Intron	7574034	-1	30	84	6	13	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	83.33	86.60	SNP	1.000	G	30	6
SLC30A8	169026	genome.wustl.edu	37	8	118147610	118147610	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr8:118147610C>A	ENST00000456015.2	+	1	44	c.44C>A	c.(43-45)gCc>gAc	p.A15D	SLC30A8_ENST00000521035.1_3'UTR|SLC30A8_ENST00000427715.2_5'UTR|SLC30A8_ENST00000519688.1_5'UTR|SLC30A8_ENST00000521243.1_Intron	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	15					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			GATAAAGCTGCCAAGATGTAT	0.418													ENSG00000164756																									Ovarian(162;1202 1922 6011 16223 52092)												0													210.0	199.0	203.0					8																	118147610		2203	4299	6502	SO:0001583	missense	0			-		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.44C>A	8.37:g.118147610C>A	ENSP00000415011:p.Ala15Asp		A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.A15D	ENST00000456015.2	37	c.44	CCDS6322.1	8	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535905	0.27475	.	.	ENSG00000164756	ENST00000456015	T	0.67865	-0.29	5.64	4.77	0.60923	.	0.390908	0.25114	N	0.033038	T	0.43634	0.1256	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28618	-1.0038	10	0.24483	T	0.36	-14.3176	9.9637	0.41712	0.0:0.8403:0.0:0.1597	.	15	Q8IWU4	ZNT8_HUMAN	D	15	ENSP00000415011:A15D	ENSP00000415011:A15D	A	+	2	0	SLC30A8	118216791	1.000000	0.71417	1.000000	0.80357	0.284000	0.27059	2.212000	0.42835	1.389000	0.46526	0.655000	0.94253	GCC	-	SLC30A8	-	NULL		0.418	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A8	HGNC	protein_coding	OTTHUMT00000381205.1	0	0	0	26	26	223	0.00	0.00	C	NM_173851		118147610	+1	13	22	72	110	tier1	no_errors	ENST00000456015	ensembl	human	known	74_37	missense	15.29	16.67	SNP	1.000	A	13	72
CTTN	2017	genome.wustl.edu	37	11	70281823	70281823	+	3'UTR	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:70281823G>A	ENST00000301843.8	+	0	2414				CTTN_ENST00000538675.1_Missense_Mutation_p.C305Y|CTTN_ENST00000346329.3_3'UTR|CTTN_ENST00000376561.3_Missense_Mutation_p.C584Y	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin						negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		ATCTGCCTATGTCATACCGTG	0.562													ENSG00000085733																																					0													39.0	36.0	37.0					11																	70281823		873	1985	2858	SO:0001624	3_prime_UTR_variant	0			-	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.*555G>A	11.37:g.70281823G>A			Q8N707|Q96H99	Missense_Mutation	SNP	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.C305Y	ENST00000301843.8	37	c.914	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	G	4.729	0.135612	0.09032	.	.	ENSG00000085733	ENST00000376561;ENST00000538675	T;T	0.36157	1.27;1.49	3.73	-7.46	0.01369	.	.	.	.	.	T	0.13927	0.0337	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28396	-1.0045	9	0.87932	D	0	.	2.4196	0.04445	0.1091:0.3516:0.274:0.2653	.	305;584	B4E358;Q8N707	.;.	Y	584;305	ENSP00000365745:C584Y;ENSP00000439762:C305Y	ENSP00000365745:C584Y	C	+	2	0	CTTN	69959471	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.776000	0.04674	-4.185000	0.00066	-0.181000	0.13052	TGT	-	CTTN	-	NULL		0.562	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	HGNC	protein_coding	OTTHUMT00000259233.2	0	0	0	105	105	82	0.00	0.00	G	NM_138565		70281823	+1	33	37	56	70	tier1	no_errors	ENST00000538675	ensembl	human	known	74_37	missense	37.08	34.58	SNP	0.000	A	33	56
ARHGAP23P1	102577425	genome.wustl.edu	37	16	33739328	33739328	+	RNA	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:33739328C>A	ENST00000567025.1	-	0	215									Rho GTPase activating protein 23 pseudogene 1																		CAGGGACATGCTTGGCTTGGA	0.612													ENSG00000260781																																					0																																												0			-			16p11.2	2013-01-23			ENSG00000260781	ENSG00000260781			45039	pseudogene	pseudogene							Standard	NG_033847		Approved				OTTHUMG00000176364		16.37:g.33739328C>A				R	SNP	-	NULL	ENST00000567025.1	37	NULL		16																																																																																			-	ARHGAP23P1	-	-		0.612	ARHGAP23P1-002	KNOWN	basic	processed_transcript	ARHGAP23P1	HGNC	pseudogene	OTTHUMT00000431823.1	0	0	0	108	108	25	0.00	0.00	C			33739328	-1	11	4	62	13	tier1	no_errors	ENST00000567025	ensembl	human	known	74_37	rna	15.07	23.53	SNP	0.998	A	11	62
MTFMT	123263	genome.wustl.edu	37	15	65295423	65295423	+	Missense_Mutation	SNP	C	C	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr15:65295423C>A	ENST00000220058.4	-	9	1160	c.1147G>T	c.(1147-1149)Gct>Tct	p.A383S		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	383						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TGTTGCATAGCAACAGTTTTT	0.353													ENSG00000103707																																					0													110.0	97.0	101.0					15																	65295423		1825	4083	5908	SO:0001583	missense	0			-	AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.1147G>T	15.37:g.65295423C>A	ENSP00000220058:p.Ala383Ser		B7Z734	Missense_Mutation	SNP	pfam_Formyl_transf_N,pfam_Formyl_trans_C,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,tigrfam_Fmt	p.A383S	ENST00000220058.4	37	c.1147	CCDS45280.1	15	.	.	.	.	.	.	.	.	.	.	C	0.761	-0.769382	0.02974	.	.	ENSG00000103707	ENST00000220058	T	0.63255	-0.03	5.65	4.73	0.59995	.	0.466252	0.21179	N	0.078856	T	0.45438	0.1342	N	0.12182	0.205	0.22050	N	0.999394	P	0.36144	0.539	B	0.33454	0.164	T	0.39901	-0.9591	10	0.72032	D	0.01	-5.667	15.2689	0.73683	0.0:0.9257:0.0:0.0743	.	383	Q96DP5	FMT_HUMAN	S	383	ENSP00000220058:A383S	ENSP00000220058:A383S	A	-	1	0	MTFMT	63082476	1.000000	0.71417	0.999000	0.59377	0.033000	0.12548	2.128000	0.42045	0.858000	0.35431	-0.813000	0.03139	GCT	-	MTFMT	-	NULL		0.353	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFMT	HGNC	protein_coding	OTTHUMT00000418155.1	0	0	0	49	49	69	0.00	0.00	C	NM_139242		65295423	-1	9	10	33	55	tier1	no_errors	ENST00000220058	ensembl	human	known	74_37	missense	21.43	15.38	SNP	1.000	A	9	33
TNFRSF21	27242	genome.wustl.edu	37	6	47202418	47202418	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:47202418A>G	ENST00000296861.2	-	5	2119	c.1726T>C	c.(1726-1728)Ttt>Ctt	p.F576L		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	576					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			TTGGTAATAAAGGAACCGTTC	0.582													ENSG00000146072																																					0													44.0	43.0	43.0					6																	47202418		2203	4300	6503	SO:0001583	missense	0			-	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1726T>C	6.37:g.47202418A>G	ENSP00000296861:p.Phe576Leu		B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,pfscan_Death_domain,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_21	p.F576L	ENST00000296861.2	37	c.1726	CCDS4921.1	6	.	.	.	.	.	.	.	.	.	.	A	34	5.332286	0.95733	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.74421	-0.84	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74801	0.3764	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80039	-0.1549	10	0.87932	D	0	.	15.5142	0.75809	1.0:0.0:0.0:0.0	.	576	O75509	TNR21_HUMAN	L	576;265	ENSP00000296861:F576L	ENSP00000296861:F576L	F	-	1	0	TNFRSF21	47310377	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	9.278000	0.95766	2.129000	0.65627	0.529000	0.55759	TTT	-	TNFRSF21	-	NULL		0.582	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	HGNC	protein_coding	OTTHUMT00000040814.1	0	0	0	36	36	113	0.00	0.00	A	NM_014452		47202418	-1	13	11	58	96	tier1	no_errors	ENST00000296861	ensembl	human	known	74_37	missense	18.31	10.28	SNP	1.000	G	13	58
GRIK2	2898	genome.wustl.edu	37	6	102250236	102250236	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr6:102250236A>G	ENST00000421544.1	+	8	1616	c.1126A>G	c.(1126-1128)Act>Gct	p.T376A	GRIK2_ENST00000413795.1_Missense_Mutation_p.T376A|GRIK2_ENST00000369138.1_Missense_Mutation_p.T376A|GRIK2_ENST00000369134.4_Missense_Mutation_p.T327A|GRIK2_ENST00000369137.3_Missense_Mutation_p.T376A|GRIK2_ENST00000318991.6_Missense_Mutation_p.T376A	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	376					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AGGCAGAATAACTTTCAACAA	0.348													ENSG00000164418																																					0													115.0	116.0	115.0					6																	102250236		2203	4299	6502	SO:0001583	missense	0			-		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1126A>G	6.37:g.102250236A>G	ENSP00000397026:p.Thr376Ala		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T376A	ENST00000421544.1	37	c.1126	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	A	9.980	1.227841	0.22542	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	D;D;D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65;-1.65;-1.65	5.61	5.61	0.85477	Extracellular ligand-binding receptor (1);	0.249412	0.39544	N	0.001329	T	0.54255	0.1847	N	0.14661	0.345	0.33887	D	0.636911	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.12156	0.007;0.007;0.004	T	0.47129	-0.9141	10	0.11794	T	0.64	.	15.8049	0.78491	1.0:0.0:0.0:0.0	.	376;376;376	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	A	376;376;376;376;376;376;327;338;89	ENSP00000397026:T376A;ENSP00000405596:T376A;ENSP00000358134:T376A;ENSP00000358133:T376A;ENSP00000313276:T376A;ENSP00000358130:T327A;ENSP00000391988:T89A	ENSP00000313276:T376A	T	+	1	0	GRIK2	102356929	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.358000	0.59442	2.127000	0.65507	0.445000	0.29226	ACT	-	GRIK2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.348	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	0	0	0	39	39	84	0.00	0.00	A			102250236	+1	34	43	38	74	tier1	no_errors	ENST00000421544	ensembl	human	known	74_37	missense	47.22	36.75	SNP	1.000	G	34	38
MMP26	56547	genome.wustl.edu	37	11	4825681	4825681	+	Intron	DEL	T	T	-			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:4825681delT	ENST00000380390.1	+	1	72				OR52R1_ENST00000356069.2_5'Flank|MMP26_ENST00000477339.1_Intron|OR52R1_ENST00000380382.1_Frame_Shift_Del_p.N56fs			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26						collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	AAAACAAGTGTTATTATTATA	0.363													ENSG00000176937																																					0													89.0	89.0	89.0					11																	4825681		2201	4298	6499	SO:0001627	intron_variant	0				AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.-145+37110T>-	11.37:g.4825681delT			Q3MJ78|Q9GZS2|Q9NR87	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N56fs	ENST00000380390.1	37	c.167	CCDS7752.1	11																																																																																				OR52R1	-	NULL		0.363	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52R1	HGNC	protein_coding	OTTHUMT00000142058.3	0	0	0	37	37	111	0.00	0.00	T	NM_021801		4825681	-1	7	38	41	50	tier1	no_errors	ENST00000380382	ensembl	human	known	74_37	frame_shift_del	14.58	43.18	DEL	0.000	-	7	41
KIAA0430	9665	genome.wustl.edu	37	16	15696480	15696481	+	Intron	INS	-	-	AGGAAAGAAGGAGGGAGGCAGAG	rs373385405|rs373082870|rs79821793|rs71293163	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	-	-	-	AGGAAAGAAGGAGGGAGGCAGAG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr16:15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG	ENST00000396368.3	-	23	4620				KIAA0430_ENST00000547936.1_Intron|KIAA0430_ENST00000548025.1_Intron|KIAA0430_ENST00000602337.1_Intron|KIAA0430_ENST00000540441.2_Intron|KIAA0430_ENST00000551742.1_Intron|KIAA0430_ENST00000344181.3_Frame_Shift_Ins_p.-1113fs	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430						double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						gaggaggaggaaggaaagaagg	0.406													ENSG00000166783		4802	0.958866	0.9955	0.9294	5008	,	,		23942	0.998		0.8777	False		,,,				2504	0.9734																0																																										SO:0001627	intron_variant	0				AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4414-420->CTCTGCCTCCCTCCTTCTTTCCT	16.37:g.15696480_15696481insAGGAAAGAAGGAGGGAGGCAGAG			A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Frame_Shift_Ins	INS	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.P1114fs	ENST00000396368.3	37	c.3339_3338	CCDS10562.2	16																																																																																				KIAA0430	-	NULL		0.406	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	0	0	0	23	23	23	0.00	0.00	-	NM_014647		15696481	-1	3	3	15	15	tier1	no_errors	ENST00000344181	ensembl	human	known	74_37	frame_shift_ins	16.67	16.67	INS	0.000:0.000	AGGAAAGAAGGAGGGAGGCAGAG	3	15
ITGA6	3655	genome.wustl.edu	37	2	173349540	173349540	+	Missense_Mutation	SNP	A	A	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:173349540A>G	ENST00000264106.6	+	13	1900	c.1697A>G	c.(1696-1698)gAa>gGa	p.E566G	ITGA6_ENST00000343713.4_Missense_Mutation_p.E522G|ITGA6_ENST00000409532.1_Missense_Mutation_p.E408G|ITGA6_ENST00000264107.7_Missense_Mutation_p.E527G|ITGA6_ENST00000409080.1_Missense_Mutation_p.E527G|AC093818.1_ENST00000442417.1_RNA|ITGA6_ENST00000375221.2_Missense_Mutation_p.E566G			P23229	ITA6_HUMAN	integrin, alpha 6	566					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			GCTGAAAAAGAAAGAAGAAAA	0.383													ENSG00000091409																																					0													58.0	59.0	58.0					2																	173349540		2203	4300	6503	SO:0001583	missense	0			-		CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.1697A>G	2.37:g.173349540A>G	ENSP00000264106:p.Glu566Gly		B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E566G	ENST00000264106.6	37	c.1697		2	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143188	0.57044	.	.	ENSG00000091409	ENST00000409532;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000343713;ENST00000409080;ENST00000442250;ENST00000458358	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.77	5.77	0.91146	.	0.245405	0.47852	D	0.000220	T	0.50633	0.1627	M	0.63428	1.95	0.45762	D	0.998656	B;B;B;B	0.30193	0.026;0.272;0.156;0.141	B;B;B;B	0.35182	0.025;0.197;0.197;0.197	T	0.53521	-0.8427	10	0.66056	D	0.02	.	14.3323	0.66566	1.0:0.0:0.0:0.0	.	522;566;527;527	P23229-4;P23229-9;G5E9H1;P23229-2	.;.;.;.	G	408;527;566;566;522;527;566;522	ENSP00000386614:E408G;ENSP00000264107:E527G;ENSP00000264106:E566G;ENSP00000364369:E566G;ENSP00000341078:E522G;ENSP00000386896:E527G;ENSP00000406694:E566G;ENSP00000394169:E522G	ENSP00000264106:E566G	E	+	2	0	ITGA6	173057786	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	3.338000	0.52128	2.200000	0.70718	0.459000	0.35465	GAA	-	ITGA6	-	pfam_Integrin_alpha-2		0.383	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	HGNC	protein_coding		0	0	0	31	31	67	0.00	0.00	A			173349540	+1	13	33	4	4	tier1	no_errors	ENST00000264106	ensembl	human	known	74_37	missense	76.47	84.62	SNP	0.998	G	13	4
KCNC4	3749	genome.wustl.edu	37	1	110768794	110768794	+	Missense_Mutation	SNP	C	C	T	rs200184574		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:110768794C>T	ENST00000369787.3	+	3	1840	c.1813C>T	c.(1813-1815)Cgg>Tgg	p.R605W	KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000413138.3_Missense_Mutation_p.R605W|KCNC4_ENST00000438661.2_Missense_Mutation_p.R605W	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	605					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGGTAGTGTCCGGAAAGGTAT	0.647													ENSG00000116396																																					0													52.0	58.0	56.0					1																	110768794		2203	4300	6503	SO:0001583	missense	0			-	BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1813C>T	1.37:g.110768794C>T	ENSP00000358802:p.Arg605Trp		Q3MIM4|Q5TBI6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.R605W	ENST00000369787.3	37	c.1813	CCDS821.1	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.656015	0.88056	.	.	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.98221	-4.8;-4.63;-4.69	5.19	5.19	0.71726	.	0.134642	0.30723	N	0.009019	D	0.97579	0.9207	L	0.59436	1.845	0.43073	D	0.99471	D;D	0.71674	0.997;0.998	P;P	0.50754	0.551;0.649	D	0.98158	1.0445	10	0.87932	D	0	.	18.7013	0.91621	0.0:1.0:0.0:0.0	.	605;605	Q03721;Q03721-3	KCNC4_HUMAN;.	W	605	ENSP00000358802:R605W;ENSP00000388029:R605W;ENSP00000393655:R605W	ENSP00000358802:R605W	R	+	1	2	KCNC4	110570317	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.651000	0.61447	2.430000	0.82344	0.462000	0.41574	CGG	rs200184574	KCNC4	-	NULL		0.647	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	HGNC	protein_coding	OTTHUMT00000052146.2	0	0	0	140	140	90	0.00	0.00	C	NM_001039574		110768794	+1	39	35	14	5	tier1	no_errors	ENST00000369787	ensembl	human	known	74_37	missense	73.58	87.50	SNP	1.000	T	39	14
OR10Q1	219960	genome.wustl.edu	37	11	57996225	57996225	+	Missense_Mutation	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr11:57996225C>T	ENST00000316770.2	-	1	165	c.123G>A	c.(121-123)atG>atA	p.M41I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	41						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CACAGAGGATCATCAAGTAGA	0.527													ENSG00000180475																																					0													114.0	122.0	119.0					11																	57996225		2200	4294	6494	SO:0001583	missense	0			-	AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.123G>A	11.37:g.57996225C>T	ENSP00000314324:p.Met41Ile		Q6IFG4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M41I	ENST00000316770.2	37	c.123	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	8.116	0.779975	0.16120	.	.	ENSG00000180475	ENST00000316770	T	0.00392	7.58	5.28	2.25	0.28309	.	0.123417	0.36555	N	0.002525	T	0.00178	0.0005	N	0.13168	0.305	0.09310	N	1	B	0.34181	0.44	B	0.30646	0.118	T	0.31558	-0.9939	10	0.10377	T	0.69	.	11.4267	0.50015	0.136:0.3334:0.5306:0.0	.	41	Q8NGQ4	O10Q1_HUMAN	I	41	ENSP00000314324:M41I	ENSP00000314324:M41I	M	-	3	0	OR10Q1	57752801	0.000000	0.05858	0.013000	0.15412	0.626000	0.37791	-0.168000	0.09925	0.305000	0.22832	0.650000	0.86243	ATG	-	OR10Q1	-	prints_GPCR_Rhodpsn		0.527	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	0	0	0	41	41	62	0.00	0.00	C	NM_001004471		57996225	-1	21	28	5	7	tier1	no_errors	ENST00000316770	ensembl	human	known	74_37	missense	80.77	80.00	SNP	0.003	T	21	5
MTMR12	54545	genome.wustl.edu	37	5	32268807	32268807	+	Splice_Site	SNP	C	C	G			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr5:32268807C>G	ENST00000382142.3	-	6	753	c.583G>C	c.(583-585)Gtc>Ctc	p.V195L	MTMR12_ENST00000264934.5_Splice_Site_p.V195L|MTMR12_ENST00000280285.5_Splice_Site_p.V195L	NM_001040446.1	NP_001035536.1	Q9C0I1	MTMRC_HUMAN	myotubularin related protein 12	195						cytoplasm (GO:0005737)	phosphatase activity (GO:0016791)			breast(3)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						AGATATTTACCTGTATTGTTT	0.403													ENSG00000150712																																					0													91.0	85.0	87.0					5																	32268807		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB051469	CCDS34138.1, CCDS75230.1	5p15.33	2011-06-09	2005-04-07	2005-04-07	ENSG00000150712	ENSG00000150712		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	18191	protein-coding gene	gene with protein product		606501	"""phosphatidylinositol-3-phosphate associated protein"""	PIP3AP		11504939, 12495846	Standard	XM_005248313		Approved	3-PAP, FLJ20476, KIAA1682, 3PAP	uc003jhq.3	Q9C0I1	OTTHUMG00000161978	ENST00000382142.3:c.583+1G>C	5.37:g.32268807C>G			Q69YJ4|Q6PFW3|Q96QU2|Q9NX27	Missense_Mutation	SNP	pfam_Myotubularin_assoc	p.V195L	ENST00000382142.3	37	c.583	CCDS34138.1	5	.	.	.	.	.	.	.	.	.	.	C	14.49	2.552433	0.45487	.	.	ENSG00000150712	ENST00000280285;ENST00000382142;ENST00000264934	D;D;D	0.95518	-3.73;-3.39;-3.25	5.22	4.34	0.51931	.	0.921001	0.09249	N	0.828100	D	0.92789	0.7707	L	0.36672	1.1	0.34377	D	0.69265	B;B;B	0.21606	0.058;0.034;0.006	B;B;B	0.22601	0.04;0.033;0.014	D	0.87687	0.2551	9	.	.	.	.	15.7546	0.78013	0.0:0.8631:0.1369:0.0	.	195;195;195	Q9C0I1-3;Q9C0I1-2;Q9C0I1	.;.;MTMRC_HUMAN	L	195	ENSP00000280285:V195L;ENSP00000371577:V195L;ENSP00000264934:V195L	.	V	-	1	0	MTMR12	32304564	1.000000	0.71417	0.761000	0.31378	0.946000	0.59487	3.527000	0.53517	1.171000	0.42768	0.650000	0.86243	GTC	-	MTMR12	-	NULL		0.403	MTMR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR12	HGNC	protein_coding	OTTHUMT00000366579.1	0	0	0	40	40	178	0.00	0.00	C	NM_019061	Missense_Mutation	32268807	-1	5	8	47	106	tier1	no_errors	ENST00000382142	ensembl	human	known	74_37	missense	9.62	7.02	SNP	0.996	G	5	47
MACF1	23499	genome.wustl.edu	37	1	39752957	39752957	+	Splice_Site	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:39752957G>T	ENST00000372915.3	+	14	1610		c.e14-1		MACF1_ENST00000545844.1_Splice_Site|MACF1_ENST00000567887.1_Splice_Site|MACF1_ENST00000317713.7_Splice_Site|MACF1_ENST00000564288.1_Splice_Site|MACF1_ENST00000361689.2_Splice_Site|MACF1_ENST00000539005.1_Splice_Site			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TTCCATTTCAGGGTCATGCGT	0.363													ENSG00000127603																																					0													112.0	106.0	108.0					1																	39752957		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1524-1G>T	1.37:g.39752957G>T			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Splice_Site	SNP	-	e14-1	ENST00000372915.3	37	c.1524-1		1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467528	0.84533	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1634	0.98142	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MACF1	39525544	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.312000	0.96287	2.773000	0.95371	0.655000	0.94253	.	-	MACF1	-	-		0.363	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	0	0	2	44	44	118	0.00	1.67	G	NM_033044	Intron	39752957	+1	30	45	30	68	tier1	no_errors	ENST00000317713	ensembl	human	known	74_37	splice_site	50.00	39.47	SNP	1.000	T	30	30
ARHGAP23	57636	genome.wustl.edu	37	17	36638789	36638789	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr17:36638789G>T	ENST00000431231.2	+	16	2845	c.2777G>T	c.(2776-2778)tGc>tTc	p.C926F	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.C926F|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.C832F	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	926	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						GTGGCTGCATGCTGTCGCATT	0.627													ENSG00000225485																																					0													19.0	16.0	17.0					17																	36638789		692	1589	2281	SO:0001583	missense	0			-	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.2777G>T	17.37:g.36638789G>T	ENSP00000393539:p.Cys926Phe			Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.C926F	ENST00000431231.2	37	c.2777	CCDS56027.1	17	.	.	.	.	.	.	.	.	.	.	G	13.48	2.249639	0.39797	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.25749	1.78;1.78;1.78	4.85	4.85	0.62838	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.63367	0.2505	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.75263	-0.3379	10	0.87932	D	0	.	16.8914	0.86088	0.0:0.0:1.0:0.0	.	926;926	Q9P227;Q9P227-2	RHG23_HUMAN;.	F	926;926;832	ENSP00000394153:C926F;ENSP00000393539:C926F;ENSP00000407333:C832F	ENSP00000393539:C926F	C	+	2	0	ARHGAP23	33892315	1.000000	0.71417	0.996000	0.52242	0.048000	0.14542	9.657000	0.98554	2.517000	0.84864	0.650000	0.86243	TGC	-	ARHGAP23	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.627	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	0	0	0	101	101	8	0.00	0.00	G	XM_290799		36638789	+1	4	0	39	5	tier1	no_errors	ENST00000431231	ensembl	human	known	74_37	missense	9.30	0.00	SNP	1.000	T	4	39
ADCY4	196883	genome.wustl.edu	37	14	24802126	24802126	+	Silent	SNP	C	C	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr14:24802126C>T	ENST00000310677.4	-	3	341	c.228G>A	c.(226-228)ctG>ctA	p.L76L	ADCY4_ENST00000558563.1_5'UTR|ADCY4_ENST00000396747.3_5'UTR|ADCY4_ENST00000418030.2_Silent_p.L76L|RP11-934B9.3_ENST00000555591.1_Missense_Mutation_p.G143R|ADCY4_ENST00000554068.2_Silent_p.L76L	NM_001198568.1|NM_001198592.1|NM_139247.3	NP_001185497.1|NP_001185521.1|NP_640340.2	Q8NFM4	ADCY4_HUMAN	adenylate cyclase 4	76					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(265;0.0192)		AAGCGAGGCCCAGCAGCAGCG	0.667											OREG0022624	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000258973																																					0													23.0	31.0	28.0					14																	24802126		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF497516	CCDS9627.1	14q11.2	2013-02-04			ENSG00000129467	ENSG00000129467	4.6.1.1	"""Adenylate cyclases"""	235	protein-coding gene	gene with protein product		600292				7766992	Standard	NM_001198592		Approved	AC4	uc001woy.3	Q8NFM4	OTTHUMG00000029347	ENST00000310677.4:c.228G>A	14.37:g.24802126C>T		774	B3KV74|D3DS75|Q17R40|Q6ZTM6|Q96ML7	Missense_Mutation	SNP	NULL	p.G143R	ENST00000310677.4	37	c.427	CCDS9627.1	14	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695148	0.68386	.	.	ENSG00000258973	ENST00000555591	.	.	.	5.66	4.73	0.59995	.	.	.	.	.	T	0.69214	0.3086	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.67154	-0.5742	4	.	.	.	.	13.8862	0.63710	0.0:0.7665:0.2334:0.0	.	.	.	.	R	143	.	.	G	-	1	0	RP11-934B9.3	23871966	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	1.838000	0.39211	2.663000	0.90544	0.555000	0.69702	GGG	-	RP11-934B9.3	-	NULL		0.667	ADCY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258973	Clone_based_vega_gene	protein_coding	OTTHUMT00000073200.4	0	0	0	35	35	19	0.00	0.00	C			24802126	-1	4	0	29	5	tier1	no_errors	ENST00000555591	ensembl	human	putative	74_37	missense	12.12	0.00	SNP	0.999	T	4	29
AC092364.4	0	genome.wustl.edu	37	19	21880281	21880281	+	RNA	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr19:21880281G>A	ENST00000579236.1	+	0	73																											gtagagaaacgccacactctg	0.522													ENSG00000266008																																					0																																												0			-																													19.37:g.21880281G>A				R	SNP	-	NULL	ENST00000579236.1	37	NULL		19																																																																																			-	AC092364.4	-	-		0.522	AC092364.4-201	NOVEL	basic	miRNA	ENSG00000266008	Clone_based_ensembl_gene	miRNA		0	0	0	22	22	31	0.00	0.00	G			21880281	+1	5	1	6	2	tier1	no_errors	ENST00000579236	ensembl	human	novel	74_37	rna	45.45	33.33	SNP	0.163	A	5	6
DUSP9	1852	genome.wustl.edu	37	X	152915639	152915639	+	Missense_Mutation	SNP	G	G	T			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chrX:152915639G>T	ENST00000342782.3	+	4	1299	c.1034G>T	c.(1033-1035)cGg>cTg	p.R345L	DUSP9_ENST00000370167.4_Missense_Mutation_p.R345L			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	345	Tyrosine-protein phosphatase.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGCAGCTTGCGGCTGGAGGAG	0.612													ENSG00000130829																																					0													135.0	120.0	125.0					X																	152915639		2203	4300	6503	SO:0001583	missense	0			-	Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.1034G>T	X.37:g.152915639G>T	ENSP00000345853:p.Arg345Leu		D3DWU5	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.R345L	ENST00000342782.3	37	c.1034	CCDS14724.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.73|11.73	1.726264|1.726264	0.30593|0.30593	.|.	.|.	ENSG00000130829|ENSG00000130829	ENST00000433144|ENST00000370167;ENST00000342782	.|T;T	.|0.58940	.|0.3;0.3	4.53|4.53	0.781|0.781	0.18561|0.18561	.|Dual specificity phosphatase, subgroup, catalytic domain (1);	.|1.080270	.|0.07212	.|N	.|0.859447	T|T	0.44138|0.44138	0.1279|0.1279	L|L	0.31371|0.31371	0.925|0.925	0.39684|0.39684	D|D	0.970946|0.970946	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.17319|0.17319	-1.0373|-1.0373	5|10	.|0.28530	.|T	.|0.3	.|.	9.0401|9.0401	0.36311|0.36311	0.3625:0.0:0.6375:0.0|0.3625:0.0:0.6375:0.0	.|.	.|345	.|Q99956	.|DUS9_HUMAN	C|L	316|345	.|ENSP00000359186:R345L;ENSP00000345853:R345L	.|ENSP00000345853:R345L	G|R	+|+	1|2	0|0	DUSP9|DUSP9	152568833|152568833	1.000000|1.000000	0.71417|0.71417	0.075000|0.075000	0.20258|0.20258	0.389000|0.389000	0.30415|0.30415	4.836000|4.836000	0.62789|0.62789	0.137000|0.137000	0.18759|0.18759	0.529000|0.529000	0.55759|0.55759	GGC|CGG	-	DUSP9	-	pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat		0.612	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUSP9	HGNC	protein_coding	OTTHUMT00000061022.3	0	0	0	38	38	2	0.00	0.00	G	NM_001395		152915639	+1	5	0	40	2	tier1	no_errors	ENST00000342782	ensembl	human	known	74_37	missense	11.11	0.00	SNP	0.993	T	5	40
NBPF11	200030	genome.wustl.edu	37	1	146055349	146055349	+	Missense_Mutation	SNP	G	G	A	rs200002878	byFrequency	TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr1:146055349G>A	ENST00000604938.1	-	7	1572	c.274C>T	c.(274-276)Ctc>Ttc	p.L92F	NBPF11_ENST00000605317.1_Missense_Mutation_p.L146F|NBPF11_ENST00000604894.1_Intron|NBPF11_ENST00000339388.5_Missense_Mutation_p.L92F|NBPF11_ENST00000401009.2_5'Flank|NBPF11_ENST00000369323.3_Intron|NBPF11_ENST00000479926.2_Intron			Q86T75	NBPFB_HUMAN	neuroblastoma breakpoint family, member 11	92						cytoplasm (GO:0005737)						all_hematologic(923;0.0276)					CCTCACCTGAGCTCCTCAGCT	0.527													ENSG00000152042																																					0																																										SO:0001583	missense	0			-			1q21.1	2014-01-16			ENSG00000152042	ENSG00000263956		"""neuroblastoma breakpoint family"""	31993	protein-coding gene	gene with protein product		614001	"""neuroblastoma breakpoint family, member 24"""	NBPF24		16079250	Standard	XM_006711197		Approved			Q86T75	OTTHUMG00000013880	ENST00000604938.1:c.274C>T	1.37:g.146055349G>A	ENSP00000474107:p.Leu92Phe		B1AKG1|B7Z7R4	Missense_Mutation	SNP	pfam_NBPF_dom,superfamily_Secretoglobin	p.L92F	ENST00000604938.1	37	c.274		1	.	.	.	.	.	.	.	.	.	.	g	8.397	0.841041	0.16891	.	.	ENSG00000152042	ENST00000339388;ENST00000479926	T	0.03553	3.89	0.804	0.804	0.18697	.	.	.	.	.	T	0.04952	0.0133	M	0.66378	2.025	0.09310	N	0.999998	D;B	0.76494	0.999;0.137	D;B	0.71656	0.974;0.01	T	0.35748	-0.9776	9	0.39692	T	0.17	.	5.0805	0.14653	0.0:0.0:1.0:0.0	.	92;92	B7WNR1;Q86T75	.;NBPFB_HUMAN	F	92	ENSP00000345181:L92F	ENSP00000345181:L92F	L	-	1	0	NBPF11	144766706	0.001000	0.12720	0.053000	0.19242	0.075000	0.17131	-0.341000	0.07811	0.772000	0.33382	0.398000	0.26397	CTC	rs200002878	NBPF11	-	NULL		0.527	NBPF11-001	KNOWN	basic|appris_candidate	protein_coding	NBPF11	HGNC	protein_coding	OTTHUMT00000351193.2	0	0	0	10	10	0	0.00	0.00	G	NM_183372		146055349	-1	11	0	13	0	tier1	no_errors	ENST00000604938	ensembl	human	known	74_37	missense	45.83	0.00	SNP	0.060	A	11	13
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147847	+	3'UTR	DEL	GTGTGTGTGTGT	GTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200666696|rs200969250|rs66612444		TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	GTGTGTGTGTGT	GTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:50147836_50147847delGTGTGTGTGTGT	ENST00000406316.2	-	0	7145_7156				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgt	0.392													ENSG00000179915																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACAC>-	2.37:g.50147836_50147847delGTGTGTGTGTGT			A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	R	DEL	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																				NRXN1	-	-		0.392	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	0	0	0	0	0	0	0.00	0.00	GTGTGTGTGTGT			50147847	-1	0	0	0	0	tier1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055	-	0	0
POTEF	728378	genome.wustl.edu	37	2	130832537	130832537	+	Silent	SNP	G	G	A			TCGA-SG-A6Z4-01A-22D-A33E-09	TCGA-SG-A6Z4-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	7f4df9e0-c36b-46fd-b7f3-4912fcb9fc49	eb6b6f4d-e3e1-4475-b6be-0e23e379f2a5	g.chr2:130832537G>A	ENST00000409914.2	-	17	2907	c.2508C>T	c.(2506-2508)atC>atT	p.I836I	POTEF_ENST00000357462.5_Silent_p.I836I	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	836	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.I836M(1)		breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						GCACAGCCTGGATGGCCACGT	0.582													ENSG00000196604																																					1	Substitution - Missense(1)	lung(1)											107.0	129.0	122.0					2																	130832537		2197	4288	6485	SO:0001819	synonymous_variant	0			-	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2508C>T	2.37:g.130832537G>A			A6NC34	Silent	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.I836	ENST00000409914.2	37	c.2508	CCDS46409.1	2																																																																																			-	POTEF	-	pfam_Actin-related,smart_Actin-related		0.582	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	0	0	0	63	63	0	0.00	0.00	G	NM_001099771		130832537	-1	4	0	30	0	tier1	no_errors	ENST00000357462	ensembl	human	known	74_37	silent	11.76	0.00	SNP	1.000	A	4	30
