#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PCDHA1	56147	genome.wustl.edu	37	5	140167900	140167900	+	Silent	SNP	G	G	A	rs143057294	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:140167900G>A	ENST00000504120.2	+	1	2025	c.2025G>A	c.(2023-2025)gcG>gcA	p.A675A	PCDHA1_ENST00000378133.3_Silent_p.A675A|PCDHA1_ENST00000394633.3_Intron	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	675	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGCCAGGCGCCAAAGGCGT	0.657													ENSG00000204970																																					0								G	,,	2,4400	4.2+/-10.8	0,2,2199	40.0	46.0	44.0		2025,2025,	-6.1	0.0	5	dbSNP_134	44	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous,intron	PCDHA1	NM_018900.2,NM_031410.1,NM_031411.1	,,	0,2,6498	AA,AG,GG		0.0,0.0454,0.0154	,,	675/951,675/808,	140167900	2,12998	2201	4299	6500	SO:0001819	synonymous_variant	0			-	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2025G>A	5.37:g.140167900G>A			O75288|Q9NRT7	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A675	ENST00000504120.2	37	c.2025	CCDS54913.1	5																																																																																			rs143057294	PCDHA1	-	smart_Cadherin,pfscan_Cadherin		0.657	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHA1	HGNC	protein_coding	OTTHUMT00000389127.1	0	0	0	61	61	12	0.00	0.00	G	NM_018900		140167900	+1	18	0	23	8	tier1	no_errors	ENST00000504120	ensembl	human	known	74_37	silent	43.90	0.00	SNP	0.004	A	18	23
RCBTB1	55213	genome.wustl.edu	37	13	50123666	50123666	+	Missense_Mutation	SNP	G	G	T	rs200826424		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr13:50123666G>T	ENST00000378302.2	-	9	1233	c.973C>A	c.(973-975)Cac>Aac	p.H325N	RCBTB1_ENST00000546015.1_Missense_Mutation_p.H325N|RCBTB1_ENST00000258646.3_Missense_Mutation_p.H325N	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	325					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		CAGGAGAAGTGGGTGAGGTGC	0.647													ENSG00000136144																																					0													94.0	69.0	78.0					13																	50123666		2203	4300	6503	SO:0001583	missense	0			-	AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.973C>A	13.37:g.50123666G>T	ENSP00000367552:p.His325Asn		Q8IY29|Q969U9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_RCC1/BLIP-II,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.H325N	ENST00000378302.2	37	c.973	CCDS9418.1	13	.	.	.	.	.	.	.	.	.	.	G	19.31	3.802263	0.70682	.	.	ENSG00000136144	ENST00000258646;ENST00000378302;ENST00000546015	T;T;T	0.39229	1.31;1.31;1.09	5.15	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.38825	0.1055	M	0.61703	1.905	0.53688	D	0.999974	B	0.17268	0.021	B	0.18561	0.022	T	0.27262	-1.0079	10	0.08381	T	0.77	-5.4607	15.0288	0.71691	0.0:0.0:0.8566:0.1434	.	325	Q8NDN9	RCBT1_HUMAN	N	325	ENSP00000258646:H325N;ENSP00000367552:H325N;ENSP00000443293:H325N	ENSP00000258646:H325N	H	-	1	0	RCBTB1	49021667	1.000000	0.71417	0.995000	0.50966	0.865000	0.49528	7.630000	0.83225	1.138000	0.42230	0.462000	0.41574	CAC	-	RCBTB1	-	NULL		0.647	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB1	HGNC	protein_coding	OTTHUMT00000044912.2	0	0	0	68	68	9	0.00	0.00	G	NM_018191		50123666	-1	4	0	23	7	tier1	no_errors	ENST00000258646	ensembl	human	known	74_37	missense	14.81	0.00	SNP	1.000	T	4	23
UBE2V1	7335	genome.wustl.edu	37	20	48698944	48698944	+	3'UTR	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr20:48698944G>T	ENST00000371674.3	-	0	849				UBE2V1_ENST00000371677.3_3'UTR|UBE2V1_ENST00000396059.3_5'UTR|UBE2V1_ENST00000420027.2_3'UTR|TMEM189-UBE2V1_ENST00000341698.2_3'UTR|TMEM189_ENST00000557021.1_3'UTR|UBE2V1_ENST00000415862.2_3'UTR|UBE2V1_ENST00000371657.5_3'UTR|UBE2V1_ENST00000340309.3_3'UTR	NM_001032288.2|NM_001257395.1	NP_001027459.1|NP_001244324.1	Q13404	UB2V1_HUMAN	ubiquitin-conjugating enzyme E2 variant 1						cell differentiation (GO:0030154)|error-free postreplication DNA repair (GO:0042275)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|regulation of DNA repair (GO:0006282)|regulation of transcription, DNA-templated (GO:0006355)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|protein complex (GO:0043234)|UBC13-UEV1A complex (GO:0035370)|ubiquitin conjugating enzyme complex (GO:0031371)|ubiquitin ligase complex (GO:0000151)	acid-amino acid ligase activity (GO:0016881)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(4)	9			BRCA - Breast invasive adenocarcinoma(9;4.74e-06)			AGAGACCCCAGGCCGTGTAAT	0.507													ENSG00000244687																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	U39360	CCDS13426.1, CCDS13427.1, CCDS33483.1, CCDS58775.1, CCDS74740.1	20q13.2	2007-07-18			ENSG00000244687	ENSG00000244687		"""Ubiquitin-conjugating enzymes E2"""	12494	protein-coding gene	gene with protein product		602995		UBE2V		9418904, 9305758	Standard	NM_001032288		Approved	UEV-1, CROC-1, UEV1A, CROC1		Q13404	OTTHUMG00000152626	ENST00000371674.3:c.*361C>A	20.37:g.48698944G>T			E1P629|Q13403|Q13532|Q5TGE0|Q5TGE3|Q96H34|Q9GZT0|Q9GZW1|Q9H4J3|Q9H4J4|Q9UKL1|Q9UM48|Q9UM49|Q9UM50	R	SNP	-	NULL	ENST00000371674.3	37	NULL	CCDS33483.1	20																																																																																			-	UBE2V1	-	-		0.507	UBE2V1-004	KNOWN	basic|CCDS	protein_coding	UBE2V1	HGNC	protein_coding	OTTHUMT00000080530.1	0	0	0	50	50	9	0.00	0.00	G	NM_021988		48698944	-1	4	0	40	6	tier1	no_errors	ENST00000396059	ensembl	human	known	74_37	rna	9.09	0.00	SNP	1.000	T	4	40
FAM159A	348378	genome.wustl.edu	37	1	53099179	53099179	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:53099179G>C	ENST00000517870.1	+	1	164	c.14G>C	c.(13-15)tGc>tCc	p.C5S	FAM159A_ENST00000401050.3_3'UTR	NM_001042693.1	NP_001036158.1	Q6UWV7	F159A_HUMAN	family with sequence similarity 159, member A	5						integral component of membrane (GO:0016021)				endometrium(3)|lung(6)|upper_aerodigestive_tract(1)	10						AGCGGCGCCTGCACGAGCTAC	0.771													ENSG00000182183																																					0													6.0	7.0	6.0					1																	53099179		1811	3938	5749	SO:0001583	missense	0			-		CCDS41336.1	1p32.3	2008-08-08			ENSG00000182183	ENSG00000182183			28757	protein-coding gene	gene with protein product						12477932	Standard	NM_001042693		Approved	MGC52498	uc001cuf.3	Q6UWV7	OTTHUMG00000008330	ENST00000517870.1:c.14G>C	1.37:g.53099179G>C	ENSP00000429726:p.Cys5Ser		Q6ZRG4	Missense_Mutation	SNP	NULL	p.C5S	ENST00000517870.1	37	c.14	CCDS41336.1	1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756636	0.89843	.	.	ENSG00000182183	ENST00000517870	.	.	.	3.44	3.44	0.39384	.	0.000000	0.64402	U	0.000003	T	0.75317	0.3833	L	0.59436	1.845	0.46203	D	0.998924	D	0.76494	0.999	D	0.83275	0.996	T	0.79736	-0.1678	9	0.87932	D	0	.	15.773	0.78187	0.0:0.0:1.0:0.0	.	5	Q6UWV7	F159A_HUMAN	S	5	.	ENSP00000429726:C5S	C	+	2	0	FAM159A	52871767	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.602000	0.90868	1.860000	0.53959	0.455000	0.32223	TGC	-	FAM159A	-	NULL		0.771	FAM159A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM159A	HGNC	protein_coding	OTTHUMT00000022934.2	0	0	0	13	13	0	0.00	0.00	G	NM_001042693		53099179	+1	7	0	3	0	tier1	no_errors	ENST00000517870	ensembl	human	known	74_37	missense	70.00	0.00	SNP	1.000	C	7	3
RP11-423O2.5	0	genome.wustl.edu	37	1	142803333	142803333	+	lincRNA	SNP	G	G	A	rs79184194	byFrequency	TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:142803333G>A	ENST00000423385.1	-	0	1632																											ACACAAGTGTGCACAAttttt	0.388													ENSG00000234978																																					0																																												0			-																													1.37:g.142803333G>A				R	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			rs79184194	RP11-423O2.5	-	-		0.388	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	0	0	0	50	50	0	0.00	0.00	G			142803333	-1	12	0	79	0	tier1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	13.19	0.00	SNP	0.005	A	12	79
HMGN2P46	283651	genome.wustl.edu	37	15	45848230	45848231	+	lincRNA	INS	-	-	T	rs372861121|rs368577527		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr15:45848230_45848231insT	ENST00000557965.1	+	0	0				HMGN2P46_ENST00000409454.1_RNA																							TTTTGTTTAGCTTTTTTTTTTT	0.322													ENSG00000179362																																					0																																												0																																15.37:g.45848241_45848241dupT				R	INS	-	NULL	ENST00000557965.1	37	NULL		15																																																																																				HMGN2P46	-	-		0.322	RP11-96O20.2-001	KNOWN	basic	lincRNA	HMGN2P46	HGNC	lincRNA	OTTHUMT00000416553.1	0	0	0	22	22	4	0.00	0.00	-			45848231	+1	6	0	35	5	tier1	no_errors	ENST00000313559	ensembl	human	known	74_37	rna	14.63	0.00	INS	0.997:0.997	T	6	35
LOR	4014	genome.wustl.edu	37	1	153234265	153234265	+	Silent	SNP	C	C	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr1:153234265C>T	ENST00000368742.3	+	2	897	c.840C>T	c.(838-840)ggC>ggT	p.G280G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	280					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTGGAGGCGGCGGCGGCGGCT	0.716													ENSG00000203782																																					0													5.0	7.0	6.0					1																	153234265		1332	3138	4470	SO:0001819	synonymous_variant	0			-	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.840C>T	1.37:g.153234265C>T			Q5T869|Q5XKF8	Silent	SNP	NULL	p.G280	ENST00000368742.3	37	c.840	CCDS30870.1	1	.	.	.	.	.	.	.	.	.	.	C	0.499	-0.871780	0.02570	.	.	ENSG00000203782	ENST00000392652	.	.	.	3.68	1.69	0.24217	.	.	.	.	.	T	0.21227	0.0511	.	.	.	0.26840	N	0.96839	.	.	.	.	.	.	T	0.23868	-1.0176	5	0.87932	D	0	-3.1075	4.9757	0.14138	0.0:0.6614:0.215:0.1236	.	.	.	.	W	280	.	ENSP00000376422:R280W	R	+	1	2	LOR	151500889	1.000000	0.71417	0.036000	0.18154	0.179000	0.23085	1.734000	0.38166	0.199000	0.20427	0.563000	0.77884	CGG	-	LOR	-	NULL		0.716	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	HGNC	protein_coding	OTTHUMT00000039107.1	0	0	0	25	25	2	0.00	0.00	C	NM_000427		153234265	+1	14	0	16	8	tier1	no_errors	ENST00000368742	ensembl	human	known	74_37	silent	45.16	0.00	SNP	0.088	T	14	16
PCDHB4	56131	genome.wustl.edu	37	5	140503450	140503450	+	Missense_Mutation	SNP	C	C	T	rs372114502		TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr5:140503450C>T	ENST00000194152.1	+	1	1870	c.1870C>T	c.(1870-1872)Cgc>Tgc	p.R624C		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	624	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCGAGGTGCGCACCGCCAG	0.697													ENSG00000081818																																					0													27.0	27.0	27.0					5																	140503450		2031	4040	6071	SO:0001583	missense	0			-	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1870C>T	5.37:g.140503450C>T	ENSP00000194152:p.Arg624Cys		Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R624C	ENST00000194152.1	37	c.1870	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899529	0.52227	.	.	ENSG00000081818	ENST00000194152	T	0.52754	0.65	4.12	4.12	0.48240	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.78742	0.4331	H	0.98295	4.195	0.48341	D	0.999639	D	0.89917	1.0	D	0.87578	0.998	D	0.84923	0.0855	9	0.72032	D	0.01	.	10.939	0.47262	0.3132:0.6868:0.0:0.0	.	624	Q9Y5E5	PCDB4_HUMAN	C	624	ENSP00000194152:R624C	ENSP00000194152:R624C	R	+	1	0	PCDHB4	140483634	0.796000	0.28864	1.000000	0.80357	0.997000	0.91878	0.439000	0.21575	2.307000	0.77673	0.485000	0.47835	CGC	-	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.697	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	0	0	0	64	64	0	0.00	0.00	C	NM_018938		140503450	+1	4	0	44	2	tier1	no_errors	ENST00000194152	ensembl	human	known	74_37	missense	8.33	0.00	SNP	1.000	T	4	44
SPRED3	399473	genome.wustl.edu	37	19	38886200	38886200	+	Silent	SNP	C	C	A			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr19:38886200C>A	ENST00000338502.4	+	5	751	c.648C>A	c.(646-648)ggC>ggA	p.G216G	SPRED3_ENST00000587013.1_Silent_p.G260G|SPRED3_ENST00000586301.1_Silent_p.G216G|AC005789.11_ENST00000588453.1_lincRNA	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	216	KBD. {ECO:0000255|PROSITE- ProRule:PRU00821}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TGGGGTGGGGCGGCCGCGGCT	0.716													ENSG00000188766																																					0													6.0	6.0	6.0					19																	38886200		1736	3911	5647	SO:0001819	synonymous_variant	0			-		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.648C>A	19.37:g.38886200C>A			Q2MJR1	Silent	SNP	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.G216	ENST00000338502.4	37	c.648	CCDS42560.1	19																																																																																			-	SPRED3	-	NULL		0.716	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1	0	0	0	29	29	4	0.00	0.00	C	XM_351191		38886200	+1	7	0	5	4	tier1	no_errors	ENST00000338502	ensembl	human	known	74_37	silent	58.33	0.00	SNP	0.992	A	7	5
CDCP1	64866	genome.wustl.edu	37	3	45127316	45127316	+	Silent	SNP	G	G	T			TCGA-SI-A71O-01A-12D-A33E-09	TCGA-SI-A71O-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	33159557-eb32-44de-aaa2-80a9752b3a96	7054e42b-ba0b-4d61-86b0-970d4d7dd6bc	g.chr3:45127316G>T	ENST00000296129.1	-	9	2459	c.2325C>A	c.(2323-2325)tcC>tcA	p.S775S		NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	775						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGGTGGGTGGGGAGGGAGGAC	0.612													ENSG00000163814																																					0													86.0	83.0	84.0					3																	45127316		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.2325C>A	3.37:g.45127316G>T			Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Silent	SNP	superfamily_CUB_dom	p.S775	ENST00000296129.1	37	c.2325	CCDS2727.1	3																																																																																			-	CDCP1	-	NULL		0.612	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCP1	HGNC	protein_coding	OTTHUMT00000256748.3	0	0	0	35	35	60	0.00	0.00	G	NM_022842		45127316	-1	4	2	25	32	tier1	no_errors	ENST00000296129	ensembl	human	known	74_37	silent	13.79	5.88	SNP	0.996	T	4	25
