#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DUSP1	1843	genome.wustl.edu	37	5	172195870	172195870	+	Silent	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr5:172195870G>A	ENST00000239223.3	-	4	1241	c.999C>T	c.(997-999)acC>acT	p.T333T	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	333	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		TGGTGGTGGAGGTGCCTCGGT	0.632													ENSG00000120129																																					0													98.0	93.0	95.0					5																	172195870		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.999C>T	5.37:g.172195870G>A			D3DQL9|Q2V508	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.T333	ENST00000239223.3	37	c.999	CCDS4380.1	5																																																																																			-	DUSP1	-	pirsf_MKP		0.632	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	HGNC	protein_coding	OTTHUMT00000252943.3	0	0	0	78	78	100	0.00	0.00	G	NM_004417		172195870	-1	6	12	33	82	tier1	no_errors	ENST00000239223	ensembl	human	known	74_37	silent	15.38	12.77	SNP	0.773	A	6	33
ZBED9	114821	genome.wustl.edu	37	6	28540383	28540383	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:28540383C>A	ENST00000452236.2	-	4	3900	c.3283G>T	c.(3283-3285)Gat>Tat	p.D1095Y		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						caattcacatctttaaaaagt	0.358													ENSG00000232040																																					0													58.0	60.0	59.0					6																	28540383		2203	4297	6500	SO:0001583	missense	0			-																												ENST00000452236.2:c.3283G>T	6.37:g.28540383C>A	ENSP00000395259:p.Asp1095Tyr			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.D1095Y	ENST00000452236.2	37	c.3283	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	13.27	2.188577	0.38609	.	.	ENSG00000232040	ENST00000452236	T	0.42513	0.97	2.27	2.27	0.28462	Ribonuclease H-like (1);	3.282620	0.01950	N	0.042540	T	0.56124	0.1964	M	0.82823	2.61	0.30275	N	0.791861	D	0.71674	0.998	D	0.79784	0.993	T	0.14062	-1.0486	10	0.72032	D	0.01	.	8.144	0.31100	0.0:1.0:0.0:0.0	.	1095	Q6R2W3	SCND3_HUMAN	Y	1095	ENSP00000395259:D1095Y	ENSP00000395259:D1095Y	D	-	1	0	SCAND3	28648362	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.730000	0.26043	1.581000	0.49865	0.655000	0.94253	GAT	-	SCAND3	-	superfamily_RNaseH-like_dom		0.358	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	0	0	1	62	62	100	0.00	0.99	C			28540383	-1	7	16	44	58	tier1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	13.73	21.62	SNP	1.000	A	7	44
MYH9	4627	genome.wustl.edu	37	22	36688042	36688042	+	Missense_Mutation	SNP	T	T	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr22:36688042T>G	ENST00000216181.5	-	31	4564	c.4334A>C	c.(4333-4335)aAg>aCg	p.K1445T		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1445					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTGGTCAAACTTCTTCTGCTT	0.592			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated				ENSG00000100345																												Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													75.0	67.0	70.0					22																	36688042		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	-		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4334A>C	22.37:g.36688042T>G	ENSP00000216181:p.Lys1445Thr		A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1445T	ENST00000216181.5	37	c.4334	CCDS13927.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.2|24.2	4.505516|4.505516	0.85282|0.85282	.|.	.|.	ENSG00000100345|ENSG00000100345	ENST00000337818;ENST00000216181|ENST00000397231	D|.	0.85629|.	-2.01|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Myosin tail (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74604|0.74604	0.3738|0.3738	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	D|.	0.56035|.	0.974|.	D|.	0.64144|.	0.922|.	T|T	0.77672|0.77672	-0.2500|-0.2500	10|6	0.72032|0.56958	D|D	0.01|0.05	.|.	14.631|14.631	0.68655|0.68655	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1445|.	P35579|.	MYH9_HUMAN|.	T|R	867;1445|48	ENSP00000216181:K1445T|.	ENSP00000216181:K1445T|ENSP00000380408:S48R	K|S	-|-	2|1	0|0	MYH9|MYH9	35017988|35017988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	7.919000|7.919000	0.87513|0.87513	1.906000|1.906000	0.55180|0.55180	0.379000|0.379000	0.24179|0.24179	AAG|AGT	-	MYH9	-	pfam_Myosin_tail		0.592	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	0	0	0	67	67	80	0.00	0.00	T	NM_002473		36688042	-1	13	16	28	50	tier1	no_errors	ENST00000216181	ensembl	human	known	74_37	missense	31.71	24.24	SNP	1.000	G	13	28
PTTG1IP	754	genome.wustl.edu	37	21	46276197	46276197	+	Silent	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr21:46276197G>A	ENST00000330938.3	-	4	580	c.360C>T	c.(358-360)tgC>tgT	p.C120C	PTTG1IP_ENST00000397886.3_Silent_p.C99C|PTTG1IP_ENST00000397887.3_Intron|PTTG1IP_ENST00000494690.1_5'UTR|PTTG1IP_ENST00000445724.2_Intron	NM_004339.3	NP_004330.1	P53801	PTTG_HUMAN	pituitary tumor-transforming 1 interacting protein	120	Poly-Cys.				multicellular organismal development (GO:0007275)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	receptor activity (GO:0004872)			ovary(1)|prostate(1)	2				Colorectal(79;0.0659)		TCCTCCTGCAGCAGCAGCAGC	0.612													ENSG00000183255																																					0													112.0	90.0	97.0					21																	46276197		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF149785	CCDS13715.1, CCDS68221.1	21q22.3	2008-07-04			ENSG00000183255	ENSG00000183255			13524	protein-coding gene	gene with protein product		603784		C21orf3, C21orf1		9570958, 10830953	Standard	NM_004339		Approved	PBF	uc002zgb.2	P53801	OTTHUMG00000090254	ENST00000330938.3:c.360C>T	21.37:g.46276197G>A			B2RDP7|D3DSL9|Q9NS09	Silent	SNP	smart_Plexin-like_fold	p.C120	ENST00000330938.3	37	c.360	CCDS13715.1	21																																																																																			-	PTTG1IP	-	NULL		0.612	PTTG1IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1IP	HGNC	protein_coding	OTTHUMT00000206553.1	0	0	0	107	107	67	0.00	0.00	G			46276197	-1	9	6	77	36	tier1	no_errors	ENST00000330938	ensembl	human	known	74_37	silent	10.34	14.29	SNP	1.000	A	9	77
ZNF407	55628	genome.wustl.edu	37	18	72346148	72346148	+	Missense_Mutation	SNP	G	G	A	rs368385934		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr18:72346148G>A	ENST00000299687.5	+	1	3173	c.3173G>A	c.(3172-3174)cGt>cAt	p.R1058H	ZNF407_ENST00000309902.6_Missense_Mutation_p.R1058H|ZNF407_ENST00000582337.1_Missense_Mutation_p.R1058H|ZNF407_ENST00000577538.1_Missense_Mutation_p.R1058H	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1058					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R1058H(2)		central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		GCGGTGACTCGTCGCGAGATG	0.458													ENSG00000215421	G|||	1	0.000199681	0.0	0.0	5008	,	,		20502	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	endometrium(2)						G	HIS/ARG,HIS/ARG,HIS/ARG	0,4064		0,0,2032	104.0	101.0	102.0		3173,3173,3173	4.3	0.8	18		102	1,8415		0,1,4207	no	missense,missense,missense	ZNF407	NM_001146189.1,NM_001146190.1,NM_017757.2	29,29,29	0,1,6239	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging,probably-damaging,probably-damaging	1058/1816,1058/1661,1058/2249	72346148	1,12479	2032	4208	6240	SO:0001583	missense	0			-	AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.3173G>A	18.37:g.72346148G>A	ENSP00000299687:p.Arg1058His		B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.R1058H	ENST00000299687.5	37	c.3173	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478642	0.44044	0.0	1.19E-4	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.12569	2.67;3.17	6.16	4.28	0.50868	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);	0.355700	0.25875	N	0.027723	T	0.10294	0.0252	L	0.32530	0.975	0.28231	N	0.926098	B;B;B	0.32939	0.391;0.219;0.14	B;B;B	0.26202	0.067;0.034;0.015	T	0.13442	-1.0509	10	0.51188	T	0.08	.	9.6873	0.40107	0.2224:0.0:0.7776:0.0	.	1058;1058;1058	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	H	1058	ENSP00000299687:R1058H;ENSP00000310359:R1058H	ENSP00000299687:R1058H	R	+	2	0	ZNF407	70475136	1.000000	0.71417	0.821000	0.32701	0.996000	0.88848	3.181000	0.50903	-0.812000	0.04363	0.528000	0.53228	CGT	-	ZNF407	-	smart_Znf_C2H2-like,smart_Znf_U1		0.458	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	0	0	0	22	22	125	0.00	0.00	G	NM_017757		72346148	+1	12	21	21	67	tier1	no_errors	ENST00000299687	ensembl	human	known	74_37	missense	36.36	23.86	SNP	0.994	A	12	21
SLC22A8	9376	genome.wustl.edu	37	11	62782355	62782355	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:62782355G>A	ENST00000336232.2	-	2	211	c.76C>T	c.(76-78)Ctc>Ttc	p.L26F	SLC22A8_ENST00000311438.8_Missense_Mutation_p.L26F|SLC22A8_ENST00000430500.2_Missense_Mutation_p.L26F|SLC22A8_ENST00000545207.1_Intron|SLC22A8_ENST00000535878.1_Intron	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	26					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGGATCGGGAGGCCCAGTATG	0.617													ENSG00000149452																																					0													177.0	169.0	172.0					11																	62782355		2201	4298	6499	SO:0001583	missense	0			-	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.76C>T	11.37:g.62782355G>A	ENSP00000337335:p.Leu26Phe		B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L26F	ENST00000336232.2	37	c.76	CCDS8042.1	11	.	.	.	.	.	.	.	.	.	.	G	2.999	-0.206460	0.06180	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000311438;ENST00000430500	T;T;T	0.56611	0.45;0.45;0.45	4.76	-5.73	0.02398	.	0.694331	0.13875	N	0.356743	T	0.32556	0.0833	L	0.42744	1.35	0.26524	N	0.974376	B;B	0.12013	0.005;0.003	B;B	0.19148	0.024;0.011	T	0.21008	-1.0258	10	0.48119	T	0.1	.	1.3625	0.02194	0.3246:0.1017:0.1386:0.4352	.	26;26	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	F	26	ENSP00000337335:L26F;ENSP00000311463:L26F;ENSP00000398548:L26F	ENSP00000311463:L26F	L	-	1	0	SLC22A8	62538931	0.017000	0.18338	0.040000	0.18447	0.080000	0.17528	-0.278000	0.08490	-0.702000	0.05056	-1.047000	0.02352	CTC	-	SLC22A8	-	tigrfam_Orgcat_transp		0.617	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A8	HGNC	protein_coding	OTTHUMT00000396191.1	0	0	0	80	80	104	0.00	0.00	G	NM_004254		62782355	-1	10	10	54	69	tier1	no_errors	ENST00000336232	ensembl	human	known	74_37	missense	15.38	12.66	SNP	0.008	A	10	54
ST18	9705	genome.wustl.edu	37	8	53084453	53084453	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr8:53084453G>A	ENST00000276480.7	-	10	1651	c.968C>T	c.(967-969)aCc>aTc	p.T323I		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	323					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CTCTTTGTAGGTGTTATGGAA	0.478													ENSG00000147488																																					0													116.0	108.0	111.0					8																	53084453		2203	4300	6503	SO:0001583	missense	0			-	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.968C>T	8.37:g.53084453G>A	ENSP00000276480:p.Thr323Ile		Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.T323I	ENST00000276480.7	37	c.968	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265224	0.80358	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.46063	0.9;0.88	5.72	4.84	0.62591	.	0.097482	0.64402	D	0.000001	T	0.60663	0.2286	M	0.65975	2.015	0.47949	D	0.999551	D	0.69078	0.997	D	0.63033	0.91	T	0.63651	-0.6589	10	0.51188	T	0.08	-9.6033	16.1358	0.81487	0.0:0.0:0.8653:0.1347	.	323	O60284	ST18_HUMAN	I	323	ENSP00000276480:T323I;ENSP00000428521:T323I	ENSP00000276480:T323I	T	-	2	0	ST18	53247006	1.000000	0.71417	0.977000	0.42913	0.966000	0.64601	6.194000	0.72082	1.397000	0.46682	0.655000	0.94253	ACC	-	ST18	-	NULL		0.478	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	0	0	0	95	95	112	0.00	0.00	G			53084453	-1	5	10	47	85	tier1	no_errors	ENST00000276480	ensembl	human	known	74_37	missense	9.62	10.53	SNP	1.000	A	5	47
NLRP12	91662	genome.wustl.edu	37	19	54313886	54313886	+	Missense_Mutation	SNP	G	G	A	rs112159191	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr19:54313886G>A	ENST00000324134.6	-	3	1195	c.1027C>T	c.(1027-1029)Cgg>Tgg	p.R343W	NLRP12_ENST00000391773.1_Missense_Mutation_p.R343W|NLRP12_ENST00000354278.3_Missense_Mutation_p.R343W|NLRP12_ENST00000391775.3_Missense_Mutation_p.R343W|NLRP12_ENST00000535162.1_Missense_Mutation_p.R343W|NLRP12_ENST00000345770.5_Missense_Mutation_p.R343W|NLRP12_ENST00000351894.4_Missense_Mutation_p.R343W|NLRP12_ENST00000391772.1_Missense_Mutation_p.R343W	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	343	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GCCGTGGGCCGTGTGGTGATG	0.557													ENSG00000142405																																					0													79.0	84.0	82.0					19																	54313886		2203	4300	6503	SO:0001583	missense	0			-	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.1027C>T	19.37:g.54313886G>A	ENSP00000319377:p.Arg343Trp		A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.R343W	ENST00000324134.6	37	c.1027	CCDS12864.1	19	.	.	.	.	.	.	.	.	.	.	G	13.35	2.212315	0.39102	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2;-2.2;-2.2	4.64	-2.5	0.06384	NACHT nucleoside triphosphatase (1);	0.000000	0.39759	N	0.001272	D	0.92616	0.7654	M	0.91818	3.245	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.90544	0.4504	10	0.87932	D	0	.	8.4404	0.32812	0.0794:0.0:0.3846:0.5361	.	343;343;343;343	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	W	343	ENSP00000319377:R343W;ENSP00000438030:R343W;ENSP00000340473:R343W;ENSP00000346231:R343W;ENSP00000375655:R343W;ENSP00000375653:R343W;ENSP00000375652:R343W	ENSP00000319377:R343W	R	-	1	2	NLRP12	59005698	0.000000	0.05858	0.646000	0.29493	0.315000	0.28087	-0.717000	0.04986	-0.148000	0.11234	-0.467000	0.05162	CGG	rs112159191	NLRP12	-	superfamily_P-loop_NTPase,pfscan_CHT_NTPase		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NLRP12	HGNC	protein_coding	OTTHUMT00000134340.1	0	0	0	46	46	82	0.00	0.00	G	NM_144687		54313886	-1	7	14	19	85	tier1	no_errors	ENST00000324134	ensembl	human	known	74_37	missense	26.92	14.14	SNP	0.375	A	7	19
LONRF2	164832	genome.wustl.edu	37	2	100915748	100915748	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:100915748G>A	ENST00000393437.3	-	6	1940	c.1301C>T	c.(1300-1302)aCa>aTa	p.T434I	LONRF2_ENST00000409647.1_Missense_Mutation_p.T191I	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	434							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ACTTTCTTCTGTCTCAGAGTT	0.433													ENSG00000170500																																					0													82.0	83.0	82.0					2																	100915748		2203	4300	6503	SO:0001583	missense	0			-	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1301C>T	2.37:g.100915748G>A	ENSP00000377086:p.Thr434Ile		B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.T434I	ENST00000393437.3	37	c.1301	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	G	5.896	0.349399	0.11182	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.86030	-1.9;-2.06	3.96	-7.93	0.01156	Zinc finger, RING/FYVE/PHD-type (1);	3.484580	0.00520	N	0.000191	T	0.71367	0.3331	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.61700	-0.7009	10	0.18710	T	0.47	14.1699	7.1238	0.25461	0.1823:0.1025:0.5782:0.1371	.	434	Q1L5Z9	LONF2_HUMAN	I	434;191	ENSP00000377086:T434I;ENSP00000386823:T191I	ENSP00000377086:T434I	T	-	2	0	LONRF2	100282180	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.517000	0.06275	-2.638000	0.00430	-1.090000	0.02178	ACA	-	LONRF2	-	NULL		0.433	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	0	0	0	71	71	99	0.00	0.00	G	NM_198461		100915748	-1	14	16	63	62	tier1	no_errors	ENST00000393437	ensembl	human	known	74_37	missense	17.95	20.51	SNP	0.000	A	14	63
ATIC	471	genome.wustl.edu	37	2	216197214	216197214	+	Silent	SNP	A	A	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:216197214A>G	ENST00000236959.9	+	8	1124	c.798A>G	c.(796-798)aaA>aaG	p.K266K	ATIC_ENST00000540518.1_Silent_p.K207K|ATIC_ENST00000435675.1_Silent_p.K265K	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	266		Transition state stabilizer. {ECO:0000255}.			'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	CCTCTTTCAAACATGTCAGCC	0.438			T	ALK	ALCL								ENSG00000138363																												Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	0													41.0	45.0	44.0					2																	216197214		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.798A>G	2.37:g.216197214A>G			A8K202|E9PBU3|Q13856|Q53S28	Silent	SNP	pfam_AICARFT_IMPCHas,pfam_MGS-like_dom,superfamily_Cytidine_deaminase-like,superfamily_MGS-like_dom,smart_MGS-like_dom,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas	p.K266	ENST00000236959.9	37	c.798	CCDS2398.1	2																																																																																			-	ATIC	-	pfam_AICARFT_IMPCHas,superfamily_Cytidine_deaminase-like,smart_AICARFT_IMPCHas,pirsf_AICARFT_IMPCHas,tigrfam_AICARFT_IMPCHas		0.438	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATIC	HGNC	protein_coding	OTTHUMT00000256610.1	0	0	0	56	56	123	0.00	0.00	A	NM_004044		216197214	+1	7	27	60	102	tier1	no_errors	ENST00000236959	ensembl	human	known	74_37	silent	10.45	20.93	SNP	0.985	G	7	60
CXXC1	30827	genome.wustl.edu	37	18	47810148	47810148	+	Missense_Mutation	SNP	A	A	T	rs138609805		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr18:47810148A>T	ENST00000285106.6	-	11	2165	c.1451T>A	c.(1450-1452)aTc>aAc	p.I484N	MBD1_ENST00000398493.1_5'Flank|MBD1_ENST00000424334.2_5'Flank|MBD1_ENST00000585595.1_5'Flank|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000353909.3_5'Flank|MBD1_ENST00000269471.5_5'Flank|CXXC1_ENST00000412036.2_Missense_Mutation_p.I488N|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000436910.1_5'Flank|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000457839.2_5'Flank|MBD1_ENST00000590208.1_5'Flank|CXXC1_ENST00000589940.1_Missense_Mutation_p.I484N|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000585672.1_5'Flank|MBD1_ENST00000339998.6_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	484					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						AACACAGAAGATCTGCAGGTC	0.577													ENSG00000154832																																					0													145.0	123.0	130.0					18																	47810148		2203	4300	6503	SO:0001583	missense	0			-	BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1451T>A	18.37:g.47810148A>T	ENSP00000285106:p.Ile484Asn		B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Missense_Mutation	SNP	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.I488N	ENST00000285106.6	37	c.1463	CCDS11945.1	18	.	.	.	.	.	.	.	.	.	.	A	21.0	4.085296	0.76642	.	.	ENSG00000154832	ENST00000285106;ENST00000412036	T;T	0.27256	1.68;1.68	4.65	4.65	0.58169	CpG binding protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.45617	0.1351	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.76071	0.977;0.987;0.985	T	0.44832	-0.9302	10	0.87932	D	0	-12.8846	12.3149	0.54951	1.0:0.0:0.0:0.0	.	488;484;351	Q9P0U4-2;Q9P0U4;Q59EC8	.;CXXC1_HUMAN;.	N	484;488	ENSP00000285106:I484N;ENSP00000390475:I488N	ENSP00000285106:I484N	I	-	2	0	CXXC1	46064146	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.508000	0.90525	1.856000	0.53863	0.383000	0.25322	ATC	-	CXXC1	-	pfam_CpG-bd_C		0.577	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	0	0	0	60	60	116	0.00	0.00	A	NM_014593		47810148	-1	6	13	34	88	tier1	no_errors	ENST00000412036	ensembl	human	known	74_37	missense	15.00	12.75	SNP	1.000	T	6	34
SIN3A	25942	genome.wustl.edu	37	15	75684814	75684814	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:75684814G>C	ENST00000394947.3	-	15	2934	c.2620C>G	c.(2620-2622)Caa>Gaa	p.Q874E	SIN3A_ENST00000394949.4_Missense_Mutation_p.Q874E|SIN3A_ENST00000360439.4_Missense_Mutation_p.Q874E	NM_001145358.1	NP_001138830.1			SIN3 transcription regulator family member A											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	63						CTTAATTTTTGAGCTGCTGTG	0.443													ENSG00000169375																																					0													146.0	145.0	146.0					15																	75684814		2197	4294	6491	SO:0001583	missense	0			-	AK027559	CCDS10279.1	15q22.33	2013-08-21	2013-08-21		ENSG00000169375	ENSG00000169375			19353	protein-coding gene	gene with protein product		607776	"""SIN3 homolog A, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog A (yeast)"""			10773092, 7601471	Standard	NM_001145357		Approved	KIAA0700, DKFZP434K2235	uc002bai.3	Q96ST3	OTTHUMG00000142834	ENST00000394947.3:c.2620C>G	15.37:g.75684814G>C	ENSP00000378402:p.Gln874Glu			Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.Q874E	ENST00000394947.3	37	c.2620	CCDS10279.1	15	.	.	.	.	.	.	.	.	.	.	G	8.662	0.900738	0.17686	.	.	ENSG00000169375	ENST00000394947;ENST00000394949;ENST00000360439	T;T;T	0.39592	1.07;1.07;1.07	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.39306	0.1073	L	0.60455	1.87	0.80722	D	1	B	0.13594	0.008	B	0.15870	0.014	T	0.40496	-0.9560	10	0.02654	T	1	-19.4734	19.0195	0.92908	0.0:0.0:1.0:0.0	.	874	Q96ST3	SIN3A_HUMAN	E	874	ENSP00000378402:Q874E;ENSP00000378403:Q874E;ENSP00000353622:Q874E	ENSP00000353622:Q874E	Q	-	1	0	SIN3A	73471867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.829000	0.99411	2.746000	0.94184	0.655000	0.94253	CAA	-	SIN3A	-	NULL		0.443	SIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIN3A	HGNC	protein_coding	OTTHUMT00000286469.1	0	0	1	56	56	105	0.00	0.94	G	NM_015477		75684814	-1	21	19	57	95	tier1	no_errors	ENST00000360439	ensembl	human	known	74_37	missense	26.92	16.67	SNP	1.000	C	21	57
ARL6	84100	genome.wustl.edu	37	3	97487021	97487021	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:97487021G>A	ENST00000463745.1	+	2	547	c.70G>A	c.(70-72)Ggg>Agg	p.G24R	ARL6_ENST00000496713.1_3'UTR|ARL6_ENST00000335979.2_Missense_Mutation_p.G24R|ARL6_ENST00000394206.1_Missense_Mutation_p.G24R	NM_001278293.1	NP_001265222.1	Q9H0F7	ARL6_HUMAN	ADP-ribosylation factor-like 6	24					cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|melanosome transport (GO:0032402)|protein polymerization (GO:0051258)|protein targeting to membrane (GO:0006612)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	axonemal microtubule (GO:0005879)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane coat (GO:0030117)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phospholipid binding (GO:0005543)			large_intestine(1)|lung(4)	5		Lung NSC(201;0.0193)|Prostate(884;0.174)		LUSC - Lung squamous cell carcinoma(29;0.0118)|Lung(72;0.0189)		TTTGTGCCTTGGGCTAGATAA	0.363													ENSG00000113966																																					0													127.0	123.0	124.0					3																	97487021		2203	4300	6503	SO:0001583	missense	0			-	BC024239	CCDS2928.1	3q11.2	2014-05-09			ENSG00000113966	ENSG00000113966		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	13210	protein-coding gene	gene with protein product		608845		BBS3		15258860, 15314642, 21282186	Standard	NM_032146		Approved	RP55	uc003drv.3	Q9H0F7	OTTHUMG00000159189	ENST00000463745.1:c.70G>A	3.37:g.97487021G>A	ENSP00000419619:p.Gly24Arg		A8KA93|D3DN31	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gprotein_alpha_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom	p.G24R	ENST00000463745.1	37	c.70	CCDS2928.1	3	.	.	.	.	.	.	.	.	.	.	G	26.0	4.691272	0.88735	.	.	ENSG00000113966	ENST00000463745;ENST00000462412;ENST00000335979;ENST00000394206	D;D;D;D	0.99292	-5.7;-5.7;-5.7;-5.7	5.76	4.87	0.63330	Small GTP-binding protein domain (1);	0.046877	0.85682	N	0.000000	D	0.99739	0.9897	H	0.99582	4.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96729	0.9538	10	0.87932	D	0	.	16.6081	0.84836	0.0:0.1302:0.8698:0.0	.	24	Q9H0F7	ARL6_HUMAN	R	24	ENSP00000419619:G24R;ENSP00000418740:G24R;ENSP00000337722:G24R;ENSP00000377756:G24R	ENSP00000337722:G24R	G	+	1	0	ARL6	98969711	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	9.229000	0.95273	1.391000	0.46566	0.655000	0.94253	GGG	-	ARL6	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.363	ARL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL6	HGNC	protein_coding	OTTHUMT00000353756.1	0	0	0	89	89	184	0.00	0.00	G	NM_032146		97487021	+1	7	16	51	134	tier1	no_errors	ENST00000335979	ensembl	human	known	74_37	missense	12.07	10.67	SNP	1.000	A	7	51
TFEC	22797	genome.wustl.edu	37	7	115750938	115750938	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr7:115750938G>A	ENST00000484212.1	-	3	196	c.22C>T	c.(22-24)Ctt>Ttt	p.L8F	TFEC_ENST00000474337.1_5'UTR			O14948	TFEC_HUMAN	transcription factor EC	0	Necessary for transcriptional transactivation.				cellular response to heat (GO:0034605)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|kidney(1)|large_intestine(5)|lung(13)|prostate(2)|skin(1)|urinary_tract(2)	25			STAD - Stomach adenocarcinoma(10;0.00878)			TGAAATTGAAGTCCAGTTAAA	0.343													ENSG00000105967																																					0																																										SO:0001583	missense	0			-	D43945	CCDS5762.1, CCDS34738.1, CCDS59076.1	7q31.2	2013-05-21			ENSG00000105967	ENSG00000105967		"""Basic helix-loop-helix proteins"""	11754	protein-coding gene	gene with protein product		604732				9256061	Standard	NM_012252		Approved	TCFEC, TFECL, bHLHe34	uc003vhj.2	O14948	OTTHUMG00000023518	ENST00000484212.1:c.22C>T	7.37:g.115750938G>A	ENSP00000417432:p.Leu8Phe		B2R8X5|Q5H9U8|Q709A4|Q8N6J9	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.L8F	ENST00000484212.1	37	c.22		7	.	.	.	.	.	.	.	.	.	.	g	17.40	3.381050	0.61845	.	.	ENSG00000105967	ENST00000484212	T	0.23754	1.89	5.48	2.7	0.31948	.	.	.	.	.	T	0.19927	0.0479	.	.	.	0.24031	N	0.996119	B	0.17852	0.024	B	0.17979	0.02	T	0.24225	-1.0166	8	0.87932	D	0	.	6.7359	0.23409	0.1584:0.1541:0.6875:0.0	.	8	B7Z757	.	F	8	ENSP00000417432:L8F	ENSP00000390171:L8F	L	-	1	0	TFEC	115538174	0.930000	0.31532	0.411000	0.26484	0.975000	0.68041	1.769000	0.38522	0.289000	0.22422	0.650000	0.86243	CTT	-	TFEC	-	NULL		0.343	TFEC-008	NOVEL	basic	protein_coding	TFEC	HGNC	protein_coding	OTTHUMT00000351050.2	0	0	0	50	50	112	0.00	0.00	G	NM_012252		115750938	-1	6	9	59	75	tier1	no_errors	ENST00000484212	ensembl	human	novel	74_37	missense	9.23	10.71	SNP	0.373	A	6	59
RYR3	6263	genome.wustl.edu	37	15	33954925	33954925	+	Silent	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:33954925C>T	ENST00000389232.4	+	35	5264	c.5194C>T	c.(5194-5196)Ctg>Ttg	p.L1732L	RYR3_ENST00000415757.3_Silent_p.L1732L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1732	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CATTGGAACCCTGCTGGTCAT	0.577													ENSG00000198838																																					0													101.0	109.0	107.0					15																	33954925		2145	4267	6412	SO:0001819	synonymous_variant	0			-		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5194C>T	15.37:g.33954925C>T			O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L1732	ENST00000389232.4	37	c.5194	CCDS45210.1	15																																																																																			-	RYR3	-	NULL		0.577	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	0	0	0	98	98	119	0.00	0.00	C			33954925	+1	21	23	52	92	tier1	no_errors	ENST00000389232	ensembl	human	known	74_37	silent	28.77	20.00	SNP	0.543	T	21	52
QKI	9444	genome.wustl.edu	37	6	163984490	163984490	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr6:163984490G>C	ENST00000361752.3	+	6	1224	c.673G>C	c.(673-675)Gct>Cct	p.A225P	QKI_ENST00000392127.2_Missense_Mutation_p.A225P|QKI_ENST00000361195.2_Missense_Mutation_p.A217P|QKI_ENST00000453779.2_Missense_Mutation_p.A225P|QKI_ENST00000424802.3_Missense_Mutation_p.A217P|QKI_ENST00000275262.7_Missense_Mutation_p.A225P	NM_006775.2|NM_206853.2|NM_206854.2|NM_206855.2	NP_006766.1|NP_996735.1|NP_996736.1|NP_996737.1	Q96PU8	QKI_HUMAN	QKI, KH domain containing, RNA binding	225					long-chain fatty acid biosynthetic process (GO:0042759)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|muscle cell differentiation (GO:0042692)|myelination (GO:0042552)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|spermatid development (GO:0007286)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(5)|ovary(1)|prostate(3)|urinary_tract(2)	27		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		AGCCCAGGCTGCTCCAAGGAT	0.488													ENSG00000112531																																					0													42.0	42.0	42.0					6																	163984490		2203	4300	6503	SO:0001583	missense	0			-	AB067798	CCDS5285.1, CCDS5286.1, CCDS5287.1, CCDS43525.1, CCDS75546.1	6q26	2011-09-12	2011-09-12		ENSG00000112531	ENSG00000112531			21100	protein-coding gene	gene with protein product		609590	"""quaking homolog, KH domain RNA binding (mouse)"""			10535969	Standard	NM_006775		Approved	QK3	uc003qui.3	Q96PU8	OTTHUMG00000015977	ENST00000361752.3:c.673G>C	6.37:g.163984490G>C	ENSP00000355094:p.Ala225Pro		Q2I375|Q5MJQ1|Q969L9|Q96EJ3|Q96KA3|Q96PU6|Q96PU7|Q9P0X6|Q9P0X7|Q9P0X8|Q9P0X9|Q9P0Y0|Q9P0Y1	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.A225P	ENST00000361752.3	37	c.673	CCDS5285.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.22|15.22	2.768390|2.768390	0.49680|0.49680	.|.	.|.	ENSG00000112531|ENSG00000112531	ENST00000453779;ENST00000275262;ENST00000392127;ENST00000361752;ENST00000361195;ENST00000424802;ENST00000544823|ENST00000537883;ENST00000544361	T;T|.	0.18338|.	2.22;2.22|.	4.63|4.63	4.63|4.63	0.57726|0.57726	.|.	0.225115|.	0.37669|.	N|.	0.001996|.	T|T	0.38692|0.38692	0.1050|0.1050	N|N	0.22421|0.22421	0.69|0.69	0.58432|0.58432	D|D	0.999998|0.999998	D;D;P;D;D;D|.	0.76494|.	0.979;0.984;0.919;0.999;0.986;0.986|.	P;P;P;D;P;P|.	0.80764|.	0.736;0.548;0.616;0.994;0.656;0.656|.	T|T	0.13872|0.13872	-1.0493|-1.0493	10|5	0.37606|.	T|.	0.19|.	-2.0224|-2.0224	13.3096|13.3096	0.60371|0.60371	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	217;225;217;225;225;225|.	Q96PU8-3;Q96PU8;Q96PU8-5;Q96PU8-9;Q96PU8-6;Q96PU8-8|.	.;QKI_HUMAN;.;.;.;.|.	P|S	225;225;225;225;217;217;170|121;58	ENSP00000354867:A217P;ENSP00000408382:A217P|.	ENSP00000275262:A225P|.	A|C	+|+	1|2	0|0	QKI|QKI	163904480|163904480	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.476000|9.476000	0.97823|0.97823	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GCT|TGC	-	QKI	-	NULL		0.488	QKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QKI	HGNC	protein_coding	OTTHUMT00000043016.2	0	0	0	29	29	45	0.00	0.00	G	NM_006775		163984490	+1	10	11	34	24	tier1	no_errors	ENST00000361752	ensembl	human	known	74_37	missense	22.73	31.43	SNP	1.000	C	10	34
CERS2	29956	genome.wustl.edu	37	1	150940932	150940932	+	Missense_Mutation	SNP	C	C	T	rs587616340	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr1:150940932C>T	ENST00000271688.6	-	3	616	c.230G>A	c.(229-231)cGg>cAg	p.R77Q	CERS2_ENST00000561294.1_Missense_Mutation_p.R77Q|CERS2_ENST00000345896.4_5'UTR|RP11-316M1.12_ENST00000561111.1_RNA|RP11-316M1.12_ENST00000560481.1_RNA|CERS2_ENST00000368954.5_Missense_Mutation_p.R77Q	NM_181746.3	NP_859530.1	Q96G23	CERS2_HUMAN	ceramide synthase 2	77					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear membrane (GO:0031965)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										GGGAGGTGCCCGCAGCCGAGT	0.557													ENSG00000143418	C|||	2	0.000399361	0.0	0.0	5008	,	,		17379	0.0		0.0	False		,,,				2504	0.002																0													82.0	78.0	79.0					1																	150940932		2203	4300	6503	SO:0001583	missense	0			-	AF189062	CCDS973.1	1q21.3	2012-09-20	2011-07-08	2011-07-08	ENSG00000143418	ENSG00000143418		"""Homeoboxes / CERS class"""	14076	protein-coding gene	gene with protein product		606920	"""longevity assurance (LAG1, S. cerevisiae) homolog 2"", ""LAG1 longevity assurance homolog 2 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 2"""	LASS2		11543633	Standard	NM_181746		Approved	SP260, FLJ10243	uc001evz.3	Q96G23	OTTHUMG00000035064	ENST00000271688.6:c.230G>A	1.37:g.150940932C>T	ENSP00000271688:p.Arg77Gln		D3DV06|Q5SZE5|Q9HD96|Q9NW79	Missense_Mutation	SNP	pfam_TLC-dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_TLC-dom,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_TLC-dom,pfscan_Homeobox_dom	p.R77Q	ENST00000271688.6	37	c.230	CCDS973.1	1	.	.	.	.	.	.	.	.	.	.	C	13.44	2.237511	0.39498	.	.	ENSG00000143418	ENST00000368954;ENST00000271688;ENST00000368949;ENST00000361419;ENST00000421609;ENST00000457392	T;T;T;T;T;T	0.29397	1.57;1.57;1.57;1.57;1.57;1.57	5.08	5.08	0.68730	Homeobox (2);Homeodomain-like (1);	0.134129	0.49305	D	0.000157	T	0.12774	0.0310	L	0.41710	1.295	0.54753	D	0.999985	B	0.20368	0.044	B	0.20184	0.028	T	0.04347	-1.0958	10	0.31617	T	0.26	-21.7859	9.9949	0.41893	0.0:0.8747:0.0:0.1253	.	77	Q96G23	CERS2_HUMAN	Q	77;77;97;77;77;77	ENSP00000357950:R77Q;ENSP00000271688:R77Q;ENSP00000357945:R97Q;ENSP00000355020:R77Q;ENSP00000393239:R77Q;ENSP00000394012:R77Q	ENSP00000271688:R77Q	R	-	2	0	CERS2	149207556	0.989000	0.36119	1.000000	0.80357	0.924000	0.55760	1.429000	0.34903	2.646000	0.89796	0.655000	0.94253	CGG	-	CERS2	-	superfamily_Homeodomain-like,pirsf_Longevity_assurance_LAG1_LAC1,pfscan_Homeobox_dom		0.557	CERS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CERS2	HGNC	protein_coding	OTTHUMT00000084897.2	0	0	0	133	133	140	0.00	0.00	C	NM_022075		150940932	-1	15	15	94	112	tier1	no_errors	ENST00000271688	ensembl	human	known	74_37	missense	13.76	11.72	SNP	1.000	T	15	94
WWC2	80014	genome.wustl.edu	37	4	184202086	184202086	+	Intron	SNP	A	A	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr4:184202086A>G	ENST00000403733.3	+	17	2883				WWC2_ENST00000504005.1_Intron|WWC2_ENST00000513834.1_Intron|WWC2_ENST00000508747.1_5'Flank|WWC2_ENST00000448232.2_Missense_Mutation_p.K907R	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		TGGGAGCTCAAAGATGATGTG	0.443													ENSG00000151718																																					0													33.0	24.0	27.0					4																	184202086		2161	4212	6373	SO:0001627	intron_variant	0			-	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.2684+36A>G	4.37:g.184202086A>G			Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Missense_Mutation	SNP	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.K907R	ENST00000403733.3	37	c.2720	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300048	0.23650	.	.	ENSG00000151718	ENST00000448232	T	0.06068	3.35	3.54	-2.09	0.07232	.	.	.	.	.	T	0.03178	0.0093	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46898	-0.9158	7	.	.	.	.	4.4031	0.11397	0.4911:0.3019:0.207:0.0	.	907	Q6AWC2-6	.	R	907	ENSP00000398577:K907R	.	K	+	2	0	WWC2	184439080	0.000000	0.05858	0.000000	0.03702	0.169000	0.22640	-0.272000	0.08560	-0.208000	0.10171	0.455000	0.32223	AAA	-	WWC2	-	NULL		0.443	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2	HGNC	protein_coding	OTTHUMT00000319608.1	0	0	1	42	42	181	0.00	0.55	A	NM_024949		184202086	+1	16	21	34	124	tier1	no_errors	ENST00000448232	ensembl	human	known	74_37	missense	32.00	14.48	SNP	0.000	G	16	34
ZNF133	7692	genome.wustl.edu	37	20	18296306	18296306	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr20:18296306G>A	ENST00000316358.4	+	4	908	c.811G>A	c.(811-813)Gtg>Atg	p.V271M	ZNF133_ENST00000535822.1_Missense_Mutation_p.V176M|ZNF133_ENST00000401790.1_Missense_Mutation_p.V271M|RP4-568F9.3_ENST00000436848.1_RNA|ZNF133_ENST00000396026.3_Missense_Mutation_p.V274M|ZNF133_ENST00000462170.1_3'UTR|ZNF133_ENST00000402618.2_Missense_Mutation_p.V208M|ZNF133_ENST00000377671.3_Missense_Mutation_p.V270M|ZNF133_ENST00000538547.1_Missense_Mutation_p.V176M	NM_001282998.1|NM_001282999.1|NM_001283000.1|NM_001283001.1|NM_001283008.1	NP_001269927.1|NP_001269928.1|NP_001269929.1|NP_001269930.1|NP_001269937.1	P52736	ZN133_HUMAN	zinc finger protein 133	271					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26						GAAGCCAATTGTGTGCAGGGA	0.547													ENSG00000125846																																					0													74.0	63.0	67.0					20																	18296306		2203	4300	6503	SO:0001583	missense	0			-	AK123005	CCDS13134.1, CCDS63234.1, CCDS63235.1, CCDS74703.1, CCDS74704.1	20p11.23	2013-01-08	2006-06-13		ENSG00000125846	ENSG00000125846		"""Zinc fingers, C2H2-type"", ""-"""	12917	protein-coding gene	gene with protein product		604075	"""zinc finger protein 150 (pHZ-66)"", ""zinc finger protein 133 (clone pHZ-13)"""	ZNF150		7557990, 7649249	Standard	XM_005260819		Approved	pHZ-13, pHZ-66	uc010gcs.3	P52736	OTTHUMG00000031965	ENST00000316358.4:c.811G>A	20.37:g.18296306G>A	ENSP00000346090:p.Val271Met		A8K5S4|B4DHU7|B4DIB8|B7ZAS1|F5H289|J3KQ11|J3KQJ0|Q53XU1|Q5JXV8|Q9BUV2|Q9H443	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V274M	ENST00000316358.4	37	c.820		20	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588688	0.46110	.	.	ENSG00000125846	ENST00000377671;ENST00000396026;ENST00000402618;ENST00000401790;ENST00000538547;ENST00000535822;ENST00000316358	T;T;T;T;T;T;T	0.34472	2.2;2.2;1.36;2.2;1.36;1.36;2.2	4.27	4.27	0.50696	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41605	D	0.000842	T	0.39733	0.1089	N	0.16266	0.395	0.24271	N	0.995244	D;P;D;D	0.71674	0.998;0.941;0.975;0.995	D;P;P;D	0.75020	0.985;0.854;0.823;0.964	T	0.12811	-1.0533	10	0.48119	T	0.1	-19.9332	10.5004	0.44802	0.0:0.1966:0.8034:0.0	.	208;274;271;270	B4DIB8;B4DHU7;P52736;P52736-2	.;.;ZN133_HUMAN;.	M	270;274;208;271;176;176;271	ENSP00000366899:V270M;ENSP00000400897:V274M;ENSP00000385279:V208M;ENSP00000383945:V271M;ENSP00000442978:V176M;ENSP00000439427:V176M;ENSP00000346090:V271M	ENSP00000346090:V271M	V	+	1	0	ZNF133	18244306	0.000000	0.05858	0.977000	0.42913	0.895000	0.52256	-0.601000	0.05687	2.667000	0.90743	0.561000	0.74099	GTG	-	ZNF133	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.547	ZNF133-002	KNOWN	basic|appris_candidate	protein_coding	ZNF133	HGNC	protein_coding	OTTHUMT00000127616.1	0	0	0	58	58	125	0.00	0.00	G	NM_003434		18296306	+1	17	19	50	71	tier1	no_errors	ENST00000396026	ensembl	human	known	74_37	missense	25.37	20.88	SNP	0.891	A	17	50
FBXO41	150726	genome.wustl.edu	37	2	73486154	73486154	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:73486154C>T	ENST00000521871.1	-	13	2999	c.2584G>A	c.(2584-2586)Ggc>Agc	p.G862S	FBXO41_ENST00000520530.2_Missense_Mutation_p.G862S|FBXO41_ENST00000295133.5_Missense_Mutation_p.G923S			Q8TF61	FBX41_HUMAN	F-box protein 41	862										breast(2)|central_nervous_system(1)|endometrium(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)	13						TTAGAGAAGCCGGGCCTCCGT	0.672													ENSG00000163013																																					0													23.0	28.0	26.0					2																	73486154		1912	4091	6003	SO:0001583	missense	0			-	AB075820	CCDS46337.1, CCDS46337.2	2p13.2	2004-08-24				ENSG00000163013		"""F-boxes /  ""other"""""	29409	protein-coding gene	gene with protein product		609108				11853319	Standard	NM_001080410		Approved	KIAA1940, Fbx41	uc021vjh.1	Q8TF61		ENST00000521871.1:c.2584G>A	2.37:g.73486154C>T	ENSP00000428646:p.Gly862Ser		G3V0Z7|Q2M1V8	Missense_Mutation	SNP	superfamily_F-box_dom	p.G923S	ENST00000521871.1	37	c.2767	CCDS46337.2	2	.	.	.	.	.	.	.	.	.	.	C	31	5.103791	0.94245	.	.	ENSG00000163013	ENST00000295133;ENST00000521871	.	.	.	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.64450	0.2599	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56456	-0.7976	9	0.17832	T	0.49	-9.3665	17.386	0.87416	0.0:1.0:0.0:0.0	.	862	Q8TF61	FBX41_HUMAN	S	923;862	.	ENSP00000295133:G923S	G	-	1	0	FBXO41	73339662	0.996000	0.38824	1.000000	0.80357	0.860000	0.49131	3.398000	0.52579	2.774000	0.95407	0.561000	0.74099	GGC	-	FBXO41	-	NULL		0.672	FBXO41-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FBXO41	HGNC	protein_coding	OTTHUMT00000377381.1	0	0	0	92	92	63	0.00	0.00	C			73486154	-1	7	6	57	37	tier1	no_errors	ENST00000295133	ensembl	human	known	74_37	missense	10.94	13.95	SNP	1.000	T	7	57
SLC5A10	125206	genome.wustl.edu	37	17	18857121	18857121	+	Intron	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:18857121G>C	ENST00000395645.3	+	1	129				SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000417251.2_Intron|AC090286.4_ENST00000354432.3_RNA|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10						sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						tcagattttagagttttgggt	0.383													ENSG00000196893																																					0																																										SO:0001627	intron_variant	0			-		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.111+1492G>C	17.37:g.18857121G>C			A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	R	SNP	-	NULL	ENST00000395645.3	37	NULL	CCDS42275.1	17																																																																																			-	AC090286.4	-	-		0.383	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928787	Clone_based_vega_gene	protein_coding	OTTHUMT00000132129.2	0	0	0	78	78	141	0.00	0.00	G	NM_152351		18857121	-1	11	32	52	111	tier1	no_errors	ENST00000354432	ensembl	human	known	74_37	rna	17.46	22.38	SNP	0.003	C	11	52
NF1	4763	genome.wustl.edu	37	17	29541587	29541588	+	Frame_Shift_Ins	INS	-	-	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:29541587_29541588insA	ENST00000358273.4	+	13	1894_1895	c.1511_1512insA	c.(1510-1515)ccaaagfs	p.PK504fs	NF1_ENST00000356175.3_Frame_Shift_Ins_p.PK504fs|NF1_ENST00000431387.4_Frame_Shift_Ins_p.PK504fs	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	504					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CATGCAGATCCAAAGCTCTTGC	0.337			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			ENSG00000196712																											yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)																																								SO:0001589	frameshift_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome			CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1514dupA	17.37:g.29541590_29541590dupA	ENSP00000351015:p.Pro504fs		O00662|Q14284|Q14930|Q14931|Q9UMK3	Frame_Shift_Ins	INS	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.L506fs	ENST00000358273.4	37	c.1511_1512	CCDS42292.1	17																																																																																				NF1	-	superfamily_ARM-type_fold		0.337	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	0	0	0	156	156	29	0.00	0.00	-	NM_000267		29541588	+1	40	10	175	16	tier1	no_errors	ENST00000358273	ensembl	human	known	74_37	frame_shift_ins	18.60	38.46	INS	1.000:0.999	A	40	175
MTRNR2L6	100463482	genome.wustl.edu	37	7	142375121	142375121	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr7:142375121T>C	ENST00000604952.1	+	1	1018	c.59T>C	c.(58-60)gTg>gCg	p.V20A		NM_001190487.1	NP_001177416.1			MT-RNR2-like 6																		GACCTGCCTGTGAAGAGGCGA	0.413													ENSG00000270672																																					0																																										SO:0001583	missense	0			-		CCDS64784.1	7q34	2014-02-18				ENSG00000270672			37163	protein-coding gene	gene with protein product	"""humanin-like 6"""					19477263	Standard	NM_001190487		Approved		uc003vzz.2	P0CJ73	OTTHUMG00000184977	ENST00000604952.1:c.59T>C	7.37:g.142375121T>C	ENSP00000473686:p.Val20Ala			Missense_Mutation	SNP	NULL	p.V20A	ENST00000604952.1	37	c.59		7																																																																																			-	MTRNR2L6	-	NULL		0.413	MTRNR2L6-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	MTRNR2L6	HGNC	protein_coding	OTTHUMT00000469394.1	0	0	0	61	61	12	0.00	0.00	T	NM_001190487		142375121	+1	16	5	53	6	tier1	no_errors	ENST00000604952	ensembl	human	known	74_37	missense	23.19	45.45	SNP	1.000	C	16	53
FAM208B	54906	genome.wustl.edu	37	10	5788196	5788196	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr10:5788196T>C	ENST00000328090.5	+	15	3437	c.2812T>C	c.(2812-2814)Tcg>Ccg	p.S938P	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	938																	TCTTGTGCTTTCGGGTATTGG	0.383													ENSG00000108021																																					0													129.0	130.0	130.0					10																	5788196		1853	4102	5955	SO:0001583	missense	0			-	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2812T>C	10.37:g.5788196T>C	ENSP00000328426:p.Ser938Pro		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.S938P	ENST00000328090.5	37	c.2812	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	T	9.777	1.174323	0.21704	.	.	ENSG00000108021	ENST00000328090	D	0.98455	-4.94	5.6	4.46	0.54185	.	0.128560	0.36134	N	0.002779	D	0.95959	0.8684	L	0.43701	1.375	0.29636	N	0.845077	B	0.34161	0.439	B	0.37422	0.249	D	0.93239	0.6624	10	0.51188	T	0.08	.	8.3516	0.32305	0.0:0.0892:0.0:0.9108	.	938	Q5VWN6	F208B_HUMAN	P	938	ENSP00000328426:S938P	ENSP00000328426:S938P	S	+	1	0	C10orf18	5828202	0.110000	0.22057	0.478000	0.27316	0.222000	0.24845	0.517000	0.22832	0.934000	0.37316	0.533000	0.62120	TCG	-	FAM208B	-	pfam_DUF3715		0.383	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	0	0	0	174	174	135	0.00	0.00	T	NM_017782		5788196	+1	17	6	101	66	tier1	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	14.29	8.33	SNP	0.962	C	17	101
NCOR1	9611	genome.wustl.edu	37	17	16049780	16049780	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:16049780C>T	ENST00000268712.3	-	10	1249	c.992G>A	c.(991-993)aGg>aAg	p.R331K	NCOR1_ENST00000395851.1_Missense_Mutation_p.R331K|NCOR1_ENST00000395848.1_Missense_Mutation_p.R222K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	331	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TTTAGCTTTCCTCCGAGGATT	0.383													ENSG00000141027																																					0													158.0	147.0	151.0					17																	16049780		2203	4300	6503	SO:0001583	missense	0			-	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.992G>A	17.37:g.16049780C>T	ENSP00000268712:p.Arg331Lys		B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.R331K	ENST00000268712.3	37	c.992	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	17.43	3.387515	0.61956	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	L	0.34521	1.04	0.80722	D	1	P;P;P;B;P;D	0.67145	0.719;0.719;0.719;0.402;0.534;0.996	B;B;B;B;P;D	0.76071	0.348;0.348;0.348;0.235;0.518;0.987	T	0.58434	-0.7637	10	0.46703	T	0.11	-9.6499	18.5255	0.90971	0.0:1.0:0.0:0.0	.	340;331;331;222;331;331	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	K	331;331;222;340;222;331;340	ENSP00000268712:R331K;ENSP00000379192:R331K;ENSP00000379189:R222K;ENSP00000407998:R331K;ENSP00000387727:R340K	ENSP00000268712:R331K	R	-	2	0	NCOR1	15990505	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.696000	0.92011	0.561000	0.74099	AGG	-	NCOR1	-	NULL		0.383	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	0	0	0	86	86	90	0.00	0.00	C	NM_006311		16049780	-1	8	8	51	79	tier1	no_errors	ENST00000268712	ensembl	human	known	74_37	missense	13.56	9.20	SNP	1.000	T	8	51
C2orf71	388939	genome.wustl.edu	37	2	29295870	29295870	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:29295870C>A	ENST00000331664.5	-	1	1257	c.1258G>T	c.(1258-1260)Gca>Tca	p.A420S		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	420					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TGAACCTTTGCCATAGGAGCC	0.582													ENSG00000179270																																					0													85.0	88.0	87.0					2																	29295870		2003	4168	6171	SO:0001583	missense	0			-		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.1258G>T	2.37:g.29295870C>A	ENSP00000332809:p.Ala420Ser			Missense_Mutation	SNP	NULL	p.A420S	ENST00000331664.5	37	c.1258	CCDS42669.1	2	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822160	0.50739	.	.	ENSG00000179270	ENST00000331664	T	0.20463	2.07	4.98	2.13	0.27403	.	0.508000	0.20508	N	0.090941	T	0.19327	0.0464	M	0.62723	1.935	0.09310	N	1	P	0.34462	0.454	B	0.34452	0.183	T	0.14755	-1.0461	10	0.17369	T	0.5	-4.2415	9.4086	0.38477	0.0:0.7612:0.0:0.2388	.	420	A6NGG8	CB071_HUMAN	S	420	ENSP00000332809:A420S	ENSP00000332809:A420S	A	-	1	0	C2orf71	29149374	0.005000	0.15991	0.011000	0.14972	0.640000	0.38277	1.608000	0.36847	0.620000	0.30215	0.561000	0.74099	GCA	-	C2orf71	-	NULL		0.582	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C2orf71	HGNC	protein_coding	OTTHUMT00000324924.3	0	0	0	81	81	102	0.00	0.00	C	NM_001029883		29295870	-1	14	5	44	84	tier1	no_errors	ENST00000331664	ensembl	human	known	74_37	missense	23.73	5.62	SNP	0.004	A	14	44
LCN2	3934	genome.wustl.edu	37	9	130913979	130913979	+	Missense_Mutation	SNP	C	C	T	rs150975968	byFrequency	TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr9:130913979C>T	ENST00000373017.1	+	4	575	c.338C>T	c.(337-339)aCg>aTg	p.T113M	LCN2_ENST00000470902.1_3'UTR|LCN2_ENST00000540948.1_Missense_Mutation_p.T113M|LCN2_ENST00000373013.2_Missense_Mutation_p.T115M|LCN2_ENST00000277480.2_Missense_Mutation_p.T113M|LCN2_ENST00000372998.1_Missense_Mutation_p.T115M			P80188	NGAL_HUMAN	lipocalin 2	113					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|small molecule binding (GO:0036094)|transporter activity (GO:0005215)			central_nervous_system(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	8						GGCGAGTTCACGCTGGGCAAC	0.582													ENSG00000148346	C|||	2	0.000399361	0.0	0.0029	5008	,	,		20739	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR	1,4405	2.1+/-5.4	0,1,2202	58.0	51.0	54.0		338	-8.9	0.0	9	dbSNP_134	54	0,8600		0,0,4300	yes	missense	LCN2	NM_005564.3	81	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	113/199	130913979	1,13005	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005		CCDS6892.1	9q34	2011-10-24	2007-12-18		ENSG00000148346	ENSG00000148346		"""Lipocalins"""	6526	protein-coding gene	gene with protein product	"""oncogene 24p3"", ""neutrophil gelatinase-associated lipocalin"", ""siderocalin"""	600181	"""lipocalin 2 (oncogene 24p3)"""			7683678	Standard	NM_005564		Approved	NGAL, 24p3	uc004bto.1	P80188	OTTHUMG00000020734	ENST00000373017.1:c.338C>T	9.37:g.130913979C>T	ENSP00000362108:p.Thr113Met		A6NII8|B4DWV4|B7ZAA2|P30150|Q5SYV9|Q5SYW0|Q6FGL5|Q92683	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase,prints_PstgldnD_synth,prints_Lipocalin,prints_A1-microglobln	p.T115M	ENST00000373017.1	37	c.344	CCDS6892.1	9	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	6.048	0.377173	0.11466	2.27E-4	0.0	ENSG00000148346	ENST00000373017;ENST00000277480;ENST00000373013;ENST00000540948;ENST00000372998	T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02	4.48	-8.95	0.00765	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.463730	0.04186	N	0.327364	T	0.22704	0.0548	M	0.72894	2.215	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.75484	0.958;0.986	T	0.54377	-0.8303	10	0.72032	D	0.01	-14.1116	9.2736	0.37686	0.104:0.5852:0.2306:0.0802	.	113;113	P80188-2;P80188	.;NGAL_HUMAN	M	113;113;115;113;115	ENSP00000362108:T113M;ENSP00000277480:T113M;ENSP00000362104:T115M;ENSP00000441666:T113M;ENSP00000362089:T115M	ENSP00000277480:T113M	T	+	2	0	LCN2	129953800	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-2.762000	0.00785	-3.051000	0.00260	-1.405000	0.01134	ACG	rs150975968	LCN2	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_N_gelatinase		0.582	LCN2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LCN2	HGNC	protein_coding	OTTHUMT00000054375.1	0	0	0	119	119	92	0.00	0.00	C	NM_005564		130913979	+1	9	4	41	70	tier1	no_errors	ENST00000372998	ensembl	human	known	74_37	missense	18.00	5.41	SNP	0.000	T	9	41
TKT	7086	genome.wustl.edu	37	3	53274298	53274298	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr3:53274298C>G	ENST00000462138.1	-	4	494	c.406G>C	c.(406-408)Gcc>Ccc	p.A136P	TKT_ENST00000423525.2_Missense_Mutation_p.A136P|TKT_ENST00000423516.1_Missense_Mutation_p.A136P|TKT_ENST00000296289.6_Missense_Mutation_p.A89P			P29401	TKT_HUMAN	transketolase	136					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		CCGGTGTAGGCCATCCCACAA	0.592													ENSG00000163931																									Colon(133;1506 2347 35238 42177)												0													90.0	84.0	86.0					3																	53274298		2203	4300	6503	SO:0001583	missense	0			-		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.406G>C	3.37:g.53274298C>G	ENSP00000417773:p.Ala136Pro		A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.A136P	ENST00000462138.1	37	c.406	CCDS2871.1	3	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344778	0.82022	.	.	ENSG00000163931	ENST00000462138;ENST00000423525;ENST00000423516;ENST00000296289	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	6.07	5.17	0.71159	Transketolase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82467	0.5043	H	0.97635	4.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88117	0.2829	10	0.87932	D	0	-3.5466	16.8452	0.85978	0.1289:0.8711:0.0:0.0	.	136;136	E7EPA7;P29401	.;TKT_HUMAN	P	136;136;136;89	ENSP00000417773:A136P;ENSP00000405455:A136P;ENSP00000391481:A136P;ENSP00000296289:A89P	ENSP00000296289:A89P	A	-	1	0	TKT	53249338	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	6.067000	0.71193	2.884000	0.98904	0.655000	0.94253	GCC	-	TKT	-	pfam_Transketolase_N,pfam_DH_E1		0.592	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TKT	HGNC	protein_coding	OTTHUMT00000350356.1	0	0	0	119	119	79	0.00	0.00	C			53274298	-1	16	5	66	58	tier1	no_errors	ENST00000423525	ensembl	human	known	74_37	missense	19.51	7.94	SNP	1.000	G	16	66
APOBR	55911	genome.wustl.edu	37	16	28507458	28507458	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr16:28507458G>A	ENST00000431282.1	+	3	1079	c.1069G>A	c.(1069-1071)Gcc>Acc	p.A357T	CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.A366T|APOBR_ENST00000328423.5_Missense_Mutation_p.A357T|CLN3_ENST00000567160.1_5'Flank			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	357	Glu-rich.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						GGCCGGGACAGCCTCAGGAGG	0.667													ENSG00000184730																																					0													16.0	19.0	18.0					16																	28507458		1959	4109	6068	SO:0001583	missense	0			-	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.1069G>A	16.37:g.28507458G>A	ENSP00000416094:p.Ala357Thr		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.A366T	ENST00000431282.1	37	c.1096		16	.	.	.	.	.	.	.	.	.	.	G	13.61	2.288719	0.40494	.	.	ENSG00000184730	ENST00000328423;ENST00000431282	T;T	0.60299	0.2;0.2	3.92	-4.9	0.03094	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.09310	N	1	B	0.30146	0.27	B	0.29524	0.103	T	0.20371	-1.0277	9	0.34782	T	0.22	6.3641	6.5262	0.22303	0.3857:0.1261:0.4882:0.0	.	357	Q9NS13	.	T	357	ENSP00000327669:A357T;ENSP00000416094:A357T	ENSP00000327669:A357T	A	+	1	0	APOBR	28414959	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.026000	0.01434	-0.919000	0.03803	-0.382000	0.06688	GCC	-	APOBR	-	NULL		0.667	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding		0	0	0	46	46	14	0.00	0.00	G	NM_182804		28507458	+1	7	0	33	5	tier1	no_errors	ENST00000564831	ensembl	human	known	74_37	missense	17.50	0.00	SNP	0.002	A	7	33
KIF1C	10749	genome.wustl.edu	37	17	4925906	4925906	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:4925906C>A	ENST00000320785.5	+	22	2887	c.2530C>A	c.(2530-2532)Ctg>Atg	p.L844M	AC109333.10_ENST00000438266.1_RNA	NM_006612.5	NP_006603.2	O43896	KIF1C_HUMAN	kinesin family member 1C	844					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|skin(1)|urinary_tract(3)	30						GACGGGGATTCTGCAGGAGGT	0.677													ENSG00000129250																									Melanoma(96;1023 1447 10250 19259 33730)												0													30.0	31.0	31.0					17																	4925906		2201	4299	6500	SO:0001583	missense	0			-	U91329	CCDS11065.1	17p13.2	2014-03-03			ENSG00000129250	ENSG00000129250		"""Kinesins"""	6317	protein-coding gene	gene with protein product		603060	"""spastic ataxia 2 (autosomal recessive)"""	SAX2		9685376, 24319291, 24482476	Standard	NM_006612		Approved	SPAX2, SPG58	uc002gan.2	O43896	OTTHUMG00000099451	ENST00000320785.5:c.2530C>A	17.37:g.4925906C>A	ENSP00000320821:p.Leu844Met		D3DTL6|O75186|Q5U618	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L844M	ENST00000320785.5	37	c.2530	CCDS11065.1	17	.	.	.	.	.	.	.	.	.	.	C	18.98	3.738621	0.69304	.	.	ENSG00000129250	ENST00000320785	T	0.74632	-0.86	4.67	4.67	0.58626	.	.	.	.	.	T	0.82084	0.4960	L	0.47190	1.495	0.33128	D	0.542648	D	0.71674	0.998	D	0.77557	0.99	D	0.86117	0.1566	9	0.87932	D	0	.	15.1018	0.72284	0.0:1.0:0.0:0.0	.	844	O43896	KIF1C_HUMAN	M	844	ENSP00000320821:L844M	ENSP00000320821:L844M	L	+	1	2	KIF1C	4866630	0.281000	0.24258	1.000000	0.80357	0.999000	0.98932	0.926000	0.28804	2.436000	0.82500	0.655000	0.94253	CTG	-	KIF1C	-	NULL		0.677	KIF1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1C	HGNC	protein_coding	OTTHUMT00000216916.1	0	0	0	45	45	12	0.00	0.00	C			4925906	+1	4	0	24	8	tier1	no_errors	ENST00000320785	ensembl	human	known	74_37	missense	14.29	0.00	SNP	1.000	A	4	24
ODF3	113746	genome.wustl.edu	37	11	197587	197587	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr11:197587C>A	ENST00000325113.4	+	3	453	c.136C>A	c.(136-138)Ctg>Atg	p.L46M	BET1L_ENST00000410108.1_Intron|ODF3_ENST00000525282.1_Missense_Mutation_p.L46M|ODF3_ENST00000342593.5_Missense_Mutation_p.L46M	NM_053280.3	NP_444510.2	Q96PU9	ODF3A_HUMAN	outer dense fiber of sperm tails 3	46					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	outer dense fiber (GO:0001520)				biliary_tract(1)|breast(1)|kidney(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)	9		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCACCAAGCTGCGTGCACC	0.637													ENSG00000177947																																					0													40.0	39.0	40.0					11																	197587		2203	4300	6503	SO:0001583	missense	0			-	AB067774	CCDS7688.1, CCDS65981.1	11p15.5	2010-04-23			ENSG00000177947	ENSG00000177947			19905	protein-coding gene	gene with protein product	"""cancer/testis antigen 135"""	608356				11870087	Standard	NM_001286136		Approved	SHIPPO1, hSHIPPO, CT135	uc001lob.3	Q96PU9	OTTHUMG00000119073	ENST00000325113.4:c.136C>A	11.37:g.197587C>A	ENSP00000325868:p.Leu46Met		B7ZLT0|Q69YX0	Missense_Mutation	SNP	pfam_SHIPPO-rpt	p.L46M	ENST00000325113.4	37	c.136	CCDS7688.1	11	.	.	.	.	.	.	.	.	.	.	C	9.055	0.993045	0.19043	.	.	ENSG00000177947	ENST00000325113;ENST00000540150;ENST00000342593;ENST00000525282	T;T;T	0.31247	1.5;1.53;1.51	5.02	3.15	0.36227	.	0.979822	0.08319	N	0.964239	T	0.32224	0.0822	N	0.24115	0.695	0.23174	N	0.99817	P;P;P	0.52577	0.891;0.852;0.954	P;P;P	0.55222	0.694;0.653;0.771	T	0.18681	-1.0329	10	0.30078	T	0.28	-5.7958	7.8334	0.29355	0.0:0.8069:0.0:0.1931	.	46;46;46	B7ZLT0;F8W6Z3;Q96PU9	.;.;ODF3A_HUMAN	M	46	ENSP00000325868:L46M;ENSP00000339623:L46M;ENSP00000436588:L46M	ENSP00000325868:L46M	L	+	1	2	ODF3	187587	0.053000	0.20554	0.496000	0.27539	0.003000	0.03518	0.502000	0.22594	0.641000	0.30601	0.561000	0.74099	CTG	-	ODF3	-	NULL		0.637	ODF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF3	HGNC	protein_coding	OTTHUMT00000239287.1	0	0	0	84	84	26	0.00	0.00	C			197587	+1	4	0	39	8	tier1	no_errors	ENST00000325113	ensembl	human	known	74_37	missense	9.30	0.00	SNP	0.569	A	4	39
DNM1P47	100216544	genome.wustl.edu	37	15	102300044	102300044	+	RNA	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr15:102300044C>G	ENST00000561463.1	+	0	8090									DNM1 pseudogene 47																		TTCATCTTCTCAGAGCTGCTG	0.587													ENSG00000259660																																					0																																												0			-	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102300044C>G				R	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	DNM1P47	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	0	0	0	49	49	0	0.00	0.00	C	NG_009149		102300044	+1	3	0	27	0	tier1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	10.00	0.00	SNP	1.000	G	3	27
KRTAP2-2	728279	genome.wustl.edu	37	17	39211139	39211140	+	In_Frame_Ins	INS	-	-	GCAGGGGGGCCGGCA	rs9674636		TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:39211139_39211140insGCAGGGGGGCCGGCA	ENST00000398477.1	-	1	342_343	c.324_325insTGCCGGCCCCCCTGC	c.(322-327)tgcggc>tgcTGCCGGCCCCCCTGCggc	p.107_108insCCRPP	KRTAP2-2_ENST00000542910.1_In_Frame_Ins_p.107_108insCCRPP	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	107	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GTCGGCTGGCCGCAGGGGGACT	0.703													ENSG00000214518																																					0										369,641		167,35,303						3.3	1.0			2	525,2849		188,149,1350	no	coding	KRTAP2-2	NM_033032.2		355,184,1653	A1A1,A1R,RR		15.5602,36.5347,20.3923				894,3490				SO:0001652	inframe_insertion	0				AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.324_325insTGCCGGCCCCCCTGC	17.37:g.39211139_39211140insGCAGGGGGGCCGGCA	ENSP00000381494:p.Pro107_Cys108insCysCysArgProPro		A8MTN3|A8MXM4	In_Frame_Ins	INS	pfam_Keratin-assoc	p.108in_frame_insCRPPC	ENST00000398477.1	37	c.325_324	CCDS54122.1	17																																																																																				KRTAP2-2	-	NULL		0.703	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	HGNC	protein_coding	OTTHUMT00000257697.1	0	0	0	0	0	0	0.00	0.00	-			39211140	-1	0	0	0	0	tier1	no_errors	ENST00000542910	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	1.000:1.000	GCAGGGGGGCCGGCA	0	0
LOC100131347	100131347	genome.wustl.edu	37	17	37213382	37213382	+	RNA	SNP	G	G	T			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr17:37213382G>T	ENST00000583447.1	+	0	111					NR_036551.1																						TGTGGGAGCTGAGCTCTGGAC	0.622													ENSG00000263818																																					0																																												0			-																													17.37:g.37213382G>T				R	SNP	-	NULL	ENST00000583447.1	37	NULL		17																																																																																			-	CTD-2206N4.4	-	-		0.622	CTD-2206N4.4-003	KNOWN	basic	processed_transcript	LOC100131347	Clone_based_vega_gene	pseudogene	OTTHUMT00000444106.1	0	0	0	66	66	0	0.00	0.00	G			37213382	+1	4	0	45	0	tier1	no_errors	ENST00000578423	ensembl	human	known	74_37	rna	8.16	0.00	SNP	0.986	T	4	45
MT-ND1	4535	genome.wustl.edu	37	M	965	965	+	5'Flank	SNP	C	C	A			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chrM:965C>A	ENST00000361390.2	+	0	0				MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TCACCCCCTCCCCAATAAAGC	0.443													ENSG00000211459																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.965C>A	Exception_encountered		C0JKH6|Q37523	R	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	MT-RNR1	-	-		0.443	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		0	0	0	59	59	1	0.00	0.00	C	YP_003024026		965	+1	2	0	18	0	tier1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	10.00	0.00	SNP	NULL	A	2	18
DRC1	92749	genome.wustl.edu	37	2	26624902	26624902	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr2:26624902C>G	ENST00000288710.2	+	1	119	c.45C>G	c.(43-45)gaC>gaG	p.D15E		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	15					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											CGAACGTGGACGAGCACTTGT	0.677													ENSG00000157856																																					0													34.0	30.0	31.0					2																	26624902		2203	4300	6503	SO:0001583	missense	0			-	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.45C>G	2.37:g.26624902C>G	ENSP00000288710:p.Asp15Glu		A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	NULL	p.D15E	ENST00000288710.2	37	c.45	CCDS1723.1	2	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.391562	0.01185	.	.	ENSG00000157856	ENST00000288710	T	0.11930	2.73	4.97	-0.914	0.10497	.	0.295281	0.27455	N	0.019294	T	0.03095	0.0091	N	0.01668	-0.77	0.09310	N	0.999992	B	0.06786	0.001	B	0.08055	0.003	T	0.43015	-0.9417	10	0.02654	T	1	-3.8821	7.8279	0.29326	0.1349:0.4747:0.3904:0.0	.	15	Q96MC2	CC164_HUMAN	E	15	ENSP00000288710:D15E	ENSP00000288710:D15E	D	+	3	2	CCDC164	26478406	0.268000	0.24133	0.052000	0.19188	0.011000	0.07611	-0.966000	0.03825	-0.390000	0.07774	0.655000	0.94253	GAC	-	DRC1	-	NULL		0.677	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRC1	HGNC	protein_coding	OTTHUMT00000246862.1	0	0	0	249	249	59	0.00	0.00	C	NM_145038		26624902	+1	16	3	178	46	tier1	no_errors	ENST00000288710	ensembl	human	known	74_37	missense	8.21	6.12	SNP	0.356	G	16	178
DCAF5	8816	genome.wustl.edu	37	14	69521851	69521851	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71P-01A-12D-A33E-09	TCGA-SI-A71P-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	666434c3-057c-46d5-875f-5243314915c1	a4b6f436-9bf6-4964-a64b-b792e75e0697	g.chr14:69521851G>C	ENST00000341516.5	-	9	1699	c.1552C>G	c.(1552-1554)Cgc>Ggc	p.R518G	DCAF5_ENST00000557386.1_Missense_Mutation_p.R517G|DCAF5_ENST00000556847.1_Missense_Mutation_p.R436G|DCAF5_ENST00000553293.1_5'Flank|DCAF5_ENST00000554215.1_Missense_Mutation_p.R436G	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	518					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						TCTTGGTAGCGCCGCAGAGCA	0.587													ENSG00000139990																																					0													52.0	51.0	52.0					14																	69521851		2203	4300	6503	SO:0001583	missense	0			-	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.1552C>G	14.37:g.69521851G>C	ENSP00000341351:p.Arg518Gly		B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R518G	ENST00000341516.5	37	c.1552	CCDS32106.1	14	.	.	.	.	.	.	.	.	.	.	G	11.19	1.565126	0.27915	.	.	ENSG00000139990	ENST00000341516;ENST00000554215;ENST00000556847;ENST00000557386	T;T;T;T	0.74842	-0.88;-0.71;-0.71;-0.31	5.23	4.25	0.50352	.	0.212334	0.34555	N	0.003869	T	0.62962	0.2471	L	0.27053	0.805	0.80722	D	1	P;P	0.41748	0.761;0.649	B;B	0.38378	0.272;0.14	T	0.70963	-0.4729	10	0.87932	D	0	-15.0753	14.8422	0.70233	0.0:0.0:0.7814:0.2185	.	517;518	G3V4J7;Q96JK2	.;DCAF5_HUMAN	G	518;436;436;517	ENSP00000341351:R518G;ENSP00000451551:R436G;ENSP00000452052:R436G;ENSP00000451845:R517G	ENSP00000341351:R518G	R	-	1	0	DCAF5	68591604	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	1.491000	0.35583	2.431000	0.82371	0.561000	0.74099	CGC	-	DCAF5	-	NULL		0.587	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCAF5	HGNC	protein_coding	OTTHUMT00000414806.2	0	0	0	38	38	58	0.00	0.00	G	NM_003861		69521851	-1	4	3	31	34	tier1	no_errors	ENST00000341516	ensembl	human	known	74_37	missense	11.43	8.11	SNP	0.999	C	4	31
