#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ZNF890P	645700	genome.wustl.edu	37	7	5161321	5161321	+	RNA	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr7:5161321G>C	ENST00000422060.2	-	0	1233					NR_034163.1				zinc finger protein 890, pseudogene																		CTGTTTGTCAGGGCAAAGCTT	0.572													ENSG00000159904																																					0																																												0			-			7p22.1	2011-05-24			ENSG00000159904	ENSG00000159904			38691	pseudogene	pseudogene							Standard	NR_034163		Approved		uc003snu.1		OTTHUMG00000166790		7.37:g.5161321G>C				R	SNP	-	NULL	ENST00000422060.2	37	NULL		7																																																																																			-	ZNF890P	-	-		0.572	ZNF890P-002	KNOWN	basic	processed_transcript	ZNF890P	HGNC	pseudogene	OTTHUMT00000391474.1	0	0	0	92	92	69	0.00	0.00	G	NR_034163		5161321	-1	44	26	152	84	tier1	no_errors	ENST00000422060	ensembl	human	known	74_37	rna	22.45	23.64	SNP	0.001	C	44	152
RP11-1396O13.13	0	genome.wustl.edu	37	4	9385981	9385981	+	Silent	SNP	A	A	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr4:9385981A>T	ENST00000508324.1	-	5	662	c.663T>A	c.(661-663)acT>acA	p.T221T																	breast(2)|lung(7)	9						GTCCCGTGTGAGTTTTCTCAT	0.428													ENSG00000219492																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000508324.1:c.663T>A	4.37:g.9385981A>T				Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T221	ENST00000508324.1	37	c.663		4																																																																																			-	RP11-1396O13.13	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	RP11-1396O13.13-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ENSG00000219492	Clone_based_vega_gene	protein_coding	OTTHUMT00000359605.2	0	0	0	283	283	89	0.00	0.00	A			9385981	-1	54	11	207	22	tier1	no_errors	ENST00000508324	ensembl	human	novel	74_37	silent	20.69	33.33	SNP	0.656	T	54	207
GALNT14	79623	genome.wustl.edu	37	2	31168687	31168687	+	Missense_Mutation	SNP	G	G	A	rs370991103		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:31168687G>A	ENST00000349752.5	-	7	1343	c.704C>T	c.(703-705)aCc>aTc	p.T235I	GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000420311.2_Missense_Mutation_p.T200I|GALNT14_ENST00000324589.5_Missense_Mutation_p.T240I|GALNT14_ENST00000406653.1_Missense_Mutation_p.T215I|GALNT14_ENST00000356174.3_Missense_Mutation_p.T202I	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	235					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GTAGGTGAAGGTGTCCAGGTT	0.532													ENSG00000158089																																					0								G	ILE/THR	0,4406		0,0,2203	106.0	84.0	91.0		704	1.7	1.0	2		91	2,8598	2.2+/-6.3	0,2,4298	no	missense	GALNT14	NM_024572.2	89	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	235/553	31168687	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.704C>T	2.37:g.31168687G>A	ENSP00000288988:p.Thr235Ile		B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.T235I	ENST00000349752.5	37	c.704	CCDS1773.2	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215495	0.79352	0.0	2.33E-4	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21	4.85	1.73	0.24493	Glycosyl transferase, family 2 (1);	0.105465	0.64402	D	0.000005	T	0.80644	0.4662	H	0.95712	3.71	0.53688	D	0.999976	P;D;D;P;D	0.64830	0.917;0.966;0.994;0.921;0.991	P;P;D;D;D	0.67725	0.697;0.836;0.928;0.912;0.953	D	0.84536	0.0636	10	0.87932	D	0	.	13.4737	0.61295	0.0:0.0:0.5342:0.4658	.	200;202;240;235;215	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	I	235;240;215;202;200;202	ENSP00000288988:T235I;ENSP00000314500:T240I;ENSP00000385435:T215I;ENSP00000348497:T202I;ENSP00000415514:T200I;ENSP00000406399:T202I	ENSP00000314500:T240I	T	-	2	0	GALNT14	31022191	0.960000	0.32886	0.994000	0.49952	0.964000	0.63967	1.001000	0.29783	0.086000	0.17137	0.455000	0.32223	ACC	-	GALNT14	-	pfam_Glyco_trans_2		0.532	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	HGNC	protein_coding	OTTHUMT00000157264.1	0	0	0	42	42	88	0.00	0.00	G	NM_024572		31168687	-1	29	22	56	39	tier1	no_errors	ENST00000349752	ensembl	human	known	74_37	missense	34.12	36.07	SNP	0.998	A	29	56
ZDBF2	57683	genome.wustl.edu	37	2	207173469	207173469	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:207173469G>T	ENST00000374423.3	+	5	4603	c.4217G>T	c.(4216-4218)gGt>gTt	p.G1406V		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1406							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TATAAATTAGGTGATTTTGAT	0.348													ENSG00000204186																																					0													55.0	53.0	54.0					2																	207173469		1828	4083	5911	SO:0001583	missense	0			-	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.4217G>T	2.37:g.207173469G>T	ENSP00000363545:p.Gly1406Val		Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.G1406V	ENST00000374423.3	37	c.4217	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947191	0.34377	.	.	ENSG00000204186	ENST00000374423	T	0.40225	1.04	3.76	1.78	0.24846	.	.	.	.	.	T	0.27278	0.0669	L	0.34521	1.04	0.39928	D	0.97425	B	0.21225	0.053	B	0.23574	0.047	T	0.06643	-1.0815	9	0.25751	T	0.34	.	5.3549	0.16055	0.0:0.1753:0.5218:0.3029	.	1406	Q9HCK1	ZDBF2_HUMAN	V	1406	ENSP00000363545:G1406V	ENSP00000363545:G1406V	G	+	2	0	ZDBF2	206881714	0.587000	0.26791	0.956000	0.39512	0.826000	0.46750	0.527000	0.22987	0.468000	0.27243	0.650000	0.86243	GGT	-	ZDBF2	-	NULL		0.348	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	0	0	0	39	39	120	0.00	0.00	G	NM_020923		207173469	+1	39	36	115	87	tier1	no_errors	ENST00000374423	ensembl	human	known	74_37	missense	25.16	29.27	SNP	0.975	T	39	115
DGKI	9162	genome.wustl.edu	37	7	137080395	137080395	+	Silent	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr7:137080395C>A	ENST00000288490.5	-	33	3030	c.3030G>T	c.(3028-3030)gtG>gtT	p.V1010V	DGKI_ENST00000446122.1_Silent_p.V992V|DGKI_ENST00000424189.2_Silent_p.V1023V|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_Silent_p.V679V	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1010					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAAGCTGGCACACAGCCCGGT	0.562													ENSG00000157680																																					0													79.0	68.0	72.0					7																	137080395		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3030G>T	7.37:g.137080395C>A			A4D1Q9|Q9NZ49	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V1010	ENST00000288490.5	37	c.3030	CCDS5845.1	7																																																																																			-	DGKI	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.562	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	0	0	0	60	60	34	0.00	0.00	C	NM_004717		137080395	-1	29	22	73	24	tier1	no_errors	ENST00000288490	ensembl	human	known	74_37	silent	28.43	47.83	SNP	1.000	A	29	73
NRK	203447	genome.wustl.edu	37	X	105153297	105153297	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:105153297C>T	ENST00000243300.9	+	13	1967	c.1664C>T	c.(1663-1665)gCa>gTa	p.A555V	NRK_ENST00000428173.2_Missense_Mutation_p.A556V	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	555	Gln-rich.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAGAACCAGGCACCTGAACAG	0.562										HNSCC(51;0.14)			ENSG00000123572																																					0													38.0	39.0	39.0					X																	105153297		2019	4161	6180	SO:0001583	missense	0			-	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.1664C>T	X.37:g.105153297C>T	ENSP00000434830:p.Ala555Val		Q32ND6|Q5H9K2|Q6ZMP2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.A556V	ENST00000243300.9	37	c.1667		X	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.286823	0.00020	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	T;T	0.23552	1.9;1.9	4.38	-5.72	0.02406	.	0.966392	0.08488	N	0.938442	T	0.07863	0.0197	N	0.04090	-0.28	0.09310	N	0.999993	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.23119	-1.0197	10	0.30854	T	0.27	.	0.1017	0.00049	0.2971:0.2501:0.188:0.2648	.	223;555	Q7Z2Y5-2;Q7Z2Y5	.;NRK_HUMAN	V	555;556	ENSP00000434830:A555V;ENSP00000438378:A556V	ENSP00000434830:A555V	A	+	2	0	NRK	105039953	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.905000	0.00702	-2.086000	0.00863	-2.635000	0.00153	GCA	-	NRK	-	NULL		0.562	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	0	0	0	19	19	39	0.00	0.00	C	NM_198465		105153297	+1	26	31	26	28	tier1	no_errors	ENST00000428173	ensembl	human	known	74_37	missense	50.00	52.54	SNP	0.000	T	26	26
CASC3	22794	genome.wustl.edu	37	17	38324174	38324174	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr17:38324174C>T	ENST00000264645.7	+	10	1949	c.1723C>T	c.(1723-1725)Cag>Tag	p.Q575*		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	575	Necessary for localization in cytoplasmic stress granules.				gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						CATGCTTGTGCAGCCAGGAAT	0.517													ENSG00000108349																																					0													145.0	125.0	132.0					17																	38324174		2203	4300	6503	SO:0001587	stop_gained	0			-	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.1723C>T	17.37:g.38324174C>T	ENSP00000264645:p.Gln575*		A8K8R0	Nonsense_Mutation	SNP	pfam_Btz_dom	p.Q575*	ENST00000264645.7	37	c.1723	CCDS11362.1	17	.	.	.	.	.	.	.	.	.	.	C	41	8.712659	0.98925	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.09	5.09	0.68999	.	0.186120	0.48286	D	0.000190	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-13.0313	18.2998	0.90160	0.0:1.0:0.0:0.0	.	.	.	.	X	575	.	ENSP00000264645:Q575X	Q	+	1	0	CASC3	35577700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.059000	0.76684	2.651000	0.90000	0.563000	0.77884	CAG	-	CASC3	-	NULL		0.517	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC3	HGNC	protein_coding	OTTHUMT00000257127.3	0	0	0	79	79	59	0.00	0.00	C	NM_007359		38324174	+1	62	23	49	41	tier1	no_errors	ENST00000264645	ensembl	human	known	74_37	nonsense	55.86	35.94	SNP	1.000	T	62	49
SIK3	23387	genome.wustl.edu	37	11	116729350	116729350	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:116729350G>A	ENST00000292055.4	-	20	2548	c.2513C>T	c.(2512-2514)tCg>tTg	p.S838L	AP006216.12_ENST00000444200.1_RNA|SIK3_ENST00000488337.1_Intron|SIK3_ENST00000446921.2_Intron|SIK3_ENST00000434315.2_Intron|SIK3_ENST00000375300.1_Missense_Mutation_p.S896L|SIK3_ENST00000375288.1_Intron|SIK3_ENST00000542607.1_Intron	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	838	Gln-rich.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GGACTGGTCCGAAAACAGATG	0.557													ENSG00000160584																																					0													74.0	78.0	76.0					11																	116729350		2201	4296	6497	SO:0001583	missense	0			-	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.2513C>T	11.37:g.116729350G>A	ENSP00000292055:p.Ser838Leu		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.S896L	ENST00000292055.4	37	c.2687	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373041	0.61624	.	.	ENSG00000160584	ENST00000375300;ENST00000292055	T;T	0.73789	-0.75;-0.78	5.67	4.72	0.59763	.	0.439086	0.16781	N	0.199764	T	0.57475	0.2056	N	0.24115	0.695	0.80722	D	1	P;P	0.49635	0.926;0.878	B;B	0.33960	0.173;0.084	T	0.61178	-0.7115	10	0.51188	T	0.08	.	13.6458	0.62281	0.0787:0.0:0.9213:0.0	.	838;838	Q9Y2K2-3;Q9Y2K2	.;SIK3_HUMAN	L	896;838	ENSP00000364449:S896L;ENSP00000292055:S838L	ENSP00000292055:S838L	S	-	2	0	SIK3	116234560	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.581000	0.74045	1.289000	0.44618	-0.345000	0.07892	TCG	-	SIK3	-	NULL		0.557	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		0	0	0	54	54	107	0.00	0.00	G	NM_025164		116729350	-1	14	7	20	35	tier1	no_errors	ENST00000375300	ensembl	human	known	74_37	missense	41.18	16.67	SNP	1.000	A	14	20
ARID1A	8289	genome.wustl.edu	37	1	27106528	27106528	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:27106528G>A	ENST00000324856.7	+	20	6510	c.6139G>A	c.(6139-6141)Gag>Aag	p.E2047K	ARID1A_ENST00000540690.1_Missense_Mutation_p.E375K|ARID1A_ENST00000374152.2_Missense_Mutation_p.E1664K|ARID1A_ENST00000457599.2_Missense_Mutation_p.E1830K	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2047					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E2047*(3)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CAACAAAGTGGAGTGGTGGTG	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""								ENSG00000117713																												Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	3	Substitution - Nonsense(3)	endometrium(2)|ovary(1)											153.0	152.0	152.0					1																	27106528		2203	4300	6503	SO:0001583	missense	0			-	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6139G>A	1.37:g.27106528G>A	ENSP00000320485:p.Glu2047Lys		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_D-bd,superfamily_ARID/BRIGHT_D-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_D-bd,pfscan_ARID/BRIGHT_D-bd	p.E2047K	ENST00000324856.7	37	c.6139	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.147329|4.147329	0.77888|0.77888	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690|ENST00000430799	T;T;T;T|.	0.37584|.	1.19;1.19;1.19;1.19|.	5.0|5.0	4.08|4.08	0.47627|0.47627	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75140|0.75140	0.3809|0.3809	M|M	0.79475|0.79475	2.455|2.455	0.54753|0.54753	D|D	0.999986|0.999986	D;D;D|.	0.61697|.	0.986;0.99;0.972|.	P;P;P|.	0.60173|.	0.737;0.87;0.737|.	T|T	0.77466|0.77466	-0.2577|-0.2577	10|5	0.54805|.	T|.	0.06|.	-13.4302|-13.4302	15.2799|15.2799	0.73773|0.73773	0.0:0.0:0.8588:0.1412|0.0:0.0:0.8588:0.1412	.|.	1664;2047;1830|.	O14497-3;O14497;O14497-2|.	.;ARI1A_HUMAN;.|.	K|E	2047;1830;1664;375|943	ENSP00000320485:E2047K;ENSP00000387636:E1830K;ENSP00000363267:E1664K;ENSP00000442437:E375K|.	ENSP00000320485:E2047K|.	E|G	+|+	1|2	0|0	ARID1A|ARID1A	26979115|26979115	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.020000|9.020000	0.93667|0.93667	1.460000|1.460000	0.47911|0.47911	0.591000|0.591000	0.81541|0.81541	GAG|GGA	-	ARID1A	-	pfam_DUF3518		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	0	0	0	53	53	137	0.00	0.00	G	NM_139135		27106528	+1	20	34	31	49	tier1	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	39.22	40.96	SNP	1.000	A	20	31
NIN	51199	genome.wustl.edu	37	14	51243731	51243731	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr14:51243731T>A	ENST00000382041.3	-	7	792	c.602A>T	c.(601-603)cAc>cTc	p.H201L	NIN_ENST00000324330.9_Missense_Mutation_p.H201L|NIN_ENST00000245441.5_Missense_Mutation_p.H201L|NIN_ENST00000453196.1_Missense_Mutation_p.H201L|NIN_ENST00000530997.2_Missense_Mutation_p.H201L|NIN_ENST00000382043.4_Missense_Mutation_p.H201L|NIN_ENST00000389868.3_Missense_Mutation_p.H201L	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	201	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					CCGGTTCAGGTGACCATCACG	0.463			T	PDGFRB	MPD								ENSG00000100503																												Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													120.0	109.0	113.0					14																	51243731		2203	4300	6503	SO:0001583	missense	0			-	AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.602A>T	14.37:g.51243731T>A	ENSP00000371472:p.His201Leu		A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tR-bd_arm,pfscan_EF_hand_dom	p.H201L	ENST00000382041.3	37	c.602	CCDS32079.1	14	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632136	0.67015	.	.	ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196;ENST00000453401	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	5.76	5.76	0.90799	EF-hand-like domain (1);	0.441675	0.29501	N	0.011969	T	0.36608	0.0973	N	0.24115	0.695	0.30734	N	0.746946	P;D;D;P;D	0.89917	0.923;0.999;1.0;0.915;0.999	P;D;D;B;D	0.85130	0.652;0.95;0.997;0.217;0.994	T	0.25433	-1.0132	10	0.28530	T	0.3	-17.4188	15.5501	0.76145	0.0:0.0:0.0:1.0	.	207;201;201;201;201	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7	.;.;NIN_HUMAN;.;.	L	201;201;201;201;207;201;201;201;163	ENSP00000245441:H201L;ENSP00000374518:H201L;ENSP00000371474:H201L;ENSP00000371472:H201L;ENSP00000324210:H201L;ENSP00000412391:H201L;ENSP00000398641:H163L	ENSP00000245441:H201L	H	-	2	0	NIN	50313481	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.275000	0.43399	2.315000	0.78130	0.533000	0.62120	CAC	-	NIN	-	NULL		0.463	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	0	0	0	25	25	119	0.00	0.00	T	NM_182946		51243731	-1	30	26	54	105	tier1	no_errors	ENST00000245441	ensembl	human	known	74_37	missense	35.71	19.85	SNP	1.000	A	30	54
OR11A1	26531	genome.wustl.edu	37	6	29395185	29395185	+	Silent	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:29395185T>A	ENST00000377149.1	-	5	706	c.234A>T	c.(232-234)gcA>gcT	p.A78A	OR11A1_ENST00000377147.2_Silent_p.A78A|OR11A1_ENST00000377148.1_Silent_p.A78A|OR5V1_ENST00000377154.1_Intron			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	78						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						TTGGCATCACTGCGGAGGTGT	0.488													ENSG00000204694																																					0													71.0	65.0	67.0					6																	29395185		1510	2709	4219	SO:0001819	synonymous_variant	0			-		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.234A>T	6.37:g.29395185T>A			A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.A78	ENST00000377149.1	37	c.234	CCDS34363.1	6																																																																																			-	OR11A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.488	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	HGNC	protein_coding	OTTHUMT00000193778.1	0	0	0	31	31	70	0.00	0.00	T			29395185	-1	19	22	28	19	tier1	no_errors	ENST00000377147	ensembl	human	known	74_37	silent	40.43	53.66	SNP	0.044	A	19	28
DPPA5	340168	genome.wustl.edu	37	6	74063926	74063926	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:74063926C>G	ENST00000370370.3	-	1	92	c.23G>C	c.(22-24)aGa>aCa	p.R8T		NM_001025290.2	NP_001020461.1	A6NC42	DPPA5_HUMAN	developmental pluripotency associated 5	8					multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|endometrium(1)|lung(5)	7						CGGGATATGTCTACGTGCCGG	0.577													ENSG00000203909																																					0													64.0	57.0	59.0					6																	74063926		2203	4300	6503	SO:0001583	missense	0			-		CCDS34483.1	6q13	2014-01-28			ENSG00000203909	ENSG00000203909			19201	protein-coding gene	gene with protein product		611111					Standard	NM_001025290		Approved	Esg1	uc003pgs.2	A6NC42	OTTHUMG00000015025	ENST00000370370.3:c.23G>C	6.37:g.74063926C>G	ENSP00000359396:p.Arg8Thr		B2RPQ7	Missense_Mutation	SNP	NULL	p.R8T	ENST00000370370.3	37	c.23	CCDS34483.1	6	.	.	.	.	.	.	.	.	.	.	C	6.202	0.405474	0.11754	.	.	ENSG00000203909	ENST00000370370	T	0.29397	1.57	3.6	-0.837	0.10766	.	0.540328	0.16982	N	0.191662	T	0.05547	0.0146	N	0.24115	0.695	0.09310	N	1	B	0.18310	0.027	B	0.16289	0.015	T	0.39396	-0.9616	10	0.26408	T	0.33	.	6.6106	0.22749	0.0:0.465:0.0:0.535	.	8	A6NC42	DPPA5_HUMAN	T	8	ENSP00000359396:R8T	ENSP00000359396:R8T	R	-	2	0	DPPA5	74120647	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	0.398000	0.20899	-0.117000	0.11872	-0.350000	0.07774	AGA	-	DPPA5	-	NULL		0.577	DPPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPPA5	HGNC	protein_coding	OTTHUMT00000041203.3	0	0	0	86	86	66	0.00	0.00	C	NM_001025290		74063926	-1	43	33	59	57	tier1	no_errors	ENST00000370370	ensembl	human	known	74_37	missense	42.16	36.67	SNP	0.000	G	43	59
PGAP1	80055	genome.wustl.edu	37	2	197707533	197707533	+	Missense_Mutation	SNP	T	T	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:197707533T>G	ENST00000354764.4	-	26	2656	c.2542A>C	c.(2542-2544)Aat>Cat	p.N848H		NM_024989.3	NP_079265.2	Q75T13	PGAP1_HUMAN	post-GPI attachment to proteins 1	848					anterior/posterior axis specification (GO:0009948)|attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|embryonic pattern specification (GO:0009880)|forebrain regionalization (GO:0021871)|head development (GO:0060322)|intracellular protein transport (GO:0006886)|myo-inositol transport (GO:0015798)|post-translational protein modification (GO:0043687)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	nuclease activity (GO:0004518)|phosphoric ester hydrolase activity (GO:0042578)			breast(4)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(11)|ovary(6)|stomach(1)|urinary_tract(1)	40						GGATCAGGATTAAGTTTAAAA	0.279													ENSG00000197121																																					0													59.0	68.0	65.0					2																	197707533		2200	4289	6489	SO:0001583	missense	0			-		CCDS2318.1	2q33.1	2014-03-03			ENSG00000197121	ENSG00000197121			25712	protein-coding gene	gene with protein product	"""GPI inositol-deacylase"""	611655				14734546, 17711852, 24482476	Standard	XM_005246866		Approved	FLJ12377, Bst1, SPG67	uc002utw.3	Q75T13	OTTHUMG00000132743	ENST00000354764.4:c.2542A>C	2.37:g.197707533T>G	ENSP00000346809:p.Asn848His		Q4G0R8|Q4ZG47|Q53SM0|Q6AW92|Q6UWV4|Q9HA24	Missense_Mutation	SNP	pfam_PGAP1-like	p.N848H	ENST00000354764.4	37	c.2542	CCDS2318.1	2	.	.	.	.	.	.	.	.	.	.	T	11.77	1.737798	0.30774	.	.	ENSG00000197121	ENST00000354764	.	.	.	5.35	4.17	0.49024	.	0.447709	0.25361	N	0.031228	T	0.25791	0.0628	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14364	-1.0475	9	0.45353	T	0.12	-5.5324	0.6207	0.00777	0.1797:0.1662:0.1878:0.4663	.	848	Q75T13	PGAP1_HUMAN	H	848	.	ENSP00000346809:N848H	N	-	1	0	PGAP1	197415778	0.995000	0.38212	0.996000	0.52242	0.951000	0.60555	0.279000	0.18771	1.014000	0.39417	0.533000	0.62120	AAT	-	PGAP1	-	NULL		0.279	PGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAP1	HGNC	protein_coding	OTTHUMT00000256103.5	0	0	0	41	41	116	0.00	0.00	T	NM_024989		197707533	-1	39	35	105	106	tier1	no_errors	ENST00000354764	ensembl	human	known	74_37	missense	27.08	24.82	SNP	0.968	G	39	105
ADAMTS19	171019	genome.wustl.edu	37	5	129072798	129072798	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr5:129072798G>T	ENST00000274487.4	+	23	3656	c.3511G>T	c.(3511-3513)Gtg>Ttg	p.V1171L	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	1171	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TCAGTGGCCAGTGTACTGCCG	0.463													ENSG00000145808																																					0													133.0	123.0	127.0					5																	129072798		2203	4300	6503	SO:0001583	missense	0			-	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.3511G>T	5.37:g.129072798G>T	ENSP00000274487:p.Val1171Leu			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.V1171L	ENST00000274487.4	37	c.3511	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623779	0.66901	.	.	ENSG00000145808	ENST00000274487	T	0.64085	-0.08	4.12	4.12	0.48240	PLAC (2);	0.000000	0.45126	D	0.000394	T	0.66436	0.2789	N	0.19112	0.55	0.53688	D	0.99997	D	0.76494	0.999	D	0.85130	0.997	T	0.65228	-0.6219	9	.	.	.	.	17.6813	0.88243	0.0:0.0:1.0:0.0	.	1171	Q8TE59	ATS19_HUMAN	L	1171	ENSP00000274487:V1171L	.	V	+	1	0	ADAMTS19	129100697	1.000000	0.71417	0.913000	0.36048	0.603000	0.37013	8.517000	0.90555	2.599000	0.87857	0.650000	0.86243	GTG	-	ADAMTS19	-	pfam_PLAC,pfscan_PLAC		0.463	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	0	0	0	21	21	90	0.00	0.00	G	NM_133638		129072798	+1	22	27	6	33	tier1	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	78.57	45.00	SNP	0.999	T	22	6
GPR112	139378	genome.wustl.edu	37	X	135487944	135487944	+	Silent	SNP	T	T	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:135487944T>C	ENST00000394143.1	+	23	9039	c.8748T>C	c.(8746-8748)gtT>gtC	p.V2916V	GPR112_ENST00000370652.1_Silent_p.V2916V|GPR112_ENST00000394141.1_Silent_p.V2711V|GPR112_ENST00000287534.4_Silent_p.V2669V|GPR112_ENST00000412101.1_Silent_p.V2711V	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2916					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.V2916V(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCTGCACTGTTCTTGTTCAAC	0.403													ENSG00000156920																																					1	Substitution - coding silent(1)	large_intestine(1)											166.0	142.0	150.0					X																	135487944		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.8748T>C	X.37:g.135487944T>C			A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.V2916	ENST00000394143.1	37	c.8748	CCDS35409.1	X																																																																																			-	GPR112	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.403	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	0	0	0	49	49	67	0.00	0.00	T			135487944	+1	25	21	65	73	tier1	no_errors	ENST00000370652	ensembl	human	known	74_37	silent	27.78	22.11	SNP	0.998	C	25	65
ARRDC5	645432	genome.wustl.edu	37	19	4891142	4891142	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:4891142G>T	ENST00000381781.2	-	3	944	c.945C>A	c.(943-945)atC>atA	p.I315I	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	315										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CGCTGGTGATGATGATGGGAA	0.572													ENSG00000205784																																					0													116.0	121.0	119.0					19																	4891142		2154	4248	6402	SO:0001819	synonymous_variant	0			-		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.945C>A	19.37:g.4891142G>T				Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.I315	ENST00000381781.2	37	c.945	CCDS45929.1	19																																																																																			-	ARRDC5	-	pfam_Arrestin_C-like,superfamily_Ig_E-set		0.572	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	HGNC	protein_coding	OTTHUMT00000450443.1	0	0	1	47	47	87	0.00	1.14	G	XM_292803		4891142	-1	27	33	72	96	tier1	no_errors	ENST00000381781	ensembl	human	known	74_37	silent	27.27	25.58	SNP	0.019	T	27	72
KLF8	11279	genome.wustl.edu	37	X	56292123	56292123	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:56292123C>A	ENST00000468660.1	+	3	880	c.592C>A	c.(592-594)Cct>Act	p.P198T	KLF8_ENST00000374928.3_Missense_Mutation_p.P198T	NM_007250.4	NP_009181.2	O95600	KLF8_HUMAN	Kruppel-like factor 8	198					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(4)|large_intestine(6)|lung(5)|ovary(1)	16						AGATGGGGGCCCTGCAGCCAT	0.498													ENSG00000102349																																					0													55.0	49.0	51.0					X																	56292123		2203	4300	6503	SO:0001583	missense	0			-	U28282	CCDS14373.1, CCDS55428.1	Xp11.21	2013-01-08			ENSG00000102349	ENSG00000102349		"""Zinc fingers, C2H2-type"", ""Kruppel-like transcription factors"""	6351	protein-coding gene	gene with protein product		300286					Standard	NM_007250		Approved	BKLF3, ZNF741, DXS741	uc004dur.3	O95600	OTTHUMG00000021666	ENST00000468660.1:c.592C>A	X.37:g.56292123C>A	ENSP00000417303:p.Pro198Thr		B4DJN3|E7EQQ8|L0R3U8|L0R4U2|Q2M246|Q59GV5|Q5HYQ5|Q5JXP7|Q6MZJ7|Q9UGC4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P198T	ENST00000468660.1	37	c.592	CCDS14373.1	X	.	.	.	.	.	.	.	.	.	.	C	3.294	-0.144236	0.06627	.	.	ENSG00000102349	ENST00000374928;ENST00000468660	T;T	0.25579	1.79;1.79	4.35	3.38	0.38709	.	0.246250	0.34338	N	0.004054	T	0.15955	0.0384	L	0.41079	1.255	0.31757	N	0.633807	P;B;B	0.37466	0.596;0.216;0.027	B;B;B	0.37989	0.262;0.085;0.006	T	0.08330	-1.0727	10	0.02654	T	1	.	7.9918	0.30246	0.3775:0.6225:0.0:0.0	.	198;198;198	E7EQQ8;B4DJN3;O95600	.;.;KLF8_HUMAN	T	198	ENSP00000364063:P198T;ENSP00000417303:P198T	ENSP00000431911:P198T	P	+	1	0	KLF8	56308848	0.978000	0.34361	0.997000	0.53966	0.984000	0.73092	2.250000	0.43178	2.088000	0.63022	0.600000	0.82982	CCT	-	KLF8	-	NULL		0.498	KLF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF8	HGNC	protein_coding	OTTHUMT00000056887.2	0	0	0	17	17	12	0.00	0.00	C	NM_007250		56292123	+1	20	4	47	28	tier1	no_errors	ENST00000468660	ensembl	human	known	74_37	missense	29.85	12.50	SNP	0.992	A	20	47
FGFR1	2260	genome.wustl.edu	37	8	38274849	38274849	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr8:38274849G>T	ENST00000447712.2	-	12	2579	c.1638C>A	c.(1636-1638)aaC>aaA	p.N546K	FGFR1_ENST00000356207.5_Missense_Mutation_p.N457K|FGFR1_ENST00000341462.5_Missense_Mutation_p.N546K|FGFR1_ENST00000335922.5_Missense_Mutation_p.N536K|FGFR1_ENST00000397103.1_Missense_Mutation_p.N457K|FGFR1_ENST00000532791.1_Missense_Mutation_p.N544K|FGFR1_ENST00000397108.4_Missense_Mutation_p.N544K|FGFR1_ENST00000425967.3_Missense_Mutation_p.N577K|FGFR1_ENST00000326324.6_Missense_Mutation_p.N455K|FGFR1_ENST00000397113.2_Missense_Mutation_p.N544K|FGFR1_ENST00000397091.5_Missense_Mutation_p.N544K	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	546	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)	p.N546K(4)	FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCCCCAGCAGGTTGATGATAT	0.542		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""						ENSG00000077782																									Melanoma(146;1153 1840 21453 21841 43625)			Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	4	Substitution - Missense(4)	central_nervous_system(4)											87.0	95.0	92.0					8																	38274849		2154	4289	6443	SO:0001583	missense	0			-	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.1638C>A	8.37:g.38274849G>T	ENSP00000400162:p.Asn546Lys		A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.N577K	ENST00000447712.2	37	c.1731	CCDS6107.2	8	.	.	.	.	.	.	.	.	.	.	G	23.4	4.406498	0.83230	.	.	ENSG00000077782	ENST00000397091;ENST00000425967;ENST00000447712;ENST00000341462;ENST00000310729;ENST00000532791;ENST00000397113;ENST00000356207;ENST00000335922;ENST00000326324;ENST00000397103;ENST00000397108	D;D;D;D;D;D;D;D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7;-2.7	5.57	3.76	0.43208	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87577	0.6212	N	0.04387	-0.21	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.88572	0.3130	10	0.87932	D	0	.	9.3132	0.37919	0.2169:0.0:0.7831:0.0	.	455;455;546;536;544	P11362-14;P11362-4;P11362;P11362-20;P11362-2	.;.;FGFR1_HUMAN;.;.	K	544;577;546;546;546;544;544;457;536;455;457;544	ENSP00000380280:N544K;ENSP00000393312:N577K;ENSP00000400162:N546K;ENSP00000340636:N546K;ENSP00000432972:N544K;ENSP00000380302:N544K;ENSP00000348537:N457K;ENSP00000337247:N536K;ENSP00000327229:N455K;ENSP00000380292:N457K;ENSP00000380297:N544K	ENSP00000311337:N546K	N	-	3	2	FGFR1	38394006	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.001000	0.40825	1.491000	0.48482	0.655000	0.94253	AAC	-	FGFR1	-	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.542	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGFR1	HGNC	protein_coding		0	0	0	26	26	34	0.00	0.00	G			38274849	-1	11	18	38	23	tier1	no_errors	ENST00000425967	ensembl	human	known	74_37	missense	22.45	43.90	SNP	1.000	T	11	38
CCDC155	147872	genome.wustl.edu	37	19	49910870	49910870	+	Splice_Site	SNP	G	G	A	rs535323954		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:49910870G>A	ENST00000447857.3	+	12	1140	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_144688.4	NP_653289.3	Q8N6L0	KASH5_HUMAN	coiled-coil domain containing 155	312						chromosome, telomeric region (GO:0000781)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(10)|ovary(1)|stomach(1)	22						CTTTCCTAGCGCACTCGCGAT	0.642													ENSG00000161609	g|||	1	0.000199681	0.0	0.0	5008	,	,		13852	0.0		0.0	False		,,,				2504	0.001																0													38.0	42.0	41.0					19																	49910870		1948	4139	6087	SO:0001630	splice_region_variant	0			-		CCDS46140.1	19q13.33	2014-01-21			ENSG00000161609	ENSG00000161609			26520	protein-coding gene	gene with protein product							Standard	NM_144688		Approved	FLJ32658, KASH5	uc002pnm.2	Q8N6L0	OTTHUMG00000183170	ENST00000447857.3:c.934-1G>A	19.37:g.49910870G>A			Q96MC3	Missense_Mutation	SNP	NULL	p.R312H	ENST00000447857.3	37	c.935	CCDS46140.1	19	.	.	.	.	.	.	.	.	.	.	g	18.09	3.545249	0.65198	.	.	ENSG00000161609	ENST00000447857	T	0.35789	1.29	4.83	4.83	0.62350	.	0.274240	0.30101	N	0.010402	T	0.59500	0.2198	M	0.75447	2.3	0.35404	D	0.791875	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.69606	-0.5100	10	0.56958	D	0.05	-18.8095	14.1996	0.65693	0.0:0.0:1.0:0.0	.	312;312	C9JGW3;Q8N6L0	.;CC155_HUMAN	H	312	ENSP00000404220:R312H	ENSP00000404220:R312H	R	+	2	0	CCDC155	54602682	0.991000	0.36638	0.996000	0.52242	0.351000	0.29236	2.029000	0.41098	2.636000	0.89361	0.645000	0.84053	CGC	-	CCDC155	-	NULL		0.642	CCDC155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC155	HGNC	protein_coding	OTTHUMT00000465436.2	0	0	0	112	112	79	0.00	0.00	G	NM_144688	Missense_Mutation	49910870	+1	56	13	118	35	tier1	no_errors	ENST00000447857	ensembl	human	known	74_37	missense	32.18	26.53	SNP	0.998	A	56	118
C2orf72	257407	genome.wustl.edu	37	2	231911630	231911630	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:231911630T>A	ENST00000373640.4	+	3	858	c.782T>A	c.(781-783)cTa>cAa	p.L261Q	C2orf72_ENST00000477463.1_3'UTR	NM_001144994.1	NP_001138466.1	A6NCS6	CB072_HUMAN	chromosome 2 open reading frame 72	261																	GAGCTGCCACTAACAGCCATA	0.498													ENSG00000204128																																					0													60.0	62.0	61.0					2																	231911630		692	1591	2283	SO:0001583	missense	0			-		CCDS46539.1	2q37.1	2012-08-06			ENSG00000204128	ENSG00000204128			27418	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001144994		Approved	LOC257407	uc002vrl.4	A6NCS6	OTTHUMG00000153996	ENST00000373640.4:c.782T>A	2.37:g.231911630T>A	ENSP00000362743:p.Leu261Gln			Missense_Mutation	SNP	NULL	p.L261Q	ENST00000373640.4	37	c.782	CCDS46539.1	2	.	.	.	.	.	.	.	.	.	.	T	13.67	2.306099	0.40795	.	.	ENSG00000204128	ENST00000373640	.	.	.	5.27	5.27	0.74061	.	0.000000	0.29783	N	0.011201	T	0.68888	0.3050	M	0.65498	2.005	0.33475	D	0.586642	D	0.89917	1.0	D	0.91635	0.999	T	0.78909	-0.2018	9	0.87932	D	0	-13.9458	11.5054	0.50463	0.0:0.0:0.0:1.0	.	261	A6NCS6	CB072_HUMAN	Q	261	.	ENSP00000362743:L261Q	L	+	2	0	C2orf72	231619874	1.000000	0.71417	0.337000	0.25536	0.009000	0.06853	3.785000	0.55424	2.203000	0.70933	0.460000	0.39030	CTA	-	C2orf72	-	NULL		0.498	C2orf72-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	C2orf72	HGNC	protein_coding	OTTHUMT00000333376.2	0	0	0	86	86	89	0.00	0.00	T	NM_001144994		231911630	+1	34	26	103	89	tier1	no_errors	ENST00000373640	ensembl	human	putative	74_37	missense	24.82	22.61	SNP	0.873	A	34	103
SCGB1C1	147199	genome.wustl.edu	37	11	194424	194424	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:194424G>A	ENST00000342878.2	+	3	282	c.262G>A	c.(262-264)Gtg>Atg	p.V88M	ODF3_ENST00000342593.5_5'Flank|ODF3_ENST00000525282.1_5'Flank|ODF3_ENST00000325113.4_5'Flank|BET1L_ENST00000410108.1_Intron	NM_145651.2	NP_663626.2	Q8TD33	SG1C1_HUMAN	secretoglobin, family 1C, member 1	88						extracellular region (GO:0005576)				endometrium(1)|liver(2)|lung(1)|skin(1)	5		all_cancers(49;1.58e-09)|all_epithelial(84;2.71e-06)|Breast(177;0.000162)|Ovarian(85;0.000626)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;3.95e-27)|Epithelial(43;2.66e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.55e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCAGGTGCAAGTGCTGGGCAG	0.602													ENSG00000188076																																					0													157.0	163.0	161.0					11																	194424		2158	4256	6414	SO:0001583	missense	0			-	AY026938	CCDS41581.1	11p15.5	2011-12-14			ENSG00000188076	ENSG00000188076		"""Secretoglobins"""	18394	protein-coding gene	gene with protein product		610176				22155607	Standard	NM_145651		Approved	RYD5	uc001loa.1	Q8TD33	OTTHUMG00000165539	ENST00000342878.2:c.262G>A	11.37:g.194424G>A	ENSP00000344545:p.Val88Met		A8MSI9|Q14DW0	Missense_Mutation	SNP	pfam_Secretoglobin,superfamily_Secretoglobin	p.V88M	ENST00000342878.2	37	c.262	CCDS41581.1	11	.	.	.	.	.	.	.	.	.	.	.	13.63	2.294603	0.40594	.	.	ENSG00000188076	ENST00000342878	T	0.19394	2.15	4.14	4.14	0.48551	.	0.105822	0.41712	D	0.000833	T	0.43590	0.1254	.	.	.	0.32908	D	0.51415	D	0.76494	0.999	D	0.91635	0.999	T	0.55945	-0.8060	9	0.72032	D	0.01	-48.5404	12.2031	0.54337	0.0:0.0:1.0:0.0	.	88	Q8TD33	SG1C1_HUMAN	M	88	ENSP00000344545:V88M	ENSP00000344545:V88M	V	+	1	0	SCGB1C1	184424	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	3.182000	0.50910	2.604000	0.88044	0.491000	0.48974	GTG	-	SCGB1C1	-	pfam_Secretoglobin,superfamily_Secretoglobin		0.602	SCGB1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB1C1	HGNC	protein_coding	OTTHUMT00000384759.1	0	0	0	101	101	96	0.00	0.00	G	NM_145651		194424	+1	11	12	75	57	tier1	no_errors	ENST00000342878	ensembl	human	known	74_37	missense	12.79	17.39	SNP	1.000	A	11	75
LCP1	3936	genome.wustl.edu	37	13	46717443	46717443	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr13:46717443C>T	ENST00000398576.2	-	15	1738	c.1350G>A	c.(1348-1350)ctG>ctA	p.L450L	LCP1_ENST00000323076.2_Silent_p.L450L|LCP1_ENST00000435666.2_5'Flank			P13796	PLSL_HUMAN	lymphocyte cytosolic protein 1 (L-plastin)	450	Actin-binding 2.|CH 3. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|organ regeneration (GO:0031100)|protein kinase A signaling (GO:0010737)|regulation of intracellular protein transport (GO:0033157)|T cell activation involved in immune response (GO:0002286)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			breast(2)|kidney(1)|large_intestine(6)|lung(18)|ovary(4)|prostate(2)|skin(1)	34		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		TATTGCCTCCCAGTTTGGGGT	0.438			T	BCL6	NHL								ENSG00000136167																												Dom	yes		13	13q14.1-q14.3	3936	lymphocyte cytosolic protein 1 (L-plastin)		L	0													179.0	146.0	157.0					13																	46717443		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M22300	CCDS9403.1	13q14.3	2013-01-10			ENSG00000136167	ENSG00000136167		"""EF-hand domain containing"""	6528	protein-coding gene	gene with protein product	"""plastin 2"""	153430				2111166	Standard	NM_002298		Approved	PLS2, CP64, L-PLASTIN, LC64P	uc001vba.4	P13796	OTTHUMG00000016864	ENST00000398576.2:c.1350G>A	13.37:g.46717443C>T			B2R613|B4DUA0|Q5TBN4	Silent	SNP	pfam_CH-domain,pfam_EF_hand_dom,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.L450	ENST00000398576.2	37	c.1350	CCDS9403.1	13																																																																																			-	LCP1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.438	LCP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP1	HGNC	protein_coding	OTTHUMT00000044800.3	0	0	0	89	89	149	0.00	0.00	C	NM_002298		46717443	-1	29	39	94	100	tier1	no_errors	ENST00000323076	ensembl	human	known	74_37	silent	23.58	28.06	SNP	1.000	T	29	94
CD2AP	23607	genome.wustl.edu	37	6	47573998	47573998	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:47573998C>T	ENST00000359314.5	+	14	1971	c.1515C>T	c.(1513-1515)ttC>ttT	p.F505F		NM_012120.2	NP_036252.1	Q9Y5K6	CD2AP_HUMAN	CD2-associated protein	505					mitotic nuclear division (GO:0007067)|negative regulation of transforming growth factor beta1 production (GO:0032911)|positive regulation of protein localization to nucleus (GO:1900182)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of receptor-mediated endocytosis (GO:0048259)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|substrate-dependent cell migration, cell extension (GO:0006930)|vesicle organization (GO:0016050)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			kidney(1)|large_intestine(9)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	20			Lung(136;0.105)|LUSC - Lung squamous cell carcinoma(51;0.138)			CGGGCCGTTTCAATGGTGGAC	0.398													ENSG00000198087																																					0													116.0	107.0	110.0					6																	47573998		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF146277	CCDS34472.1	6p12	2008-02-05			ENSG00000198087	ENSG00000198087			14258	protein-coding gene	gene with protein product		604241				10339567	Standard	NM_012120		Approved	CMS	uc003oyw.3	Q9Y5K6	OTTHUMG00000014799	ENST00000359314.5:c.1515C>T	6.37:g.47573998C>T			A6NL34|Q5VYA3|Q9UG97	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	p.F505	ENST00000359314.5	37	c.1515	CCDS34472.1	6																																																																																			-	CD2AP	-	NULL		0.398	CD2AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2AP	HGNC	protein_coding	OTTHUMT00000040817.2	0	0	1	48	48	122	0.00	0.81	C			47573998	+1	26	15	92	94	tier1	no_errors	ENST00000359314	ensembl	human	known	74_37	silent	22.03	13.76	SNP	1.000	T	26	92
TYK2	7297	genome.wustl.edu	37	19	10463610	10463610	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:10463610G>A	ENST00000525621.1	-	22	3673	c.3192C>T	c.(3190-3192)ccC>ccT	p.P1064P	TYK2_ENST00000529422.1_Intron|TYK2_ENST00000524462.1_Silent_p.P879P|TYK2_ENST00000264818.6_Silent_p.P1064P	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1064	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			ACCAGAACACGGGGCTGTCCC	0.627													ENSG00000105397																																					0													74.0	66.0	69.0					19																	10463610		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3192C>T	19.37:g.10463610G>A			Q6QB10|Q96CH0	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.P1064	ENST00000525621.1	37	c.3192	CCDS12236.1	19																																																																																			-	TYK2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.627	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	0	0	0	54	54	48	0.00	0.00	G			10463610	-1	15	8	12	12	tier1	no_errors	ENST00000264818	ensembl	human	known	74_37	silent	55.56	40.00	SNP	0.036	A	15	12
SLC38A8	146167	genome.wustl.edu	37	16	84063139	84063139	+	Missense_Mutation	SNP	G	G	A	rs146442665	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr16:84063139G>A	ENST00000299709.3	-	5	649	c.650C>T	c.(649-651)tCt>tTt	p.S217F		NM_001080442.1	NP_001073911.1	A6NNN8	S38A8_HUMAN	solute carrier family 38, member 8	217					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ACTGAACACAGAGGTCCAGGA	0.502													ENSG00000166558																																					0													92.0	90.0	90.0					16																	84063139		2200	4300	6500	SO:0001583	missense	0			-		CCDS32495.1	16q23.3	2013-05-22				ENSG00000166558		"""Solute carriers"""	32434	protein-coding gene	gene with protein product		615585					Standard	XM_006721135		Approved		uc002fhg.1	A6NNN8		ENST00000299709.3:c.650C>T	16.37:g.84063139G>A	ENSP00000299709:p.Ser217Phe			Missense_Mutation	SNP	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease	p.S217F	ENST00000299709.3	37	c.650	CCDS32495.1	16	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033913	0.54896	.	.	ENSG00000166558	ENST00000299709	T	0.02498	4.27	5.25	4.28	0.50868	.	0.115957	0.64402	D	0.000010	T	0.04770	0.0129	L	0.47716	1.5	0.80722	D	1	B	0.33494	0.414	B	0.38378	0.272	T	0.43972	-0.9358	10	0.48119	T	0.1	.	13.2767	0.60191	0.0775:0.0:0.9225:0.0	.	217	A6NNN8	S38A8_HUMAN	F	217	ENSP00000299709:S217F	ENSP00000299709:S217F	S	-	2	0	SLC38A8	82620640	1.000000	0.71417	0.955000	0.39395	0.905000	0.53344	6.957000	0.76019	2.621000	0.88768	0.643000	0.83706	TCT	-	SLC38A8	-	pfam_AA_transpt_TM,pfam_Tryptophan/tyrosine_permease		0.502	SLC38A8-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	SLC38A8	HGNC	protein_coding	OTTHUMT00000432623.1	0	0	0	105	105	130	0.00	0.00	G	NM_001080442		84063139	-1	33	39	45	96	tier1	no_errors	ENST00000299709	ensembl	human	known	74_37	missense	42.31	28.89	SNP	0.998	A	33	45
MTMR8	55613	genome.wustl.edu	37	X	63563503	63563503	+	Missense_Mutation	SNP	A	A	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrX:63563503A>C	ENST00000374852.3	-	8	1030	c.963T>G	c.(961-963)atT>atG	p.I321M	MTMR8_ENST00000478487.1_5'UTR|MTMR8_ENST00000453546.1_Missense_Mutation_p.I321M	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	321	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						TTGTAATGAAAATTCCAGCAT	0.348													ENSG00000102043																																					1	Whole gene deletion(1)	ovary(1)											61.0	51.0	54.0					X																	63563503		2203	4299	6502	SO:0001583	missense	0			-	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.963T>G	X.37:g.63563503A>C	ENSP00000363985:p.Ile321Met		Q5JT99|Q9NXP6	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,smart_Tyr_Pase_cat	p.I321M	ENST00000374852.3	37	c.963	CCDS14379.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.34|15.34	2.803252|2.803252	0.50315|0.50315	.|.	.|.	ENSG00000102043|ENSG00000102043	ENST00000442913|ENST00000453546;ENST00000374852;ENST00000247400	.|D;D	.|0.90504	.|-2.68;-2.68	3.12|3.12	1.98|1.98	0.26296|0.26296	.|Myotubularin phosphatase domain (1);	.|0.149340	.|0.30630	.|U	.|0.009201	D|D	0.90314|0.90314	0.6970|0.6970	M|M	0.74647|0.74647	2.275|2.275	0.26616|0.26616	N|N	0.972746|0.972746	.|P;P	.|0.46706	.|0.879;0.883	.|B;P	.|0.50192	.|0.295;0.634	D|D	0.83673|0.83673	0.0167|0.0167	5|10	.|0.72032	.|D	.|0.01	.|.	4.991|4.991	0.14214|0.14214	0.7603:0.0:0.2397:0.0|0.7603:0.0:0.2397:0.0	.|.	.|321;321	.|B4DQL0;Q96EF0	.|.;MTMR8_HUMAN	V|M	125|321;321;207	.|ENSP00000394003:I321M;ENSP00000363985:I321M	.|ENSP00000247400:I207M	F|I	-|-	1|3	0|3	MTMR8|MTMR8	63480228|63480228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	1.269000|1.269000	0.33074|0.33074	1.283000|1.283000	0.44513|0.44513	0.417000|0.417000	0.27973|0.27973	TTT|ATT	-	MTMR8	-	smart_Tyr_Pase_cat		0.348	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR8	HGNC	protein_coding	OTTHUMT00000056949.2	0	0	0	98	98	139	0.00	0.00	A	NM_017677		63563503	-1	33	27	128	103	tier1	no_errors	ENST00000374852	ensembl	human	known	74_37	missense	20.50	20.61	SNP	1.000	C	33	128
ARRDC5	645432	genome.wustl.edu	37	19	4891074	4891074	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:4891074G>C	ENST00000381781.2	-	3	1012	c.1013C>G	c.(1012-1014)cCa>cGa	p.P338R	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	338										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		CTGGTGATCTGGGTTCACGGG	0.502													ENSG00000205784																																					0													69.0	70.0	70.0					19																	4891074		1981	4173	6154	SO:0001583	missense	0			-		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.1013C>G	19.37:g.4891074G>C	ENSP00000371200:p.Pro338Arg			Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.P338R	ENST00000381781.2	37	c.1013	CCDS45929.1	19	.	.	.	.	.	.	.	.	.	.	G	3.429	-0.116419	0.06881	.	.	ENSG00000205784	ENST00000381781	T	0.17213	2.29	3.68	-7.36	0.01417	Immunoglobulin E-set (1);	2.856690	0.02009	N	0.046854	T	0.11153	0.0272	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21381	-1.0247	10	0.66056	D	0.02	0.3088	6.3208	0.21217	0.0867:0.2957:0.4985:0.1191	.	338	A6NEK1	ARRD5_HUMAN	R	338	ENSP00000371200:P338R	ENSP00000371200:P338R	P	-	2	0	ARRDC5	4842074	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.387000	0.00488	-4.044000	0.00079	-1.075000	0.02238	CCA	-	ARRDC5	-	superfamily_Ig_E-set		0.502	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	HGNC	protein_coding	OTTHUMT00000450443.1	0	0	0	73	73	97	0.00	0.00	G	XM_292803		4891074	-1	62	33	100	97	tier1	no_errors	ENST00000381781	ensembl	human	known	74_37	missense	37.80	25.38	SNP	0.000	C	62	100
PTPN4	5775	genome.wustl.edu	37	2	120704097	120704097	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:120704097G>A	ENST00000263708.2	+	18	2374	c.1603G>A	c.(1603-1605)Gga>Aga	p.G535R	PTPN4_ENST00000544261.1_Missense_Mutation_p.G168R	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	535	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	TTTTAAGGGAGGATATGATCA	0.299													ENSG00000088179																																					0													101.0	101.0	101.0					2																	120704097		2203	4299	6502	SO:0001583	missense	0			-		CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.1603G>A	2.37:g.120704097G>A	ENSP00000263708:p.Gly535Arg		B2RBV8|Q9UDA7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.G535R	ENST00000263708.2	37	c.1603	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	G	23.1	4.371536	0.82573	.	.	ENSG00000088179	ENST00000263708;ENST00000544261;ENST00000431283	T;T;T	0.31769	1.48;1.48;1.48	5.09	5.09	0.68999	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	H	0.96489	3.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81195	-0.1043	10	0.87932	D	0	.	18.8463	0.92208	0.0:0.0:1.0:0.0	.	535	P29074	PTN4_HUMAN	R	535;168;161	ENSP00000263708:G535R;ENSP00000445841:G168R;ENSP00000387457:G161R	ENSP00000263708:G535R	G	+	1	0	PTPN4	120420567	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.522000	0.73783	2.513000	0.84729	0.591000	0.81541	GGA	-	PTPN4	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_PDZ		0.299	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	0	0	0	53	53	82	0.00	0.00	G			120704097	+1	21	21	76	73	tier1	no_errors	ENST00000263708	ensembl	human	known	74_37	missense	21.65	22.34	SNP	1.000	A	21	76
HACE1	57531	genome.wustl.edu	37	6	105219148	105219148	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr6:105219148C>G	ENST00000262903.4	-	19	2407	c.2131G>C	c.(2131-2133)Gag>Cag	p.E711Q	HACE1_ENST00000517995.1_5'UTR|HACE1_ENST00000369125.2_Intron	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	711	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		ACATCAGTCTCAACAGAAAAA	0.373													ENSG00000085382																																					0													107.0	110.0	109.0					6																	105219148		2203	4300	6503	SO:0001583	missense	0			-	BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.2131G>C	6.37:g.105219148C>G	ENSP00000262903:p.Glu711Gln		A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.E711Q	ENST00000262903.4	37	c.2131	CCDS5050.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.632366|4.632366	0.87660|0.87660	.|.	.|.	ENSG00000085382|ENSG00000085382	ENST00000262903|ENST00000518503;ENST00000518402	T|.	0.58358|.	0.34|.	5.62|5.62	5.62|5.62	0.85841|0.85841	HECT (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.65554|.	0.2702|.	L|L	0.56340|0.56340	1.77|1.77	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;0.999;1.0|.	D;D;D|.	0.87578|.	0.977;0.998;0.998|.	T|.	0.61676|.	-0.7014|.	10|.	0.87932|.	D|.	0|.	.|.	19.6632|19.6632	0.95882|0.95882	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	200;711;364|.	B4DFM6;Q8IYU2;Q8IYU2-3|.	.;HACE1_HUMAN;.|.	Q|S	711|193;145	ENSP00000262903:E711Q|.	ENSP00000262903:E711Q|.	E|X	-|-	1|2	0|2	HACE1|HACE1	105325841|105325841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.466000|7.466000	0.80914|0.80914	2.625000|2.625000	0.88918|0.88918	0.655000|0.655000	0.94253|0.94253	GAG|TGA	-	HACE1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.373	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	0	0	0	56	56	151	0.00	0.00	C	XM_045095		105219148	-1	26	31	100	112	tier1	no_errors	ENST00000262903	ensembl	human	known	74_37	missense	20.47	21.68	SNP	1.000	G	26	100
MGA	23269	genome.wustl.edu	37	15	41961309	41961309	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr15:41961309G>C	ENST00000570161.1	+	1	217	c.217G>C	c.(217-219)Ggt>Cgt	p.G73R	MGA_ENST00000219905.7_Missense_Mutation_p.G73R|MGA_ENST00000389936.4_Missense_Mutation_p.G73R|MGA_ENST00000545763.1_Missense_Mutation_p.G73R|MGA_ENST00000568630.1_Intron|MGA_ENST00000566586.1_Missense_Mutation_p.G73R			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Ser/Thr-rich.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGTACTGTGGGTGGAATCAC	0.423													ENSG00000174197																																					0													132.0	130.0	130.0					15																	41961309		1905	4127	6032	SO:0001583	missense	0			-	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.217G>C	15.37:g.41961309G>C	ENSP00000457035:p.Gly73Arg		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_D-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.G73R	ENST00000570161.1	37	c.217	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	17.26	3.345102	0.61073	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84298	-1.82;-1.83;-1.8	5.51	5.51	0.81932	.	0.107905	0.64402	D	0.000005	D	0.87669	0.6235	L	0.29908	0.895	0.41525	D	0.988428	P;D	0.59767	0.891;0.986	P;P	0.61477	0.74;0.889	D	0.87769	0.2604	10	0.49607	T	0.09	.	19.7791	0.96410	0.0:0.0:1.0:0.0	.	73;73	F5H7K2;E7ENI0	.;.	R	73	ENSP00000219905:G73R;ENSP00000374586:G73R;ENSP00000442467:G73R	ENSP00000219905:G73R	G	+	1	0	MGA	39748601	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.245000	0.65405	2.763000	0.94921	0.650000	0.86243	GGT	-	MGA	-	NULL		0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	0	0	0	50	50	122	0.00	0.00	G	NM_001164273.1		41961309	+1	30	25	78	114	tier1	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	27.78	17.99	SNP	1.000	C	30	78
CEACAM5	1048	genome.wustl.edu	37	19	42224076	42224076	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr19:42224076C>T	ENST00000221992.6	+	7	1834	c.1720C>T	c.(1720-1722)Cag>Tag	p.Q574*	CEACAM5_ENST00000405816.1_Nonsense_Mutation_p.Q574*|CEACAM5_ENST00000398599.4_Nonsense_Mutation_p.Q573*|CEA_ENST00000598976.1_Intron	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	574	Ig-like 6.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		ATGTGGAATCCAGAACTCAGT	0.522													ENSG00000105388																																					0													206.0	188.0	194.0					19																	42224076		2203	4300	6503	SO:0001587	stop_gained	0			-	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1720C>T	19.37:g.42224076C>T	ENSP00000221992:p.Gln574*		H9KVA7	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q574*	ENST00000221992.6	37	c.1720	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.58|14.58	2.578622|2.578622	0.46006|0.46006	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|.	.|.	.|.	2.51|2.51	-4.18|-4.18	0.03846|0.03846	.|.	.|.	.|.	.|.	.|.	T|.	0.17195|.	0.0413|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.30297|.	-0.9983|.	3|.	.|0.18710	.|T	.|0.47	.|.	3.6785|3.6785	0.08301|0.08301	0.2046:0.4366:0.0:0.3588|0.2046:0.4366:0.0:0.3588	.|.	.|.	.|.	.|.	L|X	569|574;574;292	.|.	.|ENSP00000221992:Q574X	P|Q	+|+	2|1	0|0	CEACAM5|CEACAM5	46915916|46915916	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.021000|0.021000	0.10359|0.10359	-3.663000|-3.663000	0.00400|0.00400	-1.160000|-1.160000	0.02804|0.02804	0.460000|0.460000	0.39030|0.39030	CCA|CAG	-	CEACAM5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.522	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	0	0	0	107	107	59	0.00	0.00	C	NM_004363		42224076	+1	66	8	136	32	tier1	no_errors	ENST00000221992	ensembl	human	known	74_37	nonsense	32.67	20.00	SNP	0.000	T	66	136
ABCC2	1244	genome.wustl.edu	37	10	101595898	101595898	+	Silent	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr10:101595898C>T	ENST00000370449.4	+	25	3578	c.3465C>T	c.(3463-3465)acC>acT	p.T1155T		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	1155	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACTCTGTCACCAGGTCCCCAA	0.512													ENSG00000023839																																					0													137.0	126.0	130.0					10																	101595898		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.3465C>T	10.37:g.101595898C>T			B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.T1155	ENST00000370449.4	37	c.3465	CCDS7484.1	10																																																																																			-	ABCC2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc		0.512	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	0	0	0	55	55	67	0.00	0.00	C	NM_000392		101595898	+1	44	41	32	18	tier1	no_errors	ENST00000370449	ensembl	human	known	74_37	silent	57.89	69.49	SNP	0.997	T	44	32
BTBD10	84280	genome.wustl.edu	37	11	13441262	13441262	+	Frame_Shift_Del	DEL	G	G	-			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:13441262delG	ENST00000278174.5	-	4	574	c.329delC	c.(328-330)ccafs	p.P110fs	BTBD10_ENST00000528120.1_Frame_Shift_Del_p.P62fs|BTBD10_ENST00000530907.1_Frame_Shift_Del_p.P118fs|BTBD10_ENST00000532261.1_5'UTR	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	110	Ser-rich.					nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		CGGACTGCTTGGACGAGAGGA	0.388													ENSG00000148925																																					0													148.0	143.0	145.0					11																	13441262		2200	4294	6494	SO:0001589	frameshift_variant	0				AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.329delC	11.37:g.13441262delG	ENSP00000278174:p.Pro110fs		B7Z228|Q86WG1	Frame_Shift_Del	DEL	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.P110fs	ENST00000278174.5	37	c.329	CCDS7811.1	11																																																																																				BTBD10	-	NULL		0.388	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	HGNC	protein_coding	OTTHUMT00000386200.1	0	0	0	38	38	48	0.00	0.00	G	NM_032320		13441262	-1	66	37	14	5	tier1	no_errors	ENST00000278174	ensembl	human	known	74_37	frame_shift_del	82.50	88.10	DEL	1.000	-	66	14
FAM131C	348487	genome.wustl.edu	37	1	16384813	16384813	+	3'UTR	SNP	G	G	C			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:16384813G>C	ENST00000375662.4	-	0	1145				FAM131C_ENST00000494078.1_5'UTR	NM_182623.2	NP_872429.2	Q96AQ9	F131C_HUMAN	family with sequence similarity 131, member C											large_intestine(2)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		CACCTACCCTGTGCCTACCCG	0.677													ENSG00000185519																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS41270.1	1p36.13	2008-02-05	2007-03-20	2007-03-20	ENSG00000185519	ENSG00000185519			26717	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 117"""	C1orf117		12477932	Standard	NM_182623		Approved	FLJ36766	uc001axz.4	Q96AQ9	OTTHUMG00000009525	ENST00000375662.4:c.*119C>G	1.37:g.16384813G>C			Q5T5Q5|Q8N3X3|Q8N9P9	R	SNP	-	NULL	ENST00000375662.4	37	NULL	CCDS41270.1	1																																																																																			-	FAM131C	-	-		0.677	FAM131C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM131C	HGNC	protein_coding	OTTHUMT00000026319.1	0	0	0	124	124	5	0.00	0.00	G	NM_182623		16384813	-1	31	0	51	0	tier1	no_errors	ENST00000494078	ensembl	human	known	74_37	rna	37.80	0.00	SNP	0.002	C	31	51
DLGAP3	58512	genome.wustl.edu	37	1	35351792	35351792	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:35351792C>T	ENST00000373347.1	-	6	1749	c.1481G>A	c.(1480-1482)gGc>gAc	p.G494D	DLGAP3_ENST00000235180.4_Missense_Mutation_p.G494D			O95886	DLGP3_HUMAN	discs, large (Drosophila) homolog-associated protein 3	494					cell-cell signaling (GO:0007267)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(23)|ovary(4)|prostate(3)|skin(3)|urinary_tract(1)	46		Myeloproliferative disorder(586;0.0393)				GCGGAAACAGCCGGGCAGGTC	0.687													ENSG00000116544																																					0													17.0	21.0	19.0					1																	35351792		2199	4296	6495	SO:0001583	missense	0			-	AF131778	CCDS30670.1	1p35.3-p34.1	2008-02-05			ENSG00000116544	ENSG00000116544			30368	protein-coding gene	gene with protein product		611413				8619474, 9110174	Standard	NM_001080418		Approved	SAPAP3, DAP3	uc001byc.3	O95886	OTTHUMG00000004049	ENST00000373347.1:c.1481G>A	1.37:g.35351792C>T	ENSP00000362444:p.Gly494Asp		Q5TDD5|Q9H3X7	Missense_Mutation	SNP	pfam_GKAP	p.G494D	ENST00000373347.1	37	c.1481	CCDS30670.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.440685	0.96168	.	.	ENSG00000116544	ENST00000373347;ENST00000235180	D;D	0.88586	-2.4;-2.4	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.93897	0.8047	M	0.78456	2.415	0.80722	D	1	D	0.71674	0.998	P	0.61874	0.895	D	0.94503	0.7711	10	0.87932	D	0	-19.7087	18.6083	0.91275	0.0:1.0:0.0:0.0	.	494	O95886	DLGP3_HUMAN	D	494	ENSP00000362444:G494D;ENSP00000235180:G494D	ENSP00000235180:G494D	G	-	2	0	DLGAP3	35124379	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.872000	0.69636	2.625000	0.88918	0.555000	0.69702	GGC	-	DLGAP3	-	NULL		0.687	DLGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP3	HGNC	protein_coding	OTTHUMT00000011554.1	0	0	0	42	42	9	0.00	0.00	C	NM_021234		35351792	-1	3	0	14	9	tier1	no_errors	ENST00000235180	ensembl	human	known	74_37	missense	17.65	0.00	SNP	1.000	T	3	14
IFITM3	10410	genome.wustl.edu	37	11	320723	320723	+	Missense_Mutation	SNP	C	C	T	rs199582787	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr11:320723C>T	ENST00000399808.4	-	1	327	c.91G>A	c.(91-93)Gtg>Atg	p.V31M	RP11-326C3.11_ENST00000602756.1_RNA|IFITM3_ENST00000602735.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000508004.2_RNA|RP11-326C3.10_ENST00000534271.1_RNA|RP11-326C3.14_ENST00000602809.1_lincRNA|IFITM3_ENST00000526811.1_Missense_Mutation_p.V10M|RP11-326C3.11_ENST00000602429.1_RNA	NM_021034.2	NP_066362.2	Q01628	IFM3_HUMAN	interferon induced transmembrane protein 3	31					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral transcription (GO:0032897)|response to interferon-alpha (GO:0035455)|response to interferon-beta (GO:0035456)|response to interferon-gamma (GO:0034341)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				central_nervous_system(7)|endometrium(7)|kidney(2)|large_intestine(1)|lung(1)	18		all_cancers(49;2e-09)|all_epithelial(84;3.36e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;8.85e-28)|Epithelial(43;5.52e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCCCCCAGCACAGCCACCTCG	0.612													ENSG00000142089																																					0													87.0	98.0	95.0					11																	320723		1967	4140	6107	SO:0001583	missense	0			-	X57352	CCDS41585.1	11p15.5	2011-05-24	2011-05-24		ENSG00000142089	ENSG00000142089			5414	protein-coding gene	gene with protein product		605579	"""interferon induced transmembrane protein 3 (1-8U)"""			1906403, 16326387	Standard	NM_021034		Approved	1-8U	uc001lpa.2	Q01628		ENST00000399808.4:c.91G>A	11.37:g.320723C>T	ENSP00000382707:p.Val31Met		Q53Y76|Q96HK8|Q96J15	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.V31M	ENST00000399808.4	37	c.91	CCDS41585.1	11	.	.	.	.	.	.	.	.	.	.	C	11.06	1.526447	0.27299	.	.	ENSG00000142089	ENST00000399808;ENST00000270031;ENST00000526811	T;T	0.79454	-1.03;-1.27	4.61	-4.91	0.03085	.	11.488500	0.02440	N	0.084490	T	0.64516	0.2605	L	0.39147	1.195	0.09310	N	1	B	0.16802	0.019	B	0.15484	0.013	T	0.46400	-0.9194	10	0.13108	T	0.6	0.9022	6.4601	0.21952	0.1231:0.361:0.0:0.5159	.	31	Q01628	IFM3_HUMAN	M	31;15;10	ENSP00000382707:V31M;ENSP00000432108:V10M	ENSP00000372047:V15M	V	-	1	0	IFITM3	310723	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-1.638000	0.02013	-0.562000	0.06086	-1.790000	0.00627	GTG	rs199582787	IFITM3	-	NULL		0.612	IFITM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFITM3	HGNC	protein_coding	OTTHUMT00000384765.1	0	0	0	63	63	10	0.00	0.00	C	NM_021034		320723	-1	9	1	42	8	tier1	no_errors	ENST00000399808	ensembl	human	known	74_37	missense	17.65	11.11	SNP	0.000	T	9	42
LOXHD1	125336	genome.wustl.edu	37	18	44146368	44146368	+	Silent	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr18:44146368G>T	ENST00000398722.4	-	10	1454	c.1455C>A	c.(1453-1455)gcC>gcA	p.A485A	LOXHD1_ENST00000441551.2_Silent_p.A763A|LOXHD1_ENST00000536736.1_Silent_p.A763A			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	485	PLAT 4. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GGAACCAGCTGGCATGCATGC	0.592													ENSG00000167210																																					0													57.0	54.0	55.0					18																	44146368		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.1455C>A	18.37:g.44146368G>T			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.A763	ENST00000398722.4	37	c.2289		18	.	.	.	.	.	.	.	.	.	.	G	2.650	-0.282215	0.05642	.	.	ENSG00000167210	ENST00000441551	.	.	.	4.95	-5.58	0.02512	.	.	.	.	.	T	0.35038	0.0918	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.42599	-0.9442	4	.	.	.	.	0.6543	0.00832	0.2271:0.1545:0.259:0.3593	.	.	.	.	K	744	.	.	Q	-	1	0	LOXHD1	42400366	0.067000	0.21026	0.039000	0.18376	0.320000	0.28249	-0.475000	0.06599	-0.612000	0.05701	-0.479000	0.04858	CAG	-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.592	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0	0	40	40	21	0.00	0.00	G	NM_144612		44146368	-1	4	0	27	7	tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	12.90	0.00	SNP	0.277	T	4	27
ANKRD20A2	441430	genome.wustl.edu	37	9	42375546	42375547	+	Intron	INS	-	-	ACACC	rs376182807		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:42375546_42375547insACACC	ENST00000377601.2	+	4	604				ANKRD20A2_ENST00000477139.2_3'UTR	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2											large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						CTGGGATCCTGACACCATTCAT	0.431													ENSG00000183148																																					0																																										SO:0001627	intron_variant	0					CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.493-714->ACACC	9.37:g.42375547_42375551dupACACC				R	INS	-	NULL	ENST00000377601.2	37	NULL	CCDS35028.1	9																																																																																				ANKRD20A2	-	-		0.431	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A2	HGNC	protein_coding	OTTHUMT00000129794.1	0	0	0	0	0	0	0.00	0.00	-	NM_001012421		42375547	+1	0	0	0	0	tier1	no_errors	ENST00000477139	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.000:0.000	ACACC	0	0
AK5	26289	genome.wustl.edu	37	1	77857120	77857125	+	Intron	DEL	ATATAC	ATATAC	-	rs59295145|rs150964634	byFrequency	TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	ATATAC	ATATAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:77857120_77857125delATATAC	ENST00000354567.2	+	7	1154				AC095030.1_ENST00000408737.1_RNA|AK5_ENST00000344720.5_Intron	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						atatatacatatatacatatatgtgt	0.238													ENSG00000221664																																					0																																										SO:0001627	intron_variant	0				AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19541ATATAC>-	1.37:g.77857120_77857125delATATAC			Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	R	DEL	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																				AC095030.1	-	-		0.238	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000026993.4	0	0	0	0	0	0	0.00	0.00	ATATAC	NM_174858		77857125	-1	0	0	0	0	tier1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	0.00	0.00	DEL	0.993:0.996:0.997:0.998:0.999:0.999	-	0	0
LOC101927209	101927209	genome.wustl.edu	37	1	142653747	142653747	+	lincRNA	SNP	G	G	T			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr1:142653747G>T	ENST00000610091.1	-	0	3560				RP11-417J8.3_ENST00000426408.1_lincRNA|AL583842.2_ENST00000582446.1_RNA|AL583842.1_ENST00000459390.1_RNA|AL583842.3_ENST00000580249.1_RNA																							aatcccatctgcgggacaaac	0.463													ENSG00000239012																																					0																																												0			-																													1.37:g.142653747G>T				R	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	AL583842.1	-	-		0.463	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000239012	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000037265.2	1	1	0	235	235	0	0.42	0.00	G			142653747	+1	65	0	414	0	tier1	no_errors	ENST00000459390	ensembl	human	novel	74_37	rna	13.54	0.00	SNP	0.000	T	65	414
HNRNPA3	220988	genome.wustl.edu	37	2	178080861	178080861	+	Missense_Mutation	SNP	G	G	T	rs199989994		TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr2:178080861G>T	ENST00000392524.2	+	4	735	c.498G>T	c.(496-498)aaG>aaT	p.K166N	HNRNPA3_ENST00000411529.2_Missense_Mutation_p.K144N|HNRNPA3_ENST00000435711.1_Missense_Mutation_p.K166N			P51991	ROA3_HUMAN	heterogeneous nuclear ribonucleoprotein A3	166	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|urinary_tract(1)	16						GTGGAAAAAAGAGAGGATTTG	0.318													ENSG00000170144																																					0													26.0	27.0	27.0					2																	178080861		2199	4256	6455	SO:0001583	missense	0			-	AF517524	CCDS2273.1	2q31.2	2013-02-12		2008-04-18	ENSG00000170144	ENSG00000170144		"""RNA binding motif (RRM) containing"""	24941	protein-coding gene	gene with protein product		605372		HNRPA3		11886857, 15776420	Standard	XM_005246380		Approved		uc002ulc.1	P51991	OTTHUMG00000132529	ENST00000392524.2:c.498G>T	2.37:g.178080861G>T	ENSP00000376309:p.Lys166Asn		D3DPF4|Q53RW7|Q6URK5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K166N	ENST00000392524.2	37	c.498	CCDS2273.1	2	.	.	.	.	.	.	.	.	.	.	G	15.33	2.801226	0.50315	.	.	ENSG00000170144	ENST00000392524;ENST00000411529;ENST00000416446;ENST00000420139;ENST00000435711	D;D;D	0.92495	-3.05;-3.05;-3.05	4.11	-0.176	0.13311	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.48286	U	0.000187	D	0.91798	0.7405	L	0.37630	1.12	0.53688	D	0.999977	D;D	0.89917	1.0;0.998	D;D	0.71414	0.973;0.943	D	0.89221	0.3571	10	0.72032	D	0.01	.	9.4697	0.38835	0.6151:0.0:0.3849:0.0	.	144;166	B4DDB6;P51991	.;ROA3_HUMAN	N	166;144;144;144;166	ENSP00000376309:K166N;ENSP00000408487:K144N;ENSP00000416340:K166N	ENSP00000376309:K166N	K	+	3	2	HNRNPA3	177789107	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	1.290000	0.33319	-0.025000	0.13918	-0.373000	0.07131	AAG	-	HNRNPA3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.318	HNRNPA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPA3	HGNC	protein_coding	OTTHUMT00000255729.3	0	0	0	31	31	1	0.00	0.00	G	NM_194247		178080861	+1	4	0	20	0	tier1	no_errors	ENST00000392524	ensembl	human	known	74_37	missense	16.67	0.00	SNP	1.000	T	4	20
MT-ATP6	4508	genome.wustl.edu	37	M	8714	8714	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chrM:8714C>A	ENST00000361899.2	+	1	188	c.188C>A	c.(187-189)aCt>aAt	p.T63N	MT-TR_ENST00000387439.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA			P00846	ATP6_HUMAN	mitochondrially encoded ATP synthase 6	63					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|proton-transporting ATP synthase complex, coupling factor F(o) (GO:0045263)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(7)|kidney(8)|prostate(1)	18						CATACACAACACTAAAGGACG	0.403													ENSG00000198899																																					0																																										SO:0001583	missense	0			-			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198899	ENSG00000198899		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7414	protein-coding gene	gene with protein product		516060	"""ATP synthase 6"", ""spicular retinitis pigmentosa with dementia, seizures, ataxia, proximal muscle weakness and sensory deficit"""	MTATP6, RP		7219534	Standard			Approved	ATP6, ATPase-6, Su6m		P00846		ENST00000361899.2:c.188C>A	M.37:g.8714C>A	ENSP00000354632:p.Thr63Asn		Q34772|Q5S8W5|Q5S9E7|Q5S9I6|Q5SA31|Q6RPB7|Q6VHC0|Q6VHE0|Q6WQF4|Q7YCC1|Q7YCF8|Q7YCG1|Q85KU8|Q85KX1|Q85L05|Q8HNQ4|Q8HNQ8|Q8WCX6|Q9B2U5|Q9B2Z2	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,prints_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu	p.T63N	ENST00000361899.2	37	c.188		MT																																																																																			-	MT-ATP6	-	pfam_ATPase_F0-cplx_asu,superfamily_ATPase_F0-cplx_asu,tigrfam_ATPase_F0-cplx_asu		0.403	MT-ATP6-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP6	HGNC	protein_coding		0	0	0	46	46	4	0.00	0.00	C	YP_003024031		8714	+1	2	0	9	0	tier1	no_errors	ENST00000361899	ensembl	human	known	74_37	missense	18.18	0.00	SNP	NULL	A	2	9
WASH3P	374666	genome.wustl.edu	37	15	102515340	102515340	+	RNA	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr15:102515340G>A	ENST00000557932.1	+	0	1186				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GAAAGCTGGAGAAGAAGCAGC	0.652													ENSG00000185596																																					0																																												0			-			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102515340G>A				R	SNP	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			-	WASH3P	-	-		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	0	0	0	305	305	0	0.00	0.00	G	NM_199163		102515340	+1	68	0	89	1	tier1	no_errors	ENST00000557932	ensembl	human	known	74_37	rna	43.31	0.00	SNP	1.000	A	68	89
CBWD1	55871	genome.wustl.edu	37	9	122049	122049	+	Silent	SNP	G	G	A			TCGA-SI-A71Q-01A-12D-A33E-09	TCGA-SI-A71Q-10A-01D-A33H-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	289dd857-9301-4214-8ae5-3ae1f84be485	bbc63b41-0a71-4886-9194-ffdeae6bb13f	g.chr9:122049G>A	ENST00000356521.4	-	14	1081	c.993C>T	c.(991-993)gtC>gtT	p.V331V	CBWD1_ENST00000377400.4_Silent_p.V283V|CBWD1_ENST00000475411.1_5'UTR|CBWD1_ENST00000314367.10_Silent_p.V295V|CBWD1_ENST00000382447.4_Silent_p.V312V	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1	331	CobW C-terminal.						ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GGACACCCTGGACAATCACTT	0.433													ENSG00000172785																																					0													1.0	1.0	1.0					9																	122049		584	1229	1813	SO:0001819	synonymous_variant	0			-	AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.993C>T	9.37:g.122049G>A			A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	Silent	SNP	pfam_CobW/HypB/UreG_dom,pfam_Cbl_biosynth_CobW-like_C,superfamily_P-loop_NTPase,superfamily_Cbl_biosynth_CobW-like_C	p.V331	ENST00000356521.4	37	c.993	CCDS6438.1	9																																																																																			-	CBWD1	-	pfam_Cbl_biosynth_CobW-like_C,superfamily_Cbl_biosynth_CobW-like_C		0.433	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	0	0	0	181	181	2	0.00	0.00	G	NM_018491		122049	-1	108	2	5	0	tier1	no_errors	ENST00000356521	ensembl	human	known	74_37	silent	95.58	100.00	SNP	1.000	A	108	5
