#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
TAF1	6872	genome.wustl.edu	37	X	70598812	70598812	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:70598812C>T	ENST00000373790.4	+	8	1339	c.1288C>T	c.(1288-1290)Cgt>Tgt	p.R430C	TAF1_ENST00000423759.1_Missense_Mutation_p.R451C|TAF1_ENST00000276072.3_Missense_Mutation_p.R451C|TAF1_ENST00000449580.1_Missense_Mutation_p.R430C	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	430					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				AAAACCTCAGCGTGCAAGCCT	0.507													ENSG00000147133																																					0													224.0	166.0	186.0					X																	70598812		2203	4300	6503	SO:0001583	missense	0			-		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1288C>T	X.37:g.70598812C>T	ENSP00000362895:p.Arg430Cys		A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R430C	ENST00000373790.4	37	c.1288	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	17.02	3.282588	0.59867	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.10382	2.88;2.94;2.93;2.88	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.20129	0.0484	L	0.47716	1.5	0.80722	D	1	D;D	0.59357	0.975;0.985	P;P	0.54815	0.582;0.761	T	0.00124	-1.2024	10	0.72032	D	0.01	.	12.7536	0.57321	0.2863:0.7137:0.0:0.0	.	430;451	P21675;P21675-2	TAF1_HUMAN;.	C	430;430;451;451	ENSP00000362895:R430C;ENSP00000389000:R430C;ENSP00000406549:R451C;ENSP00000276072:R451C	ENSP00000276072:R451C	R	+	1	0	TAF1	70515537	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.603000	0.46266	2.498000	0.84270	0.513000	0.50165	CGT	-	TAF1	-	pirsf_TAF1_animal		0.507	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	0	0	0	60	60	17	0.00	0.00	C	NM_004606		70598812	+1	27	6	52	21	tier1	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	34.18	22.22	SNP	1.000	T	27	52
F8	2157	genome.wustl.edu	37	X	154124375	154124375	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:154124375C>T	ENST00000360256.4	-	22	6606	c.6406G>A	c.(6406-6408)Gga>Aga	p.G2136R		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2136	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GTGGAATTTCCTCGATAAGTC	0.403													ENSG00000185010																																					0			GRCh37	CI064690	F8	I							144.0	138.0	140.0					X																	154124375		2203	4300	6503	SO:0001583	missense	0			-	M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.6406G>A	X.37:g.154124375C>T	ENSP00000353393:p.Gly2136Arg		Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.G2136R	ENST00000360256.4	37	c.6406	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	c	26.2	4.715536	0.89112	.	.	ENSG00000185010	ENST00000360256	D	0.98937	-5.25	5.65	5.65	0.86999	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.049433	0.85682	D	0.000000	D	0.99187	0.9718	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99640	1.0988	10	0.87932	D	0	-17.2037	17.1744	0.86837	0.0:1.0:0.0:0.0	.	2136	P00451	FA8_HUMAN	R	2136	ENSP00000353393:G2136R	ENSP00000353393:G2136R	G	-	1	0	F8	153777569	1.000000	0.71417	0.995000	0.50966	0.992000	0.81027	6.782000	0.75073	2.370000	0.80446	0.600000	0.82982	GGA	-	F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.403	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	0	0	0	101	101	108	0.00	0.00	C			154124375	-1	20	19	104	90	tier1	no_errors	ENST00000360256	ensembl	human	known	74_37	missense	16.13	17.43	SNP	1.000	T	20	104
C15orf52	388115	genome.wustl.edu	37	15	40630782	40630782	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr15:40630782C>T	ENST00000559313.1	-	5	614	c.599G>A	c.(598-600)cGa>cAa	p.R200Q	C15orf52_ENST00000397536.2_5'Flank|C15orf52_ENST00000557973.1_5'Flank	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52	200							poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		GGGGGGGCTTCGGGTCACACG	0.582											OREG0023060	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000188549																																					0													104.0	114.0	111.0					15																	40630782		2022	4162	6184	SO:0001583	missense	0			-	AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981	ENST00000559313.1:c.599G>A	15.37:g.40630782C>T	ENSP00000453969:p.Arg200Gln	894	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	Missense_Mutation	SNP	NULL	p.R200Q	ENST00000559313.1	37	c.599	CCDS10055.2	15	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507202	0.27036	.	.	ENSG00000188549	ENST00000382688;ENST00000397535	.	.	.	4.44	-5.33	0.02713	.	1.020600	0.07843	N	0.963337	T	0.17746	0.0426	L	0.27053	0.805	0.09310	N	1	B;B	0.28971	0.229;0.017	B;B	0.15870	0.014;0.009	T	0.17992	-1.0351	9	0.25751	T	0.34	-0.1407	5.7979	0.18397	0.1416:0.2809:0.0:0.5776	.	132;200	Q6ZUT6-3;Q6ZUT6	.;CO052_HUMAN	Q	200;132	.	ENSP00000372135:R200Q	R	-	2	0	C15orf52	38418074	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.355000	0.02612	-0.790000	0.04492	0.563000	0.77884	CGA	-	C15orf52	-	NULL		0.582	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf52	HGNC	protein_coding	OTTHUMT00000319567.2	0	0	0	87	87	42	0.00	0.00	C	NM_207380		40630782	-1	42	13	94	26	tier1	no_errors	ENST00000559313	ensembl	human	known	74_37	missense	30.88	33.33	SNP	0.000	T	42	94
BAP1	8314	genome.wustl.edu	37	3	52438591	52438591	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:52438591G>A	ENST00000460680.1	-	12	1599	c.1128C>T	c.(1126-1128)gaC>gaT	p.D376D	BAP1_ENST00000296288.5_Silent_p.D358D	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CTGCCGCCAGGTCTTCTTCCT	0.587			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""							ENSG00000163930																									GBM(101;493 1458 7992 21037 25532)			Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	0													43.0	38.0	39.0					3																	52438591		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1128C>T	3.37:g.52438591G>A			B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Silent	SNP	pfam_Peptidase_C12,prints_Peptidase_C12	p.D376	ENST00000460680.1	37	c.1128	CCDS2853.1	3																																																																																			-	BAP1	-	NULL		0.587	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAP1	HGNC	protein_coding	OTTHUMT00000350895.1	0	0	0	52	52	29	0.00	0.00	G			52438591	-1	16	7	51	20	tier1	no_errors	ENST00000460680	ensembl	human	known	74_37	silent	23.88	25.93	SNP	1.000	A	16	51
WHSC1	7468	genome.wustl.edu	37	4	1918632	1918632	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:1918632G>A	ENST00000382895.3	+	6	1226	c.795G>A	c.(793-795)caG>caA	p.Q265Q	WHSC1_ENST00000382892.2_Silent_p.Q265Q|WHSC1_ENST00000382891.5_Silent_p.Q265Q|WHSC1_ENST00000398261.1_Silent_p.Q265Q|WHSC1_ENST00000508803.1_Silent_p.Q265Q|WHSC1_ENST00000514045.1_Silent_p.Q265Q|WHSC1_ENST00000503128.1_Silent_p.Q265Q|WHSC1_ENST00000420906.2_Silent_p.Q265Q	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	265	PWWP 1. {ECO:0000255|PROSITE- ProRule:PRU00162}.				anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		ATCACGTACAGTTCTTTGGTG	0.393			T	IGH@	MM								ENSG00000109685																												Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	0													86.0	91.0	89.0					4																	1918632		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.795G>A	4.37:g.1918632G>A			A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,pfam_HMG_box_dom,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_PWWP_dom,smart_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_HMG_box_dom	p.Q265	ENST00000382895.3	37	c.795	CCDS33940.1	4																																																																																			-	WHSC1	-	pfam_PWWP_dom,smart_PWWP_dom,pfscan_PWWP_dom		0.393	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1	HGNC	protein_coding	OTTHUMT00000366269.2	0	0	0	80	80	84	0.00	0.00	G	NM_133330		1918632	+1	62	59	50	57	tier1	no_errors	ENST00000382891	ensembl	human	known	74_37	silent	55.36	50.86	SNP	1.000	A	62	50
OR52M1	119772	genome.wustl.edu	37	11	4566606	4566606	+	Nonsense_Mutation	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:4566606C>G	ENST00000360213.1	+	1	186	c.186C>G	c.(184-186)taC>taG	p.Y62*		NM_001004137.1	NP_001004137.1	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M, member 1	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|lung(9)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCCCATGTACTTTTTCTTGT	0.517													ENSG00000197790																																					0													147.0	137.0	140.0					11																	4566606		2201	4298	6499	SO:0001587	stop_gained	0			-	AB065789	CCDS31353.1	11p15.4	2012-08-09	2002-11-13	2002-11-15	ENSG00000197790	ENSG00000197790		"""GPCR / Class A : Olfactory receptors"""	15225	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily M, member 1 pseudogene"""	OR52M1P			Standard	NM_001004137		Approved		uc010qyf.2	Q8NGK5	OTTHUMG00000165706	ENST00000360213.1:c.186C>G	11.37:g.4566606C>G	ENSP00000353343:p.Tyr62*			Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y62*	ENST00000360213.1	37	c.186	CCDS31353.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170650	0.78452	.	.	ENSG00000197790	ENST00000360213	.	.	.	4.71	1.83	0.25207	.	0.000000	0.42964	D	0.000635	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6777	0.40050	0.0:0.7504:0.0:0.2496	.	.	.	.	X	62	.	ENSP00000353343:Y62X	Y	+	3	2	OR52M1	4523182	0.079000	0.21365	1.000000	0.80357	0.956000	0.61745	0.583000	0.23849	0.706000	0.31912	-0.136000	0.14681	TAC	-	OR52M1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.517	OR52M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52M1	HGNC	protein_coding	OTTHUMT00000385847.1	0	0	0	66	66	85	0.00	0.00	C	NM_001004137		4566606	+1	20	9	91	60	tier1	no_errors	ENST00000360213	ensembl	human	known	74_37	nonsense	18.02	12.86	SNP	0.685	G	20	91
TRIM9	114088	genome.wustl.edu	37	14	51452697	51452697	+	Intron	SNP	G	G	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr14:51452697G>C	ENST00000298355.3	-	8	2725				TRIM9_ENST00000557456.1_5'UTR|TRIM9_ENST00000338969.5_Missense_Mutation_p.S586C	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					AGACTGTAAAGAGGAATGCAA	0.517													ENSG00000100505																																					0																																										SO:0001627	intron_variant	0			-	AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1604-3876C>G	14.37:g.51452697G>C			D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.S586C	ENST00000298355.3	37	c.1757	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	G	17.61	3.431788	0.62844	.	.	ENSG00000100505	ENST00000338969	T	0.71222	-0.55	6.08	6.08	0.98989	.	0.198684	0.44902	D	0.000406	D	0.85243	0.5652	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.85936	0.1455	9	0.72032	D	0.01	.	17.828	0.88672	0.0:0.0:1.0:0.0	.	586	Q9C026-4	.	C	586	ENSP00000342970:S586C	ENSP00000342970:S586C	S	-	2	0	TRIM9	50522447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.069000	0.71209	2.894000	0.99253	0.591000	0.81541	TCT	-	TRIM9	-	superfamily_ConA-like_lec_gl_sf		0.517	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	0	0	0	69	69	86	0.00	0.00	G	NM_015163		51452697	-1	17	16	51	54	tier1	no_errors	ENST00000338969	ensembl	human	known	74_37	missense	25.00	22.86	SNP	1.000	C	17	51
CACNA1A	773	genome.wustl.edu	37	19	13410062	13410062	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:13410062G>A	ENST00000360228.5	-	19	2384	c.2385C>T	c.(2383-2385)aaC>aaT	p.N795N	CACNA1A_ENST00000573710.2_Silent_p.N796N	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	796					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTCCATTTCGTTATACAGGG	0.622													ENSG00000141837																																					0													63.0	69.0	67.0					19																	13410062		2058	4182	6240	SO:0001819	synonymous_variant	0			-	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.2385C>T	19.37:g.13410062G>A			J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.N795	ENST00000360228.5	37	c.2385	CCDS45998.1	19																																																																																			-	CAC1A	-	NULL		0.622	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CAC1A	HGNC	protein_coding	OTTHUMT00000104062.2	0	0	0	117	117	28	0.00	0.00	G	NM_000068		13410062	-1	70	20	92	13	tier1	no_errors	ENST00000360228	ensembl	human	known	74_37	silent	43.21	60.61	SNP	0.916	A	70	92
PSMF1	9491	genome.wustl.edu	37	20	1115769	1115769	+	Missense_Mutation	SNP	A	A	G	rs371369250		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:1115769A>G	ENST00000335877.6	+	4	547	c.371A>G	c.(370-372)tAc>tGc	p.Y124C	PSMF1_ENST00000333082.3_Missense_Mutation_p.Y124C|PSMF1_ENST00000381898.4_Missense_Mutation_p.Y36C|PSMF1_ENST00000484891.1_3'UTR|PSMF1_ENST00000438768.2_Intron|PSMF1_ENST00000246015.4_Missense_Mutation_p.Y124C	NM_006814.3	NP_006805.2	Q92530	PSMF1_HUMAN	proteasome (prosome, macropain) inhibitor subunit 1 (PI31)	124	Important for homodimerization and interaction with FBXO7.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteasomal protein catabolic process (GO:1901799)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome core complex (GO:0005839)	endopeptidase inhibitor activity (GO:0004866)|proteasome binding (GO:0070628)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)	13						TGCAGGACCTACAAGAACAGT	0.557													ENSG00000125818																																					0								A	CYS/TYR,CYS/TYR	0,4406		0,0,2203	106.0	92.0	97.0		371,371	5.0	1.0	20		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PSMF1	NM_006814.3,NM_178578.2	194,194	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging	124/272,124/272	1115769	1,13005	2203	4300	6503	SO:0001583	missense	0			-	D88378	CCDS13010.1	20p13	2008-07-02			ENSG00000125818	ENSG00000125818		"""Proteasome (prosome, macropain) subunits"""	9571	protein-coding gene	gene with protein product	"""proteasome inhibitor hP131 subunit"""					10363639	Standard	NM_006814		Approved	PI31	uc002wen.4	Q92530	OTTHUMG00000031656	ENST00000335877.6:c.371A>G	20.37:g.1115769A>G	ENSP00000338039:p.Tyr124Cys		A0AVQ9|D3DVW3|Q9H4I1	Missense_Mutation	SNP	pfam_FP_dom,pfam_PI31_Prot_Reg	p.Y124C	ENST00000335877.6	37	c.371	CCDS13010.1	20	.	.	.	.	.	.	.	.	.	.	A	16.89	3.248454	0.59103	0.0	1.16E-4	ENSG00000125818	ENST00000333082;ENST00000381898;ENST00000381899;ENST00000454500;ENST00000246015;ENST00000335877	T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89	4.98	4.98	0.66077	.	0.068468	0.64402	D	0.000012	T	0.60104	0.2243	M	0.61703	1.905	0.44789	D	0.997793	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.997;0.997	T	0.62426	-0.6857	10	0.59425	D	0.04	-15.9569	12.2968	0.54852	1.0:0.0:0.0:0.0	.	36;36;124;124	F5H4Z3;B4DUJ0;Q5QPM7;Q92530	.;.;.;PSMF1_HUMAN	C	124;36;124;36;124;124	ENSP00000327704:Y124C;ENSP00000371323:Y36C;ENSP00000371324:Y124C;ENSP00000246015:Y124C;ENSP00000338039:Y124C	ENSP00000246015:Y124C	Y	+	2	0	PSMF1	1063769	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.629000	0.54266	2.099000	0.63709	0.528000	0.53228	TAC	-	PSMF1	-	pfam_FP_dom		0.557	PSMF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMF1	HGNC	protein_coding	OTTHUMT00000077504.2	0	0	0	68	68	97	0.00	0.00	A	NM_178578		1115769	+1	24	13	17	15	tier1	no_errors	ENST00000333082	ensembl	human	known	74_37	missense	58.54	46.43	SNP	1.000	G	24	17
PIWIL2	55124	genome.wustl.edu	37	8	22138936	22138936	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:22138936G>A	ENST00000454009.2	+	4	842	c.333G>A	c.(331-333)aaG>aaA	p.K111K	PIWIL2_ENST00000356766.6_Silent_p.K111K|PIWIL2_ENST00000521356.1_Silent_p.K111K	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	111					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TGGTACGCAAGGACAGGGAGG	0.493													ENSG00000197181																																					0													154.0	153.0	154.0					8																	22138936		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.333G>A	8.37:g.22138936G>A			A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Silent	SNP	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.K111	ENST00000454009.2	37	c.333	CCDS6029.1	8																																																																																			-	PIWIL2	-	NULL		0.493	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	HGNC	protein_coding	OTTHUMT00000375438.1	0	0	0	65	65	95	0.00	0.00	G			22138936	+1	18	34	78	91	tier1	no_errors	ENST00000356766	ensembl	human	known	74_37	silent	18.75	27.20	SNP	0.984	A	18	78
F7	2155	genome.wustl.edu	37	13	113765058	113765058	+	Missense_Mutation	SNP	A	A	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:113765058A>G	ENST00000375581.3	+	3	220	c.185A>G	c.(184-186)aAc>aGc	p.N62S	F7_ENST00000346342.3_Missense_Mutation_p.N40S|F7_ENST00000473085.1_3'UTR|F7_ENST00000541084.1_Intron	NM_000131.4	NP_000122.1	P08709	FA7_HUMAN	coagulation factor VII (serum prothrombin conversion accelerator)	62	Gla. {ECO:0000255|PROSITE- ProRule:PRU00463}.				blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|cellular protein metabolic process (GO:0044267)|circadian rhythm (GO:0007623)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of blood coagulation (GO:0030194)|positive regulation of cell migration (GO:0030335)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of platelet-derived growth factor receptor signaling pathway (GO:0010641)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein kinase B signaling (GO:0051897)|post-translational protein modification (GO:0043687)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to growth hormone (GO:0060416)|response to vitamin K (GO:0032571)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(4)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	16	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	CGGCGCGCCAACGCGTTCCTG	0.692													ENSG00000057593																																					0													13.0	11.0	12.0					13																	113765058		2037	3998	6035	SO:0001583	missense	0			-		CCDS9528.1, CCDS9529.1, CCDS73602.1	13q34	2014-02-03			ENSG00000057593	ENSG00000057593	3.4.21.21		3544	protein-coding gene	gene with protein product	"""eptacog alfa"", ""FVII coagulation protein"", ""factor VII"""	613878				3264725, 2511201	Standard	NM_000131		Approved		uc001vsv.4	P08709	OTTHUMG00000017373	ENST00000375581.3:c.185A>G	13.37:g.113765058A>G	ENSP00000364731:p.Asn62Ser		B0YJC8|Q14339|Q5JVF1|Q5JVF2|Q9UD52|Q9UD53|Q9UD54	Missense_Mutation	SNP	pirsf_Pept_S1A_FX,pfam_Peptidase_S1,pfam_GLA_domain,pfam_Peptidase_S1A_nudel,pfam_EG-like_dom,superfamily_Trypsin-like_Pept_dom,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Peptidase_S1,prints_Peptidase_S1A,prints_GLA_domain,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Peptidase_S1	p.N62S	ENST00000375581.3	37	c.185	CCDS9528.1	13	.	.	.	.	.	.	.	.	.	.	a	16.43	3.119783	0.56613	.	.	ENSG00000057593	ENST00000346342;ENST00000375581	D;D	0.99784	-6.74;-6.74	4.47	4.47	0.54385	Gamma-carboxyglutamic acid-rich (GLA) domain (3);Coagulation factor, subgroup, Gla domain (1);	0.121288	0.52532	N	0.000064	D	0.99591	0.9852	M	0.88310	2.945	0.80722	D	1	P;P	0.52316	0.948;0.952	P;P	0.50490	0.642;0.536	D	0.97684	1.0174	10	0.87932	D	0	.	13.8175	0.63301	1.0:0.0:0.0:0.0	.	40;62	P08709-2;P08709	.;FA7_HUMAN	S	40;62	ENSP00000329546:N40S;ENSP00000364731:N62S	ENSP00000329546:N40S	N	+	2	0	F7	112813059	0.998000	0.40836	0.515000	0.27774	0.002000	0.02628	3.906000	0.56340	1.661000	0.50771	0.412000	0.27726	AAC	-	F7	-	pirsf_Pept_S1A_FX,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain		0.692	F7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	F7	HGNC	protein_coding	OTTHUMT00000045838.4	0	0	0	142	142	15	0.00	0.00	A	NM_000131		113765058	+1	29	3	277	20	tier1	no_errors	ENST00000375581	ensembl	human	known	74_37	missense	9.48	13.04	SNP	1.000	G	29	277
TMEM8C	389827	genome.wustl.edu	37	9	136384035	136384035	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr9:136384035G>A	ENST00000339996.3	-	3	461	c.360C>T	c.(358-360)ggC>ggT	p.G120G	TMEM8C_ENST00000413714.1_5'UTR	NM_001080483.2	NP_001073952.1	A6NI61	TMM8C_HUMAN	transmembrane protein 8C	120					muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|plasma membrane fusion (GO:0045026)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|large_intestine(2)|lung(4)	8						TGCCGATGGGGCCCGAGTACA	0.612													ENSG00000187616																																					0													97.0	84.0	89.0					9																	136384035		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX324209	CCDS35170.1	9q34.2	2009-06-19		2009-06-19	ENSG00000187616	ENSG00000187616			33778	protein-coding gene	gene with protein product	"""transmembrane protein 226"""	615345					Standard	NM_001080483		Approved	TMEM226	uc011mdk.2	A6NI61	OTTHUMG00000131685	ENST00000339996.3:c.360C>T	9.37:g.136384035G>A				Silent	SNP	pfam_DUF3522	p.G120	ENST00000339996.3	37	c.360	CCDS35170.1	9																																																																																			-	TMEM8C	-	pfam_DUF3522		0.612	TMEM8C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8C	HGNC	protein_coding	OTTHUMT00000356200.2	0	0	0	60	60	24	0.00	0.00	G	NM_001080483		136384035	-1	21	6	44	18	tier1	no_errors	ENST00000339996	ensembl	human	known	74_37	silent	32.31	25.00	SNP	0.983	A	21	44
SNX14	57231	genome.wustl.edu	37	6	86215589	86215589	+	3'UTR	SNP	A	A	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:86215589A>G	ENST00000314673.3	-	0	3113				SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000505648.1_3'UTR|SNX14_ENST00000369627.2_3'UTR|SNX14_ENST00000346348.3_3'UTR|SNX14_ENST00000513865.1_3'UTR	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14						protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ACAGCGATGTACATAATATAT	0.284													ENSG00000135317																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.*96T>C	6.37:g.86215589A>G			B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	R	SNP	-	NULL	ENST00000314673.3	37	NULL	CCDS5004.1	6																																																																																			-	SNX14	-	-		0.284	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	HGNC	protein_coding	OTTHUMT00000041393.2	0	0	0	24	24	51	0.00	0.00	A	NM_153816		86215589	-1	4	13	14	46	tier1	no_errors	ENST00000508980	ensembl	human	known	74_37	rna	22.22	21.67	SNP	1.000	G	4	14
CAPN7	23473	genome.wustl.edu	37	3	15253704	15253704	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:15253704G>A	ENST00000253693.2	+	2	449	c.196G>A	c.(196-198)Gct>Act	p.A66T		NM_014296.2	NP_055111.1	Q9Y6W3	CAN7_HUMAN	calpain 7	66					positive regulation of epithelial cell migration (GO:0010634)|self proteolysis (GO:0097264)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|endopeptidase activity (GO:0004175)|MIT domain binding (GO:0090541)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|skin(2)	22						AAGAGTTCAAGCTCTACATTC	0.363													ENSG00000131375																																					0													76.0	77.0	76.0					3																	15253704		2203	4300	6503	SO:0001583	missense	0			-	AB028639	CCDS2624.1	3p24	2008-07-18			ENSG00000131375	ENSG00000131375			1484	protein-coding gene	gene with protein product	"""calpain like protease"", ""homolog of Aspergillus Nidulans PALB"""	606400				8163008, 10051333	Standard	NM_014296		Approved	PalBH	uc003bzn.3	Q9Y6W3	OTTHUMG00000129863	ENST00000253693.2:c.196G>A	3.37:g.15253704G>A	ENSP00000253693:p.Ala66Thr			Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_MIT,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_MIT,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,prints_Calpain_cysteine_protease,pfscan_Peptidase_C2_calpain_cat	p.A66T	ENST00000253693.2	37	c.196	CCDS2624.1	3	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262019	0.23051	.	.	ENSG00000131375	ENST00000253693	T	0.69306	-0.39	5.49	5.49	0.81192	MIT (2);	0.115965	0.64402	D	0.000019	T	0.51398	0.1672	N	0.20986	0.625	0.51767	D	0.999934	B	0.14012	0.009	B	0.15052	0.012	T	0.51068	-0.8752	10	0.05351	T	0.99	-14.1306	18.9685	0.92706	0.0:0.0:1.0:0.0	.	66	Q9Y6W3	CAN7_HUMAN	T	66	ENSP00000253693:A66T	ENSP00000253693:A66T	A	+	1	0	CAPN7	15228708	1.000000	0.71417	0.996000	0.52242	0.805000	0.45488	6.713000	0.74686	2.591000	0.87537	0.555000	0.69702	GCT	-	CAPN7	-	pfam_MIT,smart_MIT		0.363	CAPN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN7	HGNC	protein_coding	OTTHUMT00000252105.2	0	0	0	65	65	73	0.00	0.00	G	NM_014296		15253704	+1	29	23	42	44	tier1	no_errors	ENST00000253693	ensembl	human	known	74_37	missense	40.85	34.33	SNP	1.000	A	29	42
ZBED9	114821	genome.wustl.edu	37	6	28540109	28540109	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:28540109A>T	ENST00000452236.2	-	4	4174	c.3557T>A	c.(3556-3558)tTa>tAa	p.L1186*		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						aaaacattctaacaaatttgt	0.279													ENSG00000232040																																					0													28.0	27.0	27.0					6																	28540109		2196	4283	6479	SO:0001587	stop_gained	0			-																												ENST00000452236.2:c.3557T>A	6.37:g.28540109A>T	ENSP00000395259:p.Leu1186*			Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.L1186*	ENST00000452236.2	37	c.3557	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	A	44	11.073195	0.99511	.	.	ENSG00000232040	ENST00000452236	.	.	.	2.53	1.35	0.21983	.	0.418923	0.16610	U	0.206938	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	4.3809	0.11293	0.8374:0.0:0.1626:0.0	.	.	.	.	X	1186	.	ENSP00000395259:L1186X	L	-	2	0	SCAND3	28648088	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	1.021000	0.30040	0.391000	0.25143	0.533000	0.62120	TTA	-	SCAND3	-	superfamily_RNaseH-like_dom		0.279	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	0	0	0	91	91	73	0.00	0.00	A			28540109	-1	23	27	53	49	tier1	no_errors	ENST00000452236	ensembl	human	known	74_37	nonsense	30.26	35.53	SNP	0.992	T	23	53
POF1B	79983	genome.wustl.edu	37	X	84614563	84614563	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:84614563G>C	ENST00000262753.4	-	4	575	c.430C>G	c.(430-432)Cct>Gct	p.P144A	POF1B_ENST00000373145.3_Missense_Mutation_p.P144A	NM_024921.3	NP_079197.3	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	144						tight junction (GO:0005923)				central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|liver(2)|lung(17)|ovary(1)|prostate(1)	35						ACCTGTTCAGGATTTTGTACT	0.333													ENSG00000124429																																					0													166.0	145.0	152.0					X																	84614563		2203	4298	6501	SO:0001583	missense	0			-	BC017500	CCDS14452.1	Xq21.2	2008-02-05			ENSG00000124429	ENSG00000124429			13711	protein-coding gene	gene with protein product		300603				11299520	Standard	NM_024921		Approved	POF, FLJ22792	uc004eer.2	Q8WVV4	OTTHUMG00000021934	ENST00000262753.4:c.430C>G	X.37:g.84614563G>C	ENSP00000262753:p.Pro144Ala		A8K2U5|Q5H9E9|Q5H9F0|Q8NG12|Q9H5Y2|Q9H738|Q9H744	Missense_Mutation	SNP	NULL	p.P144A	ENST00000262753.4	37	c.430	CCDS14452.1	X	.	.	.	.	.	.	.	.	.	.	G	11.72	1.724026	0.30593	.	.	ENSG00000124429	ENST00000262753;ENST00000373145;ENST00000276124	T;T	0.33438	1.42;1.41	4.77	3.88	0.44766	.	0.121898	0.37304	N	0.002144	T	0.27027	0.0662	L	0.50333	1.59	0.38207	D	0.94036	B;B	0.13594	0.008;0.002	B;B	0.14578	0.011;0.005	T	0.09952	-1.0651	10	0.40728	T	0.16	.	9.6613	0.39956	0.0:0.2064:0.7936:0.0	.	144;144	Q8WVV4-1;Q8WVV4	.;POF1B_HUMAN	A	144	ENSP00000262753:P144A;ENSP00000362238:P144A	ENSP00000262753:P144A	P	-	1	0	POF1B	84501219	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	2.522000	0.45572	0.978000	0.38470	0.506000	0.49869	CCT	-	POF1B	-	NULL		0.333	POF1B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POF1B	HGNC	protein_coding	OTTHUMT00000057391.2	0	0	0	84	84	98	0.00	0.00	G	NM_024921		84614563	-1	52	64	51	57	tier1	no_errors	ENST00000373145	ensembl	human	known	74_37	missense	50.49	52.46	SNP	1.000	C	52	51
TAOK1	57551	genome.wustl.edu	37	17	27822611	27822611	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:27822611G>A	ENST00000261716.3	+	11	1384	c.865G>A	c.(865-867)Gtg>Atg	p.V289M	TAOK1_ENST00000536202.1_Missense_Mutation_p.V289M	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	289					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			CCCTGAAACCGTGTTAATAGA	0.413													ENSG00000160551																																					0													112.0	108.0	109.0					17																	27822611		2203	4300	6503	SO:0001583	missense	0			-	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.865G>A	17.37:g.27822611G>A	ENSP00000261716:p.Val289Met		A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Homeodomain-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V289M	ENST00000261716.3	37	c.865	CCDS32601.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.307465	0.95629	.	.	ENSG00000160551	ENST00000261716;ENST00000536202	D;D	0.86366	-2.11;-2.11	5.22	5.22	0.72569	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93275	0.7857	M	0.77103	2.36	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.991	P;D;P	0.65773	0.893;0.938;0.673	D	0.93873	0.7164	10	0.87932	D	0	.	19.1509	0.93488	0.0:0.0:1.0:0.0	.	289;115;289	B7ZLV6;Q7L7X3-2;Q7L7X3	.;.;TAOK1_HUMAN	M	289	ENSP00000261716:V289M;ENSP00000438819:V289M	ENSP00000261716:V289M	V	+	1	0	TAOK1	24846737	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.660000	0.98599	2.599000	0.87857	0.563000	0.77884	GTG	-	TAOK1	-	superfamily_Kinase-like_dom		0.413	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAOK1	HGNC	protein_coding	OTTHUMT00000447790.1	0	0	0	81	81	53	0.00	0.00	G	NM_020791		27822611	+1	19	10	59	68	tier1	no_errors	ENST00000261716	ensembl	human	known	74_37	missense	24.36	12.82	SNP	1.000	A	19	59
ETV1	2115	genome.wustl.edu	37	7	13971306	13971306	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr7:13971306C>A	ENST00000430479.1	-	9	1290	c.623G>T	c.(622-624)cGt>cTt	p.R208L	ETV1_ENST00000405358.4_Missense_Mutation_p.R222L|ETV1_ENST00000399357.3_Missense_Mutation_p.R105L|ETV1_ENST00000405218.2_Missense_Mutation_p.R208L|ETV1_ENST00000242066.5_Missense_Mutation_p.R190L|ETV1_ENST00000476720.2_5'UTR|ETV1_ENST00000403685.1_Missense_Mutation_p.R190L|ETV1_ENST00000403527.1_Missense_Mutation_p.R168L|ETV1_ENST00000405192.2_Missense_Mutation_p.R208L|ETV1_ENST00000343495.5_Missense_Mutation_p.R190L|ETV1_ENST00000420159.2_Missense_Mutation_p.R150L	NM_004956.4	NP_004947.2	P50549	ETV1_HUMAN	ets variant 1	208					axon guidance (GO:0007411)|cell differentiation (GO:0030154)|mechanosensory behavior (GO:0007638)|muscle organ development (GO:0007517)|peripheral nervous system neuron development (GO:0048935)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		TMPRSS2/ETV1(34)|ACSL3_ENST00000357430/ETV1(2)|EWSR1/ETV1(7)|KLK2/ETV1(3)|SLC45A3/ETV1(3)|HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31						GTACATAGGACGTCCTTCCCT	0.502			T	"""EWSR1, TMPRSS2, SLC45A3, C15orf21, HNRNPA2B1. ACSL3"""	"""Ewing sarcoma, prostate"""								ENSG00000006468																												Dom	yes		7	7p22	2115	ets variant gene 1		"""M, E"""	0													137.0	134.0	135.0					7																	13971306		2044	4191	6235	SO:0001583	missense	0			-		CCDS55083.1, CCDS55084.1, CCDS55085.1, CCDS55086.1, CCDS55087.1, CCDS55088.1	7p22	2008-09-12	2008-09-12		ENSG00000006468	ENSG00000006468			3490	protein-coding gene	gene with protein product		600541	"""ets variant gene 1"""			1340465	Standard	NM_004956		Approved	ER81	uc003ssw.4	P50549	OTTHUMG00000152403	ENST00000430479.1:c.623G>T	7.37:g.13971306C>A	ENSP00000405327:p.Arg208Leu		A4D118|B2R768|B7Z2I4|B7Z618|B7Z9P2|C9JT37|E9PHB1|F5GXR2|O75849|Q4KMQ6|Q59GA7|Q6AI30|Q9UQ71|Q9Y636	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.R208L	ENST00000430479.1	37	c.623	CCDS55088.1	7	.	.	.	.	.	.	.	.	.	.	C	32	5.168572	0.94768	.	.	ENSG00000006468	ENST00000430479;ENST00000242066;ENST00000343495;ENST00000420159;ENST00000399357;ENST00000405192;ENST00000405358;ENST00000403527;ENST00000405218;ENST00000403685;ENST00000438956;ENST00000443608	T;T;T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	6.13	6.13	0.99165	PEA3-type ETS-domain transcription factor, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	L	0.47716	1.5	0.53688	D	0.999973	D;D;P;P;D;D;D;P	0.89917	0.982;1.0;0.82;0.891;0.997;0.998;0.966;0.898	P;D;B;P;D;D;P;P	0.85130	0.81;0.985;0.385;0.457;0.997;0.992;0.737;0.796	T	0.02983	-1.1086	10	0.27082	T	0.32	.	20.8401	0.99726	0.0:1.0:0.0:0.0	.	219;190;222;150;105;168;150;208	Q59GA7;P50549-2;B5MCT2;F5GXR2;B7Z9P2;E9PHB1;B7Z618;P50549	.;.;.;.;.;.;.;ETV1_HUMAN	L	208;190;190;150;105;208;222;168;208;190;150;105	ENSP00000405327:R208L;ENSP00000242066:R190L;ENSP00000340853:R190L;ENSP00000411626:R150L;ENSP00000382293:R105L;ENSP00000385381:R208L;ENSP00000384085:R222L;ENSP00000384138:R168L;ENSP00000385551:R208L;ENSP00000385686:R190L;ENSP00000393078:R150L;ENSP00000394710:R105L	ENSP00000242066:R190L	R	-	2	0	ETV1	13937831	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.291000	0.78721	2.932000	0.99384	0.644000	0.83932	CGT	-	ETV1	-	pfam_ETS_PEA3_N		0.502	ETV1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ETV1	HGNC	protein_coding	OTTHUMT00000326111.1	0	0	0	90	90	146	0.00	0.00	C	NM_004956		13971306	-1	42	30	183	174	tier1	no_errors	ENST00000405218	ensembl	human	known	74_37	missense	18.58	14.56	SNP	1.000	A	42	183
ATRX	546	genome.wustl.edu	37	X	76938686	76938686	+	Nonsense_Mutation	SNP	T	T	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:76938686T>A	ENST00000373344.5	-	9	2276	c.2062A>T	c.(2062-2064)Aaa>Taa	p.K688*	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Nonsense_Mutation_p.K650*	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	688					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AGTTTTTGTTTCTCCTTAACT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)											137.0	135.0	136.0					X																	76938686		2203	4295	6498	SO:0001587	stop_gained	0			-	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2062A>T	X.37:g.76938686T>A	ENSP00000362441:p.Lys688*		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K688*	ENST00000373344.5	37	c.2062	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	T	36	5.923794	0.97110	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.12	2.67	0.31697	.	0.066111	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7636	7.3742	0.26818	0.0:0.0764:0.1418:0.7818	.	.	.	.	X	688;650;615	.	ENSP00000362441:K688X	K	-	1	0	ATRX	76825342	1.000000	0.71417	0.873000	0.34254	0.246000	0.25737	3.918000	0.56432	0.147000	0.19030	-0.466000	0.05196	AAA	-	ATRX	-	NULL		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	28	28	95	0.00	0.00	T	NM_000489		76938686	-1	22	48	24	31	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	47.83	60.76	SNP	0.984	A	22	24
KATNAL1	84056	genome.wustl.edu	37	13	30829681	30829681	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr13:30829681G>A	ENST00000380615.3	-	4	562	c.395C>T	c.(394-396)gCc>gTc	p.A132V	KATNAL1_ENST00000380617.3_Missense_Mutation_p.A132V	NM_032116.4	NP_115492.1			katanin p60 subunit A-like 1											autonomic_ganglia(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)|urinary_tract(3)	19		Lung SC(185;0.0257)		all cancers(112;0.114)|OV - Ovarian serous cystadenocarcinoma(117;0.213)		AGGTCCCCGGGCTCCTACTCC	0.453													ENSG00000102781																																					0													222.0	234.0	230.0					13																	30829681		2203	4300	6503	SO:0001583	missense	0			-	AK097423	CCDS31956.1	13q12.3	2010-04-21			ENSG00000102781	ENSG00000102781		"""ATPases / AAA-type"""	28361	protein-coding gene	gene with protein product		614764				12477932	Standard	NM_001014380		Approved	MGC2599	uc001uss.4	Q9BW62	OTTHUMG00000016665	ENST00000380615.3:c.395C>T	13.37:g.30829681G>A	ENSP00000369989:p.Ala132Val			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_D_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A132V	ENST00000380615.3	37	c.395	CCDS31956.1	13	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606766	0.46527	.	.	ENSG00000102781	ENST00000380615;ENST00000380617;ENST00000414289;ENST00000441394	D;D	0.94376	-3.41;-3.41	5.8	4.95	0.65309	.	0.486664	0.24443	N	0.038482	D	0.87593	0.6216	N	0.19112	0.55	0.40314	D	0.978758	B	0.02656	0.0	B	0.04013	0.001	T	0.82766	-0.0295	10	0.24483	T	0.36	0.0104	15.7122	0.77641	0.0:0.1372:0.8628:0.0	.	132	Q9BW62	KATL1_HUMAN	V	132	ENSP00000369989:A132V;ENSP00000369991:A132V	ENSP00000369989:A132V	A	-	2	0	KATNAL1	29727681	0.997000	0.39634	1.000000	0.80357	0.881000	0.50899	1.612000	0.36889	1.439000	0.47511	0.650000	0.86243	GCC	-	KATL1	-	NULL		0.453	KATNAL1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KATL1	HGNC	protein_coding	OTTHUMT00000044346.2	0	0	0	140	140	62	0.00	0.00	G	NM_032116		30829681	-1	61	16	53	22	tier1	no_errors	ENST00000380615	ensembl	human	known	74_37	missense	52.59	40.00	SNP	1.000	A	61	53
CACNA2D3	55799	genome.wustl.edu	37	3	55107538	55107538	+	Silent	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:55107538C>G	ENST00000474759.1	+	36	3102	c.3054C>G	c.(3052-3054)ctC>ctG	p.L1018L	CACNA2D3_ENST00000478261.1_Intron|CACNA2D3_ENST00000490478.1_Silent_p.L924L|CACNA2D3_ENST00000415676.2_Silent_p.L1018L|CACNA2D3_ENST00000288197.5_Silent_p.L1018L	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	1018						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	GCAGCTGCCTCTGTGAATCTG	0.512													ENSG00000157445																																					0													87.0	89.0	88.0					3																	55107538		2035	4185	6220	SO:0001819	synonymous_variant	0			-	AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.3054C>G	3.37:g.55107538C>G			B2RPL6|Q9NY16|Q9NY18	Silent	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.L1018	ENST00000474759.1	37	c.3054	CCDS54598.1	3																																																																																			-	CAC2D3	-	NULL		0.512	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAC2D3	HGNC	protein_coding	OTTHUMT00000351402.1	0	0	0	89	89	100	0.00	0.00	C			55107538	+1	59	39	71	26	tier1	no_errors	ENST00000288197	ensembl	human	known	74_37	silent	45.38	60.00	SNP	1.000	G	59	71
SBNO1	55206	genome.wustl.edu	37	12	123812034	123812034	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:123812034T>C	ENST00000602398.1	-	13	1758	c.1631A>G	c.(1630-1632)aAa>aGa	p.K544R	SBNO1_ENST00000267176.4_Missense_Mutation_p.K543R|SBNO1_ENST00000420886.2_Missense_Mutation_p.K544R|SBNO1_ENST00000602750.1_Missense_Mutation_p.K543R			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	544					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTCCTCAATTTTGAAGGTCAC	0.368													ENSG00000139697																																					0													64.0	64.0	64.0					12																	123812034		2203	4300	6503	SO:0001583	missense	0			-	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.1631A>G	12.37:g.123812034T>C	ENSP00000473665:p.Lys544Arg		Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Prismane-like	p.K544R	ENST00000602398.1	37	c.1631	CCDS53844.1	12	.	.	.	.	.	.	.	.	.	.	T	11.97	1.799009	0.31777	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.30981	1.51;1.51	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.30916	0.0780	N	0.04203	-0.255	0.80722	D	1	B;B;D	0.71674	0.083;0.02;0.998	B;B;D	0.78314	0.127;0.078;0.991	T	0.24584	-1.0156	10	0.08599	T	0.76	-33.8024	16.5763	0.84648	0.0:0.0:0.0:1.0	.	544;543;542	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	R	544;543;543	ENSP00000387361:K544R;ENSP00000267176:K543R	ENSP00000267176:K543R	K	-	2	0	SBNO1	122377987	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.266000	0.72540	2.317000	0.78254	0.459000	0.35465	AAA	-	SBNO1	-	NULL		0.368	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	0	0	0	34	34	119	0.00	0.00	T	NM_018183		123812034	-1	9	26	29	87	tier1	no_errors	ENST00000420886	ensembl	human	known	74_37	missense	23.68	23.01	SNP	1.000	C	9	29
SGPL1	8879	genome.wustl.edu	37	10	72619225	72619225	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:72619225T>C	ENST00000373202.3	+	7	784	c.584T>C	c.(583-585)cTg>cCg	p.L195P		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	195					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						GCTTGTTCCCTGTTCAATGGG	0.418													ENSG00000166224																									Colon(151;1054 2458 6676 40971)												0													114.0	100.0	105.0					10																	72619225		2203	4300	6503	SO:0001583	missense	0			-	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.584T>C	10.37:g.72619225T>C	ENSP00000362298:p.Leu195Pro		B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.L195P	ENST00000373202.3	37	c.584	CCDS31216.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.6|24.6	4.545706|4.545706	0.86022|0.86022	.|.	.|.	ENSG00000166224|ENSG00000166224	ENST00000409118|ENST00000373202;ENST00000299297	.|T;T	.|0.63580	.|0.22;-0.05	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.85613|0.85613	0.5737|0.5737	H|H	0.96142|0.96142	3.775|3.775	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.90257|0.90257	0.4298|0.4298	5|10	.|0.87932	.|D	.|0	-8.3496|-8.3496	15.3946|15.3946	0.74781|0.74781	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|195	.|O95470	.|SGPL1_HUMAN	R|P	109|195;178	.|ENSP00000362298:L195P;ENSP00000299297:L178P	.|ENSP00000299297:L178P	C|L	+|+	1|2	0|0	SGPL1|SGPL1	72289231|72289231	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.975000|0.975000	0.68041|0.68041	7.305000|7.305000	0.78891|0.78891	2.113000|2.113000	0.64589|0.64589	0.533000|0.533000	0.62120|0.62120	TGT|CTG	-	SGPL1	-	superfamily_PyrdxlP-dep_Trfase		0.418	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGPL1	HGNC	protein_coding	OTTHUMT00000048533.1	0	0	0	153	153	91	0.00	0.00	T	NM_003901		72619225	+1	44	32	62	37	tier1	no_errors	ENST00000373202	ensembl	human	known	74_37	missense	41.51	45.71	SNP	1.000	C	44	62
MLIP	90523	genome.wustl.edu	37	6	53986311	53986311	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr6:53986311C>A	ENST00000274897.5	+	2	243	c.130C>A	c.(130-132)Cca>Aca	p.P44T	MLIP_ENST00000509997.1_Intron|MLIP_ENST00000358276.5_Missense_Mutation_p.P38T|MLIP_ENST00000502396.1_Missense_Mutation_p.P55T|MLIP_ENST00000514921.1_Missense_Mutation_p.P44T|MLIP_ENST00000511744.1_3'UTR|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000370877.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	44						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						CAGAAGACTACCAACCCATAC	0.408													ENSG00000146147																																					0													128.0	124.0	126.0					6																	53986311		2203	4300	6503	SO:0001583	missense	0			-	AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.130C>A	6.37:g.53986311C>A	ENSP00000274897:p.Pro44Thr		B7Z2N0|D6RE05|Q96H08|Q96NF7	Missense_Mutation	SNP	NULL	p.P44T	ENST00000274897.5	37	c.130	CCDS4954.1	6	.	.	.	.	.	.	.	.	.	.	C	19.98	3.927572	0.73327	.	.	ENSG00000146147	ENST00000274897;ENST00000514921;ENST00000502396;ENST00000358276;ENST00000514433	T;T;T;T;T	0.61859	0.88;0.17;0.23;0.07;0.51	5.22	5.22	0.72569	.	0.000000	0.56097	D	0.000026	T	0.66406	0.2786	M	0.64997	1.995	0.31866	N	0.620329	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.998;0.976;0.999	T	0.68205	-0.5470	10	0.87932	D	0	-6.1984	14.626	0.68621	0.0:1.0:0.0:0.0	.	55;44;44	Q5VWP3-3;Q5VWP3;D6RE05	.;MLIP_HUMAN;.	T	44;44;55;38;45	ENSP00000274897:P44T;ENSP00000425142:P44T;ENSP00000426290:P55T;ENSP00000351019:P38T;ENSP00000421444:P45T	ENSP00000274897:P44T	P	+	1	0	MLIP	54094270	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.199000	0.58426	2.599000	0.87857	0.655000	0.94253	CCA	-	MLIP	-	NULL		0.408	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	0	0	0	53	53	106	0.00	0.00	C	NM_138569		53986311	+1	13	21	68	102	tier1	no_errors	ENST00000274897	ensembl	human	known	74_37	missense	16.05	17.07	SNP	1.000	A	13	68
SOX3	6658	genome.wustl.edu	37	X	139586763	139586763	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:139586763G>A	ENST00000370536.2	-	1	462	c.463C>T	c.(463-465)Cgc>Tgc	p.R155C		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	155					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R155C(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					GCCATTTTGCGCCGCTGCCCG	0.632													ENSG00000134595																																					1	Substitution - Missense(1)	large_intestine(1)											49.0	50.0	50.0					X																	139586763		2203	4300	6503	SO:0001583	missense	0			-		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.463C>T	X.37:g.139586763G>A	ENSP00000359567:p.Arg155Cys		P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R155C	ENST00000370536.2	37	c.463	CCDS14669.1	X	.	.	.	.	.	.	.	.	.	.	g	17.97	3.518465	0.64634	.	.	ENSG00000134595	ENST00000370536	D	0.99277	-5.67	4.12	4.12	0.48240	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.99465	0.9810	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98794	1.0737	9	.	.	.	.	10.1878	0.43009	0.0:0.0:0.8014:0.1986	.	155	P41225	SOX3_HUMAN	C	155	ENSP00000359567:R155C	.	R	-	1	0	SOX3	139414429	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.574000	0.53863	1.638000	0.50547	0.525000	0.51046	CGC	-	SOX3	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom		0.632	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX3	HGNC	protein_coding	OTTHUMT00000058577.1	0	0	0	142	142	31	0.00	0.00	G			139586763	-1	34	4	194	27	tier1	no_errors	ENST00000370536	ensembl	human	known	74_37	missense	14.91	12.90	SNP	1.000	A	34	194
TMEM132C	92293	genome.wustl.edu	37	12	129190234	129190234	+	Silent	SNP	G	G	C	rs534721977		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:129190234G>C	ENST00000435159.2	+	9	2721	c.2721G>C	c.(2719-2721)ggG>ggC	p.G907G	TMEM132C_ENST00000315208.8_Silent_p.G523G|TMEM132C_ENST00000537538.1_Silent_p.G292G	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	907						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CCGGGAGTGGGCTGGAGGAAA	0.642													ENSG00000181234																																					0													18.0	26.0	23.0					12																	129190234		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2721G>C	12.37:g.129190234G>C			Q69YX8	Silent	SNP	NULL	p.G907	ENST00000435159.2	37	c.2721		12																																																																																			-	TMEM132C	-	NULL		0.642	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	HGNC	protein_coding		0	0	0	83	83	35	0.00	0.00	G	XM_044062		129190234	+1	22	11	78	42	tier1	no_errors	ENST00000435159	ensembl	human	known	74_37	silent	22.00	20.75	SNP	0.049	C	22	78
KCNJ12	3768	genome.wustl.edu	37	17	21318772	21318772	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:21318772C>T	ENST00000583088.1	+	3	1013	c.118C>T	c.(118-120)Cgc>Tgc	p.R40C	KCNJ12_ENST00000331718.5_Missense_Mutation_p.R40C	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	40					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCACACGCGGCGCAGGTGCCG	0.612										Prostate(3;0.18)			ENSG00000184185																																					0													116.0	88.0	98.0					17																	21318772		2203	4300	6503	SO:0001583	missense	0			-	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.118C>T	17.37:g.21318772C>T	ENSP00000463778:p.Arg40Cys		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.R40C	ENST00000583088.1	37	c.118	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	C	17.46	3.395066	0.62066	.	.	ENSG00000184185	ENST00000331718	T	0.38722	1.12	5.33	3.24	0.37175	Potassium channel, inwardly rectifying, Kir, N-terminal (1);	0.175986	0.42964	U	0.000638	T	0.54415	0.1857	L	0.59436	1.845	0.58432	D	0.999999	D	0.76494	0.999	D	0.64877	0.93	T	0.56980	-0.7889	10	0.87932	D	0	.	9.5137	0.39093	0.3622:0.5301:0.1077:0.0	.	40	Q14500	IRK12_HUMAN	C	40	ENSP00000328150:R40C	ENSP00000328150:R40C	R	+	1	0	KCNJ12	21259365	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.763000	0.38461	1.242000	0.43836	0.591000	0.81541	CGC	-	KCNJ12	-	pfam_K_chnl_inward-rec_Kir_N,pirsf_K_chnl_inward-rec_Kir		0.612	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	0	0	0	129	129	120	0.00	0.00	C	NM_021012		21318772	+1	27	8	168	72	tier1	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	13.85	10.00	SNP	1.000	T	27	168
TUBGCP2	10844	genome.wustl.edu	37	10	135094822	135094822	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr10:135094822T>C	ENST00000252936.3	-	16	2567	c.2528A>G	c.(2527-2529)tAt>tGt	p.Y843C	TUBGCP2_ENST00000543663.1_Missense_Mutation_p.Y871C|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.Y713C|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.Y843C|TUBGCP2_ENST00000368562.1_Missense_Mutation_p.Y436C			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	843					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ACTGGTGCTATAGATGCTCAG	0.632													ENSG00000130640																																					0													98.0	84.0	88.0					10																	135094822		2203	4300	6503	SO:0001583	missense	0			-	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2528A>G	10.37:g.135094822T>C	ENSP00000252936:p.Tyr843Cys		B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_TUBGCP,superfamily_Ocr	p.Y871C	ENST00000252936.3	37	c.2612	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	T	14.98	2.697961	0.48307	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.33865	2.38;2.13;2.38;1.39;2.41	4.49	3.27	0.37495	.	0.000000	0.85682	D	0.000000	T	0.41259	0.1151	M	0.65975	2.015	0.58432	D	0.999995	B;B;P	0.47762	0.03;0.018;0.9	B;B;P	0.48227	0.072;0.033;0.571	T	0.29119	-1.0022	10	0.38643	T	0.18	-20.1466	9.9607	0.41695	0.1522:0.0:0.0:0.8478	.	871;871;843	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	C	843;713;843;436;871	ENSP00000252936:Y843C;ENSP00000395666:Y713C;ENSP00000357551:Y843C;ENSP00000357550:Y436C;ENSP00000446093:Y871C	ENSP00000252936:Y843C	Y	-	2	0	TUBGCP2	134944812	1.000000	0.71417	0.993000	0.49108	0.840000	0.47671	4.655000	0.61476	2.036000	0.60181	0.459000	0.35465	TAT	-	TUBGCP2	-	NULL		0.632	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	0	0	0	76	76	61	0.00	0.00	T			135094822	-1	20	8	45	14	tier1	no_errors	ENST00000543663	ensembl	human	known	74_37	missense	30.30	36.36	SNP	1.000	C	20	45
RP11-364P22.2	0	genome.wustl.edu	37	4	158559249	158559249	+	lincRNA	SNP	A	A	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:158559249A>C	ENST00000507296.1	+	0	411																											aacaacaaaaagttaaaaagc	0.378													ENSG00000249275																																					0																																												0			-																													4.37:g.158559249A>C				R	SNP	-	NULL	ENST00000507296.1	37	NULL		4																																																																																			-	RP11-364P22.2	-	-		0.378	RP11-364P22.2-001	KNOWN	basic	lincRNA	ENSG00000249275	Clone_based_vega_gene	lincRNA	OTTHUMT00000365220.1	0	0	0	8	8	22	0.00	0.00	A			158559249	+1	8	11	4	20	tier1	no_errors	ENST00000507296	ensembl	human	known	74_37	rna	66.67	35.48	SNP	0.020	C	8	4
TTLL9	164395	genome.wustl.edu	37	20	30522516	30522516	+	Missense_Mutation	SNP	C	C	T	rs369485862		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:30522516C>T	ENST00000375938.4	+	12	1082	c.829C>T	c.(829-831)Cgc>Tgc	p.R277C	TTLL9_ENST00000535842.1_Missense_Mutation_p.R277C|TTLL9_ENST00000375922.4_Missense_Mutation_p.R219C|TTLL9_ENST00000310998.4_Missense_Mutation_p.R242C|TTLL9_ENST00000375921.2_Intron|TTLL9_ENST00000375934.4_Silent_p.S244S			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	277	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.R277C(1)|p.R266C(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GACGCTGCAGCGCTTCCGGCA	0.607													ENSG00000131044																																					2	Substitution - Missense(2)	lung(2)						C	CYS/ARG	0,3982		0,0,1991	27.0	28.0	28.0		829	4.2	1.0	20		28	2,8324		0,2,4161	no	missense	TTLL9	NM_001008409.2	180	0,2,6152	TT,TC,CC		0.024,0.0,0.0162	benign	277/440	30522516	2,12306	1991	4163	6154	SO:0001583	missense	0			-	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.829C>T	20.37:g.30522516C>T	ENSP00000365105:p.Arg277Cys		A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	pfam_TTL/TTLL_fam	p.R277C	ENST00000375938.4	37	c.829	CCDS42863.1	20	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672569	0.88348	0.0	2.4E-4	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375935;ENST00000375922	T;T;T;T	0.05855	3.38;3.38;3.38;3.38	5.09	4.15	0.48705	.	0.197212	0.46145	D	0.000316	T	0.16727	0.0402	L	0.46157	1.445	0.80722	D	1	D;D	0.67145	0.992;0.996	P;D	0.65443	0.809;0.935	T	0.00501	-1.1702	10	0.72032	D	0.01	.	12.8253	0.57716	0.0:0.9199:0.0:0.0801	.	277;179	Q3SXZ7;B1ANK8	TTLL9_HUMAN;.	C	277;277;242;266;219	ENSP00000365105:R277C;ENSP00000442515:R277C;ENSP00000308980:R242C;ENSP00000365088:R219C	ENSP00000308980:R242C	R	+	1	0	TTLL9	29986177	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.034000	0.57289	1.279000	0.44446	-0.254000	0.11334	CGC	-	TTLL9	-	pfam_TTL/TTLL_fam		0.607	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL9	HGNC	protein_coding		0	0	0	34	34	27	0.00	0.00	C	NM_001008409		30522516	+1	32	10	43	16	tier1	no_errors	ENST00000375938	ensembl	human	known	74_37	missense	42.11	38.46	SNP	1.000	T	32	43
TPH2	121278	genome.wustl.edu	37	12	72425429	72425429	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:72425429C>T	ENST00000333850.3	+	11	1568	c.1427C>T	c.(1426-1428)aCa>aTa	p.T476I		NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	476					aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	GACTTGAATACAGTGTGTGAT	0.413													ENSG00000139287																																					0													176.0	172.0	174.0					12																	72425429		2203	4300	6503	SO:0001583	missense	0			-	AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.1427C>T	12.37:g.72425429C>T	ENSP00000329093:p.Thr476Ile		A6NGA4|Q14CB0	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Trp_5_mOase	p.T476I	ENST00000333850.3	37	c.1427	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	C	5.981	0.364911	0.11296	.	.	ENSG00000139287	ENST00000333850	D	0.99488	-6.0	5.86	5.86	0.93980	Aromatic amino acid hydroxylase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96364	0.8814	N	0.03903	-0.33	0.80722	D	1	B	0.13145	0.007	B	0.15052	0.012	D	0.94018	0.7290	10	0.02654	T	1	-19.5798	20.1859	0.98214	0.0:1.0:0.0:0.0	.	476	Q8IWU9	TPH2_HUMAN	I	476	ENSP00000329093:T476I	ENSP00000329093:T476I	T	+	2	0	TPH2	70711696	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	4.952000	0.63618	2.777000	0.95525	0.591000	0.81541	ACA	-	TPH2	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Trp_5_mOase		0.413	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	0	0	0	47	47	124	0.00	0.00	C	NM_173353		72425429	+1	9	24	48	84	tier1	no_errors	ENST00000333850	ensembl	human	known	74_37	missense	15.79	22.22	SNP	1.000	T	9	48
ZNF536	9745	genome.wustl.edu	37	19	30935562	30935562	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:30935562C>A	ENST00000355537.3	+	2	1240	c.1093C>A	c.(1093-1095)Cgc>Agc	p.R365S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	365					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGGTCACATGCGCAAGCACAA	0.617													ENSG00000198597																																					0													99.0	105.0	103.0					19																	30935562		2203	4300	6503	SO:0001583	missense	0			-		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1093C>A	19.37:g.30935562C>A	ENSP00000347730:p.Arg365Ser		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R365S	ENST00000355537.3	37	c.1093	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301359	0.40694	.	.	ENSG00000198597	ENST00000355537	T	0.56776	0.44	5.41	4.35	0.52113	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.65302	0.2678	L	0.56124	1.755	0.49130	D	0.999759	D;D	0.89917	0.973;1.0	D;D	0.91635	0.93;0.999	T	0.66925	-0.5800	10	0.72032	D	0.01	-25.9075	10.8773	0.46919	0.421:0.579:0.0:0.0	.	365;365	A7E228;O15090	.;ZN536_HUMAN	S	365	ENSP00000347730:R365S	ENSP00000347730:R365S	R	+	1	0	ZNF536	35627402	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.834000	0.48167	2.523000	0.85059	0.491000	0.48974	CGC	-	ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.617	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	0	0	0	77	77	56	0.00	0.00	C	NM_014717		30935562	+1	14	5	56	23	tier1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	20.00	17.86	SNP	1.000	A	14	56
RASSF8	11228	genome.wustl.edu	37	12	26218075	26218075	+	Nonsense_Mutation	SNP	A	A	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr12:26218075A>T	ENST00000405154.2	+	3	947	c.748A>T	c.(748-750)Aaa>Taa	p.K250*	RASSF8_ENST00000541490.1_Nonsense_Mutation_p.K250*|RASSF8_ENST00000542865.1_Nonsense_Mutation_p.K250*|RASSF8_ENST00000381352.3_Nonsense_Mutation_p.K250*|RASSF8_ENST00000282884.9_Nonsense_Mutation_p.K250*	NM_001164748.1	NP_001158220.1	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 8	250	Glu-rich.				signal transduction (GO:0007165)					cervix(2)|endometrium(1)|large_intestine(6)|lung(15)|urinary_tract(1)	25	Colorectal(261;0.0847)					AATAAGACAGAAAATAACAGA	0.358													ENSG00000123094																																					0													100.0	107.0	105.0					12																	26218075		2203	4300	6503	SO:0001587	stop_gained	0			-	U82396	CCDS8705.1, CCDS53765.1	12p12.3	2013-05-30	2008-02-22	2005-09-14	ENSG00000123094	ENSG00000123094			13232	protein-coding gene	gene with protein product		608231	"""chromosome 12 open reading frame 2"""	C12orf2			Standard	NM_007211		Approved	HoJ-1	uc001rgx.3	Q8NHQ8	OTTHUMG00000169087	ENST00000405154.2:c.748A>T	12.37:g.26218075A>T	ENSP00000384491:p.Lys250*		A8K1Z0|O95647|Q5SCI2|Q76KB6	Nonsense_Mutation	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.K250*	ENST00000405154.2	37	c.748	CCDS53765.1	12	.	.	.	.	.	.	.	.	.	.	A	21.0	4.077193	0.76415	.	.	ENSG00000123094	ENST00000381352;ENST00000405154;ENST00000542865;ENST00000541490;ENST00000282884	.	.	.	5.21	4.03	0.46877	.	0.152790	0.53938	D	0.000042	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.3533	11.5375	0.50645	0.7179:0.2821:0.0:0.0	.	.	.	.	X	250	.	ENSP00000282884:K250X	K	+	1	0	RASSF8	26109342	1.000000	0.71417	0.958000	0.39756	0.947000	0.59692	4.359000	0.59449	0.898000	0.36418	0.460000	0.39030	AAA	-	RASSF8	-	NULL		0.358	RASSF8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF8	HGNC	protein_coding	OTTHUMT00000402209.2	0	0	0	40	40	77	0.00	0.00	A	NM_007211		26218075	+1	10	17	27	56	tier1	no_errors	ENST00000282884	ensembl	human	known	74_37	nonsense	27.03	23.29	SNP	0.998	T	10	27
FAM182B	728882	genome.wustl.edu	37	20	25755837	25755837	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr20:25755837G>A	ENST00000376403.1	-	3	497	c.119C>T	c.(118-120)cCa>cTa	p.P40L	FAM182B_ENST00000478164.1_5'UTR|FAM182B_ENST00000376404.2_Missense_Mutation_p.P37L			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	40										lung(1)	1						TCCGGGATGTGGACCAGGCAG	0.572													ENSG00000175170																																					0																																										SO:0001583	missense	0			-			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.119C>T	20.37:g.25755837G>A	ENSP00000365585:p.Pro40Leu		Q4G0Q1	Missense_Mutation	SNP	NULL	p.P37L	ENST00000376403.1	37	c.110		20	.	.	.	.	.	.	.	.	.	.	.	0.715	-0.785686	0.02907	.	.	ENSG00000175170	ENST00000376404;ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	L	37;40	.	ENSP00000365585:P40L	P	-	2	0	FAM182B	25703837	0.187000	0.23238	0.208000	0.23602	0.210000	0.24377	-0.339000	0.07832	0.064000	0.16427	0.064000	0.15345	CCA	-	FAM182B	-	NULL		0.572	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	FAM182B	HGNC	protein_coding	OTTHUMT00000078463.2	0	0	0	121	121	64	0.00	0.00	G	NR_026714		25755837	-1	12	7	60	32	tier1	no_errors	ENST00000376404	ensembl	human	known	74_37	missense	16.67	17.95	SNP	0.210	A	12	60
ALDH1L1	10840	genome.wustl.edu	37	3	125877353	125877353	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr3:125877353C>A	ENST00000393434.2	-	3	606	c.257G>T	c.(256-258)tGc>tTc	p.C86F	ALDH1L1_ENST00000472186.1_Missense_Mutation_p.C86F|ALDH1L1_ENST00000452905.2_Missense_Mutation_p.C86F|ALDH1L1_ENST00000455064.2_Intron|U1_ENST00000606575.1_RNA|ALDH1L1_ENST00000413612.1_5'Flank|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.C86F|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.C96F	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	86	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	GAATTGGCTGCAGAAGGGCAG	0.587													ENSG00000144908																																					0													85.0	76.0	79.0					3																	125877353		2203	4300	6503	SO:0001583	missense	0			-	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.257G>T	3.37:g.125877353C>A	ENSP00000377083:p.Cys86Phe		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.C86F	ENST00000393434.2	37	c.257	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	C	18.67	3.673835	0.67928	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434;ENST00000393431;ENST00000490367;ENST00000460368;ENST00000488356;ENST00000509952	T;T;T;T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	4.84	4.84	0.62591	Formyl transferase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	N	0.25426	0.745	0.80722	D	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.97110	0.996;1.0;1.0	T	0.79004	-0.1980	10	0.87932	D	0	.	15.4491	0.75259	0.0:1.0:0.0:0.0	.	86;138;86	E9PBX3;Q59G10;O75891	.;.;AL1L1_HUMAN	F	96;86;86;86;86;86;86;86;86	ENSP00000273450:C96F;ENSP00000420293:C86F;ENSP00000395881:C86F;ENSP00000377083:C86F;ENSP00000377081:C86F;ENSP00000418711:C86F;ENSP00000419826:C86F;ENSP00000419955:C86F;ENSP00000426594:C86F	ENSP00000273450:C96F	C	-	2	0	ALDH1L1	127360043	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.441000	0.80485	2.525000	0.85131	0.491000	0.48974	TGC	-	ALDH1L1	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH		0.587	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	0	0	0	64	64	79	0.00	0.00	C	NM_012190		125877353	-1	7	8	60	44	tier1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	10.29	15.38	SNP	1.000	A	7	60
NRXN3	9369	genome.wustl.edu	37	14	80327832	80327832	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr14:80327832C>A	ENST00000557594.1	+	6	2392	c.1439C>A	c.(1438-1440)gCt>gAt	p.A480D	NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000335750.5_Intron|NRXN3_ENST00000281127.7_Intron|NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000556003.1_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	480					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CGCTTCACAGCTTCCTCCTCG	0.502													ENSG00000021645																																					0																																										SO:0001583	missense	0			-	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1439C>A	14.37:g.80327832C>A	ENSP00000451672:p.Ala480Asp		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.A480D	ENST00000557594.1	37	c.1439		14	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177250	0.57692	.	.	ENSG00000021645	ENST00000330071;ENST00000557594	T	0.36157	1.27	6.05	6.05	0.98169	.	.	.	.	.	T	0.28034	0.0691	.	.	.	0.80722	D	1	P	0.38922	0.651	B	0.30401	0.115	T	0.02789	-1.1110	7	.	.	.	.	18.7818	0.91937	0.0:1.0:0.0:0.0	.	480	Q9HDB5	NRX3B_HUMAN	D	1486;480	ENSP00000451672:A480D	.	A	+	2	0	NRXN3	79397585	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.709000	0.84645	2.878000	0.98634	0.650000	0.86243	GCT	-	NRXN3	-	NULL		0.502	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	0	0	0	74	74	72	0.00	0.00	C	NM_001105250		80327832	+1	34	29	34	25	tier1	no_errors	ENST00000557594	ensembl	human	novel	74_37	missense	50.00	53.70	SNP	1.000	A	34	34
CCDC171	203238	genome.wustl.edu	37	9	15744289	15744290	+	Frame_Shift_Ins	INS	-	-	A	rs35013909	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr9:15744289_15744290insA	ENST00000380701.3	+	17	2396_2397	c.2068_2069insA	c.(2068-2070)gaafs	p.E690fs	CCDC171_ENST00000297641.3_Frame_Shift_Ins_p.E690fs	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	690																	AGAAATTGCTGAAAAAAACATG	0.297													ENSG00000164989																																					0																																										SO:0001589	frameshift_variant	0				AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2075dupA	9.37:g.15744296_15744296dupA	ENSP00000370077:p.Glu690fs		B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Frame_Shift_Ins	INS	superfamily_STAT_TF_coiled-coil	p.N692fs	ENST00000380701.3	37	c.2068_2069	CCDS6481.1	9																																																																																				CCDC171	-	superfamily_STAT_TF_coiled-coil		0.297	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC171	HGNC	protein_coding	OTTHUMT00000051768.4	0	0	0	64	64	56	0.00	0.00	-	NM_173550		15744290	+1	7	12	41	70	tier1	no_errors	ENST00000380701	ensembl	human	known	74_37	frame_shift_ins	14.58	14.63	INS	1.000:1.000	A	7	41
TEFM	79736	genome.wustl.edu	37	17	29233372	29233372	+	5'UTR	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr17:29233372G>T	ENST00000581216.1	-	0	466				TEFM_ENST00000580840.1_5'Flank|ADAP2_ENST00000583688.1_3'UTR	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial						DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										GCAGTGGGTCGTCCGCGTCTG	0.711													ENSG00000184060																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.-156C>A	17.37:g.29233372G>T			E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	R	SNP	-	NULL	ENST00000581216.1	37	NULL	CCDS42291.1	17																																																																																			-	ADAP2	-	-		0.711	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAP2	HGNC	protein_coding	OTTHUMT00000444498.1	0	0	0	14	14	7	0.00	0.00	G	NM_024683		29233372	+1	8	3	4	3	tier1	no_errors	ENST00000583688	ensembl	human	putative	74_37	rna	66.67	50.00	SNP	0.000	T	8	4
C1orf106	55765	genome.wustl.edu	37	1	200880698	200880698	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:200880698G>A	ENST00000367342.4	+	9	1532	c.1332G>A	c.(1330-1332)ccG>ccA	p.P444P	C1orf106_ENST00000413687.2_Silent_p.P359P	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	444										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCAAGCCCCCGCTGCCCCACG	0.687													ENSG00000163362																																					0													74.0	87.0	83.0					1																	200880698		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.1332G>A	1.37:g.200880698G>A			B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Silent	SNP	pfam_DUF3338	p.P444	ENST00000367342.4	37	c.1332		1																																																																																			-	C1orf106	-	NULL		0.687	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	HGNC	protein_coding	OTTHUMT00000087057.2	0	0	0	98	98	14	0.00	0.00	G	NM_018265		200880698	+1	25	2	50	8	tier1	no_errors	ENST00000367342	ensembl	human	known	74_37	silent	32.89	20.00	SNP	0.687	A	25	50
ERG	2078	genome.wustl.edu	37	21	39947669	39947669	+	5'UTR	SNP	C	C	T	rs371363525		TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr21:39947669C>T	ENST00000417133.2	-	0	141				ERG_ENST00000485493.1_5'UTR|ERG_ENST00000398919.2_5'UTR|ERG_ENST00000398897.1_5'UTR|ERG_ENST00000442448.1_5'UTR|ERG_ENST00000398910.1_5'UTR|ERG_ENST00000398911.1_5'UTR	NM_001136154.1|NM_001243432.1	NP_001129626.1|NP_001230361.1	Q12809	KCNH2_HUMAN	v-ets avian erythroblastosis virus E26 oncogene homolog						cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)		EWSR1/ERG(178)|NDRG1/ERG(5)|TMPRSS2/ERG(3582)|FUS/ERG(167)|SLC45A3/ERG(50)	lung(2)|ovary(1)|skin(1)	4		Prostate(19;3.6e-06)			Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CAGAACCTGACGGCTAGAAGA	0.448			T	"""EWSR1, TMPRSS2, ELF4, FUS, HERPUD1, NDRG1"""	"""Ewing sarcoma, prostate, AML"""								ENSG00000157554																									Esophageal Squamous(130;336 1700 3010 3083 40589)			Dom	yes		21	21q22.3	2078	v-ets erythroblastosis virus E26 oncogene like (avian)		"""M, E, L"""	0								T	,	1,4405	2.1+/-5.4	0,1,2202	73.0	60.0	64.0		,	0.9	0.0	21		64	1,8599	1.2+/-3.3	0,1,4299	no	utr-5,utr-5	ERG	NM_001136154.1,NM_004449.4	,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,	,	39947669	2,13004	2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			-		CCDS13657.1, CCDS13658.1, CCDS46648.1, CCDS46649.1, CCDS58789.1	21q22.3	2013-07-09	2013-07-09		ENSG00000157554	ENSG00000157554			3446	protein-coding gene	gene with protein product	"""v-ets avian erythroblastosis virus E26 oncogene related"", ""transcriptional regulator ERG (transforming protein ERG)"", ""v-ets erythroblastosis virus E26 oncogene like"", ""TMPRSS2-ERG prostate cancer specific"""	165080	"""v-ets avian erythroblastosis virus E26 oncogene related"""			3274086	Standard	NM_001136154		Approved	erg-3, p55	uc002yxa.3	P11308	OTTHUMG00000090767	ENST00000417133.2:c.-45G>A	21.37:g.39947669C>T			A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	R	SNP	-	NULL	ENST00000417133.2	37	NULL	CCDS46648.1	21																																																																																			-	ERG	-	-		0.448	ERG-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ERG	HGNC	protein_coding	OTTHUMT00000207532.2	0	0	0	40	40	84	0.00	0.00	C	NM_182918		39947669	-1	26	48	3	8	tier1	no_errors	ENST00000485493	ensembl	human	known	74_37	rna	89.66	85.71	SNP	0.073	T	26	3
INPP5D	3635	genome.wustl.edu	37	2	234055015	234055015	+	Silent	SNP	C	C	G			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr2:234055015C>G	ENST00000359570.5	+	10	801	c.801C>G	c.(799-801)gtC>gtG	p.V267V	INPP5D_ENST00000538935.1_Silent_p.V266V|INPP5D_ENST00000455936.2_Silent_p.V31V|INPP5D_ENST00000450745.1_Silent_p.V31V			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	279					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GCCCACAGGTCAAGGCCTTGC	0.612													ENSG00000168918																									NSCLC(82;1215 1426 16163 20348 41018)												0													61.0	60.0	61.0					2																	234055015		692	1591	2283	SO:0001819	synonymous_variant	0			-	U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.801C>G	2.37:g.234055015C>G			O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.V267	ENST00000359570.5	37	c.801		2																																																																																			-	INPP5D	-	NULL		0.612	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	HGNC	protein_coding		0	0	0	66	66	47	0.00	0.00	C	NM_001017915		234055015	+1	40	27	10	4	tier1	no_errors	ENST00000359570	ensembl	human	known	74_37	silent	80.00	87.10	SNP	1.000	G	40	10
MRGPRX4	117196	genome.wustl.edu	37	11	18195645	18195645	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:18195645G>A	ENST00000314254.3	+	1	1262	c.842G>A	c.(841-843)cGt>cAt	p.R281H	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						TTTAGGCAGCGTCAAAATAGG	0.498													ENSG00000179817																																					0													88.0	89.0	89.0					11																	18195645		2199	4290	6489	SO:0001583	missense	0			-	AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.842G>A	11.37:g.18195645G>A	ENSP00000314042:p.Arg281His		Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.R281H	ENST00000314254.3	37	c.842	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	7.726	0.698303	0.15106	.	.	ENSG00000179817	ENST00000314254	T	0.39592	1.07	2.85	-5.7	0.02421	.	0.934257	0.08943	N	0.871317	T	0.35158	0.0922	M	0.79011	2.435	0.09310	N	1	B	0.18461	0.028	B	0.13407	0.009	T	0.21724	-1.0237	10	0.21540	T	0.41	.	5.1213	0.14862	0.3667:0.0:0.4739:0.1594	.	281	Q96LA9	MRGX4_HUMAN	H	281	ENSP00000314042:R281H	ENSP00000314042:R281H	R	+	2	0	MRGPRX4	18152221	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-1.029000	0.03585	-2.234000	0.00715	-1.179000	0.01719	CGT	-	MRGPRX4	-	NULL		0.498	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	HGNC	protein_coding	OTTHUMT00000389788.1	0	0	0	67	67	5	0.00	0.00	G	NM_054032		18195645	+1	52	9	33	7	tier1	no_errors	ENST00000314254	ensembl	human	known	74_37	missense	61.18	56.25	SNP	0.000	A	52	33
OPRK1	4986	genome.wustl.edu	37	8	54163589	54163589	+	Silent	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:54163589G>A	ENST00000265572.3	-	2	306	c.9C>T	c.(7-9)tcC>tcT	p.S3S	OPRK1_ENST00000520287.1_Silent_p.S3S	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	3					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TCTGGATCGGGGAGTCCATGG	0.711													ENSG00000082556																																					0													6.0	9.0	8.0					8																	54163589		1954	4010	5964	SO:0001819	synonymous_variant	0			-		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.9C>T	8.37:g.54163589G>A			E5RHC9|Q499G4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Kappa_opi_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Neuropept_B/W_rcpt,prints_Somatstn_rcpt,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.S3	ENST00000265572.3	37	c.9	CCDS6152.1	8																																																																																			-	OPRK1	-	NULL		0.711	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPRK1	HGNC	protein_coding	OTTHUMT00000378048.1	0	0	0	29	29	9	0.00	0.00	G			54163589	-1	25	7	25	3	tier1	no_errors	ENST00000265572	ensembl	human	known	74_37	silent	48.08	70.00	SNP	0.999	A	25	25
OR2T1	26696	genome.wustl.edu	37	1	248569970	248569970	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:248569970C>A	ENST00000366474.1	+	1	675	c.675C>A	c.(673-675)aaC>aaA	p.N225K		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.N225K(1)		NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGGAGATTAACCACTTCTTCT	0.512													ENSG00000175143																																					1	Substitution - Missense(1)	lung(1)											144.0	131.0	135.0					1																	248569970		2203	4300	6503	SO:0001583	missense	0			-	U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.675C>A	1.37:g.248569970C>A	ENSP00000355430:p.Asn225Lys		Q6IEZ9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N225K	ENST00000366474.1	37	c.675	CCDS31115.1	1	.	.	.	.	.	.	.	.	.	.	c	15.68	2.905883	0.52333	.	.	ENSG00000175143	ENST00000366474	T	0.00115	8.71	4.75	0.61	0.17580	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	U	0.001253	T	0.00271	0.0008	L	0.58428	1.81	0.09310	N	1	D	0.56746	0.977	P	0.62560	0.904	T	0.48725	-0.9010	10	0.72032	D	0.01	.	5.4531	0.16576	0.0:0.5441:0.1374:0.3185	.	225	O43869	OR2T1_HUMAN	K	225	ENSP00000355430:N225K	ENSP00000355430:N225K	N	+	3	2	OR2T1	246636593	0.004000	0.15560	0.213000	0.23690	0.856000	0.48823	-0.657000	0.05335	0.218000	0.20820	0.650000	0.86243	AAC	-	OR2T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T1	HGNC	protein_coding	OTTHUMT00000097346.2	0	0	0	44	44	89	0.00	0.00	C			248569970	+1	37	45	5	8	tier1	no_errors	ENST00000366474	ensembl	human	known	74_37	missense	88.10	84.91	SNP	0.054	A	37	5
SPIB	6689	genome.wustl.edu	37	19	50923209	50923209	+	Missense_Mutation	SNP	C	C	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:50923209C>A	ENST00000595883.1	+	2	55	c.30C>A	c.(28-30)gaC>gaA	p.D10E	SPIB_ENST00000596074.1_Missense_Mutation_p.D10E|SPIB_ENST00000270632.7_Missense_Mutation_p.D10E|SPIB_ENST00000439922.2_5'UTR|CTD-2545M3.6_ENST00000599632.1_Silent_p.R145R|SPIB_ENST00000597855.1_Missense_Mutation_p.D10E	NM_001243999.1|NM_001244000.1|NM_003121.4	NP_001230928.1|NP_001230929.1|NP_003112.2	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	10	TAD1 (Acidic).				cell differentiation (GO:0030154)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)	14		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CCAGGCTCGACGGGCCACACT	0.647													ENSG00000269404																																					0													35.0	30.0	32.0					19																	50923209		2201	4300	6501	SO:0001583	missense	0			-		CCDS33080.1, CCDS58674.1, CCDS59412.1	19q13.3-q13.4	2008-07-22				ENSG00000269404			11242	protein-coding gene	gene with protein product		606802				1406622	Standard	NM_003121		Approved	SPI-B	uc002psd.3	Q01892		ENST00000595883.1:c.30C>A	19.37:g.50923209C>A	ENSP00000471921:p.Asp10Glu		A8K9C9|B4DUG6|Q15359	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.D10E	ENST00000595883.1	37	c.30	CCDS33080.1	19	.	.	.	.	.	.	.	.	.	.	C	11.78	1.740744	0.30865	.	.	ENSG00000142539	ENST00000270632	T	0.52754	0.65	2.29	-1.33	0.09172	.	.	.	.	.	T	0.44393	0.1291	L	0.40543	1.245	0.80722	D	1	D;D	0.63880	0.989;0.993	D;D	0.69479	0.943;0.964	T	0.57046	-0.7878	9	0.02654	T	1	0.1745	5.2332	0.15434	0.0:0.4095:0.0:0.5905	.	10;10	Q01892-2;Q01892	.;SPIB_HUMAN	E	10	ENSP00000270632:D10E	ENSP00000270632:D10E	D	+	3	2	SPIB	55615021	0.000000	0.05858	0.985000	0.45067	0.897000	0.52465	-4.360000	0.00246	-0.258000	0.09446	-0.476000	0.04901	GAC	-	SPIB	-	NULL		0.647	SPIB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPIB	HGNC	protein_coding	OTTHUMT00000464744.1	0	0	0	240	240	24	0.00	0.00	C	NM_003121		50923209	+1	69	5	127	1	tier1	no_errors	ENST00000595883	ensembl	human	known	74_37	missense	35.20	83.33	SNP	0.990	A	69	127
SLAIN2	57606	genome.wustl.edu	37	4	48380035	48380035	+	Nonsense_Mutation	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:48380035C>T	ENST00000264313.6	+	3	1079	c.661C>T	c.(661-663)Cga>Tga	p.R221*	SLAIN2_ENST00000506375.1_3'UTR|SLAIN2_ENST00000512093.1_Nonsense_Mutation_p.R28*	NM_020846.1	NP_065897.1	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2	221					cytoplasmic microtubule organization (GO:0031122)|microtubule nucleation (GO:0007020)|positive regulation of microtubule polymerization (GO:0031116)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)	13						AACCCCAGTGCGACCTCCTAT	0.408													ENSG00000109171																																					0													121.0	120.0	120.0					4																	48380035		1884	4110	5994	SO:0001587	stop_gained	0			-	BC006139	CCDS47051.1	4p12	2008-02-05	2006-09-12	2006-09-12	ENSG00000109171	ENSG00000109171			29282	protein-coding gene	gene with protein product		610492	"""KIAA1458"""	KIAA1458		16546155	Standard	NM_020846		Approved	FLJ21611	uc003gya.4	Q9P270	OTTHUMG00000161701	ENST00000264313.6:c.661C>T	4.37:g.48380035C>T	ENSP00000264313:p.Arg221*		A8K4P1|Q8N5R3	Nonsense_Mutation	SNP	NULL	p.R221*	ENST00000264313.6	37	c.661	CCDS47051.1	4	.	.	.	.	.	.	.	.	.	.	C	20.9	4.062404	0.76187	.	.	ENSG00000109171	ENST00000264313;ENST00000512093	.	.	.	5.96	4.01	0.46588	.	0.123592	0.52532	D	0.000065	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	-6.4436	12.3262	0.55011	0.5695:0.4305:0.0:0.0	.	.	.	.	X	221;28	.	ENSP00000264313:R221X	R	+	1	2	SLAIN2	48074792	1.000000	0.71417	0.997000	0.53966	0.385000	0.30292	2.594000	0.46189	1.462000	0.47948	0.655000	0.94253	CGA	-	SLAIN2	-	NULL		0.408	SLAIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAIN2	HGNC	protein_coding	OTTHUMT00000365807.4	0	0	0	68	68	117	0.00	0.00	C	NM_020846		48380035	+1	7	7	61	116	tier1	no_errors	ENST00000264313	ensembl	human	known	74_37	nonsense	10.29	5.69	SNP	1.000	T	7	61
AMOT	154796	genome.wustl.edu	37	X	112022791	112022791	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chrX:112022791G>A	ENST00000524145.1	-	11	2665	c.2591C>T	c.(2590-2592)aCc>aTc	p.T864I	AMOT_ENST00000371959.3_Missense_Mutation_p.T864I|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000304758.1_Missense_Mutation_p.T455I|AMOT_ENST00000371962.1_Missense_Mutation_p.T632I			Q4VCS5	AMOT_HUMAN	angiomotin	864					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						TTCAGTTTGGGTACTGCAGTC	0.592													ENSG00000126016																																					0													116.0	77.0	91.0					X																	112022791		2203	4300	6503	SO:0001583	missense	0			-	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2591C>T	X.37:g.112022791G>A	ENSP00000429013:p.Thr864Ile		Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.T864I	ENST00000524145.1	37	c.2591	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292894	0.80914	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214	T;T;T;T	0.38722	1.49;1.12;1.34;1.12	5.5	5.5	0.81552	.	0.047914	0.85682	D	0.000000	T	0.63129	0.2485	M	0.68317	2.08	0.58432	D	0.999999	D	0.89917	1.0	D	0.69307	0.963	T	0.65047	-0.6263	10	0.56958	D	0.05	-15.4293	17.3331	0.87271	0.0:0.0:1.0:0.0	.	864	Q4VCS5	AMOT_HUMAN	I	455;864;632;864;104	ENSP00000305557:T455I;ENSP00000361027:T864I;ENSP00000361030:T632I;ENSP00000429013:T864I	ENSP00000305557:T455I	T	-	2	0	AMOT	111909447	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.676000	0.98643	2.305000	0.77605	0.529000	0.55759	ACC	-	AMOT	-	NULL		0.592	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	0	0	0	70	70	71	0.00	0.00	G	NM_133265		112022791	-1	10	8	92	84	tier1	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	9.80	8.70	SNP	1.000	A	10	92
TEKT4P2	100132288	genome.wustl.edu	37	21	9908223	9908223	+	RNA	SNP	G	G	A	rs374471127	byFrequency	TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr21:9908223G>A	ENST00000416067.1	-	0	569					NR_037872.1|NR_038327.1				tektin 4 pseudogene 2																		GGAGAGGGTCGCAGCGAGGAG	0.627													ENSG00000188681	.|||	279	0.0557109	0.0129	0.049	5008	,	,		23956	0.0942		0.0616	False		,,,				2504	0.0726																0																																												0			-			21p11.2	2012-10-03	2011-06-14	2011-06-14	ENSG00000188681	ENSG00000188681			40046	pseudogene	pseudogene			"""MAFF interacting protein-like"""	MAFIPL			Standard	NR_038327		Approved		uc021wgx.1		OTTHUMG00000172149		21.37:g.9908223G>A				R	SNP	-	NULL	ENST00000416067.1	37	NULL		21																																																																																			-	TEKT4P2	-	-		0.627	TEKT4P2-002	KNOWN	basic	processed_transcript	TEKT4P2	HGNC	pseudogene	OTTHUMT00000417115.1	0	0	0	62	62	13	0.00	0.00	G	NM_001033515		9908223	-1	2	1	8	2	tier1	no_errors	ENST00000416067	ensembl	human	known	74_37	rna	20.00	33.33	SNP	0.000	A	2	8
ZDHHC13	54503	genome.wustl.edu	37	11	19138776	19138776	+	5'UTR	SNP	C	C	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr11:19138776C>T	ENST00000446113.2	+	0	101				ZDHHC13_ENST00000399351.3_5'UTR	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13						metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						GTAGCCTCAGCCGCTGTGGGC	0.736													ENSG00000177054																																					0													3.0	5.0	4.0					11																	19138776		1489	3316	4805	SO:0001623	5_prime_UTR_variant	0			-	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.-21C>T	11.37:g.19138776C>T			Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	R	SNP	-	NULL	ENST00000446113.2	37	NULL	CCDS44550.1	11																																																																																			-	ZDHHC13	-	-		0.736	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZDHHC13	HGNC	protein_coding	OTTHUMT00000387821.1	0	0	0	41	41	7	0.00	0.00	C	NM_019028		19138776	+1	4	0	33	5	tier1	no_errors	ENST00000524744	ensembl	human	putative	74_37	rna	10.81	0.00	SNP	0.003	T	4	33
FAM86B3P	286042	genome.wustl.edu	37	8	8095821	8095821	+	RNA	SNP	T	T	C			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr8:8095821T>C	ENST00000310542.3	+	0	0				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		AGAGGCCCTTTGCCTTCACAG	0.607													ENSG00000253981																																					0																																												0			-			8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8095821T>C				R	SNP	-	NULL	ENST00000310542.3	37	NULL		8																																																																																			-	ALG1L13P	-	-		0.607	FAM86B3P-005	KNOWN	basic	processed_transcript	ALG1L13P	HGNC	pseudogene	OTTHUMT00000448496.1	0	0	0	274	274	0	0.00	0.00	T			8095821	-1	44	0	386	0	tier1	no_errors	ENST00000518201	ensembl	human	known	74_37	rna	10.23	0.00	SNP	1.000	C	44	386
RP11-435B5.5	0	genome.wustl.edu	37	1	143391795	143391795	+	lincRNA	SNP	G	G	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr1:143391795G>A	ENST00000428624.1	+	0	2011				RP11-435B5.4_ENST00000423249.1_lincRNA																							ATAAATCAGAGCTAGATGAAA	0.308													ENSG00000238261																																					0																																												0			-																													1.37:g.143391795G>A				R	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			-	RP11-435B5.5	-	-		0.308	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	0	0	0	392	392	3	0.00	0.00	G			143391795	+1	75	0	303	3	tier1	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	19.84	0.00	SNP	0.855	A	75	303
PNPLA6	10908	genome.wustl.edu	37	19	7619936	7619936	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr19:7619936T>A	ENST00000221249.6	+	25	3109	c.2678T>A	c.(2677-2679)tTt>tAt	p.F893Y	PNPLA6_ENST00000600737.1_Missense_Mutation_p.F931Y|PNPLA6_ENST00000414982.3_Missense_Mutation_p.F941Y|PNPLA6_ENST00000545201.2_Missense_Mutation_p.F866Y|PNPLA6_ENST00000450331.3_Missense_Mutation_p.F893Y	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	932					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CGCCGCCTCTTTTCGCGCCGC	0.731													ENSG00000032444																																					0													7.0	9.0	8.0					19																	7619936		2152	4233	6385	SO:0001583	missense	0			-	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2678T>A	19.37:g.7619936T>A	ENSP00000221249:p.Phe893Tyr		A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.F941Y	ENST00000221249.6	37	c.2822	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	t	21.9	4.222094	0.79464	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.35	5.35	0.76521	.	0.110115	0.64402	D	0.000006	T	0.51975	0.1706	M	0.83012	2.62	0.58432	D	0.999997	D;D;P;D	0.69078	0.997;0.996;0.685;0.974	D;D;B;D	0.65573	0.911;0.936;0.382;0.915	T	0.58836	-0.7566	10	0.72032	D	0.01	.	13.3305	0.60483	0.0:0.0:0.0:1.0	.	932;866;931;893	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	Y	893;866;941;893	ENSP00000221249:F893Y;ENSP00000443323:F866Y;ENSP00000407509:F941Y;ENSP00000394348:F893Y	ENSP00000221249:F893Y	F	+	2	0	PNPLA6	7525936	1.000000	0.71417	1.000000	0.80357	0.109000	0.19521	7.975000	0.88055	2.040000	0.60383	0.454000	0.30748	TTT	-	PNPLA6	-	NULL		0.731	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	0	0	0	49	49	4	0.00	0.00	T	NM_006702		7619936	+1	10	0	39	0	tier1	no_errors	ENST00000414982	ensembl	human	known	74_37	missense	20.41	0.00	SNP	1.000	A	10	39
SLIT2	9353	genome.wustl.edu	37	4	20530661	20530661	+	Missense_Mutation	SNP	G	G	T			TCGA-SI-AA8B-01A-11D-A387-09	TCGA-SI-AA8B-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4e8ac125-c26a-4677-9ddb-c0b6c8fa4ddb	47631d66-5a15-4dbc-a27c-c9505a24e1a8	g.chr4:20530661G>T	ENST00000504154.1	+	16	1804	c.1552G>T	c.(1552-1554)Gat>Tat	p.D518Y	SLIT2_ENST00000503837.1_Missense_Mutation_p.D514Y|SLIT2_ENST00000503823.1_Missense_Mutation_p.D510Y|SLIT2_ENST00000273739.5_Missense_Mutation_p.D522Y|MIR218-1_ENST00000384999.1_RNA	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	518	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AACCACAGTAGATTGCTCTAA	0.443													ENSG00000145147																																					0													125.0	124.0	124.0					4																	20530661		2203	4300	6503	SO:0001583	missense	0			-	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1552G>T	4.37:g.20530661G>T	ENSP00000422591:p.Asp518Tyr		B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.D518Y	ENST00000504154.1	37	c.1552	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083795	0.76642	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.96427	-4.01;-4.01;-4.01;-4.01	5.93	5.93	0.95920	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.98005	0.9343	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.87578	0.716;0.998	D	0.98206	1.0470	10	0.66056	D	0.02	.	20.3465	0.98790	0.0:0.0:1.0:0.0	.	510;518	O94813-3;O94813	.;SLIT2_HUMAN	Y	510;518;522;514;514	ENSP00000427548:D510Y;ENSP00000422591:D518Y;ENSP00000273739:D522Y;ENSP00000422261:D514Y	ENSP00000273739:D522Y	D	+	1	0	SLIT2	20139759	1.000000	0.71417	0.928000	0.36995	0.873000	0.50193	9.467000	0.97671	2.798000	0.96311	0.655000	0.94253	GAT	-	SLIT2	-	pfam_LRR-contain_N,smart_LRR-contain_N		0.443	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	0	0	0	50	50	113	0.00	0.00	G			20530661	+1	8	3	74	147	tier1	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	9.76	2.00	SNP	1.000	T	8	74
