#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
DGKG	1608	genome.wustl.edu	37	3	186015929	186015929	+	Silent	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr3:186015929G>T	ENST00000265022.3	-	4	773	c.234C>A	c.(232-234)gcC>gcA	p.A78A	DGKG_ENST00000544847.1_Silent_p.A78A|DGKG_ENST00000382164.4_Silent_p.A78A|DGKG_ENST00000344484.4_Silent_p.A78A	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	78					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TCTGGCTGAAGGCCAGGAAGA	0.587													ENSG00000058866																																					0													109.0	107.0	107.0					3																	186015929		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.234C>A	3.37:g.186015929G>T			B2RAH4|Q2M1H4|Q5FWG1	Silent	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A78	ENST00000265022.3	37	c.234	CCDS3274.1	3																																																																																			-	DGKG	-	NULL		0.587	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3	0	0	0	90	90	75	0.00	0.00	G			186015929	-1	7	6	54	45	tier1	no_errors	ENST00000265022	ensembl	human	known	74_37	silent	11.48	11.76	SNP	1.000	T	7	54
HS6ST3	266722	genome.wustl.edu	37	13	97485014	97485014	+	Silent	SNP	T	T	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr13:97485014T>A	ENST00000376705.2	+	2	1002	c.978T>A	c.(976-978)acT>acA	p.T326T		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	326					heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					ATAACTTGACTTTCATGAACG	0.502													ENSG00000185352																																					0													90.0	90.0	90.0					13																	97485014		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.978T>A	13.37:g.97485014T>A			Q5W0L0|Q68CW6	Silent	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.T326	ENST00000376705.2	37	c.978	CCDS9481.1	13																																																																																			-	HS6ST3	-	pfam_Sulfotransferase		0.502	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST3	HGNC	protein_coding	OTTHUMT00000045517.2	0	0	0	64	64	96	0.00	0.00	T	NM_153456		97485014	+1	5	6	38	43	tier1	no_errors	ENST00000376705	ensembl	human	known	74_37	silent	11.63	12.24	SNP	0.934	A	5	38
FRMPD2	143162	genome.wustl.edu	37	10	49414887	49414887	+	Silent	SNP	G	G	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:49414887G>T	ENST00000374201.3	-	14	2003	c.1701C>A	c.(1699-1701)atC>atA	p.I567I	FRMPD2_ENST00000407470.4_Silent_p.I535I|FRMPD2_ENST00000305531.3_Silent_p.I542I	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	567	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CCTTGGCACAGATCCCCAGGG	0.483													ENSG00000170324																																					0													127.0	115.0	119.0					10																	49414887		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.1701C>A	10.37:g.49414887G>T			B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Silent	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.I567	ENST00000374201.3	37	c.1701	CCDS31195.1	10																																																																																			-	FRMPD2	-	pfam_FERM_PH-like_C,pfscan_FERM_domain		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	0	0	1	106	106	83	0.00	1.19	G	NM_152428		49414887	-1	10	9	33	35	tier1	no_errors	ENST00000374201	ensembl	human	known	74_37	silent	23.26	20.45	SNP	0.998	T	10	33
PASD1	139135	genome.wustl.edu	37	X	150789982	150789982	+	Silent	SNP	A	A	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrX:150789982A>G	ENST00000370357.4	+	6	581	c.336A>G	c.(334-336)ttA>ttG	p.L112L		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	112						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGTCATTTAAAAAGAGGAA	0.289													ENSG00000166049																																					0													131.0	107.0	115.0					X																	150789982		2202	4297	6499	SO:0001819	synonymous_variant	0			-	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.336A>G	X.37:g.150789982A>G			Q3MNE0|Q69HD7|Q8N7X9	Silent	SNP	superfamily_PAS,smart_PAS,pfscan_PAS	p.L112	ENST00000370357.4	37	c.336	CCDS35431.1	X																																																																																			-	PASD1	-	superfamily_PAS		0.289	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	HGNC	protein_coding	OTTHUMT00000060879.2	0	0	0	133	133	90	0.00	0.00	A	NM_173493		150789982	+1	32	35	51	56	tier1	no_errors	ENST00000370357	ensembl	human	known	74_37	silent	38.55	38.46	SNP	0.001	G	32	51
PKHD1L1	93035	genome.wustl.edu	37	8	110457290	110457290	+	Missense_Mutation	SNP	T	T	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:110457290T>A	ENST00000378402.5	+	38	5296	c.5192T>A	c.(5191-5193)gTg>gAg	p.V1731E		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1731	IPT/TIG 9.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATACATGGAGTGCCTGCCCAG	0.433										HNSCC(38;0.096)			ENSG00000205038																																					0													170.0	164.0	166.0					8																	110457290		1924	4142	6066	SO:0001583	missense	0			-	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5192T>A	8.37:g.110457290T>A	ENSP00000367655:p.Val1731Glu		Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.V1731E	ENST00000378402.5	37	c.5192	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753855	0.69648	.	.	ENSG00000205038	ENST00000378402	T	0.74106	-0.81	6.17	5.0	0.66597	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.078312	0.52532	D	0.000061	T	0.78604	0.4309	L	0.60455	1.87	0.27804	N	0.942394	P	0.48016	0.904	P	0.53549	0.729	T	0.73626	-0.3923	10	0.66056	D	0.02	.	10.9899	0.47543	0.1398:0.0:0.0:0.8602	.	1731	Q86WI1	PKHL1_HUMAN	E	1731	ENSP00000367655:V1731E	ENSP00000367655:V1731E	V	+	2	0	PKHD1L1	110526466	0.945000	0.32115	1.000000	0.80357	0.998000	0.95712	1.955000	0.40372	1.113000	0.41760	0.533000	0.62120	GTG	-	PKHD1L1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT		0.433	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	0	0	0	66	66	87	0.00	0.00	T	NM_177531		110457290	+1	5	14	49	114	tier1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	9.26	10.94	SNP	1.000	A	5	49
IZUMO3	100129669	genome.wustl.edu	37	9	24543733	24543733	+	Silent	SNP	A	A	T	rs7859006	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr9:24543733A>T	ENST00000543880.2	-	6	741	c.510T>A	c.(508-510)gcT>gcA	p.A170A	RP11-20A20.2_ENST00000602851.1_lincRNA|IZUMO3_ENST00000604921.1_Silent_p.A164A			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CTCGATTCTCAGCCTTTCTTG	0.388													ENSG00000205442																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.510T>A	9.37:g.24543733A>T				Silent	SNP	NULL	p.A170	ENST00000543880.2	37	c.510		9	.	.	.	.	.	.	.	.	.	.	A	1.469	-0.560331	0.03939	.	.	ENSG00000205442	ENST00000412335	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.918	10.7137	0.46000	1.0:0.0:0.0:0.0	.	.	.	.	R	103	.	.	X	-	1	0	IZUMO3	24533733	0.939000	0.31865	0.864000	0.33941	0.069000	0.16628	1.721000	0.38032	2.091000	0.63221	0.528000	0.53228	TGA	-	IZUMO3	-	NULL		0.388	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	HGNC	protein_coding	OTTHUMT00000467652.1	0	0	0	68	68	112	0.00	0.00	A	NM_001271706		24543733	-1	17	36	23	43	tier1	no_errors	ENST00000543880	ensembl	human	novel	74_37	silent	42.50	45.57	SNP	0.882	T	17	23
RABGAP1L	9910	genome.wustl.edu	37	1	174652688	174652688	+	Missense_Mutation	SNP	G	G	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:174652688G>C	ENST00000251507.4	+	15	2027	c.1853G>C	c.(1852-1854)gGg>gCg	p.G618A		NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						GAAGACATTGGGTACTGTCAA	0.368													ENSG00000152061																																					0													231.0	205.0	214.0					1																	174652688		2203	4300	6503	SO:0001583	missense	0			-	AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1853G>C	1.37:g.174652688G>C	ENSP00000251507:p.Gly618Ala		B7ZAA4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.G618A	ENST00000251507.4	37	c.1853	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638387	0.87760	.	.	ENSG00000152061	ENST00000251507;ENST00000367692	T	0.10860	2.83	5.42	5.42	0.78866	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.65409	-0.6175	10	0.87932	D	0	.	18.3433	0.90313	0.0:0.0:1.0:0.0	.	618	Q5R372	RBG1L_HUMAN	A	618;630	ENSP00000251507:G618A	ENSP00000251507:G618A	G	+	2	0	RABGAP1L	172919311	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	8.805000	0.91925	2.687000	0.91594	0.655000	0.94253	GGG	-	RABGAP1L	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.368	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084497.1	0	0	0	145	145	120	0.00	0.00	G	NM_001243765		174652688	+1	7	10	80	67	tier1	no_errors	ENST00000251507	ensembl	human	known	74_37	missense	8.05	12.99	SNP	1.000	C	7	80
GCNT6	644378	genome.wustl.edu	37	6	10634149	10634149	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:10634149G>A	ENST00000417671.1	+	1	157	c.157G>A	c.(157-159)Gca>Aca	p.A53T				Q5T4J0	GCNT6_HUMAN	glucosaminyl (N-acetyl) transferase 6	53					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)			breast(1)	1						CATCTGTGACGCAGCCCTAAA	0.438													ENSG00000205318																																					0																																										SO:0001583	missense	0			-			6p24.2	2013-02-25			ENSG00000205318	ENSG00000205318		"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	21623	protein-coding gene	gene with protein product							Standard			Approved	bA421M1.3		Q5T4J0	OTTHUMG00000014243	ENST00000417671.1:c.157G>A	6.37:g.10634149G>A	ENSP00000398277:p.Ala53Thr			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.A53T	ENST00000417671.1	37	c.157		6	.	.	.	.	.	.	.	.	.	.	g	12.08	1.831626	0.32329	.	.	ENSG00000205318	ENST00000417671	T	0.10382	2.88	3.36	-3.52	0.04682	.	.	.	.	.	T	0.01592	0.0051	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.46133	-0.9213	7	0.15499	T	0.54	.	3.964	0.09423	0.4279:0.0:0.3118:0.2603	.	.	.	.	T	53	ENSP00000398277:A53T	ENSP00000398277:A53T	A	+	1	0	GCNT6	10742135	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.881000	0.01626	-1.154000	0.02825	-2.244000	0.00286	GCA	-	GCNT6	-	NULL		0.438	GCNT6-201	KNOWN	basic|appris_principal	protein_coding	GCNT6	HGNC	protein_coding		0	0	0	59	59	138	0.00	0.00	G			10634149	+1	16	47	25	56	tier1	no_errors	ENST00000417671	ensembl	human	known	74_37	missense	39.02	45.19	SNP	0.000	A	16	25
KHDRBS2	202559	genome.wustl.edu	37	6	62757794	62757794	+	Missense_Mutation	SNP	C	C	G			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:62757794C>G	ENST00000281156.4	-	3	603	c.325G>C	c.(325-327)Gat>Cat	p.D109H		NM_152688.2	NP_689901.2	Q5VWX1	KHDR2_HUMAN	KH domain containing, RNA binding, signal transduction associated 2	109	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) binding (GO:0008143)|poly(U) RNA binding (GO:0008266)	p.D109Y(1)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|liver(1)|lung(13)|ovary(3)|prostate(3)|skin(12)|upper_aerodigestive_tract(2)|urinary_tract(1)	49				BRCA - Breast invasive adenocarcinoma(397;0.149)		TTAGCTTTATCTCTCATTGAT	0.408													ENSG00000112232																																					1	Substitution - Missense(1)	endometrium(1)											197.0	188.0	191.0					6																	62757794		2203	4300	6503	SO:0001583	missense	0			-	BC034043	CCDS4963.1	6q11.1	2013-09-20			ENSG00000112232	ENSG00000112232			18114	protein-coding gene	gene with protein product	"""Sam68-like mammalian protein 1"""	610487					Standard	NM_152688		Approved	SLM1, SLM-1, MGC26664	uc003peg.2	Q5VWX1	OTTHUMG00000014936	ENST00000281156.4:c.325G>C	6.37:g.62757794C>G	ENSP00000281156:p.Asp109His		A8K7M8|Q8N4I4|Q8TCZ4	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.D109H	ENST00000281156.4	37	c.325	CCDS4963.1	6	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850198	0.71719	.	.	ENSG00000112232	ENST00000281156;ENST00000539571	T	0.19394	2.15	5.12	4.26	0.50523	K Homology (1);K Homology, type 1 (1);	0.098954	0.64402	D	0.000002	T	0.39708	0.1088	M	0.82193	2.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.49153	-0.8969	10	0.87932	D	0	-5.9294	13.7525	0.62917	0.0:0.9255:0.0:0.0745	.	109	Q5VWX1	KHDR2_HUMAN	H	109	ENSP00000281156:D109H	ENSP00000281156:D109H	D	-	1	0	KHDRBS2	62815753	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.776000	0.85560	1.301000	0.44836	0.460000	0.39030	GAT	-	KHDRBS2	-	smart_KH_dom,pfscan_KH_dom_type_1		0.408	KHDRBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS2	HGNC	protein_coding	OTTHUMT00000041066.2	0	0	0	99	99	92	0.00	0.00	C	NM_152688		62757794	-1	13	55	32	58	tier1	no_errors	ENST00000281156	ensembl	human	known	74_37	missense	28.89	48.67	SNP	1.000	G	13	32
PAXIP1	22976	genome.wustl.edu	37	7	154752762	154752762	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr7:154752762C>T	ENST00000404141.1	-	12	2429	c.2275G>A	c.(2275-2277)Gcc>Acc	p.A759T	PAXIP1_ENST00000397192.1_Missense_Mutation_p.A759T|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	759	BRCT 4. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CACTCTTTGGCTTTTTCATAC	0.393													ENSG00000157212																																					0													80.0	77.0	78.0					7																	154752762		1864	4091	5955	SO:0001583	missense	0			-	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2275G>A	7.37:g.154752762C>T	ENSP00000384048:p.Ala759Thr		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.A759T	ENST00000404141.1	37	c.2275	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	27.5	4.841079	0.91197	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	D;D	0.97455	-4.39;-4.39	5.51	5.51	0.81932	BRCT (3);	0.000000	0.56097	U	0.000040	D	0.98495	0.9498	M	0.81802	2.56	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.999	D	0.99521	1.0958	10	0.87932	D	0	-23.208	19.4545	0.94882	0.0:1.0:0.0:0.0	.	712;725;759	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	T	759;759;583;712	ENSP00000384048:A759T;ENSP00000380376:A759T	ENSP00000319149:A712T	A	-	1	0	PAXIP1	154383695	1.000000	0.71417	0.986000	0.45419	0.925000	0.55904	7.525000	0.81892	2.590000	0.87494	0.650000	0.86243	GCC	-	PAXIP1	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom		0.393	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	0	0	0	111	111	103	0.00	0.00	C	NM_007349		154752762	-1	19	22	43	33	tier1	no_errors	ENST00000397192	ensembl	human	known	74_37	missense	30.65	40.00	SNP	1.000	T	19	43
USP46	64854	genome.wustl.edu	37	4	53492298	53492298	+	Missense_Mutation	SNP	T	T	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr4:53492298T>C	ENST00000441222.3	-	4	632	c.448A>G	c.(448-450)Aaa>Gaa	p.K150E	USP46_ENST00000451218.2_Missense_Mutation_p.K123E|USP46_ENST00000508499.1_Missense_Mutation_p.K143E	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	150	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TTGCCATTTTTTAATTTTCCA	0.383													ENSG00000109189																																					0													137.0	124.0	128.0					4																	53492298		1821	4085	5906	SO:0001583	missense	0			-	AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.448A>G	4.37:g.53492298T>C	ENSP00000407818:p.Lys150Glu		B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.K150E	ENST00000441222.3	37	c.448	CCDS47053.1	4	.	.	.	.	.	.	.	.	.	.	T	1.078	-0.667891	0.03428	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.23754	1.97;1.89;1.97	5.0	2.45	0.29901	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.317275	0.26963	N	0.021614	T	0.12305	0.0299	N	0.05199	-0.095	0.52501	D	0.999954	B;B;B;B	0.19445	0.014;0.0;0.036;0.002	B;B;B;B	0.32149	0.039;0.004;0.141;0.014	T	0.12344	-1.0551	10	0.06625	T	0.88	-21.2475	11.5578	0.50759	0.0:0.0:0.4443:0.5557	.	34;138;150;143	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	E	150;123;143	ENSP00000407818:K150E;ENSP00000390102:K123E;ENSP00000423244:K143E	ENSP00000407818:K150E	K	-	1	0	USP46	53187055	1.000000	0.71417	0.987000	0.45799	0.017000	0.09413	2.537000	0.45702	0.303000	0.22785	-0.321000	0.08615	AAA	-	USP46	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.383	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	0	0	0	209	209	100	0.00	0.00	T	NM_022832		53492298	-1	56	35	79	59	tier1	no_errors	ENST00000441222	ensembl	human	known	74_37	missense	41.48	37.23	SNP	1.000	C	56	79
SUZ12	23512	genome.wustl.edu	37	17	30322708	30322732	+	Frame_Shift_Del	DEL	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA	-	TCCGTCCACAAGAAATGGAAGTAGA	TCCGTCCACAAGAAATGGAAGTAGA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr17:30322708_30322732delTCCGTCCACAAGAAATGGAAGTAGA	ENST00000322652.5	+	14	1950_1974	c.1721_1745delTCCGTCCACAAGAAATGGAAGTAGA	c.(1720-1746)ctccgtccacaagaaatggaagtagatfs	p.LRPQEMEVD574fs	SUZ12_ENST00000580398.1_Frame_Shift_Del_p.LRPQEMEVD551fs	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	574	VEFS-box.				histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGAT	0.342			T	JAZF1	endometrial stromal tumours								ENSG00000178691																												Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0																																										SO:0001589	frameshift_variant	0				D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.1721_1745delTCCGTCCACAAGAAATGGAAGTAGA	17.37:g.30322708_30322732delTCCGTCCACAAGAAATGGAAGTAGA	ENSP00000316578:p.Leu574fs		Q96BD9	Frame_Shift_Del	DEL	pfam_Polycomb_protein_VEFS-Box	p.R575fs	ENST00000322652.5	37	c.1721_1745	CCDS11270.1	17																																																																																				SUZ12	-	pfam_Polycomb_protein_VEFS-Box		0.342	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2	0	0	0	105	105	105	0.00	0.00	TCCGTCCACAAGAAATGGAAGTAGA	NM_015355		30322732	+1	7	7	15	15	tier1	no_errors	ENST00000322652	ensembl	human	known	74_37	frame_shift_del	31.82	31.82	DEL	1.000:0.999:1.000:1.000:0.967:1.000:1.000:0.973:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	7	15
MYC	4609	genome.wustl.edu	37	8	128750604	128750605	+	In_Frame_Ins	INS	-	-	CAG			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-	-	CAG	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:128750604_128750605insCAG	ENST00000259523.6	+	2	1301_1302	c.96_97insCAG	c.(97-99)cag>CAGcag	p.33_33Q>QQ	MYC_ENST00000377970.2_In_Frame_Ins_p.48_48Q>QQ|MYC_ENST00000524013.1_In_Frame_Ins_p.47_47Q>QQ			P01106	MYC_HUMAN	v-myc avian myelocytomatosis viral oncogene homolog	33	Poly-Gln.				branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular iron ion homeostasis (GO:0006879)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|chromosome organization (GO:0051276)|energy reserve metabolic process (GO:0006112)|fibroblast apoptotic process (GO:0044346)|gene expression (GO:0010467)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell division (GO:0051782)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|oxygen transport (GO:0015671)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of metanephric cap mesenchymal cell proliferation (GO:0090096)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of telomere maintenance (GO:0032204)|response to drug (GO:0042493)|response to gamma radiation (GO:0010332)|response to growth factor (GO:0070848)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein complex binding (GO:0032403)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	all_cancers(1;6.19e-134)|all_epithelial(1;1.75e-119)|all_lung(1;5.66e-51)|Breast(1;1.08e-22)|all_neural(1;4.45e-21)|Medulloblastoma(1;1.88e-20)|Colorectal(1;1.92e-09)|Lung SC(1;4.52e-07)|Ovarian(5;0.000122)|Esophageal squamous(12;0.000995)|Renal(1;0.0921)|Hepatocellular(40;0.108)|Myeloproliferative disorder(2;0.135)|Melanoma(291;0.185)	Myeloproliferative disorder(644;0.0255)|Ovarian(118;0.0654)|Breast(495;0.212)|Acute lymphoblastic leukemia(644;0.22)	Epithelial(1;1.63e-94)|all cancers(1;5.82e-87)|OV - Ovarian serous cystadenocarcinoma(1;2.12e-71)|BRCA - Breast invasive adenocarcinoma(1;4.3e-14)|Lung(2;0.000381)|Colorectal(2;0.0102)|LUAD - Lung adenocarcinoma(14;0.0172)|READ - Rectum adenocarcinoma(2;0.0723)|LUSC - Lung squamous cell carcinoma(258;0.151)	KIRC - Kidney renal clear cell carcinoma(542;0.248)	Nadroparin(DB08813)	AGAACTTCTACCAGCAGCAGCA	0.614		3	"""A, T"""	"""IGK@, BCL5, BCL7A , BTG1, TRA@, IGH@"""	"""Burkitt lymphoma,  amplified in other cancers, B-CLL"""						OREG0018982	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000136997																												Dom	yes		8	8q24.12-q24.13	4609	v-myc myelocytomatosis viral oncogene homolog (avian)		"""L, E"""	0										1,4263		0,1,2131						4.2	1.0			46	2,8252		0,2,4125	no	coding	MYC	NM_002467.4		0,3,6256	A1A1,A1R,RR		0.0242,0.0235,0.024				3,12515				SO:0001652	inframe_insertion	0					CCDS6359.2	8q24	2013-07-09	2013-07-09		ENSG00000136997	ENSG00000136997		"""Basic helix-loop-helix proteins"""	7553	protein-coding gene	gene with protein product		190080					Standard	NM_002467		Approved	c-Myc, bHLHe39, MYCC	uc003ysi.3	P01106	OTTHUMG00000128475	ENST00000259523.6:c.109_111dupCAG	8.37:g.128750611_128750613dupCAG	ENSP00000259523:p.Gln37dup	1567	A8WFE7|P01107|Q14026	In_Frame_Ins	INS	pfam_Tscrpt_reg_Myc_N,pfam_Myc-LZ,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom,prints_Tscrpt_reg_Myc	p.51in_frame_insQ	ENST00000259523.6	37	c.141_142		8																																																																																				MYC	-	pfam_Tscrpt_reg_Myc_N		0.614	MYC-002	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	MYC	HGNC	protein_coding	OTTHUMT00000250278.1	0	0	0	102	102	66	0.00	0.00	-			128750605	+1	15	11	60	24	tier1	no_errors	ENST00000377970	ensembl	human	known	74_37	in_frame_ins	20.00	31.43	INS	1.000:1.000	CAG	15	60
CPNE9	151835	genome.wustl.edu	37	3	9771323	9771323	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr3:9771323C>T	ENST00000383832.3	+	21	1799	c.1609C>T	c.(1609-1611)Cgg>Tgg	p.R537W	BRPF1_ENST00000433861.2_5'Flank|BRPF1_ENST00000424362.1_5'Flank|BRPF1_ENST00000383829.2_5'Flank|BRPF1_ENST00000302054.3_5'Flank	NM_153635.2	NP_705899.2	Q8IYJ1	CPNE9_HUMAN	copine family member IX	537	Poly-Pro.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	16	Medulloblastoma(99;0.227)					CATCCAGCCTCGGCCCCCACC	0.632													ENSG00000144550																																					0													42.0	51.0	48.0					3																	9771323		2082	4211	6293	SO:0001583	missense	0			-		CCDS2574.2	3p25.3	2008-10-30			ENSG00000144550	ENSG00000144550			24336	protein-coding gene	gene with protein product						9430674	Standard	XM_006712990		Approved	KIAA4217	uc003bsd.3	Q8IYJ1	OTTHUMG00000128418	ENST00000383832.3:c.1609C>T	3.37:g.9771323C>T	ENSP00000373343:p.Arg537Trp		A1L430|A6NDX6|A8MSP8	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.R537W	ENST00000383832.3	37	c.1609	CCDS2574.2	3	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901013	0.52227	.	.	ENSG00000144550	ENST00000383832	T	0.06768	3.26	5.22	4.29	0.51040	.	0.157190	0.40728	U	0.001040	T	0.23133	0.0559	M	0.78637	2.42	0.80722	D	1	D	0.69078	0.997	P	0.56648	0.803	T	0.01133	-1.1441	10	0.72032	D	0.01	-0.1584	13.3114	0.60382	0.1588:0.8412:0.0:0.0	.	537	Q8IYJ1	CPNE9_HUMAN	W	537	ENSP00000373343:R537W	ENSP00000373343:R537W	R	+	1	2	CPNE9	9746323	0.465000	0.25815	0.998000	0.56505	0.834000	0.47266	1.176000	0.31957	2.395000	0.81488	0.655000	0.94253	CGG	-	CPNE9	-	NULL		0.632	CPNE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE9	HGNC	protein_coding	OTTHUMT00000250205.4	0	0	0	89	89	25	0.00	0.00	C	NM_001033755		9771323	+1	37	10	33	9	tier1	no_errors	ENST00000383832	ensembl	human	known	74_37	missense	52.86	52.63	SNP	0.998	T	37	33
DLGAP2	9228	genome.wustl.edu	37	8	1497797	1497797	+	Missense_Mutation	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr8:1497797C>T	ENST00000421627.2	+	2	1072	c.938C>T	c.(937-939)cCg>cTg	p.P313L		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	392					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CTGGACAAGCCGCTGCTGCAC	0.672													ENSG00000198010																																					0													6.0	7.0	7.0					8																	1497797		2027	4092	6119	SO:0001583	missense	0			-	AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.938C>T	8.37:g.1497797C>T	ENSP00000400258:p.Pro313Leu		A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.P313L	ENST00000421627.2	37	c.938	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.977761|3.977761	0.74360|0.74360	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.13307|.	2.6|.	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78792|0.78792	0.4339|0.4339	M|M	0.80028|0.80028	2.48|2.48	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.71674|.	0.998;0.997|.	P;P|.	0.57776|.	0.827;0.676|.	T|T	0.79654|0.79654	-0.1713|-0.1713	10|5	0.72032|.	D|.	0.01|.	-14.1979|-14.1979	18.9482|18.9482	0.92630|0.92630	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	392;392|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	L|C	358;313|330	ENSP00000400258:P313L|.	ENSP00000348366:P358L|.	P|R	+|+	2|1	0|0	DLGAP2|DLGAP2	1485204|1485204	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.538000|0.538000	0.34931|0.34931	7.052000|7.052000	0.76634|0.76634	2.463000|2.463000	0.83235|0.83235	0.655000|0.655000	0.94253|0.94253	CCG|CGC	-	DLGAP2	-	NULL		0.672	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	0	0	0	73	73	10	0.00	0.00	C	NM_004745		1497797	+1	7	5	54	7	tier1	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	11.48	41.67	SNP	0.999	T	7	54
KAZN	23254	genome.wustl.edu	37	1	15430617	15430617	+	Silent	SNP	C	C	T			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr1:15430617C>T	ENST00000376030.2	+	13	2274	c.1980C>T	c.(1978-1980)atC>atT	p.I660I		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	660	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CCCTGGGCATCCCCAGTGGGA	0.632													ENSG00000189337																																					0													57.0	43.0	48.0					1																	15430617		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.1980C>T	1.37:g.15430617C>T			B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.I660	ENST00000376030.2	37	c.1980	CCDS152.2	1																																																																																			-	KAZN	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.632	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2	0	0	0	60	60	17	0.00	0.00	C	NM_001017999		15430617	+1	14	9	4	5	tier1	no_errors	ENST00000376030	ensembl	human	known	74_37	silent	77.78	64.29	SNP	1.000	T	14	4
EVL	51466	genome.wustl.edu	37	14	100595978	100595978	+	Missense_Mutation	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr14:100595978G>A	ENST00000402714.2	+	7	1394	c.790G>A	c.(790-792)Gga>Aga	p.G264R	EVL_ENST00000392920.3_Missense_Mutation_p.G266R|EVL_ENST00000544450.2_Missense_Mutation_p.G270R			Q9UI08	EVL_HUMAN	Enah/Vasp-like	264	EVH2.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CGGGGGTGGCGGAGGAGGCCT	0.622													ENSG00000196405																																					0													44.0	41.0	42.0					14																	100595978		2202	4299	6501	SO:0001583	missense	0			-	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.790G>A	14.37:g.100595978G>A	ENSP00000384720:p.Gly264Arg		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Missense_Mutation	SNP	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.G266R	ENST00000402714.2	37	c.796		14	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939494	0.73557	.	.	ENSG00000196405	ENST00000402714;ENST00000544450;ENST00000392920;ENST00000539470;ENST00000557384;ENST00000554695	T;T;T;T	0.76578	-1.0;-1.03;-1.0;0.34	5.24	4.35	0.52113	.	0.368082	0.27876	N	0.017491	D	0.85982	0.5824	M	0.87547	2.89	0.38658	D	0.952009	D;D;D	0.65815	0.995;0.995;0.992	P;P;P	0.57720	0.739;0.826;0.674	D	0.88718	0.3227	10	0.66056	D	0.02	-19.3173	10.8189	0.46593	0.1477:0.0:0.8523:0.0	.	270;266;264	B7Z3I5;Q9UI08-2;Q9UI08	.;.;EVL_HUMAN	R	264;270;266;229;160;81	ENSP00000384720:G264R;ENSP00000437904:G270R;ENSP00000376652:G266R;ENSP00000450979:G160R	ENSP00000376652:G266R	G	+	1	0	EVL	99665731	1.000000	0.71417	0.907000	0.35723	0.593000	0.36681	4.471000	0.60182	2.445000	0.82738	0.655000	0.94253	GGA	-	EVL	-	pirsf_Vasodilator_phosphoprotein		0.622	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1	0	0	0	52	52	78	0.00	0.00	G			100595978	+1	10	5	40	59	tier1	no_errors	ENST00000392920	ensembl	human	known	74_37	missense	20.00	7.69	SNP	0.985	A	10	40
TBC1D20	128637	genome.wustl.edu	37	20	422183	422183	+	Intron	SNP	G	G	T	rs577622376		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr20:422183G>T	ENST00000354200.4	-	5	774				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				GGTGTGGGGGGGTGTGGGCGT	0.507													ENSG00000125875	G|||	1	0.000199681	0.0	0.0014	5008	,	,		19204	0.0		0.0	False		,,,				2504	0.0																0													84.0	72.0	76.0					20																	422183		2203	4300	6503	SO:0001627	intron_variant	0			-	AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.626+48C>A	20.37:g.422183G>T			A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	R	SNP	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			-	TBC1D20	-	-		0.507	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	0	0	0	48	48	98	0.00	0.00	G	NM_144628		422183	-1	7	10	51	143	tier1	no_errors	ENST00000461188	ensembl	human	known	74_37	rna	12.07	6.54	SNP	0.000	T	7	51
COL11A2	1302	genome.wustl.edu	37	6	33147260	33147260	+	Missense_Mutation	SNP	G	G	A	rs143965711		TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr6:33147260G>A	ENST00000374708.4	-	12	1451	c.1193C>T	c.(1192-1194)gCg>gTg	p.A398V	COL11A2_ENST00000374712.1_Missense_Mutation_p.A403V|COL11A2_ENST00000341947.2_Missense_Mutation_p.A484V|COL11A2_ENST00000477772.1_5'Flank|COL11A2_ENST00000357486.1_Missense_Mutation_p.A463V|COL11A2_ENST00000361917.1_Missense_Mutation_p.A377V|COL11A2_ENST00000395197.1_Missense_Mutation_p.A424V|COL11A2_ENST00000374714.1_Missense_Mutation_p.A458V|COL11A2_ENST00000374713.1_Missense_Mutation_p.A437V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	484	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TCCACGGAGCGCCAGCTAGGG	0.632													ENSG00000204248																									Melanoma(1;90 116 3946 5341 17093)												0									VAL/ALA,VAL/ALA,VAL/ALA	1,2969		0,1,1484	24.0	11.0	16.0		1130,1451,1193	4.8	1.0	6	dbSNP_134	16	0,5362		0,0,2681	no	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	64,64,64	0,1,4165	AA,AG,GG		0.0,0.0337,0.012	probably-damaging,probably-damaging,probably-damaging	377/1630,484/1737,398/1651	33147260	1,8331	1485	2681	4166	SO:0001583	missense	0			-	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1193C>T	6.37:g.33147260G>A	ENSP00000363840:p.Ala398Val		A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A484V	ENST00000374708.4	37	c.1451	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	19.85	3.902925	0.72754	3.37E-4	0.0	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788	D;D;D;D;D;D;D;D;D	0.90788	-2.48;-2.41;-2.44;-2.45;-2.45;-2.44;-2.55;-2.44;-2.73	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.94532	0.8239	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.81914	0.962;0.957;0.995	D	0.95062	0.8196	10	0.87932	D	0	.	15.3205	0.74117	0.0:0.0:1.0:0.0	.	377;398;484	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	V	398;484;463;458;437;424;403;377;484	ENSP00000363840:A398V;ENSP00000339915:A484V;ENSP00000350079:A463V;ENSP00000363846:A458V;ENSP00000363845:A437V;ENSP00000378623:A424V;ENSP00000363844:A403V;ENSP00000355123:A377V;ENSP00000405520:A484V	ENSP00000339915:A484V	A	-	2	0	COL11A2	33255238	1.000000	0.71417	0.954000	0.39281	0.213000	0.24496	5.939000	0.70179	2.477000	0.83638	0.549000	0.68633	GCG	rs143965711	COL11A2	-	NULL		0.632	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	0	0	0	77	77	7	0.00	0.00	G			33147260	-1	4	0	36	8	tier1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	10.00	0.00	SNP	0.998	A	4	36
CDH23	64072	genome.wustl.edu	37	10	73157033	73157034	+	Frame_Shift_Ins	INS	-	-	CGAGG	rs147915565|rs560521778|rs377387074|rs71012280	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr10:73157033_73157034insCGAGG	ENST00000299366.7	+	1	340_341	c.88_89insCGAGG	c.(88-90)ccgfs	p.-32fs	CDH23_ENST00000461841.3_Frame_Shift_Ins_p.-32fs|CDH23_ENST00000398842.3_5'UTR|CDH23_ENST00000398809.4_5'UTR	NM_001171931.1	NP_001165402.1	Q9H251	CAD23_HUMAN	cadherin-related 23						calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AGAGCAGAGCCCGAGGCGAGGC	0.767													ENSG00000107736																																					0																																										SO:0001589	frameshift_variant	0				AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000299366.7:c.99_103dupCGAGG	10.37:g.73157039_73157043dupCGAGG	ENSP00000299366:p.Arg32fs		C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Frame_Shift_Ins	INS	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G34fs	ENST00000299366.7	37	c.88_89		10																																																																																				CDH23	-	NULL		0.767	CDH23-003	PUTATIVE	basic	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051229.7	0	0	0	0	0	0	0.00	0.00	-	NM_052836		73157034	+1	0	0	0	0	tier1	no_errors	ENST00000461841	ensembl	human	known	74_37	frame_shift_ins	0.00	0.00	INS	0.008:0.011	CGAGG	0	0
FOXA1	3169	genome.wustl.edu	37	14	38064348	38064350	+	5'Flank	DEL	GCG	GCG	-	rs546145599	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr14:38064348_38064350delGCG	ENST00000250448.2	-	0	0				FOXA1_ENST00000540786.1_Intron|FOXA1_ENST00000545425.2_5'Flank	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1						anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		cgcggcgtgcgcggcggcggcgg	0.837													ENSG00000129514		3732	0.745208	0.8707	0.7032	5008	,	,		2587	0.8056		0.6392	False		,,,				2504	0.6524																0																																										SO:0001631	upstream_gene_variant	0				U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253		14.37:g.38064357_38064359delGCG	Exception_encountered		B2R9H6|B7ZAP5|Q9H2A0	R	DEL	-	NULL	ENST00000250448.2	37	NULL	CCDS9665.1	14																																																																																				FOXA1	-	-		0.837	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	0	0	0	8	8	0	0.00	0.00	GCG			38064350	-1	4	0	6	0	tier1	no_errors	ENST00000557418	ensembl	human	known	74_37	rna	40.00	0.00	DEL	0.998:0.994:0.997	-	4	6
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693													ENSG00000221837		1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0																																										SO:0001624	3_prime_UTR_variant	0				AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT			A2RRG1|A6NIR9|Q70LJ1	R	INS	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																				KRTAP10-9	-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	0	0	0	0	0	0	0.00	0.00	-			46048197	+1	0	0	0	0	tier1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	CGCTGGT	0	0
MN1	4330	genome.wustl.edu	37	22	28194881	28194883	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:28194881_28194883delGCT	ENST00000302326.4	-	1	2603_2605	c.1649_1651delAGC	c.(1648-1653)cagcgc>cgc	p.Q550del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	550	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						GCGTTTTGGCgctgctgctgctg	0.645			T	ETV6	"""AML, meningioma"""								ENSG00000169184																												Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0										88,3382		14,60,1661						3.4	1.0			5	216,6858		15,186,3336	no	coding	MN1	NM_002430.2		29,246,4997	A1A1,A1R,RR		3.0534,2.536,2.8832				304,10240				SO:0001651	inframe_deletion	0				X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1649_1651delAGC	22.37:g.28194890_28194892delGCT	ENSP00000304956:p.Gln550del		A9Z1V9	In_Frame_Del	DEL	NULL	p.Q550in_frame_del	ENST00000302326.4	37	c.1651_1649	CCDS42998.1	22																																																																																				MN1	-	NULL		0.645	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	0	0	0	43	43	3	0.00	0.00	GCT	NM_002430		28194883	-1	2	0	11	2	tier1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	15.38	0.00	DEL	1.000:1.000:1.000	-	2	11
MN1	4330	genome.wustl.edu	37	22	28195625	28195627	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chr22:28195625_28195627delGCT	ENST00000302326.4	-	1	1859_1861	c.905_907delAGC	c.(904-909)cagccc>ccc	p.Q302del		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	302	Poly-Gln.				intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						tgctgctggggctgctgctgctg	0.66			T	ETV6	"""AML, meningioma"""								ENSG00000169184																												Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	0										39,2663		9,21,1321						-0.8	0.0		dbSNP_131	3	111,5619		17,77,2771	no	coding	MN1	NM_002430.2		26,98,4092	A1A1,A1R,RR		1.9372,1.4434,1.7789				150,8282				SO:0001651	inframe_deletion	0				X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.905_907delAGC	22.37:g.28195634_28195636delGCT	ENSP00000304956:p.Gln302del		A9Z1V9	In_Frame_Del	DEL	NULL	p.Q302in_frame_del	ENST00000302326.4	37	c.907_905	CCDS42998.1	22																																																																																				MN1	-	NULL		0.660	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1	0	0	0	35	35	2	0.00	0.00	GCT	NM_002430		28195627	-1	3	0	12	1	tier1	no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	20.00	0.00	DEL	0.962:0.987:0.994	-	3	12
MT-ND2	4536	genome.wustl.edu	37	M	2814	2814	+	5'Flank	SNP	G	G	A			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrM:2814G>A	ENST00000361453.3	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TF_ENST00000387314.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						AAAATTTCGGTTGGGGCGACC	0.438													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.2814G>A	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	R	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.438	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		1	1	0	344	344	3	0.29	0.00	G	YP_003024027		2814	+1	210	3	32	0	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	86.42	100.00	SNP	NULL	A	210	32
MT-CO1	4512	genome.wustl.edu	37	M	2978	2978	+	5'Flank	SNP	T	T	C			TCGA-SI-AA8C-01A-11D-A387-09	TCGA-SI-AA8C-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b939bdb6-694c-4411-b89b-ee9ac7dc62a9	7a75c68f-e44f-4634-92eb-e759d0c9075c	g.chrM:2978T>C	ENST00000361624.2	+	0	0				MT-TV_ENST00000387342.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TF_ENST00000387314.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TCAACAATAGGGTTTACGACC	0.433													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.2978T>C	Exception_encountered		Q34770	R	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	40	40	1	0.00	0.00	T	YP_003024028		2978	+1	4	0	29	0	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	12.12	0.00	SNP	NULL	C	4	29
