#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
CILP2	148113	genome.wustl.edu	37	19	19654173	19654173	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:19654173C>T	ENST00000291495.5	+	7	1179	c.1094C>T	c.(1093-1095)gCg>gTg	p.A365V	CILP2_ENST00000586018.1_Missense_Mutation_p.A371V	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	365	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						TGGAATGAGGCGGGTGCCGTG	0.657													ENSG00000160161																																					0													52.0	54.0	53.0					19																	19654173		2203	4300	6503	SO:0001583	missense	0			-	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.1094C>T	19.37:g.19654173C>T	ENSP00000291495:p.Ala365Val		Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,superfamily_Thrombospondin_1_rpt,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.A365V	ENST00000291495.5	37	c.1094	CCDS12405.1	19	.	.	.	.	.	.	.	.	.	.	C	15.80	2.938924	0.52972	.	.	ENSG00000160161	ENST00000291495	T	0.12147	2.71	4.47	3.43	0.39272	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.241710	0.42548	D	0.000690	T	0.11750	0.0286	L	0.43646	1.37	0.29470	N	0.857114	B;B	0.25312	0.123;0.123	B;B	0.24269	0.052;0.04	T	0.09907	-1.0653	10	0.72032	D	0.01	-2.3915	7.2947	0.26387	0.0:0.7954:0.0:0.2046	.	365;365	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	V	365	ENSP00000291495:A365V	ENSP00000291495:A365V	A	+	2	0	CILP2	19515173	0.062000	0.20869	0.030000	0.17652	0.038000	0.13279	0.609000	0.24238	0.880000	0.35969	0.485000	0.47835	GCG	-	CILP2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.657	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CILP2	HGNC	protein_coding	OTTHUMT00000459738.3	0	0	0	60	60	27	0.00	0.00	C	NM_153221		19654173	+1	19	5	132	25	tier1	no_errors	ENST00000291495	ensembl	human	known	74_37	missense	12.58	16.67	SNP	0.700	T	19	132
COBL	23242	genome.wustl.edu	37	7	51096413	51096413	+	Missense_Mutation	SNP	T	T	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr7:51096413T>A	ENST00000265136.7	-	10	2545	c.2380A>T	c.(2380-2382)Acc>Tcc	p.T794S	COBL_ENST00000395542.2_Missense_Mutation_p.T876S	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	794					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					GGCACAGGGGTGGAGGGGGGT	0.602													ENSG00000106078																									NSCLC(189;2119 2138 12223 30818 34679)												0													41.0	46.0	44.0					7																	51096413		2203	4300	6503	SO:0001583	missense	0			-	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2380A>T	7.37:g.51096413T>A	ENSP00000265136:p.Thr794Ser		A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	pfam_Cordon-bleu_ubiquitin_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.T876S	ENST00000265136.7	37	c.2626	CCDS34637.1	7	.	.	.	.	.	.	.	.	.	.	T	6.115	0.389385	0.11581	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	4.71	-7.92	0.01160	.	0.934280	0.08852	N	0.884297	T	0.07818	0.0196	L	0.42245	1.32	0.09310	N	1	B;B;B;B;B	0.30605	0.001;0.001;0.009;0.287;0.112	B;B;B;B;B	0.27380	0.003;0.003;0.002;0.079;0.013	T	0.16305	-1.0407	10	0.33940	T	0.23	.	3.3138	0.07026	0.0859:0.2339:0.2104:0.4698	.	794;851;794;876;336	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	S	794;686;679;876	ENSP00000265136:T794S;ENSP00000401204:T686S;ENSP00000413498:T679S;ENSP00000378912:T876S	ENSP00000265136:T794S	T	-	1	0	COBL	51063907	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.101000	0.15251	-1.845000	0.01176	-2.821000	0.00108	ACC	-	COBL	-	NULL		0.602	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	HGNC	protein_coding	OTTHUMT00000342682.1	0	0	0	23	23	60	0.00	0.00	T	NM_015198		51096413	-1	21	27	28	39	tier1	no_errors	ENST00000395542	ensembl	human	known	74_37	missense	42.00	40.91	SNP	0.000	A	21	28
IFT27	11020	genome.wustl.edu	37	22	37154392	37154392	+	Missense_Mutation	SNP	T	T	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr22:37154392T>A	ENST00000433985.2	-	7	944	c.524A>T	c.(523-525)tAc>tTc	p.Y175F	IFT27_ENST00000340630.5_Missense_Mutation_p.Y174F|IFT27_ENST00000453009.2_Missense_Mutation_p.Y134F	NM_001177701.2	NP_001171172.1	Q9BW83	IFT27_HUMAN	intraflagellar transport 27	175					small GTPase mediated signal transduction (GO:0007264)	centrosome (GO:0005813)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)	GTP binding (GO:0005525)			endometrium(3)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CTTCTCCCGGTACAGCTGGTG	0.493											OREG0026524	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000100360																																					0													108.0	116.0	113.0					22																	37154392		2203	4300	6503	SO:0001583	missense	0			-	Z80897	CCDS13932.1, CCDS54523.1	22q13.1	2014-07-03	2014-07-03	2010-04-22	ENSG00000100360	ENSG00000100360		"""Intraflagellar transport homologs"", ""RAB, member RAS oncogene"""	18626	protein-coding gene	gene with protein product		615870	"""RAB, member of RAS oncogene family-like 4"", ""intraflagellar transport 27 homolog (Chlamydomonas)"""	RABL4		12529303, 17276912	Standard	NM_001177701		Approved	RAYL, BBS19	uc003apv.3	Q9BW83	OTTHUMG00000150544	ENST00000433985.2:c.524A>T	22.37:g.37154392T>A	ENSP00000393541:p.Tyr175Phe	868	O60897	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Y175F	ENST00000433985.2	37	c.524	CCDS54523.1	22	.	.	.	.	.	.	.	.	.	.	T	18.99	3.740674	0.69304	.	.	ENSG00000100360	ENST00000340630;ENST00000433985;ENST00000453009	T;T;T	0.79554	-1.28;-1.28;-1.28	5.4	5.4	0.78164	.	.	.	.	.	D	0.87657	0.6232	M	0.73319	2.225	0.45995	D	0.998807	D;D	0.89917	1.0;0.991	D;D	0.87578	0.998;0.954	D	0.85305	0.1075	9	0.19590	T	0.45	.	14.4038	0.67068	0.0:0.0:0.0:1.0	.	175;174	Q9BW83;Q9BW83-2	IFT27_HUMAN;.	F	174;175;134	ENSP00000343593:Y174F;ENSP00000393541:Y175F;ENSP00000405394:Y134F	ENSP00000343593:Y174F	Y	-	2	0	IFT27	35484338	1.000000	0.71417	1.000000	0.80357	0.480000	0.33159	5.315000	0.65810	2.029000	0.59856	0.533000	0.62120	TAC	-	IFT27	-	superfamily_P-loop_NTPase		0.493	IFT27-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT27	HGNC	protein_coding		0	0	0	74	74	130	0.00	0.00	T	NM_006860		37154392	-1	31	27	126	131	tier1	no_errors	ENST00000433985	ensembl	human	known	74_37	missense	19.62	16.98	SNP	1.000	A	31	126
KRT26	353288	genome.wustl.edu	37	17	38928025	38928025	+	Missense_Mutation	SNP	T	T	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr17:38928025T>G	ENST00000335552.4	-	1	389	c.341A>C	c.(340-342)aAg>aCg	p.K114T		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				GCCCTTGATCTTCTGCTCCAG	0.512													ENSG00000186393																																					0													121.0	118.0	119.0					17																	38928025		2203	4300	6503	SO:0001583	missense	0			-	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.341A>C	17.37:g.38928025T>G	ENSP00000334798:p.Lys114Thr			Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K114T	ENST00000335552.4	37	c.341	CCDS11374.1	17	.	.	.	.	.	.	.	.	.	.	T	22.7	4.320541	0.81469	.	.	ENSG00000186393	ENST00000335552	D	0.90788	-2.73	5.72	4.64	0.57946	Filament (1);	0.091635	0.47852	D	0.000212	D	0.96237	0.8773	H	0.94964	3.605	0.41046	D	0.985266	D	0.89917	1.0	D	0.91635	0.999	D	0.96400	0.9296	10	0.87932	D	0	.	11.049	0.47876	0.0:0.0726:0.0:0.9274	.	114	Q7Z3Y9	K1C26_HUMAN	T	114	ENSP00000334798:K114T	ENSP00000334798:K114T	K	-	2	0	KRT26	36181551	0.687000	0.27671	1.000000	0.80357	0.987000	0.75469	2.627000	0.46469	1.094000	0.41399	0.528000	0.53228	AAG	-	KRT26	-	pfam_IF		0.512	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT26	HGNC	protein_coding	OTTHUMT00000257215.1	0	0	0	40	40	38	0.00	0.00	T	NM_181539		38928025	-1	8	2	41	18	tier1	no_errors	ENST00000335552	ensembl	human	known	74_37	missense	16.33	10.00	SNP	1.000	G	8	41
ZSCAN5B	342933	genome.wustl.edu	37	19	56701298	56701298	+	Silent	SNP	G	G	A	rs367702594		TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:56701298G>A	ENST00000586855.2	-	5	1699	c.1386C>T	c.(1384-1386)tcC>tcT	p.S462S	ZSCAN5B_ENST00000358992.3_Silent_p.S462S			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	462					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GCTTCTCTCCGGAGTGGGTGC	0.537													ENSG00000197213																																					0								G		1,4179		0,1,2089	84.0	85.0	84.0		1386	-7.2	0.0	19		84	0,8482		0,0,4241	no	coding-synonymous	ZSCAN5B	NM_001080456.2		0,1,6330	AA,AG,GG		0.0,0.0239,0.0079		462/496	56701298	1,12661	2090	4241	6331	SO:0001819	synonymous_variant	0			-		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.1386C>T	19.37:g.56701298G>A				Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S462	ENST00000586855.2	37	c.1386	CCDS46203.1	19																																																																																			-	ZSCAN5B	-	pfscan_Znf_C2H2		0.537	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	0	0	1	80	80	120	0.00	0.83	G	NM_001080456		56701298	-1	37	34	66	75	tier1	no_errors	ENST00000358992	ensembl	human	known	74_37	silent	35.92	30.91	SNP	0.000	A	37	66
RIMS2	9699	genome.wustl.edu	37	8	104709367	104709367	+	Missense_Mutation	SNP	A	A	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr8:104709367A>C	ENST00000406091.3	+	2	230	c.230A>C	c.(229-231)gAa>gCa	p.E77A		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	108	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AAGATGGGAGAAGAATCACAG	0.403										HNSCC(12;0.0054)			ENSG00000176406																																					0													113.0	112.0	113.0					8																	104709367		1956	4135	6091	SO:0001583	missense	0			-	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.230A>C	8.37:g.104709367A>C	ENSP00000384892:p.Glu77Ala		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.E77A	ENST00000406091.3	37	c.230	CCDS55269.1	8	.	.	.	.	.	.	.	.	.	.	A	21.4	4.141027	0.77775	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.75589	-0.95;-0.95	5.57	5.57	0.84162	.	.	.	.	.	T	0.78438	0.4283	L	0.38175	1.15	0.80722	D	1	D	0.71674	0.998	D	0.63488	0.915	T	0.75459	-0.3310	9	0.25106	T	0.35	.	15.7866	0.78310	1.0:0.0:0.0:0.0	.	77	F8WD47	.	A	77;108;77;108	ENSP00000427018:E77A;ENSP00000384892:E77A	ENSP00000332184:E108A	E	+	2	0	RIMS2	104778543	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.336000	0.96533	2.125000	0.65367	0.454000	0.30748	GAA	-	RIMS2	-	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ		0.403	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		0	0	0	45	45	95	0.00	0.00	A	NM_001100117		104709367	+1	13	23	83	118	tier1	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	13.54	16.31	SNP	1.000	C	13	83
PHF21B	112885	genome.wustl.edu	37	22	45297795	45297795	+	Intron	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr22:45297795G>C	ENST00000313237.5	-	6	982				PHF21B_ENST00000403565.1_Intron|PHF21B_ENST00000447824.3_Intron|PHF21B_ENST00000396103.3_Intron|PHF21B_ENST00000404079.2_Intron|RP1-127B20.4_ENST00000431036.1_RNA	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B								zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		AAAATGCCTAGATATTCTCCT	0.463													ENSG00000223730																																					0																																										SO:0001627	intron_variant	0			-	AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.832-5832C>G	22.37:g.45297795G>C			B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	R	SNP	-	NULL	ENST00000313237.5	37	NULL	CCDS14061.1	22																																																																																			-	RP1-127B20.4	-	-		0.463	PHF21B-001	KNOWN	basic|CCDS	protein_coding	ENSG00000223730	Clone_based_vega_gene	protein_coding	OTTHUMT00000321731.2	0	0	1	10	10	83	0.00	1.19	G	NM_138415		45297795	+1	8	31	44	83	tier1	no_errors	ENST00000431036	ensembl	human	known	74_37	rna	15.38	26.96	SNP	1.000	C	8	44
CCDC144A	9720	genome.wustl.edu	37	17	16623536	16623536	+	Silent	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr17:16623536A>G	ENST00000360524.8	+	7	1816	c.1740A>G	c.(1738-1740)gaA>gaG	p.E580E	CCDC144A_ENST00000456009.1_Silent_p.E300E|RP11-219A15.1_ENST00000448331.3_Silent_p.E580E|CCDC144A_ENST00000399273.1_Silent_p.E580E|CCDC144A_ENST00000443444.2_Silent_p.E580E	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	580																	CATCTAATGAAAAGAACGAGG	0.234													ENSG00000170160																																					0													16.0	16.0	16.0					17																	16623536		1734	3932	5666	SO:0001819	synonymous_variant	0			-	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.1740A>G	17.37:g.16623536A>G			O60311|Q6ZU57	Silent	SNP	pfam_DUF3496	p.E580	ENST00000360524.8	37	c.1740	CCDS45621.1	17	.	.	.	.	.	.	.	.	.	.	.	4.243	0.044025	0.08196	.	.	ENSG00000170160	ENST00000328495	.	.	.	1.4	1.4	0.22301	.	.	.	.	.	T	0.51449	0.1675	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43360	-0.9396	4	.	.	.	.	4.9561	0.14041	1.0:0.0:0.0:0.0	.	.	.	.	R	64	.	.	K	+	2	0	CCDC144A	16564261	0.696000	0.27757	0.853000	0.33588	0.182000	0.23217	2.456000	0.44997	0.893000	0.36288	0.155000	0.16302	AAA	-	CCDC144A	-	NULL		0.234	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	0	0	0	51	51	81	0.00	0.00	A			16623536	+1	20	17	123	75	tier1	no_errors	ENST00000360524	ensembl	human	known	74_37	silent	13.99	18.48	SNP	0.957	G	20	123
GRSF1	2926	genome.wustl.edu	37	4	71686565	71686565	+	3'UTR	SNP	C	C	A	rs527867660		TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr4:71686565C>A	ENST00000254799.6	-	0	1599				GRSF1_ENST00000502323.1_3'UTR|GRSF1_ENST00000545193.1_3'UTR|GRSF1_ENST00000508091.1_5'UTR|GRSF1_ENST00000439371.1_3'UTR	NM_002092.3	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1						anterior/posterior pattern specification (GO:0009952)|morphogenesis of embryonic epithelium (GO:0016331)|mRNA polyadenylation (GO:0006378)|tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|upper_aerodigestive_tract(2)	17		all_hematologic(202;0.21)	Lung(101;0.235)			AAATGAAATGCTTCTTGCTTC	0.333													ENSG00000132463																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC040485	CCDS47069.1, CCDS47070.1	4q13	2013-07-16				ENSG00000132463		"""RNA binding motif (RRM) containing"""	4610	protein-coding gene	gene with protein product		604851				8036161	Standard	NM_001098477		Approved		uc010iia.1	Q12849		ENST00000254799.6:c.*39G>T	4.37:g.71686565C>A			B3KPW0|Q4W5S5|Q6ZST3|Q8IWD6|Q8NBD2	R	SNP	-	NULL	ENST00000254799.6	37	NULL	CCDS47069.1	4																																																																																			-	GRSF1	-	-		0.333	GRSF1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	GRSF1	HGNC	protein_coding	OTTHUMT00000362642.1	0	0	0	32	32	91	0.00	0.00	C	NM_002092		71686565	-1	35	71	33	45	tier1	no_errors	ENST00000508091	ensembl	human	known	74_37	rna	51.47	61.21	SNP	1.000	A	35	33
INO80C	125476	genome.wustl.edu	37	18	33048664	33048664	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr18:33048664T>C	ENST00000334598.7	-	5	606	c.490A>G	c.(490-492)Att>Gtt	p.I164V	INO80C_ENST00000590757.1_Missense_Mutation_p.I67V|RP11-322E11.6_ENST00000589258.1_Intron|INO80C_ENST00000586489.1_Missense_Mutation_p.I109V|INO80C_ENST00000592173.1_Intron|RP11-322E11.5_ENST00000591141.1_lincRNA|INO80C_ENST00000441607.2_Missense_Mutation_p.I200V	NM_194281.3	NP_919257.2	Q6PI98	IN80C_HUMAN	INO80 complex subunit C	164					chromatin remodeling (GO:0006338)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ino80 complex (GO:0031011)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)				central_nervous_system(1)|endometrium(1)|lung(3)|prostate(2)|skin(1)	8						AACTCTTCAATGGTGCTGAAC	0.547													ENSG00000153391																																					0													112.0	112.0	112.0					18																	33048664		2203	4300	6503	SO:0001583	missense	0			-		CCDS11914.1, CCDS45853.1	18q12.2	2011-07-06	2008-08-07	2008-08-07	ENSG00000153391	ENSG00000153391		"""INO80 complex subunits"""	26994	protein-coding gene	gene with protein product	"""IES6 homolog (S. cerevisiae)"""		"""chromosome 18 open reading frame 37"""	C18orf37		16230350	Standard	NM_001098817		Approved	FLJ38183, hIes6, IES6	uc010dmt.3	Q6PI98	OTTHUMG00000132564	ENST00000334598.7:c.490A>G	18.37:g.33048664T>C	ENSP00000334473:p.Ile164Val		B4DUI4|E9PCS7|Q86WR1|Q8N994	Missense_Mutation	SNP	pfam_YL1_C	p.I200V	ENST00000334598.7	37	c.598	CCDS11914.1	18	.	.	.	.	.	.	.	.	.	.	T	2.869	-0.234308	0.05983	.	.	ENSG00000153391	ENST00000441607;ENST00000334598	.	.	.	5.57	4.41	0.53225	YL1 nuclear, C-terminal (1);	.	.	.	.	T	0.15565	0.0375	N	0.02315	-0.6	0.09310	N	1	B;B	0.18461	0.028;0.0	B;B	0.18263	0.021;0.002	T	0.22836	-1.0205	8	0.25751	T	0.34	.	8.9493	0.35779	0.0:0.0898:0.0:0.9102	.	200;164	E9PCS7;Q6PI98	.;IN80C_HUMAN	V	200;164	.	ENSP00000334473:I164V	I	-	1	0	INO80C	31302662	0.991000	0.36638	0.577000	0.28562	0.973000	0.67179	2.544000	0.45761	0.956000	0.37904	0.455000	0.32223	ATT	-	INO80C	-	pfam_YL1_C		0.547	INO80C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80C	HGNC	protein_coding	OTTHUMT00000255768.1	0	0	0	80	80	98	0.00	0.00	T	NM_194281		33048664	-1	47	32	79	29	tier1	no_errors	ENST00000441607	ensembl	human	known	74_37	missense	37.01	52.46	SNP	0.138	C	47	79
FBN1	2200	genome.wustl.edu	37	15	48826356	48826356	+	Missense_Mutation	SNP	A	A	T	rs113721547	byFrequency	TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr15:48826356A>T	ENST00000316623.5	-	8	1238	c.783T>A	c.(781-783)aaT>aaA	p.N261K		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	261	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TATTAATGCAATTTCCTCCCT	0.398													ENSG00000166147																																					0													219.0	231.0	227.0					15																	48826356		2197	4296	6493	SO:0001583	missense	0			-	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.783T>A	15.37:g.48826356A>T	ENSP00000325527:p.Asn261Lys		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.N261K	ENST00000316623.5	37	c.783	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	A	13.33	2.205546	0.39003	.	.	ENSG00000166147	ENST00000316623	D	0.91464	-2.85	5.51	4.31	0.51392	Matrix fibril-associated (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.085006	0.85682	D	0.000000	T	0.77928	0.4204	N	0.04820	-0.15	0.80722	D	1	B	0.17268	0.021	B	0.15052	0.012	T	0.72411	-0.4302	10	0.15499	T	0.54	.	11.6942	0.51534	0.8677:0.0:0.0:0.1323	.	261	P35555	FBN1_HUMAN	K	261	ENSP00000325527:N261K	ENSP00000325527:N261K	N	-	3	2	FBN1	46613648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.176000	0.50863	2.225000	0.72522	0.533000	0.62120	AAT	-	FBN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_TB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.398	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	0	0	0	54	54	55	0.00	0.00	A			48826356	-1	12	6	97	48	tier1	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	11.01	11.11	SNP	1.000	T	12	97
MACF1	23499	genome.wustl.edu	37	1	39765937	39765937	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:39765937G>A	ENST00000372915.3	+	21	2639	c.2552G>A	c.(2551-2553)aGa>aAa	p.R851K	MACF1_ENST00000361689.2_Missense_Mutation_p.R851K|MACF1_ENST00000539005.1_Missense_Mutation_p.R851K|MACF1_ENST00000567887.1_Missense_Mutation_p.R883K|MACF1_ENST00000545844.1_Missense_Mutation_p.R851K|MACF1_ENST00000564288.1_Missense_Mutation_p.R846K|MACF1_ENST00000317713.7_Missense_Mutation_p.R851K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	851					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTCGTTGGGAGATCAAAAACC	0.433													ENSG00000127603																																					0													193.0	167.0	176.0					1																	39765937		2203	4300	6503	SO:0001583	missense	0			-	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.2552G>A	1.37:g.39765937G>A	ENSP00000362006:p.Arg851Lys		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R851K	ENST00000372915.3	37	c.2552		1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325411	0.60743	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.96967	-4.19;-4.19;-4.19;-4.19;-4.19;-4.19;-4.19	5.81	5.81	0.92471	.	.	.	.	.	D	0.94328	0.8177	L	0.36672	1.1	0.80722	D	1	B;B	0.33299	0.105;0.407	B;B	0.35470	0.084;0.203	D	0.92738	0.6205	9	0.44086	T	0.13	.	20.0621	0.97678	0.0:0.0:1.0:0.0	.	851;816	F8W8Q1;Q9UPN3-3	.;.	K	851;851;851;851;851;809;1000;1013	ENSP00000439537:R851K;ENSP00000362006:R851K;ENSP00000354573:R851K;ENSP00000313438:R851K;ENSP00000444364:R851K;ENSP00000435070:R809K;ENSP00000437059:R1000K	ENSP00000313438:R851K	R	+	2	0	MACF1	39538524	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	8.018000	0.88722	2.750000	0.94351	0.655000	0.94253	AGA	-	MACF1	-	NULL		0.433	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	0	0	0	38	38	86	0.00	0.00	G	NM_033044		39765937	+1	16	18	72	81	tier1	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	18.18	17.82	SNP	1.000	A	16	72
CRYGN	155051	genome.wustl.edu	37	7	151130689	151130689	+	Intron	SNP	G	G	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr7:151130689G>A	ENST00000337323.2	-	3	543				CRYGN_ENST00000476631.1_Intron|CRYGN_ENST00000491928.1_Intron|MIR3907_ENST00000579424.1_RNA|RP4-555L14.4_ENST00000465549.1_RNA	NM_144727.1	NP_653328.1	Q8WXF5	CRGN_HUMAN	crystallin, gamma N											central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(1)|lung(4)	8			OV - Ovarian serous cystadenocarcinoma(82;0.00358)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CATGGCCCCCGTATCCATGCC	0.642													ENSG00000265810																																					0																																										SO:0001627	intron_variant	0			-	AF445455	CCDS5926.1	7q36.1	2003-02-25			ENSG00000127377	ENSG00000127377			20458	protein-coding gene	gene with protein product		609603					Standard	NM_144727		Approved		uc003wke.3	Q8WXF5	OTTHUMG00000157353	ENST00000337323.2:c.416+2576C>T	7.37:g.151130689G>A			Q496G6	R	SNP	-	NULL	ENST00000337323.2	37	NULL	CCDS5926.1	7																																																																																			-	MIR3907	-	-		0.642	CRYGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3907	HGNC	protein_coding	OTTHUMT00000348553.1	1	1	0	122	122	72	0.81	0.00	G			151130689	-1	112	12	153	36	tier1	no_errors	ENST00000579424	ensembl	human	known	74_37	rna	42.26	25.00	SNP	0.000	A	112	153
OR56B1	387748	genome.wustl.edu	37	11	5757842	5757842	+	Missense_Mutation	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr11:5757842G>C	ENST00000317121.3	+	1	162	c.96G>C	c.(94-96)tgG>tgC	p.W32C	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		TTCACAGCTGGCAACACTGGC	0.488													ENSG00000181023																																					0													139.0	128.0	131.0					11																	5757842		2201	4297	6498	SO:0001583	missense	0			-	BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.96G>C	11.37:g.5757842G>C	ENSP00000322939:p.Trp32Cys		B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.W32C	ENST00000317121.3	37	c.96	CCDS31395.1	11	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300689	0.40694	.	.	ENSG00000181023	ENST00000317121	T	0.02944	4.1	5.91	5.91	0.95273	.	0.000000	0.42172	U	0.000746	T	0.18130	0.0435	M	0.86028	2.79	0.53688	D	0.999979	D	0.89917	1.0	D	0.72338	0.977	T	0.00068	-1.2139	10	0.44086	T	0.13	-5.7139	17.7874	0.88542	0.0:0.0:1.0:0.0	.	32	Q8NGI3	O56B1_HUMAN	C	32	ENSP00000322939:W32C	ENSP00000322939:W32C	W	+	3	0	OR56B1	5714418	0.780000	0.28664	1.000000	0.80357	0.339000	0.28857	0.905000	0.28504	2.801000	0.96364	0.655000	0.94253	TGG	-	OR56B1	-	NULL		0.488	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56B1	HGNC	protein_coding	OTTHUMT00000143354.1	0	0	0	31	31	87	0.00	0.00	G	NM_001005180		5757842	+1	21	28	51	70	tier1	no_errors	ENST00000317121	ensembl	human	known	74_37	missense	29.17	28.57	SNP	1.000	C	21	51
ETV7	51513	genome.wustl.edu	37	6	36353379	36353379	+	Missense_Mutation	SNP	T	T	C	rs370294288		TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr6:36353379T>C	ENST00000340181.4	-	2	315	c.74A>G	c.(73-75)cAa>cGa	p.Q25R	ETV7_ENST00000339796.5_Missense_Mutation_p.Q25R|ETV7_ENST00000373738.1_Missense_Mutation_p.Q25R|RP1-50J22.4_ENST00000411643.1_RNA|ETV7_ENST00000373737.4_Missense_Mutation_p.Q25R|ETV7_ENST00000538992.1_Intron	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	25					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						ACATCTGGCTTGCACGTGGGT	0.517													ENSG00000010030																																					0								T	ARG/GLN,ARG/GLN,,ARG/GLN,ARG/GLN,,,ARG/GLN	1,4405	2.1+/-5.4	0,1,2202	81.0	82.0	82.0		74,74,,74,74,,,74	2.5	0.0	6		82	0,8600		0,0,4300	no	missense,missense,utr-5,missense,missense,intron,intron,missense	ETV7	NM_001207035.1,NM_001207036.1,NM_001207037.1,NM_001207038.1,NM_001207039.1,NM_001207040.1,NM_001207041.1,NM_016135.3	43,43,,43,43,,,43	0,1,6502	CC,CT,TT		0.0,0.0227,0.0077	benign,benign,,benign,benign,,,benign	25/318,25/287,,25/265,25/263,,,25/342	36353379	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.74A>G	6.37:g.36353379T>C	ENSP00000341843:p.Gln25Arg		B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.Q25R	ENST00000340181.4	37	c.74	CCDS4819.1	6	.	.	.	.	.	.	.	.	.	.	T	0.102	-1.150063	0.01700	2.27E-4	0.0	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373737;ENST00000373738	T;T;T;T	0.13196	3.12;3.12;2.77;2.61	3.63	2.45	0.29901	Sterile alpha motif/pointed domain (1);	0.882556	0.09506	U	0.792903	T	0.03915	0.0110	L	0.27053	0.805	0.09310	N	0.999999	B;B;B;D;B	0.56968	0.004;0.002;0.002;0.978;0.007	B;B;B;P;B	0.50754	0.003;0.004;0.003;0.649;0.009	T	0.19516	-1.0303	10	0.12430	T	0.62	.	4.3915	0.11343	0.0:0.1119:0.2003:0.6878	.	25;25;25;25;25	Q9Y603-7;Q9Y603-4;Q9Y603;Q9Y603-6;Q9Y603-5	.;.;ETV7_HUMAN;.;.	R	25	ENSP00000342260:Q25R;ENSP00000341843:Q25R;ENSP00000362842:Q25R;ENSP00000362843:Q25R	ENSP00000342260:Q25R	Q	-	2	0	ETV7	36461357	0.019000	0.18553	0.042000	0.18584	0.046000	0.14306	0.139000	0.16036	0.314000	0.23086	0.377000	0.23210	CAA	-	ETV7	-	superfamily_SAM/pointed		0.517	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETV7	HGNC	protein_coding	OTTHUMT00000040341.1	0	0	0	26	26	86	0.00	0.00	T	NM_016135		36353379	-1	10	32	20	34	tier1	no_errors	ENST00000340181	ensembl	human	known	74_37	missense	33.33	48.48	SNP	0.008	C	10	20
MIR520A	574467	genome.wustl.edu	37	19	54194150	54194150	+	RNA	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:54194150T>C	ENST00000384862.1	+	0	16				MIR1283-1_ENST00000408494.1_RNA	NR_030189.1				microRNA 520a																		GCTGTGACCCTCCAGAGGGAA	0.418													ENSG00000207594																																					0													172.0	161.0	164.0					19																	54194150		1568	3582	5150			0			-			19q13.42	2011-09-12		2008-12-18	ENSG00000207594	ENSG00000207594		"""ncRNAs / Micro RNAs"""	32099	non-coding RNA	RNA, micro				MIRN520A			Standard	NR_030189		Approved	hsa-mir-520a	uc021uzs.1				19.37:g.54194150T>C				R	SNP	-	NULL	ENST00000384862.1	37	NULL		19																																																																																			-	MIR520A	-	-		0.418	MIR520A-201	KNOWN	basic	miRNA	MIR520A	HGNC	miRNA		0	0	0	96	96	27	0.00	0.00	T	NR_030189		54194150	+1	52	6	115	18	tier1	no_errors	ENST00000384862	ensembl	human	known	74_37	rna	31.14	25.00	SNP	0.120	C	52	115
ALOXE3	59344	genome.wustl.edu	37	17	8006780	8006780	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr17:8006780G>T	ENST00000448843.2	-	15	2157	c.1817C>A	c.(1816-1818)cCa>cAa	p.P606Q	ALOXE3_ENST00000380149.1_Missense_Mutation_p.P762Q|ALOXE3_ENST00000318227.3_Missense_Mutation_p.P738Q	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	606	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CATGGATGATGGAGCATTGGG	0.577													ENSG00000179148																																					0													101.0	84.0	90.0					17																	8006780		2203	4300	6503	SO:0001583	missense	0			-	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1817C>A	17.37:g.8006780G>T	ENSP00000400581:p.Pro606Gln		B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_C	p.P738Q	ENST00000448843.2	37	c.2213	CCDS11130.1	17	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202546	0.79127	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	D;D;D	0.97731	-4.51;-4.51;-4.51	5.14	4.17	0.49024	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	H	0.96633	3.855	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.998	D	0.99104	1.0844	10	0.87932	D	0	-14.7647	13.1558	0.59516	0.0786:0.0:0.9214:0.0	.	738;606;606	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	Q	762;738;606	ENSP00000369494:P762Q;ENSP00000314879:P738Q;ENSP00000400581:P606Q	ENSP00000314879:P738Q	P	-	2	0	ALOXE3	7947505	1.000000	0.71417	0.565000	0.28409	0.946000	0.59487	9.267000	0.95665	1.532000	0.49169	0.655000	0.94253	CCA	-	ALOXE3	-	pfam_LipOase_C,superfamily_LipOase_C		0.577	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOXE3	HGNC	protein_coding	OTTHUMT00000441475.1	0	0	0	73	73	76	0.00	0.00	G			8006780	-1	21	24	82	95	tier1	no_errors	ENST00000318227	ensembl	human	known	74_37	missense	20.39	20.17	SNP	1.000	T	21	82
PRRC2B	84726	genome.wustl.edu	37	9	134343099	134343099	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr9:134343099C>A	ENST00000357304.4	+	12	1925	c.1870C>A	c.(1870-1872)Ctt>Att	p.L624I	PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Missense_Mutation_p.L624I|PRRC2B_ENST00000405995.1_Missense_Mutation_p.L624I	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	624	Gln-rich.						poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						TCAGAAGTCCCTTCCTCCCCG	0.557													ENSG00000130723																																					0													52.0	60.0	57.0					9																	134343099		2063	4212	6275	SO:0001583	missense	0			-	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.1870C>A	9.37:g.134343099C>A	ENSP00000349856:p.Leu624Ile		O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	pfam_BAT2_N	p.L624I	ENST00000357304.4	37	c.1870	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490726	0.44249	.	.	ENSG00000130723	ENST00000405995;ENST00000357304;ENST00000458550;ENST00000422467	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	5.36	3.47	0.39725	.	0.000000	0.37669	U	0.001994	T	0.17023	0.0409	M	0.78049	2.395	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.02877	-1.1099	10	0.51188	T	0.08	-5.9753	7.2626	0.26212	0.3005:0.6207:0.0:0.0788	.	624	Q5JSZ5	PRC2B_HUMAN	I	624;624;624;164	ENSP00000384606:L624I;ENSP00000349856:L624I;ENSP00000398853:L624I;ENSP00000391063:L164I	ENSP00000349856:L624I	L	+	1	0	PRRC2B	133332920	0.624000	0.27102	0.721000	0.30653	0.996000	0.88848	1.080000	0.30779	0.709000	0.31976	0.655000	0.94253	CTT	-	PRRC2B	-	NULL		0.557	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		0	0	0	70	70	97	0.00	0.00	C			134343099	+1	32	14	61	38	tier1	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	34.41	26.92	SNP	0.445	A	32	61
WIPF3	644150	genome.wustl.edu	37	7	29874401	29874401	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr7:29874401C>T	ENST00000409290.1	+	1	61	c.61C>T	c.(61-63)Cct>Tct	p.P21S	WIPF3_ENST00000409123.1_Missense_Mutation_p.P21S|WIPF3_ENST00000242140.5_Missense_Mutation_p.P21S	NM_001080529.2	NP_001073998.2	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3	21					cell differentiation (GO:0030154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)				breast(2)|large_intestine(3)|lung(6)|ovary(1)	12						tctgggggctcctccccctcc	0.562													ENSG00000122574																																					0													13.0	14.0	14.0					7																	29874401		937	2074	3011	SO:0001583	missense	0			-	AK094250	CCDS56472.1	7p15.1	2006-10-12			ENSG00000122574	ENSG00000122574			22004	protein-coding gene	gene with protein product		612432					Standard	NM_001080529		Approved	CR16, FLJ36931	uc022aaz.1	A6NGB9	OTTHUMG00000152761	ENST00000409290.1:c.61C>T	7.37:g.29874401C>T	ENSP00000386878:p.Pro21Ser		B8ZZV2	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.P21S	ENST00000409290.1	37	c.61	CCDS56472.1	7	.	.	.	.	.	.	.	.	.	.	C	15.01	2.706428	0.48412	.	.	ENSG00000122574	ENST00000409123;ENST00000409290;ENST00000242140	T;T;T	0.62941	0.01;-0.01;0.01	4.56	4.56	0.56223	.	2.602770	0.04222	U	0.333688	T	0.75309	0.3832	L	0.39898	1.24	0.34709	D	0.727537	D	0.89917	1.0	D	0.79108	0.992	T	0.65841	-0.6070	10	0.87932	D	0	.	13.0067	0.58710	0.0:1.0:0.0:0.0	.	21	A6NGB9	WIPF3_HUMAN	S	21	ENSP00000386790:P21S;ENSP00000386878:P21S;ENSP00000242140:P21S	ENSP00000242140:P21S	P	+	1	0	WIPF3	29840926	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.716000	0.37981	2.527000	0.85204	0.655000	0.94253	CCT	-	WIPF3	-	NULL		0.562	WIPF3-002	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	WIPF3	HGNC	protein_coding	OTTHUMT00000327705.1	1	1	0	106	106	36	0.93	0.00	C			29874401	+1	63	11	203	27	tier1	no_errors	ENST00000242140	ensembl	human	known	74_37	missense	23.60	28.95	SNP	1.000	T	63	203
IGLON5	402665	genome.wustl.edu	37	19	51827072	51827072	+	Silent	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:51827072C>T	ENST00000270642.8	+	3	315	c.315C>T	c.(313-315)ggC>ggT	p.G105G		NM_001101372.1	NP_001094842.1	A6NGN9	IGLO5_HUMAN	IgLON family member 5	105	Ig-like C2-type 1.					extracellular region (GO:0005576)				large_intestine(5)|lung(6)|prostate(1)	12						TGGGGCTCGGCGACGAGGGCC	0.662													ENSG00000142549																																					0													41.0	48.0	46.0					19																	51827072		1970	4134	6104	SO:0001819	synonymous_variant	0			-		CCDS46158.1	19q13.33	2013-01-29			ENSG00000142549	ENSG00000142549		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	34550	protein-coding gene	gene with protein product							Standard	NM_001101372		Approved	LOC402665	uc002pwc.2	A6NGN9	OTTHUMG00000154422	ENST00000270642.8:c.315C>T	19.37:g.51827072C>T				Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G105	ENST00000270642.8	37	c.315	CCDS46158.1	19																																																																																			-	IGLON5	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.662	IGLON5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGLON5	HGNC	protein_coding	OTTHUMT00000335149.1	0	0	0	60	60	48	0.00	0.00	C	NM_001101372		51827072	+1	10	7	83	25	tier1	no_errors	ENST00000270642	ensembl	human	known	74_37	silent	10.75	21.88	SNP	0.653	T	10	83
ZNF615	284370	genome.wustl.edu	37	19	52497670	52497670	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:52497670A>G	ENST00000602063.1	-	6	1008	c.659T>C	c.(658-660)aTt>aCt	p.I220T	ZNF615_ENST00000391795.3_Missense_Mutation_p.I225T|ZNF615_ENST00000376716.5_Missense_Mutation_p.I220T|ZNF615_ENST00000598071.1_Missense_Mutation_p.I231T|ZNF615_ENST00000594083.1_Missense_Mutation_p.I231T			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	220					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CTGATGATCAATAAACTGAGA	0.413													ENSG00000197619																																					0													187.0	180.0	182.0					19																	52497670		2203	4300	6503	SO:0001583	missense	0			-	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.659T>C	19.37:g.52497670A>G	ENSP00000473089:p.Ile220Thr		B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I231T	ENST00000602063.1	37	c.692	CCDS12846.1	19	.	.	.	.	.	.	.	.	.	.	A	0.937	-0.710749	0.03230	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.27720	1.65;1.65	3.2	-6.4	0.01944	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13372	0.0324	N	0.21324	0.655	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.35649	-0.9780	9	0.09084	T	0.74	.	5.7578	0.18182	0.149:0.1104:0.5543:0.1864	.	225;227;231;220	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	T	220;230;225;230	ENSP00000365906:I220T;ENSP00000375672:I225T	ENSP00000347019:I230T	I	-	2	0	ZNF615	57189482	0.000000	0.05858	0.000000	0.03702	0.032000	0.12392	-1.780000	0.01775	-1.718000	0.01383	-0.256000	0.11100	ATT	-	ZNF615	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF615	HGNC	protein_coding	OTTHUMT00000462391.1	0	0	0	40	40	65	0.00	0.00	A	NM_198480		52497670	-1	20	15	54	45	tier1	no_errors	ENST00000594083	ensembl	human	known	74_37	missense	27.03	25.00	SNP	0.000	G	20	54
PCLO	27445	genome.wustl.edu	37	7	82578814	82578814	+	Missense_Mutation	SNP	A	A	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr7:82578814A>T	ENST00000333891.9	-	6	11427	c.11090T>A	c.(11089-11091)tTt>tAt	p.F3697Y	PCLO_ENST00000423517.2_Missense_Mutation_p.F3697Y|PCLO_ENST00000437081.1_Missense_Mutation_p.F417Y	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GGTATACTGAAAAGGAGCCCT	0.468													ENSG00000186472																																					0													179.0	172.0	175.0					7																	82578814		1909	4137	6046	SO:0001583	missense	0			-	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11090T>A	7.37:g.82578814A>T	ENSP00000334319:p.Phe3697Tyr			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.F3697Y	ENST00000333891.9	37	c.11090	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	A	16.86	3.239359	0.58995	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.21191	2.02;2.02	5.92	4.75	0.60458	.	.	.	.	.	T	0.23926	0.0579	L	0.58428	1.81	0.35627	D	0.809886	B;B;B	0.14438	0.001;0.01;0.01	B;B;B	0.15484	0.002;0.013;0.013	T	0.13899	-1.0492	9	0.87932	D	0	.	12.3874	0.55340	0.8736:0.0:0.0:0.1263	.	3628;3697;3697	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	Y	3628;3697;3697;417	ENSP00000334319:F3697Y;ENSP00000388393:F3697Y	ENSP00000334319:F3697Y	F	-	2	0	PCLO	82416750	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.466000	0.66731	1.027000	0.39758	0.528000	0.53228	TTT	-	PCLO	-	NULL		0.468	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	0	0	1	38	38	112	0.00	0.88	A	NM_014510		82578814	-1	24	26	46	75	tier1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	34.29	25.74	SNP	1.000	T	24	46
SPATA31D1	389763	genome.wustl.edu	37	9	84607869	84607869	+	Silent	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr9:84607869T>C	ENST00000344803.2	+	4	2531	c.2484T>C	c.(2482-2484)aaT>aaC	p.N828N		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	828					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AACTTGAAAATGCCCTGACAG	0.453													ENSG00000214929																																					0													78.0	73.0	75.0					9																	84607869		1865	4092	5957	SO:0001819	synonymous_variant	0			-		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2484T>C	9.37:g.84607869T>C				Silent	SNP	NULL	p.N828	ENST00000344803.2	37	c.2484	CCDS47986.1	9																																																																																			-	SPATA31D1	-	NULL		0.453	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	0	0	0	52	52	98	0.00	0.00	T	NM_001001670		84607869	+1	85	47	73	55	tier1	no_errors	ENST00000344803	ensembl	human	known	74_37	silent	53.80	45.63	SNP	0.000	C	85	73
HERC3	8916	genome.wustl.edu	37	4	89574169	89574169	+	Silent	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr4:89574169C>T	ENST00000402738.1	+	6	852	c.613C>T	c.(613-615)Ctg>Ttg	p.L205L	HERC3_ENST00000407637.1_Silent_p.L205L|HERC3_ENST00000264345.3_Silent_p.L205L	NM_001271602.1|NM_014606.1	NP_001258531.1|NP_055421.1	Q15034	HERC3_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 3	205					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|prostate(2)|skin(2)	45				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		CAGCTTTGCCCTGTCTCTCTC	0.567													ENSG00000138641																																					0													65.0	74.0	71.0					4																	89574169		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D25215	CCDS34028.1	4q21	2012-02-23	2012-02-23		ENSG00000138641	ENSG00000138641			4876	protein-coding gene	gene with protein product		605200	"""hect domain and RLD 3"""			10702688	Standard	NM_014606		Approved	KIAA0032	uc003hrw.2	Q15034	OTTHUMG00000150436	ENST00000402738.1:c.613C>T	4.37:g.89574169C>T			A8K1S5|Q8IXX3	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.L205	ENST00000402738.1	37	c.613	CCDS34028.1	4																																																																																			-	HERC3	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.567	HERC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC3	HGNC	protein_coding	OTTHUMT00000318081.2	0	0	0	52	52	68	0.00	0.00	C	NM_014606		89574169	+1	42	30	67	40	tier1	no_errors	ENST00000264345	ensembl	human	known	74_37	silent	38.53	42.86	SNP	1.000	T	42	67
RIOK1	83732	genome.wustl.edu	37	6	7398933	7398933	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr6:7398933A>G	ENST00000379834.2	+	5	947	c.440A>G	c.(439-441)tAt>tGt	p.Y147C		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	147							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					TTGGTTAGGTATCGCATCAAA	0.318													ENSG00000124784																																					0													219.0	212.0	214.0					6																	7398933		2203	4300	6503	SO:0001583	missense	0			-	BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.440A>G	6.37:g.7398933A>G	ENSP00000369162:p.Tyr147Cys		B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1	p.Y147C	ENST00000379834.2	37	c.440	CCDS4500.1	6	.	.	.	.	.	.	.	.	.	.	A	12.00	1.805808	0.31961	.	.	ENSG00000124784	ENST00000379834	T	0.05649	3.41	5.05	2.66	0.31614	.	0.196582	0.45606	N	0.000353	T	0.02230	0.0069	L	0.43152	1.355	0.44469	D	0.997407	B	0.06786	0.001	B	0.12837	0.008	T	0.36817	-0.9732	10	0.39692	T	0.17	-8.5851	8.7028	0.34336	0.7687:0.0:0.2313:0.0	.	147	Q9BRS2	RIOK1_HUMAN	C	147	ENSP00000369162:Y147C	ENSP00000369162:Y147C	Y	+	2	0	RIOK1	7343932	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.161000	0.58170	0.352000	0.24053	0.482000	0.46254	TAT	-	RIOK1	-	pirsf_Ser/Thr_kinase_Rio1		0.318	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK1	HGNC	protein_coding	OTTHUMT00000039780.2	0	0	0	37	37	104	0.00	0.00	A	NM_031480		7398933	+1	35	26	36	50	tier1	no_errors	ENST00000379834	ensembl	human	known	74_37	missense	49.30	34.21	SNP	1.000	G	35	36
WDR64	128025	genome.wustl.edu	37	1	241907737	241907737	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:241907737G>T	ENST00000366552.2	+	12	1690	c.1483G>T	c.(1483-1485)Gaa>Taa	p.E495*	WDR64_ENST00000437684.2_Nonsense_Mutation_p.E495*	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	495										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CCAGATTTTAGAACCTCATGG	0.413													ENSG00000162843																																					0													113.0	112.0	113.0					1																	241907737		2203	4300	6503	SO:0001587	stop_gained	0			-	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1483G>T	1.37:g.241907737G>T	ENSP00000355510:p.Glu495*		B1ANT0|Q7Z573|Q96LY9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E495*	ENST00000366552.2	37	c.1483		1	.	.	.	.	.	.	.	.	.	.	G	41	9.101020	0.99066	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	.	.	.	6.08	6.08	0.98989	.	0.073883	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-15.0056	11.4914	0.50383	0.081:0.0:0.919:0.0	.	.	.	.	X	495;495;266	.	ENSP00000355510:E495X	E	+	1	0	WDR64	239974360	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.314000	0.59166	2.894000	0.99253	0.655000	0.94253	GAA	-	WDR64	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.413	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		0	0	1	63	63	74	0.00	1.33	G	NM_144625		241907737	+1	59	28	11	10	tier1	no_errors	ENST00000366552	ensembl	human	known	74_37	nonsense	84.29	73.68	SNP	1.000	T	59	11
XIRP2	129446	genome.wustl.edu	37	2	168108404	168108404	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr2:168108404C>A	ENST00000409195.1	+	9	10591	c.10502C>A	c.(10501-10503)gCt>gAt	p.A3501D	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.A3501D|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.A3279D|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3326					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ACCGCAGATGCTTCTGCAACT	0.383													ENSG00000163092																																					0													68.0	65.0	66.0					2																	168108404		1860	4090	5950	SO:0001583	missense	0			-	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10502C>A	2.37:g.168108404C>A	ENSP00000386840:p.Ala3501Asp		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.A3501D	ENST00000409195.1	37	c.10502	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	2.301	-0.360075	0.05103	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02837	4.14;4.14;4.14	6.02	3.22	0.36961	.	0.454356	0.25851	N	0.027896	T	0.02848	0.0085	L	0.38838	1.175	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.12156	0.003;0.007;0.003	T	0.41680	-0.9495	10	0.42905	T	0.14	-6.4636	7.2307	0.26040	0.1295:0.6778:0.1247:0.0681	.	3326;3326;3279	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	D	3501;3501;3279;915	ENSP00000386840:A3501D;ENSP00000295237:A3501D;ENSP00000387255:A3279D	ENSP00000295237:A3501D	A	+	2	0	XIRP2	167816650	0.095000	0.21747	0.056000	0.19401	0.146000	0.21551	1.606000	0.36826	0.406000	0.25560	-0.158000	0.13435	GCT	-	XIRP2	-	NULL		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	0	0	0	49	49	83	0.00	0.00	C	NM_152381		168108404	+1	4	9	38	56	tier1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	9.52	13.85	SNP	0.128	A	4	38
VWCE	220001	genome.wustl.edu	37	11	61058764	61058764	+	Missense_Mutation	SNP	C	C	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr11:61058764C>G	ENST00000335613.5	-	3	653	c.267G>C	c.(265-267)caG>caC	p.Q89H		NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	89	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GCTCTCCATCCTGGCAGGAGC	0.597													ENSG00000167992																																					0													41.0	40.0	40.0					11																	61058764		2203	4299	6502	SO:0001583	missense	0			-	AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.267G>C	11.37:g.61058764C>G	ENSP00000334186:p.Gln89His		A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.Q89H	ENST00000335613.5	37	c.267	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654350	0.47467	.	.	ENSG00000167992	ENST00000335613	T	0.69040	-0.37	5.16	2.09	0.27110	Epidermal growth factor-like (1);	0.155917	0.30437	N	0.009626	T	0.33000	0.0848	N	0.04297	-0.235	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.03840	-1.0999	10	0.12430	T	0.62	.	2.0636	0.03597	0.1409:0.4994:0.1368:0.2228	.	89	Q96DN2	VWCE_HUMAN	H	89	ENSP00000334186:Q89H	ENSP00000301770:Q89H	Q	-	3	2	VWCE	60815340	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	0.647000	0.24812	0.557000	0.29117	0.561000	0.74099	CAG	-	VWCE	-	smart_EG-like_dom		0.597	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	0	0	1	39	39	93	0.00	1.06	C	NM_152718		61058764	-1	12	28	46	37	tier1	no_errors	ENST00000335613	ensembl	human	known	74_37	missense	20.69	43.08	SNP	0.998	G	12	46
C6orf163	206412	genome.wustl.edu	37	6	88054895	88054895	+	Silent	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr6:88054895A>G	ENST00000388923.4	+	1	329	c.78A>G	c.(76-78)ggA>ggG	p.G26G	RP1-102H19.8_ENST00000448282.2_Intron|C6orf163_ENST00000608326.1_5'Flank	NM_001010868.2	NP_001010868.2	Q5TEZ5	CF163_HUMAN	chromosome 6 open reading frame 163	26										central_nervous_system(1)|kidney(1)	2						CCCCTTTTGGAAAAACCTTCA	0.348													ENSG00000203872																																					0													79.0	63.0	68.0					6																	88054895		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK092941	CCDS55042.1	6q15	2012-02-07			ENSG00000203872	ENSG00000203872			21403	protein-coding gene	gene with protein product							Standard	NM_001010868		Approved		uc021zcl.1	Q5TEZ5	OTTHUMG00000015169	ENST00000388923.4:c.78A>G	6.37:g.88054895A>G				Silent	SNP	NULL	p.G26	ENST00000388923.4	37	c.78	CCDS55042.1	6																																																																																			-	C6orf163	-	NULL		0.348	C6orf163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf163	HGNC	protein_coding	OTTHUMT00000041436.2	0	0	0	52	52	108	0.00	0.00	A	NM_001010868		88054895	+1	13	18	137	99	tier1	no_errors	ENST00000388923	ensembl	human	known	74_37	silent	8.67	15.38	SNP	0.309	G	13	137
FRAS1	80144	genome.wustl.edu	37	4	79461845	79461845	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr4:79461845T>C	ENST00000264895.6	+	74	12046	c.11606T>C	c.(11605-11607)aTc>aCc	p.I3869T		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3865					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GATTCCCTCATCTATGACAAT	0.552													ENSG00000138759																																					0													43.0	46.0	45.0					4																	79461845		2030	4186	6216	SO:0001583	missense	0			-	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11606T>C	4.37:g.79461845T>C	ENSP00000264895:p.Ile3869Thr		A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.I3869T	ENST00000264895.6	37	c.11606	CCDS54771.1	4	.	.	.	.	.	.	.	.	.	.	T	16.05	3.011873	0.54468	.	.	ENSG00000138759	ENST00000264895	T	0.46819	0.86	6.16	6.16	0.99307	.	0.114885	0.64402	D	0.000016	T	0.57417	0.2052	L	0.42245	1.32	0.80722	D	1	D	0.61080	0.989	P	0.56398	0.797	T	0.59252	-0.7489	10	0.72032	D	0.01	.	16.8061	0.85666	0.0:0.0:0.0:1.0	.	3869	E9PHH6	.	T	3869	ENSP00000264895:I3869T	ENSP00000264895:I3869T	I	+	2	0	FRAS1	79680869	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	7.854000	0.86942	2.367000	0.80283	0.528000	0.53228	ATC	-	FRAS1	-	NULL		0.552	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		0	0	0	16	16	96	0.00	0.00	T			79461845	+1	15	22	34	56	tier1	no_errors	ENST00000264895	ensembl	human	known	74_37	missense	30.61	28.21	SNP	1.000	C	15	34
RGS18	64407	genome.wustl.edu	37	1	192127851	192127851	+	Silent	SNP	A	A	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:192127851A>T	ENST00000367460.3	+	1	265	c.84A>T	c.(82-84)tcA>tcT	p.S28S	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	28					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TACATGGTTCAGGAAAAGAAG	0.279													ENSG00000150681																																					0													48.0	52.0	50.0					1																	192127851		2202	4288	6490	SO:0001819	synonymous_variant	0			-	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.84A>T	1.37:g.192127851A>T			B2RD23	Silent	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S28	ENST00000367460.3	37	c.84	CCDS1374.1	1																																																																																			-	RGS18	-	NULL		0.279	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	HGNC	protein_coding	OTTHUMT00000086382.1	0	0	0	36	36	98	0.00	0.00	A	NM_130782		192127851	+1	21	61	138	242	tier1	no_errors	ENST00000367460	ensembl	human	known	74_37	silent	13.21	20.13	SNP	0.752	T	21	138
ANKRD28	23243	genome.wustl.edu	37	3	15711767	15711767	+	3'UTR	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr3:15711767C>T	ENST00000399451.2	-	0	3539				ANKRD28_ENST00000497037.1_5'UTR|ANKRD28_ENST00000383777.1_3'UTR	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28							nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						ACTCCCTCCTCCTCAGCCTCT	0.438													ENSG00000206560																																					0													62.0	59.0	60.0					3																	15711767		1900	4136	6036	SO:0001624	3_prime_UTR_variant	0			-	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.*10G>A	3.37:g.15711767C>T			B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	R	SNP	-	NULL	ENST00000399451.2	37	NULL	CCDS46769.1	3																																																																																			-	ANKRD28	-	-		0.438	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	HGNC	protein_coding	OTTHUMT00000339758.1	0	0	0	26	26	75	0.00	0.00	C	NM_015199		15711767	-1	21	23	31	44	tier1	no_errors	ENST00000497037	ensembl	human	known	74_37	rna	39.62	34.33	SNP	0.002	T	21	31
CEP89	84902	genome.wustl.edu	37	19	33428567	33428567	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr19:33428567G>A	ENST00000305768.5	-	7	725	c.637C>T	c.(637-639)Cca>Tca	p.P213S	CEP89_ENST00000590597.2_Missense_Mutation_p.P213S	NM_032816.3	NP_116205.3	Q96ST8	CEP89_HUMAN	centrosomal protein 89kDa	213					cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(4)|large_intestine(4)|lung(15)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	35						TCACATAATGGAGGTTTTTCA	0.373													ENSG00000121289																																					0													99.0	108.0	105.0					19																	33428567		2203	4300	6503	SO:0001583	missense	0			-	AL832158	CCDS32987.1	19q13.11	2014-02-20	2011-05-06	2011-05-06		ENSG00000121289			25907	protein-coding gene	gene with protein product		615470	"""coiled-coil domain containing 123"""	CCDC123		16395595	Standard	NM_032816		Approved	FLJ14640	uc002nty.3	Q96ST8		ENST00000305768.5:c.637C>T	19.37:g.33428567G>A	ENSP00000306105:p.Pro213Ser		B9EGA6|Q8N5J8	Missense_Mutation	SNP	NULL	p.P213S	ENST00000305768.5	37	c.637	CCDS32987.1	19	.	.	.	.	.	.	.	.	.	.	G	2.741	-0.262195	0.05791	.	.	ENSG00000121289	ENST00000305768	T	0.29397	1.57	4.92	0.0682	0.14368	.	1.117230	0.06528	N	0.740958	T	0.22126	0.0533	L	0.50919	1.6	0.09310	N	1	B;B;B	0.33583	0.129;0.035;0.418	B;B;B	0.30855	0.082;0.015;0.121	T	0.20940	-1.0260	10	0.09338	T	0.73	-0.0066	5.0188	0.14350	0.2804:0.151:0.5687:0.0	.	184;213;213	Q8WUL5;Q96ST8-3;Q96ST8	.;.;CEP89_HUMAN	S	213	ENSP00000306105:P213S	ENSP00000306105:P213S	P	-	1	0	CEP89	38120407	0.836000	0.29430	0.001000	0.08648	0.252000	0.25951	1.435000	0.34969	0.016000	0.14998	0.643000	0.83706	CCA	-	CEP89	-	NULL		0.373	CEP89-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP89	HGNC	protein_coding	OTTHUMT00000451300.2	0	0	0	110	110	115	0.00	0.00	G	NM_032816		33428567	-1	59	44	121	83	tier1	no_errors	ENST00000305768	ensembl	human	known	74_37	missense	32.78	34.38	SNP	0.008	A	59	121
FBN1	2200	genome.wustl.edu	37	15	48826355	48826355	+	Missense_Mutation	SNP	A	A	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr15:48826355A>T	ENST00000316623.5	-	8	1239	c.784T>A	c.(784-786)Tgc>Agc	p.C262S		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	262	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTATTAATGCAATTTCCTCCC	0.398													ENSG00000166147																																					0													220.0	232.0	228.0					15																	48826355		2197	4296	6493	SO:0001583	missense	0			-	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.784T>A	15.37:g.48826355A>T	ENSP00000325527:p.Cys262Ser		B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.C262S	ENST00000316623.5	37	c.784	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427538	0.83667	.	.	ENSG00000166147	ENST00000316623	D	0.99429	-5.89	5.51	4.35	0.52113	Matrix fibril-associated (1);EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99315	0.9760	H	0.99090	4.425	0.80722	D	1	P	0.37663	0.604	B	0.32928	0.155	D	0.97626	1.0139	10	0.87932	D	0	.	12.7525	0.57316	0.8627:0.1373:0.0:0.0	.	262	P35555	FBN1_HUMAN	S	262	ENSP00000325527:C262S	ENSP00000325527:C262S	C	-	1	0	FBN1	46613647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	0.996000	0.38943	0.533000	0.62120	TGC	-	FBN1	-	pfam_EGF-like_Ca-bd_dom,superfamily_TB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.398	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	0	0	0	54	54	56	0.00	0.00	A			48826355	-1	12	6	98	48	tier1	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	10.91	11.11	SNP	1.000	T	12	98
GALNT1	2589	genome.wustl.edu	37	18	33234543	33234543	+	5'UTR	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr18:33234543A>G	ENST00000269195.5	+	0	20				GALNT1_ENST00000591081.1_5'UTR|GALNT1_ENST00000586725.1_3'UTR|GALNT1_ENST00000537549.1_5'Flank	NM_020474.3	NP_065207.2	Q10472	GALT1_HUMAN	polypeptide N-acetylgalactosaminyltransferase 1						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|ovary(4)|stomach(1)	21						GTGATTTCTGATGAAACTGGA	0.219													ENSG00000141429																																					0																																										SO:0001623	5_prime_UTR_variant	0			-		CCDS11915.1	18q12.1	2014-03-13	2014-03-13		ENSG00000141429	ENSG00000141429	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4123	protein-coding gene	gene with protein product	"""protein-UDP acetylgalactosaminyltransferase 1"", ""polypeptide GalNAc transferase 1"""	602273	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 1 (GalNAc-T1)"""			7592619, 12199709	Standard	NM_020474		Approved	GalNAc-T1	uc002kzb.3	Q10472	OTTHUMG00000132567	ENST00000269195.5:c.-84A>G	18.37:g.33234543A>G			Q86TJ7|Q9UM86	R	SNP	-	NULL	ENST00000269195.5	37	NULL	CCDS11915.1	18																																																																																			-	GALNT1	-	-		0.219	GALNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT1	HGNC	protein_coding	OTTHUMT00000255771.2	0	0	0	26	26	20	0.00	0.00	A	NM_020474		33234543	+1	7	8	7	21	tier1	no_errors	ENST00000586725	ensembl	human	known	74_37	rna	50.00	27.59	SNP	1.000	G	7	7
IGHV1OR21-1	390530	genome.wustl.edu	37	21	10862964	10862964	+	RNA	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr21:10862964T>C	ENST00000559480.1	+	0	260							A6NJS3	IV1U1_HUMAN	immunoglobulin heavy variable 1/OR21-1 (non-functional)							extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(3)|lung(20)|urinary_tract(1)	26						CAGGCCAGAGTCACCATAACC	0.532													ENSG00000169861																																					0													364.0	357.0	359.0					21																	10862964		2181	4281	6462			0			-			21p11.2	2014-05-06	2010-11-09		ENSG00000169861	ENSG00000277282		"""Immunoglobulins / IGH orphons"""	38040	other	immunoglobulin gene			"""immunoglobulin heavy variable 1/OR21-1 pseudogene"""				Standard	NG_011680		Approved	IGHV1/OR21-1		A6NJS3	OTTHUMG00000188295		21.37:g.10862964T>C				Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.V87A	ENST00000559480.1	37	c.260		21																																																																																			-	IGHV1OR21-1	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.532	IGHV1OR21-1-201	KNOWN	basic|appris_principal	IG_V_gene	IGHV1OR21-1	HGNC	IG_V_gene		0	0	0	145	145	33	0.00	0.00	T	NG_011680		10862964	+1	57	7	211	31	tier1	no_errors	ENST00000559480	ensembl	human	known	74_37	missense	21.27	18.42	SNP	0.929	C	57	211
PHF13	148479	genome.wustl.edu	37	1	6682484	6682484	+	3'UTR	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:6682484C>T	ENST00000377648.4	+	0	2072				THAP3_ENST00000054650.4_5'Flank|THAP3_ENST00000377627.3_5'Flank|PHF13_ENST00000495385.1_3'UTR|THAP3_ENST00000307896.6_5'Flank	NM_153812.2	NP_722519.2	Q86YI8	PHF13_HUMAN	PHD finger protein 13						chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(1)|lung(3)	7	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;1.46e-33)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.19e-07)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000501)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|STAD - Stomach adenocarcinoma(132;0.0165)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGTGCCCTCTTAGTTGGTG	0.468													ENSG00000116273																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK027492	CCDS85.1	1p36.23	2013-01-28			ENSG00000116273	ENSG00000116273		"""Zinc fingers, PHD-type"""	22983	protein-coding gene	gene with protein product							Standard	NM_153812		Approved	MGC43399	uc001aob.4	Q86YI8	OTTHUMG00000001439	ENST00000377648.4:c.*787C>T	1.37:g.6682484C>T			B3KUQ7|Q59FB6|Q5TH65|Q8N551|Q9UJP2	R	SNP	-	NULL	ENST00000377648.4	37	NULL	CCDS85.1	1																																																																																			-	PHF13	-	-		0.468	PHF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF13	HGNC	protein_coding	OTTHUMT00000004201.1	0	0	0	34	34	69	0.00	0.00	C	NM_153812		6682484	+1	29	13	72	63	tier1	no_errors	ENST00000495385	ensembl	human	known	74_37	rna	28.71	17.11	SNP	0.002	T	29	72
MDM1	56890	genome.wustl.edu	37	12	68707424	68707424	+	Splice_Site	SNP	C	C	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr12:68707424C>A	ENST00000303145.7	-	10	1695	c.1609G>T	c.(1609-1611)Ggt>Tgt	p.G537C	MDM1_ENST00000411698.2_Splice_Site_p.G502C|MDM1_ENST00000540418.1_Splice_Site_p.G257C	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	537					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TGCCGATTACCAACAGCTGGA	0.428													ENSG00000111554																																					0													108.0	106.0	107.0					12																	68707424		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.1609+1G>T	12.37:g.68707424C>A			B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Missense_Mutation	SNP	NULL	p.G537C	ENST00000303145.7	37	c.1609	CCDS8983.1	12	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038576	0.75617	.	.	ENSG00000111554	ENST00000540418;ENST00000303145;ENST00000411698	T;T;T	0.31247	1.5;1.5;1.5	4.98	4.98	0.66077	.	0.053455	0.85682	D	0.000000	T	0.57548	0.2061	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.58601	-0.7608	9	.	.	.	-14.5683	18.6391	0.91389	0.0:1.0:0.0:0.0	.	502;537	E7EPQ3;Q8TC05	.;MDM1_HUMAN	C	257;537;502	ENSP00000443815:G257C;ENSP00000302537:G537C;ENSP00000391006:G502C	.	G	-	1	0	MDM1	66993691	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	5.764000	0.68826	2.481000	0.83766	0.484000	0.47621	GGT	-	MDM1	-	NULL		0.428	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDM1	HGNC	protein_coding	OTTHUMT00000402402.1	0	0	0	44	44	121	0.00	0.00	C	NM_020128	Missense_Mutation	68707424	-1	49	60	34	53	tier1	no_errors	ENST00000303145	ensembl	human	known	74_37	missense	59.04	53.10	SNP	1.000	A	49	34
AGRN	375790	genome.wustl.edu	37	1	982235	982235	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:982235C>A	ENST00000379370.2	+	19	3336	c.3286C>A	c.(3286-3288)Cct>Act	p.P1096T		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	1096	Gly/Ser-rich.|Ser/Thr-rich.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CGTGGCCACCCCTGGGCCACC	0.697													ENSG00000188157																																					0													20.0	21.0	20.0					1																	982235		2192	4283	6475	SO:0001583	missense	0			-	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.3286C>A	1.37:g.982235C>A	ENSP00000368678:p.Pro1096Thr		Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.P1096T	ENST00000379370.2	37	c.3286	CCDS30551.1	1	.	.	.	.	.	.	.	.	.	.	C	1.566	-0.535312	0.04082	.	.	ENSG00000188157	ENST00000379370	T	0.75050	-0.9	4.19	3.25	0.37280	.	0.757532	0.10976	N	0.613274	T	0.56731	0.2005	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.41413	-0.9510	10	0.02654	T	1	0.0761	8.3323	0.32193	0.1772:0.6514:0.1714:0.0	.	1096	O00468	AGRIN_HUMAN	T	1096	ENSP00000368678:P1096T	ENSP00000368678:P1096T	P	+	1	0	AGRN	972098	0.035000	0.19736	0.018000	0.16275	0.050000	0.14768	1.486000	0.35530	0.938000	0.37419	0.561000	0.74099	CCT	-	AGRN	-	NULL		0.697	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	0	0	0	42	42	26	0.00	0.00	C	NM_198576		982235	+1	25	6	75	8	tier1	no_errors	ENST00000379370	ensembl	human	known	74_37	missense	25.00	42.86	SNP	0.410	A	25	75
C9orf16	79095	genome.wustl.edu	37	9	130922685	130922685	+	5'UTR	SNP	C	C	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr9:130922685C>G	ENST00000372994.1	+	0	147				C9orf16_ENST00000492588.1_3'UTR	NM_024112.3	NP_077017.1	Q9BUW7	CI016_HUMAN	chromosome 9 open reading frame 16											ovary(1)	1		Myeloproliferative disorder(762;0.0511)		GBM - Glioblastoma multiforme(294;0.0294)		CCCGAGCCCGCAATGTCGGGC	0.731													ENSG00000171159																																					0													8.0	10.0	9.0					9																	130922685		1686	3102	4788	SO:0001623	5_prime_UTR_variant	0			-	AK022885	CCDS6893.1	9q34.1	2012-03-06			ENSG00000171159	ENSG00000171159			17823	protein-coding gene	gene with protein product						10369878	Standard	NM_024112		Approved	EST00098, FLJ12823, MGC4639	uc004btp.1	Q9BUW7	OTTHUMG00000020731	ENST00000372994.1:c.-2C>G	9.37:g.130922685C>G			Q5SYV8|Q9Y3F7	R	SNP	-	NULL	ENST00000372994.1	37	NULL	CCDS6893.1	9																																																																																			-	C9orf16	-	-		0.731	C9orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf16	HGNC	protein_coding	OTTHUMT00000054351.1	0	0	0	23	23	5	0.00	0.00	C	NM_024112		130922685	+1	12	3	20	1	tier1	no_errors	ENST00000489240	ensembl	human	known	74_37	rna	37.50	75.00	SNP	0.959	G	12	20
MAGEA4	4103	genome.wustl.edu	37	X	151092443	151092443	+	Missense_Mutation	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chrX:151092443G>C	ENST00000360243.2	+	3	574	c.307G>C	c.(307-309)Gag>Cag	p.E103Q	MAGEA4_ENST00000276344.2_Missense_Mutation_p.E103Q|MAGEA4_ENST00000370335.1_Missense_Mutation_p.E103Q|MAGEA4_ENST00000370340.3_Missense_Mutation_p.E103Q|MAGEA4_ENST00000393921.1_Missense_Mutation_p.E103Q|MAGEA4_ENST00000393920.1_Missense_Mutation_p.E103Q|MAGEA4_ENST00000370337.4_Missense_Mutation_p.E103Q	NM_001011550.1	NP_001011550.1	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	103										breast(2)|central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)	27	Acute lymphoblastic leukemia(192;6.56e-05)					GCCTGACGCAGAGTCCTTGTT	0.542													ENSG00000147381																																					0													76.0	69.0	72.0					X																	151092443		2203	4300	6503	SO:0001583	missense	0			-		CCDS14702.1	Xq28	2009-03-13			ENSG00000147381	ENSG00000147381			6802	protein-coding gene	gene with protein product	"""melanoma-associated antigen 4"", ""cancer/testis antigen family 1, member 4"""	300175		MAGE4		8575766	Standard	XM_005274677		Approved	MAGE4A, MAGE4B, MAGE-41, MAGE-X2, MGC21336, CT1.4	uc004ffa.3	P43358	OTTHUMG00000024174	ENST00000360243.2:c.307G>C	X.37:g.151092443G>C	ENSP00000353379:p.Glu103Gln		Q14798	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E103Q	ENST00000360243.2	37	c.307	CCDS14702.1	X	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864238	0.32977	.	.	ENSG00000147381	ENST00000431963;ENST00000276344;ENST00000448295;ENST00000393921;ENST00000430273;ENST00000370337;ENST00000441865;ENST00000393920;ENST00000370340;ENST00000416020;ENST00000425182;ENST00000457310;ENST00000370335;ENST00000360243;ENST00000431971	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.02944	4.1;4.56;4.26;4.56;4.28;4.56;4.28;4.56;4.56;4.26;4.26;4.28;4.56;4.56;4.28	2.43	-0.505	0.11993	.	2.973990	0.00982	N	0.003393	T	0.11324	0.0276	M	0.81112	2.525	0.09310	N	1	D	0.65815	0.995	P	0.57720	0.826	T	0.15925	-1.0420	10	0.62326	D	0.03	.	2.9238	0.05778	0.318:0.2367:0.4453:0.0	.	103	P43358	MAGA4_HUMAN	Q	103	ENSP00000387777:E103Q;ENSP00000276344:E103Q;ENSP00000391904:E103Q;ENSP00000377498:E103Q;ENSP00000394149:E103Q;ENSP00000359362:E103Q;ENSP00000402624:E103Q;ENSP00000377497:E103Q;ENSP00000359365:E103Q;ENSP00000394073:E103Q;ENSP00000400900:E103Q;ENSP00000402186:E103Q;ENSP00000359360:E103Q;ENSP00000353379:E103Q;ENSP00000390096:E103Q	ENSP00000276344:E103Q	E	+	1	0	MAGEA4	150843099	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.055000	0.11807	-0.270000	0.09285	-0.312000	0.09012	GAG	-	MAGEA4	-	NULL		0.542	MAGEA4-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA4	HGNC	protein_coding	OTTHUMT00000060898.1	0	0	0	21	21	41	0.00	0.00	G	NM_002362		151092443	+1	39	20	8	5	tier1	no_errors	ENST00000276344	ensembl	human	known	74_37	missense	82.98	80.00	SNP	0.000	C	39	8
SEC14L5	9717	genome.wustl.edu	37	16	5047002	5047002	+	Silent	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr16:5047002G>C	ENST00000251170.7	+	8	1107	c.927G>C	c.(925-927)ctG>ctC	p.L309L		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	309	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						CCCCTGCCCTGCTGGAGGAGT	0.592													ENSG00000103184																																					0													28.0	28.0	28.0					16																	5047002		1921	4106	6027	SO:0001819	synonymous_variant	0			-	AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.927G>C	16.37:g.5047002G>C				Silent	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.L309	ENST00000251170.7	37	c.927	CCDS45403.1	16																																																																																			-	SEC14L5	-	superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom		0.592	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	0	0	0	39	39	48	0.00	0.00	G			5047002	+1	23	19	2	6	tier1	no_errors	ENST00000251170	ensembl	human	known	74_37	silent	92.00	76.00	SNP	0.690	C	23	2
TAF1C	9013	genome.wustl.edu	37	16	84212906	84212906	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr16:84212906T>C	ENST00000567759.1	-	14	2433	c.2251A>G	c.(2251-2253)Aag>Gag	p.K751E	TAF1C_ENST00000566732.1_Missense_Mutation_p.K725E|TAF1C_ENST00000570117.1_Missense_Mutation_p.K419E|TAF1C_ENST00000541676.1_Missense_Mutation_p.K658E|TAF1C_ENST00000378541.4_Missense_Mutation_p.K751E|TAF1C_ENST00000341690.6_Missense_Mutation_p.K657E	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	751					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						GTCCGGCGCTTGGGCCGCCTG	0.687													ENSG00000103168																																					0													15.0	18.0	17.0					16																	84212906		2190	4284	6474	SO:0001583	missense	0			-	L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.2251A>G	16.37:g.84212906T>C	ENSP00000455265:p.Lys751Glu		B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.K751E	ENST00000567759.1	37	c.2251	CCDS32496.1	16	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822805	0.71028	.	.	ENSG00000103168	ENST00000378541;ENST00000541676;ENST00000341690;ENST00000544090	T;T;T	0.02552	4.25;4.25;4.25	5.14	3.97	0.46021	.	0.000000	0.64402	D	0.000004	T	0.11410	0.0278	M	0.70595	2.14	0.28028	N	0.934266	D;D;D;D	0.71674	0.996;0.996;0.998;0.996	D;D;D;D	0.80764	0.99;0.99;0.994;0.987	T	0.01027	-1.1476	10	0.87932	D	0	-29.3976	8.3287	0.32173	0.0:0.0:0.2001:0.7999	.	725;274;751;657	Q15572-6;F5H0H4;Q15572;Q15572-2	.;.;TAF1C_HUMAN;.	E	751;658;657;274	ENSP00000367802:K751E;ENSP00000437900:K658E;ENSP00000345305:K657E	ENSP00000345305:K657E	K	-	1	0	TAF1C	82770407	0.011000	0.17503	1.000000	0.80357	0.885000	0.51271	0.185000	0.16958	1.935000	0.56089	0.459000	0.35465	AAG	-	TAF1C	-	NULL		0.687	TAF1C-001	KNOWN	basic|CCDS	protein_coding	TAF1C	HGNC	protein_coding	OTTHUMT00000433045.2	0	0	0	14	14	9	0.00	0.00	T	NM_139353		84212906	-1	11	7	13	8	tier1	no_errors	ENST00000378541	ensembl	human	known	74_37	missense	45.83	46.67	SNP	0.996	C	11	13
TKTL1	8277	genome.wustl.edu	37	X	153537793	153537793	+	Splice_Site	SNP	A	A	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chrX:153537793A>T	ENST00000369915.3	+	3	538	c.349A>T	c.(349-351)Agc>Tgc	p.S117C	TKTL1_ENST00000369912.2_Splice_Site_p.S61C|TKTL1_ENST00000217905.7_Intron	NM_001145933.1|NM_012253.3	NP_001139405.1|NP_036385.3	P51854	TKTL1_HUMAN	transketolase-like 1	117					glucose catabolic process (GO:0006007)|thiamine metabolic process (GO:0006772)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|transketolase activity (GO:0004802)			NS(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(5)|prostate(1)|skin(1)|urinary_tract(2)	34	all_cancers(53;5.05e-16)|all_epithelial(53;1.82e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGACAGGGCCAGGTGAGGTTC	0.547													ENSG00000007350																																					0													218.0	183.0	195.0					X																	153537793		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X91817	CCDS35448.1, CCDS55541.1	Xq28	2008-02-05			ENSG00000007350	ENSG00000007350			11835	protein-coding gene	gene with protein product		300044				8838793	Standard	NM_012253		Approved	TKR, TKT2	uc004fkg.3	P51854	OTTHUMG00000022707	ENST00000369915.3:c.350+1A>T	X.37:g.153537793A>T			A8K896|Q5TYJ8|Q5TYJ9|Q8TC75	Missense_Mutation	SNP	pfam_Transketolase_N,pfam_Transketolase-like_Pyr-bd,pfam_Transketolase_C,pfam_DH_E1,superfamily_Transketo_C/Pyr-ferredox_oxred,smart_Transketolase-like_Pyr-bd	p.S117C	ENST00000369915.3	37	c.349	CCDS35448.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.43|15.43	2.829948|2.829948	0.50845|0.50845	.|.	.|.	ENSG00000007350|ENSG00000007350	ENST00000426203|ENST00000369915;ENST00000441970;ENST00000426989;ENST00000369912	.|T;T;T	.|0.23950	.|1.88;1.88;1.88	4.5|4.5	4.5|4.5	0.54988|0.54988	.|Transketolase, N-terminal (1);	.|0.140596	.|0.64402	.|D	.|0.000006	T|T	0.63307|0.63307	0.2500|0.2500	H|H	0.96576|0.96576	3.845|3.845	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.995;0.997	T|T	0.75150|0.75150	-0.3419|-0.3419	5|10	.|0.66056	.|D	.|0.02	-16.5361|-16.5361	12.1167|12.1167	0.53870|0.53870	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|111;117	.|B7Z7I0;P51854	.|.;TKTL1_HUMAN	L|C	99|117;61;117;61	.|ENSP00000358931:S117C;ENSP00000401111:S117C;ENSP00000358928:S61C	.|ENSP00000358928:S61C	Q|S	+|+	2|1	0|0	TKTL1|TKTL1	153190987|153190987	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.204000|0.204000	0.24138|0.24138	6.983000|6.983000	0.76180|0.76180	1.773000|1.773000	0.52216|0.52216	0.486000|0.486000	0.48141|0.48141	CAG|AGC	-	TKTL1	-	pfam_Transketolase_N,pfam_DH_E1		0.547	TKTL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TKTL1	HGNC	protein_coding	OTTHUMT00000058923.1	0	0	0	31	31	47	0.00	0.00	A	NM_012253	Missense_Mutation	153537793	+1	20	30	9	3	tier1	no_errors	ENST00000369915	ensembl	human	known	74_37	missense	68.97	90.91	SNP	1.000	T	20	9
TMCO3	55002	genome.wustl.edu	37	13	114150047	114150047	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr13:114150047C>T	ENST00000434316.2	+	2	510	c.151C>T	c.(151-153)Cgg>Tgg	p.R51W	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Missense_Mutation_p.R51W	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	51						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			GCAGTGGGTCCGGGACAGCTG	0.617													ENSG00000150403																																					0													34.0	35.0	35.0					13																	114150047		2203	4300	6503	SO:0001583	missense	0			-	BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.151C>T	13.37:g.114150047C>T	ENSP00000389399:p.Arg51Trp		Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	pfam_Cation/H_exchanger	p.R51W	ENST00000434316.2	37	c.151	CCDS9537.1	13	.	.	.	.	.	.	.	.	.	.	C	7.965	0.747719	0.15710	.	.	ENSG00000150403	ENST00000434316;ENST00000375391	T	0.30981	1.51	5.46	3.67	0.42095	.	0.465345	0.23256	N	0.050188	T	0.12561	0.0305	N	0.08118	0	0.09310	N	1	P;P	0.46457	0.807;0.878	B;B	0.37650	0.255;0.112	T	0.09975	-1.0650	10	0.54805	T	0.06	-13.9298	3.954	0.09382	0.1206:0.508:0.2342:0.1373	.	51;51	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	W	51	ENSP00000389399:R51W	ENSP00000364540:R51W	R	+	1	2	TMCO3	113198048	0.004000	0.15560	0.011000	0.14972	0.311000	0.27955	0.047000	0.14056	0.635000	0.30488	0.555000	0.69702	CGG	-	TMCO3	-	NULL		0.617	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3	0	0	0	53	53	49	0.00	0.00	C	NM_017905		114150047	+1	34	11	5	9	tier1	no_errors	ENST00000434316	ensembl	human	known	74_37	missense	87.18	55.00	SNP	0.000	T	34	5
AOC4P	90586	genome.wustl.edu	37	17	41020025	41020025	+	RNA	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr17:41020025T>C	ENST00000585538.1	+	0	864					NR_002773.1				amine oxidase, copper containing 4, pseudogene																		CCACGTGGGCTTGGAGCTGCT	0.607													ENSG00000260105																																					0																																												0			-			17q21.31	2013-06-19			ENSG00000260105	ENSG00000260105			48869	pseudogene	pseudogene						20013028	Standard	NR_002773		Approved				OTTHUMG00000176596		17.37:g.41020025T>C				R	SNP	-	NULL	ENST00000585538.1	37	NULL		17																																																																																			-	AOC4P	-	-		0.607	AOC4P-006	KNOWN	basic	processed_transcript	AOC4P	HGNC	pseudogene	OTTHUMT00000452449.1	0	0	0	43	43	85	0.00	0.00	T			41020025	+1	7	4	31	55	tier1	no_errors	ENST00000562301	ensembl	human	known	74_37	rna	18.42	6.78	SNP	0.632	C	7	31
SAP130	79595	genome.wustl.edu	37	2	128783869	128783869	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr2:128783869C>T	ENST00000259235.3	-	2	205	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	SAP130_ENST00000357702.5_Missense_Mutation_p.E26K|SAP130_ENST00000259234.6_5'UTR	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	26					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		GAACTCATTTCCACCTGTAGT	0.418													ENSG00000136715																																					0													75.0	79.0	78.0					2																	128783869		2203	4300	6503	SO:0001583	missense	0			-	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.76G>A	2.37:g.128783869C>T	ENSP00000259235:p.Glu26Lys		B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.E26K	ENST00000259235.3	37	c.76	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	C	18.54	3.647087	0.67358	.	.	ENSG00000136715	ENST00000357702;ENST00000259235	.	.	.	5.2	5.2	0.72013	.	0.121256	0.53938	D	0.000045	T	0.46678	0.1405	N	0.04508	-0.205	0.38795	D	0.955063	D;D	0.67145	0.996;0.996	D;D	0.73708	0.981;0.981	T	0.42565	-0.9444	9	0.06757	T	0.87	.	15.6615	0.77190	0.0:1.0:0.0:0.0	.	26;26	B7ZLM3;Q9H0E3	.;SP130_HUMAN	K	26	.	ENSP00000259235:E26K	E	-	1	0	SAP130	128500339	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.722000	0.61958	2.422000	0.82143	0.555000	0.69702	GAA	-	SAP130	-	NULL		0.418	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3	0	0	0	87	87	77	0.00	0.00	C	NM_024545		128783869	-1	17	7	95	79	tier1	no_errors	ENST00000357702	ensembl	human	known	74_37	missense	15.18	8.14	SNP	1.000	T	17	95
LRP2	4036	genome.wustl.edu	37	2	170060691	170060691	+	Silent	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr2:170060691G>C	ENST00000263816.3	-	42	8091	c.7806C>G	c.(7804-7806)ggC>ggG	p.G2602G		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2602					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AAATATACTGGCCATAGAGAG	0.453													ENSG00000081479																																					0													152.0	162.0	159.0					2																	170060691		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7806C>G	2.37:g.170060691G>C			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.G2602	ENST00000263816.3	37	c.7806	CCDS2232.1	2																																																																																			-	LRP2	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.453	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	0	0	0	36	36	75	0.00	0.00	G	NM_004525		170060691	-1	6	4	45	50	tier1	no_errors	ENST00000263816	ensembl	human	known	74_37	silent	11.76	7.41	SNP	0.992	C	6	45
ZSCAN23	222696	genome.wustl.edu	37	6	28403655	28403655	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr6:28403655A>G	ENST00000289788.4	-	2	534	c.389T>C	c.(388-390)cTg>cCg	p.L130P	ZSCAN23_ENST00000486481.1_Intron	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	130	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						TGGGTCATCCAGCTCTCTCTC	0.532													ENSG00000187987																																					0													100.0	89.0	92.0					6																	28403655		692	1591	2283	SO:0001583	missense	0			-	AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.389T>C	6.37:g.28403655A>G	ENSP00000289788:p.Leu130Pro		Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L130P	ENST00000289788.4	37	c.389	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	A	13.02	2.112263	0.37242	.	.	ENSG00000187987	ENST00000289788	T	0.05996	3.36	3.62	3.62	0.41486	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.36200	N	0.002739	T	0.10981	0.0268	M	0.69185	2.1	0.53005	D	0.999964	P;D	0.89917	0.72;1.0	P;D	0.74674	0.447;0.984	T	0.01839	-1.1263	10	0.39692	T	0.17	.	8.921	0.35612	1.0:0.0:0.0:0.0	.	130;130	G3V1D5;Q3MJ62	.;ZSC23_HUMAN	P	130	ENSP00000289788:L130P	ENSP00000289788:L130P	L	-	2	0	ZSCAN23	28511634	0.999000	0.42202	1.000000	0.80357	0.802000	0.45316	1.219000	0.32479	1.855000	0.53841	0.455000	0.32223	CTG	-	ZSCAN23	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.532	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	0	0	0	30	30	73	0.00	0.00	A	XM_167147		28403655	-1	8	4	49	58	tier1	no_errors	ENST00000289788	ensembl	human	known	74_37	missense	14.04	6.45	SNP	1.000	G	8	49
MAN1C1	57134	genome.wustl.edu	37	1	26085135	26085135	+	Missense_Mutation	SNP	G	G	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:26085135G>C	ENST00000374332.4	+	6	1312	c.982G>C	c.(982-984)Gga>Cga	p.G328R	MAN1C1_ENST00000473891.1_3'UTR|MAN1C1_ENST00000263979.3_Missense_Mutation_p.G148R|MAN1C1_ENST00000374329.1_Missense_Mutation_p.G99R	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	328					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		GGCGGAGTTTGGATCCCTGCA	0.592													ENSG00000117643																																					0													95.0	86.0	89.0					1																	26085135		2203	4300	6503	SO:0001583	missense	0			-	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.982G>C	1.37:g.26085135G>C	ENSP00000363452:p.Gly328Arg		A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.G328R	ENST00000374332.4	37	c.982	CCDS265.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843600	0.91197	.	.	ENSG00000117643	ENST00000374332;ENST00000374331;ENST00000263979;ENST00000374329	T;T;T	0.79940	-1.32;-1.32;-1.32	4.71	4.71	0.59529	.	0.112708	0.64402	D	0.000011	D	0.94453	0.8215	H	0.99435	4.565	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96910	0.9666	10	0.87932	D	0	.	16.4228	0.83772	0.0:0.0:1.0:0.0	.	328	Q9NR34	MA1C1_HUMAN	R	328;148;148;99	ENSP00000363452:G328R;ENSP00000263979:G148R;ENSP00000363449:G99R	ENSP00000263979:G148R	G	+	1	0	MAN1C1	25957722	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	8.949000	0.93012	2.447000	0.82792	0.655000	0.94253	GGA	-	MAN1C1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47		0.592	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1C1	HGNC	protein_coding	OTTHUMT00000012828.3	0	0	0	74	74	104	0.00	0.00	G	NM_020379		26085135	+1	23	7	121	76	tier1	no_errors	ENST00000374332	ensembl	human	known	74_37	missense	15.97	8.43	SNP	1.000	C	23	121
KHDRBS1	10657	genome.wustl.edu	37	1	32508537	32508537	+	3'UTR	DEL	A	A	-			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:32508537delA	ENST00000327300.7	+	0	1811				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GAAGTTGAGTAAAAAAAAAAA	0.254													ENSG00000121774																									Ovarian(173;401 1982 12359 31110 42403)												0																																										SO:0001624	3_prime_UTR_variant	0				U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*312A>-	1.37:g.32508537delA				R	DEL	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																				KHDRBS1	-	-		0.254	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	0	0	1	32	32	52	0.00	1.89	A	NM_006559		32508537	+1	10	5	61	69	tier1	no_errors	ENST00000307714	ensembl	human	known	74_37	rna	14.08	6.76	DEL	0.903	-	10	61
ITGA10	8515	genome.wustl.edu	37	1	145528030	145528030	+	Silent	SNP	C	C	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr1:145528030C>A	ENST00000369304.3	+	3	442	c.267C>A	c.(265-267)ggC>ggA	p.G89G	ITGA10_ENST00000539363.1_Intron|ITGA10_ENST00000538811.1_Intron	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	89					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GTGCCAAGGGCCACTTAGGTG	0.582													ENSG00000143127																																					0													8.0	10.0	10.0					1																	145528030		2178	4280	6458	SO:0001819	synonymous_variant	0			-	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.267C>A	1.37:g.145528030C>A			B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.G89	ENST00000369304.3	37	c.267	CCDS918.1	1																																																																																			-	ITGA10	-	smart_Int_alpha_beta-p		0.582	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	0	0	0	38	38	70	0.00	0.00	C	NM_003637		145528030	+1	10	7	63	83	tier1	no_errors	ENST00000369304	ensembl	human	known	74_37	silent	13.70	7.69	SNP	0.999	A	10	63
SIMC1	375484	genome.wustl.edu	37	5	175717627	175717627	+	Missense_Mutation	SNP	C	C	T	rs151017862	byFrequency	TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr5:175717627C>T	ENST00000443967.1	+	4	1450	c.1043C>T	c.(1042-1044)cCa>cTa	p.P348L	SIMC1_ENST00000430704.2_Intron|SIMC1_ENST00000341199.6_Intron|SIMC1_ENST00000429602.2_Missense_Mutation_p.P367L			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	348	Pro-rich.						SUMO polymer binding (GO:0032184)										CCTCACTTACCAGGAGACAGG	0.532													ENSG00000170085																																					0													285.0	278.0	280.0					5																	175717627		2203	4300	6503	SO:0001583	missense	0			-	BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.1043C>T	5.37:g.175717627C>T	ENSP00000406571:p.Pro348Leu		J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	NULL	p.P348L	ENST00000443967.1	37	c.1043		5	.	.	.	.	.	.	.	.	.	.	C	9.554	1.116768	0.20795	.	.	ENSG00000170085	ENST00000443967;ENST00000429602;ENST00000377277	T;T	0.33654	2.16;1.4	3.8	3.8	0.43715	.	0.628470	0.14812	N	0.296964	T	0.37598	0.1009	.	.	.	0.09310	N	1	P;P	0.51351	0.944;0.939	P;P	0.47044	0.461;0.535	T	0.16867	-1.0388	9	0.49607	T	0.09	-8.6317	11.3891	0.49804	0.0:1.0:0.0:0.0	.	367;348	B4DRM7;Q8NDZ2	.;CE025_HUMAN	L	348;367;259	ENSP00000406571:P348L;ENSP00000410552:P367L	ENSP00000366489:P259L	P	+	2	0	C5orf25	175650233	0.001000	0.12720	0.004000	0.12327	0.020000	0.10135	0.748000	0.26305	2.116000	0.64780	0.603000	0.83216	CCA	rs151017862	SIMC1	-	NULL		0.532	SIMC1-001	KNOWN	basic	protein_coding	SIMC1	HGNC	protein_coding	OTTHUMT00000253155.2	0	0	2	42	42	102	0.00	1.92	C	NM_198567		175717627	+1	12	12	45	43	tier1	no_errors	ENST00000443967	ensembl	human	known	74_37	missense	21.05	21.82	SNP	0.007	T	12	45
ANKRD12	23253	genome.wustl.edu	37	18	9256918	9256918	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr18:9256918C>T	ENST00000262126.4	+	9	3893	c.3653C>T	c.(3652-3654)aCt>aTt	p.T1218I	RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000383440.2_Missense_Mutation_p.T1195I|ANKRD12_ENST00000400020.3_Missense_Mutation_p.T1195I	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1218						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TCCTGCCATACTACAGTGACA	0.433													ENSG00000101745																																					0													67.0	70.0	69.0					18																	9256918		2202	4300	6502	SO:0001583	missense	0			-	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3653C>T	18.37:g.9256918C>T	ENSP00000262126:p.Thr1218Ile		O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T1218I	ENST00000262126.4	37	c.3653	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356377	0.61293	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.76839	-1.04;-1.05	5.42	4.55	0.56014	.	0.053493	0.85682	D	0.000000	T	0.79947	0.4534	M	0.68593	2.085	0.39339	D	0.965541	P;P	0.46220	0.874;0.8	P;B	0.45712	0.491;0.296	D	0.83586	0.0120	10	0.87932	D	0	-11.1357	15.5511	0.76152	0.1393:0.8607:0.0:0.0	.	1195;1218	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	I	1195;1218	ENSP00000372932:T1195I;ENSP00000262126:T1218I	ENSP00000262126:T1218I	T	+	2	0	ANKRD12	9246918	1.000000	0.71417	0.533000	0.28001	0.967000	0.64934	7.235000	0.78143	1.271000	0.44313	0.655000	0.94253	ACT	-	ANKRD12	-	NULL		0.433	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	0	0	2	45	45	111	0.00	1.77	C	NM_015208		9256918	+1	25	27	44	49	tier1	no_errors	ENST00000262126	ensembl	human	known	74_37	missense	36.23	35.53	SNP	0.998	T	25	44
PDE6A	5145	genome.wustl.edu	37	5	149245772	149245772	+	Silent	SNP	T	T	C			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr5:149245772T>C	ENST00000255266.5	-	20	2438	c.2319A>G	c.(2317-2319)caA>caG	p.Q773Q		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	773					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	TGAAGCCGACTTGAAGCTTAG	0.468													ENSG00000132915																																					0													177.0	162.0	167.0					5																	149245772		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.2319A>G	5.37:g.149245772T>C			Q0P638	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.Q773	ENST00000255266.5	37	c.2319	CCDS4299.1	5																																																																																			-	PDE6A	-	pfam_PDEase_catalytic_dom		0.468	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6A	HGNC	protein_coding	OTTHUMT00000252326.2	0	0	2	57	57	142	0.00	1.39	T			149245772	-1	34	35	42	46	tier1	no_errors	ENST00000255266	ensembl	human	known	74_37	silent	44.74	43.21	SNP	1.000	C	34	42
FAM157B	100132403	genome.wustl.edu	37	9	141124247	141124247	+	lincRNA	SNP	A	A	G	rs543632557	byFrequency	TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr9:141124247A>G	ENST00000446912.2	+	0	906							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		actccggtatattgtactgaa	0.423													ENSG00000233013	.|||	645	0.128794	0.0953	0.1239	5008	,	,		17533	0.1508		0.0855	False		,,,				2504	0.1994																0													2.0	2.0	2.0					9																	141124247		340	623	963			0			-			9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141124247A>G				R	SNP	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			-	FAM157B	-	-		0.423	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	0	0	0	47	47	27	0.00	0.00	A	NM_001145249		141124247	+1	4	0	4	6	tier1	no_errors	ENST00000540522	ensembl	human	known	74_37	rna	50.00	0.00	SNP	0.024	G	4	4
CARD10	29775	genome.wustl.edu	37	22	37906308	37906309	+	In_Frame_Ins	INS	-	-	CTCCTT	rs113275238|rs60611523|rs574761780	byFrequency	TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr22:37906308_37906309insCTCCTT	ENST00000403299.1	-	5	1035_1036	c.819_820insAAGGAG	c.(817-822)gagcca>gagAAGGAGcca	p.272_273insEK	CARD10_ENST00000494166.1_5'UTR|CARD10_ENST00000406271.3_5'Flank|CARD10_ENST00000251973.5_In_Frame_Ins_p.272_273insEK			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	272					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					ACATTGTCTGGctccttctcct	0.634													ENSG00000100065																																					0																																										SO:0001652	inframe_insertion	0				AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.814_819dupAAGGAG	22.37:g.37906309_37906314dupCTCCTT	ENSP00000384570:p.Glu271_Lys272dup		Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	In_Frame_Ins	INS	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.273in_frame_insKE	ENST00000403299.1	37	c.820_819	CCDS13948.1	22																																																																																				CARD10	-	NULL		0.634	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	HGNC	protein_coding	OTTHUMT00000318997.1	0	0	0	1	1	1	0.00	0.00	-	NM_014550		37906309	-1	0	0	3	3	tier1	no_errors	ENST00000251973	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	0.840:0.939	CTCCTT	0	3
MT-ND2	4536	genome.wustl.edu	37	M	1978	1978	+	5'Flank	SNP	A	A	G			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chrM:1978A>G	ENST00000361453.3	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						GTGGGAAGATTTATAGGTAGA	0.448													ENSG00000210082																																					0																																										SO:0001631	upstream_gene_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891			M.37:g.1978A>G	Exception_encountered		Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	R	SNP	-	NULL	ENST00000361453.3	37	NULL		MT																																																																																			-	MT-RNR2	-	-		0.448	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR2	HGNC	protein_coding		0	0	0	42	42	2	0.00	0.00	A	YP_003024027		1978	+1	2	0	10	0	tier1	no_errors	ENST00000387347	ensembl	human	known	74_37	rna	16.67	0.00	SNP	NULL	G	2	10
WISP2	8839	genome.wustl.edu	37	20	43343871	43343880	+	Intron	DEL	TGTGTGTGTG	TGTGTGTGTG	-			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	TGTGTGTGTG	TGTGTGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr20:43343871_43343880delTGTGTGTGTG	ENST00000372868.2	+	1	318				RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|WISP2_ENST00000190983.4_5'Flank|WISP2_ENST00000372865.4_5'UTR|RP11-445H22.4_ENST00000427303.1_RNA			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CTAgtgtgtttgtgtgtgtgtgtgtgtgtg	0.567													ENSG00000064205																																					0																																										SO:0001627	intron_variant	0				AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.-26+69TGTGTGTGTG>-	20.37:g.43343881_43343890delTGTGTGTGTG			B2R9N4|E1P612|Q6PEG3	R	DEL	-	NULL	ENST00000372868.2	37	NULL	CCDS13336.1	20																																																																																				WISP2	-	-		0.567	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1	0	0	0	0	0	0	0.00	0.00	TGTGTGTGTG	NM_003881		43343880	+1	0	0	0	0	tier1	no_errors	ENST00000497421	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.044:0.049:0.052:0.062:0.059:0.007:0.005:0.003:0.005:0.006	-	0	0
KIF16B	55614	genome.wustl.edu	37	20	16360001	16360001	+	Silent	SNP	G	G	A			TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr20:16360001G>A	ENST00000354981.2	-	19	2803	c.2646C>T	c.(2644-2646)gtC>gtT	p.V882V	KIF16B_ENST00000408042.1_Silent_p.V882V|KIF16B_ENST00000355755.3_Silent_p.V882V|KIF16B_ENST00000378003.2_Silent_p.V108V	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	882	Glu-rich.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						TGACATCTGTGACACTCTCAT	0.408													ENSG00000089177																																					0													124.0	121.0	122.0					20																	16360001		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.2646C>T	20.37:g.16360001G>A			A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Silent	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.V882	ENST00000354981.2	37	c.2646	CCDS13122.1	20																																																																																			-	KIF16B	-	NULL		0.408	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	0	0	0	35	35	83	0.00	0.00	G	NM_017683		16360001	-1	4	3	37	55	tier1	no_errors	ENST00000408042	ensembl	human	known	74_37	silent	9.76	5.08	SNP	0.000	A	4	37
ANXA1	301	genome.wustl.edu	37	9	75777685	75777724	+	Splice_Site	DEL	TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	-	rs575718527	byFrequency	TCGA-VT-A80G-01A-11D-A36J-09	TCGA-VT-A80G-11A-22D-A36M-09	TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	76a70cc5-3cd1-4f21-b3ec-b076e3f30b74	b47de334-7363-417c-bd01-3a1542efabc1	g.chr9:75777685_75777724delTCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	ENST00000376911.1	+	6	1357_1384	c.475_502delTCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	c.(475-504)tcttttttctcagaactgaagagagatctg>tg	p.SFFSELKRDL159fs	ANXA1_ENST00000257497.6_Splice_Site_p.SFFSELKRDL159fs			P04083	ANXA1_HUMAN	annexin A1	159					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	AATCTATTTTTCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGA	0.346													ENSG00000135046																																					0																																										SO:0001630	splice_region_variant	0				X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.476-1TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA>-	9.37:g.75777685_75777724delTCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA				Frame_Shift_Del	DEL	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinI	p.D178fs	ENST00000376911.1	37	c.489_502	CCDS6645.1	9																																																																																				ANXA1	-	pfam_Annexin_repeat,smart_Annexin_repeat		0.346	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	0	0	0	64	64	64	0.00	0.00	TCTTTTTTCTCAGAACTGAAGAGAGATCTGGCCAAAGACA	NM_000700	Frame_Shift_Del	75777724	+1	2	2	69	69	tier1	no_errors	ENST00000257497	ensembl	human	known	74_37	frame_shift_del	2.82	2.82	DEL	0.000:0.000:0.004:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.039:0.985:1.000:1.000:0.988:0.985:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000	-	2	69
