#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ROR2	4920	genome.wustl.edu	37	9	94484841	94484841	+	IGR	SNP	C	C	T	rs537571926		TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:94484841C>T	ENST00000375708.3	-	0	4096				ROR2_ENST00000550066.1_5'Flank|ROR2_ENST00000375715.1_Missense_Mutation_p.G648R	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CACTGCCTCCCGCTGCCTCGC	0.522													ENSG00000169071	C|||	1	0.000199681	0.0	0.0	5008	,	,		19093	0.001		0.0	False		,,,				2504	0.0																0													164.0	148.0	153.0					9																	94484841		876	1991	2867	SO:0001628	intergenic_variant	0			-	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211		9.37:g.94484841C>T			Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Kringle,pfam_Frizzled_dom,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G648R	ENST00000375708.3	37	c.1942	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	13.84	2.356590	0.41801	.	.	ENSG00000169071	ENST00000375715	T	0.77620	-1.11	3.35	-2.75	0.05914	.	.	.	.	.	T	0.61502	0.2352	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48222	-0.9054	8	0.52906	T	0.07	.	4.1206	0.10104	0.0:0.2857:0.338:0.3763	.	648	B1APY4	.	R	648	ENSP00000364867:G648R	ENSP00000364867:G648R	G	-	1	0	ROR2	93524662	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.260000	0.02858	-0.602000	0.05775	-0.379000	0.06801	GGG	-	ROR2	-	NULL		0.522	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	0	0	0	21	21	97	0.00	0.00	C			94484841	-1	6	23	21	131	tier1	no_errors	ENST00000375715	ensembl	human	putative	74_37	missense	22.22	14.94	SNP	0.000	T	6	21
MAGED1	9500	genome.wustl.edu	37	X	51638173	51638173	+	Missense_Mutation	SNP	G	G	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:51638173G>A	ENST00000375722.1	+	3	322	c.70G>A	c.(70-72)Gcc>Acc	p.A24T	MAGED1_ENST00000375695.2_Missense_Mutation_p.A80T|MAGED1_ENST00000326587.7_Missense_Mutation_p.A24T|MAGED1_ENST00000375772.3_Missense_Mutation_p.A24T|MAGED1_ENST00000494718.1_3'UTR			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	24					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					AGAAGACAGCGCCTTGCTTAT	0.592										Multiple Myeloma(10;0.10)			ENSG00000179222																																					0													34.0	33.0	34.0					X																	51638173		2203	4299	6502	SO:0001583	missense	0			-	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.70G>A	X.37:g.51638173G>A	ENSP00000364874:p.Ala24Thr		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.A80T	ENST00000375722.1	37	c.238	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	G	8.300	0.819649	0.16607	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695;ENST00000430189	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	3.85	-4.12	0.03916	.	1.317030	0.05432	N	0.546076	T	0.18341	0.0440	N	0.19112	0.55	0.23962	N	0.996331	B;B;B	0.34399	0.033;0.363;0.452	B;B;B	0.20577	0.005;0.03;0.019	T	0.11941	-1.0567	10	0.14656	T	0.56	.	4.3385	0.11097	0.4391:0.3276:0.2333:0.0	.	24;80;24	B4DQ04;Q9Y5V3-2;Q9Y5V3	.;.;MAGD1_HUMAN	T	24;24;24;80;24	ENSP00000364927:A24T;ENSP00000364874:A24T;ENSP00000325333:A24T;ENSP00000364847:A80T	ENSP00000325333:A24T	A	+	1	0	MAGED1	51654913	0.962000	0.33011	0.976000	0.42696	0.963000	0.63663	-0.387000	0.07361	-0.615000	0.05679	0.420000	0.28162	GCC	-	MAGED1	-	NULL		0.592	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	0	0	0	61	61	68	0.00	0.00	G	NM_001005332		51638173	+1	30	22	23	70	tier1	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	56.60	23.91	SNP	0.950	A	30	23
UBXN4	23190	genome.wustl.edu	37	2	136530072	136530072	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:136530072A>G	ENST00000272638.9	+	9	1216	c.905A>G	c.(904-906)cAg>cGg	p.Q302R	UBXN4_ENST00000490163.1_3'UTR	NM_014607.3	NP_055422.1	Q92575	UBXN4_HUMAN	UBX domain protein 4	302					response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	24						CTAGCAAAACAGGCAGAAATG	0.433													ENSG00000144224																																					0													74.0	71.0	72.0					2																	136530072		1870	4113	5983	SO:0001583	missense	0			-	D87684	CCDS42761.1	2q21.3-q22.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000144224	ENSG00000144224		"""UBX domain containing"""	14860	protein-coding gene	gene with protein product	"""erasin"""	611216	"""UBX domain-containing 2"", ""UBX domain containing 2"""	UBXDC1, UBXD2		16968747	Standard	NM_014607		Approved	KIAA0242	uc002tur.3	Q92575	OTTHUMG00000153577	ENST00000272638.9:c.905A>G	2.37:g.136530072A>G	ENSP00000272638:p.Gln302Arg		A8K9W4|Q4ZG56|Q8IYM5	Missense_Mutation	SNP	pfam_UBX,superfamily_Thioredoxin-like_fold,smart_UBX,pfscan_UBX	p.Q302R	ENST00000272638.9	37	c.905	CCDS42761.1	2	.	.	.	.	.	.	.	.	.	.	A	18.23	3.578236	0.65878	.	.	ENSG00000144224	ENST00000272638;ENST00000430594	T	0.13420	2.59	5.8	5.8	0.92144	.	0.117723	0.64402	D	0.000015	T	0.20861	0.0502	M	0.77616	2.38	0.58432	D	0.999995	B	0.14012	0.009	B	0.12837	0.008	T	0.03112	-1.1071	10	0.24483	T	0.36	.	16.1611	0.81712	1.0:0.0:0.0:0.0	.	302	Q92575	UBXN4_HUMAN	R	302;284	ENSP00000272638:Q302R	ENSP00000272638:Q302R	Q	+	2	0	UBXN4	136246542	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.112000	0.71547	2.213000	0.71641	0.477000	0.44152	CAG	-	UBXN4	-	NULL		0.433	UBXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN4	HGNC	protein_coding	OTTHUMT00000331696.1	0	0	0	61	61	79	0.00	0.00	A	NM_014607		136530072	+1	41	16	57	117	tier1	no_errors	ENST00000272638	ensembl	human	known	74_37	missense	41.84	12.03	SNP	1.000	G	41	57
HSPB6	126393	genome.wustl.edu	37	19	36244131	36244131	+	IGR	SNP	C	C	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:36244131C>G	ENST00000592984.1	-	0	1634				AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_Missense_Mutation_p.P141A|AC002398.12_ENST00000587767.1_RNA|AC002398.9_ENST00000591613.2_3'UTR			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTCACCCCTGCCCCCGCTGCC	0.657													ENSG00000267796																																					0													18.0	20.0	19.0					19																	36244131		2036	4145	6181	SO:0001628	intergenic_variant	0			-	AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36244131C>G			O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	NULL	p.P141A	ENST00000592984.1	37	c.421	CCDS12475.1	19	.	.	.	.	.	.	.	.	.	.	C	13.03	2.114324	0.37339	.	.	ENSG00000188223	ENST00000301159	T	0.40225	1.04	4.92	2.71	0.32032	.	0.053971	0.85682	D	0.000000	T	0.31979	0.0814	L	0.42686	1.345	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.09509	-1.0671	10	0.42905	T	0.14	-17.5835	8.3309	0.32187	0.1677:0.5072:0.3251:0.0	.	141	Q96GY3	LIN37_HUMAN	A	141	ENSP00000301159:P141A	ENSP00000301159:P141A	P	+	1	0	LIN37	40935971	0.996000	0.38824	0.857000	0.33713	0.989000	0.77384	2.626000	0.46460	0.627000	0.30340	0.561000	0.74099	CCC	-	LIN37	-	NULL		0.657	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN37	HGNC	protein_coding	OTTHUMT00000109498.3	0	0	0	58	58	9	0.00	0.00	C	NM_144617		36244131	+1	22	8	68	17	tier1	no_errors	ENST00000301159	ensembl	human	known	74_37	missense	24.44	32.00	SNP	0.901	G	22	68
FLG2	388698	genome.wustl.edu	37	1	152328366	152328366	+	Silent	SNP	G	G	C			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:152328366G>C	ENST00000388718.5	-	3	1968	c.1896C>G	c.(1894-1896)ggC>ggG	p.G632G	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	632	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCCATGTTGGCCATAGCCAG	0.502													ENSG00000143520																																					0													152.0	203.0	186.0					1																	152328366		2203	4297	6500	SO:0001819	synonymous_variant	0			-	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1896C>G	1.37:g.152328366G>C			Q9H4U1	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.G632	ENST00000388718.5	37	c.1896	CCDS30861.1	1																																																																																			-	FLG2	-	NULL		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	1	1	0	107	107	52	0.92	0.00	G	NM_001014342		152328366	-1	40	24	61	95	tier1	no_errors	ENST00000388718	ensembl	human	known	74_37	silent	39.22	20.00	SNP	0.000	C	40	61
LOC440700	440700	genome.wustl.edu	37	1	165677941	165677941	+	lincRNA	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:165677941C>T	ENST00000608512.1	-	0	0				RP11-466F5.6_ENST00000400982.2_RNA																							TACGTTATGGCTGTGATTCCT	0.537													ENSG00000215838																																					0																																												0			-																													1.37:g.165677941C>T				R	SNP	-	NULL	ENST00000608512.1	37	NULL		1																																																																																			-	RP11-466F5.6	-	-		0.537	RP11-466F5.10-001	KNOWN	basic	lincRNA	LOC440700	Clone_based_vega_gene	lincRNA	OTTHUMT00000473144.1	0	0	0	38	38	54	0.00	0.00	C			165677941	+1	10	20	2	65	tier1	no_errors	ENST00000400982	ensembl	human	known	74_37	rna	83.33	23.53	SNP	0.013	T	10	2
ARRDC1	92714	genome.wustl.edu	37	9	140507315	140507315	+	Intron	SNP	T	T	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:140507315T>A	ENST00000371421.4	+	2	182				ARRDC1_ENST00000491911.1_3'UTR|C9orf37_ENST00000496793.1_5'Flank	NM_152285.2	NP_689498.1	Q8N5I2	ARRD1_HUMAN	arrestin domain containing 1							cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.106)			OV - Ovarian serous cystadenocarcinoma(145;0.000273)|Epithelial(140;0.000464)		GGCCGTCGGCTGGCTGGGGCT	0.642													ENSG00000197070																																					0													35.0	32.0	33.0					9																	140507315		2203	4298	6501	SO:0001627	intron_variant	0			-	AJ420420	CCDS7049.1	9q34.3	2013-10-11			ENSG00000197070	ENSG00000197070			28633	protein-coding gene	gene with protein product	"""alpha-arrestin 1"""					23886940	Standard	XM_005266119		Approved	MGC40555	uc004cns.3	Q8N5I2	OTTHUMG00000020993	ENST00000371421.4:c.119-33T>A	9.37:g.140507315T>A				R	SNP	-	NULL	ENST00000371421.4	37	NULL	CCDS7049.1	9																																																																																			-	ARRDC1	-	-		0.642	ARRDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC1	HGNC	protein_coding	OTTHUMT00000055358.1	0	0	0	47	47	15	0.00	0.00	T	NM_152285		140507315	+1	6	4	16	27	tier1	no_errors	ENST00000491911	ensembl	human	known	74_37	rna	27.27	12.90	SNP	0.300	A	6	16
SASH1	23328	genome.wustl.edu	37	6	148846428	148846428	+	Splice_Site	SNP	G	G	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:148846428G>T	ENST00000367467.3	+	11	1686	c.1211G>T	c.(1210-1212)aGa>aTa	p.R404I	AL033378.1_ENST00000411390.2_RNA	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	404					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TTTCCACAGAGAACCTGCAGT	0.478													ENSG00000111961																																					0													222.0	202.0	209.0					6																	148846428		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.1210-1G>T	6.37:g.148846428G>T			Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.R404I	ENST00000367467.3	37	c.1211	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.438132	0.96168	.	.	ENSG00000111961	ENST00000367467;ENST00000535767	T	0.62639	0.01	5.63	5.63	0.86233	.	0.134101	0.64402	D	0.000002	T	0.76856	0.4046	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77770	-0.2463	10	0.87932	D	0	-26.0197	20.0442	0.97604	0.0:0.0:1.0:0.0	.	385;404	Q6P4R9;O94885	.;SASH1_HUMAN	I	404;165	ENSP00000356437:R404I	ENSP00000356437:R404I	R	+	2	0	SASH1	148888121	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.420000	0.97426	2.814000	0.96858	0.655000	0.94253	AGA	-	SASH1	-	pfam_rSAM/SH3_domain-containing		0.478	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042619.1	0	0	0	50	50	124	0.00	0.00	G	NM_015278	Missense_Mutation	148846428	+1	43	38	31	128	tier1	no_errors	ENST00000367467	ensembl	human	known	74_37	missense	58.11	22.89	SNP	1.000	T	43	31
ZCCHC12	170261	genome.wustl.edu	37	X	117960020	117960020	+	Silent	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:117960020C>T	ENST00000310164.2	+	4	1320	c.813C>T	c.(811-813)gaC>gaT	p.D271D		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	271					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						ATACCCTCGACGACTCCGATG	0.582													ENSG00000174460																																					0													91.0	77.0	82.0					X																	117960020		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.813C>T	X.37:g.117960020C>T			B3KV48|Q6PID5|Q8N1C1	Silent	SNP	superfamily_Znf_CCHC	p.D271	ENST00000310164.2	37	c.813	CCDS14574.1	X																																																																																			-	ZCCHC12	-	NULL		0.582	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	0	0	0	35	35	28	0.00	0.00	C	NM_173798		117960020	+1	11	13	5	40	tier1	no_errors	ENST00000310164	ensembl	human	known	74_37	silent	68.75	24.53	SNP	0.946	T	11	5
LRIT2	340745	genome.wustl.edu	37	10	85982349	85982349	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr10:85982349C>T	ENST00000372113.4	-	3	985	c.980G>A	c.(979-981)tGc>tAc	p.C327Y	LRIT2_ENST00000538192.1_Missense_Mutation_p.C337Y	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	327	Ig-like.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GGAGGCCATGCAGGTGTAATT	0.532													ENSG00000204033																																					0													84.0	72.0	76.0					10																	85982349		2203	4300	6503	SO:0001583	missense	0			-		CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.980G>A	10.37:g.85982349C>T	ENSP00000361185:p.Cys327Tyr		B7ZME6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C337Y	ENST00000372113.4	37	c.1010	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621890	0.66787	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;D	0.92647	-0.56;-3.08	5.41	4.51	0.55191	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.093122	0.85682	D	0.000000	D	0.97838	0.9290	H	0.99404	4.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98221	1.0478	10	0.87932	D	0	.	12.7105	0.57086	0.0:0.9189:0.0:0.0811	.	337;327	B7ZME6;A6NDA9	.;LRIT2_HUMAN	Y	327;337	ENSP00000361185:C327Y;ENSP00000438264:C337Y	ENSP00000361185:C327Y	C	-	2	0	LRIT2	85972329	1.000000	0.71417	0.782000	0.31804	0.651000	0.38670	5.801000	0.69115	1.277000	0.44412	0.557000	0.71058	TGC	-	LRIT2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.532	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	HGNC	protein_coding	OTTHUMT00000049110.4	0	0	0	37	37	102	0.00	0.00	C	XM_291697		85982349	-1	15	29	10	121	tier1	no_errors	ENST00000538192	ensembl	human	known	74_37	missense	60.00	19.21	SNP	0.998	T	15	10
AHNAK2	113146	genome.wustl.edu	37	14	105413459	105413459	+	Missense_Mutation	SNP	A	A	G	rs564635013	byFrequency	TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:105413459A>G	ENST00000333244.5	-	7	8448	c.8329T>C	c.(8329-8331)Tcc>Ccc	p.S2777P	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2777						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TCCATGCTGGACAGAGACATC	0.622													ENSG00000185567	.|||	4	0.000798722	0.0008	0.0014	5008	,	,		18641	0.002		0.0	False		,,,				2504	0.0																0													130.0	144.0	140.0					14																	105413459		1865	4082	5947	SO:0001583	missense	0			-	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8329T>C	14.37:g.105413459A>G	ENSP00000353114:p.Ser2777Pro		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S2777P	ENST00000333244.5	37	c.8329	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	a	7.528	0.658070	0.14645	.	.	ENSG00000185567	ENST00000333244	T	0.00569	6.52	3.54	2.58	0.30949	.	.	.	.	.	T	0.00109	0.0003	N	0.00007	-3.175	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41645	-0.9497	9	0.15499	T	0.54	.	2.901	0.05706	0.1059:0.1771:0.5352:0.1818	.	2777	Q8IVF2	AHNK2_HUMAN	P	2777	ENSP00000353114:S2777P	ENSP00000353114:S2777P	S	-	1	0	AHNAK2	104484504	0.137000	0.22531	0.010000	0.14722	0.014000	0.08584	0.922000	0.28734	0.020000	0.15106	-0.665000	0.03846	TCC	-	AHK2	-	NULL		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK2	HGNC	protein_coding	OTTHUMT00000410300.1	0	0	0	97	97	31	0.00	0.00	A	NM_138420		105413459	-1	60	4	67	22	tier1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	47.24	15.38	SNP	0.466	G	60	67
ADCY8	114	genome.wustl.edu	37	8	132051899	132051899	+	Silent	SNP	G	G	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:132051899G>A	ENST00000286355.5	-	1	2773	c.681C>T	c.(679-681)tgC>tgT	p.C227C	ADCY8_ENST00000377928.3_Silent_p.C227C	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	227					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)	p.C227C(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CCACCAGGGCGCAGATCACTA	0.627										HNSCC(32;0.087)			ENSG00000155897																																					1	Substitution - coding silent(1)	large_intestine(1)											61.0	58.0	59.0					8																	132051899		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.681C>T	8.37:g.132051899G>A				Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.C227	ENST00000286355.5	37	c.681	CCDS6363.1	8																																																																																			-	ADCY8	-	NULL		0.627	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	0	0	0	24	24	51	0.00	0.00	G			132051899	-1	12	28	10	85	tier1	no_errors	ENST00000286355	ensembl	human	known	74_37	silent	54.55	24.78	SNP	0.998	A	12	10
TP53	7157	genome.wustl.edu	37	17	7578393	7578393	+	Missense_Mutation	SNP	A	A	C			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr17:7578393A>C	ENST00000269305.4	-	5	726	c.537T>G	c.(535-537)caT>caG	p.H179Q	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.H179Q|TP53_ENST00000445888.2_Missense_Mutation_p.H179Q|TP53_ENST00000455263.2_Missense_Mutation_p.H179Q|TP53_ENST00000413465.2_Missense_Mutation_p.H179Q|TP53_ENST00000420246.2_Missense_Mutation_p.H179Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	179	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in LFS; germline mutation and in sporadic cancers; somatic mutation).|HH -> QS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H179Q(23)|p.P177_C182delPHHERC(8)|p.0?(8)|p.C176_R181delCPHHER(3)|p.R174fs*24(3)|p.H178_S183delHHERCS(3)|p.R175_E180delRCPHHE(3)|p.H179H(2)|p.P177fs*3(2)|p.V173fs*59(2)|p.H86Q(2)|p.H47Q(2)|p.C176fs*65(1)|p.P177_H179delPHH(1)|p.V173fs*23(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.H46_S51delHHERCS(1)|p.H178fs*6(1)|p.P177_E180delPHHE(1)|p.R42fs*24(1)|p.H85_S90delHHERCS(1)|p.R174fs*3(1)|p.E171fs*61(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGCAGCGCTCATGGTGGGGGC	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	76	Substitution - Missense(27)|Deletion - In frame(24)|Deletion - Frameshift(14)|Whole gene deletion(8)|Substitution - coding silent(2)|Complex - deletion inframe(1)	large_intestine(18)|breast(10)|upper_aerodigestive_tract(8)|lung(7)|liver(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(5)|bone(5)|central_nervous_system(4)|stomach(2)|oesophagus(2)|pancreas(2)|endometrium(1)											47.0	47.0	47.0					17																	7578393		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.537T>G	17.37:g.7578393A>C	ENSP00000269305:p.His179Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H179Q	ENST00000269305.4	37	c.537	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252337	0.80135	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99909	-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87;-7.87	5.47	-9.19	0.00685	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.048592	0.85682	N	0.000000	D	0.99878	0.9942	M	0.92507	3.315	0.58432	D	0.999998	D;D;D;D;D;D;D	0.89917	0.989;1.0;0.995;1.0;0.996;1.0;0.999	D;D;D;D;D;D;D	0.97110	0.952;0.997;0.939;1.0;0.985;0.995;0.971	D	0.99861	1.1083	10	0.87932	D	0	-15.4889	14.291	0.66278	0.2679:0.1015:0.6306:0.0	.	140;179;179;86;179;179;179	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	Q	179;179;179;179;179;179;168;86;47;86;47	ENSP00000410739:H179Q;ENSP00000352610:H179Q;ENSP00000269305:H179Q;ENSP00000398846:H179Q;ENSP00000391127:H179Q;ENSP00000391478:H179Q;ENSP00000425104:H47Q;ENSP00000423862:H86Q	ENSP00000269305:H179Q	H	-	3	2	TP53	7519118	0.081000	0.21417	0.351000	0.25721	0.844000	0.47949	-0.635000	0.05471	-2.028000	0.00931	-0.376000	0.06991	CAT	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	39	39	67	0.00	0.00	A	NM_000546		7578393	-1	7	13	8	55	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	46.67	19.12	SNP	0.699	C	7	8
FAM210B	116151	genome.wustl.edu	37	20	54941148	54941148	+	Missense_Mutation	SNP	C	C	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:54941148C>G	ENST00000371384.3	+	3	475	c.384C>G	c.(382-384)atC>atG	p.I128M		NM_080821.2	NP_543011.2	Q96KR6	F210B_HUMAN	family with sequence similarity 210, member B	128	DUF1279.					integral component of membrane (GO:0016021)											TGCCTGCAATCCTGCTGAAAC	0.438													ENSG00000124098																																					0													68.0	65.0	66.0					20																	54941148		2203	4300	6503	SO:0001583	missense	0			-	AL121914	CCDS13450.1	20q13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000124098	ENSG00000124098			16102	protein-coding gene	gene with protein product	"""hypothetical protein LOC116151"""		"""chromosome 20 open reading frame 108"""	C20orf108		11780052	Standard	NM_080821		Approved	dJ1167H4.1, DKFZP434A1114	uc002xxc.3	Q96KR6	OTTHUMG00000032793	ENST00000371384.3:c.384C>G	20.37:g.54941148C>G	ENSP00000360437:p.Ile128Met		B2RBQ9|E1P5Y7|Q8WVN2|Q9BYL6|Q9H418	Missense_Mutation	SNP	pfam_DUF1279	p.I128M	ENST00000371384.3	37	c.384	CCDS13450.1	20	.	.	.	.	.	.	.	.	.	.	C	14.04	2.418104	0.42918	.	.	ENSG00000124098	ENST00000371384	T	0.30448	1.53	5.56	3.42	0.39159	Domain of unknown function DUF1279 (1);	1.110600	0.06535	N	0.742233	T	0.42517	0.1206	L	0.56769	1.78	0.25085	N	0.990897	B	0.30526	0.283	B	0.43445	0.42	T	0.47433	-0.9118	10	0.54805	T	0.06	-9.2788	8.7326	0.34507	0.0:0.7011:0.0:0.2989	.	128	Q96KR6	CT108_HUMAN	M	128	ENSP00000360437:I128M	ENSP00000360437:I128M	I	+	3	3	C20orf108	54374555	0.983000	0.35010	0.986000	0.45419	0.711000	0.40976	0.058000	0.14301	1.334000	0.45468	0.650000	0.86243	ATC	-	FAM210B	-	pfam_DUF1279		0.438	FAM210B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM210B	HGNC	protein_coding	OTTHUMT00000079800.2	0	0	0	21	21	45	0.00	0.00	C	NM_080821		54941148	+1	11	11	30	69	tier1	no_errors	ENST00000371384	ensembl	human	known	74_37	missense	26.83	13.75	SNP	0.995	G	11	30
BMP6	654	genome.wustl.edu	37	6	7727534	7727534	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:7727534C>A	ENST00000283147.6	+	1	505	c.346C>A	c.(346-348)Cag>Aag	p.Q116K		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	116					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					gcagcagcagcagcagcagcT	0.716													ENSG00000153162																																					0													6.0	9.0	8.0					6																	7727534		1989	3931	5920	SO:0001583	missense	0			-	AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.346C>A	6.37:g.7727534C>A	ENSP00000283147:p.Gln116Lys		Q5TCP3	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.Q116K	ENST00000283147.6	37	c.346	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	C	0.031	-1.336876	0.01287	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	T	0.71817	-0.6	1.12	0.102	0.14522	Transforming growth factor-beta, N-terminal (1);	.	.	.	.	T	0.29288	0.0729	L	0.36672	1.1	0.09310	N	0.999999	B	0.23650	0.089	B	0.13407	0.009	T	0.12319	-1.0552	9	0.18710	T	0.47	.	3.7963	0.08740	0.0:0.723:0.0:0.277	.	116	P22004	BMP6_HUMAN	K	38;116;79	ENSP00000283147:Q116K	ENSP00000283147:Q116K	Q	+	1	0	BMP6	7672533	0.109000	0.22037	0.209000	0.23619	0.239000	0.25481	0.676000	0.25247	0.007000	0.14760	0.185000	0.17295	CAG	-	BMP6	-	pfam_TGF-b_N		0.716	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1	0	0	0	10	10	8	0.00	0.00	C	NM_001718		7727534	+1	4	3	7	1	tier1	no_errors	ENST00000283147	ensembl	human	known	74_37	missense	36.36	75.00	SNP	0.341	A	4	7
CDH26	60437	genome.wustl.edu	37	20	58577889	58577889	+	Intron	SNP	C	C	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:58577889C>G	ENST00000244047.5	+	14	2408				CDH26_ENST00000244049.3_Intron|CDH26_ENST00000348616.4_Missense_Mutation_p.P730A|CDH26_ENST00000350849.6_Missense_Mutation_p.P63A|CDH26_ENST00000497614.1_3'UTR			Q8IXH8	CAD26_HUMAN	cadherin 26						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GCCCTTTGAGCCAAGAAGTGT	0.338													ENSG00000124215																																					0													89.0	84.0	86.0					20																	58577889		2203	4300	6503	SO:0001627	intron_variant	0			-	AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.2097+3171C>G	20.37:g.58577889C>G			A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P730A	ENST00000244047.5	37	c.2188		20	.	.	.	.	.	.	.	.	.	.	C	5.589	0.293462	0.10567	.	.	ENSG00000124215	ENST00000348616;ENST00000350849;ENST00000456106	T;T	0.51325	0.71;0.71	3.31	-1.21	0.09524	.	0.765590	0.10841	N	0.628244	T	0.18800	0.0451	N	0.08118	0	0.09310	N	1	P;B	0.39282	0.666;0.221	B;B	0.35039	0.194;0.083	T	0.17349	-1.0372	10	0.02654	T	1	.	8.3482	0.32286	0.0:0.553:0.0:0.447	.	63;730	Q8IXH8-2;Q8IXH8-4	.;.	A	730;63;40	ENSP00000339390:P730A;ENSP00000310845:P63A	ENSP00000339390:P730A	P	+	1	0	CDH26	58011284	0.957000	0.32711	0.004000	0.12327	0.001000	0.01503	0.135000	0.15952	-0.516000	0.06470	-1.731000	0.00696	CCA	-	CDH26	-	NULL		0.338	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		0	0	0	78	78	109	0.00	0.00	C	NM_177980		58577889	+1	16	12	66	143	tier1	no_errors	ENST00000348616	ensembl	human	known	74_37	missense	19.28	7.74	SNP	0.008	G	16	66
MYL1	4632	genome.wustl.edu	37	2	211179643	211179643	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:211179643C>T	ENST00000352451.3	-	1	271	c.124G>A	c.(124-126)Gcc>Acc	p.A42T		NM_079420.2	NP_524144.1	P05976	MYL1_HUMAN	myosin, light chain 1, alkali; skeletal, fast	42					cardiac muscle contraction (GO:0060048)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|sarcomere (GO:0030017)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	16				Epithelial(149;0.00573)|Lung(261;0.0422)|LUSC - Lung squamous cell carcinoma(261;0.0444)|all cancers(144;0.057)		ACCTTAATGGCAGAGAGGTCA	0.502													ENSG00000168530																																					0													137.0	152.0	147.0					2																	211179643		2203	4300	6503	SO:0001583	missense	0			-		CCDS2390.1, CCDS2391.1	2q33-q34	2013-01-10	2006-09-29		ENSG00000168530	ENSG00000168530		"""Myosins / Light chain"", ""EF-hand domain containing"""	7582	protein-coding gene	gene with protein product		160780	"""myosin, light polypeptide 1, alkali; skeletal, fast"""			2304459, 3422212	Standard	NM_079422		Approved		uc002vec.3	P05976	OTTHUMG00000132992	ENST00000352451.3:c.124G>A	2.37:g.211179643C>T	ENSP00000307280:p.Ala42Thr		B2R4N6|B2R4T6|P06741|Q6IBD5	Missense_Mutation	SNP	smart_EF_hand_dom,pfscan_EF_hand_dom	p.A42T	ENST00000352451.3	37	c.124	CCDS2390.1	2	.	.	.	.	.	.	.	.	.	.	C	11.76	1.735650	0.30774	.	.	ENSG00000168530	ENST00000352451	D	0.84146	-1.81	5.39	-0.136	0.13473	.	0.368381	0.27604	N	0.018632	T	0.66616	0.2807	N	0.12182	0.205	0.36351	D	0.860091	B	0.16396	0.017	B	0.15052	0.012	T	0.52396	-0.8581	10	0.22706	T	0.39	.	7.3309	0.26582	0.6434:0.2362:0.0:0.1204	.	42	P05976	MYL1_HUMAN	T	42	ENSP00000307280:A42T	ENSP00000307280:A42T	A	-	1	0	MYL1	210887888	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	1.003000	0.29809	-0.046000	0.13446	-0.262000	0.10625	GCC	-	MYL1	-	NULL		0.502	MYL1-001	KNOWN	basic|CCDS	protein_coding	MYL1	HGNC	protein_coding	OTTHUMT00000256566.2	0	0	0	61	61	86	0.00	0.00	C	NM_079420		211179643	-1	7	10	59	99	tier1	no_errors	ENST00000352451	ensembl	human	known	74_37	missense	10.61	9.17	SNP	0.993	T	7	59
CELSR3	1951	genome.wustl.edu	37	3	48701489	48701489	+	5'Flank	SNP	G	G	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr3:48701489G>T	ENST00000164024.4	-	0	0				RP11-148G20.1_ENST00000421275.1_RNA|NCKIPSD_ENST00000341520.4_Missense_Mutation_p.P682T|CELSR3_ENST00000544264.1_5'Flank	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3						axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ACAGGGTGCGGCTCCCGCGAT	0.652											OREG0015562	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000213672																																					0													12.0	12.0	12.0					3																	48701489		873	1989	2862	SO:0001631	upstream_gene_variant	0			-	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544		3.37:g.48701489G>T	Exception_encountered	956	O75092	Missense_Mutation	SNP	pfam_DUF2013,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.P682T	ENST00000164024.4	37	c.2044	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240235	0.39598	.	.	ENSG00000213672	ENST00000341520	T	0.48522	0.81	3.62	1.82	0.25136	.	0.376809	0.24189	U	0.040730	T	0.41811	0.1175	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28073	-1.0055	7	0.49607	T	0.09	.	5.7411	0.18094	0.2459:0.0:0.7541:0.0	.	.	.	.	T	682	ENSP00000342621:P682T	ENSP00000342621:P682T	P	-	1	0	NCKIPSD	48676493	0.309000	0.24518	0.040000	0.18447	0.154000	0.21943	1.282000	0.33226	0.503000	0.28060	0.655000	0.94253	CCG	-	NCKIPSD	-	NULL		0.652	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKIPSD	HGNC	protein_coding	OTTHUMT00000257523.1	0	0	0	179	179	28	0.00	0.00	G	NM_001407		48701489	-1	26	5	119	89	tier1	no_errors	ENST00000341520	ensembl	human	known	74_37	missense	17.93	5.26	SNP	0.098	T	26	119
LINC01317	104355287	genome.wustl.edu	37	2	33952141	33952141	+	lincRNA	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:33952141C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CAGAGTACACCAGGTCGCCCA	0.572													ENSG00000239649																																					0																																												0			-																													2.37:g.33952141C>T				R	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	MYADML	-	-		0.572	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	0	0	0	61	61	148	0.00	0.00	C			33952141	-1	20	12	49	174	tier1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	28.99	6.45	SNP	1.000	T	20	49
FILIP1	27145	genome.wustl.edu	37	6	76023331	76023331	+	Silent	SNP	A	A	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr6:76023331A>G	ENST00000237172.7	-	5	2547	c.2217T>C	c.(2215-2217)gaT>gaC	p.D739D	FILIP1_ENST00000370020.1_Silent_p.D640D|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000393004.2_Silent_p.D739D	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	739										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						GAGAAAGCTGATCTTCTTTGT	0.373													ENSG00000118407																																					0													113.0	118.0	116.0					6																	76023331		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2217T>C	6.37:g.76023331A>G			B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Silent	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.D739	ENST00000237172.7	37	c.2217	CCDS4984.1	6																																																																																			-	FILIP1	-	NULL		0.373	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	0	0	0	24	24	88	0.00	0.00	A	XM_029179		76023331	-1	10	6	9	79	tier1	no_errors	ENST00000237172	ensembl	human	known	74_37	silent	52.63	7.06	SNP	0.956	G	10	9
CHD5	26038	genome.wustl.edu	37	1	6206323	6206323	+	Missense_Mutation	SNP	C	C	T	rs141210110		TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:6206323C>T	ENST00000262450.3	-	11	1850	c.1751G>A	c.(1750-1752)cGc>cAc	p.R584H	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GATGCCATAGCGGTAGAAGCG	0.607													ENSG00000116254																																					0								C	HIS/ARG	0,4406		0,0,2203	146.0	145.0	145.0		1751	3.8	1.0	1	dbSNP_134	145	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHD5	NM_015557.2	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	584/1955	6206323	2,13004	2203	4300	6503	SO:0001583	missense	0			-	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1751G>A	1.37:g.6206323C>T	ENSP00000262450:p.Arg584His		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R584H	ENST00000262450.3	37	c.1751	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686569	0.88639	0.0	2.33E-4	ENSG00000116254	ENST00000262450;ENST00000378006	T	0.72725	-0.68	3.85	3.85	0.44370	Chromo domain-like (1);	0.000000	0.85682	D	0.000000	D	0.85414	0.5691	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.88972	0.3401	10	0.87932	D	0	-21.9232	16.3262	0.82983	0.0:1.0:0.0:0.0	.	584	Q8TDI0	CHD5_HUMAN	H	584;100	ENSP00000262450:R584H	ENSP00000262450:R584H	R	-	2	0	CHD5	6128910	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.558000	0.82253	2.138000	0.66242	0.462000	0.41574	CGC	rs141210110	CHD5	-	superfamily_Chromodomain-like		0.607	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	0	0	0	35	35	63	0.00	0.00	C	NM_015557		6206323	-1	9	7	17	96	tier1	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	34.62	6.80	SNP	1.000	T	9	17
CPS1	1373	genome.wustl.edu	37	2	211540493	211540493	+	Missense_Mutation	SNP	C	C	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr2:211540493C>A	ENST00000233072.5	+	36	4399	c.4203C>A	c.(4201-4203)aaC>aaA	p.N1401K	CPS1_ENST00000451903.2_Missense_Mutation_p.N950K|CPS1_ENST00000430249.2_Missense_Mutation_p.N1407K	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1401					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	TCAACGCCAACAATGTCCCTG	0.438													ENSG00000021826																																					0													69.0	68.0	68.0					2																	211540493		2203	4300	6503	SO:0001583	missense	0			-	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.4203C>A	2.37:g.211540493C>A	ENSP00000233072:p.Asn1401Lys		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.N1407K	ENST00000233072.5	37	c.4221	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035743	0.54896	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.81739	-1.53;-1.53;-1.53	6.08	6.08	0.98989	Methylglyoxal synthase-like domain (4);	0.093021	0.64402	D	0.000001	T	0.78162	0.4240	M	0.61387	1.9	0.43152	D	0.994927	B;B	0.25904	0.137;0.137	B;B	0.25614	0.062;0.062	T	0.75382	-0.3337	10	0.56958	D	0.05	-12.7482	12.4627	0.55741	0.0:0.918:0.0:0.082	.	1411;1401	Q59HF8;P31327	.;CPSM_HUMAN	K	1407;1409;1401;950	ENSP00000402608:N1407K;ENSP00000233072:N1401K;ENSP00000406136:N950K	ENSP00000233072:N1401K	N	+	3	2	CPS1	211248738	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	1.531000	0.36018	2.894000	0.99253	0.591000	0.81541	AAC	-	CPS1	-	pfam_MGS-like_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu		0.438	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	0	0	0	43	43	61	0.00	0.00	C			211540493	+1	9	9	39	101	tier1	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	18.75	8.18	SNP	1.000	A	9	39
GINS1	9837	genome.wustl.edu	37	20	25422336	25422336	+	Splice_Site	SNP	A	A	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr20:25422336A>G	ENST00000262460.4	+	6	541		c.e6-1		GINS1_ENST00000429262.2_Splice_Site	NM_021067.3	NP_066545.3	Q14691	PSF1_HUMAN	GINS complex subunit 1 (Psf1 homolog)						DNA strand elongation involved in DNA replication (GO:0006271)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TTTTTCTTTCAGGTCCGGTGT	0.299													ENSG00000101003																																					0													75.0	81.0	79.0					20																	25422336		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BC012542	CCDS33451.1	20p11.21	2006-05-04			ENSG00000101003	ENSG00000101003			28980	protein-coding gene	gene with protein product		610608				8724849, 8786132	Standard	NM_021067		Approved	KIAA0186, PSF1	uc002wuv.1	Q14691	OTTHUMG00000032124	ENST00000262460.4:c.448-1A>G	20.37:g.25422336A>G			Q9NQE2|Q9NQI7	Splice_Site	SNP	-	e6-2	ENST00000262460.4	37	c.448-2	CCDS33451.1	20	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485580	0.63962	.	.	ENSG00000101003	ENST00000262460	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7931	0.69857	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GINS1	25370336	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	6.472000	0.73567	2.130000	0.65690	0.533000	0.62120	.	-	GINS1	-	-		0.299	GINS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS1	HGNC	protein_coding	OTTHUMT00000078433.1	0	0	0	49	49	83	0.00	0.00	A	NM_021067	Intron	25422336	+1	13	4	45	74	tier1	no_errors	ENST00000262460	ensembl	human	known	74_37	splice_site	22.41	5.13	SNP	1.000	G	13	45
TRPM6	140803	genome.wustl.edu	37	9	77502760	77502760	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr9:77502760G>T	ENST00000360774.1	-	1	250	c.13C>A	c.(13-15)Cct>Act	p.P5T	TRPM6_ENST00000376871.3_Missense_Mutation_p.P5T|TRPM6_ENST00000376872.3_Missense_Mutation_p.P5T|TRPM6_ENST00000361255.3_5'Flank|TRPM6_ENST00000449912.2_5'Flank|TRPM6_ENST00000451710.3_Missense_Mutation_p.P5T|TRPM6_ENST00000376864.4_Missense_Mutation_p.P5T|TRPM6_ENST00000359047.2_Missense_Mutation_p.P5T	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	5					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						TCCAAGACAGGTTGTTCTTTC	0.562													ENSG00000119121																																					0													155.0	140.0	145.0					9																	77502760		2203	4300	6503	SO:0001583	missense	0			-	AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.13C>A	9.37:g.77502760G>T	ENSP00000354006:p.Pro5Thr		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P5T	ENST00000360774.1	37	c.13	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138658	0.21123	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000376871;ENST00000376864;ENST00000359047	T;T;T;T;T;T	0.61627	0.77;0.76;0.68;0.91;0.66;0.09	3.19	-2.78	0.05859	.	2.543950	0.02094	N	0.053379	T	0.38214	0.1032	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.26318	0.0;0.0;0.0;0.146;0.001	B;B;B;B;B	0.21546	0.001;0.001;0.001;0.035;0.001	T	0.13442	-1.0509	10	0.54805	T	0.06	.	0.6123	0.00763	0.3717:0.171:0.2836:0.1737	.	5;5;5;5;5	Q9BX84-7;Q9BX84-6;Q9BX84-5;Q96LV9;Q9BX84	.;.;.;.;TRPM6_HUMAN	T	5	ENSP00000354006:P5T;ENSP00000407341:P5T;ENSP00000366068:P5T;ENSP00000366067:P5T;ENSP00000366060:P5T;ENSP00000351942:P5T	ENSP00000351942:P5T	P	-	1	0	TRPM6	76692580	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.296000	0.19083	-0.641000	0.05487	-0.258000	0.10820	CCT	-	TRPM6	-	NULL		0.562	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	0	0	1	34	34	74	0.00	1.33	G	NM_017662		77502760	-1	14	15	22	139	tier1	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	38.89	9.74	SNP	0.000	T	14	22
NPFFR2	10886	genome.wustl.edu	37	4	73013005	73013005	+	Missense_Mutation	SNP	T	T	C			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr4:73013005T>C	ENST00000308744.6	+	4	1143	c.1045T>C	c.(1045-1047)Ttc>Ctc	p.F349L	NPFFR2_ENST00000506359.1_3'UTR|NPFFR2_ENST00000344413.5_3'UTR|NPFFR2_ENST00000358749.3_Missense_Mutation_p.F247L|NPFFR2_ENST00000395999.1_Missense_Mutation_p.F250L	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	349					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AATTTCACTCTTCAGGGCTGC	0.502													ENSG00000056291																																					0													80.0	74.0	76.0					4																	73013005		2203	4300	6503	SO:0001583	missense	0			-	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.1045T>C	4.37:g.73013005T>C	ENSP00000307822:p.Phe349Leu		Q96RV1|Q9NR49	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPFF_rcpt_2,prints_NPFF_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.F349L	ENST00000308744.6	37	c.1045	CCDS3551.1	4	.	.	.	.	.	.	.	.	.	.	T	12.50	1.957788	0.34565	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.33438	1.41;1.41;1.41	5.82	3.34	0.38264	GPCR, rhodopsin-like superfamily (1);	0.431858	0.22318	N	0.061660	T	0.29491	0.0735	L	0.48174	1.505	0.50632	D	0.99988	B;B	0.30236	0.05;0.274	B;B	0.38296	0.061;0.27	T	0.05022	-1.0911	10	0.42905	T	0.14	.	7.4187	0.27059	0.1281:0.0698:0.0:0.802	.	250;349	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	L	349;250;247	ENSP00000307822:F349L;ENSP00000379321:F250L;ENSP00000351599:F247L	ENSP00000307822:F349L	F	+	1	0	NPFFR2	73231869	0.998000	0.40836	0.622000	0.29159	0.021000	0.10359	4.141000	0.58038	0.437000	0.26423	0.482000	0.46254	TTC	-	NPFFR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.502	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	NPFFR2	HGNC	protein_coding	OTTHUMT00000252170.2	0	0	1	54	54	91	0.00	1.09	T	NM_004885		73013005	+1	17	6	42	112	tier1	no_errors	ENST00000308744	ensembl	human	known	74_37	missense	28.81	5.08	SNP	0.998	C	17	42
SYNE4	163183	genome.wustl.edu	37	19	36497392	36497392	+	Missense_Mutation	SNP	C	C	T	rs200616477		TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr19:36497392C>T	ENST00000324444.3	-	5	911	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	AC002116.8_ENST00000473572.2_RNA|ALKBH6_ENST00000495116.2_5'Flank|SYNE4_ENST00000340477.5_Missense_Mutation_p.R154Q	NM_001039876.1	NP_001034965.1	Q8N205	SYNE4_HUMAN	spectrin repeat containing, nuclear envelope family member 4	267					establishment of epithelial cell apical/basal polarity (GO:0045198)	integral component of nuclear outer membrane (GO:0031309)											TCCTAGTGTCCGGGCTGTCTT	0.667													ENSG00000181392																																					0																																										SO:0001583	missense	0			-	BC038360	CCDS42553.1	19q13.12	2014-01-28	2012-05-31	2012-05-31	ENSG00000181392	ENSG00000181392			26703	protein-coding gene	gene with protein product		615535	"""chromosome 19 open reading frame 46"", ""deafness, autosomal recessive 76"""	C19orf46, DFNB76		23348741	Standard	XM_005258597		Approved	FLJ36445, Nesprin-4, Nesp4	uc002ocq.1	Q8N205	OTTHUMG00000048135	ENST00000324444.3:c.800G>A	19.37:g.36497392C>T	ENSP00000316130:p.Arg267Gln		A8MRS0|A8MYE3|Q7Z7L3	Missense_Mutation	SNP	pfam_KASH,pfscan_KASH	p.R267Q	ENST00000324444.3	37	c.800	CCDS42553.1	19	.	.	.	.	.	.	.	.	.	.	C	3.833	-0.035435	0.07497	.	.	ENSG00000181392	ENST00000340477;ENST00000324444	T;T	0.34472	1.36;1.36	5.15	0.562	0.17290	.	1.528510	0.03379	N	0.200115	T	0.22589	0.0545	N	0.24115	0.695	0.09310	N	1	B;B	0.12013	0.005;0.001	B;B	0.04013	0.001;0.001	T	0.11941	-1.0567	10	0.27785	T	0.31	-29.6686	1.8582	0.03183	0.1659:0.497:0.1605:0.1766	.	154;267	Q8N205-2;Q8N205	.;SYNE4_HUMAN	Q	154;267	ENSP00000343152:R154Q;ENSP00000316130:R267Q	ENSP00000316130:R267Q	R	-	2	0	C19orf46	41189232	0.000000	0.05858	0.014000	0.15608	0.057000	0.15508	0.142000	0.16096	0.059000	0.16252	-0.136000	0.14681	CGG	rs200616477	SYNE4	-	NULL		0.667	SYNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE4	HGNC	protein_coding	OTTHUMT00000109525.3	0	0	0	56	56	33	0.00	0.00	C	NM_001039876		36497392	-1	13	7	63	83	tier1	no_errors	ENST00000324444	ensembl	human	known	74_37	missense	17.11	7.78	SNP	0.030	T	13	63
RGS21	431704	genome.wustl.edu	37	1	192316509	192316522	+	Splice_Site	DEL	AGCCAACCAAGGTA	AGCCAACCAAGGTA	-	rs142678159	byFrequency	TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	AGCCAACCAAGGTA	AGCCAACCAAGGTA	AGCCAACCAAGGTA	-	AGCCAACCAAGGTA	AGCCAACCAAGGTA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:192316509_192316522delAGCCAACCAAGGTA	ENST00000417209.2	+	3	252_262	c.78_88delAGCCAACCAAGGTA	c.(76-90)ttagccaaccaaggt>ttgt	p.ANQG27fs		NM_001039152.3	NP_001034241.1	Q2M5E4	RGS21_HUMAN	regulator of G-protein signaling 21	27	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.N28K(1)		NS(1)|endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	15						ACACGCTTTTAGCCAACCAAGGTAAGATTTAACT	0.299													ENSG00000253148																																					1	Substitution - Missense(1)	ovary(1)																																								SO:0001630	splice_region_variant	0				AY643711	CCDS41448.1	1q31.2	2013-09-24	2007-08-14		ENSG00000253148	ENSG00000253148		"""Regulators of G-protein signaling"""	26839	protein-coding gene	gene with protein product		612407	"""regulator of G-protein signalling 21"""			15066150	Standard	NM_001039152		Approved		uc001gsh.3	Q2M5E4	OTTHUMG00000035594	ENST00000417209.2:c.88+1AGCCAACCAAGGTA>-	1.37:g.192316509_192316522delAGCCAACCAAGGTA				Frame_Shift_Del	DEL	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.L26fs	ENST00000417209.2	37	c.78_88	CCDS41448.1	1																																																																																				RGS21	-	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom		0.299	RGS21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS21	HGNC	protein_coding	OTTHUMT00000086387.2	0	0	0	82	82	82	0.00	0.00	AGCCAACCAAGGTA		Frame_Shift_Del	192316522	+1	4	4	85	85	tier1	no_errors	ENST00000417209	ensembl	human	known	74_37	frame_shift_del	4.49	4.49	DEL	1.000:1.000:1.000:0.991:0.990:0.968:0.645:0.950:1.000:1.000:1.000	-	4	85
ESRP1	54845	genome.wustl.edu	37	8	95677276	95677276	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr8:95677276C>T	ENST00000433389.2	+	8	1067	c.877C>T	c.(877-879)Cgg>Tgg	p.R293W	ESRP1_ENST00000423620.2_Missense_Mutation_p.R293W|ESRP1_ENST00000358397.5_Missense_Mutation_p.R293W|ESRP1_ENST00000454170.2_Missense_Mutation_p.R293W	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	293	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)		ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						CATGGGGACCCGGTATATTGA	0.478													ENSG00000104413																																					0													101.0	99.0	100.0					8																	95677276		1928	4139	6067	SO:0001583	missense	0			-	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.877C>T	8.37:g.95677276C>T	ENSP00000405738:p.Arg293Trp		A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,smart_RRM_dom,pfscan_RRM_dom	p.R293W	ENST00000433389.2	37	c.877	CCDS47897.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.1|21.1	4.090705|4.090705	0.76756|0.76756	.|.	.|.	ENSG00000104413|ENSG00000104413	ENST00000519505|ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000522756;ENST00000517610	.|T;T;T;T;T;T	.|0.13420	.|2.59;2.59;2.59;2.59;2.59;2.59	5.53|5.53	4.62|4.62	0.57501|0.57501	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53142|0.53142	0.1778|0.1778	H|H	0.97564|0.97564	4.03|4.03	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0;1.0;1.0	T|T	0.70908|0.70908	-0.4744|-0.4744	5|10	.|0.87932	.|D	.|0	-15.3355|-15.3355	15.7289|15.7289	0.77788|0.77788	0.1372:0.8628:0.0:0.0|0.1372:0.8628:0.0:0.0	.|.	.|293;293;293;293;293;293	.|D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1	.|.;.;.;.;.;ESRP1_HUMAN	L|W	158|293;293;293;293;76;152	.|ENSP00000407349:R293W;ENSP00000405738:R293W;ENSP00000351168:R293W;ENSP00000402766:R293W;ENSP00000428490:R76W;ENSP00000429125:R152W	.|ENSP00000351168:R293W	P|R	+|+	2|1	0|2	ESRP1|ESRP1	95746452|95746452	0.064000|0.064000	0.20934|0.20934	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	0.512000|0.512000	0.22755|0.22755	2.601000|2.601000	0.87937|0.87937	0.563000|0.563000	0.77884|0.77884	CCG|CGG	-	ESRP1	-	smart_RRM_dom,pfscan_RRM_dom		0.478	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ESRP1	HGNC	protein_coding	OTTHUMT00000379326.1	0	0	2	68	68	106	0.00	1.85	C	NM_017697		95677276	+1	10	52	37	146	tier1	no_errors	ENST00000433389	ensembl	human	known	74_37	missense	21.28	26.26	SNP	1.000	T	10	37
ATAD3C	219293	genome.wustl.edu	37	1	1387815	1387815	+	Splice_Site	SNP	G	G	A			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:1387815G>A	ENST00000378785.2	+	3	1217		c.e3+1			NM_001039211.2	NP_001034300.2	Q5T2N8	ATD3C_HUMAN	ATPase family, AAA domain containing 3C								ATP binding (GO:0005524)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|lung(4)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		GACAGCCACGGTAAACATACT	0.602													ENSG00000215915																																					0													138.0	118.0	124.0					1																	1387815		692	1591	2283	SO:0001630	splice_region_variant	0			-	AK091918	CCDS44039.1	1p36.33	2010-04-21		2007-02-08	ENSG00000215915	ENSG00000215915		"""ATPases / AAA-type"""	32151	protein-coding gene	gene with protein product							Standard	NM_001039211		Approved	FLJ34599	uc001aft.2	Q5T2N8	OTTHUMG00000000531	ENST00000378785.2:c.222+1G>A	1.37:g.1387815G>A			Q8N1Z5	Splice_Site	SNP	-	e3+1	ENST00000378785.2	37	c.222+1	CCDS44039.1	1	.	.	.	.	.	.	.	.	.	.	G	8.235	0.805515	0.16467	.	.	ENSG00000215915	ENST00000378785	.	.	.	2.48	2.48	0.30137	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9955	0.53201	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATAD3C	1377678	1.000000	0.71417	0.959000	0.39883	0.164000	0.22412	7.420000	0.80191	1.224000	0.43551	0.194000	0.17425	.	-	ATAD3C	-	-		0.602	ATAD3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD3C	HGNC	protein_coding	OTTHUMT00000001279.3	0	0	2	112	112	105	0.00	1.87	G	NM_001039211	Intron	1387815	+1	36	9	25	90	tier1	no_errors	ENST00000378785	ensembl	human	known	74_37	splice_site	59.02	9.09	SNP	1.000	A	36	25
DMD	1756	genome.wustl.edu	37	X	33229530	33229530	+	5'UTR	SNP	C	C	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:33229530C>G	ENST00000357033.4	-	0	106				DMD_ENST00000288447.4_Intron	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AACCAACAAACTTCAGCAGCT	0.368													ENSG00000198947																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.-101G>C	X.37:g.33229530C>G			E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	R	SNP	-	NULL	ENST00000357033.4	37	NULL	CCDS14233.1	X																																																																																			-	DMD	-	-		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	0	0	2	71	71	130	0.00	1.52	C	NM_004006		33229530	-1	53	60	57	158	tier1	no_errors	ENST00000463609	ensembl	human	known	74_37	rna	48.18	27.52	SNP	0.902	G	53	57
ACCS	84680	genome.wustl.edu	37	11	44104733	44104733	+	Missense_Mutation	SNP	G	G	T	rs368035781		TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr11:44104733G>T	ENST00000263776.8	+	13	1560	c.1126G>T	c.(1126-1128)Gtg>Ttg	p.V376L		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	376					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GATCAACCAGGTGTACCTGCC	0.522													ENSG00000110455																									Esophageal Squamous(158;148 1889 8077 23160 41213)												0													132.0	135.0	134.0					11																	44104733		2203	4300	6503	SO:0001583	missense	0			-	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.1126G>T	11.37:g.44104733G>T	ENSP00000263776:p.Val376Leu		B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.V376L	ENST00000263776.8	37	c.1126	CCDS7907.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.105651	0.94292	.	.	ENSG00000110455	ENST00000263776	T	0.21361	2.01	5.77	5.77	0.91146	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.123947	0.53938	D	0.000049	T	0.48978	0.1530	M	0.83953	2.67	0.80722	D	1	P	0.52692	0.955	P	0.58520	0.84	T	0.50136	-0.8863	10	0.62326	D	0.03	-21.2101	19.5934	0.95525	0.0:0.0:1.0:0.0	.	376	Q96QU6	1A1L1_HUMAN	L	376	ENSP00000263776:V376L	ENSP00000263776:V376L	V	+	1	0	ACCS	44061309	1.000000	0.71417	0.994000	0.49952	0.996000	0.88848	5.099000	0.64554	2.724000	0.93272	0.561000	0.74099	GTG	-	ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase		0.522	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	0	0	2	54	54	157	0.00	1.25	G	NM_032592		44104733	+1	31	51	9	165	tier1	no_errors	ENST00000263776	ensembl	human	known	74_37	missense	77.50	23.61	SNP	0.999	T	31	9
KHDRBS1	10657	genome.wustl.edu	37	1	32503558	32503558	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:32503558C>T	ENST00000327300.7	+	6	1195	c.1028C>T	c.(1027-1029)cCa>cTa	p.P343L	KHDRBS1_ENST00000492989.1_Missense_Mutation_p.P304L|KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGGGGTGCTCCAGCACCAAGA	0.557													ENSG00000121774																									Ovarian(173;401 1982 12359 31110 42403)												0													87.0	85.0	85.0					1																	32503558		2203	4300	6503	SO:0001583	missense	0			-	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.1028C>T	1.37:g.32503558C>T	ENSP00000313829:p.Pro343Leu			Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.P343L	ENST00000327300.7	37	c.1028	CCDS350.1	1	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649893	0.67358	.	.	ENSG00000121774	ENST00000327300;ENST00000492989;ENST00000355201	T;T	0.47869	0.83;0.89	5.84	5.84	0.93424	.	0.364627	0.34652	N	0.003782	T	0.40909	0.1136	L	0.31420	0.93	0.80722	D	1	P;P	0.46912	0.818;0.886	B;P	0.45829	0.22;0.494	T	0.17107	-1.0380	10	0.02654	T	1	.	20.1225	0.97967	0.0:1.0:0.0:0.0	.	343;304	Q07666;Q07666-3	KHDR1_HUMAN;.	L	343;304;319	ENSP00000313829:P343L;ENSP00000417731:P304L	ENSP00000313829:P343L	P	+	2	0	KHDRBS1	32276145	1.000000	0.71417	0.994000	0.49952	0.810000	0.45777	5.063000	0.64332	2.937000	0.99478	0.650000	0.86243	CCA	-	KHDRBS1	-	NULL		0.557	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	0	0	1	52	52	34	0.00	2.86	C	NM_006559		32503558	+1	29	11	75	89	tier1	no_errors	ENST00000327300	ensembl	human	known	74_37	missense	27.88	11.00	SNP	0.997	T	29	75
PLEKHO1	51177	genome.wustl.edu	37	1	150128083	150128083	+	Intron	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:150128083C>T	ENST00000369124.4	+	3	455				PLEKHO1_ENST00000025469.6_Intron|PLEKHO1_ENST00000479194.1_Intron|PLEKHO1_ENST00000369126.1_Intron	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTGGAGCTGCCCTAGCGTCCT	0.552													ENSG00000023902																																					0																																										SO:0001627	intron_variant	0			-	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.178-177C>T	1.37:g.150128083C>T			Q336K5|Q8IZ51|Q9NRV3|Q9UL48	R	SNP	-	NULL	ENST00000369124.4	37	NULL	CCDS945.1	1																																																																																			-	PLEKHO1	-	-		0.552	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLEKHO1	HGNC	protein_coding	OTTHUMT00000034962.1	0	0	2	59	59	111	0.00	1.77	C	NM_016274		150128083	+1	25	52	27	191	tier1	no_errors	ENST00000477309	ensembl	human	known	74_37	rna	48.08	21.40	SNP	0.002	T	25	27
MT1HL1	645745	genome.wustl.edu	37	1	237167633	237167633	+	Missense_Mutation	SNP	C	C	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr1:237167633C>T	ENST00000464121.2	-	1	85	c.40G>A	c.(40-42)Gcc>Acc	p.A14T		NM_001276687.1	NP_001263616.1	P0DM35	M1BL1_HUMAN	metallothionein 1H-like 1	14	Beta.|Cys-rich.						metal ion binding (GO:0046872)										CCGGCGCAGGCGTAGGAGCCT	0.627													ENSG00000244020																																					0													31.0	34.0	34.0					1																	237167633		692	1591	2283	SO:0001583	missense	0			-	AF333388	CCDS31068.1	1q43	2013-03-07	2013-03-07	2013-03-07	ENSG00000244020	ENSG00000244020		"""Metallothioneins"""	31864	protein-coding gene	gene with protein product			"""metallothionein 1 pseudogene 2"""	MT1P2			Standard	NM_001276687		Approved		uc001hyk.2	P0DM35	OTTHUMG00000040065	ENST00000464121.2:c.40G>A	1.37:g.237167633C>T	ENSP00000476141:p.Ala14Thr			Missense_Mutation	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.A14T	ENST00000464121.2	37	c.40		1																																																																																			-	MT1HL1	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert		0.627	MT1HL1-001	KNOWN	basic|appris_principal	protein_coding	MT1HL1	HGNC	protein_coding	OTTHUMT00000096642.4	0	0	0	47	47	5	0.00	0.00	C	NM_001039954		237167633	-1	17	1	12	7	tier1	no_errors	ENST00000464121	ensembl	human	known	74_37	missense	58.62	12.50	SNP	0.006	T	17	12
RTL1	388015	genome.wustl.edu	37	14	101347810	101347810	+	Missense_Mutation	SNP	A	A	G			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr14:101347810A>G	ENST00000534062.1	-	1	3374	c.3316T>C	c.(3316-3318)Tcg>Ccg	p.S1106P	MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1106					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GGCCGCAGCGAGAGGCATTGC	0.657													ENSG00000254656																																					0													45.0	40.0	42.0					14																	101347810		692	1591	2283	SO:0001583	missense	0			-		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3316T>C	14.37:g.101347810A>G	ENSP00000435342:p.Ser1106Pro		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.S1106P	ENST00000534062.1	37	c.3316	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	A	5.569	0.289777	0.10567	.	.	ENSG00000254656	ENST00000534062	T	0.24350	1.86	3.11	-6.22	0.02058	.	.	.	.	.	T	0.12135	0.0295	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20940	-1.0260	9	0.48119	T	0.1	.	2.4661	0.04553	0.2213:0.2306:0.4247:0.1234	.	1106	E9PKS8	.	P	1106	ENSP00000435342:S1106P	ENSP00000435342:S1106P	S	-	1	0	RTL1	100417563	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.374000	0.01072	-2.327000	0.00636	-0.589000	0.04120	TCG	-	RTL1	-	NULL		0.657	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	0	0	0	26	26	9	0.00	0.00	A	NM_001134888		101347810	-1	8	0	16	6	tier1	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	33.33	0.00	SNP	0.000	G	8	16
LOC645752	645752	genome.wustl.edu	37	15	78207077	78207077	+	lincRNA	SNP	G	G	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr15:78207077G>T	ENST00000565869.1	+	0	0				RN7SL214P_ENST00000487317.2_RNA																							ATTCTGTAATGAATATATGTG	0.368													ENSG00000260776																																					0																																												0			-																													15.37:g.78207077G>T				R	SNP	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			-	RP11-114H24.2	-	-		0.368	RP11-114H24.7-001	KNOWN	basic	lincRNA	LOC645752	Clone_based_vega_gene	lincRNA	OTTHUMT00000421587.1	1	1	0	121	121	0	0.82	0.00	G			78207077	-1	57	0	140	0	tier1	no_errors	ENST00000563349	ensembl	human	known	74_37	rna	28.93	0.00	SNP	0.019	T	57	140
NPIPA1	9284	genome.wustl.edu	37	16	15045631	15045631	+	Missense_Mutation	SNP	G	G	A	rs201805072	byFrequency	TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chr16:15045631G>A	ENST00000328085.6	+	8	802	c.802G>A	c.(802-804)Gag>Aag	p.E268K	NPIPA1_ENST00000472413.1_3'UTR	NM_006985.2	NP_008916.2	Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1	268	Pro-rich.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											GACACCTTCCGAGTGTCTGCT	0.517													ENSG00000183426																																					0													83.0	70.0	75.0					16																	15045631		1386	2350	3736	SO:0001583	missense	0			-	AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000328085.6:c.802G>A	16.37:g.15045631G>A	ENSP00000331843:p.Glu268Lys		O15102	Missense_Mutation	SNP	NULL	p.E268K	ENST00000328085.6	37	c.802	CCDS10557.1	16	.	.	.	.	.	.	.	.	.	.	.	7.020	0.558597	0.13436	.	.	ENSG00000183426	ENST00000432470;ENST00000328085	T	0.51817	0.69	.	.	.	.	.	.	.	.	T	0.42720	0.1215	M	0.64997	1.995	0.09310	N	1	P	0.41265	0.744	B	0.40410	0.328	T	0.34030	-0.9845	7	0.66056	D	0.02	.	.	.	.	.	268	Q9UND3	NPIP_HUMAN	K	268	ENSP00000331843:E268K	ENSP00000331843:E268K	E	+	1	0	NPIP	14953132	0.018000	0.18449	0.031000	0.17742	0.031000	0.12232	0.112000	0.15479	0.121000	0.18284	0.123000	0.15791	GAG	rs201805072	NPIPA1	-	NULL		0.517	NPIPA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	NPIPA1	HGNC	protein_coding	OTTHUMT00000207326.2	0	0	0	41	41	0	0.00	0.00	G	NM_006985		15045631	+1	5	0	7	0	tier1	no_errors	ENST00000328085	ensembl	human	novel	74_37	missense	41.67	0.00	SNP	0.032	A	5	7
SPANXD	64648	genome.wustl.edu	37	X	140786506	140786506	+	Missense_Mutation	SNP	G	G	T			TCGA-VT-A80J-01A-11D-A36J-09	TCGA-VT-A80J-11A-22D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	695291d4-4e6c-46d1-aeff-2ddaf0fdd1ee	fd6129c3-faca-4233-9ba6-92cc70bcb0de	g.chrX:140786506G>T	ENST00000370515.3	-	1	390	c.57C>A	c.(55-57)aaC>aaA	p.N19K		NM_032417.2|NM_145665.1	NP_115793.1|NP_663698.1	Q9BXN6	SPNXD_HUMAN	SPANX family, member D	19						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9	Acute lymphoblastic leukemia(192;7.65e-05)					CGTTGGCCTCGTTGGAATCAC	0.507													ENSG00000196406																																					0													3.0	3.0	3.0					X																	140786506		1544	3070	4614	SO:0001583	missense	0			-	AJ457791	CCDS14675.1	Xq27.2	2014-06-19			ENSG00000196406	ENSG00000196406			14332	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 4"""	300670, 300671	"""SPANX family, member E"""	SPANXE			Standard	NM_032417		Approved	CT11.4		Q9BXN6	OTTHUMG00000022563	ENST00000370515.3:c.57C>A	X.37:g.140786506G>T	ENSP00000359546:p.Asn19Lys		Q5JWI1	Missense_Mutation	SNP	pfam_SPANX_prot	p.N19K	ENST00000370515.3	37	c.57	CCDS14675.1	X	.	.	.	.	.	.	.	.	.	.	G	8.848	0.943818	0.18281	.	.	ENSG00000196406	ENST00000370515	T	0.14516	2.5	.	.	.	.	.	.	.	.	T	0.29976	0.0750	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.85130	0.997	T	0.07809	-1.0753	6	0.87932	D	0	.	.	.	.	.	19	Q9BXN6	SPNXD_HUMAN	K	19	ENSP00000359546:N19K	ENSP00000359546:N19K	N	-	3	2	SPANXD	140614172	0.220000	0.23631	0.016000	0.15963	0.032000	0.12392	0.740000	0.26188	0.080000	0.16959	0.081000	0.15443	AAC	-	SPANXD	-	pfam_SPANX_prot		0.507	SPANXD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXD	HGNC	protein_coding	OTTHUMT00000058598.1	1	1	0	196	196	24	0.51	0.00	G			140786506	-1	74	2	45	22	tier1	no_errors	ENST00000370515	ensembl	human	known	74_37	missense	62.18	8.33	SNP	0.016	T	74	45
