#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
OPHN1	4983	genome.wustl.edu	37	X	67283813	67283813	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:67283813C>A	ENST00000355520.5	-	21	2682	c.2041G>T	c.(2041-2043)Ggg>Tgg	p.G681W	OPHN1_ENST00000484842.1_5'UTR|OPHN1_ENST00000540071.1_Intron	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	681	Pro-rich.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						ATCTTGGTCCCTCCATCCTGC	0.607													ENSG00000079482																																					0													79.0	61.0	67.0					X																	67283813		2203	4300	6503	SO:0001583	missense	0			-	AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.2041G>T	X.37:g.67283813C>A	ENSP00000347710:p.Gly681Trp		B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.G681W	ENST00000355520.5	37	c.2041	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828782	0.50845	.	.	ENSG00000079482	ENST00000355520	T	0.50001	0.76	4.9	4.02	0.46733	.	0.185819	0.37437	N	0.002083	T	0.34687	0.0906	N	0.14661	0.345	0.80722	D	1	D	0.54047	0.964	P	0.46685	0.524	T	0.24048	-1.0171	10	0.72032	D	0.01	.	9.9236	0.41478	0.0:0.7987:0.2013:0.0	.	681	O60890	OPHN1_HUMAN	W	681	ENSP00000347710:G681W	ENSP00000347710:G681W	G	-	1	0	OPHN1	67200538	1.000000	0.71417	0.979000	0.43373	0.631000	0.37964	2.576000	0.46033	1.037000	0.40024	0.506000	0.49869	GGG	-	OPHN1	-	NULL		0.607	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	0	0	0	110	110	96	0.00	0.00	C	NM_002547		67283813	-1	12	16	44	72	tier1	no_errors	ENST00000355520	ensembl	human	known	74_37	missense	21.43	18.18	SNP	0.990	A	12	44
NRIP3	56675	genome.wustl.edu	37	11	9007284	9007284	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:9007284C>T	ENST00000309166.3	-	4	649	c.536G>A	c.(535-537)cGc>cAc	p.R179H	NRIP3_ENST00000531090.1_Intron	NM_020645.2	NP_065696.1	Q9NQ35	NRIP3_HUMAN	nuclear receptor interacting protein 3	179							aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|lung(4)|skin(1)|stomach(1)	7				Epithelial(150;4.77e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0241)		GCAGTCCAGGCGGAGGGAGCC	0.542													ENSG00000175352																																					0													131.0	127.0	129.0					11																	9007284		2201	4296	6497	SO:0001583	missense	0			-	AJ400877	CCDS31422.1	11p15.3	2008-02-05	2003-09-03	2003-09-05	ENSG00000175352	ENSG00000175352			1167	protein-coding gene	gene with protein product		613125	"""chromosome 11 open reading frame 14"""	C11orf14		11528127	Standard	NM_020645		Approved		uc001mhg.2	Q9NQ35	OTTHUMG00000165680	ENST00000309166.3:c.536G>A	11.37:g.9007284C>T	ENSP00000310205:p.Arg179His		Q86WD9	Missense_Mutation	SNP	pfam_Peptidase_aspartic_DDI1-type,superfamily_Peptidase_aspartic_dom	p.R179H	ENST00000309166.3	37	c.536	CCDS31422.1	11	.	.	.	.	.	.	.	.	.	.	C	17.07	3.295976	0.60086	.	.	ENSG00000175352	ENST00000309166;ENST00000531142	T	0.39592	1.07	6.02	4.17	0.49024	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);	0.399819	0.28214	N	0.016167	T	0.49541	0.1563	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.60609	0.877	T	0.49418	-0.8942	10	0.14656	T	0.56	.	6.3337	0.21285	0.1464:0.701:0.0:0.1526	.	179	Q9NQ35	NRIP3_HUMAN	H	179;7	ENSP00000310205:R179H	ENSP00000310205:R179H	R	-	2	0	NRIP3	8963860	0.465000	0.25815	0.992000	0.48379	0.835000	0.47333	0.090000	0.15025	0.893000	0.36288	-0.150000	0.13652	CGC	-	NRIP3	-	pfam_Peptidase_aspartic_DDI1-type,superfamily_Peptidase_aspartic_dom		0.542	NRIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRIP3	HGNC	protein_coding	OTTHUMT00000385774.1	0	0	0	67	67	93	0.00	0.00	C	NM_020645		9007284	-1	5	24	47	82	tier1	no_errors	ENST00000309166	ensembl	human	known	74_37	missense	9.62	22.64	SNP	0.998	T	5	47
C7orf25	79020	genome.wustl.edu	37	7	42950004	42950004	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr7:42950004T>A	ENST00000350427.4	-	2	771	c.496A>T	c.(496-498)Atc>Ttc	p.I166F	C7orf25_ENST00000431882.2_Missense_Mutation_p.I224F|C7orf25_ENST00000447342.1_Missense_Mutation_p.I166F|C7orf25_ENST00000438029.1_Missense_Mutation_p.I166F|PSMA2_ENST00000442788.1_3'UTR			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	166										endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						AATGCAAAGATGATGTGAGGG	0.502													ENSG00000136197																																					0													96.0	86.0	89.0					7																	42950004		2203	4300	6503	SO:0001583	missense	0			-	BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.496A>T	7.37:g.42950004T>A	ENSP00000343364:p.Ile166Phe		A4D1V2|J3KR36|Q9H779	Missense_Mutation	SNP	pfam_DUF1308	p.I224F	ENST00000350427.4	37	c.670	CCDS5466.1	7	.	.	.	.	.	.	.	.	.	.	T	14.00	2.405216	0.42613	.	.	ENSG00000136197	ENST00000350427;ENST00000447342;ENST00000431882;ENST00000438029;ENST00000425683	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.8	-2.11	0.07187	.	0.296244	0.34484	N	0.003935	T	0.34337	0.0894	M	0.71581	2.175	0.54753	D	0.999984	B;B;B	0.31503	0.188;0.326;0.036	B;B;B	0.36989	0.238;0.139;0.102	T	0.16100	-1.0414	10	0.10111	T	0.7	-6.0784	6.3873	0.21568	0.1081:0.314:0.0:0.5779	.	166;224;166	C9K0L6;B4DQM3;Q9BPX7	.;.;CG025_HUMAN	F	166;166;224;166;166	ENSP00000343364:I166F;ENSP00000413029:I166F;ENSP00000416290:I224F;ENSP00000396597:I166F;ENSP00000413106:I166F	ENSP00000343364:I166F	I	-	1	0	C7orf25	42916529	1.000000	0.71417	0.955000	0.39395	0.990000	0.78478	0.842000	0.27627	-0.104000	0.12154	0.454000	0.30748	ATC	-	C7orf25	-	pfam_DUF1308		0.502	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf25	HGNC	protein_coding	OTTHUMT00000250814.2	0	0	0	44	44	52	0.00	0.00	T	NM_024054		42950004	-1	9	15	18	51	tier1	no_errors	ENST00000431882	ensembl	human	known	74_37	missense	33.33	22.73	SNP	0.947	A	9	18
SULT1B1	27284	genome.wustl.edu	37	4	70596224	70596224	+	Missense_Mutation	SNP	C	C	T	rs142990488	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:70596224C>T	ENST00000310613.3	-	7	1070	c.773G>A	c.(772-774)cGt>cAt	p.R258H		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	258					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						TTTACCTTTACGCATAAAAGG	0.353													ENSG00000173597	C|||	5	0.000998403	0.0	0.0	5008	,	,		16912	0.002		0.0	False		,,,				2504	0.0031																0								C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	129.0	123.0	125.0		773	3.4	1.0	4	dbSNP_134	125	0,8600		0,0,4300	yes	missense	SULT1B1	NM_014465.3	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	258/297	70596224	1,13005	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.773G>A	4.37:g.70596224C>T	ENSP00000308770:p.Arg258His		O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R258H	ENST00000310613.3	37	c.773	CCDS3530.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	14.16	2.452004	0.43531	2.27E-4	0.0	ENSG00000173597	ENST00000310613	T	0.03181	4.02	4.27	3.43	0.39272	Sulfotransferase domain (1);	0.397593	0.18360	N	0.143598	T	0.28797	0.0714	H	0.98111	4.15	0.41988	D	0.99083	D	0.89917	1.0	D	0.97110	1.0	T	0.32134	-0.9918	10	0.87932	D	0	.	10.1702	0.42904	0.0:0.8991:0.0:0.1009	.	258	O43704	ST1B1_HUMAN	H	258	ENSP00000308770:R258H	ENSP00000308770:R258H	R	-	2	0	SULT1B1	70630813	1.000000	0.71417	0.997000	0.53966	0.171000	0.22731	5.795000	0.69074	0.937000	0.37394	-0.373000	0.07131	CGT	rs142990488	SULT1B1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.353	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1B1	HGNC	protein_coding	OTTHUMT00000251563.2	0	0	0	47	47	156	0.00	0.00	C	NM_014465		70596224	-1	4	50	6	100	tier1	no_errors	ENST00000310613	ensembl	human	known	74_37	missense	40.00	33.33	SNP	1.000	T	4	6
COL4A6	1288	genome.wustl.edu	37	X	107417804	107417804	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:107417804C>A	ENST00000372216.4	-	31	3107	c.3007G>T	c.(3007-3009)Gct>Tct	p.A1003S	COL4A6_ENST00000545689.1_Missense_Mutation_p.A1002S|COL4A6_ENST00000394872.2_Missense_Mutation_p.A1003S|COL4A6_ENST00000334504.7_Missense_Mutation_p.A1002S|COL4A6_ENST00000538570.1_Missense_Mutation_p.A1002S	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1003	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						AGGCCAGGAGCTCCAGGTAGG	0.547									Alport syndrome with Diffuse Leiomyomatosis				ENSG00000197565																									Melanoma(87;1895 1945 2589 7165)												0													30.0	32.0	31.0					X																	107417804		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		-	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3007G>T	X.37:g.107417804C>A	ENSP00000361290:p.Ala1003Ser		Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.A1003S	ENST00000372216.4	37	c.3007	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	4.227	0.041020	0.08196	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08	5.03	-0.63	0.11530	.	0.945621	0.08713	N	0.904678	D	0.84866	0.5567	N	0.16201	0.385	0.09310	N	1	P;D;P;P	0.58970	0.842;0.984;0.883;0.594	B;P;P;P	0.51487	0.39;0.671;0.625;0.458	T	0.74922	-0.3499	10	0.07990	T	0.79	.	6.264	0.20915	0.0:0.1697:0.2685:0.5618	.	1002;1002;1003;1002	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	S	1003;1002;1003;1002;1002;1002	ENSP00000361290:A1003S;ENSP00000334733:A1002S;ENSP00000378340:A1003S;ENSP00000443707:A1002S;ENSP00000445236:A1002S	ENSP00000334733:A1002S	A	-	1	0	COL4A6	107304460	0.003000	0.15002	0.115000	0.21578	0.175000	0.22909	-0.325000	0.07976	-0.156000	0.11079	-0.199000	0.12753	GCT	-	COL4A6	-	pfam_Collagen		0.547	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	0	0	0	148	148	48	0.00	0.00	C			107417804	-1	12	14	30	45	tier1	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	28.57	23.73	SNP	0.010	A	12	30
GSDMC	56169	genome.wustl.edu	37	8	130777930	130777930	+	Missense_Mutation	SNP	C	C	T	rs375510820		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:130777930C>T	ENST00000276708.4	-	4	1395	c.514G>A	c.(514-516)Gat>Aat	p.D172N		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	172						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)		p.D172N(1)		autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						CTACTGCTATCGTACAGCACA	0.428													ENSG00000147697																																					1	Substitution - Missense(1)	skin(1)						C	ASN/ASP	3,4403	6.2+/-15.9	0,3,2200	124.0	116.0	119.0		514	-2.6	0.0	8		119	0,8600		0,0,4300	no	missense	GSDMC	NM_031415.2	23	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	benign	172/509	130777930	3,13003	2203	4300	6503	SO:0001583	missense	0			-	AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.514G>A	8.37:g.130777930C>T	ENSP00000276708:p.Asp172Asn		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.D172N	ENST00000276708.4	37	c.514	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	C	8.527	0.870003	0.17322	6.81E-4	0.0	ENSG00000147697	ENST00000276708	T	0.23348	1.91	4.51	-2.59	0.06209	.	1.724680	0.02841	N	0.128013	T	0.17492	0.0420	L	0.31926	0.97	0.09310	N	1	B	0.26258	0.145	B	0.23018	0.043	T	0.12760	-1.0535	10	0.22109	T	0.4	.	5.341	0.15984	0.1422:0.3789:0.0:0.4789	.	172	Q9BYG8	GSDMC_HUMAN	N	172	ENSP00000276708:D172N	ENSP00000276708:D172N	D	-	1	0	GSDMC	130847112	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.739000	0.04866	-0.582000	0.05929	-1.936000	0.00505	GAT	-	GSDMC	-	pfam_Gasdermin		0.428	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	0	0	0	83	83	95	0.00	0.00	C			130777930	-1	15	34	18	68	tier1	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	45.45	33.33	SNP	0.000	T	15	18
PPP2R2C	5522	genome.wustl.edu	37	4	6374262	6374262	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:6374262C>T	ENST00000382599.4	-	5	829	c.613G>A	c.(613-615)Gac>Aac	p.D205N	PPP2R2C_ENST00000335585.5_Missense_Mutation_p.D205N|PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.D188N|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.D198N|PPP2R2C_ENST00000507294.1_Missense_Mutation_p.D198N			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	205					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						AAGCTCCTGTCGGTGATGGCC	0.582													ENSG00000074211																																					0													144.0	116.0	126.0					4																	6374262		2203	4300	6503	SO:0001583	missense	0			-	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.613G>A	4.37:g.6374262C>T	ENSP00000372042:p.Asp205Asn		A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.D205N	ENST00000382599.4	37	c.613		4	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661985	0.47572	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.34472	1.36;1.37;1.37;1.37;1.37	4.18	4.18	0.49190	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.32315	0.0825	L	0.50993	1.605	0.80722	D	1	B;B;B;B;B	0.26318	0.009;0.146;0.016;0.009;0.007	B;B;B;B;B	0.20577	0.007;0.03;0.007;0.007;0.007	T	0.10520	-1.0626	10	0.21540	T	0.41	-54.1694	16.0314	0.80579	0.0:1.0:0.0:0.0	.	198;301;205;188;205	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	N	205;198;188;205;198	ENSP00000335083:D205N;ENSP00000423649:D198N;ENSP00000422374:D188N;ENSP00000372042:D205N;ENSP00000425247:D198N	ENSP00000335083:D205N	D	-	1	0	PPP2R2C	6425163	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	5.333000	0.65917	2.327000	0.79052	0.462000	0.41574	GAC	-	PPP2R2C	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55,prints_PP2A_PR55		0.582	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	PPP2R2C	HGNC	protein_coding	OTTHUMT00000206889.2	0	0	0	66	66	41	0.00	0.00	C	NM_181876		6374262	-1	12	5	19	39	tier1	no_errors	ENST00000335585	ensembl	human	known	74_37	missense	38.71	11.36	SNP	1.000	T	12	19
ZNF486	90649	genome.wustl.edu	37	19	20296806	20296806	+	Silent	SNP	C	C	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296806C>G	ENST00000335117.8	+	3	225	c.168C>G	c.(166-168)gtC>gtG	p.V56V	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.V56V|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GTATTATTGTCTCTAAGCCAG	0.363													ENSG00000256229																																					0													68.0	71.0	70.0					19																	20296806		2166	4289	6455	SO:0001819	synonymous_variant	0			-	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.168C>G	19.37:g.20296806C>G			Q0VG00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V56	ENST00000335117.8	37	c.168	CCDS46029.1	19																																																																																			-	ZNF486	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.363	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	0	0	0	93	93	12	0.00	0.00	C	NM_052852		20296806	+1	7	6	36	16	tier1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	16.28	27.27	SNP	0.087	G	7	36
GGTLC2	91227	genome.wustl.edu	37	22	22989254	22989254	+	Silent	SNP	C	C	T	rs138799771		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr22:22989254C>T	ENST00000480559.1	+	2	207	c.207C>T	c.(205-207)agC>agT	p.S69S	GGTLC2_ENST00000448514.1_Silent_p.S69S|POM121L1P_ENST00000402027.1_RNA	NM_199127.2	NP_954578.2	Q14390	GGTL2_HUMAN	gamma-glutamyltransferase light chain 2	69					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)	gamma-glutamyltransferase activity (GO:0003840)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	11	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.3e-31)|Acute lymphoblastic leukemia(6;5.54e-23)		READ - Rectum adenocarcinoma(21;0.145)		CCCCGGTCAGCGAGATCCTGT	0.587													ENSG00000100121																																					0								C		1,4405	2.1+/-5.4	0,1,2202	64.0	69.0	67.0		207		0.0	22	dbSNP_134	67	0,8592		0,0,4296	no	coding-synonymous	GGTLC2	NM_199127.2		0,1,6498	TT,TC,CC		0.0,0.0227,0.0077		69/219	22989254	1,12997	2203	4296	6499	SO:0001819	synonymous_variant	0			-	X98922	CCDS13802.2	22q11.21	2008-03-25	2008-03-10	2008-03-10	ENSG00000100121	ENSG00000100121		"""Gamma-glutamyltransferases"""	18596	protein-coding gene	gene with protein product		612339	"""gamma-glutamyltransferase-like 4"""	GGTL4		9074928, 18357469	Standard	NM_199127		Approved		uc010gtt.2	Q14390	OTTHUMG00000151177	ENST00000480559.1:c.207C>T	22.37:g.22989254C>T			A1A516|A2VCM9|Q5NV76|Q6ISH0	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.S69	ENST00000480559.1	37	c.207	CCDS13802.2	22																																																																																			rs138799771	GGTLC2	-	pfam_GGT_peptidase,prints_GGT_peptidase		0.587	GGTLC2-001	KNOWN	basic|CCDS	protein_coding	GGTLC2	HGNC	protein_coding	OTTHUMT00000321662.1	1	1	0	260	260	39	0.38	0.00	C	NM_199127		22989254	+1	26	10	178	39	tier1	no_errors	ENST00000448514	ensembl	human	known	74_37	silent	12.68	20.41	SNP	0.996	T	26	178
IL27	246778	genome.wustl.edu	37	16	28513296	28513296	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr16:28513296C>T	ENST00000356897.1	-	4	485		c.e4+1			NM_145659.3	NP_663634.2	Q8TAD2	IL17D_HUMAN	interleukin 27						inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	10						CCGGGCTCTACCTGGAAGCGG	0.632													ENSG00000197272																																					0													100.0	106.0	104.0					16																	28513296		2197	4300	6497	SO:0001630	splice_region_variant	0			-	AY099296	CCDS10633.1	16p11	2011-07-21	2003-12-17	2003-12-19	ENSG00000197272	ENSG00000197272		"""Interleukins and interleukin receptors"""	19157	protein-coding gene	gene with protein product		608273	"""interleukin 30"""	IL30		12121660	Standard	NM_145659		Approved	IL-27, p28, IL27p28, IL-27A, IL27A, MGC71873	uc002dqc.3	Q8NEV9	OTTHUMG00000097023	ENST00000356897.1:c.462+1G>A	16.37:g.28513296C>T			B1AM69	Splice_Site	SNP	-	e4+1	ENST00000356897.1	37	c.462+1	CCDS10633.1	16	.	.	.	.	.	.	.	.	.	.	C	9.384	1.073737	0.20147	.	.	ENSG00000197272	ENST00000356897	.	.	.	3.52	3.52	0.40303	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.4612	0.44581	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	IL27	28420797	1.000000	0.71417	0.981000	0.43875	0.147000	0.21601	3.215000	0.51169	1.811000	0.52892	0.281000	0.19383	.	-	IL27	-	-		0.632	IL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27	HGNC	protein_coding	OTTHUMT00000214114.1	0	0	0	64	64	48	0.00	0.00	C	NM_145659	Intron	28513296	-1	6	20	31	34	tier1	no_errors	ENST00000356897	ensembl	human	known	74_37	splice_site	16.22	37.04	SNP	0.993	T	6	31
TYR	7299	genome.wustl.edu	37	11	88911205	88911205	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:88911205G>C	ENST00000263321.5	+	1	586	c.84G>C	c.(82-84)aaG>aaC	p.K28N	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	28					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	TCTCCTCTAAGAACCTGATGG	0.547													ENSG00000077498																																					0													77.0	76.0	76.0					11																	88911205		2201	4299	6500	SO:0001583	missense	0			-	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.84G>C	11.37:g.88911205G>C	ENSP00000263321:p.Lys28Asn		Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.K28N	ENST00000263321.5	37	c.84	CCDS8284.1	11	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706895	0.48412	.	.	ENSG00000077498	ENST00000263321	D	0.99136	-5.47	6.07	6.07	0.98685	.	0.414174	0.29964	N	0.010741	D	0.97801	0.9278	L	0.57536	1.79	0.38986	D	0.959057	B	0.27932	0.194	B	0.28991	0.097	D	0.97314	0.9939	9	.	.	.	.	16.8564	0.86007	0.0:0.1281:0.8719:0.0	.	28	P14679	TYRO_HUMAN	N	28	ENSP00000263321:K28N	.	K	+	3	2	TYR	88550853	1.000000	0.71417	0.976000	0.42696	0.775000	0.43874	1.193000	0.32162	2.885000	0.99019	0.655000	0.94253	AAG	-	TYR	-	NULL		0.547	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	0	0	0	45	45	82	0.00	0.00	G	NM_000372		88911205	+1	6	27	14	68	tier1	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	30.00	28.42	SNP	0.999	C	6	14
ABLIM2	84448	genome.wustl.edu	37	4	8079400	8079400	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:8079400G>A	ENST00000341937.5	-	6	694	c.630C>T	c.(628-630)atC>atT	p.I210I	ABLIM2_ENST00000546334.1_Silent_p.I210I|ABLIM2_ENST00000296372.8_Silent_p.I210I|ABLIM2_ENST00000428004.2_Silent_p.I210I|ABLIM2_ENST00000361581.5_Silent_p.I210I|ABLIM2_ENST00000318888.4_5'UTR|ABLIM2_ENST00000545242.1_Silent_p.I210I|ABLIM2_ENST00000505872.1_Silent_p.I210I|ABLIM2_ENST00000447017.2_Silent_p.I210I|ABLIM2_ENST00000407564.3_Silent_p.I210I|ABLIM2_ENST00000361737.5_Silent_p.I210I	NM_001130084.1	NP_001123556.1	Q6H8Q1	ABLM2_HUMAN	actin binding LIM protein family, member 2	210	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.|LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|myofibril (GO:0030016)	zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|pancreas(3)|prostate(2)|urinary_tract(1)	25						TGTCACAGCGGATGCCGAACT	0.652													ENSG00000163995																																					0													38.0	41.0	40.0					4																	8079400		2124	4238	6362	SO:0001819	synonymous_variant	0			-	AB058711	CCDS47011.1, CCDS47012.1, CCDS47013.1, CCDS47014.1, CCDS47015.1, CCDS47016.1, CCDS54719.1, CCDS68669.1	4p16.1	2012-05-16			ENSG00000163995	ENSG00000163995			19195	protein-coding gene	gene with protein product		612544	"""actin binding LIM protein 2"""				Standard	NM_001130083		Approved	KIAA1808	uc003gkj.4	Q6H8Q1	OTTHUMG00000057427	ENST00000341937.5:c.630C>T	4.37:g.8079400G>A			E9PF39|Q08E71|Q19VH0|Q6H8Q0|Q6NX73|Q8N3C5|Q8N9E9|Q8N9G2|Q96JL7	Silent	SNP	pfam_Znf_LIM,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Znf_LIM,smart_Villin_headpiece,pfscan_Villin_headpiece,pfscan_Znf_LIM	p.I210	ENST00000341937.5	37	c.630	CCDS47013.1	4																																																																																			-	ABLIM2	-	pfscan_Znf_LIM		0.652	ABLIM2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABLIM2	HGNC	protein_coding	OTTHUMT00000358862.2	0	0	0	162	162	38	0.00	0.00	G	NM_001130083		8079400	-1	9	5	54	33	tier1	no_errors	ENST00000447017	ensembl	human	known	74_37	silent	14.29	13.16	SNP	0.957	A	9	54
DCAF4L2	138009	genome.wustl.edu	37	8	88885852	88885852	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:88885852C>T	ENST00000319675.3	-	1	444	c.348G>A	c.(346-348)ccG>ccA	p.P116P		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	116										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						GGGTTTTGTGCGGGTATACCC	0.552													ENSG00000176566																																					0													128.0	124.0	125.0					8																	88885852		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.348G>A	8.37:g.88885852C>T				Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P116	ENST00000319675.3	37	c.348	CCDS6245.1	8																																																																																			-	DCAF4L2	-	superfamily_WD40_repeat_dom		0.552	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	0	0	1	60	60	117	0.00	0.85	C	NM_152418		88885852	-1	4	16	29	100	tier1	no_errors	ENST00000319675	ensembl	human	known	74_37	silent	12.12	13.79	SNP	0.946	T	4	29
ARG2	384	genome.wustl.edu	37	14	68117433	68117433	+	Splice_Site	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:68117433G>A	ENST00000261783.3	+	8	1041	c.861G>A	c.(859-861)ggG>ggA	p.G287G	VTI1B_ENST00000554659.1_3'UTR	NM_001172.3	NP_001163.1	P78540	ARGI2_HUMAN	arginase 2	287					arginine metabolic process (GO:0006525)|cellular nitrogen compound metabolic process (GO:0034641)|nitric oxide biosynthetic process (GO:0006809)|small molecule metabolic process (GO:0044281)|striated muscle contraction (GO:0006941)|urea cycle (GO:0000050)|ureteric bud development (GO:0001657)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	arginase activity (GO:0004053)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|ovary(1)|prostate(1)	11				all cancers(60;0.000582)|OV - Ovarian serous cystadenocarcinoma(108;0.00392)|BRCA - Breast invasive adenocarcinoma(234;0.00928)	L-Arginine(DB00125)|L-Ornithine(DB00129)	TTCTTCCAGGGTTGCTATCAG	0.488													ENSG00000081181																																					0													103.0	95.0	98.0					14																	68117433		2203	4300	6503	SO:0001630	splice_region_variant	0			-	D86724	CCDS9785.1	14q24.1	2013-05-01	2013-05-01			ENSG00000081181			664	protein-coding gene	gene with protein product		107830	"""arginase, type II"""			8954792, 8898077	Standard	NM_001172		Approved		uc001xjs.3	P78540		ENST00000261783.3:c.860-1G>A	14.37:g.68117433G>A			B2R690|Q6FHY8	Silent	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase	p.G287	ENST00000261783.3	37	c.861	CCDS9785.1	14																																																																																			-	ARG2	-	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Arginase		0.488	ARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARG2	HGNC	protein_coding	OTTHUMT00000415190.2	0	0	0	27	27	103	0.00	0.00	G	NM_001172	Silent	68117433	+1	7	26	9	84	tier1	no_errors	ENST00000261783	ensembl	human	known	74_37	silent	43.75	23.64	SNP	0.687	A	7	9
USH2A	7399	genome.wustl.edu	37	1	216246595	216246595	+	Missense_Mutation	SNP	C	C	T	rs200923150		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:216246595C>T	ENST00000307340.3	-	28	6006	c.5620G>A	c.(5620-5622)Gtt>Att	p.V1874I	USH2A_ENST00000366943.2_Missense_Mutation_p.V1874I|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1874	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GCCAAGTTAACGACAGCACCC	0.453										HNSCC(13;0.011)			ENSG00000042781																																					0													81.0	67.0	71.0					1																	216246595		2203	4300	6503	SO:0001583	missense	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5620G>A	1.37:g.216246595C>T	ENSP00000305941:p.Val1874Ile		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.V1874I	ENST00000307340.3	37	c.5620	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481524	0.44147	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.79352	-1.26;-1.26	5.93	4.04	0.47022	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (3);Laminin G domain (1);	0.174654	0.26875	N	0.022051	T	0.68833	0.3044	L	0.55103	1.725	0.36610	D	0.875133	B	0.19445	0.036	B	0.12837	0.008	T	0.63134	-0.6705	10	0.14656	T	0.56	.	9.6692	0.40002	0.1402:0.7891:0.0:0.0707	.	1874	O75445	USH2A_HUMAN	I	1874	ENSP00000305941:V1874I;ENSP00000355910:V1874I	ENSP00000305941:V1874I	V	-	1	0	USH2A	214313218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.968000	0.40500	0.811000	0.34303	0.655000	0.94253	GTT	-	USH2A	-	superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Laminin_G		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	44	44	87	0.00	0.00	C	NM_007123		216246595	-1	4	29	11	76	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	26.67	27.62	SNP	1.000	T	4	11
FBN3	84467	genome.wustl.edu	37	19	8193949	8193949	+	Silent	SNP	G	G	A	rs60853419		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:8193949G>A	ENST00000600128.1	-	18	2673	c.2259C>T	c.(2257-2259)ccC>ccT	p.P753P	FBN3_ENST00000601739.1_Silent_p.P753P|FBN3_ENST00000270509.2_Silent_p.P753P			Q75N90	FBN3_HUMAN	fibrillin 3	753	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGTGGAAGCCGGGGGGGCAGG	0.597													ENSG00000142449	g|||	1	0.000199681	0.0	0.0	5008	,	,		18394	0.001		0.0	False		,,,				2504	0.0																0								A		0,4406		0,0,2203	43.0	48.0	46.0		2259	-3.0	0.2	19	dbSNP_129	46	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	FBN3	NM_032447.3		0,2,6501	AA,AG,GG		0.0233,0.0,0.0154		753/2810	8193949	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2259C>T	19.37:g.8193949G>A			Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.P753	ENST00000600128.1	37	c.2259	CCDS12196.1	19																																																																																			rs60853419	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.597	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	0	0	1	79	79	61	0.00	1.61	G	NM_032447		8193949	-1	20	20	33	43	tier1	no_errors	ENST00000270509	ensembl	human	known	74_37	silent	36.36	31.25	SNP	0.646	A	20	33
DIP2B	57609	genome.wustl.edu	37	12	51112505	51112505	+	Silent	SNP	T	T	G			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:51112505T>G	ENST00000301180.5	+	24	2899	c.2865T>G	c.(2863-2865)gcT>gcG	p.A955A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	955						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						TAGGCCCTGCTTCCGTGATGG	0.458													ENSG00000066084																																					0													137.0	114.0	122.0					12																	51112505		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2865T>G	12.37:g.51112505T>G			Q6B011|Q8N1L5|Q8NB38	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A955	ENST00000301180.5	37	c.2865	CCDS31799.1	12																																																																																			-	DIP2B	-	NULL		0.458	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	0	0	0	76	76	104	0.00	0.00	T	NM_173602		51112505	+1	7	32	28	77	tier1	no_errors	ENST00000301180	ensembl	human	known	74_37	silent	20.00	29.36	SNP	0.986	G	7	28
TSPAN19	144448	genome.wustl.edu	37	12	85421771	85421771	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:85421771G>A	ENST00000532498.2	-	4	250	c.170C>T	c.(169-171)tCt>tTt	p.S57F	TSPAN19_ENST00000547403.2_Intron	NM_001100917.1	NP_001094387.1	P0C672	TSN19_HUMAN	tetraspanin 19	57						integral component of membrane (GO:0016021)				ovary(1)	1						CAAAATTTGAGAAATAGGTAC	0.289													ENSG00000231738																																					0													59.0	54.0	56.0					12																	85421771		1804	4066	5870	SO:0001583	missense	0			-		CCDS44949.1	12q21.31	2013-02-14			ENSG00000231738	ENSG00000231738		"""Tetraspanins"""	31886	protein-coding gene	gene with protein product							Standard	NM_001100917		Approved		uc009zsj.3	P0C672	OTTHUMG00000166181	ENST00000532498.2:c.170C>T	12.37:g.85421771G>A	ENSP00000433816:p.Ser57Phe			Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.S57F	ENST00000532498.2	37	c.170	CCDS44949.1	12	.	.	.	.	.	.	.	.	.	.	G	6.419	0.445465	0.12164	.	.	ENSG00000231738	ENST00000532498;ENST00000547836	T;T	0.79554	-1.28;-1.28	4.4	1.35	0.21983	.	.	.	.	.	T	0.68118	0.2966	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.14023	0.01	T	0.56214	-0.8016	9	0.48119	T	0.1	.	7.2829	0.26322	0.2951:0.0:0.7049:0.0	.	57	P0C672	TSN19_HUMAN	F	57	ENSP00000433816:S57F;ENSP00000446898:S57F	ENSP00000433816:S57F	S	-	2	0	TSPAN19	83945902	0.112000	0.22096	0.002000	0.10522	0.047000	0.14425	0.260000	0.18424	0.129000	0.18514	0.655000	0.94253	TCT	-	TSPAN19	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin		0.289	TSPAN19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN19	HGNC	protein_coding	OTTHUMT00000388240.2	0	0	0	91	91	97	0.00	0.00	G	NM_001100917		85421771	-1	180	409	165	363	tier1	no_errors	ENST00000532498	ensembl	human	known	74_37	missense	52.17	52.91	SNP	0.013	A	180	165
NRXN3	9369	genome.wustl.edu	37	14	80328258	80328258	+	Missense_Mutation	SNP	A	A	G	rs200832810		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr14:80328258A>G	ENST00000557594.1	+	6	2818	c.1865A>G	c.(1864-1866)aAg>aGg	p.K622R	NRXN3_ENST00000428277.2_Missense_Mutation_p.K444R|NRXN3_ENST00000554719.1_Missense_Mutation_p.K1046R|NRXN3_ENST00000335750.5_Missense_Mutation_p.K1046R|NRXN3_ENST00000281127.7_Missense_Mutation_p.K417R|NRXN3_ENST00000556003.1_3'UTR	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	622					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		CAGAGCTCGAAGAGCGGCCAC	0.522													ENSG00000021645																																					0													78.0	81.0	80.0					14																	80328258		2203	4300	6503	SO:0001583	missense	0			GMAF=0	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1865A>G	14.37:g.80328258A>G	ENSP00000451672:p.Lys622Arg		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.K1046R	ENST00000557594.1	37	c.3137		14	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	A	16.99	3.273327	0.59649	.	.	ENSG00000021645	ENST00000330071;ENST00000554719;ENST00000335750;ENST00000557594;ENST00000281127;ENST00000428277	T;T;T;T;T	0.70986	-0.53;-0.53;1.03;1.24;1.04	5.9	5.9	0.94986	.	0.108957	0.64402	D	0.000009	T	0.75606	0.3872	M	0.61703	1.905	0.40838	D	0.983641	P;P;D;B	0.57899	0.902;0.952;0.981;0.122	B;P;P;B	0.50537	0.318;0.6;0.643;0.173	T	0.76761	-0.2840	9	.	.	.	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	444;417;622;1046	Q9HDB5-4;Q9HDB5-2;Q9HDB5;Q9Y4C0-3	.;.;NRX3B_HUMAN;.	R	1628;1046;1046;622;417;444	ENSP00000451648:K1046R;ENSP00000338349:K1046R;ENSP00000451672:K622R;ENSP00000281127:K417R;ENSP00000394426:K444R	.	K	+	2	0	NRXN3	79398011	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	9.339000	0.96797	2.251000	0.74343	0.528000	0.53228	AAG	rs200832810	NRXN3	-	NULL		0.522	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	0	0	0	17	17	84	0.00	0.00	A	NM_001105250		80328258	+1	4	20	6	67	tier1	no_errors	ENST00000335750	ensembl	human	known	74_37	missense	36.36	22.99	SNP	1.000	G	4	6
ZNF486	90649	genome.wustl.edu	37	19	20296831	20296831	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296831C>T	ENST00000335117.8	+	3	250	c.193C>T	c.(193-195)Ctg>Ttg	p.L65L	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.L65L|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						GATCACCTGTCTGGAGCAAGG	0.373													ENSG00000256229																																					0													80.0	83.0	82.0					19																	20296831		2173	4293	6466	SO:0001819	synonymous_variant	0			-	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.193C>T	19.37:g.20296831C>T			Q0VG00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L65	ENST00000335117.8	37	c.193	CCDS46029.1	19																																																																																			-	ZNF486	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.373	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	0	0	0	94	94	13	0.00	0.00	C	NM_052852		20296831	+1	10	3	47	15	tier1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	17.54	16.67	SNP	0.043	T	10	47
KIAA2018	205717	genome.wustl.edu	37	3	113377201	113377201	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr3:113377201C>T	ENST00000478658.1	-	5	3345	c.3328G>A	c.(3328-3330)Gaa>Aaa	p.E1110K	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.E1110K			Q68DE3	K2018_HUMAN	KIAA2018	1110						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GTCACATCTTCTCTTGTTGTT	0.443													ENSG00000176542																																					0													146.0	137.0	140.0					3																	113377201		1989	4173	6162	SO:0001583	missense	0			-	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3328G>A	3.37:g.113377201C>T	ENSP00000420721:p.Glu1110Lys		Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.E1110K	ENST00000478658.1	37	c.3328	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	19.31	3.802376	0.70682	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15834	2.39;2.39	4.9	4.9	0.64082	.	0.106321	0.41294	N	0.000917	T	0.31606	0.0802	L	0.29908	0.895	0.52501	D	0.999957	D	0.69078	0.997	D	0.75020	0.985	T	0.05022	-1.0911	10	0.59425	D	0.04	-11.3644	18.2797	0.90094	0.0:1.0:0.0:0.0	.	1110	Q68DE3	K2018_HUMAN	K	1110	ENSP00000320794:E1110K;ENSP00000420721:E1110K	ENSP00000320794:E1110K	E	-	1	0	KIAA2018	114859891	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	5.105000	0.64591	2.560000	0.86352	0.561000	0.74099	GAA	-	KIAA2018	-	NULL		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	0	0	0	34	34	56	0.00	0.00	C	NM_001009899		113377201	-1	5	16	7	32	tier1	no_errors	ENST00000316407	ensembl	human	known	74_37	missense	41.67	33.33	SNP	1.000	T	5	7
MSH3	4437	genome.wustl.edu	37	5	79968152	79968152	+	Silent	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:79968152A>T	ENST00000265081.6	+	5	962	c.882A>T	c.(880-882)gtA>gtT	p.V294V		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	294	Interaction with EXO1.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		TTGTTCATGTACGCCGCCTGG	0.413								Mismatch excision repair (MMR)					ENSG00000113318																									Melanoma(88;1010 1399 13793 26548 36275)												0													105.0	100.0	102.0					5																	79968152		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.882A>T	5.37:g.79968152A>T			A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	pfam_D_mismatch_repair_MutS_C,pfam_D_mismatch_repair_MutS_core,pfam_D_mmatch_repair_MutS_con_dom,pfam_D_mismatch_repair_MutS-lik_N,pfam_D_mismatch_repair_MutS_clamp,superfamily_D_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_D_mismatch_repair_MutS_N,superfamily_D_mmatch_repair_MutS_con_dom,smart_D_mismatch_repair_MutS_core,smart_D_mismatch_repair_MutS_C	p.V294	ENST00000265081.6	37	c.882	CCDS34195.1	5																																																																																			-	MSH3	-	pfam_D_mismatch_repair_MutS-lik_N,superfamily_D_mismatch_repair_MutS_N		0.413	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	0	0	0	87	87	108	0.00	0.00	A	NM_002439		79968152	+1	10	32	21	58	tier1	no_errors	ENST00000265081	ensembl	human	known	74_37	silent	32.26	35.56	SNP	0.004	T	10	21
ZNF486	90649	genome.wustl.edu	37	19	20296824	20296824	+	Silent	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:20296824C>T	ENST00000335117.8	+	3	243	c.186C>T	c.(184-186)atC>atT	p.I62I	CTC-260E6.6_ENST00000593655.1_RNA|ZNF486_ENST00000597083.1_Silent_p.I62I|CTC-260E6.6_ENST00000586657.1_RNA|CTC-260E6.6_ENST00000585498.1_RNA	NM_052852.3	NP_443084.2	Q96H40	ZN486_HUMAN	zinc finger protein 486	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11						CAGACCTGATCACCTGTCTGG	0.378													ENSG00000256229																																					0													77.0	81.0	80.0					19																	20296824		2172	4293	6465	SO:0001819	synonymous_variant	0			-	BC008936	CCDS46029.1	19p12	2014-02-13	2003-12-16	2003-12-17	ENSG00000256229	ENSG00000256229		"""Zinc fingers, C2H2-type"", ""-"""	20807	protein-coding gene	gene with protein product			"""KRAB domain only 2"""	KRBO2			Standard	NM_052852		Approved	MGC2396	uc002nou.3	Q96H40	OTTHUMG00000179731	ENST00000335117.8:c.186C>T	19.37:g.20296824C>T			Q0VG00	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I62	ENST00000335117.8	37	c.186	CCDS46029.1	19																																																																																			-	ZNF486	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.378	ZNF486-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF486	HGNC	protein_coding	OTTHUMT00000447843.2	0	0	0	85	85	14	0.00	0.00	C	NM_052852		20296824	+1	9	6	43	15	tier1	no_errors	ENST00000335117	ensembl	human	known	74_37	silent	17.31	28.57	SNP	0.080	T	9	43
ARFGAP2	84364	genome.wustl.edu	37	11	47193866	47193866	+	Missense_Mutation	SNP	A	A	G	rs369493716		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr11:47193866A>G	ENST00000524782.1	-	8	866	c.638T>C	c.(637-639)aTt>aCt	p.I213T	ARFGAP2_ENST00000419701.2_Missense_Mutation_p.I106T|ARFGAP2_ENST00000395449.3_5'UTR|RP11-390K5.6_ENST00000524412.1_RNA|ARFGAP2_ENST00000426335.2_Intron|ARFGAP2_ENST00000319543.6_Intron	NM_001242832.1|NM_032389.4	NP_001229761.1|NP_115765.2	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating protein 2	213	Required for interaction with coatomer.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.I213T(1)		breast(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						CTTCTTGCCAATGATGGAGCT	0.537													ENSG00000149182																																					1	Substitution - Missense(1)	kidney(1)						A	THR/ILE,THR/ILE	1,4401	2.1+/-5.4	0,1,2200	316.0	285.0	295.0		554,638	6.1	1.0	11		295	0,8596		0,0,4298	no	missense,missense	ARFGAP2	NM_001242832.1,NM_032389.4	89,89	0,1,6498	GG,GA,AA		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	185/494,213/522	47193866	1,12997	2201	4298	6499	SO:0001583	missense	0			-	AK027482	CCDS7926.1, CCDS73283.1	11p11.2-p11.12	2012-10-05	2008-01-09	2008-01-09	ENSG00000149182	ENSG00000149182		"""ADP-ribosylation factor GTPase activating proteins"""	13504	protein-coding gene	gene with protein product		606908	"""zinc finger protein 289, ID1 regulated"""	ZNF289		11278321, 14690497	Standard	NM_032389		Approved	IRZ, Zfp289, FLJ14576	uc001ndt.3	Q8N6H7	OTTHUMG00000166773	ENST00000524782.1:c.638T>C	11.37:g.47193866A>G	ENSP00000434442:p.Ile213Thr		B4DX29|B7Z9M7|D3DQQ9|Q3LIF2|Q8N3I1|Q96SX7	Missense_Mutation	SNP	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.I213T	ENST00000524782.1	37	c.638	CCDS7926.1	11	.	.	.	.	.	.	.	.	.	.	A	22.3	4.276919	0.80580	2.27E-4	0.0	ENSG00000149182	ENST00000524782;ENST00000419701;ENST00000525398;ENST00000525314;ENST00000528444	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.99	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.57051	0.2027	M	0.74258	2.255	0.80722	D	1	P;P	0.52061	0.95;0.745	P;B	0.53185	0.72;0.367	T	0.56269	-0.8007	10	0.34782	T	0.22	-15.0887	15.8218	0.78654	1.0:0.0:0.0:0.0	.	106;213	B4DX29;Q8N6H7	.;ARFG2_HUMAN	T	213;106;227;227;238	ENSP00000434442:I213T;ENSP00000389264:I106T;ENSP00000431939:I227T;ENSP00000434809:I227T;ENSP00000431684:I238T	ENSP00000389264:I106T	I	-	2	0	ARFGAP2	47150442	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.870000	0.92336	2.326000	0.78906	0.533000	0.62120	ATT	-	ARFGAP2	-	NULL		0.537	ARFGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP2	HGNC	protein_coding	OTTHUMT00000391425.1	0	0	0	94	94	148	0.00	0.00	A	NM_032389		47193866	-1	8	35	22	98	tier1	no_errors	ENST00000524782	ensembl	human	known	74_37	missense	26.67	26.32	SNP	1.000	G	8	22
SMR3B	10879	genome.wustl.edu	37	4	71255546	71255546	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr4:71255546C>A	ENST00000304915.3	+	3	370	c.221C>A	c.(220-222)cCa>cAa	p.P74Q	SMR3B_ENST00000504825.1_Missense_Mutation_p.P74Q	NM_006685.3	NP_006676.1	P02814	SMR3B_HUMAN	submaxillary gland androgen regulated protein 3B	74	Poly-Pro.|Pro-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				large_intestine(2)|lung(3)|skin(2)	7		all_hematologic(202;0.196)				ATATTTCCACCACCCCCTCCT	0.582													ENSG00000171201																																					0													119.0	111.0	114.0					4																	71255546		2203	4300	6503	SO:0001583	missense	0			-	D29833	CCDS3540.1	4q13.3	2008-02-27	2008-02-27	2005-02-07	ENSG00000171201	ENSG00000171201			17326	protein-coding gene	gene with protein product		611593	"""proline rich 3"", ""submaxillary gland androgen regulated protein 3 homolog B (mouse)"""	PROL3		7982889, 479131	Standard	NM_006685		Approved	P-B, PRL3		P02814	OTTHUMG00000129396	ENST00000304915.3:c.221C>A	4.37:g.71255546C>A	ENSP00000302400:p.Pro74Gln		B7ZMG7|Q9UBN0|Q9UCT0	Missense_Mutation	SNP	NULL	p.P74Q	ENST00000304915.3	37	c.221	CCDS3540.1	4	.	.	.	.	.	.	.	.	.	.	C	2.065	-0.414438	0.04766	.	.	ENSG00000171201	ENST00000504825;ENST00000304915	T;T	0.56611	0.45;0.45	1.02	1.02	0.19986	.	.	.	.	.	T	0.64549	0.2608	.	.	.	0.09310	N	1	D	0.76494	0.999	D	0.76575	0.988	T	0.49606	-0.8922	8	0.87932	D	0	.	5.3705	0.16136	0.0:1.0:0.0:0.0	.	74	P02814	SMR3B_HUMAN	Q	74	ENSP00000423138:P74Q;ENSP00000302400:P74Q	ENSP00000302400:P74Q	P	+	2	0	SMR3B	71290135	0.004000	0.15560	0.045000	0.18777	0.022000	0.10575	0.632000	0.24583	0.881000	0.35993	0.205000	0.17691	CCA	-	SMR3B	-	NULL		0.582	SMR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMR3B	HGNC	protein_coding	OTTHUMT00000251552.2	0	0	0	160	160	93	0.00	0.00	C	NM_006685		71255546	+1	20	25	34	65	tier1	no_errors	ENST00000304915	ensembl	human	known	74_37	missense	37.04	27.78	SNP	0.047	A	20	34
ZNF347	84671	genome.wustl.edu	37	19	53643945	53643946	+	Frame_Shift_Ins	INS	-	-	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:53643945_53643946insT	ENST00000334197.7	-	5	2203_2204	c.2135_2136insA	c.(2134-2136)aatfs	p.N712fs	ZNF347_ENST00000452676.2_Frame_Shift_Ins_p.N713fs|ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000601469.2_Frame_Shift_Ins_p.N713fs	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	712					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TCCCACACTGATTACACTCATA	0.421													ENSG00000197937																									Melanoma(64;205 1597 17324 45721)												0																																										SO:0001589	frameshift_variant	0				AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2136dupA	19.37:g.53643947_53643947dupT	ENSP00000334146:p.Asn712fs		B3KU77|B9EG59|G5E9N4|Q8TCN1	Frame_Shift_Ins	INS	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N713fs	ENST00000334197.7	37	c.2139_2138	CCDS33097.1	19																																																																																				ZNF347	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.421	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	0	0	0	77	77	84	0.00	0.00	-	NM_032584		53643946	-1	5	13	50	108	tier1	no_errors	ENST00000452676	ensembl	human	known	74_37	frame_shift_ins	9.09	10.74	INS	0.000:0.000	T	5	50
FAM86B3P	286042	genome.wustl.edu	37	8	8098246	8098246	+	RNA	SNP	G	G	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:8098246G>T	ENST00000310542.3	+	0	356				ALG1L13P_ENST00000523017.1_RNA					family with sequence similarity 86, member B3, pseudogene																		CTCTAATATTGTTTctgggtg	0.542													ENSG00000173295																																					0																																												0			-			8p23.1	2013-06-10			ENSG00000173295	ENSG00000173295			44371	pseudogene	pseudogene							Standard	NR_024361		Approved		uc011kwt.2		OTTHUMG00000163669		8.37:g.8098246G>T				R	SNP	-	NULL	ENST00000310542.3	37	NULL		8	.	.	.	.	.	.	.	.	.	.	.	4.912	0.169469	0.09339	.	.	ENSG00000173295	ENST00000310542	.	.	.	1.01	1.01	0.19927	.	.	.	.	.	T	0.45836	0.1362	.	.	.	0.30974	N	0.7227589999999999	.	.	.	.	.	.	T	0.56275	-0.8006	4	0.87932	D	0	.	5.4085	0.16335	0.0:0.0:1.0:0.0	.	.	.	.	F	8	.	ENSP00000312142:L8F	L	+	3	2	AC068020.1	8135656	0.001000	0.12720	0.012000	0.15200	0.342000	0.28953	1.068000	0.30629	0.844000	0.35094	0.162000	0.16502	TTG	-	FAM86B3P	-	-		0.542	FAM86B3P-005	KNOWN	basic	processed_transcript	FAM86B3P	HGNC	pseudogene	OTTHUMT00000448496.1	0	0	0	76	76	6	0.00	0.00	G			8098246	+1	8	5	29	5	tier1	no_errors	ENST00000310542	ensembl	human	known	74_37	rna	21.62	50.00	SNP	0.016	T	8	29
RP11-782C8.1	0	genome.wustl.edu	37	1	143230391	143230391	+	lincRNA	SNP	A	A	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:143230391A>T	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							CAATGAATCCACACACAGTTC	0.343													ENSG00000225278																																					0																																												0			-																													1.37:g.143230391A>T				R	SNP	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			-	RP11-782C8.5	-	-		0.343	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	Clone_based_vega_gene	lincRNA	OTTHUMT00000037560.1	0	0	1	35	35	66	0.00	1.49	A			143230391	-1	2	5	10	70	tier1	no_errors	ENST00000422716	ensembl	human	known	74_37	rna	16.67	6.67	SNP	0.080	T	2	10
DTX3	196403	genome.wustl.edu	37	12	58002927	58002937	+	Stop_Codon_Del	DEL	GATGACTGAAG	GATGACTGAAG	-	rs543446533	byFrequency	TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GATGACTGAAG	GATGACTGAAG	GATGACTGAAG	-	GATGACTGAAG	GATGACTGAAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:58002927_58002937delGATGACTGAAG	ENST00000548198.1	+	0	2540_2550				DTX3_ENST00000337737.3_Stop_Codon_Del|ARHGEF25_ENST00000333972.7_5'Flank|AC025165.8_ENST00000356672.3_RNA|ARHGEF25_ENST00000286494.4_5'Flank|DTX3_ENST00000551632.1_Stop_Codon_Del|DTX3_ENST00000548804.1_Stop_Codon_Del			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase						Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					GGGTATCACAGATGACTGAAGGACATCGCCT	0.588													ENSG00000178498																																					0																																										SO:0001567	stop_retained_variant	0				AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		Exception_encountered	12.37:g.58002927_58002937delGATGACTGAAG	ENSP00000447873:p.*348Serext*11		Q53ZZ2|Q8NAU6|Q8NDS8	In_Frame_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.DD*349in_frame_del	ENST00000548198.1	37	c.1045_1053	CCDS41800.1	12																																																																																				DTX3	-	NULL		0.588	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DTX3	HGNC	protein_coding	OTTHUMT00000407848.1	0	0	0	81	81	81	0.00	0.00	GATGACTGAAG	NM_178502		58002937	+1	30	30	1036	1036	tier1	no_errors	ENST00000551632	ensembl	human	known	74_37	in_frame_del	2.81	2.81	DEL	0.987:0.979:0.973:1.000:1.000:1.000:1.000:1.000:0.982	-	30	1036
CDH18	1016	genome.wustl.edu	37	5	19473754	19473754	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:19473754G>A	ENST00000507958.1	-	15	2944	c.1954C>T	c.(1954-1956)Cgg>Tgg	p.R652W	CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.R652W|CDH18_ENST00000506372.1_3'UTR|CDH18_ENST00000274170.4_Missense_Mutation_p.R652W			Q13634	CAD18_HUMAN	cadherin 18, type 2	652					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					ACGTTCTCCCGTACATCCTCT	0.478													ENSG00000145526																																					0													159.0	165.0	163.0					5																	19473754		2203	4300	6503	SO:0001583	missense	0			-	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1954C>T	5.37:g.19473754G>A	ENSP00000425093:p.Arg652Trp		A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R652W	ENST00000507958.1	37	c.1954	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	G	18.75	3.690107	0.68271	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170	D;D;D	0.84589	-1.87;-1.87;-1.87	6.16	3.01	0.34805	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.93989	0.8075	H	0.94771	3.58	0.47949	D	0.999552	D	0.89917	1.0	D	0.70487	0.969	D	0.95553	0.8622	9	.	.	.	.	15.5988	0.76609	0.0:0.0:0.6347:0.3653	.	652	Q13634	CAD18_HUMAN	W	652	ENSP00000371710:R652W;ENSP00000425093:R652W;ENSP00000274170:R652W	.	R	-	1	2	CDH18	19509511	0.032000	0.19561	0.990000	0.47175	0.965000	0.64279	0.309000	0.19332	0.860000	0.35481	0.650000	0.86243	CGG	-	CDH18	-	pfam_Cadherin_cytoplasmic-dom		0.478	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	HGNC	protein_coding	OTTHUMT00000366747.1	0	0	2	69	69	105	0.00	1.87	G	NM_004934		19473754	-1	9	18	20	73	tier1	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	31.03	19.78	SNP	0.827	A	9	20
ELANE	1991	genome.wustl.edu	37	19	855742	855742	+	Frame_Shift_Del	DEL	G	G	-	rs200449787		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:855742delG	ENST00000590230.1	+	5	686	c.545delG	c.(544-546)cgtfs	p.R183fs	ELANE_ENST00000263621.1_Frame_Shift_Del_p.R183fs			P08246	ELNE_HUMAN	elastase, neutrophil expressed	183	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				acute inflammatory response to antigenic stimulus (GO:0002438)|cellular calcium ion homeostasis (GO:0006874)|collagen catabolic process (GO:0030574)|defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of chemotaxis (GO:0050922)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil mediated killing of fungus (GO:0070947)|phagocytosis (GO:0006909)|positive regulation of immune response (GO:0050778)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)|response to UV (GO:0009411)|response to yeast (GO:0001878)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|transcriptional repressor complex (GO:0017053)	cytokine binding (GO:0019955)|endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|RNA polymerase II transcription corepressor activity (GO:0001106)|serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(1)|lung(4)|pancreas(1)	13					Alpha-1-proteinase inhibitor(DB00058)|Filgrastim(DB00099)|Pegfilgrastim(DB00019)	TCCCTCTGCCGTCGCAGCAAC	0.692													ENSG00000197561																																					0													65.0	59.0	61.0					19																	855742		2202	4297	6499	SO:0001589	frameshift_variant	0					CCDS12045.1	19p13.3	2014-09-17	2009-05-05	2009-05-05	ENSG00000197561	ENSG00000197561	3.4.21.37		3309	protein-coding gene	gene with protein product	"""neutrophil elastase"", ""leukocyte elastase"", ""medullasin"""	130130	"""elastase 2, neutrophil"""	ELA2		2902087	Standard	XM_005259517		Approved	NE, HNE, HLE	uc002lqb.3	P08246		ENST00000590230.1:c.545delG	19.37:g.855742delG	ENSP00000466090:p.Arg183fs		P09649|Q6B0D9|Q6LDP5	Frame_Shift_Del	DEL	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.R182fs	ENST00000590230.1	37	c.545	CCDS12045.1	19																																																																																				ELANE	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.692	ELANE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELANE	HGNC	protein_coding	OTTHUMT00000457890.2	0	0	0	64	64	9	0.00	0.00	G	NM_001972		855742	+1	2	0	19	6	tier1	no_errors	ENST00000263621	ensembl	human	known	74_37	frame_shift_del	9.52	0.00	DEL	0.109	-	2	19
PAK4	10298	genome.wustl.edu	37	19	39663769	39663769	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:39663769C>T	ENST00000593690.1	+	5	843	c.416C>T	c.(415-417)gCc>gTc	p.A139V	PAK4_ENST00000321944.4_Intron|PAK4_ENST00000360442.3_Missense_Mutation_p.A139V|PAK4_ENST00000435673.2_Missense_Mutation_p.A139V|PAK4_ENST00000599386.1_Intron|PAK4_ENST00000358301.3_Missense_Mutation_p.A139V|PAK4_ENST00000599470.1_Intron	NM_001014831.2	NP_001014831.1	O96013	PAK4_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 4	139	Linker.		A -> T (in dbSNP:rs35655056). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	13	all_cancers(60;1.03e-07)|all_epithelial(25;9.66e-08)|all_lung(34;1.58e-07)|Lung NSC(34;1.88e-07)|Ovarian(47;0.0454)		Epithelial(26;4.82e-25)|all cancers(26;2.94e-22)|Lung(45;0.000797)|LUSC - Lung squamous cell carcinoma(53;0.00113)			GGCCGGTTCGCCGGTCACAGC	0.741													ENSG00000130669																																					0													3.0	4.0	4.0					19																	39663769		1826	3605	5431	SO:0001583	missense	0			-	AJ011855	CCDS12528.1, CCDS33019.1	19p11-q11	2008-06-17	2008-06-17						16059	protein-coding gene	gene with protein product		605451	"""p21(CDKN1A)-activated kinase 4"""			9822598, 10461188	Standard	NM_001014831		Approved		uc002okn.1	O96013		ENST00000593690.1:c.416C>T	19.37:g.39663769C>T	ENSP00000469413:p.Ala139Val		B4DGG6|Q8N4E1|Q8NCH5|Q8NDE3|Q9BU33|Q9ULS8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.A139V	ENST00000593690.1	37	c.416	CCDS12528.1	19	.	.	.	.	.	.	.	.	.	.	C	3.352	-0.132268	0.06753	.	.	ENSG00000130669	ENST00000358301;ENST00000435673;ENST00000360442	T;T;T	0.71934	-0.61;-0.61;-0.61	4.08	4.08	0.47627	.	0.933553	0.08904	N	0.876808	T	0.63721	0.2535	L	0.44542	1.39	0.09310	N	1	B	0.09022	0.002	B	0.12156	0.007	T	0.49597	-0.8923	10	0.27082	T	0.32	.	11.6615	0.51349	0.0:1.0:0.0:0.0	.	139	O96013	PAK4_HUMAN	V	139	ENSP00000351049:A139V;ENSP00000392753:A139V;ENSP00000353625:A139V	ENSP00000351049:A139V	A	+	2	0	PAK4	44355609	0.972000	0.33761	0.003000	0.11579	0.008000	0.06430	1.703000	0.37846	2.101000	0.63845	0.556000	0.70494	GCC	-	PAK4	-	NULL		0.741	PAK4-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PAK4	HGNC	protein_coding	OTTHUMT00000463823.1	0	0	0	42	42	8	0.00	0.00	C			39663769	+1	3	0	10	4	tier1	no_errors	ENST00000358301	ensembl	human	known	74_37	missense	23.08	0.00	SNP	0.004	T	3	10
PCDHA5	56143	genome.wustl.edu	37	5	140202596	140202596	+	Silent	SNP	G	G	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr5:140202596G>A	ENST00000529859.1	+	1	1236	c.1236G>A	c.(1234-1236)ctG>ctA	p.L412L	PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Silent_p.L412L|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000378126.3_Silent_p.L412L|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	412	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGCGCCCTGGACCGCGAGA	0.647													ENSG00000204965																																					0													147.0	140.0	142.0					5																	140202596		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1236G>A	5.37:g.140202596G>A			O75284|Q8N4R3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L412	ENST00000529859.1	37	c.1236	CCDS54917.1	5																																																																																			-	PCDHA5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.647	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	HGNC	protein_coding	OTTHUMT00000372883.2	1	1	0	165	165	5	0.60	0.00	G	NM_018908		140202596	+1	18	1	33	5	tier1	no_errors	ENST00000529859	ensembl	human	known	74_37	silent	35.29	16.67	SNP	1.000	A	18	33
TERF1	7013	genome.wustl.edu	37	8	73921284	73921286	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr8:73921284_73921286delGAG	ENST00000276603.5	+	1	186_188	c.163_165delGAG	c.(163-165)gagdel	p.E62del	TERF1_ENST00000276602.6_In_Frame_Del_p.E62del	NM_017489.2	NP_059523.2	P54274	TERF1_HUMAN	telomeric repeat binding factor (NIMA-interacting) 1	62	Asp/Glu-rich (acidic).|Poly-Glu.|TRFH dimerization.				age-dependent telomere shortening (GO:0001309)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of DNA replication (GO:0008156)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via semi-conservative replication (GO:0032214)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of apoptotic process (GO:0043065)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of mitosis (GO:0045840)|positive regulation of mitotic cell cycle (GO:0045931)|protein homooligomerization (GO:0051260)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)|telomere maintenance via telomere shortening (GO:0010834)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded telomeric DNA binding (GO:0003691)|microtubule binding (GO:0008017)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|telomeric DNA binding (GO:0042162)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9	Breast(64;0.218)		Epithelial(68;0.0984)			GGGGGCCCCCgaggaggaggagg	0.65													ENSG00000147601																																					0																																										SO:0001651	inframe_deletion	0				U74382	CCDS6210.1, CCDS6211.1	8q21.11	2011-05-24			ENSG00000147601	ENSG00000147601			11728	protein-coding gene	gene with protein product		600951		TRBF1		9391075	Standard	NM_003218		Approved	PIN2, TRF1, TRF	uc003xzd.2	P54274	OTTHUMG00000164522	ENST00000276603.5:c.163_165delGAG	8.37:g.73921293_73921295delGAG	ENSP00000276603:p.Glu62del		A7XP29|Q15553|Q8NHT6|Q93029	In_Frame_Del	DEL	pfam_Telomere_rpt-bd_fac_dimer_dom,pfam_SANT/Myb,superfamily_Telomere_rpt-bd_fac_dimer_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Telomere_repeat-bd-1/2,pfscan_Myb-like_dom	p.E58in_frame_del	ENST00000276603.5	37	c.163_165	CCDS6211.1	8																																																																																				TERF1	-	pirsf_Telomere_repeat-bd-1/2		0.650	TERF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERF1	HGNC	protein_coding	OTTHUMT00000379093.1	0	0	0	46	46	5	0.00	0.00	GAG	NM_017489		73921286	+1	2	0	16	7	tier1	no_errors	ENST00000276603	ensembl	human	known	74_37	in_frame_del	11.11	0.00	DEL	0.121:0.130:0.144	-	2	16
LOC101927209	101927209	genome.wustl.edu	37	1	142716762	142716762	+	lincRNA	SNP	C	C	A			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr1:142716762C>A	ENST00000610091.1	-	0	282																											TATTTTTTCACTTTTGTTTGT	0.274													ENSG00000203849																																					0																																												0			-																													1.37:g.142716762C>A				R	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	RP11-417J8.6	-	-		0.274	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	0	0	0	67	67	0	0.00	0.00	C			142716762	-1	9	0	20	0	tier1	no_errors	ENST00000595144	ensembl	human	known	74_37	rna	31.03	0.00	SNP	0.007	A	9	20
SEPT7	989	genome.wustl.edu	37	7	35882541	35882542	+	Intron	DEL	TA	TA	-	rs146264668		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr7:35882541_35882542delTA	ENST00000435235.1	+	2	442				SEPT7_ENST00000469679.2_Intron|SEPT7_ENST00000399035.3_Intron|SEPT7_ENST00000350320.6_Intron|AC007551.1_ENST00000408229.1_RNA|SEPT7_ENST00000494488.2_Intron|SEPT7_ENST00000399034.2_Intron|SEPT7_ENST00000475109.1_Intron			Q16181	SEPT7_HUMAN	septin 7						cilium morphogenesis (GO:0060271)|cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein heterooligomerization (GO:0051291)|regulation of embryonic cell shape (GO:0016476)	actin cytoskeleton (GO:0015629)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|septin complex (GO:0031105)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)	14						CACACACATTtatatatatatg	0.317													ENSG00000221156																																					0																																										SO:0001627	intron_variant	0				S72008	CCDS75582.1	7p14.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000122545	ENSG00000122545		"""Septins"""	1717	protein-coding gene	gene with protein product		603151	"""CDC10 cell division cycle 10 homolog (S. cerevisiae)"""	CDC10		8037772	Standard	NM_001788		Approved	CDC3, SEPT7A	uc011kau.2	Q16181	OTTHUMG00000155063	ENST00000435235.1:c.10+10031TA>-	7.37:g.35882549_35882550delTA			Q52M76|Q6NX50	R	DEL	-	NULL	ENST00000435235.1	37	NULL		7																																																																																				AC007551.1	-	-		0.317	SEPT7-001	NOVEL	basic	protein_coding	ENSG00000221156	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000338285.1	0	0	0	43	43	0	0.00	0.00	TA	NM_001788		35882542	+1	2	0	12	0	tier1	no_errors	ENST00000408229	ensembl	human	novel	74_37	rna	14.29	0.00	DEL	0.000:0.000	-	2	12
HMGB3	3149	genome.wustl.edu	37	X	150156358	150156360	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chrX:150156358_150156360delGAG	ENST00000325307.7	+	5	670_672	c.574_576delGAG	c.(574-576)gagdel	p.E198del	HMGB3_ENST00000448905.2_In_Frame_Del_p.E198del	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	198	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					ggaggaagaagaggaggaggagg	0.443													ENSG00000029993																																					1	Substitution - coding silent(1)	large_intestine(1)																																								SO:0001651	inframe_deletion	0				AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.574_576delGAG	X.37:g.150156367_150156369delGAG	ENSP00000359393:p.Glu198del		O95556|Q6NS40	In_Frame_Del	DEL	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E195in_frame_del	ENST00000325307.7	37	c.574_576	CCDS35428.1	X																																																																																				HMGB3	-	NULL		0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	HGNC	protein_coding	OTTHUMT00000060867.1	0	0	0	46	46	0	0.00	0.00	GAG	NM_005342		150156360	+1	2	0	12	1	tier1	no_errors	ENST00000325307	ensembl	human	known	74_37	in_frame_del	14.29	0.00	DEL	0.987:0.994:0.985	-	2	12
KMT2D	8085	genome.wustl.edu	37	12	49426727	49426727	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr12:49426727delG	ENST00000301067.7	-	39	11760	c.11761delC	c.(11761-11763)caafs	p.Q3925fs	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3925	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										tgttgctgttgtagctgctgc	0.542													ENSG00000167548																																					0													14.0	16.0	15.0					12																	49426727		1801	3355	5156	SO:0001589	frameshift_variant	0				AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11761delC	12.37:g.49426727delG	ENSP00000301067:p.Gln3925fs		O14687	Frame_Shift_Del	DEL	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q3921fs	ENST00000301067.7	37	c.11761	CCDS44873.1	12																																																																																				KMT2D	-	NULL		0.542	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	HGNC	protein_coding	OTTHUMT00000390183.2	0	0	0	57	57	3	0.00	0.00	G			49426727	-1	8	0	23	2	tier1	no_errors	ENST00000301067	ensembl	human	known	74_37	frame_shift_del	25.81	0.00	DEL	0.012	-	8	23
GP6	51206	genome.wustl.edu	37	19	55526104	55526107	+	3'UTR	DEL	CAGA	CAGA	-	rs375520233		TCGA-WK-A8XO-01A-11D-A37C-09	TCGA-WK-A8XO-10A-01D-A37F-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	66179bb1-3f19-4b27-aaba-d59e3bbac62c	234d02ef-7286-46bc-b74a-744de27b69d8	g.chr19:55526104_55526107delCAGA	ENST00000417454.1	-	0	1229_1232				CTC-550B14.7_ENST00000593060.1_RNA|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000310373.3_Frame_Shift_Del_p.CL402fs|GP6_ENST00000333884.2_3'UTR	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)						blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		gacagagaggcagacagacagaca	0.593													ENSG00000088053																																					0									,	18,301,3753		5,0,8,23,255,1745					,	0.4	0.0		dbSNP_132	66	31,160,7921		2,0,27,6,148,3873	yes	utr-3,codingComplex	GP6	NM_016363.4,NM_001083899.1	,	7,0,35,29,403,5618	A1A1,A1A2,A1R,A2A2,A2R,RR		2.3545,7.834,4.1858	,	,		49,461,11674				SO:0001624	3_prime_UTR_variant	0				AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.*185TCTG>-	19.37:g.55526112_55526115delCAGA			Q9HCN7|Q9UIF2	Frame_Shift_Del	DEL	smart_Ig_sub,smart_Ig_sub2	p.P404fs	ENST00000417454.1	37	c.1209_1206	CCDS46184.1	19																																																																																				GP6	-	NULL		0.593	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	0	0	0	42	42	56	0.00	0.00	CAGA			55526107	-1	3	2	18	107	tier1	no_errors	ENST00000310373	ensembl	human	known	74_37	frame_shift_del	14.29	1.83	DEL	0.009:0.011:0.014:0.015	-	3	18
