#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
GPR98	84059	genome.wustl.edu	37	5	90106396	90106396	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr5:90106396G>A	ENST00000405460.2	+	74	15415	c.15319G>A	c.(15319-15321)Gtt>Att	p.V5107I	GPR98_ENST00000425867.2_Missense_Mutation_p.V768I	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5107					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AAAGTTTGATGTTAATTGGAG	0.348													ENSG00000164199																																					0													120.0	120.0	120.0					5																	90106396		1839	4086	5925	SO:0001583	missense	0			-	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15319G>A	5.37:g.90106396G>A	ENSP00000384582:p.Val5107Ile		O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.V5107I	ENST00000405460.2	37	c.15319	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	0.201	-1.044848	0.01997	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.35789	1.29;1.29	5.37	2.4	0.29515	.	0.730922	0.14273	N	0.330033	T	0.20414	0.0491	N	0.22421	0.69	0.09310	N	1	B;B;B	0.16396	0.01;0.006;0.017	B;B;B	0.18561	0.01;0.006;0.022	T	0.19484	-1.0304	9	.	.	.	.	4.9037	0.13788	0.0763:0.1577:0.5426:0.2234	.	768;5107;768	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	I	5107;5107;768	ENSP00000384582:V5107I;ENSP00000392618:V768I	.	V	+	1	0	GPR98	90142152	0.984000	0.35163	0.005000	0.12908	0.133000	0.20885	2.188000	0.42612	0.743000	0.32719	-0.311000	0.09066	GTT	-	GPR98	-	NULL		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	0	0	0	18	18	84	0.00	0.00	G	NM_032119		90106396	+1	16	48	20	45	tier1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	44.44	51.61	SNP	0.007	A	16	20
RPA1	6117	genome.wustl.edu	37	17	1782517	1782517	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:1782517T>A	ENST00000254719.5	+	10	878	c.768T>A	c.(766-768)taT>taA	p.Y256*	RPA1_ENST00000573924.1_3'UTR	NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	256					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						AGGTGTATTATTTCTCGAAAG	0.507								Nucleotide excision repair (NER)					ENSG00000132383																																					0													67.0	68.0	67.0					17																	1782517		2203	4300	6503	SO:0001587	stop_gained	0			-	M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.768T>A	17.37:g.1782517T>A	ENSP00000254719:p.Tyr256*		A8K0Y9|Q59ES9	Nonsense_Mutation	SNP	pfam_Rep_factor-A_C,pfam_Rep_factor-A_N,pfam_-bd_OB_tR,superfamily_-bd_OB-fold,tigrfam_Rep_factor_Rpa1	p.Y256*	ENST00000254719.5	37	c.768	CCDS11014.1	17	.	.	.	.	.	.	.	.	.	.	T	18.90	3.720587	0.68959	.	.	ENSG00000132383	ENST00000254719	.	.	.	6.08	-3.34	0.04943	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.6321	15.6688	0.77255	0.0:0.5576:0.0:0.4424	.	.	.	.	X	256	.	ENSP00000254719:Y256X	Y	+	3	2	RPA1	1729267	0.987000	0.35691	0.974000	0.42286	0.157000	0.22087	0.263000	0.18478	-0.532000	0.06332	0.482000	0.46254	TAT	-	RPA1	-	pfam_-bd_OB_tR,superfamily_-bd_OB-fold,tigrfam_Rep_factor_Rpa1		0.507	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA1	HGNC	protein_coding	OTTHUMT00000207118.2	0	0	0	23	23	105	0.00	0.00	T	NM_002945		1782517	+1	23	42	8	51	tier1	no_errors	ENST00000254719	ensembl	human	known	74_37	nonsense	74.19	45.16	SNP	0.989	A	23	8
ZNF285	26974	genome.wustl.edu	37	19	44891263	44891263	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:44891263C>A	ENST00000330997.4	-	4	1208	c.1144G>T	c.(1144-1146)Gat>Tat	p.D382Y	ZNF285_ENST00000544719.2_Missense_Mutation_p.D382Y|ZNF285_ENST00000591679.1_Missense_Mutation_p.D389Y|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAGCTCTGATCAAAGCCCTTC	0.463													ENSG00000267508																																					0													62.0	62.0	62.0					19																	44891263		2203	4300	6503	SO:0001583	missense	0			-	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.1144G>T	19.37:g.44891263C>A	ENSP00000333595:p.Asp382Tyr		Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D382Y	ENST00000330997.4	37	c.1144	CCDS12638.1	19	.	.	.	.	.	.	.	.	.	.	C	9.615	1.132186	0.21041	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.17370	2.28	3.36	-1.52	0.08637	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12646	0.0307	N	0.17248	0.465	0.09310	N	1	P;P	0.44309	0.832;0.801	P;P	0.49140	0.601;0.58	T	0.20240	-1.0281	9	0.87932	D	0	.	3.4849	0.07615	0.2968:0.1973:0.0:0.5059	.	406;382	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	Y	405;382	ENSP00000333595:D382Y	ENSP00000333595:D382Y	D	-	1	0	ZNF285	49583103	0.000000	0.05858	0.147000	0.22382	0.950000	0.60333	-4.159000	0.00283	-0.051000	0.13334	0.298000	0.19748	GAT	-	ZNF285	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.463	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF285	HGNC	protein_coding	OTTHUMT00000443600.1	0	0	0	90	90	40	0.00	0.00	C	NM_152354		44891263	-1	47	25	48	21	tier1	no_errors	ENST00000330997	ensembl	human	known	74_37	missense	49.47	54.35	SNP	0.000	A	47	48
TMPRSS11D	9407	genome.wustl.edu	37	4	68708322	68708322	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr4:68708322A>T	ENST00000283916.6	-	4	369	c.271T>A	c.(271-273)Tca>Aca	p.S91T	UBA6-AS1_ENST00000500538.2_RNA|TMPRSS11D_ENST00000509584.1_5'UTR|TMPRSS11D_ENST00000545541.1_5'UTR	NM_004262.2	NP_004253.1	O60235	TM11D_HUMAN	transmembrane protease, serine 11D	91	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)|respiratory gaseous exchange (GO:0007585)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTTAAATTTGATTCTTTGAAT	0.358													ENSG00000153802																																					0													79.0	82.0	81.0					4																	68708322		2203	4299	6502	SO:0001583	missense	0			-	AB002134	CCDS3518.1	4q13.2	2010-04-13			ENSG00000153802	ENSG00000153802		"""Serine peptidases / Transmembrane"""	24059	protein-coding gene	gene with protein product	"""airway trypsin like protease"""	605369				9565616, 9070615	Standard	XM_005265710		Approved		uc003hdq.3	O60235	OTTHUMG00000129300	ENST00000283916.6:c.271T>A	4.37:g.68708322A>T	ENSP00000283916:p.Ser91Thr		Q08AF6	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1,pfam_SEA_dom,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_SEA_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_SEA_dom,pfscan_Peptidase_S1	p.S91T	ENST00000283916.6	37	c.271	CCDS3518.1	4	.	.	.	.	.	.	.	.	.	.	A	16.96	3.266363	0.59540	.	.	ENSG00000153802	ENST00000283916	T	0.55052	0.54	5.19	5.19	0.71726	SEA (3);	0.000000	0.48767	D	0.000179	T	0.73674	0.3617	M	0.86420	2.815	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.75752	-0.3207	10	0.39692	T	0.17	.	11.7214	0.51685	1.0:0.0:0.0:0.0	.	91	O60235	TM11D_HUMAN	T	91	ENSP00000283916:S91T	ENSP00000283916:S91T	S	-	1	0	TMPRSS11D	68390917	0.998000	0.40836	0.536000	0.28039	0.654000	0.38779	4.243000	0.58721	2.067000	0.61834	0.533000	0.62120	TCA	-	TMPRSS11D	-	pirsf_Pept_S1A_HAT/DESC1,pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom		0.358	TMPRSS11D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11D	HGNC	protein_coding	OTTHUMT00000251430.3	0	0	0	18	18	73	0.00	0.00	A	NM_004262		68708322	-1	9	16	46	45	tier1	no_errors	ENST00000283916	ensembl	human	known	74_37	missense	16.36	26.23	SNP	0.757	T	9	46
SFXN2	118980	genome.wustl.edu	37	10	104497506	104497506	+	Missense_Mutation	SNP	A	A	G	rs201424155		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:104497506A>G	ENST00000369893.5	+	12	1123	c.956A>G	c.(955-957)aAt>aGt	p.N319S		NM_178858.4	NP_849189.1	Q96NB2	SFXN2_HUMAN	sideroflexin 2	319					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|prostate(1)	13		Colorectal(252;0.207)		Epithelial(162;4.53e-09)|all cancers(201;1.2e-07)|BRCA - Breast invasive adenocarcinoma(275;0.218)		GTCTACTTCAATAAGGGTCTC	0.463													ENSG00000156398	A|||	1	0.000199681	0.0	0.0	5008	,	,		21464	0.0		0.001	False		,,,				2504	0.0																0													129.0	109.0	115.0					10																	104497506		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF462052	CCDS7539.1	10q24.32	2006-03-13			ENSG00000156398	ENSG00000156398		"""Sideroflexins"""	16086	protein-coding gene	gene with protein product		615570					Standard	NM_178858		Approved		uc001kwb.2	Q96NB2	OTTHUMG00000018967	ENST00000369893.5:c.956A>G	10.37:g.104497506A>G	ENSP00000358909:p.Asn319Ser		Q5JSM6	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.N319S	ENST00000369893.5	37	c.956	CCDS7539.1	10	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	24.0	4.487136	0.84854	.	.	ENSG00000156398	ENST00000369893	T	0.37411	1.2	5.68	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.63570	0.2522	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68337	-0.5435	10	0.87932	D	0	-8.0034	10.3504	0.43931	0.9225:0.0:0.0775:0.0	.	319	Q96NB2	SFXN2_HUMAN	S	319	ENSP00000358909:N319S	ENSP00000358909:N319S	N	+	2	0	SFXN2	104487496	1.000000	0.71417	0.996000	0.52242	0.975000	0.68041	7.875000	0.87205	0.998000	0.38996	0.459000	0.35465	AAT	rs201424155	SFXN2	-	pfam_Mtc,tigrfam_Mtc		0.463	SFXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN2	HGNC	protein_coding	OTTHUMT00000050096.2	0	0	0	29	29	74	0.00	0.00	A	XM_058359		104497506	+1	29	40	28	50	tier1	no_errors	ENST00000369893	ensembl	human	known	74_37	missense	50.88	44.44	SNP	1.000	G	29	28
CREB3L3	84699	genome.wustl.edu	37	19	4171147	4171147	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:4171147C>T	ENST00000078445.2	+	8	1097	c.950C>T	c.(949-951)tCa>tTa	p.S317L	CREB3L3_ENST00000602147.1_Silent_p.V281V|CREB3L3_ENST00000595923.1_Missense_Mutation_p.S316L|CREB3L3_ENST00000602257.1_Missense_Mutation_p.S315L|CREB3L3_ENST00000252587.3_Intron	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	317					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCAGCAAGTCAGCCCAGACA	0.607													ENSG00000060566																																					0													76.0	71.0	72.0					19																	4171147		2203	4300	6503	SO:0001583	missense	0			-		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.950C>T	19.37:g.4171147C>T	ENSP00000078445:p.Ser317Leu		B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	pfam_bZIP,superfamily_TF_D-bd,smart_bZIP,pfscan_bZIP	p.S317L	ENST00000078445.2	37	c.950	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146870	0.57151	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.84223	-1.82	4.58	4.58	0.56647	.	0.353602	0.26023	N	0.026810	D	0.86485	0.5944	M	0.65975	2.015	0.80722	D	1	P;P;P	0.48640	0.828;0.913;0.858	B;P;B	0.47044	0.197;0.535;0.334	D	0.88006	0.2759	10	0.56958	D	0.05	-0.0711	14.8629	0.70394	0.0:1.0:0.0:0.0	.	315;316;317	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	L	317;275	ENSP00000078445:S317L	ENSP00000078445:S317L	S	+	2	0	CREB3L3	4122147	0.994000	0.37717	0.949000	0.38748	0.231000	0.25187	5.371000	0.66150	2.093000	0.63338	0.561000	0.74099	TCA	-	CREB3L3	-	NULL		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	HGNC	protein_coding	OTTHUMT00000457922.1	0	0	0	40	40	62	0.00	0.00	C	NM_032607		4171147	+1	35	12	33	20	tier1	no_errors	ENST00000078445	ensembl	human	known	74_37	missense	51.47	37.50	SNP	0.925	T	35	33
PSMD3	5709	genome.wustl.edu	37	17	38146359	38146359	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:38146359C>G	ENST00000264639.4	+	6	1064	c.890C>G	c.(889-891)gCc>gGc	p.A297G	PSMD3_ENST00000541736.1_Missense_Mutation_p.A159G	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	297					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					CGAATCAAAGCCATCCAGCTG	0.587													ENSG00000108344																									Ovarian(186;531 2051 6385 19668 48409)												0													69.0	59.0	63.0					17																	38146359		2203	4300	6503	SO:0001583	missense	0			-	D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.890C>G	17.37:g.38146359C>G	ENSP00000264639:p.Ala297Gly		B3KMW9|B4DT72|Q96EI2|Q9BQA4	Missense_Mutation	SNP	pfam_26S_Psome_reg_C,pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.A297G	ENST00000264639.4	37	c.890	CCDS11356.1	17	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628416	0.67015	.	.	ENSG00000108344	ENST00000264639;ENST00000415039;ENST00000541736	T;T	0.76578	-1.03;-1.03	4.96	2.97	0.34412	Tetratricopeptide-like helical (1);PCI/PINT associated module (1);	0.051446	0.85682	D	0.000000	D	0.83575	0.5284	H	0.94771	3.58	0.80722	D	1	P	0.46621	0.881	P	0.44518	0.452	D	0.85104	0.0959	10	0.72032	D	0.01	-14.5673	9.9572	0.41675	0.0:0.7844:0.1396:0.076	.	297	O43242	PSMD3_HUMAN	G	297;284;159	ENSP00000264639:A297G;ENSP00000442508:A159G	ENSP00000264639:A297G	A	+	2	0	PSMD3	35399885	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.446000	0.80609	0.679000	0.31345	0.655000	0.94253	GCC	-	PSMD3	-	smart_PAM		0.587	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD3	HGNC	protein_coding	OTTHUMT00000257018.1	0	0	1	53	53	80	0.00	1.23	C	NM_002809		38146359	+1	35	37	45	36	tier1	no_errors	ENST00000264639	ensembl	human	known	74_37	missense	43.75	50.68	SNP	1.000	G	35	45
OR5P2	120065	genome.wustl.edu	37	11	7817816	7817816	+	Missense_Mutation	SNP	C	C	T	rs372220227		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr11:7817816C>T	ENST00000329434.2	-	1	704	c.674G>A	c.(673-675)cGc>cAc	p.R225H	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153444.1	NP_703145.1	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P, member 2	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	22				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTCAGTGGAGCGCATCTTCAG	0.493													ENSG00000183303	C|||	1	0.000199681	0.0008	0.0	5008	,	,		18924	0.0		0.0	False		,,,				2504	0.0																0								C	HIS/ARG	0,4214		0,0,2107	110.0	112.0	112.0		674	1.6	1.0	11		112	1,8583		0,1,4291	no	missense	OR5P2	NM_153444.1	29	0,1,6398	TT,TC,CC		0.0116,0.0,0.0078	benign	225/323	7817816	1,12797	2107	4292	6399	SO:0001583	missense	0			-	AF173006	CCDS7782.1	11p15.4	2012-08-09			ENSG00000183303	ENSG00000183303		"""GPCR / Class A : Olfactory receptors"""	14783	protein-coding gene	gene with protein product							Standard	NM_153444		Approved	JCG3	uc001mfp.1	Q8WZ92	OTTHUMG00000165668	ENST00000329434.2:c.674G>A	11.37:g.7817816C>T	ENSP00000331823:p.Arg225His		Q3MIS8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R225H	ENST00000329434.2	37	c.674	CCDS7782.1	11	.	.	.	.	.	.	.	.	.	.	C	6.987	0.552188	0.13374	0.0	1.16E-4	ENSG00000183303	ENST00000329434	T	0.39229	1.09	5.5	1.61	0.23674	GPCR, rhodopsin-like superfamily (1);	1.249150	0.05210	N	0.506500	T	0.20901	0.0503	N	0.05124	-0.11	0.22096	N	0.999368	B	0.17852	0.024	B	0.20767	0.031	T	0.23726	-1.0180	10	0.13470	T	0.59	3.4885	4.7514	0.13063	0.0:0.5351:0.147:0.3179	.	225	Q8WZ92	OR5P2_HUMAN	H	225	ENSP00000331823:R225H	ENSP00000331823:R225H	R	-	2	0	OR5P2	7774392	0.000000	0.05858	0.994000	0.49952	0.866000	0.49608	-1.237000	0.02922	0.155000	0.19261	0.555000	0.69702	CGC	-	OR5P2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.493	OR5P2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P2	HGNC	protein_coding	OTTHUMT00000385696.1	0	0	0	37	37	67	0.00	0.00	C	NM_153444		7817816	-1	27	38	30	51	tier1	no_errors	ENST00000329434	ensembl	human	known	74_37	missense	46.55	42.70	SNP	0.435	T	27	30
SETX	23064	genome.wustl.edu	37	9	135202975	135202975	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr9:135202975C>A	ENST00000224140.5	-	10	4192	c.4010G>T	c.(4009-4011)aGa>aTa	p.R1337I	SETX_ENST00000372169.2_Missense_Mutation_p.R1337I|SETX_ENST00000393220.1_Missense_Mutation_p.R1337I	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	1337					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CTTATTATTTCTGACAGACAG	0.358													ENSG00000107290																																					0													65.0	66.0	66.0					9																	135202975		2202	4300	6502	SO:0001583	missense	0			-	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.4010G>T	9.37:g.135202975C>A	ENSP00000224140:p.Arg1337Ile		A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.R1337I	ENST00000224140.5	37	c.4010	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	10.99	1.506249	0.26949	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87334	-2.15;-2.24;-1.85	5.46	-6.75	0.01738	.	1.015060	0.07854	N	0.965186	D	0.82765	0.5108	L	0.36672	1.1	0.39908	D	0.973981	P;P;D	0.53151	0.911;0.877;0.958	P;B;P	0.44990	0.466;0.276;0.466	T	0.80674	-0.1277	10	0.87932	D	0	.	16.9966	0.86369	0.0:0.1018:0.0:0.8982	.	1337;1337;1337	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	I	1337	ENSP00000224140:R1337I;ENSP00000361242:R1337I;ENSP00000376913:R1337I	ENSP00000224140:R1337I	R	-	2	0	SETX	134192796	0.296000	0.24398	0.145000	0.22337	0.048000	0.14542	-0.435000	0.06931	-1.509000	0.01798	-0.312000	0.09012	AGA	-	SETX	-	NULL		0.358	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	0	0	0	29	29	51	0.00	0.00	C	NM_015046		135202975	-1	38	25	45	36	tier1	no_errors	ENST00000372169	ensembl	human	known	74_37	missense	45.78	40.32	SNP	0.923	A	38	45
OTX1	5013	genome.wustl.edu	37	2	63283301	63283301	+	Silent	SNP	T	T	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr2:63283301T>A	ENST00000282549.2	+	5	1191	c.915T>A	c.(913-915)ggT>ggA	p.G305G	OTX1_ENST00000366671.3_Silent_p.G305G	NM_014562.3	NP_055377.1	P32242	OTX1_HUMAN	orthodenticle homeobox 1	305					anterior/posterior pattern specification (GO:0009952)|diencephalon morphogenesis (GO:0048852)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Lung NSC(7;0.121)|all_lung(7;0.211)					aAGGCTACGGTGGCTCTGGGC	0.627													ENSG00000115507																																					0													93.0	71.0	79.0					2																	63283301		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS1873.1	2p15	2011-06-20	2007-02-15		ENSG00000115507	ENSG00000115507		"""Homeoboxes / PRD class"""	8521	protein-coding gene	gene with protein product		600036	"""orthodenticle (Drosophila) homolog 1"", ""orthodenticle homolog 1 (Drosophila)"""			7959790	Standard	NM_001199770		Approved		uc002scd.3	P32242	OTTHUMG00000129454	ENST00000282549.2:c.915T>A	2.37:g.63283301T>A			A6NHA2|B3KTJ4|Q53TG6	Silent	SNP	pfam_Otx_TF_C,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Otx1_TF,prints_Otx_TF	p.G305	ENST00000282549.2	37	c.915	CCDS1873.1	2																																																																																			-	OTX1	-	NULL		0.627	OTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTX1	HGNC	protein_coding	OTTHUMT00000251617.1	0	0	0	41	41	23	0.00	0.00	T			63283301	+1	29	9	33	13	tier1	no_errors	ENST00000282549	ensembl	human	known	74_37	silent	46.77	40.91	SNP	0.997	A	29	33
CPEB1	64506	genome.wustl.edu	37	15	83297194	83297194	+	5'UTR	SNP	G	G	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr15:83297194G>C	ENST00000562019.1	-	0	26				CPEB1_ENST00000568757.1_Intron|CPEB1_ENST00000568128.1_Intron|CPEB1_ENST00000450751.2_Intron|CPEB1_ENST00000563800.1_Missense_Mutation_p.A6G			Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding protein 1						cellular response to amino acid stimulus (GO:0071230)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|mRNA processing (GO:0006397)|negative regulation of cytoplasmic translation (GO:2000766)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(1)|skin(1)	28			BRCA - Breast invasive adenocarcinoma(143;0.229)			tgttgaagtagcaatgccaga	0.398													ENSG00000214575																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF329402	CCDS42072.1, CCDS45329.1, CCDS45330.1, CCDS42072.2, CCDS45329.2, CCDS45330.2	15q25.1	2008-02-05				ENSG00000214575			21744	protein-coding gene	gene with protein product		607342				11223249	Standard	NM_001079533		Approved	FLJ13203, CPEB	uc002biv.3	Q9BZB8		ENST00000562019.1:c.-291C>G	15.37:g.83297194G>C			B7Z6C6|Q86W46|Q8IV41|Q9BZB7|Q9H8V5	Missense_Mutation	SNP	pfscan_RRM_dom	p.A6G	ENST00000562019.1	37	c.17		15																																																																																			-	CPEB1	-	NULL		0.398	CPEB1-006	KNOWN	basic|appris_candidate_longest	protein_coding	CPEB1	HGNC	protein_coding	OTTHUMT00000421102.1	0	0	0	13	13	45	0.00	0.00	G	NM_030594		83297194	-1	16	27	7	29	tier1	no_errors	ENST00000563800	ensembl	human	putative	74_37	missense	69.57	48.21	SNP	0.118	C	16	7
ZNF589	51385	genome.wustl.edu	37	3	48309726	48309726	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr3:48309726A>G	ENST00000354698.3	+	4	617	c.545A>G	c.(544-546)aAc>aGc	p.N182S	ZNF589_ENST00000440261.2_Intron|ZNF589_ENST00000427617.2_Intron|ZNF589_ENST00000412564.1_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	182					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TGGGGAGGCAACAGAATATTA	0.502													ENSG00000164048																									Colon(9;319 328 25374 27611 50948)												0													51.0	55.0	54.0					3																	48309726		1873	4120	5993	SO:0001583	missense	0			-	AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.545A>G	3.37:g.48309726A>G	ENSP00000346729:p.Asn182Ser		Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N182S	ENST00000354698.3	37	c.545	CCDS43085.1	3	.	.	.	.	.	.	.	.	.	.	A	6.947	0.544587	0.13312	.	.	ENSG00000164048	ENST00000354698;ENST00000296437	T	0.05996	3.36	1.32	-1.25	0.09405	.	.	.	.	.	T	0.04815	0.0130	L	0.38175	1.15	0.09310	N	0.999999	B;B	0.23854	0.092;0.055	B;B	0.11329	0.006;0.003	T	0.38200	-0.9672	9	0.42905	T	0.14	.	5.1691	0.15101	0.6428:0.0:0.3572:0.0	.	179;182	Q86UQ0-2;Q86UQ0	.;ZN589_HUMAN	S	182;179	ENSP00000346729:N182S	ENSP00000296437:N179S	N	+	2	0	ZNF589	48284730	.	.	0.002000	0.10522	0.544000	0.35116	.	.	-0.384000	0.07845	0.383000	0.25322	AAC	-	ZNF589	-	NULL		0.502	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF589	HGNC	protein_coding	OTTHUMT00000346124.1	0	0	0	21	21	60	0.00	0.00	A	NM_016089		48309726	+1	15	34	20	38	tier1	no_errors	ENST00000354698	ensembl	human	known	74_37	missense	42.86	47.22	SNP	0.048	G	15	20
UGT2B11	10720	genome.wustl.edu	37	4	70079967	70079967	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr4:70079967C>A	ENST00000446444.1	-	1	482	c.474G>T	c.(472-474)gaG>gaT	p.E158D	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	158					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CAGCCAGCAGCTCACCACAGG	0.413													ENSG00000213759																																					0													132.0	128.0	130.0					4																	70079967		2203	4298	6501	SO:0001583	missense	0			-	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.474G>T	4.37:g.70079967C>A	ENSP00000387683:p.Glu158Asp		Q3KNV9	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.E158D	ENST00000446444.1	37	c.474	CCDS3527.1	4	.	.	.	.	.	.	.	.	.	.	-	0.568	-0.842466	0.02671	.	.	ENSG00000213759	ENST00000446444	T	0.60920	0.15	1.96	1.96	0.26148	.	0.081913	0.47852	U	0.000201	T	0.42381	0.1200	L	0.38692	1.165	0.20638	N	0.999873	B	0.16802	0.019	B	0.20384	0.029	T	0.21895	-1.0232	10	0.20519	T	0.43	.	9.5515	0.39313	0.0:1.0:0.0:0.0	.	158	O75310	UDB11_HUMAN	D	158	ENSP00000387683:E158D	ENSP00000387683:E158D	E	-	3	2	UGT2B11	70114556	0.211000	0.23529	0.976000	0.42696	0.037000	0.13140	-0.666000	0.05280	1.087000	0.41251	0.184000	0.17185	GAG	-	UGT2B11	-	pfam_UDP_glucos_trans		0.413	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	HGNC	protein_coding	OTTHUMT00000251551.2	0	0	0	94	94	36	0.00	0.00	C	NM_001073		70079967	-1	59	29	72	23	tier1	no_errors	ENST00000446444	ensembl	human	known	74_37	missense	45.04	55.77	SNP	1.000	A	59	72
CHD9	80205	genome.wustl.edu	37	16	53302010	53302010	+	Silent	SNP	A	A	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr16:53302010A>G	ENST00000398510.3	+	21	4776	c.4689A>G	c.(4687-4689)ggA>ggG	p.G1563G	CHD9_ENST00000447540.1_Silent_p.G1563G|CHD9_ENST00000566029.1_Silent_p.G1563G|CHD9_ENST00000564845.1_Silent_p.G1563G			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1563					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				CTGAAGATGGACAGACACGAG	0.338													ENSG00000177200																																					0													80.0	73.0	75.0					16																	53302010		1859	4097	5956	SO:0001819	synonymous_variant	0			-	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.4689A>G	16.37:g.53302010A>G			B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.G1563	ENST00000398510.3	37	c.4689		16																																																																																			-	CHD9	-	NULL		0.338	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	0	0	0	20	20	90	0.00	0.00	A	NM_025134		53302010	+1	13	44	8	48	tier1	no_errors	ENST00000398510	ensembl	human	known	74_37	silent	61.90	47.83	SNP	0.922	G	13	8
VWF	7450	genome.wustl.edu	37	12	6184682	6184682	+	Silent	SNP	G	G	A	rs527344390	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr12:6184682G>A	ENST00000261405.5	-	7	947	c.693C>T	c.(691-693)acC>acT	p.T231T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	231	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)	p.T231T(1)		NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	CAAACACCGAGGTGCTCTTCA	0.627													ENSG00000110799																																					1	Substitution - coding silent(1)	lung(1)											43.0	42.0	42.0					12																	6184682		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.693C>T	12.37:g.6184682G>A			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T231	ENST00000261405.5	37	c.693	CCDS8539.1	12																																																																																			-	VWF	-	pirsf_VWF,pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.627	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	0	0	0	62	62	35	0.00	0.00	G	NM_000552		6184682	-1	32	18	41	28	tier1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	43.84	39.13	SNP	0.136	A	32	41
HERC2P3	283755	genome.wustl.edu	37	15	20657785	20657785	+	RNA	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr15:20657785A>T	ENST00000428453.1	-	0	2173							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CTCATTGGTGATGGTTTGCAG	0.537													ENSG00000180229																																					0													103.0	92.0	96.0					15																	20657785		2175	4237	6412			0			-	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20657785A>T				R	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			-	HERC2P3	-	-		0.537	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	1	1	0	263	263	35	0.38	0.00	A	NG_008269		20657785	-1	109	8	236	32	tier1	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	31.59	20.00	SNP	1.000	T	109	236
YWHAG	7532	genome.wustl.edu	37	7	75958930	75958930	+	Silent	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:75958930G>A	ENST00000307630.3	-	2	930	c.708C>T	c.(706-708)gaC>gaT	p.D236D		NM_012479.3	NP_036611.2	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma	236					apoptotic process (GO:0006915)|cellular response to insulin stimulus (GO:0032869)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of neuron differentiation (GO:0045664)|regulation of signal transduction (GO:0009966)|regulation of synaptic plasticity (GO:0048167)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	insulin-like growth factor receptor binding (GO:0005159)|poly(A) RNA binding (GO:0044822)|protein kinase C binding (GO:0005080)|protein kinase C inhibitor activity (GO:0008426)			endometrium(2)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8						CGTCCTGCTGGTCGCTCGTCC	0.582													ENSG00000170027																																					0													71.0	56.0	61.0					7																	75958930		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF142498	CCDS5584.1	7q11.23	2014-06-13	2013-12-03		ENSG00000170027	ENSG00000170027			12852	protein-coding gene	gene with protein product	"""14-3-3 gamma"", ""protein phosphatase 1, regulatory subunit 170"""	605356	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide"""			10486217, 10433554	Standard	NM_012479		Approved	PPP1R170	uc011kgj.1	P61981	OTTHUMG00000022862	ENST00000307630.3:c.708C>T	7.37:g.75958930G>A			O70457|P35214|Q6FH52|Q9UDP2|Q9UN99	Silent	SNP	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3	p.D236	ENST00000307630.3	37	c.708	CCDS5584.1	7																																																																																			-	YWHAG	-	pfam_14-3-3_domain,superfamily_14-3-3_domain,smart_14-3-3_domain,pirsf_14-3-3,prints_14-3-3		0.582	YWHAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAG	HGNC	protein_coding	OTTHUMT00000253002.1	0	0	0	29	29	29	0.00	0.00	G	NM_012479		75958930	-1	26	12	24	24	tier1	no_errors	ENST00000307630	ensembl	human	known	74_37	silent	52.00	33.33	SNP	0.728	A	26	24
KRT27	342574	genome.wustl.edu	37	17	38935802	38935802	+	Silent	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr17:38935802T>C	ENST00000301656.3	-	5	964	c.924A>G	c.(922-924)aaA>aaG	p.K308K	KRT27_ENST00000540723.1_5'Flank	NM_181537.3	NP_853515.2			keratin 27											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(3)|skin(1)|stomach(1)	21		Breast(137;0.000812)				GAAGAGTGCGTTTCATCTCGA	0.493													ENSG00000171446																																					0													71.0	64.0	66.0					17																	38935802		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ564206	CCDS11375.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000171446	ENSG00000171446		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30841	protein-coding gene	gene with protein product			"""keratin 25C"""	KRT25C		16831889	Standard	NM_181537		Approved		uc002hvg.3	Q7Z3Y8	OTTHUMG00000133371	ENST00000301656.3:c.924A>G	17.37:g.38935802T>C				Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K308	ENST00000301656.3	37	c.924	CCDS11375.1	17																																																																																			-	KRT27	-	pfam_IF,superfamily_Prefoldin		0.493	KRT27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT27	HGNC	protein_coding	OTTHUMT00000257216.1	0	0	0	49	49	63	0.00	0.00	T	NM_181537		38935802	-1	24	44	29	41	tier1	no_errors	ENST00000301656	ensembl	human	known	74_37	silent	45.28	51.16	SNP	0.999	C	24	29
HPCA	3208	genome.wustl.edu	37	1	33359548	33359548	+	3'UTR	SNP	G	G	A			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:33359548G>A	ENST00000373467.3	+	0	769				TMEM54_ENST00000475208.1_5'Flank	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin						inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				ATTCTGGCTGGGGGCCAGATT	0.642													ENSG00000121905																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.*85G>A	1.37:g.33359548G>A			B2R9T3|D3DPQ7|P32076|P41211|P70510	R	SNP	-	NULL	ENST00000373467.3	37	NULL	CCDS370.1	1																																																																																			-	HPCA	-	-		0.642	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCA	HGNC	protein_coding	OTTHUMT00000011480.1	0	0	0	19	19	51	0.00	0.00	G	NM_002143		33359548	+1	13	10	10	33	tier1	no_errors	ENST00000459874	ensembl	human	known	74_37	rna	56.52	23.26	SNP	1.000	A	13	10
DNAJC1	64215	genome.wustl.edu	37	10	22048139	22048139	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr10:22048139C>T	ENST00000376980.3	-	11	1846	c.1556G>A	c.(1555-1557)cGc>cAc	p.R519H	DNAJC1_ENST00000483085.1_5'Flank	NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	519	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				TTTGTCCCAGCGGTCAGAGGA	0.542													ENSG00000136770																																					0													129.0	130.0	130.0					10																	22048139		2203	4300	6503	SO:0001583	missense	0			-	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.1556G>A	10.37:g.22048139C>T	ENSP00000366179:p.Arg519His		B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	pfam_DnaJ_domain,pfam_SANT/Myb,superfamily_DnaJ_domain,superfamily_Homeodomain-like,smart_DnaJ_domain,smart_SANT/Myb,pfscan_Myb-like_dom,pfscan_DnaJ_domain,prints_DnaJ_domain	p.R519H	ENST00000376980.3	37	c.1556	CCDS7136.1	10	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257777	0.80246	.	.	ENSG00000136770	ENST00000376980	T	0.44881	0.91	5.94	5.94	0.96194	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.050907	0.85682	D	0.000000	T	0.78528	0.4297	H	0.97158	3.95	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84896	0.0839	10	0.87932	D	0	-2.6786	20.3633	0.98874	0.0:1.0:0.0:0.0	.	240;519	Q96NY3;Q96KC8	.;DNJC1_HUMAN	H	519	ENSP00000366179:R519H	ENSP00000366179:R519H	R	-	2	0	DNAJC1	22088145	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	7.729000	0.84864	2.826000	0.97356	0.561000	0.74099	CGC	-	DJC1	-	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom		0.542	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DJC1	HGNC	protein_coding	OTTHUMT00000047149.1	0	0	0	37	37	69	0.00	0.00	C	NM_022365		22048139	-1	15	22	20	40	tier1	no_errors	ENST00000376980	ensembl	human	known	74_37	missense	42.86	35.48	SNP	1.000	T	15	20
WBP11P1	441818	genome.wustl.edu	37	18	30093484	30093484	+	RNA	SNP	A	A	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr18:30093484A>T	ENST00000567636.1	+	0	1859					NR_003558.1				WW domain binding protein 11 pseudogene 1																		AAGTGCAGCCACCGTTGAGAA	0.517													ENSG00000260389																																					0																																												0			-	BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30093484A>T				R	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			-	WBP11P1	-	-		0.517	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	0	0	0	28	28	52	0.00	0.00	A			30093484	+1	19	27	25	37	tier1	no_errors	ENST00000567636	ensembl	human	known	74_37	rna	43.18	42.19	SNP	1.000	T	19	25
MAP7D1	55700	genome.wustl.edu	37	1	36636667	36636667	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr1:36636667C>G	ENST00000373151.2	+	2	358	c.142C>G	c.(142-144)Ccc>Gcc	p.P48A	MAP7D1_ENST00000373150.4_Missense_Mutation_p.P48A|MAP7D1_ENST00000316156.4_Missense_Mutation_p.P48A	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	48	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CCCCGACACTCCCCCGGACAC	0.652													ENSG00000116871																																					0													46.0	51.0	50.0					1																	36636667		2203	4300	6503	SO:0001583	missense	0			-	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.142C>G	1.37:g.36636667C>G	ENSP00000362244:p.Pro48Ala		D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	pfam_MAP7	p.P48A	ENST00000373151.2	37	c.142	CCDS30673.1	1	.	.	.	.	.	.	.	.	.	.	C	19.84	3.902286	0.72754	.	.	ENSG00000116871	ENST00000429533;ENST00000316156;ENST00000373150;ENST00000373151;ENST00000530729	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	4.74	4.74	0.60224	.	0.000000	0.41500	D	0.000866	T	0.14830	0.0358	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.993	D;D;D	0.83275	0.996;0.996;0.971	T	0.00468	-1.1721	10	0.49607	T	0.09	-18.004	14.9178	0.70812	0.0:1.0:0.0:0.0	.	48;48;48	Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;MA7D1_HUMAN	A	9;48;48;48;9	ENSP00000390091:P9A;ENSP00000320228:P48A;ENSP00000362243:P48A;ENSP00000362244:P48A;ENSP00000435126:P9A	ENSP00000320228:P48A	P	+	1	0	MAP7D1	36409254	0.246000	0.23909	1.000000	0.80357	0.938000	0.57974	1.368000	0.34216	2.631000	0.89168	0.462000	0.41574	CCC	-	MAP7D1	-	NULL		0.652	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D1	HGNC	protein_coding	OTTHUMT00000382095.1	0	0	0	78	78	59	0.00	0.00	C	NM_018067		36636667	+1	67	29	63	34	tier1	no_errors	ENST00000373151	ensembl	human	known	74_37	missense	51.54	46.03	SNP	1.000	G	67	63
CELF4	56853	genome.wustl.edu	37	18	34825066	34825066	+	3'UTR	SNP	G	G	T			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr18:34825066G>T	ENST00000420428.2	-	0	1995				CELF4_ENST00000334919.5_3'UTR|RP11-95O2.5_ENST00000589281.1_RNA|CELF4_ENST00000412753.1_3'UTR|CELF4_ENST00000603232.1_3'UTR|CELF4_ENST00000601019.1_3'UTR|CELF4_ENST00000591287.1_3'UTR|CELF4_ENST00000590011.1_5'UTR|CELF4_ENST00000361795.5_3'UTR	NM_020180.3	NP_064565.1	Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4						alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						GATTGATATTGGCTGATATGT	0.398													ENSG00000101489																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000420428.2:c.*139C>A	18.37:g.34825066G>T			Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	R	SNP	-	NULL	ENST00000420428.2	37	NULL	CCDS32818.1	18																																																																																			-	CELF4	-	-		0.398	CELF4-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF4	HGNC	protein_coding		0	0	0	8	8	24	0.00	0.00	G	NM_020180		34825066	-1	8	6	7	6	tier1	no_errors	ENST00000590011	ensembl	human	known	74_37	rna	53.33	50.00	SNP	1.000	T	8	7
MUM1L1	139221	genome.wustl.edu	37	X	105451169	105451169	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chrX:105451169T>C	ENST00000357175.2	+	4	2393	c.1744T>C	c.(1744-1746)Tgg>Cgg	p.W582R	MUM1L1_ENST00000337685.2_Missense_Mutation_p.W582R|MUM1L1_ENST00000372552.1_Missense_Mutation_p.W582R	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	582						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AGGATCCAGATGGCTGAAATC	0.413													ENSG00000157502																																					0													49.0	43.0	45.0					X																	105451169		1865	4093	5958	SO:0001583	missense	0			-	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1744T>C	X.37:g.105451169T>C	ENSP00000349699:p.Trp582Arg		D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	superfamily_PyrdxlP-dep_Trfase	p.W582R	ENST00000357175.2	37	c.1744	CCDS55469.1	X	.	.	.	.	.	.	.	.	.	.	T	15.70	2.911846	0.52439	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.41065	1.01;1.01;1.01	5.08	5.08	0.68730	.	0.000000	0.49305	D	0.000143	T	0.61999	0.2392	M	0.73598	2.24	0.39573	D	0.969304	D	0.89917	1.0	D	0.91635	0.999	T	0.67734	-0.5594	10	0.87932	D	0	-41.673	10.1122	0.42570	0.0:0.0:0.0:1.0	.	582	Q5H9M0	MUML1_HUMAN	R	582	ENSP00000349699:W582R;ENSP00000338641:W582R;ENSP00000361632:W582R	ENSP00000338641:W582R	W	+	1	0	MUM1L1	105337825	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	3.428000	0.52792	1.992000	0.58205	0.486000	0.48141	TGG	-	MUM1L1	-	NULL		0.413	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MUM1L1	HGNC	protein_coding	OTTHUMT00000057795.1	0	0	0	18	18	48	0.00	0.00	T	NM_152423		105451169	+1	23	36	0	6	tier1	no_errors	ENST00000337685	ensembl	human	known	74_37	missense	100.00	85.71	SNP	0.999	C	23	0
CACNA1A	773	genome.wustl.edu	37	19	13318673	13318678	+	In_Frame_Del	DEL	CTGCTG	CTGCTG	-	rs16054|rs370146696	byFrequency	TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	CTGCTG	CTGCTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr19:13318673_13318678delCTGCTG	ENST00000360228.5	-	47	6969_6974	c.6970_6975delCAGCAG	c.(6970-6975)cagcagdel	p.QQ2324del	CACNA1A_ENST00000573710.2_3'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2323	Poly-Gln.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGCCACCGCctgctgctgctgctgc	0.767													ENSG00000141837																																					0																																										SO:0001651	inframe_deletion	0				U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6970_6975delCAGCAG	19.37:g.13318679_13318684delCTGCTG	ENSP00000353362:p.Gln2324_Gln2325del		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.QQ2324in_frame_del	ENST00000360228.5	37	c.6975_6970	CCDS45998.1	19																																																																																				CAC1A	-	NULL		0.767	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CAC1A	HGNC	protein_coding	OTTHUMT00000104062.2	0	0	0	0	0	0	0.00	0.00	CTGCTG	NM_000068		13318678	-1	0	0	0	0	tier1	no_errors	ENST00000360228	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.259:0.316:0.374:0.432:0.459:0.497	-	0	0
MUC3A	4584	genome.wustl.edu	37	7	100608123	100608124	+	Intron	INS	-	-	G	rs111295588		TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:100608123_100608124insG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CAGCATTTCCCGATGGCTGAAG	0.589													ENSG00000225946																																					0																																										SO:0001627	intron_variant	0				AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-183->G	7.37:g.100608124_100608124dupG			O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	R	INS	-	NULL	ENST00000319509.7	37	NULL		7																																																																																				RP11-395B7.2	-	-		0.589	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	0	0	0	12	12	87	0.00	0.00	-	XM_001725354		100608124	-1	7	2	12	84	tier1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	36.84	2.33	INS	0.000:0.037	G	7	12
SPDYE2B	100310812	genome.wustl.edu	37	7	102294074	102294074	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XQ-01A-11D-A37C-09	TCGA-WK-A8XQ-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	a362ed3c-3c06-4aad-8b9e-a4b46b4cbcd3	779e9645-be20-45ce-842e-6224726c5e5a	g.chr7:102294074T>C	ENST00000507450.1	+	3	811	c.337T>C	c.(337-339)Tcc>Ccc	p.S113P	POLR2J2_ENST00000333432.6_Intron|SPDYE2B_ENST00000455020.2_5'Flank|POLR2J2_ENST00000591000.1_Intron|SPDYE2B_ENST00000436228.2_Missense_Mutation_p.S113P|POLR2J2_ENST00000476151.1_Intron	NM_001166339.1	NP_001159811.1	A6NHP3	SPE2B_HUMAN	speedy/RINGO cell cycle regulator family member E2B	113																	GCGAGTGTCATCCATCCTCCC	0.542													ENSG00000173678																																					0																																										SO:0001583	missense	0			-		CCDS59507.1	7q22.1	2013-05-08			ENSG00000173678	ENSG00000173678		"""Speedy homologs"""	48334	protein-coding gene	gene with protein product							Standard	NM_001166339		Approved			A6NHP3	OTTHUMG00000158393	ENST00000507450.1:c.337T>C	7.37:g.102294074T>C	ENSP00000424058:p.Ser113Pro		D6RBN0	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S113P	ENST00000507450.1	37	c.337	CCDS59507.1	7	.	.	.	.	.	.	.	.	.	.	c	0	-2.811089	0.00074	.	.	ENSG00000173678	ENST00000540965;ENST00000507450;ENST00000436228	.	.	.	.	.	.	.	.	.	.	.	T	0.12732	0.0309	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	6	0.27082	T	0.32	.	.	.	.	.	113	A6NHP3	SPE2L_HUMAN	P	113	.	ENSP00000440393:S113P	S	+	1	0	RP11-577H5.4	102081310	0.724000	0.28038	0.002000	0.10522	0.002000	0.02628	-0.913000	0.04042	-1.655000	0.01497	-1.635000	0.00777	TCC	-	SPDYE2B	-	NULL		0.542	SPDYE2B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE2B	HGNC	protein_coding	OTTHUMT00000350899.3	0	0	0	8	8	0	0.00	0.00	T			102294074	+1	4	0	6	0	tier1	no_errors	ENST00000436228	ensembl	human	known	74_37	missense	40.00	0.00	SNP	0.002	C	4	6
