#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PNMA3	29944	genome.wustl.edu	37	X	152226127	152226127	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:152226127G>C	ENST00000370264.4	+	1	741	c.715G>C	c.(715-717)Gtg>Ctg	p.V239L	PNMA3_ENST00000370265.4_Missense_Mutation_p.V239L|PNMA3_ENST00000447306.1_Missense_Mutation_p.V239L			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	239					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					cttgcagcaggtgttcggacc	0.542													ENSG00000183837																																					0													122.0	124.0	123.0					X																	152226127		2203	4300	6503	SO:0001583	missense	0			-	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.715G>C	X.37:g.152226127G>C	ENSP00000359286:p.Val239Leu		D3DWT7|Q9H0A4	Missense_Mutation	SNP	superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.V239L	ENST00000370264.4	37	c.715	CCDS35435.2	X	.	.	.	.	.	.	.	.	.	.	g	13.16	2.153246	0.38021	.	.	ENSG00000183837	ENST00000370265;ENST00000447306;ENST00000370264	T;T;T	0.10477	2.87;2.87;2.87	1.98	1.1	0.20463	.	.	.	.	.	T	0.14657	0.0354	L	0.56340	1.77	0.09310	N	1	P	0.51933	0.949	P	0.52881	0.712	T	0.16897	-1.0387	9	0.25751	T	0.34	.	4.2224	0.10565	0.2157:0.0:0.7843:0.0	.	239	Q9UL41	PNMA3_HUMAN	L	239	ENSP00000359288:V239L;ENSP00000407642:V239L;ENSP00000359286:V239L	ENSP00000359286:V239L	V	+	1	0	PNMA3	151976783	0.773000	0.28580	0.043000	0.18650	0.033000	0.12548	0.226000	0.17776	0.309000	0.22966	0.464000	0.42555	GTG	-	PNMA3	-	NULL		0.542	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA3	HGNC	protein_coding	OTTHUMT00000060946.2	0	0	1	44	44	118	0.00	0.84	G	NM_013364		152226127	+1	24	72	28	101	tier1	no_errors	ENST00000370264	ensembl	human	known	74_37	missense	46.15	41.62	SNP	0.039	C	24	28
GPHB5	122876	genome.wustl.edu	37	14	63784386	63784386	+	RNA	SNP	C	C	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr14:63784386C>A	ENST00000539258.1	-	0	234							Q86YW7	GPHB5_HUMAN	glycoprotein hormone beta 5						regulation of thyroid hormone mediated signaling pathway (GO:0002155)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(4)|urinary_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		GCGACCCCAGCAGGCATCCGT	0.562													ENSG00000179600																																					0													40.0	43.0	42.0					14																	63784386		2029	4181	6210			0			-	AF467770	CCDS73643.1	14q23.3	2006-09-25				ENSG00000179600			18055	protein-coding gene	gene with protein product		609652					Standard	NM_145171		Approved	ZLUT1, GPB5	uc021rud.1	Q86YW7			14.37:g.63784386C>A			Q6NTD0|Q8NFW2	R	SNP	-	NULL	ENST00000539258.1	37	NULL		14																																																																																			-	GPHB5	-	-		0.562	GPHB5-001	KNOWN	basic	processed_transcript	GPHB5	HGNC	processed_transcript	OTTHUMT00000400582.1	0	0	0	63	63	48	0.00	0.00	C	NM_145171		63784386	-1	22	12	60	64	tier1	no_errors	ENST00000314140	ensembl	human	known	74_37	rna	26.83	15.79	SNP	1.000	A	22	60
MYO6	4646	genome.wustl.edu	37	6	76599937	76599937	+	Missense_Mutation	SNP	A	A	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr6:76599937A>C	ENST00000369977.3	+	26	2961	c.2822A>C	c.(2821-2823)gAa>gCa	p.E941A	MYO6_ENST00000369985.4_Missense_Mutation_p.E941A|MYO6_ENST00000369975.1_Missense_Mutation_p.E941A|MYO6_ENST00000369981.3_Missense_Mutation_p.E941A	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	941	Glu-rich.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAAAGACGTGAAGAAGACGAA	0.383													ENSG00000196586																																					0													98.0	117.0	110.0					6																	76599937		2203	4300	6503	SO:0001583	missense	0			-	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.2822A>C	6.37:g.76599937A>C	ENSP00000358994:p.Glu941Ala		A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.E941A	ENST00000369977.3	37	c.2822	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	A	13.81	2.349351	0.41599	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975;ENST00000430435	T;T;T;T;T	0.67698	2.23;3.72;3.72;-0.28;0.88	5.98	5.98	0.97165	.	0.153546	0.56097	D	0.000027	T	0.78868	0.4351	M	0.85041	2.73	0.80722	D	1	D;D	0.56035	0.974;0.974	D;D	0.70487	0.969;0.969	T	0.78001	-0.2375	10	0.29301	T	0.29	.	16.1462	0.81575	1.0:0.0:0.0:0.0	.	941;941	Q9UM54-2;Q9UM54-1	.;.	A	941;941;941;941;941;4	ENSP00000358998:E941A;ENSP00000359002:E941A;ENSP00000358994:E941A;ENSP00000358992:E941A;ENSP00000399406:E4A	ENSP00000358992:E941A	E	+	2	0	MYO6	76656657	1.000000	0.71417	0.922000	0.36590	0.022000	0.10575	8.097000	0.89539	2.296000	0.77279	0.482000	0.46254	GAA	-	MYO6	-	NULL		0.383	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	0	0	0	32	32	91	0.00	0.00	A	NM_004999		76599937	+1	10	19	15	28	tier1	no_errors	ENST00000369981	ensembl	human	known	74_37	missense	40.00	40.43	SNP	1.000	C	10	15
C11orf49	79096	genome.wustl.edu	37	11	47183083	47183083	+	Missense_Mutation	SNP	G	G	T	rs541095717		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:47183083G>T	ENST00000278460.7	+	9	949	c.890G>T	c.(889-891)cGg>cTg	p.R297L	C11orf49_ENST00000543718.1_Missense_Mutation_p.R213L|C11orf49_ENST00000395460.2_3'UTR|C11orf49_ENST00000378615.3_Missense_Mutation_p.R303L|C11orf49_ENST00000378618.2_Intron|C11orf49_ENST00000536126.1_Missense_Mutation_p.R200L	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	297						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						CTGCCTTCCCGGACCCCTCCC	0.622											OREG0020950	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000149179																																					0													45.0	47.0	46.0					11																	47183083		2201	4299	6500	SO:0001583	missense	0			-	AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.890G>T	11.37:g.47183083G>T	ENSP00000278460:p.Arg297Leu	944	D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	NULL	p.R303L	ENST00000278460.7	37	c.908	CCDS7925.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.371946	0.95923	.	.	ENSG00000149179	ENST00000536126;ENST00000278460;ENST00000378615;ENST00000543718	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.63	5.63	0.86233	.	0.110104	0.64402	D	0.000008	T	0.52581	0.1743	M	0.68317	2.08	0.58432	D	0.99999	D;D;P;P	0.71674	0.998;0.998;0.932;0.932	D;D;P;P	0.80764	0.994;0.994;0.585;0.585	T	0.50759	-0.8790	10	0.72032	D	0.01	-4.9959	20.0471	0.97613	0.0:0.0:1.0:0.0	.	213;213;303;297	F5H6E0;B4DEG1;Q9H6J7-2;Q9H6J7	.;.;.;CK049_HUMAN	L	200;297;303;213	ENSP00000438207:R200L;ENSP00000278460:R297L;ENSP00000367878:R303L;ENSP00000437689:R213L	ENSP00000278460:R297L	R	+	2	0	C11orf49	47139659	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.417000	0.73337	2.815000	0.96918	0.561000	0.74099	CGG	-	C11orf49	-	NULL		0.622	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf49	HGNC	protein_coding	OTTHUMT00000391218.1	0	0	0	41	41	46	0.00	0.00	G	NM_024113		47183083	+1	15	10	38	46	tier1	no_errors	ENST00000378615	ensembl	human	known	74_37	missense	28.30	17.86	SNP	1.000	T	15	38
SH3PXD2B	285590	genome.wustl.edu	37	5	171766855	171766855	+	Silent	SNP	C	C	T	rs115528822		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr5:171766855C>T	ENST00000311601.5	-	13	1424	c.1254G>A	c.(1252-1254)ccG>ccA	p.P418P	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	418	SH3 3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGAAGGTGGCCGGGGCCCACC	0.562													ENSG00000174705	C|||	1	0.000199681	0.0008	0.0	5008	,	,		18542	0.0		0.0	False		,,,				2504	0.0																0													67.0	69.0	68.0					5																	171766855		2203	4300	6503	SO:0001819	synonymous_variant	0			GMAF=0.0005	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1254G>A	5.37:g.171766855C>T			B6F0V2|Q9P2Q1	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac-type,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.P418	ENST00000311601.5	37	c.1254	CCDS34291.1	5																																																																																			rs115528822	SH3PXD2B	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.562	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	0	0	0	25	25	90	0.00	0.00	C	NM_017963		171766855	-1	17	51	20	51	tier1	no_errors	ENST00000311601	ensembl	human	known	74_37	silent	45.95	50.00	SNP	0.991	T	17	20
OR4S1	256148	genome.wustl.edu	37	11	48328655	48328655	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:48328655A>G	ENST00000319988.1	+	1	881	c.881A>G	c.(880-882)aAt>aGt	p.N294S		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						GATGTGAAAAATGCCATGAGG	0.443													ENSG00000176555																																					0													76.0	71.0	72.0					11																	48328655		2201	4298	6499	SO:0001583	missense	0			-	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.881A>G	11.37:g.48328655A>G	ENSP00000321447:p.Asn294Ser		Q6IFB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N294S	ENST00000319988.1	37	c.881	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	A	9.373	1.071053	0.20147	.	.	ENSG00000176555	ENST00000319988	T	0.37584	1.19	5.02	-0.143	0.13444	.	.	.	.	.	T	0.19805	0.0476	N	0.26130	0.795	0.09310	N	1	B	0.19706	0.038	B	0.19946	0.027	T	0.27191	-1.0081	9	0.45353	T	0.12	.	0.1609	0.00103	0.3572:0.1584:0.1777:0.3067	.	294	Q8NGB4	OR4S1_HUMAN	S	294	ENSP00000321447:N294S	ENSP00000321447:N294S	N	+	2	0	OR4S1	48285231	0.000000	0.05858	0.997000	0.53966	0.424000	0.31475	-0.113000	0.10774	0.011000	0.14865	0.533000	0.62120	AAT	-	OR4S1	-	NULL		0.443	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	HGNC	protein_coding	OTTHUMT00000390556.1	0	0	0	15	15	126	0.00	0.00	A	NM_001004725		48328655	+1	16	52	6	68	tier1	no_errors	ENST00000319988	ensembl	human	known	74_37	missense	72.73	43.33	SNP	0.191	G	16	6
C10orf113	387638	genome.wustl.edu	37	10	21414843	21414843	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:21414843C>T	ENST00000534331.1	-	2	427	c.377G>A	c.(376-378)gGt>gAt	p.G126D	C10orf113_ENST00000377118.4_Missense_Mutation_p.G116D|C10orf113_ENST00000529198.1_3'UTR|NEBL_ENST00000417816.2_Intron	NM_001010896.2	NP_001010896.2	Q5VZT2	CJ113_HUMAN	chromosome 10 open reading frame 113	126										endometrium(1)|large_intestine(1)|lung(1)|ovary(3)|pancreas(1)	7						TTTGGTTATACCTTCTGGTCC	0.463													ENSG00000204683																																					0													99.0	98.0	98.0					10																	21414843		2203	4300	6503	SO:0001583	missense	0			-		CCDS31162.1, CCDS31162.2, CCDS53496.1	10p12.31	2012-06-12			ENSG00000204683	ENSG00000204683			31447	protein-coding gene	gene with protein product							Standard	NM_001010896		Approved	bA165O3.1	uc001iqm.3	Q5VZT2	OTTHUMG00000017786	ENST00000534331.1:c.377G>A	10.37:g.21414843C>T	ENSP00000433646:p.Gly126Asp		B9EIM9|E9PRX7	Missense_Mutation	SNP	NULL	p.G126D	ENST00000534331.1	37	c.377	CCDS31162.2	10	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465854	0.43839	.	.	ENSG00000204683	ENST00000534331;ENST00000377118	T;T	0.45668	0.89;0.89	4.81	3.91	0.45181	.	.	.	.	.	T	0.26122	0.0637	N	0.08118	0	0.26429	N	0.975973	P	0.46706	0.883	B	0.43413	0.419	T	0.05920	-1.0856	9	0.87932	D	0	-2.0903	8.7064	0.34356	0.0:0.8969:0.0:0.1031	.	126	Q5VZT2	CJ113_HUMAN	D	126;116	ENSP00000433646:G126D;ENSP00000366322:G116D	ENSP00000366322:G116D	G	-	2	0	C10orf113	21454849	0.980000	0.34600	1.000000	0.80357	0.995000	0.86356	1.994000	0.40757	1.243000	0.43853	0.460000	0.39030	GGT	-	C10orf113	-	NULL		0.463	C10orf113-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf113	HGNC	protein_coding	OTTHUMT00000047108.3	0	0	0	42	42	84	0.00	0.00	C	NM_001010896		21414843	-1	20	39	4	10	tier1	no_errors	ENST00000534331	ensembl	human	known	74_37	missense	83.33	79.59	SNP	1.000	T	20	4
PUS7	54517	genome.wustl.edu	37	7	105142968	105142968	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:105142968G>C	ENST00000356362.2	-	5	843	c.629C>G	c.(628-630)gCt>gGt	p.A210G	PUS7_ENST00000469408.1_Missense_Mutation_p.A210G	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	210					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						AGATTTGATAGCCTGATGGAT	0.398													ENSG00000091127																									Colon(138;2387 3051 17860)												0													206.0	180.0	189.0					7																	105142968		2203	4300	6503	SO:0001583	missense	0			-	AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.629C>G	7.37:g.105142968G>C	ENSP00000348722:p.Ala210Gly		Q75MG4|Q9NX19	Missense_Mutation	SNP	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	p.A210G	ENST00000356362.2	37	c.629	CCDS34725.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098686	0.76870	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.49720	0.77;0.77	5.84	5.84	0.93424	Pseudouridine synthase, catalytic domain (1);	0.051008	0.85682	D	0.000000	T	0.47322	0.1439	L	0.59436	1.845	0.80722	D	1	B;B	0.27068	0.086;0.167	B;B	0.23716	0.028;0.048	T	0.32745	-0.9895	10	0.26408	T	0.33	-19.0505	19.1228	0.93371	0.0:0.0:1.0:0.0	.	210;210	B3KY42;Q96PZ0	.;PUS7_HUMAN	G	210	ENSP00000348722:A210G;ENSP00000417402:A210G	ENSP00000348722:A210G	A	-	2	0	PUS7	104930204	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	7.634000	0.83273	2.765000	0.95021	0.655000	0.94253	GCT	-	PUS7	-	superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk		0.398	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PUS7	HGNC	protein_coding	OTTHUMT00000348681.1	0	0	0	80	80	102	0.00	0.00	G	NM_019042		105142968	-1	13	29	52	76	tier1	no_errors	ENST00000356362	ensembl	human	known	74_37	missense	20.00	27.62	SNP	1.000	C	13	52
KCP	375616	genome.wustl.edu	37	7	128520456	128520456	+	RNA	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:128520456G>A	ENST00000476647.2	-	0	3785							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						ACACGAGAGCGGTGAGCAGCG	0.657											OREG0018300	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000135253																																					0													9.0	13.0	12.0					7																	128520456		686	1583	2269			0			-	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128520456G>A		1565	Q8NBE0	R	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			-	KCP	-	-		0.657	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	0	0	0	55	55	20	0.00	0.00	G	NM_199349		128520456	-1	18	8	59	23	tier1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	23.38	25.81	SNP	0.002	A	18	59
KCNA7	3743	genome.wustl.edu	37	19	49573848	49573848	+	Silent	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:49573848T>A	ENST00000221444.1	-	2	1198	c.843A>T	c.(841-843)cgA>cgT	p.R281R		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	281					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	CACGCACCAATCGGATGACTC	0.632													ENSG00000104848																									Colon(74;686 1235 3793 23366 48562)												0													86.0	80.0	82.0					19																	49573848		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.843A>T	19.37:g.49573848T>A			A1KYX7|Q9BYS4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1	p.R281	ENST00000221444.1	37	c.843	CCDS12755.1	19																																																																																			-	KC7	-	pfam_Ion_trans_dom		0.632	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KC7	HGNC	protein_coding	OTTHUMT00000466263.1	0	0	0	40	40	54	0.00	0.00	T	NM_031886		49573848	-1	11	15	8	30	tier1	no_errors	ENST00000221444	ensembl	human	known	74_37	silent	57.89	33.33	SNP	0.729	A	11	8
AGBL1	123624	genome.wustl.edu	37	15	86822903	86822903	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr15:86822903C>T	ENST00000441037.2	+	15	2066	c.1971C>T	c.(1969-1971)ggC>ggT	p.G657G	AGBL1_ENST00000421325.2_Silent_p.G657G|AGBL1_ENST00000389298.3_Silent_p.G388G	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	657					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CTGTTGCAGGCGGAGCATCTG	0.512													ENSG00000166748																																					0													144.0	144.0	144.0					15																	86822903		2073	4215	6288	SO:0001819	synonymous_variant	0			-	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1971C>T	15.37:g.86822903C>T			A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.G657	ENST00000441037.2	37	c.1971	CCDS58398.1	15																																																																																			-	AGBL1	-	NULL		0.512	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	0	0	0	46	46	91	0.00	0.00	C	NM_152336		86822903	+1	30	48	29	37	tier1	no_errors	ENST00000441037	ensembl	human	known	74_37	silent	50.85	56.47	SNP	0.215	T	30	29
SLAMF8	56833	genome.wustl.edu	37	1	159799923	159799923	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:159799923T>A	ENST00000289707.5	+	2	457	c.308T>A	c.(307-309)gTg>gAg	p.V103E	SLAMF8_ENST00000368104.4_Intron|SLAMF8_ENST00000471286.1_3'UTR	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	103					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					AACTTCTCCGTGTTGATGGTG	0.632													ENSG00000158714																																					0													47.0	49.0	48.0					1																	159799923		2203	4300	6503	SO:0001583	missense	0			-	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.308T>A	1.37:g.159799923T>A	ENSP00000289707:p.Val103Glu		Q32MC6|Q5VU15	Missense_Mutation	SNP	pfscan_Ig-like_dom	p.V103E	ENST00000289707.5	37	c.308	CCDS1188.1	1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723624	0.48728	.	.	ENSG00000158714	ENST00000289707	T	0.25579	1.79	4.44	4.44	0.53790	.	0.377503	0.25258	N	0.031972	T	0.12475	0.0303	L	0.32530	0.975	0.80722	D	1	P	0.50943	0.94	P	0.44860	0.462	T	0.02365	-1.1170	10	0.59425	D	0.04	-13.682	10.0044	0.41949	0.0:0.0:0.0:1.0	.	103	Q9P0V8	SLAF8_HUMAN	E	103	ENSP00000289707:V103E	ENSP00000289707:V103E	V	+	2	0	SLAMF8	158066547	0.884000	0.30299	0.797000	0.32132	0.881000	0.50899	2.238000	0.43070	1.861000	0.53984	0.260000	0.18958	GTG	-	SLAMF8	-	NULL		0.632	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF8	HGNC	protein_coding	OTTHUMT00000085983.1	0	0	0	37	37	56	0.00	0.00	T	NM_020125		159799923	+1	6	13	24	49	tier1	no_errors	ENST00000289707	ensembl	human	known	74_37	missense	20.00	20.97	SNP	0.778	A	6	24
PPP1R3A	5506	genome.wustl.edu	37	7	113518500	113518500	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:113518500T>A	ENST00000284601.3	-	4	2715	c.2647A>T	c.(2647-2649)Agg>Tgg	p.R883W		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	883			R -> S (in dbSNP:rs1800000). {ECO:0000269|PubMed:9726244}.		glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						TGAACCTGCCTAAGATCTCTG	0.368													ENSG00000154415																																					0													92.0	89.0	90.0					7																	113518500		2203	4299	6502	SO:0001583	missense	0			-	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2647A>T	7.37:g.113518500T>A	ENSP00000284601:p.Arg883Trp		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.R883W	ENST00000284601.3	37	c.2647	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	3.991	-0.004434	0.07773	.	.	ENSG00000154415	ENST00000284601	T	0.16196	2.36	5.81	2.95	0.34219	.	0.934583	0.09032	N	0.858650	T	0.09818	0.0241	N	0.08118	0	0.09310	N	1	P	0.37525	0.598	B	0.36289	0.221	T	0.27123	-1.0083	10	0.62326	D	0.03	1.4488	8.75	0.34609	0.0:0.713:0.0:0.2869	.	883	Q16821	PPR3A_HUMAN	W	883	ENSP00000284601:R883W	ENSP00000284601:R883W	R	-	1	2	PPP1R3A	113305736	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	0.801000	0.27055	0.788000	0.33755	-0.182000	0.12963	AGG	-	PPP1R3A	-	NULL		0.368	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	0	0	0	27	27	131	0.00	0.00	T	NM_002711		113518500	-1	15	59	13	39	tier1	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	53.57	59.60	SNP	0.000	A	15	13
RSRP1	57035	genome.wustl.edu	37	1	25570199	25570199	+	Intron	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:25570199T>A	ENST00000243189.7	-	4	949				C1orf63_ENST00000417642.2_Intron	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN												breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AAAAATAGCCTAATTGTAAAC	0.313													ENSG00000117616																																					0																																										SO:0001627	intron_variant	0			-																												ENST00000243189.7:c.673-75A>T	1.37:g.25570199T>A			A8K917|Q49AA4|Q5TH71|Q9GZP6	R	SNP	-	NULL	ENST00000243189.7	37	NULL	CCDS260.1	1																																																																																			-	C1orf63	-	-		0.313	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf63	HGNC	protein_coding	OTTHUMT00000101966.2	0	0	0	24	24	136	0.00	0.00	T			25570199	-1	6	44	21	82	tier1	no_errors	ENST00000569495	ensembl	human	known	74_37	rna	22.22	34.65	SNP	0.000	A	6	21
INPPL1	3636	genome.wustl.edu	37	11	71943350	71943350	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:71943350A>T	ENST00000298229.2	+	14	1886	c.1682A>T	c.(1681-1683)cAc>cTc	p.H561L	INPPL1_ENST00000538751.1_Missense_Mutation_p.H319L|INPPL1_ENST00000541756.1_Missense_Mutation_p.H319L	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	561					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GTGAATTGTCACCTCACCTCG	0.557													ENSG00000165458																																					0													88.0	75.0	79.0					11																	71943350		2177	4257	6434	SO:0001583	missense	0			-	Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.1682A>T	11.37:g.71943350A>T	ENSP00000298229:p.His561Leu		B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.H561L	ENST00000298229.2	37	c.1682	CCDS8213.1	11	.	.	.	.	.	.	.	.	.	.	a	28.9	4.956624	0.92726	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	D;D;D	0.99042	-5.36;-5.36;-5.36	5.3	5.3	0.74995	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.057088	0.64402	D	0.000001	D	0.99566	0.9844	H	0.98525	4.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.74348	0.983	D	0.97823	1.0258	10	0.87932	D	0	.	13.4861	0.61366	1.0:0.0:0.0:0.0	.	561	O15357	SHIP2_HUMAN	L	561;319;319	ENSP00000298229:H561L;ENSP00000446360:H319L;ENSP00000444619:H319L	ENSP00000298229:H561L	H	+	2	0	INPPL1	71620998	1.000000	0.71417	0.997000	0.53966	0.892000	0.51952	7.021000	0.76425	2.126000	0.65437	0.533000	0.62120	CAC	-	INPPL1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.557	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	HGNC	protein_coding	OTTHUMT00000396789.1	0	0	0	31	31	96	0.00	0.00	A	NM_001567		71943350	+1	19	49	3	11	tier1	no_errors	ENST00000298229	ensembl	human	known	74_37	missense	86.36	81.67	SNP	1.000	T	19	3
PLPPR1	54886	genome.wustl.edu	37	9	104086318	104086318	+	Silent	SNP	G	G	A	rs371737348		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:104086318G>A	ENST00000374874.3	+	8	1396	c.957G>A	c.(955-957)gcG>gcA	p.A319A	SNORA31_ENST00000517232.1_RNA|LPPR1_ENST00000395056.2_Silent_p.A319A	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		319					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										ATCACTCTGCGTCCATGACCG	0.413													ENSG00000148123																																					0								G	,	1,4405	2.1+/-5.4	0,1,2202	163.0	126.0	138.0		957,957	3.3	1.0	9		138	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	LPPR1	NM_017753.2,NM_207299.1	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	319/326,319/326	104086318	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-																												ENST00000374874.3:c.957G>A	9.37:g.104086318G>A			Q5VX23|Q9NXE2	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A319	ENST00000374874.3	37	c.957	CCDS6751.1	9																																																																																			-	LPPR1	-	NULL		0.413	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR1	Uniprot_gn	protein_coding	OTTHUMT00000053425.1	0	0	0	32	32	92	0.00	0.00	G			104086318	+1	10	29	45	71	tier1	no_errors	ENST00000374874	ensembl	human	known	74_37	silent	18.18	29.00	SNP	1.000	A	10	45
CNGB3	54714	genome.wustl.edu	37	8	87679208	87679208	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:87679208T>C	ENST00000320005.5	-	6	844	c.797A>G	c.(796-798)tAt>tGt	p.Y266C		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	266					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TAGCATATCATAAAGGTAGAT	0.423													ENSG00000170289																																					0													111.0	101.0	104.0					8																	87679208		2203	4300	6503	SO:0001583	missense	0			-	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.797A>G	8.37:g.87679208T>C	ENSP00000316605:p.Tyr266Cys		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Y266C	ENST00000320005.5	37	c.797	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	0.439	-0.899597	0.02472	.	.	ENSG00000170289	ENST00000320005	D	0.97378	-4.36	5.55	1.63	0.23807	.	0.621291	0.16792	N	0.199358	D	0.83774	0.5327	N	0.00583	-1.355	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.77752	-0.2470	10	0.27082	T	0.32	.	2.4143	0.04432	0.2804:0.4527:0.1227:0.1443	.	266;266	Q9NQW8-2;Q9NQW8	.;CNGB3_HUMAN	C	266	ENSP00000316605:Y266C	ENSP00000316605:Y266C	Y	-	2	0	CNGB3	87748324	0.011000	0.17503	0.611000	0.29010	0.134000	0.20937	1.810000	0.38932	0.012000	0.14892	-0.242000	0.12053	TAT	-	CNGB3	-	NULL		0.423	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	0	0	0	32	32	92	0.00	0.00	T	NM_019098		87679208	-1	17	67	14	41	tier1	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	54.84	62.04	SNP	0.003	C	17	14
OR13G1	441933	genome.wustl.edu	37	1	247835974	247835974	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:247835974A>G	ENST00000359688.2	-	1	391	c.370T>C	c.(370-372)Tgt>Cgt	p.C124R	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005487.1	NP_001005487.1	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G, member 1	124						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(2)|lung(28)|skin(2)	35	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGAGGGAAACAAATGGCCACA	0.488													ENSG00000197437																																					0													99.0	82.0	88.0					1																	247835974		2203	4300	6503	SO:0001583	missense	0			-	AB065623	CCDS31094.1	1q44	2012-08-09			ENSG00000197437	ENSG00000197437		"""GPCR / Class A : Olfactory receptors"""	14999	protein-coding gene	gene with protein product		611677					Standard	NM_001005487		Approved		uc001idi.1	Q8NGZ3	OTTHUMG00000040212	ENST00000359688.2:c.370T>C	1.37:g.247835974A>G	ENSP00000352717:p.Cys124Arg		B2RN80|Q5T2T2|Q6IF86	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.C124R	ENST00000359688.2	37	c.370	CCDS31094.1	1	.	.	.	.	.	.	.	.	.	.	A	16.27	3.075084	0.55646	.	.	ENSG00000197437	ENST00000359688	T	0.34472	1.36	4.2	4.2	0.49525	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000219	T	0.65439	0.2691	M	0.91038	3.17	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73164	-0.4069	10	0.72032	D	0.01	-43.0462	11.5555	0.50745	1.0:0.0:0.0:0.0	.	124	Q8NGZ3	O13G1_HUMAN	R	124	ENSP00000352717:C124R	ENSP00000352717:C124R	C	-	1	0	OR13G1	245902597	0.323000	0.24643	0.987000	0.45799	0.505000	0.33919	3.249000	0.51437	1.888000	0.54679	0.460000	0.39030	TGT	-	OR13G1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.488	OR13G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13G1	HGNC	protein_coding	OTTHUMT00000096869.1	0	0	0	24	24	78	0.00	0.00	A	NM_001005487		247835974	-1	22	51	26	81	tier1	no_errors	ENST00000359688	ensembl	human	known	74_37	missense	45.83	38.35	SNP	1.000	G	22	26
GPR113	165082	genome.wustl.edu	37	2	26536280	26536280	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr2:26536280C>T	ENST00000311519.1	-	9	1437	c.1438G>A	c.(1438-1440)Gat>Aat	p.D480N	GPR113_ENST00000541401.1_Missense_Mutation_p.D83N|GPR113_ENST00000421160.2_Missense_Mutation_p.D411N|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.D281N	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	480					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCTCGCATCTGTGCAGCTG	0.647													ENSG00000173567																																					0													27.0	27.0	27.0					2																	26536280		2202	4300	6502	SO:0001583	missense	0			-	AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.1438G>A	2.37:g.26536280C>T	ENSP00000307831:p.Asp480Asn		B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.D281N	ENST00000311519.1	37	c.841	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512387	0.44660	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.29397	1.57;3.08;3.08;3.08	5.84	4.96	0.65561	.	.	.	.	.	T	0.35480	0.0933	M	0.64997	1.995	0.80722	D	1	B;B;B;B	0.25609	0.1;0.13;0.061;0.082	B;B;B;B	0.32928	0.155;0.064;0.063;0.096	T	0.10428	-1.0630	9	0.27785	T	0.31	-14.3356	14.8179	0.70048	0.0:0.8552:0.1448:0.0	.	411;281;480;83	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	N	83;281;411;480	ENSP00000445729:D83N;ENSP00000327396:D281N;ENSP00000388537:D411N;ENSP00000307831:D480N	ENSP00000307831:D480N	D	-	1	0	GPR113	26389784	0.465000	0.25815	0.498000	0.27564	0.381000	0.30169	1.153000	0.31676	1.462000	0.47948	0.561000	0.74099	GAT	-	GPR113	-	NULL		0.647	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	HGNC	protein_coding	OTTHUMT00000316892.1	0	0	0	50	50	39	0.00	0.00	C	NM_153835		26536280	-1	12	12	39	25	tier1	no_errors	ENST00000333478	ensembl	human	known	74_37	missense	23.53	32.43	SNP	0.629	T	12	39
ZW10	9183	genome.wustl.edu	37	11	113604439	113604439	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:113604439C>T	ENST00000200135.3	-	16	2461	c.2317G>A	c.(2317-2319)Gct>Act	p.A773T		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	773					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		GCAAGGGCAGCTGCTCTTCTT	0.423													ENSG00000086827																																					0													102.0	100.0	101.0					11																	113604439		2201	4296	6497	SO:0001583	missense	0			-	U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.2317G>A	11.37:g.113604439C>T	ENSP00000200135:p.Ala773Thr		A1A528	Missense_Mutation	SNP	pfam_RZZ-complex_Zw10	p.A773T	ENST00000200135.3	37	c.2317	CCDS8363.1	11	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742655	0.49151	.	.	ENSG00000086827	ENST00000200135	T	0.45668	0.89	5.58	4.48	0.54585	.	0.158128	0.56097	D	0.000035	T	0.30479	0.0766	L	0.28740	0.885	0.53688	D	0.999973	B	0.06786	0.001	B	0.08055	0.003	T	0.06991	-1.0796	10	0.14656	T	0.56	-13.6341	15.3329	0.74229	0.0:0.9213:0.0:0.0787	.	773	O43264	ZW10_HUMAN	T	773	ENSP00000200135:A773T	ENSP00000200135:A773T	A	-	1	0	ZW10	113109649	0.992000	0.36948	0.995000	0.50966	0.998000	0.95712	2.976000	0.49289	2.610000	0.88304	0.591000	0.81541	GCT	-	ZW10	-	NULL		0.423	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZW10	HGNC	protein_coding	OTTHUMT00000398700.1	0	0	0	40	40	68	0.00	0.00	C	NM_004724		113604439	-1	31	40	3	10	tier1	no_errors	ENST00000200135	ensembl	human	known	74_37	missense	91.18	80.00	SNP	0.997	T	31	3
PHF6	84295	genome.wustl.edu	37	X	133527620	133527620	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:133527620T>A	ENST00000332070.3	+	4	532	c.330T>A	c.(328-330)caT>caA	p.H110Q	PHF6_ENST00000370803.3_Missense_Mutation_p.H110Q|PHF6_ENST00000370799.1_Missense_Mutation_p.H110Q|PHF6_ENST00000394292.1_Missense_Mutation_p.H110Q|PHF6_ENST00000416404.2_Missense_Mutation_p.H76Q|PHF6_ENST00000370800.4_Missense_Mutation_p.H110Q	NM_032458.2	NP_115834.1	Q8IWS0	PHF6_HUMAN	PHD finger protein 6	110	Extended PHD1 domain (ePHD1).				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|scaffold protein binding (GO:0097110)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(88)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(1)|skin(1)|urinary_tract(1)	103	Acute lymphoblastic leukemia(192;0.000127)					GTGCATTGCATGATAAAGCTC	0.348			"""F, N, Splice, Mis"""		ETP ALL								ENSG00000156531																									Colon(100;666 1493 6344 21231 35807)			Rec	yes		X	Xq26.3	84295	PHD finger protein 6		L	0													154.0	128.0	137.0					X																	133527620		2203	4300	6503	SO:0001583	missense	0			-	AB058726	CCDS14639.1, CCDS14640.1	Xq26	2014-09-17			ENSG00000156531	ENSG00000156531		"""Zinc fingers, PHD-type"""	18145	protein-coding gene	gene with protein product	"""centromere protein 31"""	300414	"""Borjeson-Forssman-Lehmann syndrome"""	BFLS, BORJ		12415272, 15466013	Standard	NM_032335		Approved	KIAA1823, MGC14797, CENP-31	uc004exk.3	Q8IWS0	OTTHUMG00000022453	ENST00000332070.3:c.330T>A	X.37:g.133527620T>A	ENSP00000329097:p.His110Gln		A8K230|B4E0G4|D3DTG3|E9PC97|Q5JRC7|Q5JRC8|Q96JK3|Q9BRU0	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.H110Q	ENST00000332070.3	37	c.330	CCDS14639.1	X	.	.	.	.	.	.	.	.	.	.	T	8.052	0.766301	0.15983	.	.	ENSG00000156531	ENST00000370803;ENST00000332070;ENST00000394292;ENST00000370799;ENST00000416404;ENST00000370800	T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.15	1.33	0.21861	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);	0.166026	0.56097	D	0.000034	T	0.28830	0.0715	N	0.00583	-1.355	0.40701	D	0.982486	B;B;B;B;B	0.16396	0.017;0.002;0.01;0.01;0.005	B;B;B;B;B	0.18871	0.023;0.001;0.022;0.022;0.006	T	0.03287	-1.1052	10	0.26408	T	0.33	-12.7114	8.247	0.31695	0.0:0.2399:0.0:0.7601	.	76;110;110;110;110	B4E0G4;A8K230;Q8IWS0;E9PC97;Q8IWS0-2	.;.;PHF6_HUMAN;.;.	Q	110;110;110;110;76;110	ENSP00000359839:H110Q;ENSP00000329097:H110Q;ENSP00000377831:H110Q;ENSP00000359835:H110Q;ENSP00000394480:H76Q;ENSP00000359836:H110Q	ENSP00000329097:H110Q	H	+	3	2	PHF6	133355286	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	2.214000	0.42853	-0.039000	0.13602	-0.520000	0.04383	CAT	-	PHF6	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD		0.348	PHF6-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF6	HGNC	protein_coding	OTTHUMT00000058367.1	0	0	0	57	57	86	0.00	0.00	T	NM_032458		133527620	+1	25	53	30	73	tier1	no_errors	ENST00000394292	ensembl	human	known	74_37	missense	45.45	42.06	SNP	1.000	A	25	30
NUP188	23511	genome.wustl.edu	37	9	131744924	131744924	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:131744924G>A	ENST00000372577.2	+	16	1634	c.1613G>A	c.(1612-1614)aGc>aAc	p.S538N		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	538					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						TCCTATAGCAGCTGGACCCTC	0.488													ENSG00000095319																																					0													139.0	111.0	120.0					9																	131744924		2203	4300	6503	SO:0001583	missense	0			-	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.1613G>A	9.37:g.131744924G>A	ENSP00000361658:p.Ser538Asn		Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.S538N	ENST00000372577.2	37	c.1613	CCDS35156.1	9	.	.	.	.	.	.	.	.	.	.	G	18.26	3.585803	0.66105	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.31769	1.48	5.71	5.71	0.89125	.	0.171001	0.64402	D	0.000005	T	0.37293	0.0998	N	0.19112	0.55	0.49798	D	0.999825	D	0.58268	0.982	P	0.56865	0.808	T	0.08066	-1.0740	10	0.41790	T	0.15	-8.1849	18.8346	0.92157	0.0:0.0:1.0:0.0	.	538	Q5SRE5	NU188_HUMAN	N	427;538	ENSP00000361658:S538N	ENSP00000349125:S427N	S	+	2	0	NUP188	130784745	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.695000	0.74593	2.710000	0.92621	0.491000	0.48974	AGC	-	NUP188	-	pfam_Nucleoporin_Nup188		0.488	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	0	0	0	19	19	109	0.00	0.00	G			131744924	+1	28	71	22	75	tier1	no_errors	ENST00000372577	ensembl	human	known	74_37	missense	56.00	48.63	SNP	1.000	A	28	22
KCNJ12	3768	genome.wustl.edu	37	17	21318837	21318837	+	Silent	SNP	C	C	T	rs61514986	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr17:21318837C>T	ENST00000583088.1	+	3	1078	c.183C>T	c.(181-183)gaC>gaT	p.D61D	KCNJ12_ENST00000331718.5_Silent_p.D61D	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	61					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CCAACATGGACGAGAAGTCAC	0.592										Prostate(3;0.18)			ENSG00000184185																																					0								C		66,4340	55.5+/-91.7	0,66,2137	206.0	134.0	158.0		183	-1.7	1.0	17	dbSNP_129	158	117,8483	56.0+/-117.1	0,117,4183	no	coding-synonymous	KCNJ12	NM_021012.4		0,183,6320	TT,TC,CC		1.3605,1.498,1.407		61/434	21318837	183,12823	2203	4300	6503	SO:0001819	synonymous_variant	0			-	L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.183C>T	17.37:g.21318837C>T			O43401|Q15756|Q8NG63	Silent	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.D61	ENST00000583088.1	37	c.183	CCDS11219.1	17																																																																																			rs61514986	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2		0.592	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	0	0	1	56	56	150	0.00	0.66	C	NM_021012		21318837	+1	24	38	93	214	tier1	no_errors	ENST00000331718	ensembl	human	known	74_37	silent	20.34	15.08	SNP	0.958	T	24	93
AGK	55750	genome.wustl.edu	37	7	141315307	141315307	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:141315307C>T	ENST00000355413.4	+	8	720	c.460C>T	c.(460-462)Ctg>Ttg	p.L154L	AGK_ENST00000535825.1_Silent_p.L151L|AGK_ENST00000473247.1_Silent_p.L126L	NM_018238.3	NP_060708.1	Q53H12	AGK_HUMAN	acylglycerol kinase	154	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide biosynthetic process (GO:0046513)|glycerolipid metabolic process (GO:0046486)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acylglycerol kinase activity (GO:0047620)|ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(1)|endometrium(1)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(3)	17	Melanoma(164;0.0171)					ATTTATCCCACTGGGAGAGAC	0.443													ENSG00000006530																																					0													180.0	183.0	182.0					7																	141315307		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC022777	CCDS5865.1	7q34	2010-05-04	2007-01-11	2007-01-11	ENSG00000006530	ENSG00000006530	2.7.1.94		21869	protein-coding gene	gene with protein product		610345	"""multiple substrate lipid kinase"""	MULK		15252046, 15939762, 17135245	Standard	NM_018238		Approved	FLJ10842	uc003vwi.2	Q53H12	OTTHUMG00000157499	ENST00000355413.4:c.460C>T	7.37:g.141315307C>T			Q75KN1|Q96GC3|Q9NP48	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.L154	ENST00000355413.4	37	c.460	CCDS5865.1	7																																																																																			-	AGK	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom		0.443	AGK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGK	HGNC	protein_coding	OTTHUMT00000348969.1	0	0	0	76	76	115	0.00	0.00	C	NM_018238		141315307	+1	30	66	36	42	tier1	no_errors	ENST00000355413	ensembl	human	known	74_37	silent	45.45	61.11	SNP	1.000	T	30	36
CDH4	1002	genome.wustl.edu	37	20	60318791	60318791	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr20:60318791C>T	ENST00000360469.5	+	3	430	c.342C>T	c.(340-342)gaC>gaT	p.D114D	RP11-429E11.2_ENST00000442888.1_RNA|RP11-429E11.2_ENST00000447909.1_RNA|CDH4_ENST00000543233.1_Silent_p.D40D	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	114					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGAAATGGGACGCCGTGGTGC	0.637													ENSG00000179242																																					0													61.0	48.0	52.0					20																	60318791		2202	4300	6502	SO:0001819	synonymous_variant	0			-	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.342C>T	20.37:g.60318791C>T			B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Cadherin/Desmocollin	p.D114	ENST00000360469.5	37	c.342	CCDS13488.1	20																																																																																			-	CDH4	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like		0.637	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH4	HGNC	protein_coding	OTTHUMT00000079965.2	0	0	0	15	15	38	0.00	0.00	C	NM_001794		60318791	+1	10	14	7	47	tier1	no_errors	ENST00000360469	ensembl	human	known	74_37	silent	58.82	22.95	SNP	0.001	T	10	7
SLC4A7	9497	genome.wustl.edu	37	3	27453211	27453211	+	Missense_Mutation	SNP	T	T	C	rs370056312		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr3:27453211T>C	ENST00000295736.5	-	12	1731	c.1661A>G	c.(1660-1662)aAt>aGt	p.N554S	SLC4A7_ENST00000428386.1_Missense_Mutation_p.N430S|SLC4A7_ENST00000440156.1_Missense_Mutation_p.N550S|SLC4A7_ENST00000435667.2_Missense_Mutation_p.N439S|SLC4A7_ENST00000437179.1_Missense_Mutation_p.N435S|SLC4A7_ENST00000454389.1_Missense_Mutation_p.N563S|SLC4A7_ENST00000425128.2_Missense_Mutation_p.N546S|SLC4A7_ENST00000455077.1_Missense_Mutation_p.N435S|SLC4A7_ENST00000446700.1_Missense_Mutation_p.N546S|SLC4A7_ENST00000388777.4_Missense_Mutation_p.N104S|SLC4A7_ENST00000445684.1_Missense_Mutation_p.N550S	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	554					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	GGTAGATCCATTGTGAAACAC	0.413													ENSG00000033867																																					0								T	SER/ASN	0,4406		0,0,2203	57.0	59.0	58.0		1661	5.4	1.0	3		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC4A7	NM_003615.3	46	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	probably-damaging	554/1215	27453211	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.1661A>G	3.37:g.27453211T>C	ENSP00000295736:p.Asn554Ser		A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk	p.N563S	ENST00000295736.5	37	c.1688	CCDS33721.1	3	.	.	.	.	.	.	.	.	.	.	T	15.55	2.867078	0.51588	0.0	1.16E-4	ENSG00000033867	ENST00000419036;ENST00000295736;ENST00000428386;ENST00000454389;ENST00000440156;ENST00000437179;ENST00000446700;ENST00000455077;ENST00000445684;ENST00000435667;ENST00000388777;ENST00000425128;ENST00000428179	T;T;T;T;T;T;T;T;T;T;T;T;T	0.80393	-1.36;-1.06;-1.11;-1.07;-1.15;-1.11;-1.14;-1.11;-1.14;-1.11;-1.37;0.24;-1.1	5.43	5.43	0.79202	Bicarbonate transporter, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.87321	0.6148	M	0.73598	2.24	0.41352	D	0.987372	D;D;D;D;D;D;D;D;D	0.61080	0.985;0.977;0.985;0.976;0.985;0.963;0.987;0.985;0.989	P;P;P;P;P;P;D;P;D	0.67548	0.867;0.887;0.867;0.695;0.867;0.883;0.947;0.867;0.952	D	0.84750	0.0756	10	0.11182	T	0.66	.	15.7674	0.78138	0.0:0.0:0.0:1.0	.	550;435;546;550;563;104;430;554;435	E9PFN4;B5M452;E9PGC1;B5M453;E9PDL9;F8W7E6;Q9Y6M7-2;Q9Y6M7;B2CI53	.;.;.;.;.;.;.;S4A7_HUMAN;.	S	105;554;430;563;550;435;546;435;550;439;104;546;450	ENSP00000411031:N105S;ENSP00000295736:N554S;ENSP00000416368:N430S;ENSP00000390394:N563S;ENSP00000414797:N550S;ENSP00000394252:N435S;ENSP00000406605:N546S;ENSP00000407382:N435S;ENSP00000406804:N550S;ENSP00000395336:N439S;ENSP00000373429:N104S;ENSP00000401949:N546S;ENSP00000388703:N450S	ENSP00000295736:N554S	N	-	2	0	SLC4A7	27428215	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	7.499000	0.81566	2.179000	0.69175	0.533000	0.62120	AAT	-	SLC4A7	-	tigrfam_HCO3_transpt_euk		0.413	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	SLC4A7	HGNC	protein_coding	OTTHUMT00000341230.2	0	0	0	69	69	53	0.00	0.00	T	NM_003615		27453211	-1	12	22	85	74	tier1	no_errors	ENST00000454389	ensembl	human	known	74_37	missense	12.37	22.92	SNP	1.000	C	12	85
CUL1	8454	genome.wustl.edu	37	7	148494904	148494904	+	Splice_Site	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:148494904G>C	ENST00000325222.4	+	18	2179	c.1900G>C	c.(1900-1902)Gac>Cac	p.D634H	CUL1_ENST00000602748.1_Splice_Site_p.D634H|CUL1_ENST00000409469.1_Splice_Site_p.D634H	NM_003592.2	NP_003583.2	Q13616	CUL1_HUMAN	cullin 1	634					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|SCF ubiquitin ligase complex (GO:0019005)				breast(2)|central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(10)|liver(2)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	40	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			TTAATTGCAGGACATTTTGGC	0.358													ENSG00000055130																																					0													96.0	96.0	96.0					7																	148494904		2203	4300	6503	SO:0001630	splice_region_variant	0			-	U58087	CCDS34772.1	7q36.1	2011-05-24			ENSG00000055130	ENSG00000055130			2551	protein-coding gene	gene with protein product		603134				8681378	Standard	NM_003592		Approved		uc003wey.3	Q13616	OTTHUMG00000152776	ENST00000325222.4:c.1900-1G>C	7.37:g.148494904G>C			D3DWG3|O60719|Q08AL6|Q8IYW1	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.D634H	ENST00000325222.4	37	c.1900	CCDS34772.1	7	.	.	.	.	.	.	.	.	.	.	.	15.39	2.820799	0.50633	.	.	ENSG00000055130	ENST00000409469;ENST00000325222;ENST00000543583;ENST00000433865	T;T	0.75821	-0.97;-0.97	4.89	4.89	0.63831	Cullin, N-terminal (1);Winged helix-turn-helix transcription repressor DNA-binding (1);Cullin homology (2);	0.048371	0.85682	D	0.000000	T	0.73133	0.3548	M	0.66506	2.035	0.80722	D	1	B;B	0.30406	0.113;0.278	B;B	0.30855	0.046;0.121	T	0.71537	-0.4563	9	.	.	.	-34.6695	17.0586	0.86541	0.0:0.0:1.0:0.0	.	561;634	E7EWR0;Q13616	.;CUL1_HUMAN	H	634;634;592;561	ENSP00000387160:D634H;ENSP00000326804:D634H	.	D	+	1	0	CUL1	148125837	1.000000	0.71417	1.000000	0.80357	0.538000	0.34931	9.430000	0.97488	2.263000	0.75096	0.313000	0.20887	GAC	-	CUL1	-	pfam_Cullin_N,superfamily_Cullin_homology,pfscan_Cullin_homology		0.358	CUL1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CUL1	HGNC	protein_coding	OTTHUMT00000467785.1	0	0	0	59	59	98	0.00	0.00	G	NM_003592	Missense_Mutation	148494904	+1	38	61	32	44	tier1	no_errors	ENST00000325222	ensembl	human	known	74_37	missense	54.29	58.10	SNP	1.000	C	38	32
RASAL2	9462	genome.wustl.edu	37	1	178269251	178269251	+	Missense_Mutation	SNP	T	T	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr1:178269251T>G	ENST00000367649.3	+	3	807	c.455T>G	c.(454-456)cTg>cGg	p.L152R	RASAL2_ENST00000448150.3_Missense_Mutation_p.L134R			Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	0	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GCCACTAAACTGGGTAAGCTA	0.458											OREG0014010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000075391																																					0													56.0	59.0	58.0					1																	178269251		2203	4300	6503	SO:0001583	missense	0			-	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000367649.3:c.455T>G	1.37:g.178269251T>G	ENSP00000356621:p.Leu152Arg	1945	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.L152R	ENST00000367649.3	37	c.455	CCDS1321.2	1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178999	0.78564	.	.	ENSG00000075391	ENST00000448150;ENST00000367649	T;T	0.20881	2.07;2.04	5.61	5.61	0.85477	.	0.490245	0.19404	N	0.115110	T	0.37433	0.1003	L	0.36672	1.1	0.51767	D	0.999932	D	0.69078	0.997	D	0.78314	0.991	T	0.07028	-1.0794	10	0.56958	D	0.05	.	15.0834	0.72133	0.0:0.0:0.0:1.0	.	152	F8W755	.	R	134;152	ENSP00000407768:L134R;ENSP00000356621:L152R	ENSP00000356621:L152R	L	+	2	0	RASAL2	176535874	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.728000	0.68531	2.254000	0.74563	0.533000	0.62120	CTG	-	RASAL2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.458	RASAL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000352415.1	0	0	0	41	41	91	0.00	0.00	T	NM_170692		178269251	+1	20	37	28	52	tier1	no_errors	ENST00000367649	ensembl	human	known	74_37	missense	41.67	41.57	SNP	1.000	G	20	28
MARS	4141	genome.wustl.edu	37	12	57883288	57883288	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:57883288C>G	ENST00000262027.5	+	4	495	c.361C>G	c.(361-363)Ctg>Gtg	p.L121V	MARS_ENST00000315473.5_5'UTR|MARS_ENST00000447721.2_Intron|ARHGAP9_ENST00000550288.1_5'Flank|ARHGAP9_ENST00000393797.2_5'Flank	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	121	GST C-terminal.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GCGGAGAGCCCTGACTCACAT	0.522													ENSG00000166986																																					0													159.0	146.0	150.0					12																	57883288		2203	4300	6503	SO:0001583	missense	0			-	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.361C>G	12.37:g.57883288C>G	ENSP00000262027:p.Leu121Val		B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tR_Synth,pfam_WHEP-TRS,superfamily_tRsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,superfamily_S15_NS1_R-bd,superfamily_Thioredoxin-like_fold,pfscan_WHEP-TRS,prints_Met-tR_synth,tigrfam_Met-tR_synth	p.L121V	ENST00000262027.5	37	c.361	CCDS8942.1	12	.	.	.	.	.	.	.	.	.	.	C	6.614	0.481621	0.12581	.	.	ENSG00000166986	ENST00000262027	T	0.77229	-1.08	5.1	1.21	0.21127	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);	0.000000	0.64402	D	0.000005	T	0.65112	0.2660	L	0.42245	1.32	0.80722	D	1	B	0.33238	0.403	B	0.30316	0.114	T	0.56450	-0.7977	10	0.30078	T	0.28	-9.3015	9.7008	0.40184	0.0:0.6272:0.0:0.3728	.	121	P56192	SYMC_HUMAN	V	121	ENSP00000262027:L121V	ENSP00000262027:L121V	L	+	1	2	MARS	56169555	0.785000	0.28726	0.997000	0.53966	0.040000	0.13550	0.805000	0.27112	0.288000	0.22398	-0.794000	0.03295	CTG	-	MARS	-	superfamily_Glutathione-S-Trfase_C-like		0.522	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	0	0	0	22	22	87	0.00	0.00	C	NM_004990		57883288	+1	7	28	4	28	tier1	no_errors	ENST00000262027	ensembl	human	known	74_37	missense	63.64	50.00	SNP	0.998	G	7	4
DRAM1	55332	genome.wustl.edu	37	12	102302067	102302067	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:102302067C>T	ENST00000258534.8	+	4	885	c.446C>T	c.(445-447)cCc>cTc	p.P149L	DRAM1_ENST00000544152.1_Intron	NM_018370.2	NP_060840.2	Q8N682	DRAM1_HUMAN	DNA-damage regulated autophagy modulator 1	149					apoptotic process (GO:0006915)|autophagy (GO:0006914)|regulation of autophagy (GO:0010506)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12						AAATCATGTCCCCAGTGGAAC	0.512													ENSG00000136048																																					0													191.0	188.0	189.0					12																	102302067		2069	4211	6280	SO:0001583	missense	0			-	BC018435, DA721965	CCDS41823.1	12q23.2	2014-02-12	2009-06-12		ENSG00000136048	ENSG00000136048			25645	protein-coding gene	gene with protein product	"""damage-regulated autophagy modulator"""	610776				16839881	Standard	NM_018370		Approved	FLJ11259, DRAM	uc001tix.3	Q8N682		ENST00000258534.8:c.446C>T	12.37:g.102302067C>T	ENSP00000258534:p.Pro149Leu		B7Z4T0|Q7L3E3|Q9NUN1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.P149L	ENST00000258534.8	37	c.446	CCDS41823.1	12	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581917	0.86748	.	.	ENSG00000136048	ENST00000258534	T	0.43294	0.95	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.68915	0.3053	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68561	-0.5376	10	0.40728	T	0.16	.	19.2868	0.94082	0.0:1.0:0.0:0.0	.	149	Q8N682	DRAM1_HUMAN	L	149	ENSP00000258534:P149L	ENSP00000258534:P149L	P	+	2	0	DRAM1	100826198	1.000000	0.71417	0.999000	0.59377	0.628000	0.37860	5.184000	0.65070	2.653000	0.90120	0.643000	0.83706	CCC	-	DRAM1	-	pfam_Frag1/DRAM/Sfk1		0.512	DRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRAM1	HGNC	protein_coding	OTTHUMT00000409195.1	0	0	0	28	28	60	0.00	0.00	C	NM_018370		102302067	+1	9	9	13	48	tier1	no_errors	ENST00000258534	ensembl	human	known	74_37	missense	40.91	15.79	SNP	1.000	T	9	13
SRRM2	23524	genome.wustl.edu	37	16	2812100	2812100	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr16:2812100G>C	ENST00000301740.8	+	11	2120	c.1571G>C	c.(1570-1572)aGa>aCa	p.R524T		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	524	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGTGGGGAAGATCTAGAAGC	0.592													ENSG00000167978																																					0													72.0	63.0	66.0					16																	2812100		2198	4300	6498	SO:0001583	missense	0			-	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1571G>C	16.37:g.2812100G>C	ENSP00000301740:p.Arg524Thr		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mR_splic_Cwf21	p.R524T	ENST00000301740.8	37	c.1571	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	12.84	2.058824	0.36277	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.29397	1.57	5.91	2.89	0.33648	.	0.331639	0.25692	N	0.028926	T	0.17492	0.0420	N	0.19112	0.55	0.26132	N	0.980403	B	0.27498	0.18	B	0.24269	0.052	T	0.13656	-1.0501	10	0.45353	T	0.12	-1.7673	7.4897	0.27454	0.271:0.0:0.729:0.0	.	524	Q9UQ35	SRRM2_HUMAN	T	524;524;489	ENSP00000301740:R524T	ENSP00000301740:R524T	R	+	2	0	SRRM2	2752101	0.812000	0.29077	0.929000	0.37066	0.999000	0.98932	1.872000	0.39549	0.391000	0.25143	0.655000	0.94253	AGA	-	SRRM2	-	NULL		0.592	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	0	0	0	24	24	70	0.00	0.00	G			2812100	+1	8	43	26	76	tier1	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	23.53	36.13	SNP	0.931	C	8	26
CCDC129	223075	genome.wustl.edu	37	7	31683190	31683198	+	In_Frame_Del	DEL	GAATGCACT	GAATGCACT	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	GAATGCACT	GAATGCACT	GAATGCACT	-	GAATGCACT	GAATGCACT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:31683190_31683198delGAATGCACT	ENST00000407970.3	+	11	2244_2252	c.2206_2214delGAATGCACT	c.(2206-2214)gaatgcactdel	p.ECT736del	CCDC129_ENST00000409210.1_In_Frame_Del_p.ECT644del|CCDC129_ENST00000451887.2_In_Frame_Del_p.ECT762del|CCDC129_ENST00000319386.3_In_Frame_Del_p.ECT588del	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	736										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						AACATCTTTAGAATGCACTGTGTGTGATC	0.512													ENSG00000180347																																					0																																										SO:0001651	inframe_deletion	0				AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2206_2214delGAATGCACT	7.37:g.31683190_31683198delGAATGCACT	ENSP00000384416:p.Glu736_Thr738del		A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	In_Frame_Del	DEL	NULL	p.ECT762in_frame_del	ENST00000407970.3	37	c.2284_2292	CCDS5435.2	7																																																																																				CCDC129	-	NULL		0.512	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	HGNC	protein_coding	OTTHUMT00000318975.1	0	0	0	130	130	130	0.00	0.00	GAATGCACT	NM_194300		31683198	+1	34	34	24	24	tier1	no_errors	ENST00000451887	ensembl	human	known	74_37	in_frame_del	58.62	58.62	DEL	0.004:0.017:0.011:0.008:0.001:0.000:0.018:0.029:0.025	-	34	24
BAZ1B	9031	genome.wustl.edu	37	7	72856562	72856562	+	Silent	SNP	G	G	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr7:72856562G>T	ENST00000339594.4	-	19	4754	c.4416C>A	c.(4414-4416)gcC>gcA	p.A1472A	BAZ1B_ENST00000404251.1_Silent_p.A1472A	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1472					cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				ACTGTCCAACGGCCTCTGGCT	0.587													ENSG00000009954																									Esophageal Squamous(112;1167 1561 21085 43672 48228)												0													166.0	167.0	166.0					7																	72856562		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.4416C>A	7.37:g.72856562G>T			B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A1472	ENST00000339594.4	37	c.4416	CCDS5549.1	7																																																																																			-	BAZ1B	-	NULL		0.587	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4	0	0	0	36	36	83	0.00	0.00	G	NM_032408		72856562	-1	5	17	28	51	tier1	no_errors	ENST00000339594	ensembl	human	known	74_37	silent	14.71	25.00	SNP	0.001	T	5	28
PTEN	5728	genome.wustl.edu	37	10	89720855	89720859	+	Frame_Shift_Del	DEL	TACTT	TACTT	-			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	TACTT	TACTT	TACTT	-	TACTT	TACTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr10:89720855_89720859delTACTT	ENST00000371953.3	+	8	2363_2367	c.1006_1010delTACTT	c.(1006-1011)tactttfs	p.YF336fs	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	336	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.Y336*(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.F337fs*7(2)|p.R335fs*8(1)|p.G165_*404del(1)|p.F337fs*6(1)|p.R335fs*4(1)|p.R335fs*7(1)|p.W274_F341del(1)|p.Y336F(1)|p.D326_K342del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGCCAACCGATACTTTTCTCCAAAT	0.337		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			ENSG00000171862																											yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	63	Whole gene deletion(37)|Deletion - Frameshift(14)|Substitution - Nonsense(5)|Deletion - In frame(3)|Unknown(2)|Insertion - Frameshift(1)|Substitution - Missense(1)	central_nervous_system(17)|prostate(17)|endometrium(6)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)|kidney(1)	GRCh37	CI983205|CM074470	PTEN	I|M																																				SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.		U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.1006_1010delTACTT	10.37:g.89720855_89720859delTACTT	ENSP00000361021:p.Tyr336fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Y336fs	ENST00000371953.3	37	c.1006_1010	CCDS31238.1	10																																																																																				PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom		0.337	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	0	0	0	107	107	107	0.00	0.00	TACTT	NM_000314		89720859	+1	26	26	14	14	tier1	no_errors	ENST00000371953	ensembl	human	known	74_37	frame_shift_del	65.00	65.00	DEL	1.000:1.000:0.996:1.000:1.000	-	26	14
AC134698.1	0	genome.wustl.edu	37	8	43415867	43415867	+	RNA	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr8:43415867G>A	ENST00000408368.1	+	0	57																											gtgaccaagcgagttatagag	0.502													ENSG00000221295																																					0																																												0			-																													8.37:g.43415867G>A				R	SNP	-	NULL	ENST00000408368.1	37	NULL		8																																																																																			-	AC134698.1	-	-		0.502	AC134698.1-201	NOVEL	basic	miRNA	ENSG00000221295	Clone_based_ensembl_gene	miRNA		0	0	0	54	54	22	0.00	0.00	G			43415867	+1	22	21	19	1	tier1	no_errors	ENST00000408368	ensembl	human	novel	74_37	rna	53.66	95.45	SNP	0.000	A	22	19
MAP2K2	5605	genome.wustl.edu	37	19	4099304	4099304	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:4099304C>T	ENST00000262948.5	-	7	1067	c.814G>A	c.(814-816)Gcc>Acc	p.A272T	MAP2K2_ENST00000394867.4_Missense_Mutation_p.A175T|MAP2K2_ENST00000599345.1_5'Flank	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	272	Pro-rich.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	AGCTCTTTGGCGTCGGGCGGG	0.687													ENSG00000126934																																					0													14.0	16.0	15.0					19																	4099304		2198	4296	6494	SO:0001583	missense	0			-	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.814G>A	19.37:g.4099304C>T	ENSP00000262948:p.Ala272Thr			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A272T	ENST00000262948.5	37	c.814	CCDS12120.1	19	.	.	.	.	.	.	.	.	.	.	c	14.81	2.646264	0.47258	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	T;T	0.65178	-0.14;-0.14	4.53	2.27	0.28462	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.317119	0.33938	N	0.004415	T	0.41650	0.1168	N	0.21097	0.63	0.43457	D	0.99565	B	0.15719	0.014	B	0.19946	0.027	T	0.28073	-1.0055	10	0.27082	T	0.32	-26.8413	6.599	0.22691	0.1812:0.7179:0.0:0.1008	.	272	P36507	MP2K2_HUMAN	T	272;175	ENSP00000262948:A272T;ENSP00000378336:A175T	ENSP00000262948:A272T	A	-	1	0	MAP2K2	4050304	0.843000	0.29541	0.983000	0.44433	0.989000	0.77384	1.636000	0.37144	2.252000	0.74401	0.549000	0.68633	GCC	-	MAP2K2	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.687	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	HGNC	protein_coding	OTTHUMT00000258957.2	0	0	0	55	55	10	0.00	0.00	C			4099304	-1	29	3	47	6	tier1	no_errors	ENST00000262948	ensembl	human	known	74_37	missense	38.16	33.33	SNP	0.995	T	29	47
PPAPDC3	84814	genome.wustl.edu	37	9	134183431	134183431	+	Silent	SNP	C	C	T	rs371238589		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:134183431C>T	ENST00000372264.3	+	2	877	c.573C>T	c.(571-573)gcC>gcT	p.A191A		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	191					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		CCTTCCCGGCCGGGCACGCCA	0.697													ENSG00000160539																																					0								C		3,4401	6.2+/-15.9	0,3,2199	55.0	49.0	51.0		573	-2.4	1.0	9		51	0,8596		0,0,4298	no	coding-synonymous	PPAPDC3	NM_032728.3		0,3,6497	TT,TC,CC		0.0,0.0681,0.0231		191/272	134183431	3,12997	2202	4298	6500	SO:0001819	synonymous_variant	0			-	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.573C>T	9.37:g.134183431C>T			Q5T6P0|Q96SS7|Q9BRC3	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.A191	ENST00000372264.3	37	c.573	CCDS6942.1	9																																																																																			-	PPAPDC3	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.697	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC3	HGNC	protein_coding	OTTHUMT00000054724.1	0	0	0	63	63	17	0.00	0.00	C	NM_032728		134183431	+1	18	4	63	9	tier1	no_errors	ENST00000372264	ensembl	human	known	74_37	silent	22.22	30.77	SNP	0.977	T	18	63
TRIM26	7726	genome.wustl.edu	37	6	30154038	30154038	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr6:30154038G>A	ENST00000454678.2	-	10	1671	c.1235C>T	c.(1234-1236)aCg>aTg	p.T412M	TRIM26_ENST00000437089.1_Missense_Mutation_p.T412M|TRIM26_ENST00000453195.1_Missense_Mutation_p.T412M	NM_003449.4	NP_003440.1	Q12899	TRI26_HUMAN	tripartite motif containing 26	412	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			lung(1)|ovary(2)	3						ATCTTCGTCCGTTTCCCAGTC	0.552													ENSG00000234127																																					0													135.0	73.0	96.0					6																	30154038		1511	2709	4220	SO:0001583	missense	0			-	AB088090	CCDS4678.1	6p21.3	2013-01-09	2011-01-25	2001-11-23	ENSG00000234127	ENSG00000234127		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12962	protein-coding gene	gene with protein product		600830	"""tripartite motif-containing 26"""	ZNF173		8530076	Standard	NM_003449		Approved	RNF95	uc003npt.3	Q12899	OTTHUMG00000031041	ENST00000454678.2:c.1235C>T	6.37:g.30154038G>A	ENSP00000410446:p.Thr412Met		A6NG96|Q5SRL2	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.T412M	ENST00000454678.2	37	c.1235	CCDS4678.1	6	.	.	.	.	.	.	.	.	.	.	G	5.120	0.207719	0.09704	.	.	ENSG00000234127	ENST00000453195;ENST00000454678;ENST00000437089	T;T;T	0.63096	-0.02;-0.02;-0.02	5.1	4.23	0.50019	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.47455	D	0.000223	T	0.33089	0.0851	N	0.22421	0.69	0.09310	N	1	P;P	0.50443	0.935;0.813	P;B	0.45276	0.475;0.214	T	0.13019	-1.0525	10	0.56958	D	0.05	.	9.3508	0.38138	0.0965:0.0:0.9035:0.0	.	412;412	Q5SRL2;Q12899	.;TRI26_HUMAN	M	412	ENSP00000391879:T412M;ENSP00000410446:T412M;ENSP00000395491:T412M	ENSP00000395491:T412M	T	-	2	0	TRIM26	30262017	0.963000	0.33076	0.097000	0.21041	0.003000	0.03518	2.854000	0.48325	1.377000	0.46286	-0.277000	0.10078	ACG	-	TRIM26	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.552	TRIM26-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM26	HGNC	protein_coding	OTTHUMT00000253442.1	0	0	0	36	36	51	0.00	0.00	G	NM_003449		30154038	-1	25	13	4	3	tier1	no_errors	ENST00000437089	ensembl	human	known	74_37	missense	86.21	81.25	SNP	0.020	A	25	4
ZFPL1	7542	genome.wustl.edu	37	11	64852291	64852291	+	Intron	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr11:64852291C>T	ENST00000294258.3	+	2	254				CDCA5_ENST00000275517.3_5'Flank|ZFPL1_ENST00000525509.1_Nonsense_Mutation_p.R41*|ZFPL1_ENST00000526791.1_Nonsense_Mutation_p.R41*|CDCA5_ENST00000404147.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1						regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						TTCAGGGGAGCGACTGAGCAG	0.592													ENSG00000162300																																					0													47.0	43.0	44.0					11																	64852291		2201	4297	6498	SO:0001627	intron_variant	0			-		CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.102+19C>T	11.37:g.64852291C>T			A8K7E9|O14616|Q9UID0	Nonsense_Mutation	SNP	NULL	p.R41*	ENST00000294258.3	37	c.121	CCDS8092.1	11	.	.	.	.	.	.	.	.	.	.	C	33	5.218152	0.95104	.	.	ENSG00000162300	ENST00000525509;ENST00000526791	.	.	.	4.92	-4.68	0.03309	.	.	.	.	.	.	.	.	.	.	.	0.36529	D	0.870645	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	0.1404	0.00082	0.2507:0.223:0.2476:0.2787	.	.	.	.	X	41	.	ENSP00000433673:R41X	R	+	1	2	ZFPL1	64608867	0.000000	0.05858	0.000000	0.03702	0.882000	0.50991	-2.607000	0.00887	-0.401000	0.07644	0.561000	0.74099	CGA	-	ZFPL1	-	NULL		0.592	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	HGNC	protein_coding	OTTHUMT00000385196.1	0	0	0	39	39	69	0.00	0.00	C	NM_006782		64852291	+1	22	30	0	6	tier1	no_errors	ENST00000525509	ensembl	human	putative	74_37	nonsense	100.00	83.33	SNP	0.000	T	22	0
BTK	695	genome.wustl.edu	37	X	100608059	100608059	+	Intron	DEL	A	A	-	rs376521920		TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chrX:100608059delA	ENST00000308731.7	-	18	2072				BTK_ENST00000372880.1_Intron	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase						adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						gtctcaaattaaaaaaaaaaa	0.418									Agammaglobulinemia, X-linked				ENSG00000010671	|||unknown(HR)	1026	0.271788	0.1611	0.1383	3775	,	,		16549	0.2341		0.167	False		,,,				2504	0.32																0																																										SO:0001627	intron_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia		AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1908+122T>-	X.37:g.100608059delA			B2RAW1|Q32ML5	R	DEL	-	NULL	ENST00000308731.7	37	NULL	CCDS14482.1	X																																																																																				BTK	-	-		0.418	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	0	0	0	19	19	8	0.00	0.00	A	NM_000061		100608059	-1	6	1	28	2	tier1	no_errors	ENST00000470069	ensembl	human	known	74_37	rna	17.65	33.33	DEL	0.006	-	6	28
HRCT1	646962	genome.wustl.edu	37	9	35906627	35906627	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:35906627C>T	ENST00000354323.2	+	1	439	c.343C>T	c.(343-345)Cgc>Tgc	p.R115C	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	115						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						ccgccacGCTCGCTGAGGCTG	0.672													ENSG00000196196																																					0													7.0	9.0	8.0					9																	35906627		1558	3078	4636	SO:0001583	missense	0			-		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.343C>T	9.37:g.35906627C>T	ENSP00000346283:p.Arg115Cys		B7ZBJ1	Missense_Mutation	SNP	NULL	p.R115C	ENST00000354323.2	37	c.343	CCDS35012.1	9	.	.	.	.	.	.	.	.	.	.	C	8.339	0.828175	0.16749	.	.	ENSG00000196196	ENST00000354323	.	.	.	3.29	2.39	0.29439	.	.	.	.	.	T	0.18635	0.0447	N	0.14661	0.345	0.09310	N	1	D	0.67145	0.996	B	0.43783	0.431	T	0.07790	-1.0754	8	0.87932	D	0	-17.2079	6.7921	0.23705	0.0:0.8711:0.0:0.1289	.	115	Q6UXD1	HRCT1_HUMAN	C	115	.	ENSP00000346283:R115C	R	+	1	0	HRCT1	35896627	0.005000	0.15991	0.006000	0.13384	0.215000	0.24574	1.885000	0.39678	0.994000	0.38892	-0.217000	0.12591	CGC	-	HRCT1	-	NULL		0.672	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	HGNC	protein_coding	OTTHUMT00000334099.1	0	0	0	35	35	4	0.00	0.00	C	NM_001039792		35906627	+1	4	0	40	2	tier1	no_errors	ENST00000354323	ensembl	human	known	74_37	missense	9.09	0.00	SNP	0.006	T	4	40
GOLGA2P7	388152	genome.wustl.edu	37	15	84873329	84873329	+	RNA	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr15:84873329C>T	ENST00000559668.1	-	0	452				AC136698.1_ENST00000408081.1_RNA|RN7SL331P_ENST00000461138.2_RNA	NR_049748.1																						CTCCCCCCAGCGGTGCCCTAG	0.597													ENSG00000225151																																					0																																												0			-																													15.37:g.84873329C>T				R	SNP	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			-	AC103965.1	-	-		0.597	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	Clone_based_vega_gene	pseudogene	OTTHUMT00000418802.1	0	0	0	13	13	0	0.00	0.00	C			84873329	-1	7	0	13	0	tier1	no_errors	ENST00000561015	ensembl	human	known	74_37	rna	35.00	0.00	SNP	0.219	T	7	13
LRP3	4037	genome.wustl.edu	37	19	33697152	33697152	+	Silent	SNP	C	C	T			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr19:33697152C>T	ENST00000253193.7	+	5	1678	c.1476C>T	c.(1474-1476)gcC>gcT	p.A492A	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	492					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					GCCTGGCCGCCGTGCCCCGCA	0.657													ENSG00000130881																																					0													24.0	23.0	23.0					19																	33697152		2201	4293	6494	SO:0001819	synonymous_variant	0			-	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.1476C>T	19.37:g.33697152C>T			B3KQD6|B4DKF2	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_CUB_dom,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.A492	ENST00000253193.7	37	c.1476	CCDS12430.1	19																																																																																			-	LRP3	-	NULL		0.657	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP3	HGNC	protein_coding	OTTHUMT00000450842.4	0	0	0	37	37	3	0.00	0.00	C			33697152	+1	4	0	45	6	tier1	no_errors	ENST00000253193	ensembl	human	known	74_37	silent	8.16	0.00	SNP	0.004	T	4	45
MEGF9	1955	genome.wustl.edu	37	9	123476543	123476548	+	In_Frame_Del	DEL	CGGCGG	CGGCGG	-	rs200946879|rs369989873	byFrequency	TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	CGGCGG	CGGCGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr9:123476543_123476548delCGGCGG	ENST00000373930.3	-	1	200_205	c.89_94delCCGCCG	c.(88-96)gccgccgtc>gtc	p.AA30del	MEGF9_ENST00000426959.1_In_Frame_Del_p.AA22del	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	30	Ala-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						gctgaggcgacggcggcggcggcggc	0.782													ENSG00000106780		3349	0.66873	0.6044	0.7637	5008	,	,		7106	0.5853		0.7058	False		,,,				2504	0.7362																0										26,6		13,0,3						2.8	0.2		dbSNP_119	1	80,32		39,2,15	no	coding	MEGF9	NM_001080497.2		52,2,18	A1A1,A1R,RR		28.5714,18.75,26.3889				106,38				SO:0001651	inframe_deletion	0				AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.89_94delCCGCCG	9.37:g.123476549_123476554delCGGCGG	ENSP00000363040:p.Ala30_Ala31del		B7Z315|O75098	In_Frame_Del	DEL	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin	p.AA22in_frame_del	ENST00000373930.3	37	c.70_65	CCDS48010.2	9																																																																																				MEGF9	-	NULL		0.782	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF9	HGNC	protein_coding	OTTHUMT00000055513.1	0	0	0	0	0	0	0.00	0.00	CGGCGG	NM_001080497		123476548	-1	0	0	0	0	tier1	no_errors	ENST00000426959	ensembl	human	known	74_37	in_frame_del	0.00	0.00	DEL	0.255:0.243:0.247:0.263:0.993:0.998	-	0	0
MRPL42	28977	genome.wustl.edu	37	12	93894747	93894748	+	Intron	INS	-	-	A			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr12:93894747_93894748insA	ENST00000549982.1	+	6	544				MRPL42_ENST00000552217.1_Intron|MRPL42_ENST00000393128.4_Intron|MRPL42_ENST00000361630.2_Intron|MRPL42_ENST00000552938.1_3'UTR	NM_014050.3|NM_172177.3	NP_054769.1|NP_751917.1	Q9Y6G3	RM42_HUMAN	mitochondrial ribosomal protein L42						translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)	7						ccagtctctagaaaaaaaaaat	0.366													ENSG00000198015																																					0																																										SO:0001627	intron_variant	0				AB051626	CCDS9045.1	12q22	2014-02-12			ENSG00000198015	ENSG00000198015		"""Mitochondrial ribosomal proteins / large subunits"", ""Mitochondrial ribosomal proteins / small subunits"""	14493	protein-coding gene	gene with protein product	"""mitochondrial ribosomal protein S32"""	611847				11279123, 11042152	Standard	NM_014050		Approved	MRPS32, MRP-L31, RPML31, PTD007, HSPC204, MRPL31	uc001tcr.3	Q9Y6G3	OTTHUMG00000170157	ENST00000549982.1:c.384-204->A	12.37:g.93894757_93894757dupA			Q6FID1|Q96Q48|Q9P0S1	R	INS	-	NULL	ENST00000549982.1	37	NULL	CCDS9045.1	12																																																																																				MRPL42	-	-		0.366	MRPL42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL42	HGNC	protein_coding	OTTHUMT00000407715.1	0	0	0	10	10	0	0.00	0.00	-	NM_014050		93894748	+1	5	0	4	0	tier1	no_errors	ENST00000552938	ensembl	human	putative	74_37	rna	55.56	0.00	INS	0.002:0.008	A	5	4
DCT	1638	genome.wustl.edu	37	13	95131426	95131426	+	Silent	SNP	G	G	C			TCGA-WK-A8XS-01A-11D-A37C-09	TCGA-WK-A8XS-10E-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	e69af2f0-d12a-43e8-9ad7-52c69c4dd6cf	4942810b-91b3-42b0-b774-741d0c2aed08	g.chr13:95131426G>C	ENST00000377028.5	-	1	497	c.84C>G	c.(82-84)gtC>gtG	p.V28V	DCT_ENST00000446125.1_Silent_p.V28V	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	28					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		CCGTCATGCAGACTCGGGGGA	0.602													ENSG00000080166																																					0													42.0	41.0	41.0					13																	95131426		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.84C>G	13.37:g.95131426G>C			Q09GT4	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.V28	ENST00000377028.5	37	c.84	CCDS9470.1	13																																																																																			-	DCT	-	NULL		0.602	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	0	0	0	18	18	49	0.00	0.00	G			95131426	-1	8	2	34	65	tier1	no_errors	ENST00000446125	ensembl	human	known	74_37	silent	19.05	2.99	SNP	1.000	C	8	34
