#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SLC41A3	54946	genome.wustl.edu	37	3	125725891	125725891	+	Intron	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:125725891C>G	ENST00000315891.6	-	11	1605				SLC41A3_ENST00000360370.4_Missense_Mutation_p.G478R|SLC41A3_ENST00000508835.1_Missense_Mutation_p.G361R|SLC41A3_ENST00000383598.2_Missense_Mutation_p.G452R|SLC41A3_ENST00000346785.5_Intron	NM_001008485.1|NM_017836.3	NP_001008485|NP_060306.3	Q96GZ6	S41A3_HUMAN	solute carrier family 41, member 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			breast(1)|endometrium(4)|large_intestine(6)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18				GBM - Glioblastoma multiforme(114;0.167)		TCTGAGATGCCACCCAGCTCT	0.547													ENSG00000114544																																					0													87.0	87.0	87.0					3																	125725891		2203	4300	6503	SO:0001627	intron_variant	0			-		CCDS33842.1, CCDS33843.1, CCDS33844.1, CCDS43144.1, CCDS54635.1	3q21.2	2013-09-02			ENSG00000114544	ENSG00000114544		"""Solute carriers"""	31046	protein-coding gene	gene with protein product		610803					Standard	NM_001164475		Approved	FLJ20473	uc003eij.3	Q96GZ6	OTTHUMG00000162678	ENST00000315891.6:c.1366+65G>C	3.37:g.125725891C>G			A6ND60|B3KSD9|B7Z4Y2|C9JE96|E7ENY4|Q8N342|Q8NB27|Q9H9I6|Q9HAB1|Q9NX30	Missense_Mutation	SNP	pfam_SLC41_membr_dom,superfamily_Acyl_Trfase/lysoPLipase	p.G478R	ENST00000315891.6	37	c.1432	CCDS33843.1	3	.	.	.	.	.	.	.	.	.	.	C	9.980	1.227945	0.22542	.	.	ENSG00000114544	ENST00000360370;ENST00000383598;ENST00000458524;ENST00000508835	T;T	0.30448	1.53;1.54	3.69	1.53	0.23141	.	.	.	.	.	T	0.17408	0.0418	N	0.22421	0.69	0.09310	N	1	B;B;P	0.42203	0.437;0.177;0.773	B;B;B	0.36766	0.117;0.054;0.232	T	0.09997	-1.0649	9	0.52906	T	0.07	.	6.045	0.19755	0.1793:0.7028:0.0:0.1178	.	361;478;452	B7Z4Y2;E7ENY4;Q96GZ6-7	.;.;.	R	478;452;469;361	ENSP00000353533:G478R;ENSP00000373092:G452R	ENSP00000353533:G478R	G	-	1	0	SLC41A3	127208581	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	0.255000	0.18333	0.391000	0.25143	0.467000	0.42956	GGC	-	SLC41A3	-	NULL		0.547	SLC41A3-024	KNOWN	basic|CCDS	protein_coding	SLC41A3	HGNC	protein_coding	OTTHUMT00000370886.1	0	0	0	49	49	69	0.00	0.00	C	NM_017836		125725891	-1	25	13	26	45	tier1	no_errors	ENST00000360370	ensembl	human	known	74_37	missense	49.02	22.41	SNP	0.002	G	25	26
SERPINA4	5267	genome.wustl.edu	37	14	95030338	95030338	+	Silent	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr14:95030338C>T	ENST00000557004.1	+	2	940	c.519C>T	c.(517-519)taC>taT	p.Y173Y	SERPINA4_ENST00000555095.1_Silent_p.Y173Y|SERPINA5_ENST00000553780.1_Intron|SERPINA4_ENST00000298841.5_Silent_p.Y173Y			P29622	KAIN_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4	173					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(1)|large_intestine(9)|lung(28)|ovary(3)|skin(1)|urinary_tract(1)	46				COAD - Colon adenocarcinoma(157;0.211)		CCAACTTCTACGACACTGTGG	0.488													ENSG00000100665																																					0													178.0	162.0	167.0					14																	95030338		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L19684	CCDS9927.1	14q32.13	2014-02-18	2005-08-18		ENSG00000100665	ENSG00000100665		"""Serine (or cysteine) peptidase inhibitors"""	8948	protein-coding gene	gene with protein product		147935	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 4"""	PI4		8227002, 24172014	Standard	NM_001289032		Approved	KST, KAL, KLST, kallistatin	uc001ydk.3	P29622	OTTHUMG00000170859	ENST00000557004.1:c.519C>T	14.37:g.95030338C>T			Q53XB5|Q86TR9|Q96BZ5	Silent	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.Y173	ENST00000557004.1	37	c.519	CCDS9927.1	14																																																																																			-	SERPI4	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.488	SERPINA4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPI4	HGNC	protein_coding	OTTHUMT00000410718.1	0	0	0	54	54	127	0.00	0.00	C	NM_006215		95030338	+1	14	79	27	64	tier1	no_errors	ENST00000298841	ensembl	human	known	74_37	silent	34.15	55.24	SNP	0.000	T	14	27
KCNQ1	3784	genome.wustl.edu	37	11	2798237	2798237	+	Missense_Mutation	SNP	G	G	T	rs397508099		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr11:2798237G>T	ENST00000155840.5	+	14	1815	c.1707G>T	c.(1705-1707)aaG>aaT	p.K569N	KCNQ1_ENST00000335475.5_Missense_Mutation_p.K442N	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1	569					atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CCATTGGGAAGCCCTCACTGT	0.597													ENSG00000053918																																					0													250.0	175.0	201.0					11																	2798237		2202	4299	6501	SO:0001583	missense	0			-	AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1707G>T	11.37:g.2798237G>T	ENSP00000155840:p.Lys569Asn		O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCQN1,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.K569N	ENST00000155840.5	37	c.1707	CCDS7736.1	11	.	.	.	.	.	.	.	.	.	.	G	18.22	3.574624	0.65878	.	.	ENSG00000053918	ENST00000155840;ENST00000335475	D;D	0.99800	-6.8;-6.8	4.02	4.02	0.46733	Potassium channel, voltage dependent, KCNQ, C-terminal (1);	0.070588	0.56097	D	0.000037	D	0.99680	0.9880	M	0.83223	2.63	0.51012	D	0.9999	D;D;D	0.71674	0.996;0.996;0.998	D;D;D	0.72625	0.931;0.959;0.978	D	0.97279	0.9916	10	0.87932	D	0	-28.2666	11.8553	0.52433	0.0:0.0:1.0:0.0	.	442;442;569	P51787-2;Q14D14;P51787	.;.;KCNQ1_HUMAN	N	569;442	ENSP00000155840:K569N;ENSP00000334497:K442N	ENSP00000155840:K569N	K	+	3	2	KCNQ1	2754813	1.000000	0.71417	1.000000	0.80357	0.658000	0.38924	2.593000	0.46180	2.251000	0.74343	0.561000	0.74099	AAG	-	KCNQ1	-	pfam_K_chnl_volt-dep_KCNQ_C		0.597	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1	HGNC	protein_coding	OTTHUMT00000027382.2	0	0	0	118	118	85	0.00	0.00	G	NM_000218		2798237	+1	62	42	63	41	tier1	no_errors	ENST00000155840	ensembl	human	known	74_37	missense	49.60	50.60	SNP	1.000	T	62	63
ARHGAP30	257106	genome.wustl.edu	37	1	161022453	161022453	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:161022453G>C	ENST00000368013.3	-	7	1119	c.799C>G	c.(799-801)Cgg>Ggg	p.R267G	ARHGAP30_ENST00000368016.3_Missense_Mutation_p.R267G|ARHGAP30_ENST00000368015.1_Missense_Mutation_p.R90G	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	267					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TGGTAGGGCCGCATCTGTGGG	0.587													ENSG00000186517																																					0													69.0	69.0	69.0					1																	161022453		2203	4300	6503	SO:0001583	missense	0			-	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.799C>G	1.37:g.161022453G>C	ENSP00000356992:p.Arg267Gly		Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R267G	ENST00000368013.3	37	c.799	CCDS30918.1	1	.	.	.	.	.	.	.	.	.	.	G	13.60	2.285035	0.40394	.	.	ENSG00000186517	ENST00000368016;ENST00000368013;ENST00000368017;ENST00000368015	T;T;T	0.33438	2.99;2.93;1.41	4.05	4.05	0.47172	.	0.000000	0.64402	D	0.000016	T	0.30448	0.0765	L	0.40543	1.245	0.44024	D	0.996749	D;P	0.63880	0.993;0.938	P;P	0.59546	0.859;0.808	T	0.03807	-1.1002	10	0.48119	T	0.1	.	13.8274	0.63359	0.0:0.0:1.0:0.0	.	267;267	Q7Z6I6;Q7Z6I6-2	RHG30_HUMAN;.	G	267;267;119;90	ENSP00000356995:R267G;ENSP00000356992:R267G;ENSP00000356994:R90G	ENSP00000356992:R267G	R	-	1	2	ARHGAP30	159289077	1.000000	0.71417	0.962000	0.40283	0.842000	0.47809	3.963000	0.56773	2.097000	0.63578	0.549000	0.68633	CGG	-	ARHGAP30	-	NULL		0.587	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	0	0	0	45	45	114	0.00	0.00	G	NM_181720		161022453	-1	23	55	20	58	tier1	no_errors	ENST00000368013	ensembl	human	known	74_37	missense	52.27	48.25	SNP	0.994	C	23	20
PDS5A	23244	genome.wustl.edu	37	4	39851192	39851192	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr4:39851192T>C	ENST00000303538.8	-	27	3706	c.3167A>G	c.(3166-3168)aAc>aGc	p.N1056S		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TAACTTGATGTTCTCTGCCAT	0.358													ENSG00000121892																																					0													150.0	141.0	144.0					4																	39851192		1909	4135	6044	SO:0001583	missense	0			-	AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.3167A>G	4.37:g.39851192T>C	ENSP00000303427:p.Asn1056Ser			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N1056S	ENST00000303538.8	37	c.3167	CCDS47045.1	4	.	.	.	.	.	.	.	.	.	.	T	13.55	2.269904	0.40095	.	.	ENSG00000121892	ENST00000303538	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.55226	0.1907	L	0.54323	1.7	0.80722	D	1	B	0.02656	0.0	B	0.16289	0.015	T	0.51317	-0.8721	8	.	.	.	-14.6888	10.8978	0.47034	0.0:0.0729:0.0:0.9271	.	1056	Q29RF7	PDS5A_HUMAN	S	1056	.	.	N	-	2	0	PDS5A	39527587	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.188000	0.58351	2.112000	0.64535	0.533000	0.62120	AAC	-	PDS5A	-	NULL		0.358	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	0	0	0	87	87	90	0.00	0.00	T	NM_015200		39851192	-1	28	58	31	50	tier1	no_errors	ENST00000303538	ensembl	human	known	74_37	missense	47.46	53.70	SNP	1.000	C	28	31
WDFY3	23001	genome.wustl.edu	37	4	85758160	85758160	+	Silent	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr4:85758160C>T	ENST00000295888.4	-	7	905	c.498G>A	c.(496-498)gtG>gtA	p.V166V	WDFY3_ENST00000322366.6_Silent_p.V166V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	166					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTGCCTCAGGCACATGTGGAA	0.448													ENSG00000163625																																					0													93.0	81.0	85.0					4																	85758160		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.498G>A	4.37:g.85758160C>T			Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V166	ENST00000295888.4	37	c.498	CCDS3609.1	4																																																																																			-	WDFY3	-	NULL		0.448	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	0	0	0	89	89	107	0.00	0.00	C	NM_014991		85758160	-1	38	52	34	57	tier1	no_errors	ENST00000295888	ensembl	human	known	74_37	silent	52.78	47.71	SNP	1.000	T	38	34
COL12A1	1303	genome.wustl.edu	37	6	75862069	75862069	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr6:75862069C>A	ENST00000322507.8	-	18	4004	c.3695G>T	c.(3694-3696)gGc>gTc	p.G1232V	COL12A1_ENST00000345356.6_Missense_Mutation_p.G68V|COL12A1_ENST00000483888.2_Missense_Mutation_p.G1232V|COL12A1_ENST00000416123.2_Missense_Mutation_p.G1232V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1232	VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TCTTTTGGGGCCAATGTCAAA	0.423													ENSG00000111799																																					0													67.0	63.0	65.0					6																	75862069		1888	4114	6002	SO:0001583	missense	0			-	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3695G>T	6.37:g.75862069C>A	ENSP00000325146:p.Gly1232Val		O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G1232V	ENST00000322507.8	37	c.3695	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618009	0.87359	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.74	5.74	0.90152	von Willebrand factor, type A (3);	0.116646	0.56097	D	0.000033	D	0.94453	0.8215	M	0.94021	3.485	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.95074	0.8207	10	0.87932	D	0	.	19.9326	0.97124	0.0:1.0:0.0:0.0	.	68;1232	Q99715-2;Q99715	.;COCA1_HUMAN	V	1232;1232;68;1232;1232	ENSP00000325146:G1232V;ENSP00000305147:G68V;ENSP00000412864:G1232V;ENSP00000421216:G1232V	ENSP00000325146:G1232V	G	-	2	0	COL12A1	75918789	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.487000	0.81328	2.720000	0.93068	0.650000	0.86243	GGC	-	COL12A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.423	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	0	0	0	42	42	91	0.00	0.00	C	NM_004370		75862069	-1	17	52	21	53	tier1	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	44.74	49.52	SNP	1.000	A	17	21
ADCY2	108	genome.wustl.edu	37	5	7717343	7717343	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr5:7717343G>T	ENST00000338316.4	+	12	1785	c.1696G>T	c.(1696-1698)Gca>Tca	p.A566S	ADCY2_ENST00000537121.1_Missense_Mutation_p.A386S|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	566					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TGGGATTAATGCACAGAAGTG	0.318													ENSG00000078295																																					0													105.0	113.0	111.0					5																	7717343		2202	4296	6498	SO:0001583	missense	0			-	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1696G>T	5.37:g.7717343G>T	ENSP00000342952:p.Ala566Ser		B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.A566S	ENST00000338316.4	37	c.1696	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630485	0.14322	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.75260	-0.92;-0.92	6.17	6.17	0.99709	.	0.058473	0.64402	D	0.000001	T	0.42131	0.1189	N	0.00661	-1.28	0.44188	D	0.997008	B;B	0.10296	0.003;0.002	B;B	0.18871	0.023;0.003	T	0.54282	-0.8317	10	0.02654	T	1	.	15.581	0.76439	0.0:0.0:0.8623:0.1377	.	386;566	B7Z2C1;Q08462	.;ADCY2_HUMAN	S	566;399;386	ENSP00000342952:A566S;ENSP00000444803:A386S	ENSP00000342952:A566S	A	+	1	0	ADCY2	7770343	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.643000	0.74334	2.941000	0.99782	0.655000	0.94253	GCA	-	ADCY2	-	pfam_Adenylate_cyclase-like		0.318	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	0	0	0	44	44	63	0.00	0.00	G	NM_020546		7717343	+1	18	35	28	42	tier1	no_errors	ENST00000338316	ensembl	human	known	74_37	missense	39.13	45.45	SNP	1.000	T	18	28
UBE2C	11065	genome.wustl.edu	37	20	44444191	44444191	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr20:44444191C>A	ENST00000356455.4	+	4	348	c.228C>A	c.(226-228)gaC>gaA	p.D76E	UBE2C_ENST00000352551.5_Missense_Mutation_p.D47E|UBE2C_ENST00000496085.1_3'UTR|UBE2C_ENST00000405520.1_Missense_Mutation_p.D37E|UBE2C_ENST00000372568.4_Missense_Mutation_p.D37E|UBE2C_ENST00000243893.6_Intron|UBE2C_ENST00000335046.3_Intron	NM_007019.2	NP_008950.1	O00762	UBE2C_HUMAN	ubiquitin-conjugating enzyme E2C	76					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cyclin catabolic process (GO:0008054)|exit from mitosis (GO:0010458)|free ubiquitin chain polymerization (GO:0010994)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(2)|lung(2)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				TATATGAAGACCTGAGGTATA	0.542													ENSG00000175063																																					0													91.0	88.0	89.0					20																	44444191		2203	4300	6503	SO:0001583	missense	0			-	U73379	CCDS13370.1, CCDS13371.1, CCDS13372.1, CCDS13374.1, CCDS74733.1, CCDS74734.1	20q13.12	2007-02-05			ENSG00000175063	ENSG00000175063		"""Ubiquitin-conjugating enzymes E2"""	15937	protein-coding gene	gene with protein product		605574				9122200	Standard	NM_007019		Approved	UBCH10	uc002xpm.3	O00762	OTTHUMG00000033038	ENST00000356455.4:c.228C>A	20.37:g.44444191C>A	ENSP00000348838:p.Asp76Glu		A6NP33|E1P5N7|G3XAB7	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.D76E	ENST00000356455.4	37	c.228	CCDS13370.1	20	.	.	.	.	.	.	.	.	.	.	C	14.83	2.651833	0.47362	.	.	ENSG00000175063	ENST00000356455;ENST00000405520;ENST00000352551;ENST00000372568	T;T;T;T	0.72615	1.17;1.17;-0.67;1.17	4.77	3.81	0.43845	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.212210	0.49916	D	0.000126	T	0.58409	0.2120	N	0.26162	0.8	0.34850	D	0.741542	B;B	0.20164	0.042;0.001	B;B	0.27500	0.08;0.005	T	0.67461	-0.5665	10	0.72032	D	0.01	-35.8932	11.0888	0.48104	0.0:0.9073:0.0:0.0927	.	47;76	A6NP33;O00762	.;UBE2C_HUMAN	E	76;37;47;37	ENSP00000348838:D76E;ENSP00000385878:D37E;ENSP00000333975:D47E;ENSP00000361649:D37E	ENSP00000333975:D47E	D	+	3	2	UBE2C	43877598	0.994000	0.37717	1.000000	0.80357	0.993000	0.82548	0.348000	0.20031	2.486000	0.83907	0.555000	0.69702	GAC	-	UBE2C	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.542	UBE2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2C	HGNC	protein_coding	OTTHUMT00000080309.2	0	0	0	59	59	71	0.00	0.00	C	NM_007019		44444191	+1	25	40	28	36	tier1	no_errors	ENST00000356455	ensembl	human	known	74_37	missense	47.17	52.63	SNP	1.000	A	25	28
DNAH8	1769	genome.wustl.edu	37	6	38862564	38862564	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr6:38862564A>G	ENST00000359357.3	+	57	8274	c.8020A>G	c.(8020-8022)Aaa>Gaa	p.K2674E	DNAH8_ENST00000449981.2_Missense_Mutation_p.K2891E|DNAH8_ENST00000441566.1_Missense_Mutation_p.K2638E			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2674					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GTTGACCATAAAAGCTGAGGA	0.438													ENSG00000124721																																					0													84.0	77.0	80.0					6																	38862564		2203	4300	6503	SO:0001583	missense	0			-	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8020A>G	6.37:g.38862564A>G	ENSP00000352312:p.Lys2674Glu		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K2674E	ENST00000359357.3	37	c.8020		6	.	.	.	.	.	.	.	.	.	.	A	7.945	0.743718	0.15642	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.35048	1.33;1.33;1.33	5.33	5.33	0.75918	.	0.192865	0.47093	D	0.000253	T	0.07863	0.0197	N	0.20986	0.625	0.32886	D	0.51114	B	0.21753	0.06	B	0.21708	0.036	T	0.11494	-1.0585	10	0.02654	T	1	.	9.7719	0.40595	0.9228:0.0:0.0772:0.0	.	2674	Q96JB1	DYH8_HUMAN	E	2879;2879;2674;2638	ENSP00000333363:K2879E;ENSP00000352312:K2674E;ENSP00000402294:K2638E	ENSP00000333363:K2879E	K	+	1	0	DNAH8	38970542	1.000000	0.71417	0.996000	0.52242	0.918000	0.54935	4.987000	0.63857	1.999000	0.58509	0.455000	0.32223	AAA	-	DH8	-	superfamily_P-loop_NTPase		0.438	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DH8	HGNC	protein_coding	OTTHUMT00000043574.1	0	0	0	57	57	81	0.00	0.00	A	NM_001206927		38862564	+1	26	46	48	59	tier1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	35.14	43.81	SNP	0.999	G	26	48
ANAPC2	29882	genome.wustl.edu	37	9	140075277	140075277	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr9:140075277C>T	ENST00000323927.2	-	8	1577	c.1573G>A	c.(1573-1575)Gac>Aac	p.D525N		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	525					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		AGCAGGCGGTCGGCCAGCAGC	0.647													ENSG00000176248																																					0													70.0	59.0	63.0					9																	140075277		2203	4300	6503	SO:0001583	missense	0			-	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1573G>A	9.37:g.140075277C>T	ENSP00000314004:p.Asp525Asn		Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	pfam_Cullin_N,pfam_APC_su2_C,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	p.D525N	ENST00000323927.2	37	c.1573	CCDS7033.1	9	.	.	.	.	.	.	.	.	.	.	c	31	5.082470	0.94050	.	.	ENSG00000176248	ENST00000323927	T	0.75050	-0.9	5.41	5.41	0.78517	Cullin, N-terminal (1);Cullin homology (3);	0.044294	0.85682	D	0.000000	T	0.77219	0.4098	M	0.64260	1.97	0.80722	D	1	D;D	0.60575	0.988;0.985	P;B	0.47891	0.56;0.424	T	0.79715	-0.1687	10	0.54805	T	0.06	-36.3914	16.6659	0.85253	0.0:1.0:0.0:0.0	.	525;522	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	N	525	ENSP00000314004:D525N	ENSP00000314004:D525N	D	-	1	0	ANAPC2	139195098	1.000000	0.71417	0.961000	0.40146	0.935000	0.57460	5.543000	0.67225	2.536000	0.85505	0.556000	0.70494	GAC	-	APC2	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology		0.647	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000055315.1	0	0	0	88	88	24	0.00	0.00	C	NM_013366		140075277	-1	33	17	48	20	tier1	no_errors	ENST00000323927	ensembl	human	known	74_37	missense	40.74	45.95	SNP	0.999	T	33	48
NWD1	284434	genome.wustl.edu	37	19	16860069	16860069	+	Silent	SNP	A	A	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr19:16860069A>C	ENST00000552788.1	+	4	616	c.616A>C	c.(616-618)Agg>Cgg	p.R206R	NWD1_ENST00000524140.2_Silent_p.R206R|NWD1_ENST00000549814.1_Silent_p.R206R|NWD1_ENST00000339803.6_Silent_p.R71R|NWD1_ENST00000379808.3_Silent_p.R206R|NWD1_ENST00000523826.1_5'UTR			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	206							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTGCGCCCTTAGGATGGTGGA	0.592													ENSG00000188039																																					0													95.0	76.0	82.0					19																	16860069		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.616A>C	19.37:g.16860069A>C			C9J021|Q68CT3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_P-loop_NTPase,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R206	ENST00000552788.1	37	c.616		19																																																																																			-	NWD1	-	NULL		0.592	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	0	0	0	45	45	94	0.00	0.00	A	NM_001007525		16860069	+1	24	46	28	38	tier1	no_errors	ENST00000379808	ensembl	human	known	74_37	silent	46.15	54.76	SNP	0.000	C	24	28
CDH6	1004	genome.wustl.edu	37	5	31323070	31323070	+	Silent	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr5:31323070C>G	ENST00000265071.2	+	12	2293	c.2028C>G	c.(2026-2028)acC>acG	p.T676T		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	676					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATATCGGCACCCTGAGGAATC	0.502													ENSG00000113361																																					0													84.0	79.0	81.0					5																	31323070		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2028C>G	5.37:g.31323070C>G			A8K5H5|Q9BWS0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T676	ENST00000265071.2	37	c.2028	CCDS3894.1	5																																																																																			-	CDH6	-	pfam_Cadherin_cytoplasmic-dom		0.502	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	0	0	0	64	64	98	0.00	0.00	C	NM_004932		31323070	+1	34	71	36	51	tier1	no_errors	ENST00000265071	ensembl	human	known	74_37	silent	48.57	58.20	SNP	1.000	G	34	36
GLI3	2737	genome.wustl.edu	37	7	42007256	42007256	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr7:42007256A>G	ENST00000395925.3	-	14	2453	c.2369T>C	c.(2368-2370)tTt>tCt	p.F790S	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	790					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CAGTCGCGGAAACATTCCATT	0.507									Pallister-Hall syndrome;Greig Cephalopolysyndactyly				ENSG00000106571																																					0													282.0	277.0	279.0					7																	42007256		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	;	-		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2369T>C	7.37:g.42007256A>G	ENSP00000379258:p.Phe790Ser		A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F790S	ENST00000395925.3	37	c.2369	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	A	13.79	2.343158	0.41498	.	.	ENSG00000106571	ENST00000395925	T	0.12361	2.69	5.58	5.58	0.84498	.	0.181068	0.49916	D	0.000125	T	0.09423	0.0232	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.24835	-1.0149	10	0.21014	T	0.42	.	15.756	0.78025	1.0:0.0:0.0:0.0	.	790	P10071	GLI3_HUMAN	S	790	ENSP00000379258:F790S	ENSP00000379258:F790S	F	-	2	0	GLI3	41973781	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	8.962000	0.93254	2.131000	0.65755	0.533000	0.62120	TTT	-	GLI3	-	NULL		0.507	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	0	0	0	93	93	130	0.00	0.00	A	NM_000168		42007256	-1	46	61	45	62	tier1	no_errors	ENST00000395925	ensembl	human	known	74_37	missense	50.55	49.19	SNP	1.000	G	46	45
UBE3B	89910	genome.wustl.edu	37	12	109921780	109921780	+	Silent	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr12:109921780T>C	ENST00000342494.3	+	4	871	c.276T>C	c.(274-276)gaT>gaC	p.D92D	UBE3B_ENST00000280774.5_Silent_p.D92D|UBE3B_ENST00000537063.1_Silent_p.D92D|UBE3B_ENST00000434735.2_Silent_p.D92D|UBE3B_ENST00000340074.5_Silent_p.D92D|UBE3B_ENST00000540230.1_Silent_p.D92D|UBE3B_ENST00000536398.1_Silent_p.D92D	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	92					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TCAAAGAGGATAATGAGGTAA	0.323													ENSG00000151148																																					0													97.0	97.0	97.0					12																	109921780		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.276T>C	12.37:g.109921780T>C			A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.D92	ENST00000342494.3	37	c.276	CCDS9129.1	12																																																																																			-	UBE3B	-	superfamily_P-loop_NTPase		0.323	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	0	0	0	18	18	85	0.00	0.00	T	NM_183415		109921780	+1	4	36	11	57	tier1	no_errors	ENST00000342494	ensembl	human	known	74_37	silent	26.67	38.71	SNP	0.957	C	4	11
PKHD1	5314	genome.wustl.edu	37	6	51701242	51701242	+	Silent	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr6:51701242G>A	ENST00000371117.3	-	51	8408	c.8133C>T	c.(8131-8133)gtC>gtT	p.V2711V	PKHD1_ENST00000340994.4_Silent_p.V2711V	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2711					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCCGGAGAATGACTTGAACTT	0.408													ENSG00000170927																																					0													150.0	126.0	134.0					6																	51701242		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8133C>T	6.37:g.51701242G>A			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.V2711	ENST00000371117.3	37	c.8133	CCDS4935.1	6																																																																																			-	PKHD1	-	NULL		0.408	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0	0	59	59	128	0.00	0.00	G	NM_138694		51701242	-1	20	40	41	62	tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	silent	32.26	39.22	SNP	0.000	A	20	41
EML2	24139	genome.wustl.edu	37	19	46137656	46137656	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr19:46137656C>A	ENST00000245925.3	-	4	303	c.253G>T	c.(253-255)Gcc>Tcc	p.A85S	EML2_ENST00000587152.1_Missense_Mutation_p.A286S|EML2_ENST00000589876.1_Missense_Mutation_p.A85S|EML2_ENST00000536630.1_Missense_Mutation_p.A232S|EML2_ENST00000586902.1_5'Flank	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	85	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCTACGGAGGCCACAAAGTAC	0.592													ENSG00000125746																																					0													86.0	59.0	68.0					19																	46137656		2203	4300	6503	SO:0001583	missense	0			-	AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.253G>T	19.37:g.46137656C>A	ENSP00000245925:p.Ala85Ser		B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A286S	ENST00000245925.3	37	c.856	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153400	0.78114	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055;ENST00000399594	T;T;T	0.56776	0.44;0.44;0.44	4.74	4.74	0.60224	HELP (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.79076	0.4385	H	0.95079	3.62	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.951;0.998;0.999;1.0	T	0.81393	-0.0953	10	0.25106	T	0.35	-30.1418	15.2541	0.73571	0.0:1.0:0.0:0.0	.	85;251;232;243;85	B7Z918;B7Z3Q9;B7Z3I2;B7Z872;O95834	.;.;.;.;EMAL2_HUMAN	S	232;85;286;243	ENSP00000442365:A232S;ENSP00000245925:A85S;ENSP00000382503:A243S	ENSP00000245925:A85S	A	-	1	0	EML2	50829496	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	7.253000	0.78320	2.475000	0.83589	0.462000	0.41574	GCC	-	EML2	-	pfam_HELP,superfamily_Quinonprotein_ADH-like_supfam		0.592	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	0	0	0	117	117	51	0.00	0.00	C	NM_012155		46137656	-1	58	41	67	27	tier1	no_errors	ENST00000587152	ensembl	human	known	74_37	missense	46.40	60.29	SNP	1.000	A	58	67
ATF7IP	55729	genome.wustl.edu	37	12	14538308	14538308	+	Intron	SNP	G	G	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr12:14538308G>T	ENST00000261168.4	+	1	146				ATF7IP_ENST00000543189.1_Intron|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000536444.1_Intron|ATF7IP_ENST00000544627.1_5'UTR	NM_018179.3	NP_060649.3	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein						DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TCAGTGAGGAGACTTGTCACA	0.368													ENSG00000171681																																					0																																										SO:0001627	intron_variant	0			-	AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000261168.4:c.-8+19547G>T	12.37:g.14538308G>T			F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	R	SNP	-	NULL	ENST00000261168.4	37	NULL	CCDS8663.1	12																																																																																			-	ATF7IP	-	-		0.368	ATF7IP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding		0	0	0	35	35	88	0.00	0.00	G	NM_018179		14538308	+1	20	44	30	60	tier1	no_errors	ENST00000541654	ensembl	human	known	74_37	rna	40.00	42.31	SNP	0.984	T	20	30
TRIB2	28951	genome.wustl.edu	37	2	12858577	12858577	+	Silent	SNP	G	G	C	rs200687298		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr2:12858577G>C	ENST00000405331.3	+	1	214	c.144G>C	c.(142-144)ccG>ccC	p.P48P	RP11-333O1.1_ENST00000569860.1_lincRNA|TRIB2_ENST00000381465.2_Intron|TRIB2_ENST00000155926.4_Silent_p.P48P					tribbles pseudokinase 2											breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(5)|prostate(1)|skin(1)|stomach(1)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CCCCGAGCCCGCCCGAGACTC	0.557											OREG0014450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000071575																																					0													69.0	79.0	76.0					2																	12858577		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY245544	CCDS1683.1	2p25.1	2013-10-03	2013-10-03		ENSG00000071575	ENSG00000071575			30809	protein-coding gene	gene with protein product		609462	"""tribbles homolog 2 (Drosophila)"""			12736262, 17097562, 16715410	Standard	NM_021643		Approved	TRB2, GS3955	uc002rbv.4	Q92519	OTTHUMG00000090575	ENST00000405331.3:c.144G>C	2.37:g.12858577G>C		683		Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P48	ENST00000405331.3	37	c.144		2																																																																																			-	TRIB2	-	NULL		0.557	TRIB2-004	PUTATIVE	basic|exp_conf	protein_coding	TRIB2	HGNC	protein_coding	OTTHUMT00000323585.1	0	0	0	59	59	66	0.00	0.00	G	NM_021643		12858577	+1	35	13	16	30	tier1	no_errors	ENST00000155926	ensembl	human	known	74_37	silent	68.63	30.23	SNP	1.000	C	35	16
FGD6	55785	genome.wustl.edu	37	12	95604141	95604141	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr12:95604141G>A	ENST00000343958.4	-	2	1142	c.919C>T	c.(919-921)Cca>Tca	p.P307S	FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000549499.1_Missense_Mutation_p.P307S|FGD6_ENST00000546711.1_Missense_Mutation_p.P307S	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	307					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						GGGGTATATGGTACTAAATGA	0.408													ENSG00000180263																																					0													89.0	94.0	92.0					12																	95604141		2203	4300	6503	SO:0001583	missense	0			-	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.919C>T	12.37:g.95604141G>A	ENSP00000344446:p.Pro307Ser		Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.P307S	ENST00000343958.4	37	c.919	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	G	3.489	-0.104210	0.06967	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.68181	-0.21;-0.31;-0.24	5.71	3.86	0.44501	.	0.147641	0.31884	N	0.006918	T	0.61912	0.2385	M	0.62723	1.935	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.56384	-0.7988	10	0.54805	T	0.06	-4.4956	10.7483	0.46194	0.0679:0.0:0.8003:0.1319	.	307	Q6ZV73	FGD6_HUMAN	S	307	ENSP00000344446:P307S;ENSP00000450342:P307S;ENSP00000449005:P307S	ENSP00000344446:P307S	P	-	1	0	FGD6	94128272	0.949000	0.32298	0.909000	0.35828	0.169000	0.22640	1.053000	0.30442	0.731000	0.32448	-0.258000	0.10820	CCA	-	FGD6	-	NULL		0.408	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	0	0	0	42	42	123	0.00	0.00	G	NM_018351		95604141	-1	24	71	22	78	tier1	no_errors	ENST00000343958	ensembl	human	known	74_37	missense	52.17	47.65	SNP	0.029	A	24	22
HGF	3082	genome.wustl.edu	37	7	81381428	81381428	+	Intron	SNP	T	T	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr7:81381428T>A	ENST00000222390.5	-	5	852				HGF_ENST00000423064.2_Nonstop_Mutation_p.*211Y|HGF_ENST00000444829.2_Intron|HGF_ENST00000457544.2_Intron|HGF_ENST00000453411.1_Intron	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)						activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						GCATTCAGGTTTATTTACCTT	0.433													ENSG00000019991																																					0													120.0	107.0	111.0					7																	81381428		2203	4299	6502	SO:0001627	intron_variant	0			-		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.625+7A>T	7.37:g.81381428T>A			A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Nonstop_Mutation	SNP	pfam_Kringle,pfam_PAN-1_domain,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,pfscan_Pan_app,pfscan_Kringle	p.*211Y	ENST00000222390.5	37	c.633	CCDS5597.1	7	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944739	0.73672	.	.	ENSG00000019991	ENST00000423064	.	.	.	6.05	6.05	0.98169	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9918	0.58622	0.0:0.0:0.0:1.0	.	.	.	.	Y	211	.	.	X	-	3	2	HGF	81219364	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.526000	0.60566	2.323000	0.78572	0.533000	0.62120	TAA	-	HGF	-	NULL		0.433	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	HGNC	protein_coding	OTTHUMT00000253315.2	0	0	0	48	48	71	0.00	0.00	T	NM_000601		81381428	-1	21	28	36	30	tier1	no_errors	ENST00000423064	ensembl	human	known	74_37	nonstop	36.84	48.28	SNP	1.000	A	21	36
ZFHX4	79776	genome.wustl.edu	37	8	77618128	77618128	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr8:77618128G>C	ENST00000521891.2	+	2	2253	c.1805G>C	c.(1804-1806)gGg>gCg	p.G602A	ZFHX4_ENST00000050961.6_Missense_Mutation_p.G602A|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000518282.1_Missense_Mutation_p.G602A|ZFHX4_ENST00000455469.2_Missense_Mutation_p.G602A	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	602					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGCACACCAGGGCCTGGAGGA	0.577										HNSCC(33;0.089)			ENSG00000091656																																					0													69.0	76.0	74.0					8																	77618128		2100	4211	6311	SO:0001583	missense	0			-		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1805G>C	8.37:g.77618128G>C	ENSP00000430497:p.Gly602Ala		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.G602A	ENST00000521891.2	37	c.1805	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391640	0.62066	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.48836	0.8;0.84;0.82;0.81	5.65	5.65	0.86999	.	0.000000	0.38164	U	0.001788	T	0.55146	0.1902	L	0.56769	1.78	0.51767	D	0.999937	D;D;D;P	0.67145	0.982;0.996;0.99;0.95	P;P;P;P	0.58820	0.583;0.846;0.762;0.59	T	0.50145	-0.8862	10	0.02654	T	1	.	15.093	0.72211	0.0:0.0:1.0:0.0	.	602;602;602;602	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	A	602	ENSP00000430497:G602A;ENSP00000399605:G602A;ENSP00000050961:G602A;ENSP00000430848:G602A	ENSP00000050961:G602A	G	+	2	0	ZFHX4	77780683	1.000000	0.71417	0.994000	0.49952	0.700000	0.40528	7.079000	0.76829	2.941000	0.99782	0.655000	0.94253	GGG	-	ZFHX4	-	NULL		0.577	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	0	0	0	55	55	44	0.00	0.00	G	NM_024721		77618128	+1	23	23	33	22	tier1	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	40.35	51.11	SNP	1.000	C	23	33
ACSL4	2182	genome.wustl.edu	37	X	108887384	108887384	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chrX:108887384C>G	ENST00000469796.2	-	16	2406	c.2010G>C	c.(2008-2010)aaG>aaC	p.K670N	ACSL4_ENST00000348502.6_Missense_Mutation_p.K629N|ACSL4_ENST00000340800.2_Missense_Mutation_p.K670N			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	670					cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TTAATCGAACCTTGATTGGAA	0.458													ENSG00000068366																									Pancreas(188;358 2127 38547 41466 45492)												0													91.0	79.0	83.0					X																	108887384		2203	4300	6503	SO:0001583	missense	0			-	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.2010G>C	X.37:g.108887384C>G	ENSP00000419171:p.Lys670Asn		D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.K670N	ENST00000469796.2	37	c.2010	CCDS14548.1	X	.	.	.	.	.	.	.	.	.	.	C	15.71	2.915113	0.52546	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.16743	2.32;2.32;2.32	5.49	0.384	0.16244	.	0.051053	0.85682	D	0.000000	T	0.35451	0.0932	M	0.73753	2.245	0.48040	D	0.999574	D	0.63046	0.992	D	0.68039	0.955	T	0.04427	-1.0952	10	0.42905	T	0.14	-14.0331	11.5506	0.50719	0.0:0.5791:0.0:0.4209	.	670	O60488	ACSL4_HUMAN	N	629;670;670	ENSP00000262835:K629N;ENSP00000419171:K670N;ENSP00000339787:K670N	ENSP00000339787:K670N	K	-	3	2	ACSL4	108774040	0.997000	0.39634	0.937000	0.37676	0.958000	0.62258	0.498000	0.22530	-0.046000	0.13446	-0.191000	0.12829	AAG	-	ACSL4	-	NULL		0.458	ACSL4-003	KNOWN	basic|CCDS	protein_coding	ACSL4	HGNC	protein_coding	OTTHUMT00000358155.2	0	0	0	100	100	142	0.00	0.00	C	NM_004458		108887384	-1	57	72	57	74	tier1	no_errors	ENST00000340800	ensembl	human	known	74_37	missense	50.00	49.32	SNP	0.999	G	57	57
CLUH	23277	genome.wustl.edu	37	17	2599458	2599458	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr17:2599458C>G	ENST00000570628.2	-	13	2374	c.2269G>C	c.(2269-2271)Ggc>Cgc	p.G757R	CLUH_ENST00000538975.1_Missense_Mutation_p.G757R|CLUH_ENST00000435359.1_Missense_Mutation_p.G757R			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	757					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											CTCACCAAGCCAGGGATCTGG	0.637													ENSG00000132361																																					0													16.0	20.0	18.0					17																	2599458		1926	4115	6041	SO:0001583	missense	0			-	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.2269G>C	17.37:g.2599458C>G	ENSP00000458986:p.Gly757Arg		Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	superfamily_GSKIP_dom	p.G757R	ENST00000570628.2	37	c.2269	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	C	15.69	2.908799	0.52439	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.79653	-1.29;-1.29	5.66	5.66	0.87406	.	0.148317	0.64402	D	0.000011	T	0.72961	0.3526	L	0.41236	1.265	0.41973	D	0.990769	B;B	0.23058	0.079;0.079	B;B	0.25987	0.065;0.065	T	0.66760	-0.5842	10	0.17832	T	0.49	.	13.6636	0.62382	0.1544:0.8455:0.0:0.0	.	757;758	O75153;C9J6D7	K0664_HUMAN;.	R	757;758;757	ENSP00000388872:G757R;ENSP00000439628:G757R	ENSP00000320468:G758R	G	-	1	0	KIAA0664	2546208	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	4.766000	0.62279	2.673000	0.90976	0.591000	0.81541	GGC	-	CLUH	-	NULL		0.637	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUH	HGNC	protein_coding	OTTHUMT00000437807.2	0	0	0	133	133	42	0.00	0.00	C	NM_015229		2599458	-1	68	24	73	22	tier1	no_errors	ENST00000435359	ensembl	human	known	74_37	missense	48.23	52.17	SNP	0.997	G	68	73
HCFC1	3054	genome.wustl.edu	37	X	153224895	153224895	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chrX:153224895T>C	ENST00000310441.7	-	9	2458	c.1492A>G	c.(1492-1494)Act>Gct	p.T498A	HCFC1_ENST00000369984.4_Missense_Mutation_p.T498A|HCFC1_ENST00000354233.3_Missense_Mutation_p.T429A|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	498					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCAATGGAGTTCCTGTTGTA	0.607													ENSG00000172534																																					0													78.0	84.0	82.0					X																	153224895		2131	4207	6338	SO:0001583	missense	0			-		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1492A>G	X.37:g.153224895T>C	ENSP00000309555:p.Thr498Ala		Q6P4G5	Missense_Mutation	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.T498A	ENST00000310441.7	37	c.1492	CCDS44020.1	X	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233688	0.58886	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.02944	4.1;4.1;4.13	5.55	1.69	0.24217	Fibronectin, type III (1);	0.205916	0.50627	D	0.000102	T	0.02494	0.0076	N	0.08118	0	0.35618	D	0.809165	D	0.53151	0.958	P	0.55011	0.766	T	0.60682	-0.7215	10	0.32370	T	0.25	.	2.8245	0.05481	0.147:0.0824:0.1496:0.6209	.	498	P51610	HCFC1_HUMAN	A	498;498;429	ENSP00000309555:T498A;ENSP00000359001:T498A;ENSP00000346174:T429A	ENSP00000309555:T498A	T	-	1	0	HCFC1	152878089	1.000000	0.71417	0.780000	0.31762	0.973000	0.67179	2.182000	0.42556	0.193000	0.20303	0.441000	0.28932	ACT	-	HCFC1	-	smart_Fibronectin_type3		0.607	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	0	0	0	83	83	91	0.00	0.00	T	NM_005334		153224895	-1	44	33	29	66	tier1	no_errors	ENST00000310441	ensembl	human	known	74_37	missense	59.46	33.00	SNP	0.991	C	44	29
PAN2	9924	genome.wustl.edu	37	12	56726749	56726749	+	Missense_Mutation	SNP	C	C	T	rs376838096		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr12:56726749C>T	ENST00000425394.2	-	2	506	c.130G>A	c.(130-132)Gtg>Atg	p.V44M	PAN2_ENST00000257931.5_Missense_Mutation_p.V44M|PAN2_ENST00000548043.1_Missense_Mutation_p.V44M|PAN2_ENST00000440411.3_Missense_Mutation_p.V44M	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	TCCAAGGCCACTCCCTCTGGG	0.557													ENSG00000135473																																					0													120.0	99.0	106.0					12																	56726749		2203	4300	6503	SO:0001583	missense	0			-	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.130G>A	12.37:g.56726749C>T	ENSP00000401721:p.Val44Met			Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/D_pol3,pfam_Peptidase_C19/C67,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19/C67	p.V44M	ENST00000425394.2	37	c.130	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	15.58	2.876536	0.51801	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.05717	3.4;3.4;3.4;3.4	4.72	3.67	0.42095	.	0.238157	0.35838	N	0.002959	T	0.04724	0.0128	N	0.22421	0.69	0.31279	N	0.690863	B;B;B	0.12013	0.005;0.002;0.003	B;B;B	0.14023	0.01;0.004;0.004	T	0.08330	-1.0727	10	0.41790	T	0.15	-13.44	8.4099	0.32638	0.0:0.8593:0.0:0.1407	.	44;44;44	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	M	44	ENSP00000401721:V44M;ENSP00000388231:V44M;ENSP00000257931:V44M;ENSP00000449861:V44M	ENSP00000257931:V44M	V	-	1	0	PAN2	55013016	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.537000	0.67186	1.116000	0.41820	0.585000	0.79938	GTG	-	PAN2	-	NULL		0.557	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	0	0	0	38	38	55	0.00	0.00	C	NM_014871		56726749	-1	18	17	18	33	tier1	no_errors	ENST00000425394	ensembl	human	known	74_37	missense	50.00	34.00	SNP	1.000	T	18	18
MAGEA11	4110	genome.wustl.edu	37	X	148797280	148797280	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chrX:148797280C>T	ENST00000355220.5	+	4	311	c.209C>T	c.(208-210)gCc>gTc	p.A70V	MAGEA11_ENST00000333104.4_Missense_Mutation_p.A41V	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	70						cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGAGAACAGGCCAACCTGGAG	0.512													ENSG00000185247																																					0													112.0	106.0	108.0					X																	148797280		2203	4300	6503	SO:0001583	missense	0			-		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.209C>T	X.37:g.148797280C>T	ENSP00000347358:p.Ala70Val		Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A70V	ENST00000355220.5	37	c.209	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	8.223	0.803008	0.16397	.	.	ENSG00000185247	ENST00000412632;ENST00000333104;ENST00000355220	T;T;T	0.03242	4.0;4.37;4.32	0.88	0.88	0.19161	.	.	.	.	.	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	D;D	0.58620	0.983;0.971	P;B	0.45558	0.485;0.291	T	0.51725	-0.8669	8	0.27785	T	0.31	.	.	.	.	.	41;70	G5E962;P43364	.;MAGAB_HUMAN	V	41;41;70	ENSP00000391496:A41V;ENSP00000328177:A41V;ENSP00000347358:A70V	ENSP00000328177:A41V	A	+	2	0	MAGEA11	148577125	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-1.392000	0.02523	0.709000	0.31976	0.436000	0.28706	GCC	-	MAGEA11	-	NULL		0.512	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	HGNC	protein_coding	OTTHUMT00000058725.4	0	0	0	37	37	96	0.00	0.00	C	NM_005366		148797280	+1	22	32	30	32	tier1	no_errors	ENST00000355220	ensembl	human	known	74_37	missense	42.31	50.00	SNP	0.002	T	22	30
ZNF91	7644	genome.wustl.edu	37	19	23541628	23541628	+	3'UTR	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr19:23541628T>C	ENST00000300619.7	-	0	4358				ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'UTR	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TTAGAAAAGTTTGACTTGTCA	0.343													ENSG00000167232																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.*577A>G	19.37:g.23541628T>C			A8K5E1|B7Z6G6	R	SNP	-	NULL	ENST00000300619.7	37	NULL	CCDS42541.1	19																																																																																			-	ZNF91	-	-		0.343	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	0	0	0	18	18	54	0.00	0.00	T	NM_003430		23541628	-1	7	15	7	20	tier1	no_errors	ENST00000593341	ensembl	human	known	74_37	rna	50.00	42.86	SNP	0.000	C	7	7
LINC00898	400932	genome.wustl.edu	37	22	48021185	48021185	+	lincRNA	SNP	A	A	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr22:48021185A>G	ENST00000380990.1	-	0	2660					NR_033377.1				long intergenic non-protein coding RNA 898																		CGAATGCATTAAGATCCTGAG	0.453													ENSG00000205634																																					0																																												0			-			22q13.31	2013-05-17			ENSG00000205634	ENSG00000205634		"""Long non-coding RNAs"""	48581	non-coding RNA	RNA, long non-coding							Standard	NR_033377		Approved				OTTHUMG00000150323		22.37:g.48021185A>G				R	SNP	-	NULL	ENST00000380990.1	37	NULL		22																																																																																			-	LINC00898	-	-		0.453	LINC00898-001	KNOWN	basic	lincRNA	LINC00898	HGNC	lincRNA	OTTHUMT00000317560.1	0	0	0	53	53	57	0.00	0.00	A			48021185	-1	22	20	25	50	tier1	no_errors	ENST00000380990	ensembl	human	known	74_37	rna	46.81	28.57	SNP	0.000	G	22	25
SLC43A2	124935	genome.wustl.edu	37	17	1516506	1516506	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr17:1516506T>A	ENST00000301335.5	-	5	572	c.484A>T	c.(484-486)Acc>Tcc	p.T162S	SLC43A2_ENST00000571650.1_Missense_Mutation_p.T162S|SLC43A2_ENST00000382147.4_Missense_Mutation_p.T162S|snoU13_ENST00000459614.1_RNA	NM_001284498.1|NM_001284499.1	NP_001271427.1|NP_001271428.1	Q8N370	LAT4_HUMAN	solute carrier family 43 (amino acid system L transporter), member 2	162					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-amino acid transmembrane transporter activity (GO:0015179)			endometrium(4)|large_intestine(4)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0883)		GAGGTGAAGGTCATACACATC	0.468													ENSG00000167703																																					0													89.0	76.0	81.0					17																	1516506		2203	4300	6503	SO:0001583	missense	0			-	BC027923	CCDS11006.1, CCDS67107.1, CCDS67108.1	17p13.3	2013-07-17	2013-07-17		ENSG00000167703	ENSG00000167703		"""Solute carriers"""	23087	protein-coding gene	gene with protein product		610791				23268354	Standard	NM_001284498		Approved	MGC34680	uc002fsv.3	Q8N370	OTTHUMG00000090345	ENST00000301335.5:c.484A>T	17.37:g.1516506T>A	ENSP00000301335:p.Thr162Ser		B7Z6X9|C9JNU8|D3DTH9|Q5CD75|Q6IPM1|Q8NBX1|Q8NC21|Q8WZ00	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.T162S	ENST00000301335.5	37	c.484	CCDS11006.1	17	.	.	.	.	.	.	.	.	.	.	T	21.3	4.128054	0.77549	.	.	ENSG00000167703	ENST00000301335;ENST00000382147	T;T	0.58652	0.32;0.32	4.92	4.92	0.64577	Major facilitator superfamily domain, general substrate transporter (1);	0.104805	0.64402	D	0.000004	T	0.73225	0.3560	M	0.73962	2.25	0.49130	D	0.99975	D;D;D	0.69078	0.996;0.997;0.989	P;D;P	0.69142	0.877;0.962;0.898	T	0.73414	-0.3990	10	0.37606	T	0.19	-22.9086	14.2055	0.65732	0.0:0.0:0.0:1.0	.	162;162;162	Q8N370-2;Q8N370;Q8N370-3	.;LAT4_HUMAN;.	S	162	ENSP00000301335:T162S;ENSP00000371582:T162S	ENSP00000301335:T162S	T	-	1	0	SLC43A2	1463256	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.352000	0.79404	2.210000	0.71456	0.460000	0.39030	ACC	-	SLC43A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.468	SLC43A2-001	KNOWN	basic|CCDS	protein_coding	SLC43A2	HGNC	protein_coding	OTTHUMT00000206717.4	0	0	0	26	26	79	0.00	0.00	T	NM_152346		1516506	-1	15	44	20	31	tier1	no_errors	ENST00000382147	ensembl	human	known	74_37	missense	42.86	58.67	SNP	1.000	A	15	20
ZFP57	346171	genome.wustl.edu	37	6	29643198	29643198	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr6:29643198T>C	ENST00000488757.1	-	3	467	c.317A>G	c.(316-318)gAg>gGg	p.E106G	ZFP57_ENST00000376881.3_Missense_Mutation_p.E86G|ZFP57_ENST00000376883.1_Missense_Mutation_p.E86G	NM_001109809.2	NP_001103279.2	Q9NU63	ZFP57_HUMAN	ZFP57 zinc finger protein	69					DNA methylation involved in embryo development (GO:0043045)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system development (GO:0007422)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	nuclear heterochromatin (GO:0005720)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(16)|ovary(4)|skin(4)|urinary_tract(5)	44						ATGGACAAACTCTCTCCACTG	0.488													ENSG00000204644																																					0													275.0	258.0	263.0					6																	29643198		1952	4145	6097	SO:0001583	missense	0			-	AL050328	CCDS43436.1, CCDS43436.2	6p22.1	2013-01-08	2012-11-27	2005-07-20	ENSG00000204644	ENSG00000204644		"""Zinc fingers, C2H2-type"", ""-"""	18791	protein-coding gene	gene with protein product		612192	"""chromosome 6 open reading frame 40"", ""zinc finger protein 57 homolog (mouse)"""	C6orf40			Standard	NM_001109809		Approved	ZNF698, bA145L22, bA145L22.2	uc011dlw.2	Q9NU63	OTTHUMG00000031158	ENST00000488757.1:c.317A>G	6.37:g.29643198T>C	ENSP00000418259:p.Glu106Gly		B0S894|B0V254|B2RXJ7|Q5SSB1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E106G	ENST00000488757.1	37	c.317	CCDS43436.2	6	.	.	.	.	.	.	.	.	.	.	T	5.083	0.201052	0.09652	.	.	ENSG00000204644	ENST00000488757;ENST00000376881;ENST00000376883	T;T;T	0.06294	3.32;3.57;3.57	4.15	-0.703	0.11261	.	1.132320	0.06853	N	0.797699	T	0.00845	0.0028	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.11329	0.006;0.006	T	0.48906	-0.8993	10	0.23302	T	0.38	1.4099	3.7024	0.08387	0.1722:0.0:0.4877:0.3401	.	106;86	Q9NU63-3;Q9NU63-2	.;.	G	106;86;86	ENSP00000418259:E106G;ENSP00000366078:E86G;ENSP00000366080:E86G	ENSP00000366078:E86G	E	-	2	0	ZFP57	29751177	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.286000	0.08399	-0.248000	0.09583	-1.293000	0.01348	GAG	-	ZFP57	-	pfscan_Krueppel-associated_box		0.488	ZFP57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000355773.1	0	0	0	62	62	114	0.00	0.00	T	XM_294093		29643198	-1	36	46	37	52	tier1	no_errors	ENST00000488757	ensembl	human	known	74_37	missense	49.32	46.94	SNP	0.000	C	36	37
SPATA6L	55064	genome.wustl.edu	37	9	4625444	4625444	+	Silent	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr9:4625444G>A	ENST00000454239.2	-	7	797	c.552C>T	c.(550-552)gcC>gcT	p.A184A	SPATA6L_ENST00000475086.1_Silent_p.A126A|SPATA6L_ENST00000223517.5_5'UTR|SPATA6L_ENST00000381895.5_Silent_p.A61A|SPATA6L_ENST00000381890.5_Silent_p.A198A			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	184																	AGGGCGCCCGGGCTTGCATGC	0.433													ENSG00000106686																																					0													68.0	71.0	70.0					9																	4625444		1836	4080	5916	SO:0001819	synonymous_variant	0			-	AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.552C>T	9.37:g.4625444G>A			B4DIY4|Q5JVJ5|Q8IY90	Silent	SNP	NULL	p.A184	ENST00000454239.2	37	c.552		9																																																																																			-	SPATA6L	-	NULL		0.433	SPATA6L-202	KNOWN	basic	protein_coding	SPATA6L	HGNC	protein_coding		0	0	0	47	47	55	0.00	0.00	G	NM_017985		4625444	-1	34	29	31	32	tier1	no_errors	ENST00000454239	ensembl	human	known	74_37	silent	52.31	47.54	SNP	0.000	A	34	31
SIPA1L1	26037	genome.wustl.edu	37	14	72190515	72190515	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr14:72190515C>G	ENST00000555818.1	+	16	4771	c.4423C>G	c.(4423-4425)Cct>Gct	p.P1475A	SIPA1L1_ENST00000358550.2_Missense_Mutation_p.P1454A|SIPA1L1_ENST00000381232.3_Missense_Mutation_p.P1454A|SIPA1L1_ENST00000537413.1_Missense_Mutation_p.P929A|SIPA1L1_ENST00000554874.1_3'UTR	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1475	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GAGTTTTTACCCTCGCCAGGG	0.507													ENSG00000197555																																					0													119.0	119.0	119.0					14																	72190515		2203	4300	6503	SO:0001583	missense	0			-	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.4423C>G	14.37:g.72190515C>G	ENSP00000450832:p.Pro1475Ala		J3KP19|O95321|Q9UDU4|Q9UNU4	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.P1475A	ENST00000555818.1	37	c.4423	CCDS9807.1	14	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349101	0.61183	.	.	ENSG00000197555	ENST00000381232;ENST00000555818;ENST00000358550;ENST00000537413	T;T;T;D	0.84370	-1.01;-1.01;-1.01;-1.84	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.89431	0.6713	L	0.36672	1.1	0.80722	D	1	B;D;B;P;D	0.76494	0.347;0.999;0.11;0.607;0.994	B;D;B;B;D	0.78314	0.223;0.991;0.109;0.223;0.912	D	0.88967	0.3398	10	0.49607	T	0.09	-18.8553	19.8379	0.96666	0.0:1.0:0.0:0.0	.	929;1475;929;1454;1475	F5GYF8;A6H8W6;B4DYX7;O43166-2;O43166	.;.;.;.;SI1L1_HUMAN	A	1454;1475;1454;929	ENSP00000370630:P1454A;ENSP00000450832:P1475A;ENSP00000351352:P1454A;ENSP00000440682:P929A	ENSP00000351352:P1475A	P	+	1	0	SIPA1L1	71260268	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.201000	0.77847	2.765000	0.95021	0.655000	0.94253	CCT	-	SIPA1L1	-	NULL		0.507	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	0	0	0	51	51	65	0.00	0.00	C	NM_015556		72190515	+1	19	33	35	30	tier1	no_errors	ENST00000555818	ensembl	human	known	74_37	missense	35.19	51.56	SNP	1.000	G	19	35
SLC34A1	6569	genome.wustl.edu	37	5	176825332	176825332	+	3'UTR	SNP	G	G	T	rs201243343		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr5:176825332G>T	ENST00000324417.5	+	0	2056				SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1						arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCCTGGGGTGGAAAGGCAGG	0.632													ENSG00000131183																																					0													33.0	38.0	36.0					5																	176825332		2161	4171	6332	SO:0001624	3_prime_UTR_variant	0			-	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.*45G>T	5.37:g.176825332G>T			B4DPE3	R	SNP	-	NULL	ENST00000324417.5	37	NULL	CCDS4418.1	5																																																																																			-	SLC34A1	-	-		0.632	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A1	HGNC	protein_coding	OTTHUMT00000253431.1	0	0	0	51	51	52	0.00	0.00	G	NM_003052		176825332	+1	27	20	24	19	tier1	no_errors	ENST00000513614	ensembl	human	known	74_37	rna	52.94	50.00	SNP	0.000	T	27	24
ACP6	51205	genome.wustl.edu	37	1	147119311	147119311	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:147119311C>G	ENST00000369238.6	-	10	1648	c.1201G>C	c.(1201-1203)Gcc>Ccc	p.A401P	ACP6_ENST00000460583.1_5'UTR	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	401					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					ACTGACATGGCATTCAAGAAC	0.483													ENSG00000162836																																					0													134.0	127.0	129.0					1																	147119311		2203	4300	6503	SO:0001583	missense	0			-	BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.1201G>C	1.37:g.147119311C>G	ENSP00000358241:p.Ala401Pro		Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.A401P	ENST00000369238.6	37	c.1201	CCDS928.1	1	.	.	.	.	.	.	.	.	.	.	C	12.47	1.949017	0.34377	.	.	ENSG00000162836	ENST00000369238	T	0.44083	0.93	4.6	-2.29	0.06805	.	0.422568	0.26016	N	0.026854	T	0.22205	0.0535	L	0.43923	1.385	0.09310	N	1	P	0.52170	0.951	P	0.54706	0.759	T	0.19582	-1.0301	10	0.48119	T	0.1	.	4.7306	0.12962	0.1386:0.412:0.0:0.4494	.	401	Q9NPH0	PPA6_HUMAN	P	401	ENSP00000358241:A401P	ENSP00000358241:A401P	A	-	1	0	ACP6	145585935	0.000000	0.05858	0.129000	0.21949	0.101000	0.19017	-1.350000	0.02624	-0.770000	0.04614	-0.244000	0.11960	GCC	-	ACP6	-	NULL		0.483	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACP6	HGNC	protein_coding	OTTHUMT00000039420.2	0	0	0	55	55	67	0.00	0.00	C	NM_016361		147119311	-1	29	30	29	32	tier1	no_errors	ENST00000369238	ensembl	human	known	74_37	missense	49.15	48.39	SNP	0.013	G	29	29
PDE4A	5141	genome.wustl.edu	37	19	10561315	10561315	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr19:10561315G>T	ENST00000352831.6	+	5	767	c.657G>T	c.(655-657)aaG>aaT	p.K219N	PDE4A_ENST00000293683.5_Missense_Mutation_p.K193N|PDE4A_ENST00000592685.1_Missense_Mutation_p.K197N|PDE4A_ENST00000344979.3_5'Flank|PDE4A_ENST00000440014.2_Missense_Mutation_p.K158N|PDE4A_ENST00000380702.2_Missense_Mutation_p.K197N	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	219					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	CTGTCTGCAAGGCCACGCTGT	0.677													ENSG00000065989																																					0													12.0	15.0	14.0					19																	10561315		1566	3578	5144	SO:0001583	missense	0			-		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.657G>T	19.37:g.10561315G>T	ENSP00000270474:p.Lys219Asn		O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.K219N	ENST00000352831.6	37	c.657	CCDS45961.1	19	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858466	0.51376	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.31	4.29	2.17	0.27698	.	1.308090	0.05151	N	0.496096	T	0.77308	0.4111	L	0.56769	1.78	0.36552	D	0.871931	D;B;B	0.89917	1.0;0.021;0.024	D;B;B	0.83275	0.996;0.021;0.009	T	0.65475	-0.6159	10	0.39692	T	0.17	.	6.0836	0.19954	0.3179:0.0:0.6821:0.0	.	158;193;219	P27815-6;P27815-2;P27815	.;.;PDE4A_HUMAN	N	197;219;193;158	ENSP00000370078:K197N;ENSP00000270474:K219N;ENSP00000293683:K193N;ENSP00000394754:K158N	ENSP00000293683:K193N	K	+	3	2	PDE4A	10422315	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	1.088000	0.30877	0.466000	0.27193	0.491000	0.48974	AAG	-	PDE4A	-	NULL		0.677	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	HGNC	protein_coding	OTTHUMT00000451244.1	0	0	0	56	56	12	0.00	0.00	G			10561315	+1	24	6	34	10	tier1	no_errors	ENST00000352831	ensembl	human	known	74_37	missense	41.38	37.50	SNP	1.000	T	24	34
ABCA17P	650655	genome.wustl.edu	37	16	2415783	2415783	+	RNA	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr16:2415783G>C	ENST00000469908.1	+	0	639					NR_003574.1				ATP-binding cassette, sub-family A (ABC1), member 17, pseudogene																		CAGCGTCAATGACAGCAATGG	0.408													ENSG00000238098																																					0																																												0			-	DQ266102		16p13.3	2012-03-14	2010-03-12		ENSG00000238098	ENSG00000238098		"""ATP binding cassette transporters / subfamily A"""	32972	pseudogene	pseudogene						16968533	Standard	NR_003574		Approved		uc002cqc.1		OTTHUMG00000154348		16.37:g.2415783G>C				R	SNP	-	NULL	ENST00000469908.1	37	NULL		16																																																																																			-	ABCA17P	-	-		0.408	ABCA17P-002	KNOWN	basic	processed_transcript	ABCA17P	HGNC	pseudogene	OTTHUMT00000334904.1	0	0	0	38	38	87	0.00	0.00	G	NR_003574		2415783	+1	28	44	24	52	tier1	no_errors	ENST00000469908	ensembl	human	known	74_37	rna	53.85	45.36	SNP	0.000	C	28	24
ALDH1L1	10840	genome.wustl.edu	37	3	125876260	125876260	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:125876260A>T	ENST00000393434.2	-	4	803	c.454T>A	c.(454-456)Tgt>Agt	p.C152S	ALDH1L1_ENST00000273450.3_Missense_Mutation_p.C162S|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.C152S|ALDH1L1_ENST00000413612.1_5'Flank|ALDH1L1_ENST00000452905.2_Intron|ALDH1L1_ENST00000393431.2_Missense_Mutation_p.C152S|ALDH1L1_ENST00000455064.2_5'UTR|U1_ENST00000606575.1_RNA	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	152	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	AGCACCTCACACTCCTTCTGC	0.602													ENSG00000144908																																					0													102.0	94.0	97.0					3																	125876260		2203	4300	6503	SO:0001583	missense	0			-	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.454T>A	3.37:g.125876260A>T	ENSP00000377083:p.Cys152Ser		B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.C152S	ENST00000393434.2	37	c.454	CCDS3034.1	3	.	.	.	.	.	.	.	.	.	.	A	15.33	2.803084	0.50315	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000393434;ENST00000393431;ENST00000490367;ENST00000460368;ENST00000488356	T;T;T;T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07;-1.07;-1.07;-1.07	4.39	3.21	0.36854	Formyl transferase, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88051	0.6333	M	0.92649	3.33	0.80722	D	1	P;D;P	0.59767	0.952;0.986;0.873	P;D;P	0.63957	0.842;0.92;0.752	D	0.87757	0.2596	10	0.87932	D	0	.	8.4059	0.32614	0.8246:0.0:0.0:0.1754	.	204;59;152	Q59G10;Q9UFA9;O75891	.;.;AL1L1_HUMAN	S	162;152;152;152;152;152;152	ENSP00000273450:C162S;ENSP00000420293:C152S;ENSP00000377083:C152S;ENSP00000377081:C152S;ENSP00000418711:C152S;ENSP00000419826:C152S;ENSP00000419955:C152S	ENSP00000273450:C162S	C	-	1	0	ALDH1L1	127358950	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	8.829000	0.92055	0.702000	0.31825	-0.691000	0.03719	TGT	-	ALDH1L1	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH		0.602	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L1	HGNC	protein_coding	OTTHUMT00000354391.1	0	0	0	33	33	45	0.00	0.00	A	NM_012190		125876260	-1	23	21	22	16	tier1	no_errors	ENST00000393434	ensembl	human	known	74_37	missense	51.11	56.76	SNP	1.000	T	23	22
BAZ1B	9031	genome.wustl.edu	37	7	72892896	72892896	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr7:72892896T>C	ENST00000339594.4	-	7	1233	c.895A>G	c.(895-897)Atg>Gtg	p.M299V	BAZ1B_ENST00000404251.1_Missense_Mutation_p.M299V	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	299	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TTGAGAGTCATATACTAGAAT	0.373													ENSG00000009954																									Esophageal Squamous(112;1167 1561 21085 43672 48228)												0													61.0	63.0	62.0					7																	72892896		2194	4297	6491	SO:0001583	missense	0			-	AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.895A>G	7.37:g.72892896T>C	ENSP00000342434:p.Met299Val		B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.M299V	ENST00000339594.4	37	c.895	CCDS5549.1	7	.	.	.	.	.	.	.	.	.	.	T	7.661	0.684862	0.14973	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.56941	0.43;0.43	5.71	5.71	0.89125	.	0.196377	0.56097	D	0.000036	T	0.34513	0.0900	N	0.17082	0.46	0.39328	D	0.965363	B	0.27351	0.176	B	0.22753	0.041	T	0.25467	-1.0131	10	0.09843	T	0.71	-34.2117	15.1562	0.72743	0.0:0.0:0.0:1.0	.	299	Q9UIG0	BAZ1B_HUMAN	V	299	ENSP00000342434:M299V;ENSP00000385442:M299V	ENSP00000342434:M299V	M	-	1	0	BAZ1B	72530832	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	3.584000	0.53936	2.181000	0.69327	0.482000	0.46254	ATG	-	BAZ1B	-	NULL		0.373	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4	0	0	1	52	52	87	0.00	1.14	T	NM_032408		72892896	-1	28	41	36	64	tier1	no_errors	ENST00000339594	ensembl	human	known	74_37	missense	43.75	39.05	SNP	0.993	C	28	36
FAM129A	116496	genome.wustl.edu	37	1	184767242	184767242	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:184767242T>C	ENST00000367511.3	-	13	1830	c.1637A>G	c.(1636-1638)cAt>cGt	p.H546R	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	546					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CAGGATCTGATGTAAAATCTC	0.428													ENSG00000135842																																					0													96.0	88.0	90.0					1																	184767242		2203	4300	6503	SO:0001583	missense	0			-	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.1637A>G	1.37:g.184767242T>C	ENSP00000356481:p.His546Arg		Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.H546R	ENST00000367511.3	37	c.1637	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	T	3.978	-0.007046	0.07773	.	.	ENSG00000135842	ENST00000367511	T	0.09445	2.98	5.37	5.37	0.77165	.	0.436525	0.25596	N	0.029583	T	0.11580	0.0282	L	0.40543	1.245	0.22771	N	0.998756	B;P	0.41265	0.302;0.744	B;B	0.44044	0.124;0.439	T	0.20773	-1.0265	10	0.22706	T	0.39	-3.151	9.9523	0.41647	0.1509:0.0:0.0:0.8491	.	77;546	Q5TEY9;Q9BZQ8	.;NIBAN_HUMAN	R	546	ENSP00000356481:H546R	ENSP00000356481:H546R	H	-	2	0	FAM129A	183033865	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	2.971000	0.49248	2.034000	0.60081	0.533000	0.62120	CAT	-	FAM129A	-	NULL		0.428	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	0	0	0	47	47	60	0.00	0.00	T			184767242	-1	22	37	20	52	tier1	no_errors	ENST00000367511	ensembl	human	known	74_37	missense	52.38	41.57	SNP	0.941	C	22	20
JAG1	182	genome.wustl.edu	37	20	10625797	10625797	+	Missense_Mutation	SNP	T	T	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr20:10625797T>G	ENST00000254958.5	-	17	2736	c.2221A>C	c.(2221-2223)Aac>Cac	p.N741H	JAG1_ENST00000488480.1_RNA|JAG1_ENST00000423891.2_Missense_Mutation_p.N582H	NM_000214.2	NP_000205.1	P78504	JAG1_HUMAN	jagged 1	741	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				angiogenesis (GO:0001525)|aorta morphogenesis (GO:0035909)|auditory receptor cell differentiation (GO:0042491)|blood vessel remodeling (GO:0001974)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cell fate determination (GO:0001709)|ciliary body morphogenesis (GO:0061073)|distal tubule development (GO:0072017)|endocardial cushion cell development (GO:0061444)|endothelial cell differentiation (GO:0045446)|hemopoiesis (GO:0030097)|keratinocyte differentiation (GO:0030216)|loop of Henle development (GO:0072070)|morphogenesis of an epithelial sheet (GO:0002011)|myoblast differentiation (GO:0045445)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of stem cell differentiation (GO:2000737)|nervous system development (GO:0007399)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|response to muramyl dipeptide (GO:0032495)|T cell mediated immunity (GO:0002456)	apical part of cell (GO:0045177)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|urinary_tract(1)	44						TTACCTATGTTACAGGTTGTT	0.557									Alagille Syndrome				ENSG00000101384																																					0													99.0	83.0	88.0					20																	10625797		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	-	U61276	CCDS13112.1	20p12.1-p11.23	2011-05-12	2010-06-24		ENSG00000101384	ENSG00000101384		"""CD molecules"""	6188	protein-coding gene	gene with protein product		601920	"""Alagille syndrome"""	AGS, JAGL1		7697721, 9207788	Standard	NM_000214		Approved	AHD, AWS, HJ1, CD339	uc002wnw.2	P78504	OTTHUMG00000031872	ENST00000254958.5:c.2221A>C	20.37:g.10625797T>G	ENSP00000254958:p.Asn741His		A0AV43|B4DYR1|E9PCF9|O14902|O15122|Q15816	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_DSL,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom	p.N741H	ENST00000254958.5	37	c.2221	CCDS13112.1	20	.	.	.	.	.	.	.	.	.	.	T	12.10	1.837059	0.32421	.	.	ENSG00000101384	ENST00000254958;ENST00000423891	D;D	0.85861	-2.04;-2.04	5.85	4.71	0.59529	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.130123	0.64402	D	0.000002	T	0.78991	0.4371	L	0.42245	1.32	0.53005	D	0.999964	B	0.19706	0.038	B	0.18561	0.022	T	0.71133	-0.4681	10	0.22706	T	0.39	.	12.0788	0.53659	0.1291:0.0:0.0:0.8709	.	741	P78504	JAG1_HUMAN	H	741;582	ENSP00000254958:N741H;ENSP00000389519:N582H	ENSP00000254958:N741H	N	-	1	0	JAG1	10573797	1.000000	0.71417	0.993000	0.49108	0.884000	0.51177	8.040000	0.89188	0.982000	0.38575	0.533000	0.62120	AAC	-	JAG1	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom		0.557	JAG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG1	HGNC	protein_coding		0	0	0	43	43	118	0.00	0.00	T	NM_000214		10625797	-1	25	50	24	59	tier1	no_errors	ENST00000254958	ensembl	human	known	74_37	missense	51.02	45.87	SNP	1.000	G	25	24
DAAM1	23002	genome.wustl.edu	37	14	59835718	59835718	+	3'UTR	SNP	A	A	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr14:59835718A>T	ENST00000395125.1	+	0	3401				DAAM1_ENST00000553966.1_3'UTR|DAAM1_ENST00000351081.1_3'UTR|DAAM1_ENST00000360909.3_3'UTR	NM_014992.2	NP_055807.1	Q9Y4D1	DAAM1_HUMAN	dishevelled associated activator of morphogenesis 1						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	identical protein binding (GO:0042802)			breast(3)|cervix(3)|endometrium(5)|kidney(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.165)		tgtgtatgtaaatgtatgtgt	0.348													ENSG00000100592																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB014566	CCDS9737.1, CCDS58323.1	14q22.3	2008-08-11			ENSG00000100592	ENSG00000100592			18142	protein-coding gene	gene with protein product		606626				11779461, 18162551	Standard	NM_014992		Approved	KIAA0666	uc031qou.1	Q9Y4D1	OTTHUMG00000140326	ENST00000395125.1:c.*141A>T	14.37:g.59835718A>T			Q86U34|Q8N1Z8|Q8TB39	R	SNP	-	NULL	ENST00000395125.1	37	NULL	CCDS9737.1	14																																																																																			-	DAAM1	-	-		0.348	DAAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DAAM1	HGNC	protein_coding	OTTHUMT00000276942.2	0	0	0	41	41	34	0.00	0.00	A	NM_014992		59835718	+1	21	28	28	32	tier1	no_errors	ENST00000553966	ensembl	human	known	74_37	rna	42.86	46.67	SNP	0.957	T	21	28
MYH4	4622	genome.wustl.edu	37	17	10357193	10357193	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr17:10357193C>G	ENST00000255381.2	-	23	2811	c.2701G>C	c.(2701-2703)Gcc>Ccc	p.A901P	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	901					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TCAGCCAAGGCATCTGCTTCC	0.373													ENSG00000264424																																					0													200.0	191.0	194.0					17																	10357193		2203	4300	6503	SO:0001583	missense	0			-		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2701G>C	17.37:g.10357193C>G	ENSP00000255381:p.Ala901Pro			Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tR-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A901P	ENST00000255381.2	37	c.2701	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	8.782	0.928539	0.18131	.	.	ENSG00000141048	ENST00000255381	D	0.93366	-3.21	5.43	0.966	0.19667	.	0.467264	0.15531	U	0.257502	D	0.88607	0.6482	L	0.43923	1.385	0.24665	N	0.993447	B	0.20052	0.041	B	0.21546	0.035	T	0.79955	-0.1585	10	0.62326	D	0.03	.	7.2945	0.26385	0.0:0.6672:0.1197:0.2131	.	901	Q9Y623	MYH4_HUMAN	P	901	ENSP00000255381:A901P	ENSP00000255381:A901P	A	-	1	0	MYH4	10297918	0.000000	0.05858	0.981000	0.43875	0.359000	0.29487	0.333000	0.19768	0.039000	0.15632	-1.058000	0.02302	GCC	-	MYH4	-	NULL		0.373	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	0	0	0	69	69	57	0.00	0.00	C	NM_017533		10357193	-1	37	30	63	30	tier1	no_errors	ENST00000255381	ensembl	human	known	74_37	missense	37.00	49.18	SNP	0.899	G	37	63
PPP2R5E	5529	genome.wustl.edu	37	14	64010052	64010052	+	5'UTR	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr14:64010052C>T	ENST00000337537.3	-	0	40				CTD-2302E22.4_ENST00000561909.1_RNA|PPP2R5E_ENST00000555899.1_5'Flank|PPP2R5E_ENST00000553266.1_5'UTR	NM_001282179.1|NM_001282180.1|NM_001282181.1|NM_001282182.1|NM_006246.2	NP_001269108.1|NP_001269109.1|NP_001269110.1|NP_001269111.1|NP_006237.1	Q16537	2A5E_HUMAN	protein phosphatase 2, regulatory subunit B', epsilon isoform						regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)	15				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		TATCACCGGGCGGCTGAGTCC	0.657													ENSG00000154001																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	L76703	CCDS9758.1, CCDS61467.1, CCDS61468.1	14q23.2	2010-06-18	2007-01-22		ENSG00000154001	ENSG00000154001		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9313	protein-coding gene	gene with protein product		601647	"""protein phosphatase 2, regulatory subunit B (B56), epsilon isoform"""			7592815	Standard	NM_006246		Approved		uc001xgd.1	Q16537	OTTHUMG00000140341	ENST00000337537.3:c.-563G>A	14.37:g.64010052C>T			A4FU37|B7ZAW5|B7ZKK8|B7ZKK9|J3KQN6|Q52LW4	R	SNP	-	NULL	ENST00000337537.3	37	NULL	CCDS9758.1	14																																																																																			-	PPP2R5E	-	-		0.657	PPP2R5E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5E	HGNC	protein_coding	OTTHUMT00000276973.1	0	0	0	23	23	57	0.00	0.00	C	NM_006246		64010052	-1	6	37	15	55	tier1	no_errors	ENST00000553266	ensembl	human	known	74_37	rna	28.57	40.22	SNP	1.000	T	6	15
LINC01291	102724515	genome.wustl.edu	37	2	75157532	75157532	+	lincRNA	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr2:75157532C>G	ENST00000377469.1	+	0	2167																											ggagggcagcctggcaattgg	0.522													ENSG00000204792																																					0																																												0			-																													2.37:g.75157532C>G				R	SNP	-	NULL	ENST00000377469.1	37	NULL		2																																																																																			-	AC104135.3	-	-		0.522	AC104135.3-001	KNOWN	basic	lincRNA	ENSG00000204792	Clone_based_vega_gene	lincRNA	OTTHUMT00000328656.1	0	0	0	47	47	66	0.00	0.00	C			75157532	+1	15	28	14	33	tier1	no_errors	ENST00000377469	ensembl	human	known	74_37	rna	51.72	45.90	SNP	0.984	G	15	14
ABHD10	55347	genome.wustl.edu	37	3	111710511	111710521	+	Frame_Shift_Del	DEL	ACTTCTTGTTT	ACTTCTTGTTT	-	rs200494551		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	ACTTCTTGTTT	ACTTCTTGTTT	ACTTCTTGTTT	-	ACTTCTTGTTT	ACTTCTTGTTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:111710511_111710521delACTTCTTGTTT	ENST00000273359.3	+	5	891_901	c.864_874delACTTCTTGTTT	c.(862-876)caacttcttgtttacfs	p.LLVY289fs	ABHD10_ENST00000534857.1_Frame_Shift_Del_p.LLVY132fs	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	289					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						CAGACATTCAACTTCTTGTTTACACTATTGA	0.384													ENSG00000144827																																					0																																										SO:0001589	frameshift_variant	0				AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.864_874delACTTCTTGTTT	3.37:g.111710511_111710521delACTTCTTGTTT	ENSP00000273359:p.Leu289fs		B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Frame_Shift_Del	DEL	pfam_AB_hydrolase_1,pfam_Peptidase_S9	p.L289fs	ENST00000273359.3	37	c.864_874	CCDS2963.1	3																																																																																				ABHD10	-	NULL		0.384	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD10	HGNC	protein_coding	OTTHUMT00000354326.1	0	0	0	97	97	97	0.00	0.00	ACTTCTTGTTT	NM_018394		111710521	+1	13	13	62	62	tier1	no_errors	ENST00000273359	ensembl	human	known	74_37	frame_shift_del	17.33	17.33	DEL	0.872:1.000:1.000:1.000:1.000:1.000:0.992:1.000:1.000:0.988:1.000	-	13	62
ITGB8	3696	genome.wustl.edu	37	7	20420428	20420428	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr7:20420428delG	ENST00000222573.4	+	5	1459	c.775delG	c.(775-777)gccfs	p.A259fs	ITGB8_ENST00000537992.1_Frame_Shift_Del_p.A124fs	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	259	VWFA.				cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)	p.A259T(2)		NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						AGGTTTTGACGCCATGCTTCA	0.408													ENSG00000105855																																					2	Substitution - Missense(2)	large_intestine(2)											146.0	130.0	135.0					7																	20420428		2203	4300	6503	SO:0001589	frameshift_variant	0					CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.775delG	7.37:g.20420428delG	ENSP00000222573:p.Ala259fs		A4D133|B4DHD4	Frame_Shift_Del	DEL	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_EGF_extracell,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.A259fs	ENST00000222573.4	37	c.775	CCDS5370.1	7																																																																																				ITGB8	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu		0.408	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB8	HGNC	protein_coding	OTTHUMT00000059915.3	0	0	0	39	39	83	0.00	0.00	G	NM_002214		20420428	+1	21	30	29	38	tier1	no_errors	ENST00000222573	ensembl	human	known	74_37	frame_shift_del	42.00	44.12	DEL	1.000	-	21	29
PDZD2	23037	genome.wustl.edu	37	5	32087892	32087892	+	Frame_Shift_Del	DEL	G	G	-	rs72743803	byFrequency	TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr5:32087892delG	ENST00000438447.1	+	20	4726	c.4338delG	c.(4336-4338)acgfs	p.T1446fs	PDZD2_ENST00000282493.3_Frame_Shift_Del_p.T1446fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	1446					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTTCCCAGACGGGGGACAGTG	0.657													ENSG00000133401																																					0													20.0	22.0	21.0					5																	32087892		2202	4300	6502	SO:0001589	frameshift_variant	0				AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.4338delG	5.37:g.32087892delG	ENSP00000402033:p.Thr1446fs		Q9BXD4	Frame_Shift_Del	DEL	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1448fs	ENST00000438447.1	37	c.4338	CCDS34137.1	5																																																																																				PDZD2	-	NULL		0.657	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	0	0	0	65	65	47	0.00	0.00	G			32087892	+1	34	29	42	31	tier1	no_errors	ENST00000282493	ensembl	human	known	74_37	frame_shift_del	44.74	48.33	DEL	0.000	-	34	42
AHNAK2	113146	genome.wustl.edu	37	14	105414679	105414679	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr14:105414679G>C	ENST00000333244.5	-	7	7228	c.7109C>G	c.(7108-7110)cCc>cGc	p.P2370R	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2370						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AGCGGAAGGGGGCTGAACGCT	0.657													ENSG00000185567																																					0													125.0	139.0	134.0					14																	105414679		1965	4152	6117	SO:0001583	missense	0			-	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7109C>G	14.37:g.105414679G>C	ENSP00000353114:p.Pro2370Arg		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P2370R	ENST00000333244.5	37	c.7109	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	-	4.256	0.046585	0.08243	.	.	ENSG00000185567	ENST00000333244	T	0.00873	5.59	3.79	1.36	0.22044	.	.	.	.	.	T	0.01592	0.0051	L	0.51422	1.61	0.09310	N	1	P	0.48016	0.904	P	0.51582	0.674	T	0.44544	-0.9321	9	0.12430	T	0.62	.	6.0601	0.19832	0.6237:0.0:0.3763:0.0	.	2370	Q8IVF2	AHNK2_HUMAN	R	2370	ENSP00000353114:P2370R	ENSP00000353114:P2370R	P	-	2	0	AHNAK2	104485724	0.003000	0.15002	0.000000	0.03702	0.001000	0.01503	1.880000	0.39628	-0.013000	0.14199	-0.350000	0.07774	CCC	-	AHK2	-	NULL		0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK2	HGNC	protein_coding	OTTHUMT00000410300.1	0	0	0	123	123	8	0.00	0.00	G	NM_138420		105414679	-1	40	4	43	5	tier1	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	48.19	44.44	SNP	0.000	C	40	43
AOC3	8639	genome.wustl.edu	37	17	41008501	41008501	+	Silent	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr17:41008501G>A	ENST00000308423.2	+	4	2386	c.2226G>A	c.(2224-2226)ctG>ctA	p.L742L	AOC3_ENST00000591562.1_Silent_p.L199L	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	742					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	TAGCTTGCCTGCCCCAGGCTG	0.642													ENSG00000131471																									NSCLC(3;192 220 10664 11501 16477)												0													11.0	12.0	12.0					17																	41008501		2168	4239	6407	SO:0001819	synonymous_variant	0			-	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.2226G>A	17.37:g.41008501G>A			B2RCI5|K7ESB3|L0L8N9|Q45F94	Silent	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.L742	ENST00000308423.2	37	c.2226	CCDS11444.1	17																																																																																			-	AOC3	-	superfamily_Cu_amine_oxidase_C		0.642	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	HGNC	protein_coding	OTTHUMT00000452444.1	0	0	0	64	64	8	0.00	0.00	G	NM_003734		41008501	+1	27	4	33	3	tier1	no_errors	ENST00000308423	ensembl	human	known	74_37	silent	45.00	57.14	SNP	0.000	A	27	33
BEND3	57673	genome.wustl.edu	37	6	107391548	107391548	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr6:107391548C>A	ENST00000369042.1	-	4	1037	c.847G>T	c.(847-849)Gac>Tac	p.D283Y	BEND3_ENST00000429433.2_Missense_Mutation_p.D283Y			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	283	BEN 1. {ECO:0000255|PROSITE- ProRule:PRU00784}.									central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						CGGGAGAAGTCCACGTCGCTG	0.642													ENSG00000178409																																					0													18.0	19.0	19.0					6																	107391548		2192	4274	6466	SO:0001583	missense	0			-	AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.847G>T	6.37:g.107391548C>A	ENSP00000358038:p.Asp283Tyr		A2RRH2|Q9HCL9	Missense_Mutation	SNP	pfam_BEN_domain	p.D283Y	ENST00000369042.1	37	c.847	CCDS34507.1	6	.	.	.	.	.	.	.	.	.	.	C	18.88	3.716799	0.68844	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	T;T	0.41400	1.0;1.0	5.32	5.32	0.75619	BEN domain (2);	0.195770	0.45867	D	0.000340	T	0.35682	0.0940	N	0.08118	0	0.58432	D	0.999993	D	0.58620	0.983	P	0.62649	0.905	T	0.49606	-0.8922	10	0.62326	D	0.03	-0.0167	19.1834	0.93632	0.0:1.0:0.0:0.0	.	283	Q5T5X7	BEND3_HUMAN	Y	283	ENSP00000358038:D283Y;ENSP00000411268:D283Y	ENSP00000358038:D283Y	D	-	1	0	BEND3	107498241	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	5.581000	0.67471	2.774000	0.95407	0.561000	0.74099	GAC	-	BEND3	-	pfam_BEN_domain		0.642	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND3	HGNC	protein_coding	OTTHUMT00000041686.1	0	0	0	70	70	11	0.00	0.00	C	NM_020913		107391548	-1	31	3	32	4	tier1	no_errors	ENST00000369042	ensembl	human	known	74_37	missense	49.21	42.86	SNP	1.000	A	31	32
CX3CR1	1524	genome.wustl.edu	37	3	39307455	39307455	+	Silent	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:39307455G>C	ENST00000541347.1	-	2	785	c.546C>G	c.(544-546)gtC>gtG	p.V182V	CX3CR1_ENST00000542107.1_Silent_p.V182V|CX3CR1_ENST00000358309.3_Silent_p.V214V|CX3CR1_ENST00000399220.2_Silent_p.V182V	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	182					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		TTTCCTGGAGGACCTCGGGGT	0.502													ENSG00000168329																																					0													104.0	104.0	104.0					3																	39307455		1920	4120	6040	SO:0001819	synonymous_variant	0			-	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.546C>G	3.37:g.39307455G>C			A0N0N6|B2R5Z4|J3KP17	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.V214	ENST00000541347.1	37	c.642	CCDS43069.1	3																																																																																			-	CX3CR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1		0.502	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	HGNC	protein_coding	OTTHUMT00000343613.1	0	0	0	69	69	90	0.00	0.00	G	NM_001337		39307455	-1	25	43	7	9	tier1	no_errors	ENST00000358309	ensembl	human	known	74_37	silent	78.12	82.69	SNP	0.005	C	25	7
DOK2	9046	genome.wustl.edu	37	8	21769858	21769858	+	Missense_Mutation	SNP	C	C	T	rs552782288		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr8:21769858C>T	ENST00000276420.4	-	2	485	c.227G>A	c.(226-228)aGc>aAc	p.S76N	DOK2_ENST00000544659.1_5'UTR	NM_003974.2	NP_003965.2	O60496	DOK2_HUMAN	docking protein 2, 56kDa	76	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|leukocyte migration (GO:0050900)|Ras protein signal transduction (GO:0007265)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)	receptor signaling protein activity (GO:0005057)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(3)|skin(1)	26				Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CCGGGGGCTGCTGGCCTCTCC	0.716													ENSG00000147443																																					0													12.0	15.0	14.0					8																	21769858		2195	4290	6485	SO:0001583	missense	0			-	AF034970	CCDS6016.1	8p21.3	2008-08-07	2002-08-29		ENSG00000147443	ENSG00000147443			2991	protein-coding gene	gene with protein product		604997	"""docking protein 2, 56kD"""			9478921, 14645010	Standard	NM_003974		Approved	p56dok-2, Dok-2	uc003wzy.1	O60496	OTTHUMG00000131075	ENST00000276420.4:c.227G>A	8.37:g.21769858C>T	ENSP00000276420:p.Ser76Asn		Q8N5A4	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.S76N	ENST00000276420.4	37	c.227	CCDS6016.1	8	.	.	.	.	.	.	.	.	.	.	C	14.65	2.597762	0.46318	.	.	ENSG00000147443	ENST00000276420;ENST00000523932	T;T	0.46063	1.89;0.88	5.31	5.31	0.75309	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.110505	0.56097	D	0.000022	T	0.33962	0.0881	L	0.46157	1.445	0.80722	D	1	B;B	0.22146	0.031;0.065	B;B	0.25614	0.046;0.062	T	0.10154	-1.0642	10	0.07325	T	0.83	.	12.9739	0.58527	0.0:0.9211:0.0:0.0789	.	76;76	O60496;A8K7W1	DOK2_HUMAN;.	N	76	ENSP00000276420:S76N;ENSP00000429224:S76N	ENSP00000276420:S76N	S	-	2	0	DOK2	21825804	0.737000	0.28175	1.000000	0.80357	0.763000	0.43281	0.799000	0.27028	2.483000	0.83821	0.655000	0.94253	AGC	-	DOK2	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.716	DOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK2	HGNC	protein_coding	OTTHUMT00000253735.3	0	0	0	25	25	10	0.00	0.00	C	NM_003974		21769858	-1	9	2	12	5	tier1	no_errors	ENST00000276420	ensembl	human	known	74_37	missense	42.86	28.57	SNP	1.000	T	9	12
EXOSC10	5394	genome.wustl.edu	37	1	11131107	11131107	+	Intron	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:11131107C>A	ENST00000376936.4	-	21	2292				EXOSC10_ENST00000304457.7_Intron|EXOSC10_ENST00000544779.1_Intron|RP4-635E18.7_ENST00000452378.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10						CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		CCCCCTCCGACTTGGCCTAGC	0.622													ENSG00000226849																									Colon(179;105 1987 14326 27364 29542)												0																																										SO:0001627	intron_variant	0			-	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.2243-77G>T	1.37:g.11131107C>A			B1AKQ0|B1AKQ1|Q15158	R	SNP	-	NULL	ENST00000376936.4	37	NULL	CCDS30584.1	1																																																																																			-	RP4-635E18.7	-	-		0.622	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000226849	Clone_based_vega_gene	protein_coding	OTTHUMT00000006078.1	0	0	0	25	25	124	0.00	0.00	C	NM_001001998		11131107	+1	19	44	4	9	tier1	no_errors	ENST00000452378	ensembl	human	known	74_37	rna	82.61	83.02	SNP	0.001	A	19	4
MCL1	4170	genome.wustl.edu	37	1	150551644	150551644	+	Silent	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:150551644C>A	ENST00000369026.2	-	1	422	c.363G>T	c.(361-363)tcG>tcT	p.S121S	MCL1_ENST00000464132.1_5'Flank|MCL1_ENST00000307940.3_Silent_p.S121S	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1	121	PEST-like.				apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CCTCTTCGGGCGACATGATGG	0.687													ENSG00000143384																																					0													15.0	18.0	17.0					1																	150551644		2149	4215	6364	SO:0001819	synonymous_variant	0			-	BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.363G>T	1.37:g.150551644C>A			B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	Silent	SNP	pfam_Blc2_fam,pfscan_Bcl2-like,prints_Apop_reg_Mc1,prints_Blc2_fam	p.S121	ENST00000369026.2	37	c.363	CCDS957.1	1																																																																																			-	MCL1	-	NULL		0.687	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCL1	HGNC	protein_coding	OTTHUMT00000084402.1	0	0	0	37	37	9	0.00	0.00	C	NM_021960		150551644	-1	19	3	18	8	tier1	no_errors	ENST00000369026	ensembl	human	known	74_37	silent	51.35	27.27	SNP	0.714	A	19	18
MTMR14	64419	genome.wustl.edu	37	3	9719070	9719070	+	Splice_Site	SNP	A	A	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:9719070A>G	ENST00000296003.4	+	8	943	c.821A>G	c.(820-822)cAg>cGg	p.Q274R	MTMR14_ENST00000353332.5_Splice_Site_p.Q274R|MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000351233.5_Splice_Site_p.Q274R	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	274					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AACTGGAAGCAGGTATGAGCA	0.408													ENSG00000163719																																					0													132.0	120.0	124.0					3																	9719070		1899	4122	6021	SO:0001630	splice_region_variant	0			-	BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.822+1A>G	3.37:g.9719070A>G			Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.Q274R	ENST00000296003.4	37	c.821	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	A	24.1	4.495224	0.85069	.	.	ENSG00000163719	ENST00000353332;ENST00000296003;ENST00000351233;ENST00000419048;ENST00000431250	D;D;D;D	0.90620	-2.7;-2.7;-2.7;-2.7	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.94647	0.8274	M	0.72118	2.19	0.80722	D	1	D;B;B	0.63046	0.992;0.335;0.192	D;B;B	0.72982	0.979;0.188;0.061	D	0.95214	0.8328	10	0.87932	D	0	0.8162	15.4921	0.75615	1.0:0.0:0.0:0.0	.	274;274;274	Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;MTMRE_HUMAN	R	274;274;274;274;46	ENSP00000323462:Q274R;ENSP00000296003:Q274R;ENSP00000334070:Q274R;ENSP00000388746:Q46R	ENSP00000296003:Q274R	Q	+	2	0	MTMR14	9694070	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	8.275000	0.89892	2.055000	0.61198	0.533000	0.62120	CAG	-	MTMR14	-	NULL		0.408	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	0	0	0	51	51	98	0.00	0.00	A	NM_022485	Missense_Mutation	9719070	+1	19	59	5	1	tier1	no_errors	ENST00000296003	ensembl	human	known	74_37	missense	79.17	98.33	SNP	1.000	G	19	5
RGS12	6002	genome.wustl.edu	37	4	3432573	3432573	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr4:3432573G>T	ENST00000344733.5	+	17	4909	c.4005G>T	c.(4003-4005)gaG>gaT	p.E1335D	RGS12_ENST00000382788.3_Missense_Mutation_p.E1335D|RGS12_ENST00000338806.4_Missense_Mutation_p.E687D|RGS12_ENST00000336727.3_Missense_Mutation_p.E1335D|RGS12_ENST00000538395.1_3'UTR	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	1335					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGGAGGATGAGCACGTGGCCG	0.687													ENSG00000159788																																					0													27.0	32.0	30.0					4																	3432573		2200	4297	6497	SO:0001583	missense	0			-	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.4005G>T	4.37:g.3432573G>T	ENSP00000339381:p.Glu1335Asp		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.E1335D	ENST00000344733.5	37	c.4005	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	G	8.257	0.810355	0.16537	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000338806	T;T;T;T	0.41400	1.54;1.53;1.53;1.0	4.61	0.589	0.17452	.	0.408050	0.26293	N	0.025202	T	0.31575	0.0801	L	0.46157	1.445	0.80722	D	1	B;B;B;B	0.14805	0.003;0.003;0.007;0.011	B;B;B;B	0.19391	0.017;0.017;0.007;0.025	T	0.07366	-1.0776	10	0.46703	T	0.11	-24.336	6.6828	0.23129	0.162:0.2895:0.5486:0.0	.	677;687;1335;1335	O14924-2;O14924-3;O14924;O14924-4	.;.;RGS12_HUMAN;.	D	1335;1335;1335;687	ENSP00000339381:E1335D;ENSP00000338509:E1335D;ENSP00000372238:E1335D;ENSP00000342133:E687D	ENSP00000338509:E1335D	E	+	3	2	RGS12	3402371	0.278000	0.24230	0.012000	0.15200	0.394000	0.30568	0.013000	0.13310	0.064000	0.16427	0.655000	0.94253	GAG	-	RGS12	-	NULL		0.687	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	0	0	0	87	87	16	0.00	0.00	G	NM_002926		3432573	+1	31	3	47	4	tier1	no_errors	ENST00000344733	ensembl	human	known	74_37	missense	39.74	42.86	SNP	0.664	T	31	47
TSKU	25987	genome.wustl.edu	37	11	76507673	76507673	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr11:76507673A>G	ENST00000527881.1	+	2	2039	c.1013A>G	c.(1012-1014)cAc>cGc	p.H338R	TSKU_ENST00000333090.4_Missense_Mutation_p.H338R			Q8WUA8	TSK_HUMAN	tsukushi, small leucine rich proteoglycan	338					anterior commissure morphogenesis (GO:0021960)|ciliary body morphogenesis (GO:0061073)|corpus callosum morphogenesis (GO:0021540)|lateral ventricle development (GO:0021670)|negative regulation of Wnt signaling pathway (GO:0030178)|regulation of gene expression (GO:0010468)	extracellular space (GO:0005615)				NS(1)|large_intestine(4)|lung(6)|urinary_tract(1)	12	Ovarian(111;0.112)					GTGGCCCTGCACTGCGTAGAC	0.682													ENSG00000182704																																					0													9.0	16.0	13.0					11																	76507673		2070	4108	6178	SO:0001583	missense	0			-	AK075476	CCDS8246.1	11q13.5	2012-12-05	2012-12-05	2006-11-21	ENSG00000182704	ENSG00000182704			28850	protein-coding gene	gene with protein product		608015	"""leucine rich repeat containing 54"", ""tsukushin"", ""tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)"""	LRRC54		11085516, 19710929, 22880013	Standard	NM_001258210		Approved	E2IG4, TSK	uc031qcw.1	Q8WUA8		ENST00000527881.1:c.1013A>G	11.37:g.76507673A>G	ENSP00000434847:p.His338Arg		B3KQT7|Q6UXK1|Q9UG10|Q9UJX9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.H338R	ENST00000527881.1	37	c.1013	CCDS8246.1	11	.	.	.	.	.	.	.	.	.	.	A	8.307	0.821273	0.16678	.	.	ENSG00000182704	ENST00000333090;ENST00000439807;ENST00000527881	T;T	0.29397	1.57;1.57	4.64	3.42	0.39159	.	0.588760	0.19140	N	0.121710	T	0.16257	0.0391	L	0.27053	0.805	0.24829	N	0.992534	B	0.18610	0.029	B	0.16722	0.016	T	0.07849	-1.0751	10	0.27785	T	0.31	-23.6072	1.5465	0.02566	0.5494:0.1806:0.0964:0.1736	.	338	Q8WUA8	TSK_HUMAN	R	338;306;338	ENSP00000332668:H338R;ENSP00000434847:H338R	ENSP00000332668:H338R	H	+	2	0	TSKU	76185321	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	2.229000	0.42990	1.857000	0.53885	0.459000	0.35465	CAC	-	TSKU	-	NULL		0.682	TSKU-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSKU	HGNC	protein_coding	OTTHUMT00000382871.1	0	0	0	56	56	7	0.00	0.00	A	NM_015516		76507673	+1	27	5	24	5	tier1	no_errors	ENST00000333090	ensembl	human	known	74_37	missense	52.94	50.00	SNP	0.999	G	27	24
RNF165	494470	genome.wustl.edu	37	18	44030349	44030349	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr18:44030349C>T	ENST00000269439.7	+	5	757	c.706C>T	c.(706-708)Cgg>Tgg	p.R236W	RNF165_ENST00000543885.1_Missense_Mutation_p.R44W	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	236							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		CTCCGCCGTACGGGAGAGCTA	0.522													ENSG00000141622																																					0													85.0	76.0	79.0					18																	44030349		2203	4300	6503	SO:0001583	missense	0			-	BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.706C>T	18.37:g.44030349C>T	ENSP00000269439:p.Arg236Trp		B3KVD1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.R236W	ENST00000269439.7	37	c.706	CCDS32823.1	18	.	.	.	.	.	.	.	.	.	.	C	17.84	3.487852	0.64074	.	.	ENSG00000141622	ENST00000269439;ENST00000543885	T;T	0.24908	1.96;1.83	5.28	-2.75	0.05914	.	0.071157	0.56097	D	0.000039	T	0.46034	0.1372	M	0.68952	2.095	0.50813	D	0.99989	D	0.89917	1.0	D	0.71414	0.973	T	0.58109	-0.7694	10	0.72032	D	0.01	.	18.7982	0.92005	0.724:0.276:0.0:0.0	.	236	Q6ZSG1	RN165_HUMAN	W	236;44	ENSP00000269439:R236W;ENSP00000444285:R44W	ENSP00000269439:R236W	R	+	1	2	RNF165	42284347	0.989000	0.36119	0.745000	0.31077	0.818000	0.46254	0.299000	0.19138	-0.214000	0.10078	-0.518000	0.04402	CGG	-	RNF165	-	NULL		0.522	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF165	HGNC	protein_coding	OTTHUMT00000445358.1	0	0	2	67	67	106	0.00	1.85	C	NM_152470		44030349	+1	12	47	34	73	tier1	no_errors	ENST00000269439	ensembl	human	known	74_37	missense	26.09	39.17	SNP	0.990	T	12	34
LINGO1	84894	genome.wustl.edu	37	15	77908078	77908078	+	Silent	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr15:77908078G>A	ENST00000355300.6	-	2	345	c.171C>T	c.(169-171)tgC>tgT	p.C57C	LINGO1_ENST00000561030.1_Silent_p.C51C	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	57	LRRNT.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GCTTGCGGTGGCACAGCACAG	0.682													ENSG00000169783																																					0													15.0	17.0	16.0					15																	77908078		2114	4207	6321	SO:0001819	synonymous_variant	0			-	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.171C>T	15.37:g.77908078G>A			D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C57	ENST00000355300.6	37	c.171	CCDS45313.1	15																																																																																			-	LINGO1	-	smart_LRR-contain_N		0.682	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	HGNC	protein_coding	OTTHUMT00000419546.1	0	0	0	25	25	5	0.00	0.00	G	NM_032808		77908078	-1	4	0	25	0	tier1	no_errors	ENST00000355300	ensembl	human	known	74_37	silent	13.79	0.00	SNP	1.000	A	4	25
FHAD1	114827	genome.wustl.edu	37	1	15654737	15654738	+	Intron	INS	-	-	T	rs398102464|rs144888008|rs75085860|rs71000392		TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr1:15654737_15654738insT	ENST00000375998.4	+	12	1557				FHAD1_ENST00000358897.4_Intron|FHAD1_ENST00000375999.3_Intron|FHAD1_ENST00000417793.1_Intron|FHAD1_ENST00000471347.1_Intron|FHAD1_ENST00000401090.2_Intron|FHAD1_ENST00000375995.3_Intron|RP3-467K16.2_ENST00000428747.1_RNA			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1											skin(1)|stomach(1)	2						TATGTTACATCttttttttttt	0.46													ENSG00000233485																																					0																																										SO:0001627	intron_variant	0				AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.1558-35->T	1.37:g.15654748_15654748dupT			Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	R	INS	-	NULL	ENST00000375998.4	37	NULL		1																																																																																				RP3-467K16.2	-	-		0.460	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	LOC101927417	Clone_based_vega_gene	protein_coding	OTTHUMT00000393400.2	0	0	0	19	19	28	0.00	0.00	-	NM_052929		15654738	-1	4	1	9	7	tier1	no_errors	ENST00000428747	ensembl	human	known	74_37	rna	30.77	12.50	INS	0.000:0.002	T	4	9
GDNF	2668	genome.wustl.edu	37	5	37834785	37834785	+	Silent	SNP	G	G	C			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr5:37834785G>C	ENST00000326524.2	-	2	313	c.114C>G	c.(112-114)ctC>ctG	p.L38L	GDNF_ENST00000427982.1_Silent_p.L55L|GDNF_ENST00000344622.4_Intron|GDNF_ENST00000381826.4_Intron|GDNF_ENST00000515058.1_Intron	NM_000514.3	NP_000505.1	P39905	GDNF_HUMAN	glial cell derived neurotrophic factor	38					adult locomotory behavior (GO:0008344)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|enteric nervous system development (GO:0048484)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|metanephros development (GO:0001656)|mRNA stabilization (GO:0048255)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neuron projection development (GO:0031175)|organ induction (GO:0001759)|peristalsis (GO:0030432)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|postganglionic parasympathetic nervous system development (GO:0021784)|postsynaptic membrane organization (GO:0001941)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of morphogenesis of a branching structure (GO:0060688)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|ureteric bud formation (GO:0060676)	extracellular region (GO:0005576)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(8)|skin(2)	15	all_lung(31;0.00118)					GGCGGCGGCCGAGGGAGCGGT	0.756													ENSG00000168621																																					0													8.0	11.0	10.0					5																	37834785		2036	3994	6030	SO:0001819	synonymous_variant	0			-		CCDS3922.1, CCDS3923.1, CCDS54845.1, CCDS54846.1, CCDS75237.1	5p13.1-p12	2014-01-30			ENSG00000168621	ENSG00000168621		"""Endogenous ligands"""	4232	protein-coding gene	gene with protein product	"""astrocyte-derived trophic factor"", ""glial cell line derived neurotrophic factor"", ""glial derived neurotrophic factor"""	600837				8493557	Standard	NM_199231		Approved	ATF1, ATF2, HFB1-GDNF	uc011cpg.2	P39905	OTTHUMG00000090809	ENST00000326524.2:c.114C>G	5.37:g.37834785G>C			B7WPK7|O95448|O95449|O95986|Q6FH33|Q96L44|Q9UD32|Q9UD33|Q9UMV2|Q9UP67|Q9UP97	Silent	SNP	pfam_TGF-b_C,smart_TGF-b_C,pirsf_GDNF	p.L38	ENST00000326524.2	37	c.114	CCDS3922.1	5																																																																																			-	GDNF	-	pirsf_GDNF		0.756	GDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDNF	HGNC	protein_coding	OTTHUMT00000207606.1	0	0	0	71	71	3	0.00	0.00	G	NM_000514		37834785	-1	34	0	35	0	tier1	no_errors	ENST00000326524	ensembl	human	known	74_37	silent	49.28	0.00	SNP	0.999	C	34	35
LRRC34	151827	genome.wustl.edu	37	3	169530222	169530222	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr3:169530222C>A	ENST00000316515.7	-	1	352	c.76G>T	c.(76-78)Ggc>Tgc	p.G26C	LRRC34_ENST00000522830.1_Intron|LRRC34_ENST00000446859.1_Missense_Mutation_p.G39C|LRRC34_ENST00000522526.2_Missense_Mutation_p.G39C	NM_153353.4	NP_699184.2	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	26										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)	10	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AGGGCCGCGCCCGGAGTACTG	0.751													ENSG00000171757																																					0													2.0	3.0	3.0					3																	169530222		1700	3530	5230	SO:0001583	missense	0			-	AK095125	CCDS3208.1, CCDS3208.2, CCDS54672.1	3q26.2	2014-03-18			ENSG00000171757	ENSG00000171757			28408	protein-coding gene	gene with protein product						12477932	Standard	NM_153353		Approved	MGC27085	uc003ffy.3	Q8IZ02	OTTHUMG00000164419	ENST00000316515.7:c.76G>T	3.37:g.169530222C>A	ENSP00000326150:p.Gly26Cys		B4DEJ7|E9PBH2|G5E9T7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.G39C	ENST00000316515.7	37	c.115		3	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546584	0.27652	.	.	ENSG00000171757	ENST00000446859;ENST00000316515;ENST00000522526	T;T;T	0.47177	0.95;0.88;0.85	2.45	-1.92	0.07618	.	2.711210	0.01853	U	0.036021	T	0.34890	0.0913	N	0.08118	0	0.09310	N	1	P;P;P	0.45531	0.781;0.86;0.781	B;P;B	0.47470	0.346;0.548;0.346	T	0.24119	-1.0169	10	0.56958	D	0.05	.	6.5136	0.22236	0.0:0.434:0.0:0.566	.	26;39;26	B4DHF2;G5E9T7;Q8IZ02	.;.;LRC34_HUMAN	C	39;26;39	ENSP00000414635:G39C;ENSP00000326150:G26C;ENSP00000429278:G39C	ENSP00000326150:G26C	G	-	1	0	LRRC34	171012916	0.000000	0.05858	0.000000	0.03702	0.357000	0.29423	0.393000	0.20817	-0.544000	0.06232	0.313000	0.20887	GGC	-	LRRC34	-	NULL		0.751	LRRC34-201	KNOWN	basic	protein_coding	LRRC34	HGNC	protein_coding		0	0	0	9	9	2	0.00	0.00	C	NM_153353		169530222	-1	5	1	6	6	tier1	no_errors	ENST00000446859	ensembl	human	known	74_37	missense	45.45	14.29	SNP	0.000	A	5	6
RDH13	112724	genome.wustl.edu	37	19	55574429	55574430	+	5'UTR	INS	-	-	GGCGTCC	rs67813353|rs1654457|rs113253419	byFrequency	TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr19:55574429_55574430insGGCGTCC	ENST00000415061.3	-	0	114_115				RDH13_ENST00000396247.3_Intron	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)						eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GTCAGGCGTCAGGGGTCGGCGC	0.738													ENSG00000160439		4256	0.84984	0.7882	0.9035	5008	,	,		10693	0.9692		0.8598	False		,,,				2504	0.7618																0									,	1689,194,481		747,48,147,64,18,158					,		0.0		dbSNP_130	2	3753,491,1004		1682,115,274,167,42,344	no	intron,utr-5	RDH13	NM_138412.3,NM_001145971.1	,	2429,163,421,231,60,502	A1A1,A1A2,A1R,A2A2,A2R,RR		28.487,28.5533,28.5076	,	,		5442,685,1485				SO:0001623	5_prime_UTR_variant	0					CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.-30->GGACGCC	19.37:g.55574429_55574430insGGCGTCC			Q6UX79|Q96G88	R	INS	-	NULL	ENST00000415061.3	37	NULL	CCDS54320.1	19																																																																																				RDH13	-	-		0.738	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH13	HGNC	protein_coding	OTTHUMT00000451470.1	0	0	0	1	1	1	0.00	0.00	-	NM_138412		55574430	-1	0	0	0	0	tier1	no_errors	ENST00000589305	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.004:0.003	GGCGTCC	0	0
WASH6P	653440	genome.wustl.edu	37	X	155254556	155254556	+	RNA	SNP	C	C	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chrX:155254556C>T	ENST00000461007.1	+	0	3472				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GGTGCTGGGTCAGGGATCGAC	0.642													ENSG00000182484																																					0																																												0			-	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155254556C>T			A6NGF1|Q8N305	R	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	WASH6P	-	-		0.642	WASH6P-016	KNOWN	basic	processed_transcript	WASH6P	HGNC	pseudogene	OTTHUMT00000058840.1	0	0	0	11	11	0	0.00	0.00	C	NG_008380		155254556	+1	7	0	12	0	tier1	no_errors	ENST00000461007	ensembl	human	known	74_37	rna	36.84	0.00	SNP	0.016	T	7	12
TNK1	8711	genome.wustl.edu	37	17	7287395	7287395	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr17:7287395C>G	ENST00000576812.1	+	6	1058	c.689C>G	c.(688-690)gCg>gGg	p.A230G	TNK1_ENST00000311668.2_Missense_Mutation_p.A230G|TNK1_ENST00000570896.1_Missense_Mutation_p.A230G	NM_001251902.1	NP_001238831.1			tyrosine kinase, non-receptor, 1											central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(2)|pancreas(1)	16		Prostate(122;0.157)				CGGCAGCTGGCGGGAGCCATG	0.736													ENSG00000174292																																					0													3.0	5.0	5.0					17																	7287395		1707	3689	5396	SO:0001583	missense	0			-	U43408	CCDS45602.1, CCDS58510.1	17p13.1	2005-09-22				ENSG00000174292			11940	protein-coding gene	gene with protein product		608076				8632913	Standard	NM_003985		Approved		uc002ggi.4	Q13470		ENST00000576812.1:c.689C>G	17.37:g.7287395C>G	ENSP00000459799:p.Ala230Gly			Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_SAM/pointed,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A230G	ENST00000576812.1	37	c.689	CCDS58510.1	17	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345365	0.82022	.	.	ENSG00000174292	ENST00000311668	D	0.89875	-2.58	4.48	4.48	0.54585	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47852	D	0.000217	D	0.94739	0.8302	M	0.87617	2.895	0.46609	D	0.999123	D;D	0.89917	1.0;1.0	D;D	0.76071	0.978;0.987	D	0.95353	0.8448	10	0.72032	D	0.01	.	15.0215	0.71635	0.0:1.0:0.0:0.0	.	230;230	Q13470-2;Q13470	.;TNK1_HUMAN	G	230	ENSP00000312309:A230G	ENSP00000312309:A230G	A	+	2	0	TNK1	7228119	0.019000	0.18553	0.987000	0.45799	0.581000	0.36288	2.839000	0.48207	2.480000	0.83734	0.561000	0.74099	GCG	-	TNK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.736	TNK1-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TNK1	HGNC	protein_coding	OTTHUMT00000440832.2	0	0	0	43	43	3	0.00	0.00	C	NM_003985		7287395	+1	26	2	33	0	tier1	no_errors	ENST00000576812	ensembl	human	known	74_37	missense	44.07	100.00	SNP	1.000	G	26	33
FAM160A2	84067	genome.wustl.edu	37	11	6244051	6244051	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chr11:6244051G>A	ENST00000449352.2	-	5	1276	c.1013C>T	c.(1012-1014)gCc>gTc	p.A338V	FAM160A2_ENST00000524416.1_Missense_Mutation_p.A338V|FAM160A2_ENST00000265978.4_Missense_Mutation_p.A338V			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	338					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTTGTGCAAGGCAGGACCCAT	0.547													ENSG00000051009																																					0													144.0	149.0	147.0					11																	6244051		2201	4296	6497	SO:0001583	missense	0			-		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1013C>T	11.37:g.6244051G>A	ENSP00000416918:p.Ala338Val		Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.A338V	ENST00000449352.2	37	c.1013	CCDS44530.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.166660	0.94768	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.32753	1.44;1.44;1.44	5.43	5.43	0.79202	.	0.114856	0.64402	D	0.000011	T	0.61874	0.2382	M	0.85945	2.785	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.975	D;D;P	0.77557	0.99;0.986;0.719	T	0.67891	-0.5553	10	0.87932	D	0	-29.2259	18.224	0.89911	0.0:0.0:1.0:0.0	.	338;338;338	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	V	338;263;338;338	ENSP00000416918:A338V;ENSP00000265978:A338V;ENSP00000431773:A338V	ENSP00000265978:A338V	A	-	2	0	FAM160A2	6200627	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.642000	0.98461	2.561000	0.86390	0.655000	0.94253	GCC	-	FAM160A2	-	pfam_RetinoicA-induced_16-like		0.547	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM160A2	HGNC	protein_coding	OTTHUMT00000383759.1	0	0	0	34	34	112	0.00	0.00	G	NM_032127		6244051	-1	4	3	33	96	tier1	no_errors	ENST00000265978	ensembl	human	known	74_37	missense	10.81	2.97	SNP	1.000	A	4	33
SLC25A14	9016	genome.wustl.edu	37	X	129492767	129492768	+	Intron	INS	-	-	T			TCGA-WK-A8XT-01A-11D-A37C-09	TCGA-WK-A8XT-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	77c2c8cd-1275-4cb5-84f4-753622c380d2	9664ca55-37f1-47af-a918-25eba2554c04	g.chrX:129492767_129492768insT	ENST00000218197.5	+	6	821				SLC25A14_ENST00000543953.1_Intron|SLC25A14_ENST00000339231.3_Intron|SLC25A14_ENST00000545805.1_Intron|SLC25A14_ENST00000467496.1_Intron|SLC25A14_ENST00000361980.5_Intron	NM_001282195.1|NM_001282196.1|NM_001282198.1	NP_001269124.1|NP_001269125.1|NP_001269127.1	O95258	UCP5_HUMAN	solute carrier family 25 (mitochondrial carrier, brain), member 14						aerobic respiration (GO:0009060)|mitochondrial transport (GO:0006839)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)	22						TTTGCAGAGAATTTTTTTTTAT	0.366													ENSG00000102078																																					0																																										SO:0001627	intron_variant	0				AF078544	CCDS14623.1, CCDS14624.1, CCDS76020.1, CCDS76021.1	Xq24	2013-05-22			ENSG00000102078	ENSG00000102078		"""Solute carriers"""	10984	protein-coding gene	gene with protein product		300242				9852133	Standard	XM_005262485		Approved	BMCP1, UCP5	uc004evp.1	O95258	OTTHUMG00000022394	ENST00000218197.5:c.594+58->T	X.37:g.129492776_129492776dupT			D3DTG2|Q0VDH7|Q9HC60|Q9HC61	R	INS	-	NULL	ENST00000218197.5	37	NULL	CCDS14623.1	X																																																																																				SLC25A14	-	-		0.366	SLC25A14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A14	HGNC	protein_coding	OTTHUMT00000058253.1	0	0	0	34	34	78	0.00	0.00	-	NM_022810, NM_003951		129492768	+1	3	3	30	79	tier1	no_errors	ENST00000464184	ensembl	human	known	74_37	rna	9.09	3.66	INS	0.001:0.000	T	3	30
