#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MMP10	4319	genome.wustl.edu	37	11	102647402	102647402	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr11:102647402G>C	ENST00000279441.4	-	5	764	c.728C>G	c.(727-729)aCa>aGa	p.T243R		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	243					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	GGCGAGCTCTGTGAATGAGTT	0.473													ENSG00000166670																																					0													142.0	130.0	134.0					11																	102647402		2203	4299	6502	SO:0001583	missense	0			-	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.728C>G	11.37:g.102647402G>C	ENSP00000279441:p.Thr243Arg		B2R9X9|Q53HH9	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.T243R	ENST00000279441.4	37	c.728	CCDS8321.1	11	.	.	.	.	.	.	.	.	.	.	g	6.237	0.411934	0.11812	.	.	ENSG00000166670	ENST00000279441	T	0.21031	2.03	4.31	2.31	0.28768	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.402067	0.21145	N	0.079401	T	0.18551	0.0445	L	0.29908	0.895	0.09310	N	0.999995	D	0.56746	0.977	P	0.53185	0.72	T	0.10405	-1.0631	10	0.12103	T	0.63	.	6.8148	0.23824	0.0812:0.0:0.6022:0.3166	.	243	P09238	MMP10_HUMAN	R	243	ENSP00000279441:T243R	ENSP00000279441:T243R	T	-	2	0	MMP10	102152612	0.000000	0.05858	0.013000	0.15412	0.002000	0.02628	-1.235000	0.02928	0.476000	0.27440	0.655000	0.94253	ACA	-	MMP10	-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.473	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP10	HGNC	protein_coding	OTTHUMT00000398014.1	0	0	0	39	39	105	0.00	0.00	G			102647402	-1	19	33	5	10	tier1	no_errors	ENST00000279441	ensembl	human	known	74_37	missense	79.17	76.74	SNP	0.012	C	19	5
SETDB1	9869	genome.wustl.edu	37	1	150917627	150917627	+	Intron	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:150917627G>C	ENST00000271640.5	+	9	1330				SETDB1_ENST00000368969.4_Intron|SETDB1_ENST00000368962.2_Missense_Mutation_p.G395R|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1						bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGTTGGTGGGGGGGGAACTTA	0.463													ENSG00000143379																																					0													29.0	30.0	30.0					1																	150917627		2203	4300	6503	SO:0001627	intron_variant	0			-	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1140+43G>C	1.37:g.150917627G>C			A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Missense_Mutation	SNP	smart_Tudor	p.G395R	ENST00000271640.5	37	c.1183	CCDS44217.1	1	.	.	.	.	.	.	.	.	.	.	G	6.041	0.375902	0.11409	.	.	ENSG00000143379	ENST00000368962	T	0.47528	0.84	4.2	-3.86	0.04230	.	.	.	.	.	T	0.07324	0.0185	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27088	-1.0084	7	.	.	.	.	0.4673	0.00526	0.2802:0.1206:0.287:0.3122	.	395	Q15047-2	.	R	395	ENSP00000357958:G395R	.	G	+	1	0	SETDB1	149184251	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-0.180000	0.09754	-0.687000	0.05162	-1.340000	0.01251	GGG	-	SETDB1	-	smart_Tudor		0.463	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	0	0	0	43	43	94	0.00	0.00	G			150917627	+1	23	58	39	97	tier1	no_errors	ENST00000368962	ensembl	human	known	74_37	missense	37.10	37.42	SNP	0.000	C	23	39
SLC19A2	10560	genome.wustl.edu	37	1	169446394	169446394	+	Splice_Site	SNP	G	G	A	rs370511652		TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:169446394G>A	ENST00000236137.5	-	2	1042	c.806C>T	c.(805-807)cCg>cTg	p.P269L	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	269					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	TGAGCTTACCGGTTCCTCCAC	0.468													ENSG00000117479																																					0								G	LEU/PRO	1,4403		0,1,2201	88.0	94.0	92.0		806	1.4	0.4	1		92	0,8600		0,0,4300	no	missense-near-splice	SLC19A2	NM_006996.2	98	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	benign	269/498	169446394	1,13003	2202	4300	6502	SO:0001630	splice_region_variant	0			-	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.807+1C>T	1.37:g.169446394G>A			B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier	p.P269L	ENST00000236137.5	37	c.806	CCDS1280.1	1	.	.	.	.	.	.	.	.	.	.	G	4.210	0.037838	0.08148	2.27E-4	0.0	ENSG00000117479	ENST00000236137	D	0.85629	-2.01	5.34	1.38	0.22167	Major facilitator superfamily domain, general substrate transporter (1);	0.963608	0.08648	N	0.914405	T	0.52948	0.1766	L	0.31752	0.955	0.27353	N	0.95619	B	0.10296	0.003	B	0.13407	0.009	T	0.11227	-1.0596	9	0.24483	T	0.36	-3.5008	1.531	0.02536	0.1476:0.2079:0.3265:0.318	.	269	O60779	S19A2_HUMAN	L	269	ENSP00000236137:P269L	ENSP00000236137:P269L	P	-	2	0	SLC19A2	167713018	0.962000	0.33011	0.384000	0.26145	0.296000	0.27459	0.343000	0.19944	0.008000	0.14787	-0.758000	0.03466	CCG	-	SLC19A2	-	pfam_Folate_carrier,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pirsf_Folate_carrier		0.468	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC19A2	HGNC	protein_coding	OTTHUMT00000086106.1	0	0	0	35	35	96	0.00	0.00	G	NM_006996	Missense_Mutation	169446394	-1	22	72	27	66	tier1	no_errors	ENST00000236137	ensembl	human	known	74_37	missense	44.00	51.80	SNP	0.543	A	22	27
BNC1	646	genome.wustl.edu	37	15	83932303	83932303	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr15:83932303A>T	ENST00000345382.2	-	4	1785	c.1700T>A	c.(1699-1701)aTg>aAg	p.M567K	BNC1_ENST00000569704.1_Missense_Mutation_p.M560K|RP11-382A20.4_ENST00000565495.1_RNA	NM_001717.3	NP_001708.3	Q01954	BNC1_HUMAN	basonuclin 1	567					chromosome organization (GO:0051276)|epidermis development (GO:0008544)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	56						CTGTAGGGGCATGTCTTCATC	0.473													ENSG00000169594																																					0													213.0	200.0	204.0					15																	83932303		2203	4300	6503	SO:0001583	missense	0			-	L03427	CCDS10324.1, CCDS73771.1	15q25.1	2013-05-20	2004-04-30	2004-05-04	ENSG00000169594	ENSG00000169594		"""Zinc fingers, C2H2-type"""	1081	protein-coding gene	gene with protein product		601930	"""basonuclin"""	BNC		1332044	Standard	NM_001717		Approved	HsT19447	uc002bjt.1	Q01954	OTTHUMG00000147362	ENST00000345382.2:c.1700T>A	15.37:g.83932303A>T	ENSP00000307041:p.Met567Lys		Q15840	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M567K	ENST00000345382.2	37	c.1700	CCDS10324.1	15	.	.	.	.	.	.	.	.	.	.	A	9.230	1.035552	0.19590	.	.	ENSG00000169594	ENST00000345382;ENST00000541809	T	0.40756	1.02	5.14	-2.68	0.06041	.	1.842970	0.02178	N	0.060297	T	0.32585	0.0834	L	0.44542	1.39	0.09310	N	1	B;B	0.15473	0.005;0.013	B;B	0.11329	0.006;0.006	T	0.08207	-1.0733	10	0.30854	T	0.27	-1.7477	4.2797	0.10827	0.3267:0.1191:0.4383:0.1159	.	560;567	F5GY04;Q01954	.;BNC1_HUMAN	K	567;560	ENSP00000307041:M567K	ENSP00000307041:M567K	M	-	2	0	BNC1	81723307	0.000000	0.05858	0.001000	0.08648	0.974000	0.67602	0.098000	0.15189	-0.713000	0.04981	0.533000	0.62120	ATG	-	BNC1	-	NULL		0.473	BNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNC1	HGNC	protein_coding	OTTHUMT00000304006.1	0	0	0	46	46	67	0.00	0.00	A	NM_001717		83932303	-1	33	45	25	54	tier1	no_errors	ENST00000345382	ensembl	human	known	74_37	missense	56.90	45.45	SNP	0.001	T	33	25
MUC16	94025	genome.wustl.edu	37	19	9076289	9076289	+	Silent	SNP	A	A	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:9076289A>T	ENST00000397910.4	-	3	11360	c.11157T>A	c.(11155-11157)acT>acA	p.T3719T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3720	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TATTTGGGTCAGTCTTTGTAC	0.463													ENSG00000181143																																					0													126.0	124.0	125.0					19																	9076289		1981	4174	6155	SO:0001819	synonymous_variant	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.11157T>A	19.37:g.9076289A>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T3719	ENST00000397910.4	37	c.11157	CCDS54212.1	19																																																																																			-	MUC16	-	NULL		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	42	42	94	0.00	0.00	A	NM_024690		9076289	-1	20	49	24	68	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	45.45	41.88	SNP	0.001	T	20	24
ZNF574	64763	genome.wustl.edu	37	19	42584298	42584298	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:42584298C>G	ENST00000600245.1	+	2	2195	c.1540C>G	c.(1540-1542)Ctg>Gtg	p.L514V	ZNF574_ENST00000359044.4_Missense_Mutation_p.L514V|CTB-59C6.3_ENST00000594531.1_RNA|ZNF574_ENST00000222339.7_Missense_Mutation_p.L604V			Q6ZN55	ZN574_HUMAN	zinc finger protein 574	514					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20		Prostate(69;0.059)				GCGTAACCACCTGCGCACACA	0.607													ENSG00000105732																																					0													175.0	194.0	188.0					19																	42584298		2203	4300	6503	SO:0001583	missense	0			-	AK074788	CCDS12596.1	19q13.2	2013-09-20			ENSG00000105732	ENSG00000105732		"""Zinc fingers, C2H2-type"""	26166	protein-coding gene	gene with protein product						12477932	Standard	NM_022752		Approved	FLJ22059	uc002osm.4	Q6ZN55	OTTHUMG00000182751	ENST00000600245.1:c.1540C>G	19.37:g.42584298C>G	ENSP00000469029:p.Leu514Val		Q6IPE0|Q6ZN10|Q7L5Z5|Q8NCE3|Q9H6N0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L604V	ENST00000600245.1	37	c.1810	CCDS12596.1	19	.	.	.	.	.	.	.	.	.	.	C	8.728	0.915885	0.17907	.	.	ENSG00000105732	ENST00000222339;ENST00000359044;ENST00000535775	T;T	0.08634	3.07;3.07	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.156521	0.40728	N	0.001022	T	0.11580	0.0282	L	0.41824	1.3	0.31999	N	0.603625	P;P	0.47191	0.652;0.891	B;P	0.47299	0.424;0.543	T	0.02333	-1.1175	10	0.59425	D	0.04	-9.6074	12.2589	0.54638	0.1702:0.8298:0.0:0.0	.	514;603	Q6ZN55;Q6ZN55-2	ZN574_HUMAN;.	V	604;514;121	ENSP00000222339:L604V;ENSP00000351939:L514V	ENSP00000222339:L604V	L	+	1	2	ZNF574	47276138	0.704000	0.27836	1.000000	0.80357	0.030000	0.12068	0.928000	0.28831	2.340000	0.79590	0.650000	0.86243	CTG	-	ZNF574	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.607	ZNF574-002	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ZNF574	HGNC	protein_coding	OTTHUMT00000463458.1	0	0	0	34	34	59	0.00	0.00	C	NM_022752		42584298	+1	26	37	20	40	tier1	no_errors	ENST00000222339	ensembl	human	known	74_37	missense	55.32	48.05	SNP	1.000	G	26	20
ADAMTS6	11174	genome.wustl.edu	37	5	64748637	64748637	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr5:64748637C>A	ENST00000536360.1	-	5	1553	c.740G>T	c.(739-741)aGc>aTc	p.S247I				Q9UKP5	ATS6_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 6	247						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(3)	18		Lung NSC(167;2.44e-06)|Prostate(74;0.014)|Ovarian(174;0.0549)|Breast(144;0.111)|Colorectal(97;0.235)		Lung(70;0.00942)		CCGTTCAATGCTCACTGATCT	0.428													ENSG00000049192																																					0													212.0	183.0	193.0					5																	64748637		2203	4300	6503	SO:0001583	missense	0			-	AF140674	CCDS3983.2	5q13	2008-07-18	2005-08-19		ENSG00000049192	ENSG00000049192		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	222	protein-coding gene	gene with protein product	"""a disintegrin and metalloproteinase with thrombospondin motifs 6"""	605008	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 6"""			10464288	Standard	NM_197941		Approved	ADAM-TS6	uc003jtp.3	Q9UKP5	OTTHUMG00000074079	ENST00000536360.1:c.740G>T	5.37:g.64748637C>A	ENSP00000440995:p.Ser247Ile		Q59EX6|Q5IR87|Q5IR88|Q5IR89|Q68DL1	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.S247I	ENST00000536360.1	37	c.740		5	.	.	.	.	.	.	.	.	.	.	C	24.0	4.485007	0.84854	.	.	ENSG00000049192	ENST00000381055;ENST00000261306;ENST00000464680;ENST00000536360	D;D;D	0.87571	-2.27;-2.27;-2.27	5.49	5.49	0.81192	Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83686	0.5308	L	0.36672	1.1	0.80722	D	1	P	0.36412	0.552	B	0.35413	0.202	D	0.85001	0.0900	10	0.87932	D	0	.	19.3843	0.94550	0.0:1.0:0.0:0.0	.	247	Q9UKP5	ATS6_HUMAN	I	247	ENSP00000370443:S247I;ENSP00000423551:S247I;ENSP00000440995:S247I	ENSP00000261306:S247I	S	-	2	0	ADAMTS6	64784393	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.574000	0.86865	0.563000	0.77884	AGC	-	ADAMTS6	-	NULL		0.428	ADAMTS6-201	KNOWN	basic	protein_coding	ADAMTS6	HGNC	protein_coding		0	0	0	34	34	56	0.00	0.00	C	NM_197941		64748637	-1	16	53	23	53	tier1	no_errors	ENST00000381055	ensembl	human	known	74_37	missense	41.03	49.53	SNP	1.000	A	16	23
LRRC38	126755	genome.wustl.edu	37	1	13839703	13839703	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:13839703C>T	ENST00000376085.3	-	1	840	c.386G>A	c.(385-387)aGg>aAg	p.R129K	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	129					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											CTTCACCAGCCTCCCGGCCGA	0.647													ENSG00000162494																																					0																																										SO:0001583	missense	0			-	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.386G>A	1.37:g.13839703C>T	ENSP00000365253:p.Arg129Lys		Q96B32	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R129K	ENST00000376085.3	37	c.386	CCDS53269.1	1	.	.	.	.	.	.	.	.	.	.	C	1.203	-0.631825	0.03584	.	.	ENSG00000162494	ENST00000376085	T	0.57107	0.42	4.21	3.14	0.36123	.	0.343965	0.33040	N	0.005345	T	0.22513	0.0543	N	0.10809	0.05	0.30256	N	0.793624	B	0.02656	0.0	B	0.14023	0.01	T	0.28004	-1.0057	10	0.02654	T	1	.	3.3383	0.07108	0.0:0.5859:0.0:0.4141	.	129	Q5VT99	LRC38_HUMAN	K	129	ENSP00000365253:R129K	ENSP00000365253:R129K	R	-	2	0	LRRC38	13712290	0.991000	0.36638	0.997000	0.53966	0.448000	0.32197	2.011000	0.40922	1.873000	0.54277	0.297000	0.19635	AGG	-	LRRC38	-	smart_Leu-rich_rpt_typical-subtyp		0.647	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC38	HGNC	protein_coding	OTTHUMT00000021793.1	0	0	0	68	68	38	0.00	0.00	C			13839703	-1	37	26	58	27	tier1	no_errors	ENST00000376085	ensembl	human	known	74_37	missense	38.95	49.06	SNP	0.997	T	37	58
GAK	2580	genome.wustl.edu	37	4	870905	870905	+	Silent	SNP	G	G	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr4:870905G>T	ENST00000314167.4	-	17	2057	c.1947C>A	c.(1945-1947)tcC>tcA	p.S649S	GAK_ENST00000511163.1_Silent_p.S570S	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	649	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		CGCCCAGAGTGGACCGGGCGT	0.632													ENSG00000178950																																					0													43.0	45.0	44.0					4																	870905		2203	4299	6502	SO:0001819	synonymous_variant	0			-	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1947C>A	4.37:g.870905G>T			Q5U4P5|Q9BVY6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.S649	ENST00000314167.4	37	c.1947	CCDS3340.1	4																																																																																			-	GAK	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom		0.632	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1	0	0	0	60	60	26	0.00	0.00	G	NM_005255		870905	-1	30	12	37	21	tier1	no_errors	ENST00000314167	ensembl	human	known	74_37	silent	44.78	36.36	SNP	0.997	T	30	37
CBX4	8535	genome.wustl.edu	37	17	77807835	77807835	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr17:77807835A>G	ENST00000269397.4	-	5	1783	c.1606T>C	c.(1606-1608)Ttc>Ctc	p.F536L		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	536	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TTCCCAAAGAAGGGCTTGAAC	0.627													ENSG00000141582																																					0													59.0	68.0	65.0					17																	77807835		2203	4300	6503	SO:0001583	missense	0			-	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1606T>C	17.37:g.77807835A>G	ENSP00000269397:p.Phe536Leu		B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,prints_Chromo_dom_subgr,pfscan_Chromo_domain/shadow	p.F536L	ENST00000269397.4	37	c.1606	CCDS32758.1	17	.	.	.	.	.	.	.	.	.	.	A	25.2	4.611886	0.87258	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	3.16	3.16	0.36331	.	0.385355	0.25968	N	0.027159	T	0.65595	0.2706	L	0.42245	1.32	0.80722	D	1	D	0.63880	0.993	D	0.72625	0.978	T	0.67864	-0.5560	9	0.87932	D	0	-34.8339	10.4735	0.44650	1.0:0.0:0.0:0.0	.	536	O00257	CBX4_HUMAN	L	536;266	.	ENSP00000269397:F536L	F	-	1	0	CBX4	75422430	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.286000	0.89916	1.465000	0.48006	0.249000	0.18162	TTC	-	CBX4	-	NULL		0.627	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX4	HGNC	protein_coding	OTTHUMT00000318007.1	0	0	0	43	43	69	0.00	0.00	A	NM_003655		77807835	-1	31	20	28	42	tier1	no_errors	ENST00000269397	ensembl	human	known	74_37	missense	52.54	31.75	SNP	1.000	G	31	28
ADCY10	55811	genome.wustl.edu	37	1	167787437	167787437	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:167787437C>G	ENST00000367851.4	-	31	4539	c.4355G>C	c.(4354-4356)aGa>aCa	p.R1452T	RP1-313L4.3_ENST00000451545.1_RNA|ADCY10_ENST00000545172.1_Missense_Mutation_p.R1299T|ADCY10_ENST00000367848.1_Missense_Mutation_p.R1360T	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1452					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						CATGGTTCTTCTTGGCAAAAG	0.378													ENSG00000143199																																					0													112.0	107.0	109.0					1																	167787437		2203	4300	6503	SO:0001583	missense	0			-	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4355G>C	1.37:g.167787437C>G	ENSP00000356825:p.Arg1452Thr		B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,superfamily_P-loop_NTPase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.R1452T	ENST00000367851.4	37	c.4355	CCDS1265.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.28|14.28	2.487702|2.487702	0.44249|0.44249	.|.	.|.	ENSG00000143199|ENSG00000143199	ENST00000271426|ENST00000545172;ENST00000367851;ENST00000367848	.|T;T;T	.|0.31247	.|1.5;1.5;1.5	5.63|5.63	4.71|4.71	0.59529|0.59529	.|.	.|0.000000	.|0.52532	.|D	.|0.000064	T|T	0.40670|0.40670	0.1126|0.1126	M|M	0.67953|0.67953	2.075|2.075	.|0.32586	.|N	.|0.527883	.|D;D	.|0.89917	.|1.0;0.999	.|D;D	.|0.85130	.|0.997;0.994	T|T	0.23797|0.23797	-1.0178|-1.0178	5|9	0.87932|0.38643	D|T	0|0.18	-23.0822|-23.0822	10.9843|10.9843	0.47513|0.47513	0.0:0.9121:0.0:0.0879|0.0:0.9121:0.0:0.0879	.|.	.|1360;1452	.|Q96PN6-2;Q96PN6	.|.;ADCYA_HUMAN	Q|T	370|1299;1452;1360	.|ENSP00000441992:R1299T;ENSP00000356825:R1452T;ENSP00000356822:R1360T	ENSP00000271426:E370Q|ENSP00000356822:R1360T	E|R	-|-	1|2	0|0	ADCY10|ADCY10	166054061|166054061	0.912000|0.912000	0.30974|0.30974	0.898000|0.898000	0.35279|0.35279	0.116000|0.116000	0.19942|0.19942	2.389000|2.389000	0.44407|0.44407	2.652000|2.652000	0.90054|0.90054	0.655000|0.655000	0.94253|0.94253	GAA|AGA	-	ADCY10	-	pirsf_Adenylate_cylcase_typ10		0.378	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	0	0	0	37	37	100	0.00	0.00	C	NM_018417		167787437	-1	26	74	36	105	tier1	no_errors	ENST00000367851	ensembl	human	known	74_37	missense	41.94	41.11	SNP	0.876	G	26	36
TTC37	9652	genome.wustl.edu	37	5	94877519	94877519	+	Splice_Site	SNP	C	C	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr5:94877519C>T	ENST00000358746.2	-	6	624	c.326G>A	c.(325-327)aGt>aAt	p.S109N		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	109						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						CATTTCTTACCTCTCATAAAG	0.333													ENSG00000198677																																					0													75.0	75.0	75.0					5																	94877519		2203	4298	6501	SO:0001630	splice_region_variant	0			-	AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.326+1G>A	5.37:g.94877519C>T			O15077|Q6PJI3	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S109N	ENST00000358746.2	37	c.326	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	C	18.77	3.694072	0.68386	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	T;T	0.78595	-1.19;-0.22	5.33	5.33	0.75918	Tetratricopeptide-like helical (1);	0.042203	0.85682	D	0.000000	T	0.80513	0.4637	M	0.66939	2.045	0.58432	D	0.99999	D;P	0.54772	0.968;0.825	P;B	0.46208	0.507;0.299	T	0.80823	-0.1210	9	.	.	.	.	19.4472	0.94852	0.0:1.0:0.0:0.0	.	61;109	D6RCE2;Q6PGP7	.;TTC37_HUMAN	N	109;61	ENSP00000351596:S109N;ENSP00000423742:S61N	.	S	-	2	0	TTC37	94903275	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	4.204000	0.58460	2.662000	0.90505	0.650000	0.86243	AGT	-	TTC37	-	NULL		0.333	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	0	0	0	42	42	76	0.00	0.00	C	NM_014639	Missense_Mutation	94877519	-1	20	59	35	72	tier1	no_errors	ENST00000358746	ensembl	human	known	74_37	missense	35.71	44.70	SNP	1.000	T	20	35
AP2A1	160	genome.wustl.edu	37	19	50303321	50303321	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:50303321G>C	ENST00000359032.5	+	11	1369	c.1369G>C	c.(1369-1371)Gtg>Ctg	p.V457L	AP2A1_ENST00000354293.5_Missense_Mutation_p.V457L	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	457					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GGGCGACTACGTGAGTGAGGA	0.592													ENSG00000196961																																					0													89.0	100.0	97.0					19																	50303321		2159	4240	6399	SO:0001583	missense	0			-	AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1369G>C	19.37:g.50303321G>C	ENSP00000351926:p.Val457Leu		Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.V457L	ENST00000359032.5	37	c.1369	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	G	18.87	3.714760	0.68730	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.49139	0.79;0.79	4.65	4.65	0.58169	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71151	0.3306	M	0.84773	2.715	0.80722	D	1	D;D	0.69078	0.997;0.97	D;P	0.68192	0.956;0.879	T	0.77459	-0.2580	10	0.87932	D	0	.	16.4522	0.83994	0.0:0.0:1.0:0.0	.	457;457	O95782-2;O95782	.;AP2A1_HUMAN	L	457	ENSP00000346246:V457L;ENSP00000351926:V457L	ENSP00000346246:V457L	V	+	1	0	AP2A1	54995133	1.000000	0.71417	0.978000	0.43139	0.101000	0.19017	9.575000	0.98187	2.400000	0.81607	0.462000	0.41574	GTG	-	AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.592	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	0	0	0	27	27	140	0.00	0.00	G			50303321	+1	18	78	23	115	tier1	no_errors	ENST00000354293	ensembl	human	known	74_37	missense	43.90	40.41	SNP	1.000	C	18	23
BCLAF1	9774	genome.wustl.edu	37	6	136596817	136596817	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr6:136596817T>A	ENST00000531224.1	-	6	1957	c.1705A>T	c.(1705-1707)Agg>Tgg	p.R569W	BCLAF1_ENST00000353331.4_Missense_Mutation_p.R567W|BCLAF1_ENST00000527536.1_Missense_Mutation_p.R569W|BCLAF1_ENST00000527759.1_Missense_Mutation_p.R567W|BCLAF1_ENST00000530767.1_Missense_Mutation_p.R396W|BCLAF1_ENST00000392348.2_Missense_Mutation_p.R567W	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	569					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GCAAGCAGCCTGTCTTTAGTC	0.393													ENSG00000029363																									Colon(142;1534 1789 5427 7063 28491)												0													141.0	132.0	135.0					6																	136596817		2203	4300	6503	SO:0001583	missense	0			-	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.1705A>T	6.37:g.136596817T>A	ENSP00000435210:p.Arg569Trp		A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NULL	p.R569W	ENST00000531224.1	37	c.1705	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	T	18.01	3.528018	0.64860	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46;1.46	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	T	0.46112	0.1376	M	0.64997	1.995	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;0.999	D;D;D;D	0.85130	0.994;0.997;0.994;0.987	T	0.49082	-0.8976	10	0.87932	D	0	-8.8662	16.0973	0.81135	0.0:0.0:0.0:1.0	.	567;567;569;396	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	W	569;567;569;396;567;567;569	ENSP00000435210:R569W;ENSP00000229446:R567W;ENSP00000435441:R569W;ENSP00000436501:R396W;ENSP00000434826:R567W;ENSP00000376159:R567W;ENSP00000431734:R569W	ENSP00000229446:R567W	R	-	1	2	BCLAF1	136638510	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.846000	0.55888	2.263000	0.75096	0.377000	0.23210	AGG	-	BCLAF1	-	NULL		0.393	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	0	0	0	36	36	136	0.00	0.00	T	NM_014739		136596817	-1	9	21	27	76	tier1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	25.00	21.65	SNP	1.000	A	9	27
GYPC	2995	genome.wustl.edu	37	2	127447866	127447866	+	Missense_Mutation	SNP	A	A	G			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr2:127447866A>G	ENST00000259254.4	+	2	416	c.85A>G	c.(85-87)Atg>Gtg	p.M29V	GYPC_ENST00000464053.1_3'UTR|GYPC_ENST00000356887.7_Missense_Mutation_p.M8V|GYPC_ENST00000409836.3_Intron	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	29						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		CTCCACCACAATGCATACTAC	0.522													ENSG00000136732																									Melanoma(110;806 1600 6704 9981 33404)												0													142.0	109.0	120.0					2																	127447866		2203	4300	6503	SO:0001583	missense	0			-		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.85A>G	2.37:g.127447866A>G	ENSP00000259254:p.Met29Val		B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	smart_Neurexin-like	p.M29V	ENST00000259254.4	37	c.85	CCDS2136.1	2	.	.	.	.	.	.	.	.	.	.	A	0.001	-2.950053	0.00051	.	.	ENSG00000136732	ENST00000259254;ENST00000356887	T;T	0.15603	2.89;2.41	1.1	-2.21	0.06973	.	.	.	.	.	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	B	0.24426	0.103	B	0.12156	0.007	T	0.38520	-0.9657	9	0.09084	T	0.74	.	3.1132	0.06365	0.3369:0.256:0.4071:0.0	.	29	P04921	GLPC_HUMAN	V	29;8	ENSP00000259254:M29V;ENSP00000349354:M8V	ENSP00000259254:M29V	M	+	1	0	GYPC	127164336	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.067000	0.14510	-1.327000	0.02264	0.163000	0.16589	ATG	-	GYPC	-	NULL		0.522	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GYPC	HGNC	protein_coding	OTTHUMT00000254297.1	0	0	0	31	31	55	0.00	0.00	A	NM_002101		127447866	+1	19	29	39	48	tier1	no_errors	ENST00000259254	ensembl	human	known	74_37	missense	32.76	37.66	SNP	0.000	G	19	39
GAK	2580	genome.wustl.edu	37	4	871534	871534	+	Silent	SNP	G	G	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr4:871534G>T	ENST00000314167.4	-	16	1835	c.1725C>A	c.(1723-1725)atC>atA	p.I575I	GAK_ENST00000511163.1_Silent_p.I496I	NM_005255.2	NP_005246.2	O14976	GAK_HUMAN	cyclin G associated kinase	575	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell cycle (GO:0007049)|cell development (GO:0048468)|clathrin coat disassembly (GO:0072318)|clathrin-mediated endocytosis (GO:0072583)|endoplasmic reticulum organization (GO:0007029)|epidermal cell differentiation (GO:0009913)|establishment of skin barrier (GO:0061436)|forebrain morphogenesis (GO:0048853)|Golgi organization (GO:0007030)|intrahepatic bile duct development (GO:0035622)|positive regulation of neural precursor cell proliferation (GO:2000179)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(16)|skin(7)|urinary_tract(2)	39				Colorectal(103;0.219)		CCCTCACCAGGATGGGCTTGC	0.652													ENSG00000178950																																					0													66.0	59.0	62.0					4																	871534		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D88435	CCDS3340.1	4p16	2011-09-07			ENSG00000178950	ENSG00000178950		"""Heat shock proteins / DNAJ (HSP40)"""	4113	protein-coding gene	gene with protein product	"""auxilin-2"""	602052				9299234	Standard	NM_005255		Approved	DNAJC26	uc003gbm.4	O14976	OTTHUMG00000088301	ENST00000314167.4:c.1725C>A	4.37:g.871534G>T			Q5U4P5|Q9BVY6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_Kinase-like_dom,superfamily_DnaJ_domain,superfamily_C2_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_DnaJ_domain,pfscan_Prot_kinase_dom,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.I575	ENST00000314167.4	37	c.1725	CCDS3340.1	4																																																																																			-	GAK	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom		0.652	GAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAK	HGNC	protein_coding	OTTHUMT00000239188.1	0	0	0	41	41	25	0.00	0.00	G	NM_005255		871534	-1	25	7	35	27	tier1	no_errors	ENST00000314167	ensembl	human	known	74_37	silent	41.67	20.59	SNP	0.988	T	25	35
MDP1	145553	genome.wustl.edu	37	14	24683307	24683307	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr14:24683307G>A	ENST00000288087.7	-	6	565	c.454C>T	c.(454-456)Caa>Taa	p.Q152*	CHMP4A_ENST00000347519.6_5'Flank|CHMP4A_ENST00000609024.1_5'Flank|NEDD8-MDP1_ENST00000534348.1_Nonsense_Mutation_p.Q169*|AL136419.6_ENST00000565988.1_RNA|CHMP4A_ENST00000542700.2_5'Flank|NEDD8-MDP1_ENST00000604306.1_5'Flank|TM9SF1_ENST00000530611.1_5'Flank|CHMP4A_ENST00000530996.1_5'Flank|TM9SF1_ENST00000556387.1_5'Flank|MDP1_ENST00000396833.2_Missense_Mutation_p.S105L|MDP1_ENST00000532557.1_5'UTR	NM_001199822.1|NM_138476.3	NP_001186751.1|NP_612485.2	Q86V88	MGDP1_HUMAN	magnesium-dependent phosphatase 1	152						extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|large_intestine(2)|lung(3)	7						TCTAACCCTTGACTTAGAGTT	0.433													ENSG00000213920																																					0													82.0	82.0	82.0					14																	24683307		2203	4300	6503	SO:0001587	stop_gained	0			-	BC046912	CCDS9620.1, CCDS55908.1	14q12	2009-07-09			ENSG00000213920	ENSG00000213920			28781	protein-coding gene	gene with protein product	"""fructosamine-6-phosphatase"""					10889041, 16670083	Standard	NM_138476		Approved	MGC5987, FN6Pase		Q86V88	OTTHUMG00000133477	ENST00000288087.7:c.454C>T	14.37:g.24683307G>A	ENSP00000288087:p.Gln152*		Q86Y84|Q8NAD9	Nonsense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc,tigrfam_HAD_SF_ppase_IIIC	p.Q152*	ENST00000288087.7	37	c.454	CCDS9620.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.34|19.34	3.809790|3.809790	0.70797|0.70797	.|.	.|.	ENSG00000213920;ENSG00000255526|ENSG00000213920	ENST00000288087;ENST00000534348|ENST00000396833	.|.	.|.	.|.	5.25|5.25	3.22|3.22	0.36961|0.36961	.|.	0.317545|.	0.17362|.	U|.	0.177013|.	.|T	.|0.18173	.|0.0436	.|.	.|.	.|.	0.23282|0.23282	N|N	0.997983|0.997983	.|P	.|0.36909	.|0.573	.|B	.|0.40901	.|0.343	.|T	.|0.15954	.|-1.0419	.|7	0.07325|0.02654	T|T	0.83|1	-8.3948|-8.3948	7.5144|7.5144	0.27592|0.27592	0.0:0.1719:0.6255:0.2025|0.0:0.1719:0.6255:0.2025	.|.	.|105	.|Q86V88-3	.|.	X|L	152;169|105	.|.	ENSP00000288087:Q152X|ENSP00000380045:S105L	Q|S	-|-	1|2	0|0	MDP1;NEDD8-MDP1|MDP1	23753147|23753147	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.295000|1.295000	0.33377|0.33377	1.398000|1.398000	0.46701|0.46701	0.655000|0.655000	0.94253|0.94253	CAA|TCA	-	MDP1	-	pfam_NIF,superfamily_HAD-like_dom,tigrfam_MDP_1_eu_arc		0.433	MDP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MDP1	HGNC	protein_coding	OTTHUMT00000257367.1	0	0	0	22	22	68	0.00	0.00	G	NM_138476		24683307	-1	18	52	23	74	tier1	no_errors	ENST00000288087	ensembl	human	known	74_37	nonsense	43.90	41.27	SNP	1.000	A	18	23
POTEC	388468	genome.wustl.edu	37	18	14542640	14542640	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr18:14542640C>A	ENST00000358970.5	-	1	505	c.506G>T	c.(505-507)aGg>aTg	p.R169M	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	169										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						TTGCTTGTCCCTCTTGTTCAT	0.602													ENSG00000183206																																					0													295.0	276.0	281.0					18																	14542640		692	1591	2283	SO:0001583	missense	0			-	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.506G>T	18.37:g.14542640C>A	ENSP00000351856:p.Arg169Met			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R169M	ENST00000358970.5	37	c.506	CCDS45835.1	18	.	.	.	.	.	.	.	.	.	.	C	4.775	0.144155	0.09134	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.55234	0.53	1.44	-2.87	0.05700	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.57140	0.2033	M	0.76838	2.35	0.09310	N	1	P	0.47545	0.897	P	0.51657	0.676	T	0.53592	-0.8417	9	0.87932	D	0	.	3.723	0.08463	0.0:0.2779:0.4058:0.3163	.	169	B2RU33	POTEC_HUMAN	M	169	ENSP00000351856:R169M	ENSP00000351856:R169M	R	-	2	0	POTEC	14532640	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.418000	0.02462	-2.065000	0.00887	-2.969000	0.00081	AGG	-	POTEC	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.602	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	HGNC	protein_coding	OTTHUMT00000371179.1	0	0	0	167	167	45	0.00	0.00	C	XM_496269		14542640	-1	82	26	107	31	tier1	no_errors	ENST00000358970	ensembl	human	known	74_37	missense	43.39	45.61	SNP	0.000	A	82	107
DOCK3	1795	genome.wustl.edu	37	3	51273843	51273843	+	Nonsense_Mutation	SNP	T	T	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr3:51273843T>A	ENST00000266037.9	+	20	2008	c.1985T>A	c.(1984-1986)tTg>tAg	p.L662*		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	662					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TACGGCCTGTTGGTTTTTCAG	0.353													ENSG00000088538																																					0													216.0	200.0	205.0					3																	51273843		1847	4085	5932	SO:0001587	stop_gained	0			-	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1985T>A	3.37:g.51273843T>A	ENSP00000266037:p.Leu662*		O15017	Nonsense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.L662*	ENST00000266037.9	37	c.1985	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	T	37	6.489362	0.97607	.	.	ENSG00000088538	ENST00000266037	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.4559	0.75314	0.0:0.0:0.0:1.0	.	.	.	.	X	662	.	ENSP00000266037:L662X	L	+	2	0	DOCK3	51248883	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.214000	0.72200	2.108000	0.64289	0.533000	0.62120	TTG	-	DOCK3	-	superfamily_ARM-type_fold		0.353	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	0	0	0	81	81	89	0.00	0.00	T	NM_004947		51273843	+1	35	70	48	83	tier1	no_errors	ENST00000266037	ensembl	human	known	74_37	nonsense	42.17	45.75	SNP	0.993	A	35	48
LPIN2	9663	genome.wustl.edu	37	18	2946496	2946496	+	Intron	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr18:2946496G>C	ENST00000261596.4	-	4	829				RP11-737O24.3_ENST00000581139.1_RNA|RP11-737O24.2_ENST00000584431.1_RNA|RP11-737O24.2_ENST00000581488.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2						cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CAGGATCGAAGCGCTGACCGC	0.522													ENSG00000263606																																					0																																										SO:0001627	intron_variant	0			-	D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.590+4556C>G	18.37:g.2946496G>C			A7MD25|D3DUH3	R	SNP	-	NULL	ENST00000261596.4	37	NULL	CCDS11829.1	18																																																																																			-	RP11-737O24.3	-	-		0.522	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263606	Clone_based_vega_gene	protein_coding	OTTHUMT00000254363.2	0	0	0	52	52	83	0.00	0.00	G	NM_014646		2946496	-1	28	40	25	49	tier1	no_errors	ENST00000581139	ensembl	human	known	74_37	rna	52.83	43.96	SNP	0.998	C	28	25
ATP5C1	509	genome.wustl.edu	37	10	7844282	7844282	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr10:7844282C>A	ENST00000356708.7	+	7	766	c.687C>A	c.(685-687)taC>taA	p.Y229*	ATP5C1_ENST00000493053.1_3'UTR|ATP5C1_ENST00000541227.1_Nonsense_Mutation_p.Y182*|ATP5C1_ENST00000335698.4_Nonsense_Mutation_p.Y229*	NM_001001973.1	NP_001001973.1	P36542	ATPG_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1	229					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, catalytic core F(1) (GO:0000275)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	16						TGCAAAATTACCAAGAATACA	0.418													ENSG00000165629																									Melanoma(143;1012 1820 16249 30920 33158)												0													121.0	100.0	107.0					10																	7844282		2203	4300	6503	SO:0001587	stop_gained	0			-	D16561	CCDS7081.1, CCDS31142.1	10p14	2012-10-12			ENSG00000165629	ENSG00000165629		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	833	protein-coding gene	gene with protein product		108729		ATP5CL1, ATP5C		8168843, 8227057	Standard	NM_005174		Approved		uc001iju.3	P36542	OTTHUMG00000017639	ENST00000356708.7:c.687C>A	10.37:g.7844282C>A	ENSP00000349142:p.Tyr229*		A8KA31|Q5VYP3|Q6I9V2|Q96AS8	Nonsense_Mutation	SNP	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,prints_ATPase_F1-cplx_gsu,tigrfam_ATPase_F1-cplx_gsu	p.Y229*	ENST00000356708.7	37	c.687	CCDS31142.1	10	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500468	0.85176	.	.	ENSG00000165629	ENST00000356708;ENST00000335698;ENST00000541227	.	.	.	5.5	1.02	0.19986	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.2887	9.6878	0.40109	0.0:0.5889:0.0:0.4111	.	.	.	.	X	229;229;182	.	ENSP00000338568:Y229X	Y	+	3	2	ATP5C1	7884288	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	1.550000	0.36223	0.376000	0.24707	0.655000	0.94253	TAC	-	ATP5C1	-	pfam_ATPase_F1-cplx_gsu,superfamily_ATPase_F1_gsu_dom,tigrfam_ATPase_F1-cplx_gsu		0.418	ATP5C1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP5C1	HGNC	protein_coding	OTTHUMT00000046708.1	0	0	0	18	18	31	0.00	0.00	C	NM_005174		7844282	+1	7	29	10	42	tier1	no_errors	ENST00000356708	ensembl	human	known	74_37	nonsense	41.18	40.85	SNP	1.000	A	7	10
RPS15A	6210	genome.wustl.edu	37	16	18800247	18800247	+	Intron	SNP	C	C	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr16:18800247C>T	ENST00000565420.1	-	2	502				RPS15A_ENST00000563390.1_Intron|RPS15A_ENST00000569083.1_Intron|RP11-1035H13.3_ENST00000567078.2_Intron|RPS15A_ENST00000322989.4_Intron|RPS15A_ENST00000575669.1_5'Flank|RPS15A_ENST00000576436.1_Intron			P62244	RS15A_HUMAN	ribosomal protein S15a						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|response to virus (GO:0009615)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(1)	2						TTCTACAGGACTGATTTCTTA	0.448													ENSG00000134419																																					0																																										SO:0001627	intron_variant	0			-	AB007154	CCDS10571.1	16p12.3	2011-04-05			ENSG00000134419	ENSG00000134419		"""S ribosomal proteins"""	10389	protein-coding gene	gene with protein product		603674				9582194	Standard	NM_001019		Approved	S15A	uc002dfi.1	P62244	OTTHUMG00000131365	ENST00000565420.1:c.133+55G>A	16.37:g.18800247C>T			P39027|P39031|Q3MHD9|Q8C023|Q9BV24	R	SNP	-	NULL	ENST00000565420.1	37	NULL	CCDS10571.1	16																																																																																			-	RPS15A	-	-		0.448	RPS15A-005	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	RPS15A	HGNC	protein_coding	OTTHUMT00000435778.1	0	0	0	21	21	59	0.00	0.00	C	NM_001019		18800247	-1	12	42	15	60	tier1	no_errors	ENST00000573554	ensembl	human	known	74_37	rna	44.44	40.78	SNP	0.006	T	12	15
DNM1	1759	genome.wustl.edu	37	9	131001728	131001728	+	Missense_Mutation	SNP	T	T	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr9:131001728T>C	ENST00000372923.3	+	12	1519	c.1427T>C	c.(1426-1428)aTg>aCg	p.M476T	DNM1_ENST00000475805.1_Missense_Mutation_p.M476T|DNM1_ENST00000393594.3_Missense_Mutation_p.M476T|DNM1_ENST00000486160.1_Missense_Mutation_p.M476T|DNM1_ENST00000341179.7_Missense_Mutation_p.M476T	NM_004408.2	NP_004399.2	Q05193	DYN1_HUMAN	dynamin 1	476					endocytosis (GO:0006897)|endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)	extracellular vesicular exosome (GO:0070062)|membrane coat (GO:0030117)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(15)|lung(6)|ovary(2)|urinary_tract(2)	32						TTGAAGGTCATGCTTCTCATC	0.473													ENSG00000106976																									GBM(113;146 1575 2722 28670 29921)												0													384.0	384.0	384.0					9																	131001728		2203	4300	6503	SO:0001583	missense	0			-	L07807	CCDS6895.1, CCDS43882.1, CCDS75911.1, CCDS75912.1	9q34	2013-01-10			ENSG00000106976	ENSG00000106976		"""Pleckstrin homology (PH) domain containing"""	2972	protein-coding gene	gene with protein product		602377		DNM		2144893, 9143509	Standard	XM_005251763		Approved		uc022bob.1	Q05193	OTTHUMG00000020733	ENST00000372923.3:c.1427T>C	9.37:g.131001728T>C	ENSP00000362014:p.Met476Thr		A6NLM6|Q5SYX0|Q5SYX2|Q6P3T6|Q86VD2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin_SF	p.M476T	ENST00000372923.3	37	c.1427	CCDS6895.1	9	.	.	.	.	.	.	.	.	.	.	T	9.905	1.208010	0.22205	.	.	ENSG00000106976	ENST00000475805;ENST00000341179;ENST00000372923;ENST00000393589;ENST00000393594;ENST00000486160;ENST00000543158	T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62	4.54	4.54	0.55810	Dynamin central domain (1);Pleckstrin homology-type (1);	0.119478	0.64402	D	0.000014	T	0.49575	0.1565	N	0.05177	-0.1	0.54753	D	0.999988	B;B;B	0.27679	0.183;0.066;0.185	B;B;B	0.30105	0.111;0.068;0.091	T	0.47971	-0.9075	10	0.17832	T	0.49	-10.658	14.3224	0.66496	0.0:0.0:0.0:1.0	.	476;476;476	Q05193;Q05193-3;Q05193-2	DYN1_HUMAN;.;.	T	476;476;476;471;476;476;21	ENSP00000419225:M476T;ENSP00000345680:M476T;ENSP00000362014:M476T;ENSP00000377219:M476T;ENSP00000420045:M476T	ENSP00000345680:M476T	M	+	2	0	DNM1	130041549	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	5.728000	0.68531	2.025000	0.59659	0.460000	0.39030	ATG	-	DNM1	-	pfam_Dynamin_central		0.473	DNM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNM1	HGNC	protein_coding	OTTHUMT00000054367.1	0	0	0	33	33	76	0.00	0.00	T	NM_004408		131001728	+1	12	43	16	52	tier1	no_errors	ENST00000372923	ensembl	human	known	74_37	missense	42.86	45.26	SNP	1.000	C	12	16
LRP2	4036	genome.wustl.edu	37	2	170042037	170042037	+	Missense_Mutation	SNP	C	C	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr2:170042037C>T	ENST00000263816.3	-	50	10106	c.9821G>A	c.(9820-9822)aGt>aAt	p.S3274N		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3274					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TACAGCCAGACTTTCTGCAGC	0.348													ENSG00000081479																																					0													109.0	101.0	104.0					2																	170042037		2203	4300	6503	SO:0001583	missense	0			-		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.9821G>A	2.37:g.170042037C>T	ENSP00000263816:p.Ser3274Asn		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S3274N	ENST00000263816.3	37	c.9821	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	18.85	3.710362	0.68730	.	.	ENSG00000081479	ENST00000263816	D	0.91792	-2.91	5.91	5.91	0.95273	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.222050	0.52532	D	0.000077	D	0.91882	0.7430	L	0.55017	1.72	0.80722	D	1	P	0.40144	0.704	B	0.41666	0.363	D	0.91960	0.5578	10	0.72032	D	0.01	.	20.2936	0.98544	0.0:1.0:0.0:0.0	.	3274	P98164	LRP2_HUMAN	N	3274	ENSP00000263816:S3274N	ENSP00000263816:S3274N	S	-	2	0	LRP2	169750283	1.000000	0.71417	0.997000	0.53966	0.480000	0.33159	7.818000	0.86416	2.801000	0.96364	0.655000	0.94253	AGT	-	LRP2	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.348	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	0	0	0	65	65	62	0.00	0.00	C	NM_004525		170042037	-1	30	39	29	82	tier1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	50.85	32.23	SNP	1.000	T	30	29
GPR144	347088	genome.wustl.edu	37	9	127220913	127220913	+	Silent	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr9:127220913G>C	ENST00000334810.1	+	10	1704	c.1704G>C	c.(1702-1704)gtG>gtC	p.V568V				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	568					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						GCACCCAGGTGGGGTCAGCCA	0.617													ENSG00000180264																																					0													84.0	86.0	85.0					9																	127220913		692	1591	2283	SO:0001819	synonymous_variant	0			-	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1704G>C	9.37:g.127220913G>C			Q86SL4|Q8NH12	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_Pentaxin,prints_GPCR_2_secretin-like	p.V568	ENST00000334810.1	37	c.1704	CCDS48016.1	9																																																																																			-	GPR144	-	NULL		0.617	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	HGNC	protein_coding	OTTHUMT00000054026.2	0	0	0	44	44	108	0.00	0.00	G	NM_182611		127220913	+1	16	75	27	62	tier1	no_errors	ENST00000334810	ensembl	human	known	74_37	silent	37.21	54.74	SNP	1.000	C	16	27
EVPL	2125	genome.wustl.edu	37	17	74004699	74004699	+	Silent	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr17:74004699G>A	ENST00000301607.3	-	22	4840	c.4587C>T	c.(4585-4587)gaC>gaT	p.D1529D	EVPL_ENST00000586740.1_Silent_p.D1551D|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1529	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCAGGACGCGGTCCTTCTGCA	0.642													ENSG00000167880																																					0													127.0	95.0	106.0					17																	74004699		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.4587C>T	17.37:g.74004699G>A			A0AUV5	Silent	SNP	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.D1529	ENST00000301607.3	37	c.4587	CCDS11737.1	17																																																																																			-	EVPL	-	NULL		0.642	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	0	0	0	33	33	54	0.00	0.00	G	NM_001988		74004699	-1	27	27	31	44	tier1	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	46.55	38.03	SNP	1.000	A	27	31
F13A1	2162	genome.wustl.edu	37	6	6266904	6266904	+	Missense_Mutation	SNP	C	C	G			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr6:6266904C>G	ENST00000264870.3	-	4	723	c.458G>C	c.(457-459)tGt>tCt	p.C153S		NM_000129.3	NP_000120.2	P00488	F13A_HUMAN	coagulation factor XIII, A1 polypeptide	153					blood coagulation (GO:0007596)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	62	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)	CCCCACAATACATTTGGGGGA	0.493													ENSG00000124491																																					0													125.0	114.0	118.0					6																	6266904		2203	4300	6503	SO:0001583	missense	0			-	M14539	CCDS4496.1	6p24.2-p23	2014-01-24			ENSG00000124491	ENSG00000124491		"""Transglutaminases"""	3531	protein-coding gene	gene with protein product		134570		F13A			Standard	NM_000129		Approved		uc003mwv.3	P00488	OTTHUMG00000014186	ENST00000264870.3:c.458G>C	6.37:g.6266904C>G	ENSP00000264870:p.Cys153Ser		Q59HA7|Q8N6X2|Q96P24|Q9BX29	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.C153S	ENST00000264870.3	37	c.458	CCDS4496.1	6	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572628	0.65765	.	.	ENSG00000124491	ENST00000264870;ENST00000441301	D	0.86030	-2.06	5.65	5.65	0.86999	Immunoglobulin E-set (1);Transglutaminase, N-terminal (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.86871	0.6037	L	0.45352	1.415	0.58432	D	0.999998	P;D	0.63046	0.811;0.992	P;P	0.61658	0.455;0.892	D	0.86552	0.1835	10	0.49607	T	0.09	.	18.7279	0.91722	0.0:1.0:0.0:0.0	.	90;153	F5H080;P00488	.;F13A_HUMAN	S	153;90	ENSP00000264870:C153S	ENSP00000264870:C153S	C	-	2	0	F13A1	6211903	1.000000	0.71417	0.986000	0.45419	0.665000	0.39181	4.719000	0.61937	2.660000	0.90430	0.655000	0.94253	TGT	-	F13A1	-	pfam_Transglutaminase_N,superfamily_Ig_E-set		0.493	F13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13A1	HGNC	protein_coding	OTTHUMT00000039756.3	0	0	0	38	38	127	0.00	0.00	C	NM_000129		6266904	-1	18	61	0	12	tier1	no_errors	ENST00000264870	ensembl	human	known	74_37	missense	100.00	83.56	SNP	1.000	G	18	0
DEPDC1B	55789	genome.wustl.edu	37	5	59982797	59982797	+	Missense_Mutation	SNP	G	G	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr5:59982797G>T	ENST00000265036.5	-	2	373	c.306C>A	c.(304-306)caC>caA	p.H102Q	DEPDC1B_ENST00000545085.1_Missense_Mutation_p.H75Q|DEPDC1B_ENST00000453022.2_Missense_Mutation_p.H102Q	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	102	DEP. {ECO:0000255|PROSITE- ProRule:PRU00066}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				ACCTGTATAAGTGACGATTGT	0.413													ENSG00000035499																																					0													254.0	251.0	252.0					5																	59982797		2203	4300	6503	SO:0001583	missense	0			-	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.306C>A	5.37:g.59982797G>T	ENSP00000265036:p.His102Gln		A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	pfam_DEP_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_DEP_dom,pfscan_DEP_dom,pfscan_RhoGAP_dom	p.H102Q	ENST00000265036.5	37	c.306	CCDS3977.1	5	.	.	.	.	.	.	.	.	.	.	G	0.721	-0.783452	0.02907	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.21734	1.99;1.99;1.99	5.54	2.19	0.27852	DEP domain (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.314266	0.39687	N	0.001289	T	0.07143	0.0181	N	0.04880	-0.145	0.09310	N	0.999991	B;B	0.10296	0.0;0.003	B;B	0.14023	0.001;0.01	T	0.26155	-1.0111	9	.	.	.	-10.548	1.5156	0.02505	0.145:0.1587:0.3738:0.3224	.	102;102	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	Q	102;102;75	ENSP00000265036:H102Q;ENSP00000389101:H102Q;ENSP00000438320:H75Q	.	H	-	3	2	DEPDC1B	60018554	0.000000	0.05858	0.994000	0.49952	0.971000	0.66376	-0.128000	0.10531	0.654000	0.30846	0.561000	0.74099	CAC	-	DEPDC1B	-	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom		0.413	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC1B	HGNC	protein_coding	OTTHUMT00000214207.1	0	0	0	31	31	112	0.00	0.00	G	NM_018369		59982797	-1	15	59	17	100	tier1	no_errors	ENST00000265036	ensembl	human	known	74_37	missense	46.88	37.11	SNP	0.188	T	15	17
SMG8	55181	genome.wustl.edu	37	17	57288309	57288309	+	Silent	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr17:57288309G>A	ENST00000543872.2	+	2	1161	c.897G>A	c.(895-897)agG>agA	p.R299R	SMG8_ENST00000578922.1_Silent_p.R299R|CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Silent_p.R299R|SMG8_ENST00000580498.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	299					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						CCAAAAGGAGGCTGCAGCATG	0.502													ENSG00000167447																																					0													65.0	66.0	66.0					17																	57288309		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.897G>A	17.37:g.57288309G>A			Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Silent	SNP	pfam_Smg8/Smg9	p.R299	ENST00000543872.2	37	c.897	CCDS11615.1	17																																																																																			-	SMG8	-	pfam_Smg8/Smg9		0.502	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	0	0	0	33	33	88	0.00	0.00	G	NM_018149		57288309	+1	20	63	29	56	tier1	no_errors	ENST00000300917	ensembl	human	known	74_37	silent	40.82	52.94	SNP	0.996	A	20	29
TMEM91	641649	genome.wustl.edu	37	19	41884369	41884369	+	Missense_Mutation	SNP	C	C	G	rs376478364		TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:41884369C>G	ENST00000392002.2	+	2	815	c.155C>G	c.(154-156)cCg>cGg	p.P52R	TMEM91_ENST00000544232.1_Missense_Mutation_p.P52R|TMEM91_ENST00000539627.1_Missense_Mutation_p.P52R|BCKDHA_ENST00000595085.1_Missense_Mutation_p.P52R|TMEM91_ENST00000542945.1_Missense_Mutation_p.P52R|TMEM91_ENST00000413014.2_Missense_Mutation_p.P52R|TMEM91_ENST00000447302.2_Missense_Mutation_p.P52R|CTC-435M10.3_ENST00000604424.1_Intron|CTC-435M10.3_ENST00000540732.1_Missense_Mutation_p.P52R|TMEM91_ENST00000604123.1_Missense_Mutation_p.P109R|TMEM91_ENST00000436170.2_Missense_Mutation_p.P52R|TMEM91_ENST00000356385.4_Missense_Mutation_p.P52R	NM_001098821.1	NP_001092291.1	Q6ZNR0	TMM91_HUMAN	transmembrane protein 91	52					hematopoietic progenitor cell differentiation (GO:0002244)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	5						TTCCTGTCACCGCCTCTTCCC	0.632													ENSG00000248098																																					0													59.0	62.0	61.0					19																	41884369		1907	4122	6029	SO:0001583	missense	0			-	AK130820, BC063705	CCDS42571.1, CCDS42572.1, CCDS46082.1, CCDS46083.1, CCDS46084.1	19q13.2	2009-10-16							32393	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 6"""					12477932	Standard	NM_001098824		Approved	FLJ27310, IFITMD6		Q6ZNR0		ENST00000392002.2:c.155C>G	19.37:g.41884369C>G	ENSP00000375859:p.Pro52Arg		C9J9D1|C9JZ62|C9K046|Q6P434	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase_N	p.P52R	ENST00000392002.2	37	c.155	CCDS42571.1	19	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022439	0.35701	.	.	ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000142046;ENSG00000255730	ENST00000539627;ENST00000413014;ENST00000392002;ENST00000436170;ENST00000447302;ENST00000544232;ENST00000542945;ENST00000537354;ENST00000342187;ENST00000356385;ENST00000546050;ENST00000540732	D;D	0.99470	-4.68;-5.96	4.44	2.32	0.28847	.	0.426837	0.24671	N	0.036547	D	0.97867	0.9299	L	0.27053	0.805	0.24101	N	0.995875	P;P;P;D;P;P;D	0.57571	0.938;0.938;0.938;0.966;0.57;0.662;0.98	P;P;P;P;B;B;P	0.54590	0.478;0.478;0.478;0.652;0.328;0.422;0.756	D	0.94955	0.8103	10	0.17369	T	0.5	.	6.16	0.20358	0.0:0.7761:0.0:0.2239	.	52;52;52;52;52;52;52	C9J9D1;C9JZ62;C9K046;Q6P434;F5H5P2;Q6ZNR0;F5GWC9	.;.;.;.;.;TMM91_HUMAN;.	R	52;52;52;52;52;52;52;52;52;52;38;52	ENSP00000375859:P52R;ENSP00000443246:P52R	ENSP00000443246:P52R	P	+	2	0	CTC-435M10.3;TMEM91	46576209	0.111000	0.22076	0.876000	0.34364	0.276000	0.26787	0.187000	0.16998	1.238000	0.43771	0.561000	0.74099	CCG	-	BCKDHA	-	NULL		0.632	TMEM91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCKDHA	HGNC	protein_coding	OTTHUMT00000398302.2	0	0	0	33	33	86	0.00	0.00	C			41884369	+1	23	52	28	40	tier1	no_errors	ENST00000595085	ensembl	human	known	74_37	missense	45.10	56.52	SNP	0.644	G	23	28
PTCHD1	139411	genome.wustl.edu	37	X	23410954	23410954	+	Missense_Mutation	SNP	T	T	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chrX:23410954T>A	ENST00000379361.4	+	3	2179	c.1319T>A	c.(1318-1320)tTc>tAc	p.F440Y		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	440					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						CATAGTATCTTCTGTAGAAAA	0.463													ENSG00000165186																																					0													79.0	81.0	80.0					X																	23410954		2203	4300	6503	SO:0001583	missense	0			-	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1319T>A	X.37:g.23410954T>A	ENSP00000368666:p.Phe440Tyr		B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.F440Y	ENST00000379361.4	37	c.1319	CCDS35215.2	X	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690507	0.48097	.	.	ENSG00000165186	ENST00000379361	D	0.86230	-2.09	5.82	3.36	0.38483	.	0.103352	0.64402	D	0.000002	D	0.86422	0.5929	L	0.52573	1.65	0.42608	D	0.993304	P	0.38167	0.621	P	0.48304	0.573	T	0.82615	-0.0370	10	0.51188	T	0.08	.	7.8567	0.29487	0.0:0.0722:0.1363:0.7915	.	440	Q96NR3	PTHD1_HUMAN	Y	440	ENSP00000368666:F440Y	ENSP00000368666:F440Y	F	+	2	0	PTCHD1	23320875	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.836000	0.62789	0.279000	0.22186	0.486000	0.48141	TTC	-	PTCHD1	-	pfam_Patched		0.463	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD1	HGNC	protein_coding	OTTHUMT00000056047.2	0	0	0	21	21	76	0.00	0.00	T	NM_173495		23410954	+1	20	71	16	78	tier1	no_errors	ENST00000379361	ensembl	human	known	74_37	missense	55.56	47.65	SNP	1.000	A	20	16
PSG9	5678	genome.wustl.edu	37	19	43763053	43763053	+	Missense_Mutation	SNP	C	C	T	rs147249563	byFrequency	TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:43763053C>T	ENST00000270077.3	-	4	1040	c.944G>A	c.(943-945)cGa>cAa	p.R315Q	PSG9_ENST00000418820.2_Missense_Mutation_p.R222Q|PSG9_ENST00000596730.1_Intron|PSG9_ENST00000593948.1_Intron|PSG9_ENST00000443718.3_Missense_Mutation_p.R222Q|PSG9_ENST00000291752.5_Intron|PSG9_ENST00000244293.7_Intron	NM_002784.3	NP_002775.3	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	315	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GCCACCATATCGGTCCCGTAT	0.493													ENSG00000183668																																					0								C	GLN/ARG	0,4276		0,0,2138	113.0	116.0	115.0		944	0.1	0.0	19	dbSNP_134	115	6,8560		0,6,4277	no	missense	PSG9	NM_002784.3	43	0,6,6415	TT,TC,CC		0.07,0.0,0.0467	benign	315/427	43763053	6,12836	2138	4283	6421	SO:0001583	missense	0			-	M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000270077.3:c.944G>A	19.37:g.43763053C>T	ENSP00000270077:p.Arg315Gln		B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R315Q	ENST00000270077.3	37	c.944	CCDS12618.1	19	.	.	.	.	.	.	.	.	.	.	N	8.758	0.922806	0.18056	0.0	7.0E-4	ENSG00000183668	ENST00000270077;ENST00000443718;ENST00000435220	T;T	0.12039	2.72;2.72	1.39	0.099	0.14501	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.07728	0.0194	N	0.19112	0.55	0.09310	N	1	B;B	0.19583	0.037;0.027	B;B	0.19391	0.013;0.025	T	0.39143	-0.9628	9	0.30854	T	0.27	.	5.2805	0.15673	0.0:0.3826:0.6174:0.0	.	222;315	E7EW65;Q00887	.;PSG9_HUMAN	Q	315;222;276	ENSP00000270077:R315Q;ENSP00000396753:R222Q	ENSP00000270077:R315Q	R	-	2	0	PSG9	48454893	0.001000	0.12720	0.001000	0.08648	0.008000	0.06430	0.346000	0.19997	-0.114000	0.11936	0.194000	0.17425	CGA	rs147249563	PSG9	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.493	PSG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG9	HGNC	protein_coding	OTTHUMT00000323065.1	0	0	0	145	145	33	0.00	0.00	C	NM_002784		43763053	-1	92	9	84	13	tier1	no_errors	ENST00000270077	ensembl	human	known	74_37	missense	52.27	40.91	SNP	0.002	T	92	84
ROBO1	6091	genome.wustl.edu	37	3	79633761	79633762	+	Intron	DEL	GT	GT	-	rs143360306|rs373463590		TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	GT	GT	GT	-	GT	GT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr3:79633761_79633762delGT	ENST00000464233.1	-	2	202				AC117479.1_ENST00000401297.1_RNA	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		AGgtgggtgagtgtgtgtgtgt	0.396													ENSG00000216116																																					0																																										SO:0001627	intron_variant	0				AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.88+5211AC>-	3.37:g.79633771_79633772delGT			B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	R	DEL	-	NULL	ENST00000464233.1	37	NULL	CCDS54611.1	3																																																																																				AC117479.1	-	-		0.396	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216116	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000352610.1	0	0	0	18	18	26	0.00	0.00	GT	NM_002941		79633762	-1	5	8	17	56	tier1	no_errors	ENST00000401297	ensembl	human	novel	74_37	rna	22.73	12.50	DEL	0.001:0.000	-	5	17
TOR1AIP1	26092	genome.wustl.edu	37	1	179887358	179887358	+	Frame_Shift_Del	DEL	G	G	-			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:179887358delG	ENST00000606911.2	+	10	1927	c.1736delG	c.(1735-1737)aggfs	p.R579fs	TOR1AIP1_ENST00000528443.2_Frame_Shift_Del_p.R580fs|TOR1AIP1_ENST00000271583.3_Frame_Shift_Del_p.R595fs|TOR1AIP1_ENST00000435319.4_Frame_Shift_Del_p.R458fs			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	579	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						GCCCTGAAAAGGGGCATCTGC	0.433													ENSG00000143337																																					0													38.0	41.0	40.0					1																	179887358		2202	4295	6497	SO:0001589	frameshift_variant	0					CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1736delG	1.37:g.179887358delG	ENSP00000476687:p.Arg579fs		A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Frame_Shift_Del	DEL	pfam_Lamina-ass_polypeptide_CLAP1C	p.G581fs	ENST00000606911.2	37	c.1739	CCDS1335.1	1																																																																																				TOR1AIP1	-	pfam_Lamina-ass_polypeptide_CLAP1C		0.433	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOR1AIP1	HGNC	protein_coding	OTTHUMT00000100313.4	0	0	0	9	9	70	0.00	0.00	G	NM_015602		179887358	+1	15	50	6	74	tier1	no_errors	ENST00000528443	ensembl	human	known	74_37	frame_shift_del	71.43	40.32	DEL	0.000	-	15	6
TMIE	259236	genome.wustl.edu	37	3	46751074	46751076	+	In_Frame_Del	DEL	AAG	AAG	-	rs552239745|rs397817178|rs10578999|rs372639803|rs544504092|rs538183178|rs71619660|rs75020261	byFrequency	TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	AAG	AAG	AAG	-	AAG	AAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr3:46751074_46751076delAAG	ENST00000326431.3	+	4	522_524	c.367_369delAAG	c.(367-369)aagdel	p.K131del		NM_147196.2	NP_671729.2	Q8NEW7	TMIE_HUMAN	transmembrane inner ear	131	Lys-rich.			Missing (in Ref. 1; AAL89820 and 4; AAI26259/AAI26261). {ECO:0000305}.	inner ear morphogenesis (GO:0042472)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				endometrium(1)|lung(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000688)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		CACAGAGGATaagaagaagaaga	0.502													ENSG00000181585																																					0																																										SO:0001651	inframe_deletion	0				AY081842	CCDS43081.1	3p21	2010-01-06	2004-05-19		ENSG00000181585	ENSG00000181585			30800	protein-coding gene	gene with protein product		607237	"""deafness, autosomal recessive 6"""	DFNB6		12140191, 12145746	Standard	NM_147196		Approved		uc010hjk.1	Q8NEW7	OTTHUMG00000149909	ENST00000326431.3:c.367_369delAAG	3.37:g.46751083_46751085delAAG	ENSP00000324775:p.Lys131del		A0AV93|A8K0R0	In_Frame_Del	DEL	NULL	p.K126in_frame_del	ENST00000326431.3	37	c.367_369	CCDS43081.1	3																																																																																				TMIE	-	NULL		0.502	TMIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMIE	HGNC	protein_coding	OTTHUMT00000313853.1	0	0	0	29	29	32	0.00	0.00	AAG	NM_147196		46751076	+1	4	9	24	81	tier1	no_errors	ENST00000326431	ensembl	human	known	74_37	in_frame_del	14.29	10.00	DEL	0.074:0.151:0.294	-	4	24
C10orf71	118461	genome.wustl.edu	37	10	50534397	50534397	+	Silent	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr10:50534397G>A	ENST00000374144.3	+	3	4095	c.3807G>A	c.(3805-3807)gcG>gcA	p.A1269A	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	1269				A -> T (in Ref. 2; AL833265). {ECO:0000305}.						endometrium(1)	1						CCCTGCCCGCGTACCCCGCCA	0.667													ENSG00000177354																																					0													3.0	6.0	5.0					10																	50534397		624	1495	2119	SO:0001819	synonymous_variant	0			-	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.3807G>A	10.37:g.50534397G>A			A0AVL8	Silent	SNP	NULL	p.A1269	ENST00000374144.3	37	c.3807	CCDS44387.1	10																																																																																			-	C10orf71	-	NULL		0.667	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	0	0	0	103	103	31	0.00	0.00	G	NM_199459		50534397	+1	42	19	4	4	tier1	no_errors	ENST00000374144	ensembl	human	known	74_37	silent	91.30	82.61	SNP	0.136	A	42	4
HOXC13	3229	genome.wustl.edu	37	12	54333237	54333237	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr12:54333237C>T	ENST00000243056.3	+	1	703	c.547C>T	c.(547-549)Cag>Tag	p.Q183*	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	183					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CAGCTCCTACCAGGCGATGCC	0.687			T	NUP98	AML								ENSG00000123364																												Dom	yes		12	12q13.3	3229	homeo box C13		L	0													20.0	21.0	21.0					12																	54333237		2198	4293	6491	SO:0001587	stop_gained	0			-		CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.547C>T	12.37:g.54333237C>T	ENSP00000243056:p.Gln183*		Q5BL02|Q96J32|Q9NR24|Q9NYD5	Nonsense_Mutation	SNP	pfam_Homeobox_dom,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Q183*	ENST00000243056.3	37	c.547	CCDS8865.1	12	.	.	.	.	.	.	.	.	.	.	C	37	6.454397	0.97581	.	.	ENSG00000123364	ENST00000243056	.	.	.	2.87	2.87	0.33458	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.6314	0.62198	0.0:1.0:0.0:0.0	.	.	.	.	X	183	.	ENSP00000243056:Q183X	Q	+	1	0	HOXC13	52619504	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.070000	0.76763	1.955000	0.56771	0.313000	0.20887	CAG	-	HOXC13	-	NULL		0.687	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	HGNC	protein_coding	OTTHUMT00000358865.2	0	0	0	33	33	39	0.00	0.00	C			54333237	+1	29	13	7	1	tier1	no_errors	ENST00000243056	ensembl	human	known	74_37	nonsense	80.56	92.86	SNP	1.000	T	29	7
PIEZO1	9780	genome.wustl.edu	37	16	88808709	88808709	+	Splice_Site	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr16:88808709G>A	ENST00000301015.9	-	3	528	c.282C>T	c.(280-282)agC>agT	p.S94S	RP5-1142A6.7_ENST00000566114.1_RNA|RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.8_ENST00000567588.1_RNA|RP5-1142A6.8_ENST00000333666.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	94					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GCGACTCACAGCTGGGTCCCA	0.672													ENSG00000103335																																					0													29.0	37.0	35.0					16																	88808709		692	1590	2282	SO:0001630	splice_region_variant	0			-	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.283+1C>T	16.37:g.88808709G>A			A6NHT9|A7E2B7|Q0KKZ9	Silent	SNP	pfam_Piezo	p.S94	ENST00000301015.9	37	c.282	CCDS54058.1	16																																																																																			-	PIEZO1	-	NULL		0.672	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	0	0	0	42	42	20	0.00	0.00	G	NM_014745	Silent	88808709	-1	21	12	6	1	tier1	no_errors	ENST00000301015	ensembl	human	novel	74_37	silent	77.78	85.71	SNP	0.990	A	21	6
POU3F2	5454	genome.wustl.edu	37	6	99283560	99283560	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr6:99283560G>A	ENST00000328345.5	+	1	981	c.811G>A	c.(811-813)Gag>Aag	p.E271K		NM_005604.3	NP_005595.2	P20265	PO3F2_HUMAN	POU class 3 homeobox 2	271	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				astrocyte development (GO:0014002)|cellular response to organic substance (GO:0071310)|cerebral cortex radially oriented cell migration (GO:0021799)|epidermis development (GO:0008544)|forebrain ventricular zone progenitor cell division (GO:0021869)|hypothalamus cell differentiation (GO:0021979)|myelination in peripheral nervous system (GO:0022011)|neurohypophysis development (GO:0021985)|neuron differentiation (GO:0030182)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of axonogenesis (GO:0050770)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	identical protein binding (GO:0042802)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(5)	10		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		GGACGACCTGGAGCAGTTCGC	0.697													ENSG00000184486																																					0													104.0	111.0	108.0					6																	99283560		2203	4300	6503	SO:0001583	missense	0			-	Z11933	CCDS5040.1	6q16.2	2011-06-20	2007-07-13		ENSG00000184486	ENSG00000184486		"""Homeoboxes / POU class"""	9215	protein-coding gene	gene with protein product		600494	"""POU domain class 3, transcription factor 2"""	OTF7		8441633	Standard	NM_005604		Approved	POUF3, BRN2, OCT7	uc003ppe.3	P20265	OTTHUMG00000015258	ENST00000328345.5:c.811G>A	6.37:g.99283560G>A	ENSP00000329170:p.Glu271Lys		Q14960|Q86V54|Q9UJL0	Missense_Mutation	SNP	pirsf_Transcription_factor_POU,pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_D-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.E271K	ENST00000328345.5	37	c.811	CCDS5040.1	6	.	.	.	.	.	.	.	.	.	.	G	25.1	4.603689	0.87157	.	.	ENSG00000184486	ENST00000328345;ENST00000425116	T	0.71817	-0.6	3.93	3.93	0.45458	POU-specific (3);Lambda repressor-like, DNA-binding (2);	0.000000	0.64402	U	0.000003	T	0.78317	0.4264	M	0.66378	2.025	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.81858	-0.0739	10	0.87932	D	0	.	14.8953	0.70639	0.0:0.0:1.0:0.0	.	271	P20265	PO3F2_HUMAN	K	271;204	ENSP00000329170:E271K	ENSP00000329170:E271K	E	+	1	0	POU3F2	99390281	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.459000	0.97638	2.019000	0.59389	0.305000	0.20034	GAG	-	POU3F2	-	pirsf_Transcription_factor_POU,pfam_POU_specific,superfamily_Lambda_D-bd_dom,smart_POU_specific,pfscan_POU_specific		0.697	POU3F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU3F2	HGNC	protein_coding	OTTHUMT00000041586.2	0	0	0	54	54	25	0.00	0.00	G			99283560	+1	32	21	13	4	tier1	no_errors	ENST00000328345	ensembl	human	known	74_37	missense	71.11	84.00	SNP	1.000	A	32	13
PTEN	5728	genome.wustl.edu	37	10	89653790	89653790	+	Frame_Shift_Del	DEL	C	C	-			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr10:89653790delC	ENST00000371953.3	+	2	1445	c.88delC	c.(88-90)ccafs	p.P30fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	30	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(3)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGATATTTATCCAAACATTAT	0.294		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			ENSG00000171862																											yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	48	Whole gene deletion(37)|Unknown(8)|Deletion - Frameshift(3)	prostate(14)|central_nervous_system(8)|skin(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|ovary(3)|breast(2)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|NS(1)|kidney(1)											98.0	99.0	99.0					10																	89653790		2203	4293	6496	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.		U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.88delC	10.37:g.89653790delC	ENSP00000361021:p.Pro30fs		B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Del	DEL	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.P30fs	ENST00000371953.3	37	c.88	CCDS31238.1	10																																																																																				PTEN	-	smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ		0.294	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	0	0	0	39	39	33	0.00	0.00	C	NM_000314		89653790	+1	19	33	4	6	tier1	no_errors	ENST00000371953	ensembl	human	known	74_37	frame_shift_del	82.61	84.62	DEL	1.000	-	19	4
SH3TC1	54436	genome.wustl.edu	37	4	8229906	8229906	+	Missense_Mutation	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr4:8229906G>C	ENST00000245105.3	+	12	2552	c.2485G>C	c.(2485-2487)Gtg>Ctg	p.V829L	SH3TC1_ENST00000539824.1_Missense_Mutation_p.V753L	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	829										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GGACCACCTGGTGGCCCTGGC	0.662													ENSG00000125089																									NSCLC(145;2298 2623 35616 37297)												0													40.0	36.0	38.0					4																	8229906		2203	4299	6502	SO:0001583	missense	0			-	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.2485G>C	4.37:g.8229906G>C	ENSP00000245105:p.Val829Leu		Q4W5G5	Missense_Mutation	SNP	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.V829L	ENST00000245105.3	37	c.2485	CCDS3399.1	4	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.894248	0.00522	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.71579	-0.58;-0.58	4.32	1.53	0.23141	Tetratricopeptide-like helical (1);	0.377447	0.26979	N	0.021535	T	0.46833	0.1413	L	0.29908	0.895	0.22468	N	0.999074	B	0.13145	0.007	B	0.15052	0.012	T	0.18587	-1.0332	10	0.07325	T	0.83	-24.017	2.9812	0.05954	0.1553:0.1402:0.5598:0.1448	.	829	Q8TE82	S3TC1_HUMAN	L	567;829;753;658	ENSP00000245105:V829L;ENSP00000441045:V753L	ENSP00000245105:V829L	V	+	1	0	SH3TC1	8280806	0.999000	0.42202	0.758000	0.31321	0.008000	0.06430	0.850000	0.27737	0.276000	0.22118	-0.361000	0.07541	GTG	-	SH3TC1	-	NULL		0.662	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2	0	0	0	27	27	22	0.00	0.00	G	NM_018986		8229906	+1	18	10	2	1	tier1	no_errors	ENST00000245105	ensembl	human	known	74_37	missense	90.00	90.91	SNP	0.598	C	18	2
TP53	7157	genome.wustl.edu	37	17	7578176	7578176	+	Splice_Site	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr17:7578176C>A	ENST00000269305.4	-	6	862		c.e6+1		TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(56)|p.0?(8)|p.V225fs*24(1)|p.E224_V225insXX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCAAACCAGACCTCAGGCGGC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	66	Unknown(56)|Whole gene deletion(8)|Insertion - In frame(1)|Insertion - Frameshift(1)	ovary(12)|upper_aerodigestive_tract(10)|lung(8)|biliary_tract(5)|endometrium(5)|large_intestine(4)|oesophagus(4)|bone(4)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|cervix(1)|soft_tissue(1)|skin(1)|pancreas(1)	GRCh37	CS071266	TP53	S							80.0	75.0	77.0					17																	7578176		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.672+1G>T	17.37:g.7578176C>A			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5+1	ENST00000269305.4	37	c.672+1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.964220	0.74131	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	.	.	.	5.28	4.29	0.51040	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.205	0.59790	0.1605:0.8394:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7518901	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.775000	0.85489	1.321000	0.45227	0.563000	0.77884	.	-	TP53	-	-		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	37	37	127	0.00	0.00	C	NM_000546	Intron	7578176	-1	35	54	2	7	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site	94.59	88.52	SNP	1.000	A	35	2
TRPM3	80036	genome.wustl.edu	37	9	73376522	73376522	+	Nonsense_Mutation	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr9:73376522C>A	ENST00000377111.2	-	8	1510	c.1267G>T	c.(1267-1269)Gaa>Taa	p.E423*	TRPM3_ENST00000377105.1_Nonsense_Mutation_p.E270*|TRPM3_ENST00000396292.4_Nonsense_Mutation_p.E295*|TRPM3_ENST00000357533.2_Nonsense_Mutation_p.E425*|TRPM3_ENST00000377106.1_Nonsense_Mutation_p.E295*|TRPM3_ENST00000423814.3_Nonsense_Mutation_p.E450*|TRPM3_ENST00000377110.3_Nonsense_Mutation_p.E423*|TRPM3_ENST00000377101.1_Nonsense_Mutation_p.E270*|TRPM3_ENST00000396280.5_Nonsense_Mutation_p.E270*|TRPM3_ENST00000396285.1_Nonsense_Mutation_p.E270*|TRPM3_ENST00000360823.2_Nonsense_Mutation_p.E295*|TRPM3_ENST00000358082.3_Nonsense_Mutation_p.E295*|TRPM3_ENST00000408909.2_Nonsense_Mutation_p.E270*	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	448					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CCTACCAATTCCTTCTTCTTC	0.438													ENSG00000083067																																					0													120.0	103.0	109.0					9																	73376522		2203	4300	6503	SO:0001587	stop_gained	0			-	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.1267G>T	9.37:g.73376522C>A	ENSP00000366315:p.Glu423*		A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Nonsense_Mutation	SNP	pfam_Ion_trans_dom	p.E450*	ENST00000377111.2	37	c.1348		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.137162|8.137162	0.98672|0.98672	.|.	.|.	ENSG00000083067|ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814;ENST00000377101|ENST00000396280	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.243127|.	0.38548|.	N|.	0.001648|.	.|T	.|0.81302	.|0.4794	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.78306	.|-0.2255	.|3	0.66056|.	D|.	0.02|.	-23.0783|-23.0783	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|V	423;423;295;295;270;425;270;270;295;295;450;270|269	.|.	ENSP00000350140:E425X|.	E|G	-|-	1|2	0|0	TRPM3|TRPM3	72566342|72566342	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.965000|0.965000	0.64279|0.64279	5.683000|5.683000	0.68189|0.68189	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|GGA	-	TRPM3	-	NULL		0.438	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	0	0	0	41	41	119	0.00	0.00	C	NM_206945		73376522	-1	4	15	36	182	tier1	no_errors	ENST00000423814	ensembl	human	known	74_37	nonsense	10.00	7.58	SNP	1.000	A	4	36
ZZZ3	26009	genome.wustl.edu	37	1	78030138	78030139	+	IGR	INS	-	-	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:78030138_78030139insA	ENST00000370801.3	-	0	4328				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TTAACACTGGTAAAAAAAAAAA	0.282													ENSG00000036549																																					0																																										SO:0001628	intergenic_variant	0				AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652		1.37:g.78030149_78030149dupA			B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	R	INS	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																				ZZZ3	-	-		0.282	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	HGNC	protein_coding	OTTHUMT00000026615.1	0	0	1	15	15	50	0.00	1.96	-	NM_015534		78030139	-1	6	8	24	103	tier1	no_errors	ENST00000481346	ensembl	human	known	74_37	rna	20.00	7.21	INS	0.012:0.000	A	6	24
F12	2161	genome.wustl.edu	37	5	176830374	176830374	+	Missense_Mutation	SNP	G	G	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr5:176830374G>A	ENST00000253496.3	-	12	1460	c.1412C>T	c.(1411-1413)gCg>gTg	p.A471V	PFN3_ENST00000358571.2_5'Flank|F12_ENST00000514943.1_5'UTR	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	471	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	GCTGCCGTCCGCATCCTCCTG	0.741									Hereditary Angioedema				ENSG00000131187																																					0													18.0	22.0	21.0					5																	176830374		2199	4292	6491	SO:0001583	missense	0	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	-	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1412C>T	5.37:g.176830374G>A	ENSP00000253496:p.Ala471Val		P78339	Missense_Mutation	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,pfam_Kringle,pfam_FN_type2_col-bd,pfam_EG-like_dom,pfam_Fibronectin_type1,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1	p.A471V	ENST00000253496.3	37	c.1412	CCDS34302.1	5	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784699	0.49997	.	.	ENSG00000131187	ENST00000253496	D	0.86097	-2.07	5.31	-0.981	0.10269	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.193700	0.06134	N	0.671207	T	0.67097	0.2857	N	0.04116	-0.275	0.09310	N	0.999996	P	0.39520	0.676	B	0.32289	0.143	T	0.52939	-0.8508	10	0.21540	T	0.41	.	13.8523	0.63504	0.0:0.0:0.2247:0.7753	.	471	P00748	FA12_HUMAN	V	471	ENSP00000253496:A471V	ENSP00000253496:A471V	A	-	2	0	F12	176762980	0.000000	0.05858	0.000000	0.03702	0.830000	0.47004	0.162000	0.16501	-0.073000	0.12842	0.491000	0.48974	GCG	-	F12	-	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1		0.741	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F12	HGNC	protein_coding	OTTHUMT00000373217.1	0	0	0	41	41	15	0.00	0.00	G			176830374	-1	4	0	36	8	tier1	no_errors	ENST00000253496	ensembl	human	known	74_37	missense	10.00	0.00	SNP	0.000	A	4	36
NEFM	4741	genome.wustl.edu	37	8	24772312	24772312	+	Missense_Mutation	SNP	G	G	A	rs56902012		TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr8:24772312G>A	ENST00000221166.5	+	1	1788	c.1006G>A	c.(1006-1008)Ggc>Agc	p.G336S	RP11-624C23.1_ENST00000519689.1_RNA|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000518131.1_Missense_Mutation_p.G336S|NEFM_ENST00000433454.2_5'Flank|NEFM_ENST00000437366.2_Missense_Mutation_p.G336S|NEFM_ENST00000521540.1_3'UTR			P07197	NFM_HUMAN	neurofilament, medium polypeptide	336	Coil 2B.|Rod.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		GTCGGTGCGCGGCACCAAGGA	0.667													ENSG00000104722	G|||	1	0.000199681	0.0	0.0	5008	,	,		14723	0.0		0.001	False		,,,				2504	0.0																0			GRCh37	CM023104	NEFM	M	rs56902012	G	SER/GLY	0,4406		0,0,2203	13.0	14.0	14.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1006	4.7	1.0	8	dbSNP_129	14	7,8589		0,7,4291	no	missense	NEFM	NM_005382.2	56	0,7,6494	AA,AG,GG		0.0814,0.0,0.0538	probably-damaging	336/917	24772312	7,12995	2203	4298	6501	SO:0001583	missense	0			-	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1006G>A	8.37:g.24772312G>A	ENSP00000221166:p.Gly336Ser		B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	pfam_IF,pfam_Intermed_filament_D-bd,superfamily_Prefoldin,prints_Keratin_I	p.G336S	ENST00000221166.5	37	c.1006	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958201	0.92726	0.0	8.14E-4	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366	D;D;D	0.88046	-2.33;-2.33;-2.33	4.69	4.69	0.59074	Filament (1);	0.000000	0.46145	D	0.000316	D	0.88551	0.6467	N	0.17278	0.47	0.80722	D	1	D;D	0.89917	0.988;1.0	P;D	0.78314	0.894;0.991	D	0.91038	0.4869	10	0.87932	D	0	.	18.0369	0.89307	0.0:0.0:1.0:0.0	rs56902012	336;336	E7EMV2;P07197	.;NFM_HUMAN	S	336	ENSP00000221166:G336S;ENSP00000427872:G336S;ENSP00000410137:G336S	ENSP00000221166:G336S	G	+	1	0	NEFM	24828217	1.000000	0.71417	0.999000	0.59377	0.830000	0.47004	7.918000	0.87506	2.323000	0.78572	0.461000	0.40582	GGC	rs56902012	NEFM	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I		0.667	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	HGNC	protein_coding	OTTHUMT00000254954.2	0	0	0	18	18	6	0.00	0.00	G	NM_005382		24772312	+1	12	0	11	3	tier1	no_errors	ENST00000221166	ensembl	human	known	74_37	missense	52.17	0.00	SNP	1.000	A	12	11
GPR125	166647	genome.wustl.edu	37	4	22517302	22517304	+	In_Frame_Del	DEL	CGC	CGC	-			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	CGC	CGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr4:22517302_22517304delCGC	ENST00000334304.5	-	1	373_375	c.104_106delGCG	c.(103-108)ggcgcc>gcc	p.G35del	GPR125_ENST00000502482.1_In_Frame_Del_p.G35del	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	35					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				agcgccgcggcgccgccgccgcc	0.808													ENSG00000152990																																					0																																										SO:0001651	inframe_deletion	0				AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.104_106delGCG	4.37:g.22517311_22517313delCGC	ENSP00000334952:p.Gly35del		Q6UXK9|Q86SQ5|Q8TC55	In_Frame_Del	DEL	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.G35in_frame_del	ENST00000334304.5	37	c.106_104	CCDS33964.1	4																																																																																				GPR125	-	NULL		0.808	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	0	0	0	46	46	0	0.00	0.00	CGC			22517304	-1	3	0	27	1	tier1	no_errors	ENST00000334304	ensembl	human	known	74_37	in_frame_del	10.00	0.00	DEL	0.040:0.037:0.033	-	3	27
GRAMD1A	57655	genome.wustl.edu	37	19	35491315	35491319	+	5'UTR	DEL	CCGCG	CCGCG	-			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	CCGCG	CCGCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr19:35491315_35491319delCCGCG	ENST00000317991.5	+	0	125_129				GRAMD1A_ENST00000504615.2_5'UTR|CTD-2527I21.7_ENST00000600959.1_RNA|GRAMD1A_ENST00000411896.2_5'Flank|GRAMD1A_ENST00000424536.2_5'Flank|GRAMD1A_ENST00000599564.1_Intron	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A							integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CAgcccagccccgcgcagcccagcc	0.78													ENSG00000089351																																					0									,	21,729		9,3,363					,	2.5	1.0		dbSNP_102	1	63,1509		21,21,744	no	utr-5,utr-5	GRAMD1A	NM_020895.3,NM_001136199.1	,	30,24,1107	A1A1,A1R,RR		4.0076,2.8,3.6176	,	,		84,2238				SO:0001623	5_prime_UTR_variant	0				AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.-64CCGCG>-	19.37:g.35491315_35491319delCCGCG			A6NKY7|Q8NC77|Q9P1Z5	R	DEL	-	NULL	ENST00000317991.5	37	NULL	CCDS42546.1	19																																																																																				GRAMD1A	-	-		0.780	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	HGNC	protein_coding	OTTHUMT00000461557.1	0	0	0	0	0	0	0.00	0.00	CCGCG	NM_020895		35491319	+1	0	0	0	0	tier1	no_errors	ENST00000603669	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.983:0.943:0.936:0.899:0.860	-	0	0
LTBP3	4054	genome.wustl.edu	37	11	65325325	65325326	+	In_Frame_Ins	INS	-	-	CAGCAG	rs535365850|rs577530923|rs71036212	byFrequency	TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr11:65325325_65325326insCAGCAG	ENST00000301873.5	-	1	373_374	c.105_106insCTGCTG	c.(103-108)ctgggc>ctgCTGCTGggc	p.34_35insLL	LTBP3_ENST00000322147.4_In_Frame_Ins_p.34_35insLL|LTBP3_ENST00000536982.1_5'Flank	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	34	Gly-rich.			Missing (in Ref. 2; BAB15767). {ECO:0000305}.	bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ccgcccaggcccagcagcagca	0.812													ENSG00000168056		259	0.0517173	0.0182	0.0504	5008	,	,		4999	0.0258		0.1034	False		,,,				2504	0.0716																0																																										SO:0001652	inframe_insertion	0				AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.100_105dupCTGCTG	11.37:g.65325326_65325331dupCAGCAG	ENSP00000301873:p.Leu33_Leu34dup		O15107|Q96HB9|Q9H7K2|Q9UFN4	In_Frame_Ins	INS	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.35in_frame_insLL	ENST00000301873.5	37	c.106_105	CCDS44647.1	11																																																																																				LTBP3	-	NULL		0.812	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	HGNC	protein_coding	OTTHUMT00000390538.1	0	0	0	0	0	0	0.00	0.00	-	NM_021070		65325326	-1	0	0	0	0	tier1	no_errors	ENST00000301873	ensembl	human	known	74_37	in_frame_ins	0.00	0.00	INS	1.000:0.996	CAGCAG	0	0
RN7SL417P	107080636	genome.wustl.edu	37	15	84949016	84949016	+	RNA	SNP	G	G	C			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr15:84949016G>C	ENST00000408320.1	+	0	0				RN7SL417P_ENST00000459938.2_RNA																							gcaagatcttggttcttaaaa	0.532													ENSG00000244056																																					0																																												0			-																													15.37:g.84949016G>C				R	SNP	-	NULL	ENST00000408320.1	37	NULL		15																																																																																			-	RN7SL417P	-	-		0.532	AC136704.1-201	NOVEL	basic	miRNA	RN7SL417P	HGNC	miRNA		0	0	0	15	15	0	0.00	0.00	G			84949016	+1	10	0	12	0	tier1	no_errors	ENST00000459938	ensembl	human	known	74_37	rna	45.45	0.00	SNP	0.044	C	10	12
SNORD3C	780853	genome.wustl.edu	37	17	19091699	19091699	+	lincRNA	SNP	T	T	A	rs202002668		TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr17:19091699T>A	ENST00000362428.1	-	0	432				SNORD3A_ENST00000365494.1_lincRNA					small nucleolar RNA, C/D box 3C																		GCTTTTTAATTTTAGTCTTGG	0.547													ENSG00000263934																																					0																																												0			-			17p11.2	2013-09-05			ENSG00000199298	ENSG00000264940			33191	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006881		Approved	U3-3					17.37:g.19091699T>A				R	SNP	-	NULL	ENST00000362428.1	37	NULL		17																																																																																			rs202002668	SNORD3A	-	-		0.547	SNORD3C-201	KNOWN	basic	snoRNA	SNORD3A	HGNC	lincRNA		0	0	0	13	13	2	0.00	0.00	T	NR_006881		19091699	+1	10	0	27	7	tier1	no_errors	ENST00000584923	ensembl	human	known	74_37	rna	27.03	0.00	SNP	0.000	A	10	27
SYTL1	84958	genome.wustl.edu	37	1	27679961	27679961	+	Missense_Mutation	SNP	C	C	A			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:27679961C>A	ENST00000543823.1	+	13	1993	c.1531C>A	c.(1531-1533)Cgc>Agc	p.R511S	SYTL1_ENST00000318074.5_Missense_Mutation_p.R499S|SYTL1_ENST00000490170.1_3'UTR			Q8IYJ3	SYTL1_HUMAN	synaptotagmin-like 1	511	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|melanosome (GO:0042470)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)			NS(1)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	12		Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.0115)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0908)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-28)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.0013)|KIRC - Kidney renal clear cell carcinoma(1967;0.00158)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GGGGGGCACACGCCTCAGCCT	0.682													ENSG00000142765																																					0													21.0	22.0	22.0					1																	27679961		2202	4298	6500	SO:0001583	missense	0			-	AK027902	CCDS298.1, CCDS53286.1	1p35.3	2008-02-05			ENSG00000142765	ENSG00000142765			15584	protein-coding gene	gene with protein product		608042				12137562	Standard	NM_032872		Approved	SLP1, JFC1, FLJ14996, exophilin-7	uc001bnw.2	Q8IYJ3	OTTHUMG00000005770	ENST00000543823.1:c.1531C>A	1.37:g.27679961C>A	ENSP00000440704:p.Arg511Ser		Q5SSC9|Q96BB6|Q96GU6|Q96S89|Q96SI0	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ	p.R511S	ENST00000543823.1	37	c.1531	CCDS53286.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411261	0.83340	.	.	ENSG00000142765	ENST00000318074;ENST00000543823	T;T	0.72394	-0.65;-0.65	5.46	4.49	0.54785	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.86049	0.5840	M	0.89840	3.065	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.99;1.0	D	0.88651	0.3182	10	0.87932	D	0	-25.635	13.9324	0.64003	0.1529:0.8471:0.0:0.0	.	511;511;499	A8KAH3;Q8IYJ3;Q8IYJ3-2	.;SYTL1_HUMAN;.	S	499;511	ENSP00000316464:R499S;ENSP00000440704:R511S	ENSP00000316464:R499S	R	+	1	0	SYTL1	27552548	0.906000	0.30813	1.000000	0.80357	0.984000	0.73092	1.864000	0.39469	2.559000	0.86315	0.561000	0.74099	CGC	-	SYTL1	-	superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.682	SYTL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SYTL1	HGNC	protein_coding		0	0	0	23	23	4	0.00	0.00	C	NM_032872		27679961	+1	14	2	16	8	tier1	no_errors	ENST00000543823	ensembl	human	known	74_37	missense	46.67	20.00	SNP	1.000	A	14	16
CENPE	1062	genome.wustl.edu	37	4	104062023	104062023	+	Missense_Mutation	SNP	A	A	T			TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr4:104062023A>T	ENST00000265148.3	-	36	5791	c.5702T>A	c.(5701-5703)cTc>cAc	p.L1901H	CENPE_ENST00000380026.3_Missense_Mutation_p.L1876H	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1901					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTCCAGTTTGAGTGTCTCCTC	0.363													ENSG00000138778																																					0													146.0	130.0	135.0					4																	104062023		2203	4300	6503	SO:0001583	missense	0			-	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5702T>A	4.37:g.104062023A>T	ENSP00000265148:p.Leu1901His		A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1901H	ENST00000265148.3	37	c.5702	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	A	14.34	2.507418	0.44558	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.71461	-0.57;-0.57	4.96	4.96	0.65561	.	.	.	.	.	D	0.82440	0.5037	M	0.73962	2.25	0.37047	D	0.897432	D;D	0.89917	0.975;1.0	P;D	0.72982	0.664;0.979	D	0.85814	0.1381	9	0.46703	T	0.11	.	13.9228	0.63942	1.0:0.0:0.0:0.0	.	1876;1901	Q02224-3;Q02224	.;CENPE_HUMAN	H	1901;1901;1876	ENSP00000265148:L1901H;ENSP00000369365:L1876H	ENSP00000265148:L1901H	L	-	2	0	CENPE	104281472	0.909000	0.30893	0.098000	0.21074	0.327000	0.28475	3.413000	0.52686	1.978000	0.57642	0.519000	0.50382	CTC	-	CENPE	-	NULL		0.363	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		0	0	0	36	36	81	0.00	0.00	A			104062023	-1	4	2	41	122	tier1	no_errors	ENST00000265148	ensembl	human	known	74_37	missense	8.89	1.61	SNP	0.606	T	4	41
PDE4DIP	9659	genome.wustl.edu	37	1	144877290	144877304	+	Intron	DEL	GGAAAGAGTAAGTAT	GGAAAGAGTAAGTAT	-	rs369665167	byFrequency	TCGA-WK-A8XY-01A-11D-A37C-09	TCGA-WK-A8XY-10A-01D-A37F-09	GGAAAGAGTAAGTAT	GGAAAGAGTAAGTAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ec1ddc84-64c1-4852-a98e-5a8406e0df9a	d9bcdaa1-d682-4750-a6d0-14155e7e1ac5	g.chr1:144877290_144877304delGGAAAGAGTAAGTAT	ENST00000369354.3	-	28	4605				AL138796.1_ENST00000582173.1_RNA|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000369359.4_Intron|RP4-791M13.5_ENST00000531288.1_RNA|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000524974.1_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GGACAGAAGAGGAAAGAGTAAGTATGGAAAGAGTG	0.437			T	PDGFRB	MPD								ENSG00000254913																												Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0																																										SO:0001627	intron_variant	0				AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.4416-19ATACTTACTCTTTCC>-	1.37:g.144877290_144877304delGGAAAGAGTAAGTAT			A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Splice_Site	DEL	-	NULL	ENST00000369354.3	37	c.NULL	CCDS30824.1	1																																																																																				RP4-791M13.5	-	-		0.437	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	ENSG00000254913	Clone_based_vega_gene	protein_coding	OTTHUMT00000038858.2	0	0	0	45	45	45	0.00	0.00	GGAAAGAGTAAGTAT	NM_022359		144877304	+1	3	3	60	60	tier1	no_errors	ENST00000531288	ensembl	human	known	74_37	splice_site_del	4.76	4.76	DEL	0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.003:0.000:0.000	-	3	60
