#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
CSPG5	10675	genome.wustl.edu	37	3	47618467	47618467	+	Nonsense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:47618467A>T	ENST00000383738.2	-	2	3147	c.1049T>A	c.(1048-1050)tTg>tAg	p.L350*	CSPG5_ENST00000456150.1_Nonsense_Mutation_p.L212*|CSPG5_ENST00000465441.1_5'Flank|CSPG5_ENST00000264723.4_Nonsense_Mutation_p.L350*	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	350					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		ACTGGAGGCCAAGTCCCTGCC	0.632													ENSG00000114646																																					0													55.0	57.0	57.0					3																	47618467		2203	4300	6503	SO:0001587	stop_gained	0			-	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.1049T>A	3.37:g.47618467A>T	ENSP00000373244:p.Leu350*		Q71M39|Q71M40	Nonsense_Mutation	SNP	pfam_Chon_Sulph_att,pfam_Neural_ProG_Cyt	p.L350*	ENST00000383738.2	37	c.1049	CCDS56253.1	3	.	.	.	.	.	.	.	.	.	.	A	51	18.309812	0.99903	.	.	ENSG00000114646	ENST00000456150;ENST00000383738;ENST00000264723	.	.	.	4.19	4.19	0.49359	.	0.416966	0.22245	N	0.062624	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.3636	7.7751	0.29033	0.8991:0.0:0.1009:0.0	.	.	.	.	X	212;350;350	.	ENSP00000264723:L350X	L	-	2	0	CSPG5	47593471	0.967000	0.33354	1.000000	0.80357	0.455000	0.32408	1.142000	0.31540	1.753000	0.51906	0.533000	0.62120	TTG	-	CSPG5	-	NULL		0.632	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG5	HGNC	protein_coding	OTTHUMT00000257489.1	0	0	0	50	50	35	0.00	0.00	A	NM_006574		47618467	-1	14	13	31	27	tier1	no_errors	ENST00000383738	ensembl	human	known	74_37	nonsense	31.11	32.50	SNP	1.000	T	14	31
NLRP5	126206	genome.wustl.edu	37	19	56544095	56544095	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:56544095A>G	ENST00000390649.3	+	8	2395	c.2395A>G	c.(2395-2397)Aag>Gag	p.K799E		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	799					cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GCGGGCCATGAAGACCCTGTG	0.597													ENSG00000171487																																					0													105.0	111.0	109.0					19																	56544095		2094	4240	6334	SO:0001583	missense	0			-	AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.2395A>G	19.37:g.56544095A>G	ENSP00000375063:p.Lys799Glu		A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,pfscan_DAPIN	p.K799E	ENST00000390649.3	37	c.2395	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	A	12.86	2.065578	0.36470	.	.	ENSG00000171487	ENST00000390649	D	0.88975	-2.45	4.84	1.39	0.22231	.	0.537062	0.14225	N	0.333121	D	0.91768	0.7396	M	0.73372	2.23	0.22292	N	0.999222	D	0.71674	0.998	D	0.70935	0.971	T	0.81913	-0.0715	10	0.62326	D	0.03	.	5.6507	0.17614	0.5894:0.3169:0.0937:0.0	.	799	P59047	NALP5_HUMAN	E	799	ENSP00000375063:K799E	ENSP00000375063:K799E	K	+	1	0	NLRP5	61235907	0.240000	0.23847	0.917000	0.36280	0.077000	0.17291	0.632000	0.24583	0.272000	0.22027	0.529000	0.55759	AAG	-	NLRP5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.597	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	0	0	0	41	41	38	0.00	0.00	A	NM_153447		56544095	+1	12	10	42	46	tier1	no_errors	ENST00000390649	ensembl	human	known	74_37	missense	22.22	17.86	SNP	0.610	G	12	42
CRNN	49860	genome.wustl.edu	37	1	152382768	152382768	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:152382768G>C	ENST00000271835.3	-	3	852	c.790C>G	c.(790-792)Cag>Gag	p.Q264E	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	264	Gln-rich.				response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCTGTTCTGGTCATTGGTG	0.602													ENSG00000143536																																					0													259.0	260.0	259.0					1																	152382768		2203	4300	6503	SO:0001583	missense	0			-	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.790C>G	1.37:g.152382768G>C	ENSP00000271835:p.Gln264Glu		B2RE60|Q8N613	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q264E	ENST00000271835.3	37	c.790	CCDS1010.1	1	.	.	.	.	.	.	.	.	.	.	G	16.34	3.094946	0.56075	.	.	ENSG00000143536	ENST00000271835	T	0.04862	3.54	4.31	4.31	0.51392	.	0.825696	0.10559	N	0.660556	T	0.04497	0.0123	L	0.46157	1.445	0.28066	N	0.932772	P	0.47302	0.893	B	0.44315	0.446	T	0.21999	-1.0229	10	0.66056	D	0.02	.	12.4949	0.55923	0.0:0.0:1.0:0.0	.	264	Q9UBG3	CRNN_HUMAN	E	264	ENSP00000271835:Q264E	ENSP00000271835:Q264E	Q	-	1	0	CRNN	150649392	0.998000	0.40836	0.866000	0.34008	0.058000	0.15608	5.215000	0.65241	2.396000	0.81511	0.585000	0.79938	CAG	-	CRNN	-	NULL		0.602	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRNN	HGNC	protein_coding	OTTHUMT00000034503.1	0	0	0	77	77	93	0.00	0.00	G	NM_016190		152382768	-1	40	53	64	70	tier1	no_errors	ENST00000271835	ensembl	human	known	74_37	missense	38.46	43.09	SNP	0.914	C	40	64
IKZF3	22806	genome.wustl.edu	37	17	37934017	37934017	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:37934017C>T	ENST00000346872.3	-	7	774	c.713G>A	c.(712-714)aGt>aAt	p.S238N	IKZF3_ENST00000377945.3_Intron|IKZF3_ENST00000535189.1_Missense_Mutation_p.S204N|IKZF3_ENST00000377944.3_Missense_Mutation_p.S95N|IKZF3_ENST00000583368.1_De_novo_Start_OutOfFrame|IKZF3_ENST00000467757.1_Missense_Mutation_p.S182N|IKZF3_ENST00000351680.3_Missense_Mutation_p.S199N|IKZF3_ENST00000377952.2_Intron|IKZF3_ENST00000394189.2_Missense_Mutation_p.S56N|IKZF3_ENST00000350532.3_Intron|IKZF3_ENST00000377958.2_Missense_Mutation_p.S151N|IKZF3_ENST00000439016.2_Missense_Mutation_p.S143N|IKZF3_ENST00000439167.2_Missense_Mutation_p.S165N|IKZF3_ENST00000346243.3_Intron	NM_012481.4	NP_036613.2	Q9UKT9	IKZF3_HUMAN	IKAROS family zinc finger 3 (Aiolos)	238					B cell activation (GO:0042113)|mesoderm development (GO:0007498)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of B cell proliferation (GO:0030888)|regulation of lymphocyte differentiation (GO:0045619)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(6)|large_intestine(4)|liver(1)|lung(13)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42	Breast(7;4.5e-103)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGCCTCCGCACTTGCTAGTTT	0.423													ENSG00000161405																																					0													137.0	146.0	143.0					17																	37934017		2203	4300	6503	SO:0001583	missense	0			-	AF129512	CCDS11346.1, CCDS11347.1, CCDS11348.1, CCDS11349.1, CCDS11350.1, CCDS11351.1, CCDS58539.1, CCDS58540.1, CCDS58541.1, CCDS58542.1, CCDS58543.1, CCDS58544.1, CCDS58545.1, CCDS74055.1	17q11.2	2013-01-08	2006-08-25	2006-08-25	ENSG00000161405	ENSG00000161405		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13178	protein-coding gene	gene with protein product		606221	"""zinc finger protein, subfamily 1A, 3 (Aiolos)"""	ZNFN1A3		9155026, 10552935	Standard	NM_012481		Approved	Aiolos	uc002hsu.4	Q9UKT9	OTTHUMG00000133250	ENST00000346872.3:c.713G>A	17.37:g.37934017C>T	ENSP00000344544:p.Ser238Asn		B4DVV5|Q69BL6|Q69BL7|Q69BL8|Q69BL9|Q69BM0|Q69BM1|Q69BM2|Q69BM3|Q69BM5|Q8N574|Q8WWQ9|Q8WWR0|Q8WWR1|Q8WWR2|Q8WWR3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S238N	ENST00000346872.3	37	c.713	CCDS11346.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.94|12.94	2.089417|2.089417	0.36855|0.36855	.|.	.|.	ENSG00000161405|ENSG00000161405	ENST00000488188;ENST00000346872;ENST00000394189;ENST00000377944;ENST00000377958;ENST00000535189;ENST00000351680;ENST00000467757|ENST00000439167;ENST00000439016	T;T;T;T;T;T|.	0.09073|.	3.53;3.26;3.02;3.3;3.34;4.35|.	5.39|5.39	5.39|5.39	0.77823|0.77823	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.47857|0.47857	0.1468|0.1468	N|N	0.21097|0.21097	0.63|0.63	0.36496|0.36496	D|D	0.868718|0.868718	B;D;B;B;D;B;B;B;B|.	0.67145|.	0.008;0.996;0.01;0.001;0.996;0.094;0.008;0.005;0.004|.	B;D;B;B;D;B;B;B;B|.	0.78314|.	0.009;0.991;0.004;0.005;0.991;0.039;0.009;0.004;0.004|.	T|T	0.50808|0.50808	-0.8784|-0.8784	10|5	0.19147|.	T|.	0.46|.	-18.19|-18.19	15.5203|15.5203	0.75859|0.75859	0.0:0.8614:0.1386:0.0|0.0:0.8614:0.1386:0.0	.|.	151;56;95;204;143;182;199;165;238|.	Q9UKT9-9;Q9UKT9-11;Q9UKT9-10;Q9UKT9-7;Q9UKT9-5;Q9UKT9-2;Q9UKT9-3;Q9UKT9-8;Q9UKT9|.	.;.;.;.;.;.;.;.;IKZF3_HUMAN|.	N|M	238;143;56;95;151;204;199;182|153;192	ENSP00000377741:S56N;ENSP00000367179:S95N;ENSP00000367194:S151N;ENSP00000438972:S204N;ENSP00000345622:S199N;ENSP00000420463:S182N|.	ENSP00000344544:S143N|.	S|V	-|-	2|1	0|0	IKZF3|IKZF3	35187543|35187543	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	3.081000|3.081000	0.50120|0.50120	2.699000|2.699000	0.92147|0.92147	0.650000|0.650000	0.86243|0.86243	AGT|GTG	-	IKZF3	-	NULL		0.423	IKZF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF3	HGNC	protein_coding	OTTHUMT00000257004.2	0	0	0	67	67	117	0.00	0.00	C	NM_012481		37934017	-1	29	76	20	46	tier1	no_errors	ENST00000346872	ensembl	human	known	74_37	missense	59.18	62.30	SNP	1.000	T	29	20
CHRNA3	1136	genome.wustl.edu	37	15	78893698	78893698	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr15:78893698T>C	ENST00000326828.5	-	5	1670	c.1286A>G	c.(1285-1287)gAt>gGt	p.D429G	CHRNA3_ENST00000348639.3_Missense_Mutation_p.D429G	NM_000743.4	NP_000734.2	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3 (neuronal)	429					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of membrane potential (GO:0042391)|regulation of smooth muscle contraction (GO:0006940)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18					Bupropion(DB01156)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Levomethadyl Acetate(DB01227)|Nicotine(DB00184)|Pentolinium(DB01090)|Varenicline(DB01273)	CAGCACAGCATCAACAGATTC	0.448													ENSG00000080644																																					0													163.0	151.0	155.0					15																	78893698		2196	4293	6489	SO:0001583	missense	0			-		CCDS10305.1, CCDS53964.1	15q24	2012-02-11	2012-02-07		ENSG00000080644	ENSG00000080644		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1957	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 3 (neuronal)"""	118503	"""cholinergic receptor, nicotinic, alpha polypeptide 3"""			2004777	Standard	NM_000743		Approved		uc002bec.3	P32297	OTTHUMG00000143863	ENST00000326828.5:c.1286A>G	15.37:g.78893698T>C	ENSP00000315602:p.Asp429Gly		Q15823|Q4KMN8|Q86U77|Q96RH3|Q99553|Q9BQ93|Q9BRR4	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D429G	ENST00000326828.5	37	c.1286	CCDS10305.1	15	.	.	.	.	.	.	.	.	.	.	T	4.327	0.060138	0.08339	.	.	ENSG00000080644	ENST00000348639;ENST00000326828	D;D	0.85702	-2.02;-2.02	5.79	4.66	0.58398	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.690028	0.14556	N	0.312359	T	0.79269	0.4417	L	0.43598	1.365	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.62548	-0.6831	10	0.19590	T	0.45	.	11.8361	0.52325	0.0:0.0686:0.0:0.9314	.	429;429	P32297;P32297-3	ACHA3_HUMAN;.	G	429	ENSP00000267951:D429G;ENSP00000315602:D429G	ENSP00000315602:D429G	D	-	2	0	CHRNA3	76680753	0.774000	0.28592	0.002000	0.10522	0.771000	0.43674	4.911000	0.63328	1.010000	0.39314	0.482000	0.46254	GAT	-	CHR3	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.448	CHRNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHR3	HGNC	protein_coding	OTTHUMT00000290111.3	0	0	0	67	67	99	0.00	0.00	T			78893698	-1	15	22	34	81	tier1	no_errors	ENST00000326828	ensembl	human	known	74_37	missense	30.61	21.36	SNP	0.096	C	15	34
CHMP4B	128866	genome.wustl.edu	37	20	32399398	32399398	+	Missense_Mutation	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr20:32399398T>A	ENST00000217402.2	+	1	289	c.124T>A	c.(124-126)Ttc>Atc	p.F42I	RP4-553F4.6_ENST00000439444.1_RNA|RP4-553F4.6_ENST00000443171.1_RNA	NM_176812.4	NP_789782.1	Q9H444	CHM4B_HUMAN	charged multivesicular body protein 4B	42					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|negative regulation of autophagic vacuole assembly (GO:1902902)|negative regulation of neuron death (GO:1901215)|positive regulation of viral release from host cell (GO:1902188)|posttranslational protein targeting to membrane (GO:0006620)|protein homooligomerization (GO:0051260)|regulation of viral process (GO:0050792)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|ESCRT III complex (GO:0000815)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13						GAAACAGGAGTTCCTGGAGAA	0.647													ENSG00000101421																																					0													21.0	26.0	24.0					20																	32399398		2202	4300	6502	SO:0001583	missense	0			-	AL050349	CCDS13228.1	20q11.22	2011-09-21	2011-09-21	2005-04-04	ENSG00000101421	ENSG00000101421		"""Charged multivesicular body proteins"""	16171	protein-coding gene	gene with protein product		610897	"""chromosome 20 open reading frame 178"", ""chromatin modifying protein 4B"""	C20orf178		14678797	Standard	NM_176812		Approved	dJ553F4.4, Shax1, SNF7-2, VPS32B	uc002xaa.3	Q9H444	OTTHUMG00000032272	ENST00000217402.2:c.124T>A	20.37:g.32399398T>A	ENSP00000217402:p.Phe42Ile		E1P5N4|Q53ZD6	Missense_Mutation	SNP	pfam_Snf7	p.F42I	ENST00000217402.2	37	c.124	CCDS13228.1	20	.	.	.	.	.	.	.	.	.	.	T	25.6	4.658094	0.88154	.	.	ENSG00000101421	ENST00000217402	T	0.72167	-0.63	5.31	5.31	0.75309	.	0.166668	0.53938	D	0.000051	T	0.81380	0.4810	M	0.82823	2.61	0.48395	D	0.99964	P	0.44816	0.844	P	0.52598	0.703	D	0.84435	0.0579	10	0.72032	D	0.01	-3.7706	14.9122	0.70767	0.0:0.0:0.0:1.0	.	42	Q9H444	CHM4B_HUMAN	I	42	ENSP00000217402:F42I	ENSP00000217402:F42I	F	+	1	0	CHMP4B	31863059	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	4.464000	0.60134	2.010000	0.58986	0.374000	0.22700	TTC	-	CHMP4B	-	pfam_Snf7		0.647	CHMP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP4B	HGNC	protein_coding	OTTHUMT00000078738.2	0	0	0	109	109	45	0.00	0.00	T			32399398	+1	25	10	69	28	tier1	no_errors	ENST00000217402	ensembl	human	known	74_37	missense	26.60	26.32	SNP	1.000	A	25	69
TMPRSS15	5651	genome.wustl.edu	37	21	19726140	19726140	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr21:19726140A>T	ENST00000284885.3	-	9	954	c.921T>A	c.(919-921)ttT>ttA	p.F307L		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	307	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CTTGGTTGGAAAAAATTCTTA	0.313													ENSG00000154646																																					0													70.0	75.0	74.0					21																	19726140		2203	4291	6494	SO:0001583	missense	0			-		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.921T>A	21.37:g.19726140A>T	ENSP00000284885:p.Phe307Leu		Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.F307L	ENST00000284885.3	37	c.921	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	A	14.50	2.553785	0.45487	.	.	ENSG00000154646	ENST00000284885	T	0.17528	2.27	4.46	3.31	0.37934	CUB (5);	0.077703	0.53938	D	0.000057	T	0.11707	0.0285	N	0.20328	0.56	0.37958	D	0.93287	P	0.47841	0.901	P	0.44597	0.454	T	0.18713	-1.0328	9	.	.	.	.	8.8929	0.35446	0.9096:0.0:0.0904:0.0	.	307	P98073	ENTK_HUMAN	L	307	ENSP00000284885:F307L	.	F	-	3	2	TMPRSS15	18648011	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.290000	0.43531	0.755000	0.32990	-0.388000	0.06559	TTT	-	TMPRSS15	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.313	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	0	0	0	78	78	137	0.00	0.00	A	NM_002772		19726140	-1	26	75	37	91	tier1	no_errors	ENST00000284885	ensembl	human	known	74_37	missense	41.27	45.18	SNP	1.000	T	26	37
SEC24D	9871	genome.wustl.edu	37	4	119666191	119666191	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr4:119666191A>G	ENST00000280551.6	-	14	1970	c.1732T>C	c.(1732-1734)Ttc>Ctc	p.F578L	SEC24D_ENST00000429811.2_Missense_Mutation_p.F134L|SEC24D_ENST00000379735.5_Missense_Mutation_p.F579L|SEC24D_ENST00000419654.2_Missense_Mutation_p.F134L|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000511481.1_Missense_Mutation_p.F209L			O94855	SC24D_HUMAN	SEC24 family member D	578					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						TGGAAGATGAACAGCTTCCCA	0.388													ENSG00000150961																																					0													117.0	118.0	118.0					4																	119666191		2203	4300	6503	SO:0001583	missense	0			-	AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1732T>C	4.37:g.119666191A>G	ENSP00000280551:p.Phe578Leu		Q8IYI7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.F579L	ENST00000280551.6	37	c.1735	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	A	19.31	3.803603	0.70682	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000429811;ENST00000511481;ENST00000419654	T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08	5.59	5.59	0.84812	Sec23/Sec24, trunk domain (1);	0.086882	0.85682	D	0.000000	T	0.35998	0.0951	L	0.41356	1.27	0.58432	D	0.999997	B;B	0.26120	0.002;0.142	B;B	0.29942	0.006;0.109	T	0.13980	-1.0489	10	0.12103	T	0.63	-9.5956	15.7516	0.77989	1.0:0.0:0.0:0.0	.	579;578	O94855-2;O94855	.;SC24D_HUMAN	L	578;579;134;209;134	ENSP00000280551:F578L;ENSP00000369059:F579L;ENSP00000409775:F134L;ENSP00000425491:F209L;ENSP00000388324:F134L	ENSP00000280551:F578L	F	-	1	0	SEC24D	119885639	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.274000	0.72587	2.112000	0.64535	0.533000	0.62120	TTC	-	SEC24D	-	pfam_Sec23/24_trunk_dom		0.388	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	0	0	0	33	33	24	0.00	0.00	A			119666191	-1	8	4	28	27	tier1	no_errors	ENST00000379735	ensembl	human	known	74_37	missense	22.22	12.50	SNP	1.000	G	8	28
ZNF573	126231	genome.wustl.edu	37	19	38283217	38283217	+	5'UTR	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:38283217T>A	ENST00000480587.2	-	0	713				CTD-2554C21.1_ENST00000591908.1_RNA|ZNF573_ENST00000392138.1_Intron			Q86YE8	ZN573_HUMAN	zinc finger protein 573						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			CCTTTCCCAATATTTATCCAT	0.433													ENSG00000189144																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000480587.2:c.-8A>T	19.37:g.38283217T>A			B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	R	SNP	-	NULL	ENST00000480587.2	37	NULL		19																																																																																			-	ZNF573	-	-		0.433	ZNF573-005	KNOWN	basic	processed_transcript	ZNF573	HGNC	protein_coding	OTTHUMT00000109616.2	0	0	0	93	93	115	0.00	0.00	T	NM_152360		38283217	-1	13	33	81	108	tier1	no_errors	ENST00000480587	ensembl	human	known	74_37	rna	13.83	23.40	SNP	0.535	A	13	81
HECTD2	143279	genome.wustl.edu	37	10	93220291	93220291	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:93220291C>A	ENST00000298068.5	+	3	470	c.376C>A	c.(376-378)Cct>Act	p.P126T	HECTD2_ENST00000536715.1_5'Flank|HECTD2_ENST00000371681.4_Missense_Mutation_p.P126T|HECTD2_ENST00000446394.1_Missense_Mutation_p.P126T	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	126					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						ACCTATTCTTCCTATCCAGCC	0.383													ENSG00000165338																									NSCLC(12;376 469 1699 39910 41417)												0													123.0	111.0	115.0					10																	93220291		2203	4300	6503	SO:0001583	missense	0			-	AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.376C>A	10.37:g.93220291C>A	ENSP00000298068:p.Pro126Thr		Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.P126T	ENST00000298068.5	37	c.376	CCDS7414.1	10	.	.	.	.	.	.	.	.	.	.	C	17.22	3.334802	0.60853	.	.	ENSG00000165338	ENST00000446394;ENST00000371681;ENST00000298068	T;T;T	0.61158	1.13;0.13;1.14	5.39	4.49	0.54785	.	0.116946	0.64402	D	0.000014	T	0.67468	0.2896	L	0.59436	1.845	0.80722	D	1	P;P;D	0.71674	0.931;0.931;0.998	P;P;D	0.66351	0.522;0.522;0.943	T	0.63708	-0.6576	10	0.14656	T	0.56	.	13.5118	0.61517	0.0:0.9237:0.0:0.0763	.	126;126;126	E7ERR3;Q5U5R9;Q5VZ98	.;HECD2_HUMAN;.	T	126	ENSP00000401023:P126T;ENSP00000360746:P126T;ENSP00000298068:P126T	ENSP00000298068:P126T	P	+	1	0	HECTD2	93210271	1.000000	0.71417	0.429000	0.26710	0.704000	0.40688	3.837000	0.55820	1.253000	0.44018	0.563000	0.77884	CCT	-	HECTD2	-	NULL		0.383	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	0	0	0	52	52	142	0.00	0.00	C			93220291	+1	6	51	22	104	tier1	no_errors	ENST00000446394	ensembl	human	known	74_37	missense	21.43	32.90	SNP	1.000	A	6	22
CDKL5	6792	genome.wustl.edu	37	X	18627005	18627005	+	Silent	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:18627005T>G	ENST00000379989.3	+	14	2304	c.2019T>G	c.(2017-2019)tcT>tcG	p.S673S	CDKL5_ENST00000379996.3_Silent_p.S673S|CDKL5_ENST00000463994.1_3'UTR	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	673					neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					AAGGCACCTCTTCCTTCCATA	0.403													ENSG00000008086																																					0													73.0	63.0	66.0					X																	18627005		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.2019T>G	X.37:g.18627005T>G			G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S673	ENST00000379989.3	37	c.2019	CCDS14186.1	X																																																																																			-	CDKL5	-	NULL		0.403	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKL5	HGNC	protein_coding	OTTHUMT00000055945.2	0	0	0	83	83	125	0.00	0.00	T	NM_003159		18627005	+1	16	34	50	97	tier1	no_errors	ENST00000379989	ensembl	human	known	74_37	silent	24.24	25.95	SNP	0.993	G	16	50
RLIM	51132	genome.wustl.edu	37	X	73812194	73812194	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:73812194A>T	ENST00000332687.6	-	4	1174	c.956T>A	c.(955-957)aTa>aAa	p.I319K	RLIM_ENST00000349225.2_Missense_Mutation_p.I319K	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	319					negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ATCAAGGACTATGGTTGGAGG	0.478													ENSG00000131263																									Esophageal Squamous(169;1899 1923 14997 18818 32118)												0													59.0	51.0	54.0					X																	73812194		2203	4300	6503	SO:0001583	missense	0			-	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.956T>A	X.37:g.73812194A>T	ENSP00000328059:p.Ile319Lys		B2RBQ1|D3DTE0|Q96D38|Q9Y598	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I319K	ENST00000332687.6	37	c.956	CCDS14427.1	X	.	.	.	.	.	.	.	.	.	.	A	15.43	2.830678	0.50845	.	.	ENSG00000131263	ENST00000332687;ENST00000349225	T;T	0.16457	2.34;2.34	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.44180	0.1281	M	0.79123	2.44	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.45629	-0.9248	10	0.87932	D	0	-9.1494	14.9929	0.71401	1.0:0.0:0.0:0.0	.	319	Q9NVW2	RNF12_HUMAN	K	319	ENSP00000328059:I319K;ENSP00000253571:I319K	ENSP00000328059:I319K	I	-	2	0	RLIM	73728919	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.959000	0.93110	1.923000	0.55706	0.486000	0.48141	ATA	-	RLIM	-	NULL		0.478	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLIM	HGNC	protein_coding	OTTHUMT00000057268.1	0	0	0	18	18	75	0.00	0.00	A	NM_016120		73812194	-1	8	19	7	21	tier1	no_errors	ENST00000332687	ensembl	human	known	74_37	missense	53.33	47.50	SNP	1.000	T	8	7
ELFN2	114794	genome.wustl.edu	37	22	37769292	37769292	+	Nonsense_Mutation	SNP	G	G	T	rs150497338		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr22:37769292G>T	ENST00000402918.2	-	3	3068	c.2283C>A	c.(2281-2283)taC>taA	p.Y761*	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	761					negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TCTCGGATGAGTACTCGGGGC	0.627													ENSG00000166897																																					0													90.0	82.0	85.0					22																	37769292		2203	4300	6503	SO:0001587	stop_gained	0			-	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.2283C>A	22.37:g.37769292G>T	ENSP00000385277:p.Tyr761*		Q96PY3	Nonsense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.Y761*	ENST00000402918.2	37	c.2283	CCDS33642.1	22	.	.	.	.	.	.	.	.	.	.	G	38	6.980715	0.97979	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	.	.	.	4.63	3.59	0.41128	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-33.463	13.5721	0.61853	0.0804:0.0:0.9196:0.0	.	.	.	.	X	761	.	ENSP00000300147:Y761X	Y	-	3	2	ELFN2	36099238	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.120000	0.41968	2.265000	0.75225	0.561000	0.74099	TAC	-	ELFN2	-	NULL		0.627	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	HGNC	protein_coding	OTTHUMT00000318900.2	0	0	0	57	57	57	0.00	0.00	G	NM_052906		37769292	-1	23	19	36	52	tier1	no_errors	ENST00000402918	ensembl	human	known	74_37	nonsense	38.98	26.76	SNP	1.000	T	23	36
THRB	7068	genome.wustl.edu	37	3	24164567	24164567	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:24164567A>G	ENST00000356447.4	-	10	1478	c.1194T>C	c.(1192-1194)agT>agC	p.S398S	THRB_ENST00000396671.2_Silent_p.S398S|THRB_ENST00000280696.5_Silent_p.S413S|THRB_ENST00000416420.1_Silent_p.S398S	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	398	Interaction with NR2F6.|Ligand-binding.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCAGCAGGAAACTATCTTGGT	0.478													ENSG00000151090																									Melanoma(21;896 1043 15021 37958)												0													124.0	131.0	129.0					3																	24164567		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1194T>C	3.37:g.24164567A>G			B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S398	ENST00000356447.4	37	c.1194	CCDS2641.1	3																																																																																			-	THRB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.478	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3	0	0	0	79	79	129	0.00	0.00	A	NM_000461		24164567	-1	9	40	85	191	tier1	no_errors	ENST00000356447	ensembl	human	known	74_37	silent	9.57	17.24	SNP	1.000	G	9	85
TRIO	7204	genome.wustl.edu	37	5	14481717	14481717	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:14481717A>T	ENST00000344204.4	+	45	6479	c.6455A>T	c.(6454-6456)cAa>cTa	p.Q2152L	TRIO_ENST00000537187.1_Missense_Mutation_p.Q2152L	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	2152					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					GGGCGGCTGCAAGGATTCGAC	0.488													ENSG00000038382																																					0													148.0	146.0	147.0					5																	14481717		2203	4300	6503	SO:0001583	missense	0			-	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.6455A>T	5.37:g.14481717A>T	ENSP00000339299:p.Gln2152Leu		D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssD_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.Q2152L	ENST00000344204.4	37	c.6455	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	A	29.3	4.993098	0.93167	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000513206;ENST00000541447	T;T	0.66638	-0.22;-0.22	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	D	0.84579	0.5503	M	0.91510	3.215	0.80722	D	1	D;D	0.63880	0.993;0.967	D;D	0.65874	0.939;0.932	D	0.88235	0.2906	10	0.72032	D	0.01	.	15.5612	0.76249	1.0:0.0:0.0:0.0	.	2152;2152	O75962-5;O75962	.;TRIO_HUMAN	L	2152;2152;1839;232	ENSP00000339299:Q2152L;ENSP00000446348:Q2152L	ENSP00000339299:Q2152L	Q	+	2	0	TRIO	14534717	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.297000	0.96120	2.072000	0.62099	0.460000	0.39030	CAA	-	TRIO	-	NULL		0.488	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	0	0	0	74	74	125	0.00	0.00	A	NM_007118		14481717	+1	20	33	62	105	tier1	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	24.39	23.91	SNP	1.000	T	20	62
CRISPLD1	83690	genome.wustl.edu	37	8	75928820	75928820	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:75928820C>T	ENST00000262207.4	+	7	1216	c.748C>T	c.(748-750)Ccc>Tcc	p.P250S	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.P62S|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.P64S	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	250					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CAGGTATTATCCCCCTCGAGA	0.363													ENSG00000121005																																					0													117.0	122.0	120.0					8																	75928820		2203	4300	6503	SO:0001583	missense	0			-	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.748C>T	8.37:g.75928820C>T	ENSP00000262207:p.Pro250Ser		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.P250S	ENST00000262207.4	37	c.748	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	0.157	-1.085513	0.01873	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;T	0.80824	0.35;-1.13;-1.42	4.98	-2.83	0.05769	.	0.454838	0.25663	N	0.029133	T	0.45357	0.1338	N	0.02539	-0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42396	-0.9454	10	0.13470	T	0.59	.	2.72	0.05198	0.401:0.3389:0.0958:0.1643	.	64;250	B7Z929;Q9H336	.;CRLD1_HUMAN	S	250;62;64	ENSP00000262207:P250S;ENSP00000430105:P62S;ENSP00000429746:P64S	ENSP00000262207:P250S	P	+	1	0	CRISPLD1	76091375	0.002000	0.14202	0.033000	0.17914	0.007000	0.05969	-0.045000	0.12003	-0.737000	0.04824	-2.122000	0.00348	CCC	-	CRISPLD1	-	NULL		0.363	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	0	0	0	24	24	183	0.00	0.00	C	NM_031461		75928820	+1	6	35	30	201	tier1	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	16.67	14.77	SNP	0.019	T	6	30
FAM131B	9715	genome.wustl.edu	37	7	143055944	143055944	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:143055944C>T	ENST00000409408.1	-	4	2066	c.358G>A	c.(358-360)Gag>Aag	p.E120K	FAM131B_ENST00000409578.1_Missense_Mutation_p.E136K|FAM131B_ENST00000443739.2_Missense_Mutation_p.E148K|FAM131B_ENST00000409222.3_Missense_Mutation_p.E120K|FAM131B_ENST00000409346.1_Missense_Mutation_p.E120K			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	120										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					GCCTCCTTCTCGCCATCGCTG	0.587													ENSG00000159784																																					0													82.0	76.0	78.0					7																	143055944		2203	4299	6502	SO:0001583	missense	0			-	BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.358G>A	7.37:g.143055944C>T	ENSP00000387017:p.Glu120Lys		A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NULL	p.E148K	ENST00000409408.1	37	c.442	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	C	29.8	5.033168	0.93575	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.39592	1.07;1.07;1.07;1.07;1.07	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.65760	0.2722	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.991;0.994	T	0.69379	-0.5161	10	0.87932	D	0	-11.8725	18.8528	0.92240	0.0:1.0:0.0:0.0	.	136;120	Q86XD5-2;Q86XD5	.;F131B_HUMAN	K	148;136;120;124;120;120	ENSP00000410603:E148K;ENSP00000386568:E136K;ENSP00000386984:E120K;ENSP00000387017:E120K;ENSP00000387147:E120K	ENSP00000387147:E120K	E	-	1	0	FAM131B	142766066	1.000000	0.71417	1.000000	0.80357	0.613000	0.37349	5.696000	0.68287	2.442000	0.82660	0.561000	0.74099	GAG	-	FAM131B	-	NULL		0.587	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	HGNC	protein_coding	OTTHUMT00000328057.1	0	0	0	73	73	67	0.00	0.00	C	NM_014690		143055944	-1	14	25	14	28	tier1	no_errors	ENST00000443739	ensembl	human	known	74_37	missense	50.00	46.30	SNP	1.000	T	14	14
KIF13A	63971	genome.wustl.edu	37	6	17804729	17804729	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:17804729A>T	ENST00000259711.6	-	20	2422	c.2317T>A	c.(2317-2319)Tac>Aac	p.Y773N	KIF13A_ENST00000378843.2_Missense_Mutation_p.Y773N|KIF13A_ENST00000378814.5_Missense_Mutation_p.Y773N|KIF13A_ENST00000378816.5_Missense_Mutation_p.Y773N|KIF13A_ENST00000378826.2_Missense_Mutation_p.Y773N	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	773					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			CGTTTTCCGTAGAGTCTCTTT	0.393													ENSG00000137177																																					0													63.0	60.0	61.0					6																	17804729		1926	4135	6061	SO:0001583	missense	0			-	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.2317T>A	6.37:g.17804729A>T	ENSP00000259711:p.Tyr773Asn		A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Y773N	ENST00000259711.6	37	c.2317	CCDS47381.1	6	.	.	.	.	.	.	.	.	.	.	A	7.798	0.712990	0.15306	.	.	ENSG00000137177	ENST00000378814;ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91	5.88	5.88	0.94601	.	0.741795	0.14008	N	0.347663	T	0.31451	0.0797	N	0.02960	-0.455	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.10450	0.003;0.001;0.005;0.001	T	0.12863	-1.0531	10	0.27082	T	0.32	.	11.1442	0.48422	0.8298:0.0:0.0:0.1702	.	773;773;773;773	Q9H1H9-4;Q9H1H9-2;Q9H1H9;Q9H1H9-3	.;.;KI13A_HUMAN;.	N	773	ENSP00000368091:Y773N;ENSP00000259711:Y773N;ENSP00000368103:Y773N;ENSP00000368120:Y773N;ENSP00000368093:Y773N	ENSP00000259711:Y773N	Y	-	1	0	KIF13A	17912708	0.661000	0.27430	0.370000	0.25965	0.582000	0.36321	2.938000	0.48987	2.253000	0.74438	0.454000	0.30748	TAC	-	KIF13A	-	pfam_KIF1B		0.393	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF13A	HGNC	protein_coding	OTTHUMT00000039954.4	0	0	0	63	63	143	0.00	0.00	A			17804729	-1	33	84	13	58	tier1	no_errors	ENST00000259711	ensembl	human	known	74_37	missense	71.74	58.74	SNP	0.022	T	33	13
KIAA1217	56243	genome.wustl.edu	37	10	24833379	24833379	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:24833379C>T	ENST00000376454.3	+	19	5210	c.5180C>T	c.(5179-5181)cCc>cTc	p.P1727L	KIAA1217_ENST00000458595.1_Intron|KIAA1217_ENST00000396446.1_Intron|KIAA1217_ENST00000376452.3_Intron|KIAA1217_ENST00000307544.6_Intron|KIAA1217_ENST00000376462.1_Intron|KIAA1217_ENST00000396445.1_Intron|KIAA1217_ENST00000376451.2_Missense_Mutation_p.P1410L	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1727					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						GCCCTAGAGCCCCCTACGTCG	0.502													ENSG00000120549																																					0													65.0	65.0	65.0					10																	24833379		2203	4300	6503	SO:0001583	missense	0			-	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5180C>T	10.37:g.24833379C>T	ENSP00000365637:p.Pro1727Leu		A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	pfam_AIP3_C	p.P1727L	ENST00000376454.3	37	c.5180	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	C	16.57	3.160565	0.57368	.	.	ENSG00000120549	ENST00000442879;ENST00000376454;ENST00000376451	T;T	0.30182	1.97;1.54	5.1	5.1	0.69264	.	0.385935	0.24046	N	0.042044	T	0.30541	0.0768	L	0.47716	1.5	0.80722	D	1	P;P;B	0.41848	0.763;0.763;0.019	B;B;B	0.37144	0.242;0.242;0.011	T	0.11372	-1.0590	10	0.48119	T	0.1	.	18.5469	0.91050	0.0:1.0:0.0:0.0	.	1410;1410;1727	C9JRK3;Q5T5P2-3;Q5T5P2	.;.;SKT_HUMAN	L	1410;1727;1410	ENSP00000365637:P1727L;ENSP00000365634:P1410L	ENSP00000365634:P1410L	P	+	2	0	KIAA1217	24873385	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	3.373000	0.52394	2.376000	0.81061	0.655000	0.94253	CCC	-	KIAA1217	-	NULL		0.502	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	0	0	0	27	27	139	0.00	0.00	C	NM_019590		24833379	+1	6	38	15	99	tier1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	28.57	27.54	SNP	1.000	T	6	15
ISPD	729920	genome.wustl.edu	37	7	16317841	16317841	+	Silent	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:16317841G>C	ENST00000407010.2	-	6	845	c.846C>G	c.(844-846)tcC>tcG	p.S282S	ISPD_ENST00000479493.1_5'UTR|ISPD_ENST00000399310.3_Silent_p.S232S	NM_001101426.3	NP_001094896.1	A4D126	ISPD_HUMAN	isoprenoid synthase domain containing	282					axon guidance (GO:0007411)|isoprenoid biosynthetic process (GO:0008299)|protein O-linked mannosylation (GO:0035269)		nucleotidyltransferase activity (GO:0016779)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)	9						AAATCTCTTGGGAAATTCTCT	0.303										Multiple Myeloma(15;0.18)			ENSG00000214960																																					0													39.0	38.0	38.0					7																	16317841		1784	4057	5841	SO:0001819	synonymous_variant	0			-	AK124805		7p21.2	2010-03-19			ENSG00000214960	ENSG00000214960			37276	protein-coding gene	gene with protein product	"""notch1-induced protein"", ""4-diphosphocytidyl-2C-methyl-D-erythritol synthase homolog (Arabidopsis)"""	614631				11181995	Standard	NM_001101417		Approved	hCG_1745121, IspD, Nip	uc010ktx.2	A4D126	OTTHUMG00000152447	ENST00000407010.2:c.846C>G	7.37:g.16317841G>C			A8MU35|H9KVB2	Silent	SNP	pfam_IspD	p.S282	ENST00000407010.2	37	c.846		7																																																																																			-	ISPD	-	NULL		0.303	ISPD-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ISPD	HGNC	protein_coding	OTTHUMT00000326252.4	0	0	0	79	79	63	0.00	0.00	G	NM_001101426		16317841	-1	20	7	63	53	tier1	no_errors	ENST00000407010	ensembl	human	known	74_37	silent	24.10	11.67	SNP	0.998	C	20	63
OR4A5	81318	genome.wustl.edu	37	11	51412103	51412103	+	Missense_Mutation	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:51412103T>G	ENST00000319760.6	-	1	345	c.293A>C	c.(292-294)cAg>cCg	p.Q98P		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	98						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				TATAAATAGCTGGCCCATGCA	0.433													ENSG00000221840																																					0													65.0	67.0	66.0					11																	51412103		2201	4296	6497	SO:0001583	missense	0			-	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.293A>C	11.37:g.51412103T>G	ENSP00000367664:p.Gln98Pro		Q6IF84	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q98P	ENST00000319760.6	37	c.293	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	10.73	1.433290	0.25813	.	.	ENSG00000221840	ENST00000319760	T	0.01240	5.12	1.93	1.93	0.25924	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45126	D	0.000391	T	0.15392	0.0371	H	0.99794	4.785	0.36724	D	0.881348	D	0.69078	0.997	D	0.68483	0.958	T	0.21042	-1.0257	10	0.72032	D	0.01	.	7.8263	0.29318	0.0:0.0:0.0:1.0	.	98	Q8NH83	OR4A5_HUMAN	P	98	ENSP00000367664:Q98P	ENSP00000367664:Q98P	Q	-	2	0	OR4A5	51268679	1.000000	0.71417	0.160000	0.22671	0.015000	0.08874	6.676000	0.74498	1.143000	0.42306	0.136000	0.15936	CAG	-	OR4A5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.433	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	0	0	1	61	61	103	0.00	0.96	T	NM_001005272		51412103	-1	17	23	32	52	tier1	no_errors	ENST00000319760	ensembl	human	known	74_37	missense	34.69	30.26	SNP	0.985	G	17	32
CCDC79	283847	genome.wustl.edu	37	16	66811166	66811166	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:66811166G>C	ENST00000558713.2	-	10	997	c.925C>G	c.(925-927)Ctg>Gtg	p.L309V	CCDC79_ENST00000415744.1_Missense_Mutation_p.L309V|CCDC79_ENST00000432602.1_Missense_Mutation_p.L309V|CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000433574.1_Missense_Mutation_p.L309V|CCDC79_ENST00000433154.1_Missense_Mutation_p.L309V			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	309					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						CCTGAATCCAGACTTTCATGA	0.333													ENSG00000249961																																					0													168.0	139.0	148.0					16																	66811166		692	1591	2283	SO:0001583	missense	0			-	AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.925C>G	16.37:g.66811166G>C	ENSP00000462883:p.Leu309Val		A0AUW1	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_ARM-type_fold,superfamily_Homeodomain-like,superfamily_Cytokine_IL1-like,smart_SANT/Myb	p.L309V	ENST00000558713.2	37	c.925		16	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625023	0.28889	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T;T	0.21031	2.03;2.03;2.03;2.03	5.33	3.35	0.38373	Armadillo-like helical (1);Armadillo-type fold (1);	0.093380	0.45126	D	0.000399	T	0.42063	0.1186	M	0.66939	2.045	0.32521	N	0.536196	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.55698	-0.8100	10	0.62326	D	0.03	-5.1105	11.7197	0.51675	0.1473:0.0:0.8527:0.0	.	309;309	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	V	309	ENSP00000463762:L309V;ENSP00000462977:L309V;ENSP00000462037:L309V;ENSP00000462236:L309V	ENSP00000440822:L309V	L	-	1	2	CCDC79	65368667	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.302000	0.51849	1.255000	0.44051	0.655000	0.94253	CTG	-	CCDC79	-	superfamily_ARM-type_fold		0.333	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	CCDC79	HGNC	protein_coding	OTTHUMT00000418864.2	0	0	0	41	41	149	0.00	0.00	G			66811166	-1	12	52	15	56	tier1	no_errors	ENST00000433154	ensembl	human	known	74_37	missense	44.44	48.15	SNP	1.000	C	12	15
FZD3	7976	genome.wustl.edu	37	8	28385628	28385628	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:28385628A>G	ENST00000240093.3	+	5	1829	c.1351A>G	c.(1351-1353)Aca>Gca	p.T451A	FZD3_ENST00000537916.1_Missense_Mutation_p.T451A|RNA5SP259_ENST00000365541.1_RNA	NM_017412.3	NP_059108.1	Q9NPG1	FZD3_HUMAN	frizzled class receptor 3	451					canonical Wnt signaling pathway (GO:0060070)|cell proliferation in midbrain (GO:0033278)|commissural neuron axon guidance (GO:0071679)|establishment of planar polarity (GO:0001736)|facial nucleus development (GO:0021754)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|post-anal tail morphogenesis (GO:0036342)|vasculature development (GO:0001944)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|neuron projection membrane (GO:0032589)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(15)|ovary(1)|prostate(1)|skin(1)	41		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.109)|Kidney(114;0.13)|Colorectal(74;0.23)		CATCTGGGAAACAACGTGGAT	0.398													ENSG00000104290																																					0													130.0	128.0	129.0					8																	28385628		2203	4300	6503	SO:0001583	missense	0			-	AJ272427	CCDS6069.1	8p21	2014-06-27	2014-01-29		ENSG00000104290	ENSG00000104290		"""GPCR / Class F : Frizzled receptors"""	4041	protein-coding gene	gene with protein product		606143	"""frizzled (Drosophila) homolog 3"", ""frizzled homolog 3 (Drosophila)"", ""frizzled 3, seven transmembrane spanning receptor"", ""frizzled family receptor 3"""			10777673, 10873558	Standard	NM_145866		Approved		uc010lvb.3	Q9NPG1	OTTHUMG00000102145	ENST00000240093.3:c.1351A>G	8.37:g.28385628A>G	ENSP00000240093:p.Thr451Ala		A8K615	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.T451A	ENST00000240093.3	37	c.1351	CCDS6069.1	8	.	.	.	.	.	.	.	.	.	.	A	6.457	0.452440	0.12283	.	.	ENSG00000104290	ENST00000537916;ENST00000240093	D;D	0.81579	-1.51;-1.51	5.45	5.45	0.79879	GPCR, family 2-like (1);	0.046680	0.85682	D	0.000000	T	0.76990	0.4065	L	0.37630	1.12	0.52501	D	0.999951	B	0.32862	0.387	B	0.42959	0.403	T	0.71708	-0.4511	10	0.14252	T	0.57	.	14.3149	0.66443	1.0:0.0:0.0:0.0	.	451	Q9NPG1	FZD3_HUMAN	A	451	ENSP00000437489:T451A;ENSP00000240093:T451A	ENSP00000240093:T451A	T	+	1	0	FZD3	28441547	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.576000	0.82467	2.060000	0.61445	0.460000	0.39030	ACA	-	FZD3	-	pfam_Frizzled,pfscan_GPCR_2-like		0.398	FZD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD3	HGNC	protein_coding	OTTHUMT00000219986.2	0	0	0	30	30	122	0.00	0.00	A	NM_145866		28385628	+1	6	38	14	112	tier1	no_errors	ENST00000240093	ensembl	human	known	74_37	missense	30.00	25.33	SNP	1.000	G	6	14
VIL1	7429	genome.wustl.edu	37	2	219296835	219296835	+	Missense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:219296835G>A	ENST00000248444.5	+	12	1358	c.1270G>A	c.(1270-1272)Ggc>Agc	p.G424S	VIL1_ENST00000392114.2_Missense_Mutation_p.G113S	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	424	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTTCTATGGGGGCGACTGCTA	0.597													ENSG00000127831																																					0													94.0	72.0	79.0					2																	219296835		2203	4300	6503	SO:0001583	missense	0			-	X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1270G>A	2.37:g.219296835G>A	ENSP00000248444:p.Gly424Ser		B2R9A7|Q53S11|Q96AC8	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.G424S	ENST00000248444.5	37	c.1270	CCDS2417.1	2	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022892	0.54683	.	.	ENSG00000127831	ENST00000248444;ENST00000392114	T;T	0.59083	1.37;0.29	4.57	3.69	0.42338	Gelsolin domain (1);	0.142245	0.45867	D	0.000324	T	0.80628	0.4659	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85050	0.0928	10	0.72032	D	0.01	-17.7859	12.7092	0.57080	0.0799:0.0:0.9201:0.0	.	424	P09327	VILI_HUMAN	S	424;113	ENSP00000248444:G424S;ENSP00000375962:G113S	ENSP00000248444:G424S	G	+	1	0	VIL1	219005079	1.000000	0.71417	0.178000	0.23040	0.002000	0.02628	9.642000	0.98461	1.162000	0.42619	-0.258000	0.10820	GGC	-	VIL1	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin		0.597	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3	0	0	0	25	25	74	0.00	0.00	G	NM_007127		219296835	+1	8	34	10	32	tier1	no_errors	ENST00000248444	ensembl	human	known	74_37	missense	44.44	51.52	SNP	1.000	A	8	10
TEX2	55852	genome.wustl.edu	37	17	62291465	62291465	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:62291465A>G	ENST00000583097.1	-	2	285	c.113T>C	c.(112-114)tTc>tCc	p.F38S	TEX2_ENST00000584379.1_Missense_Mutation_p.F38S|TEX2_ENST00000258991.3_Missense_Mutation_p.F38S			Q8IWB9	TEX2_HUMAN	testis expressed 2	38					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GGATGCCGAGAAGTGAATGGC	0.562													ENSG00000136478																																					0													109.0	100.0	103.0					17																	62291465		2203	4300	6503	SO:0001583	missense	0			-	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.113T>C	17.37:g.62291465A>G	ENSP00000462665:p.Phe38Ser		Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	pfam_DUF2404	p.F38S	ENST00000583097.1	37	c.113		17	.	.	.	.	.	.	.	.	.	.	A	12.43	1.937037	0.34189	.	.	ENSG00000136478	ENST00000258991	T	0.58506	0.33	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.67627	0.2913	L	0.36672	1.1	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.996	T	0.71457	-0.4587	10	0.87932	D	0	-15.96	14.8276	0.70125	1.0:0.0:0.0:0.0	.	38;38	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	S	38	ENSP00000258991:F38S	ENSP00000258991:F38S	F	-	2	0	TEX2	59645197	1.000000	0.71417	1.000000	0.80357	0.862000	0.49288	8.962000	0.93254	1.923000	0.55706	0.254000	0.18369	TTC	-	TEX2	-	NULL		0.562	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	HGNC	protein_coding	OTTHUMT00000443745.1	0	0	0	41	41	85	0.00	0.00	A	NM_018469		62291465	-1	8	23	29	140	tier1	no_errors	ENST00000258991	ensembl	human	known	74_37	missense	21.62	14.02	SNP	1.000	G	8	29
PTHLH	5744	genome.wustl.edu	37	12	28122519	28122519	+	Intron	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:28122519C>A	ENST00000545234.1	-	4	519				RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000535992.1_Intron|PTHLH_ENST00000538310.1_5'Flank|PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000395868.3_Intron|PTHLH_ENST00000354417.3_Intron|PTHLH_ENST00000539239.1_5'Flank|PTHLH_ENST00000201015.4_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					CTCCGCTCCCCCTTTTTAGCC	0.527													ENSG00000257042																																					0																																										SO:0001627	intron_variant	0			-		CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.22-70G>T	12.37:g.28122519C>A			Q15251|Q6FH74	R	SNP	-	NULL	ENST00000545234.1	37	NULL	CCDS44853.1	12																																																																																			-	RP11-993B23.3	-	-		0.527	PTHLH-001	KNOWN	basic|CCDS	protein_coding	ENSG00000257042	Clone_based_vega_gene	protein_coding	OTTHUMT00000402913.1	0	0	0	85	85	114	0.00	0.00	C	NM_198965		28122519	+1	22	33	44	63	tier1	no_errors	ENST00000538113	ensembl	human	known	74_37	rna	33.33	34.38	SNP	0.000	A	22	44
TMBIM6	7009	genome.wustl.edu	37	12	50156676	50156676	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:50156676A>G	ENST00000267115.5	+	10	796	c.711A>G	c.(709-711)aaA>aaG	p.K237K	TMBIM6_ENST00000395006.4_Silent_p.K237K|TMBIM6_ENST00000549385.1_Silent_p.K237K|TMBIM6_ENST00000547798.1_Silent_p.K200K|TMBIM6_ENST00000552699.1_Silent_p.K295K|TMBIM6_ENST00000423828.1_Silent_p.K295K	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6	237					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						AAGAGAAGAAATGAAGTGACC	0.368											OREG0021802	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000139644																																					0													139.0	151.0	147.0					12																	50156676		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.711A>G	12.37:g.50156676A>G		967	B2R5M4|F8W034|O14938|Q643A7|Q96J50	Silent	SNP	pfam_Bax_inhibitor_1-related	p.K295	ENST00000267115.5	37	c.885	CCDS31797.1	12																																																																																			-	TMBIM6	-	NULL		0.368	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TMBIM6	HGNC	protein_coding	OTTHUMT00000405289.1	0	0	1	73	73	181	0.00	0.55	A	NM_003217		50156676	+1	19	66	32	109	tier1	no_errors	ENST00000423828	ensembl	human	known	74_37	silent	37.25	37.71	SNP	1.000	G	19	32
IL26	55801	genome.wustl.edu	37	12	68618939	68618939	+	Missense_Mutation	SNP	A	A	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:68618939A>C	ENST00000229134.4	-	3	417	c.353T>G	c.(352-354)tTg>tGg	p.L118W	IFNG-AS1_ENST00000536914.1_RNA	NM_018402.1	NP_060872.1	Q9NPH9	IL26_HUMAN	interleukin 26	118					cell-cell signaling (GO:0007267)|negative regulation of epithelial cell proliferation (GO:0050680)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000515)		ACAGTGGCTCAATTTCTGCCT	0.418													ENSG00000111536																																					0													96.0	89.0	91.0					12																	68618939		2203	4300	6503	SO:0001583	missense	0			-	AJ251549	CCDS8981.1	12q15	2008-08-04			ENSG00000111536	ENSG00000111536		"""Interleukins and interleukin receptors"""	17119	protein-coding gene	gene with protein product		605679				10729163, 11528524	Standard	NM_018402		Approved	AK155, IL-26	uc001stx.1	Q9NPH9	OTTHUMG00000169114	ENST00000229134.4:c.353T>G	12.37:g.68618939A>C	ENSP00000229134:p.Leu118Trp			Missense_Mutation	SNP	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core	p.L118W	ENST00000229134.4	37	c.353	CCDS8981.1	12	.	.	.	.	.	.	.	.	.	.	A	9.264	1.043936	0.19748	.	.	ENSG00000111536	ENST00000229134	D	0.87334	-2.24	5.19	1.15	0.20763	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.719989	0.12032	N	0.505858	D	0.82332	0.5014	L	0.55481	1.735	0.09310	N	1	B	0.28552	0.215	B	0.33196	0.159	T	0.68435	-0.5409	9	.	.	.	-13.4042	5.7806	0.18304	0.5895:0.3225:0.088:0.0	.	118	Q9NPH9	IL26_HUMAN	W	118	ENSP00000229134:L118W	.	L	-	2	0	IL26	66905206	0.237000	0.23815	0.016000	0.15963	0.017000	0.09413	0.826000	0.27407	0.014000	0.14944	0.443000	0.29094	TTG	-	IL26	-	pfam_IL-10/19/20/24/26_fam,superfamily_4_helix_cytokine-like_core		0.418	IL26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL26	HGNC	protein_coding	OTTHUMT00000402302.1	0	0	1	42	42	138	0.00	0.72	A	NM_018402		68618939	-1	6	30	24	65	tier1	no_errors	ENST00000229134	ensembl	human	known	74_37	missense	20.00	31.58	SNP	0.056	C	6	24
URGCP	55665	genome.wustl.edu	37	7	43918207	43918207	+	Silent	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:43918207C>T	ENST00000453200.1	-	6	1348	c.855G>A	c.(853-855)ccG>ccA	p.P285P	URGCP_ENST00000443736.1_Silent_p.P242P|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000447717.3_Silent_p.P242P|URGCP_ENST00000336086.6_Silent_p.P242P|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000223341.7_Silent_p.P242P|URGCP_ENST00000402306.3_Silent_p.P276P			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	285					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCCTGTGGCCCGGGCTGAGGA	0.592													ENSG00000106608																																					0													41.0	45.0	44.0					7																	43918207		2009	4163	6172	SO:0001819	synonymous_variant	0			-		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.855G>A	7.37:g.43918207C>T			E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	superfamily_P-loop_NTPase,prints_GTP_binding_domain	p.P285	ENST00000453200.1	37	c.855	CCDS47578.1	7																																																																																			-	URGCP	-	NULL		0.592	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	URGCP	HGNC	protein_coding	OTTHUMT00000338995.1	0	0	0	36	36	98	0.00	0.00	C	NM_001077664		43918207	-1	11	26	32	77	tier1	no_errors	ENST00000453200	ensembl	human	known	74_37	silent	25.58	25.24	SNP	0.000	T	11	32
PORCN	64840	genome.wustl.edu	37	X	48370298	48370298	+	Silent	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:48370298C>T	ENST00000326194.6	+	3	391	c.348C>T	c.(346-348)gaC>gaT	p.D116D	PORCN_ENST00000359882.4_Silent_p.D116D|PORCN_ENST00000537758.1_Silent_p.D116D|PORCN_ENST00000355961.4_Silent_p.D116D|PORCN_ENST00000355092.3_Silent_p.D116D|PORCN_ENST00000367574.4_Silent_p.D45D|PORCN_ENST00000361988.3_Silent_p.D116D	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	116					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						ACATGGTAGACACCGTGACAT	0.607											OREG0019764	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000102312																																					0													164.0	111.0	129.0					X																	48370298		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.348C>T	X.37:g.48370298C>T		954	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Silent	SNP	pfam_MBOAT_fam	p.D116	ENST00000326194.6	37	c.348	CCDS14299.1	X																																																																																			-	PORCN	-	NULL		0.607	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	HGNC	protein_coding	OTTHUMT00000356990.1	0	0	0	22	22	94	0.00	0.00	C	NM_022825		48370298	+1	4	41	7	95	tier1	no_errors	ENST00000326194	ensembl	human	known	74_37	silent	36.36	30.15	SNP	0.988	T	4	7
OR2M3	127062	genome.wustl.edu	37	1	248366777	248366777	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:248366777G>C	ENST00000456743.1	+	1	446	c.408G>C	c.(406-408)atG>atC	p.M136I		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	136						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			CCAATCTCATGAGCCCTAAAA	0.443													ENSG00000228198																																					0													216.0	216.0	216.0					1																	248366777		2203	4300	6503	SO:0001583	missense	0			-		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.408G>C	1.37:g.248366777G>C	ENSP00000389625:p.Met136Ile		B9EH06|Q6IEY0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M136I	ENST00000456743.1	37	c.408	CCDS31107.1	1	.	.	.	.	.	.	.	.	.	.	G	12.24	1.877669	0.33162	.	.	ENSG00000228198	ENST00000456743	T	0.00551	6.65	2.55	2.55	0.30701	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38605	U	0.001631	T	0.01092	0.0036	M	0.86953	2.85	0.26784	N	0.969532	B	0.26195	0.144	B	0.30572	0.117	T	0.12293	-1.0553	10	0.56958	D	0.05	.	13.1134	0.59288	0.0:0.0:1.0:0.0	.	136	Q8NG83	OR2M3_HUMAN	I	136	ENSP00000389625:M136I	ENSP00000389625:M136I	M	+	3	0	OR2M3	246433400	0.993000	0.37304	0.176000	0.23000	0.010000	0.07245	1.617000	0.36943	1.425000	0.47237	0.405000	0.27470	ATG	-	OR2M3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.443	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M3	HGNC	protein_coding	OTTHUMT00000097355.1	0	0	0	132	132	33	0.00	0.00	G	NM_001004689		248366777	+1	28	12	72	57	tier1	no_errors	ENST00000456743	ensembl	human	known	74_37	missense	28.00	17.39	SNP	0.977	C	28	72
ABCA13	154664	genome.wustl.edu	37	7	48427476	48427476	+	Missense_Mutation	SNP	G	G	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:48427476G>T	ENST00000435803.1	+	36	11417	c.11393G>T	c.(11392-11394)aGt>aTt	p.S3798I		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3798					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TATTGGAAGAGTGTGGGTTTC	0.318													ENSG00000179869																																					0													114.0	110.0	111.0					7																	48427476		1815	4078	5893	SO:0001583	missense	0			-	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11393G>T	7.37:g.48427476G>T	ENSP00000411096:p.Ser3798Ile		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S3798I	ENST00000435803.1	37	c.11393	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	13.04	2.117171	0.37339	.	.	ENSG00000179869	ENST00000435803	D	0.85861	-2.04	5.36	-3.88	0.04205	.	0.609607	0.14957	N	0.288612	T	0.79076	0.4385	L	0.52011	1.625	0.09310	N	0.999997	D;P	0.53151	0.958;0.718	P;B	0.45506	0.483;0.316	T	0.73219	-0.4052	10	0.66056	D	0.02	.	8.1808	0.31309	0.6617:0.1384:0.1999:0.0	.	1500;3798	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	I	3798	ENSP00000411096:S3798I	ENSP00000411096:S3798I	S	+	2	0	ABCA13	48398022	0.040000	0.19996	0.000000	0.03702	0.061000	0.15899	0.262000	0.18460	-0.707000	0.05022	0.655000	0.94253	AGT	-	ABCA13	-	NULL		0.318	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	0	0	0	26	26	101	0.00	0.00	G	NM_152701		48427476	+1	9	33	50	91	tier1	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	15.25	26.61	SNP	0.003	T	9	50
WDR36	134430	genome.wustl.edu	37	5	110439580	110439580	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:110439580A>T	ENST00000513710.2	+	7	865	c.861A>T	c.(859-861)caA>caT	p.Q287H	WDR36_ENST00000505303.1_Missense_Mutation_p.Q231H|WDR36_ENST00000506538.2_Missense_Mutation_p.Q287H			Q8NI36	WDR36_HUMAN	WD repeat domain 36	287					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AGTTTCGTCAAGACTGGGGAC	0.333													ENSG00000134987																																					0													63.0	66.0	65.0					5																	110439580		2201	4298	6499	SO:0001583	missense	0			-	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.861A>T	5.37:g.110439580A>T	ENSP00000424628:p.Gln287His		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q287H	ENST00000513710.2	37	c.861	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	A	18.46	3.629625	0.67015	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.81078	-1.45;-1.45;3.35	5.21	2.83	0.33086	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.85084	0.5616	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83624	0.0141	10	0.87932	D	0	-13.1049	8.9224	0.35619	0.774:0.0:0.226:0.0	.	287	Q8NI36	WDR36_HUMAN	H	287;287;231	ENSP00000423067:Q287H;ENSP00000424628:Q287H;ENSP00000422158:Q231H	ENSP00000422158:Q231H	Q	+	3	2	WDR36	110467479	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.558000	0.36309	0.400000	0.25396	0.260000	0.18958	CAA	-	WDR36	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.333	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	0	0	0	55	55	157	0.00	0.00	A	NM_139281		110439580	+1	12	35	15	77	tier1	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	44.44	31.25	SNP	1.000	T	12	15
EFCC1	79825	genome.wustl.edu	37	3	128753020	128753020	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:128753020A>G	ENST00000480450.1	+	5	1297	c.1297A>G	c.(1297-1299)Acg>Gcg	p.T433A	EFCC1_ENST00000436022.2_5'UTR			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	433							calcium ion binding (GO:0005509)										TGATGACCAGACGGCGGAGAA	0.622													ENSG00000114654																																					0													83.0	80.0	81.0					3																	128753020		2203	4300	6503	SO:0001583	missense	0			-	AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1297A>G	3.37:g.128753020A>G	ENSP00000420075:p.Thr433Ala		A8MYE2	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.T433A	ENST00000480450.1	37	c.1297	CCDS3054.2	3	.	.	.	.	.	.	.	.	.	.	A	8.940	0.965677	0.18583	.	.	ENSG00000114654	ENST00000480450	T	0.45668	0.89	4.47	2.04	0.26737	.	.	.	.	.	T	0.24774	0.0601	L	0.38531	1.155	0.80722	D	1	B	0.20671	0.047	B	0.11329	0.006	T	0.06826	-1.0805	9	0.09338	T	0.73	.	4.9737	0.14129	0.621:0.2053:0.0:0.1738	.	433	Q9HA90	CCD48_HUMAN	A	433	ENSP00000420075:T433A	ENSP00000420075:T433A	T	+	1	0	CCDC48	130235710	0.961000	0.32948	0.115000	0.21578	0.945000	0.59286	2.032000	0.41127	0.202000	0.20498	0.260000	0.18958	ACG	-	EFCC1	-	NULL		0.622	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EFCC1	HGNC	protein_coding	OTTHUMT00000352832.1	0	0	0	43	43	104	0.00	0.00	A	NM_024768		128753020	+1	12	31	28	69	tier1	no_errors	ENST00000480450	ensembl	human	novel	74_37	missense	30.00	31.00	SNP	0.945	G	12	28
CHRD	8646	genome.wustl.edu	37	3	184101126	184101126	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:184101126G>C	ENST00000204604.1	+	11	1486	c.1240G>C	c.(1240-1242)Gat>Cat	p.D414H	CHRD_ENST00000450923.1_Missense_Mutation_p.D414H|CHRD_ENST00000545352.1_Missense_Mutation_p.D44H|CHRD_ENST00000348986.3_Missense_Mutation_p.D414H|EIF2B5_ENST00000444495.1_Intron	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	414	CHRD 3. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTGTGGGGCTGATGCCCTGAT	0.607													ENSG00000090539																																					0													85.0	78.0	80.0					3																	184101126		2203	4300	6503	SO:0001583	missense	0			-	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1240G>C	3.37:g.184101126G>C	ENSP00000204604:p.Asp414His		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	pfam_CHRD,pfam_VWF_C,smart_VWF_C,smart_CHRD,pirsf_Chordin,pfscan_CHRD,pfscan_VWF_C	p.D414H	ENST00000204604.1	37	c.1240	CCDS3266.1	3	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928831	0.73327	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.46063	0.88;0.88;2.38;0.88	4.65	4.65	0.58169	CHRD (3);	0.057280	0.64402	D	0.000002	T	0.63117	0.2484	M	0.65975	2.015	0.58432	D	0.999992	D;D;D;D	0.89917	0.98;1.0;0.999;1.0	D;D;D;D	0.81914	0.93;0.983;0.984;0.995	T	0.67428	-0.5673	10	0.72032	D	0.01	-11.9283	16.5167	0.84302	0.0:0.0:1.0:0.0	.	44;414;414;414	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	H	414;414;414;44;127	ENSP00000204604:D414H;ENSP00000408972:D414H;ENSP00000334036:D414H;ENSP00000442948:D44H	ENSP00000204604:D414H	D	+	1	0	CHRD	185583820	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	5.200000	0.65158	2.306000	0.77630	0.462000	0.41574	GAT	-	CHRD	-	pfam_CHRD,smart_CHRD,pirsf_Chordin,pfscan_CHRD		0.607	CHRD-001	KNOWN	basic|CCDS	protein_coding	CHRD	HGNC	protein_coding	OTTHUMT00000280432.1	0	0	0	85	85	106	0.00	0.00	G	NM_003741		184101126	+1	10	37	47	90	tier1	no_errors	ENST00000204604	ensembl	human	known	74_37	missense	17.54	29.13	SNP	0.998	C	10	47
MYOM2	9172	genome.wustl.edu	37	8	2033509	2033509	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:2033509A>T	ENST00000262113.4	+	14	1772	c.1631A>T	c.(1630-1632)tAc>tTc	p.Y544F	MYOM2_ENST00000523438.1_Intron	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	544	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CCGCTCATGTACTTCATTGAG	0.597													ENSG00000036448																																					0													54.0	48.0	50.0					8																	2033509		2203	4300	6503	SO:0001583	missense	0			-		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.1631A>T	8.37:g.2033509A>T	ENSP00000262113:p.Tyr544Phe		Q7Z3Y2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Y544F	ENST00000262113.4	37	c.1631	CCDS5957.1	8	.	.	.	.	.	.	.	.	.	.	A	17.07	3.295025	0.60086	.	.	ENSG00000036448	ENST00000262113	T	0.75704	-0.96	5.75	5.75	0.90469	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.87669	0.6235	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89612	0.3842	10	0.87932	D	0	.	16.072	0.80941	1.0:0.0:0.0:0.0	.	544	P54296	MYOM2_HUMAN	F	544	ENSP00000262113:Y544F	ENSP00000262113:Y544F	Y	+	2	0	MYOM2	2020916	1.000000	0.71417	0.955000	0.39395	0.215000	0.24574	9.001000	0.93568	2.188000	0.69820	0.529000	0.55759	TAC	-	MYOM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.597	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	0	0	0	56	56	81	0.00	0.00	A	NM_003970		2033509	+1	8	28	23	47	tier1	no_errors	ENST00000262113	ensembl	human	known	74_37	missense	25.81	37.33	SNP	1.000	T	8	23
GREB1	9687	genome.wustl.edu	37	2	11765428	11765428	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:11765428A>G	ENST00000381486.2	+	24	4596	c.4296A>G	c.(4294-4296)atA>atG	p.I1432M	GREB1_ENST00000396123.1_Missense_Mutation_p.I430M|GREB1_ENST00000234142.5_Missense_Mutation_p.I1432M	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1432						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		ATCAGGGTATAAAGAGTGAAG	0.468													ENSG00000196208																									Ovarian(39;850 945 2785 23371 33093)												0													226.0	210.0	215.0					2																	11765428		1906	4129	6035	SO:0001583	missense	0			-		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4296A>G	2.37:g.11765428A>G	ENSP00000370896:p.Ile1432Met		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.I1432M	ENST00000381486.2	37	c.4296	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	A	2.707	-0.269747	0.05716	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.23147	3.24;3.24;1.92	4.87	-8.19	0.01049	.	1.080900	0.06913	N	0.808094	T	0.17492	0.0420	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.11329	0.006	T	0.25537	-1.0129	10	0.30854	T	0.27	0.0274	11.8408	0.52353	0.1874:0.325:0.4876:0.0	.	1432	Q4ZG55	GREB1_HUMAN	M	1432;1432;430	ENSP00000370896:I1432M;ENSP00000234142:I1432M;ENSP00000379429:I430M	ENSP00000234142:I1432M	I	+	3	3	GREB1	11682879	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-0.776000	0.04674	-1.736000	0.01352	-0.441000	0.05720	ATA	-	GREB1	-	NULL		0.468	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	0	0	0	50	50	131	0.00	0.00	A	NM_014668		11765428	+1	6	30	22	79	tier1	no_errors	ENST00000234142	ensembl	human	known	74_37	missense	21.43	27.52	SNP	0.002	G	6	22
GADL1	339896	genome.wustl.edu	37	3	30842399	30842399	+	Missense_Mutation	SNP	C	C	G	rs530115326		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:30842399C>G	ENST00000282538.5	-	12	1382	c.1232G>C	c.(1231-1233)cGt>cCt	p.R411P	GADL1_ENST00000454381.3_Missense_Mutation_p.R411P	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	411					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						AGCAAGAGCACGATTAACTCT	0.473													ENSG00000144644																																					0													117.0	109.0	112.0					3																	30842399		2203	4300	6503	SO:0001583	missense	0			-	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1232G>C	3.37:g.30842399C>G	ENSP00000282538:p.Arg411Pro			Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	p.R411P	ENST00000282538.5	37	c.1232	CCDS2649.2	3	.	.	.	.	.	.	.	.	.	.	C	18.11	3.551078	0.65311	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	T;T	0.44482	0.92;0.92	5.47	4.6	0.57074	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.121374	0.51477	D	0.000087	T	0.68723	0.3032	M	0.90650	3.135	0.40883	D	0.98401	D	0.67145	0.996	D	0.67725	0.953	T	0.76539	-0.2922	10	0.54805	T	0.06	.	14.4309	0.67249	0.0:0.9284:0.0:0.0716	.	411	Q6ZQY3	GADL1_HUMAN	P	411	ENSP00000282538:R411P;ENSP00000427059:R411P	ENSP00000282538:R411P	R	-	2	0	GADL1	30817403	1.000000	0.71417	0.999000	0.59377	0.898000	0.52572	3.754000	0.55189	1.310000	0.45006	0.585000	0.79938	CGT	-	GADL1	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase		0.473	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADL1	HGNC	protein_coding	OTTHUMT00000253106.2	0	0	0	45	45	53	0.00	0.00	C	NM_207359		30842399	-1	9	18	34	91	tier1	no_errors	ENST00000282538	ensembl	human	known	74_37	missense	20.93	16.36	SNP	0.970	G	9	34
BAIAP2L1	55971	genome.wustl.edu	37	7	97984424	97984424	+	Silent	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:97984424T>A	ENST00000005260.8	-	3	359	c.144A>T	c.(142-144)ggA>ggT	p.G48G	BAIAP2L1_ENST00000462558.1_5'UTR	NM_018842.4	NP_061330.2	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	48	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|response to bacterium (GO:0009617)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)	23	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			AGTAGGCTTTTCCTGCCAGGA	0.488													ENSG00000006453																																					0													103.0	83.0	90.0					7																	97984424		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF119666	CCDS34687.1	7q22.1	2012-10-04			ENSG00000006453	ENSG00000006453			21649	protein-coding gene	gene with protein product		611877					Standard	NM_018842		Approved	IRTKS	uc003upj.3	Q9UHR4	OTTHUMG00000165117	ENST00000005260.8:c.144A>T	7.37:g.97984424T>A			A4D268|Q75L21|Q75L22|Q96CV4|Q9H5F5|Q9Y2M8	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.G48	ENST00000005260.8	37	c.144	CCDS34687.1	7																																																																																			-	BAIAP2L1	-	pfam_IRSp53/MIM_homology_IMD		0.488	BAIAP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L1	HGNC	protein_coding	OTTHUMT00000334681.1	0	0	0	37	37	123	0.00	0.00	T	NM_018842		97984424	-1	13	40	15	105	tier1	no_errors	ENST00000005260	ensembl	human	known	74_37	silent	46.43	27.59	SNP	1.000	A	13	15
NPR2	4882	genome.wustl.edu	37	9	35799691	35799691	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr9:35799691C>A	ENST00000342694.2	+	3	1205	c.950C>A	c.(949-951)gCc>gAc	p.A317D		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	317					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	CTGATAAGAGCCCGGGAAGAC	0.522													ENSG00000159899																																					0													123.0	123.0	123.0					9																	35799691		2203	4300	6503	SO:0001583	missense	0			-	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.950C>A	9.37:g.35799691C>A	ENSP00000341083:p.Ala317Asp		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.A317D	ENST00000342694.2	37	c.950	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561432	0.86335	.	.	ENSG00000159899	ENST00000342694	D	0.83250	-1.7	5.69	5.69	0.88448	Extracellular ligand-binding receptor (1);	0.000000	0.43416	D	0.000575	D	0.90246	0.6950	M	0.82323	2.585	0.80722	D	1	D;P	0.59767	0.986;0.908	D;P	0.63957	0.92;0.717	D	0.87593	0.2492	10	0.18710	T	0.47	.	16.9713	0.86301	0.0:1.0:0.0:0.0	.	317;317	P20594-2;P20594	.;ANPRB_HUMAN	D	317	ENSP00000341083:A317D	ENSP00000341083:A317D	A	+	2	0	NPR2	35789691	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.146000	0.71777	2.699000	0.92147	0.655000	0.94253	GCC	-	NPR2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.522	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	0	0	0	62	62	144	0.00	0.00	C			35799691	+1	12	32	63	150	tier1	no_errors	ENST00000342694	ensembl	human	known	74_37	missense	16.00	17.58	SNP	1.000	A	12	63
ZNF77	58492	genome.wustl.edu	37	19	2944942	2944942	+	5'Flank	SNP	G	G	A	rs566476995		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:2944942G>A	ENST00000314531.4	-	0	0				ZNF77_ENST00000588050.1_5'UTR	NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCGGGGAAGCGCGCAAGGC	0.672													ENSG00000175691	G|||	1	0.000199681	0.0	0.0	5008	,	,		15288	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001631	upstream_gene_variant	0			-	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935			19.37:g.2944942G>A	Exception_encountered		Q86XJ3|Q9NPP0	R	SNP	-	NULL	ENST00000314531.4	37	NULL	CCDS12099.1	19																																																																																			-	ZNF77	-	-		0.672	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF77	HGNC	protein_coding	OTTHUMT00000451924.1	0	0	0	10	10	45	0.00	0.00	G	NM_021217		2944942	-1	7	28	5	30	tier1	no_errors	ENST00000588050	ensembl	human	known	74_37	rna	58.33	48.28	SNP	0.012	A	7	5
GPBP1L1	60313	genome.wustl.edu	37	1	46106026	46106026	+	Silent	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:46106026T>C	ENST00000290795.3	-	7	1821	c.600A>G	c.(598-600)aaA>aaG	p.K200K	GPBP1L1_ENST00000355105.3_Silent_p.K200K			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	200					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					CTTTGGAAACTTTTTTGATAA	0.463													ENSG00000159592																																					0													258.0	244.0	248.0					1																	46106026		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.600A>G	1.37:g.46106026T>C			D3DQ10|Q9H751	Silent	SNP	NULL	p.K200	ENST00000290795.3	37	c.600	CCDS528.1	1																																																																																			-	GPBP1L1	-	NULL		0.463	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBP1L1	HGNC	protein_coding	OTTHUMT00000098375.1	0	0	0	104	104	86	0.00	0.00	T	NM_021639		46106026	-1	46	59	19	50	tier1	no_errors	ENST00000290795	ensembl	human	known	74_37	silent	70.77	54.13	SNP	1.000	C	46	19
GPR158	57512	genome.wustl.edu	37	10	25464562	25464562	+	Silent	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:25464562G>A	ENST00000376351.3	+	1	572	c.213G>A	c.(211-213)gcG>gcA	p.A71A	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	71					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						CCATCTTGGCGCAGAAACTCG	0.682													ENSG00000151025																																					0													25.0	26.0	26.0					10																	25464562		2200	4289	6489	SO:0001819	synonymous_variant	0			-	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.213G>A	10.37:g.25464562G>A			Q6QR81|Q9ULT3	Silent	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.A71	ENST00000376351.3	37	c.213	CCDS31166.1	10																																																																																			-	GPR158	-	NULL		0.682	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	0	0	0	25	25	33	0.00	0.00	G	XM_166110		25464562	+1	12	2	15	12	tier1	no_errors	ENST00000376351	ensembl	human	known	74_37	silent	44.44	14.29	SNP	1.000	A	12	15
TENM2	57451	genome.wustl.edu	37	5	167630814	167630814	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:167630814A>G	ENST00000518659.1	+	18	3590	c.3551A>G	c.(3550-3552)cAc>cGc	p.H1184R	TENM2_ENST00000545108.1_Missense_Mutation_p.H1184R|TENM2_ENST00000520394.1_Missense_Mutation_p.H952R|TENM2_ENST00000519204.1_Missense_Mutation_p.H1063R|TENM2_ENST00000403607.2_Missense_Mutation_p.H1008R	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1184					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CTAGACAAACACCACATCCTC	0.502													ENSG00000145934																																					0													177.0	170.0	172.0					5																	167630814		1932	4134	6066	SO:0001583	missense	0			-	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3551A>G	5.37:g.167630814A>G	ENSP00000429430:p.His1184Arg		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.H1184R	ENST00000518659.1	37	c.3551		5	.	.	.	.	.	.	.	.	.	.	a	23.5	4.419880	0.83559	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.93426	-2.75;-2.71;-2.89;-3.14;-3.22	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.97269	0.9107	M	0.91090	3.175	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;0.984	D;D;D	0.91635	0.999;0.998;0.964	D	0.98258	1.0497	10	0.87932	D	0	.	15.1221	0.72453	1.0:0.0:0.0:0.0	.	1184;1184;952	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	R	1184;1184;1063;952;1008	ENSP00000429430:H1184R;ENSP00000438635:H1184R;ENSP00000428964:H1063R;ENSP00000427874:H952R;ENSP00000384905:H1008R	ENSP00000384905:H1008R	H	+	2	0	ODZ2	167563392	1.000000	0.71417	0.974000	0.42286	0.990000	0.78478	9.284000	0.95882	2.022000	0.59522	0.524000	0.50904	CAC	-	TENM2	-	superfamily_ConA-like_lec_gl_sf		0.502	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	0	0	0	58	58	119	0.00	0.00	A	NM_001122679		167630814	+1	8	41	39	73	tier1	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	17.02	35.65	SNP	1.000	G	8	39
PARP14	54625	genome.wustl.edu	37	3	122422740	122422740	+	Missense_Mutation	SNP	A	A	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:122422740A>C	ENST00000474629.2	+	7	3499	c.3233A>C	c.(3232-3234)aAa>aCa	p.K1078T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1078	Macro 2. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		ACAGTGCTCAAAACCAGCAGC	0.527													ENSG00000173193																																					0													137.0	142.0	141.0					3																	122422740		2069	4215	6284	SO:0001583	missense	0			-	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3233A>C	3.37:g.122422740A>C	ENSP00000418194:p.Lys1078Thr		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.K1078T	ENST00000474629.2	37	c.3233	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	A	1.143	-0.648893	0.03506	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000398157	T	0.21031	2.03	5.71	-1.59	0.08453	Appr-1-p processing (3);	0.909246	0.09418	N	0.804854	T	0.05502	0.0145	N	0.02011	-0.69	0.09310	N	1	P;B	0.36110	0.537;0.049	B;B	0.36989	0.238;0.034	T	0.23476	-1.0187	10	0.11182	T	0.66	.	1.0628	0.01604	0.2683:0.3641:0.1572:0.2105	.	1078;1078	Q460N5-4;Q460N5	.;PAR14_HUMAN	T	1078;997;74	ENSP00000418194:K1078T	ENSP00000381224:K74T	K	+	2	0	PARP14	123905430	0.000000	0.05858	0.332000	0.25469	0.017000	0.09413	-2.497000	0.00969	0.099000	0.17552	-0.254000	0.11334	AAA	-	PARP14	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom		0.527	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2	0	0	0	68	68	126	0.00	0.00	A	NM_017554		122422740	+1	11	33	35	55	tier1	no_errors	ENST00000474629	ensembl	human	known	74_37	missense	23.91	37.50	SNP	0.007	C	11	35
CTBP1	1487	genome.wustl.edu	37	4	1209885	1209885	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr4:1209885C>T	ENST00000290921.6	-	5	837	c.656G>A	c.(655-657)cGt>cAt	p.R219H	CTBP1_ENST00000382952.3_Missense_Mutation_p.R208H	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1	219					Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		GGTGCTGACACGCTGCAGCCC	0.647													ENSG00000159692																																					0													101.0	83.0	89.0					4																	1209885		2202	4299	6501	SO:0001583	missense	0			-	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.656G>A	4.37:g.1209885C>T	ENSP00000290921:p.Arg219His		Q4W5N3|Q7Z2Q5	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_DP-bd	p.R219H	ENST00000290921.6	37	c.656	CCDS3348.1	4	.	.	.	.	.	.	.	.	.	.	C	17.79	3.476732	0.63737	.	.	ENSG00000159692	ENST00000382952;ENST00000290921	T;T	0.81247	-1.47;-1.47	4.62	3.76	0.43208	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.109914	0.56097	D	0.000035	D	0.86628	0.5978	L	0.54908	1.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.87110	0.2184	10	0.66056	D	0.02	-15.0728	13.929	0.63981	0.1534:0.8466:0.0:0.0	.	219;208	Q13363;Q7Z2Q5	CTBP1_HUMAN;.	H	208;219	ENSP00000372411:R208H;ENSP00000290921:R219H	ENSP00000290921:R219H	R	-	2	0	CTBP1	1199885	1.000000	0.71417	0.795000	0.32087	0.009000	0.06853	7.133000	0.77259	0.901000	0.36495	0.561000	0.74099	CGT	-	CTBP1	-	pfam_D-isomer_2_OHA_DH_D-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_DP-bd		0.647	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1	HGNC	protein_coding	OTTHUMT00000202938.1	0	0	0	37	37	25	0.00	0.00	C	NM_001328		1209885	-1	16	17	18	26	tier1	no_errors	ENST00000290921	ensembl	human	known	74_37	missense	47.06	39.53	SNP	1.000	T	16	18
CCT8L2	150160	genome.wustl.edu	37	22	17073326	17073326	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr22:17073326C>A	ENST00000359963.3	-	1	374	c.115G>T	c.(115-117)Gca>Tca	p.A39S		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	39					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				GTCTGGACTGCAGCCAAGCTG	0.647													ENSG00000198445																																					0													62.0	66.0	65.0					22																	17073326		2203	4300	6503	SO:0001583	missense	0			-	AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.115G>T	22.37:g.17073326C>A	ENSP00000353048:p.Ala39Ser		A4QPH3|Q9UJS3	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1	p.A39S	ENST00000359963.3	37	c.115	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	c	17.88	3.498039	0.64186	.	.	ENSG00000198445	ENST00000359963	T	0.16597	2.33	2.0	2.0	0.26442	.	0.000000	0.38217	U	0.001765	T	0.17916	0.0430	N	0.08118	0	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.02603	-1.1135	10	0.72032	D	0.01	-15.2322	7.4831	0.27417	0.0:1.0:0.0:0.0	.	39	Q96SF2	TCPQM_HUMAN	S	39	ENSP00000353048:A39S	ENSP00000353048:A39S	A	-	1	0	CCT8L2	15453326	0.018000	0.18449	0.008000	0.14137	0.548000	0.35241	0.885000	0.28227	1.126000	0.42016	0.393000	0.25936	GCA	-	CCT8L2	-	superfamily_Cpn60/TCP-1		0.647	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	0	0	0	104	104	13	0.00	0.00	C			17073326	-1	17	4	57	18	tier1	no_errors	ENST00000359963	ensembl	human	known	74_37	missense	22.67	18.18	SNP	0.018	A	17	57
NXPE4	54827	genome.wustl.edu	37	11	114452463	114452463	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:114452463A>G	ENST00000375478.3	-	4	1056	c.876T>C	c.(874-876)agT>agC	p.S292S	NXPE4_ENST00000424261.2_Silent_p.S8S	NM_001077639.1	NP_001071107.1	Q6UWF7	NXPE4_HUMAN	neurexophilin and PC-esterase domain family, member 4	292						extracellular vesicular exosome (GO:0070062)											ATTTGGAGACACTAATTGTAT	0.378													ENSG00000137634																																					0													131.0	126.0	127.0					11																	114452463		1883	4106	5989	SO:0001819	synonymous_variant	0			-	AK000134	CCDS41718.1, CCDS44737.1	11q23.3	2012-06-14	2012-06-11	2012-06-11	ENSG00000137634	ENSG00000137634			23117	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 33"", ""family with sequence similarity 55, member D"""	C11orf33, FAM55D		20056006	Standard	NM_017678		Approved	FLJ20127	uc001ppc.3	Q6UWF7	OTTHUMG00000168291	ENST00000375478.3:c.876T>C	11.37:g.114452463A>G			Q6QDB4|Q9NXP5	Silent	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.S292	ENST00000375478.3	37	c.876	CCDS41718.1	11																																																																																			-	NXPE4	-	NULL		0.378	NXPE4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NXPE4	HGNC	protein_coding	OTTHUMT00000399179.1	0	0	0	33	33	145	0.00	0.00	A	NM_017678		114452463	-1	7	48	21	36	tier1	no_errors	ENST00000375478	ensembl	human	known	74_37	silent	25.00	57.14	SNP	0.007	G	7	21
PMS2P4	5382	genome.wustl.edu	37	7	66767698	66767698	+	RNA	SNP	G	G	C	rs534317461		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:66767698G>C	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		CTGAGCGTTGGTGTTTGGCAC	0.592													ENSG00000106610																																					0																																												0			-	D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767698G>C				R	SNP	-	NULL	ENST00000414507.1	37	NULL		7																																																																																			-	STAG3L4	-	-		0.592	PMS2P4-002	KNOWN	basic	processed_transcript	STAG3L4	HGNC	pseudogene	OTTHUMT00000346632.1	0	0	0	81	81	23	0.00	0.00	G	NR_022007		66767698	+1	35	14	10	12	tier1	no_errors	ENST00000416602	ensembl	human	known	74_37	rna	77.78	53.85	SNP	0.014	C	35	10
FCRL5	83416	genome.wustl.edu	37	1	157512513	157512513	+	Intron	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:157512513G>A	ENST00000361835.3	-	6	1281				FCRL5_ENST00000368190.3_Intron|FCRL5_ENST00000356953.4_Intron|FCRL5_ENST00000368189.3_Intron|FCRL5_ENST00000368191.3_Intron	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5						negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				TCAGTGAGCCGGAGAGTGGAG	0.537													ENSG00000143297																																					0																																										SO:0001627	intron_variant	0			-	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1123+135C>T	1.37:g.157512513G>A			A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	R	SNP	-	NULL	ENST00000361835.3	37	NULL	CCDS1165.1	1																																																																																			-	FCRL5	-	-		0.537	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	0	0	0	15	15	115	0.00	0.00	G	NM_031281		157512513	-1	5	29	26	101	tier1	no_errors	ENST00000481082	ensembl	human	known	74_37	rna	16.13	22.31	SNP	0.000	A	5	26
CST2	1470	genome.wustl.edu	37	20	23807102	23807102	+	Missense_Mutation	SNP	G	G	A	rs112783512	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr20:23807102G>A	ENST00000304725.2	-	1	266	c.196C>T	c.(196-198)Cgc>Tgc	p.R66C		NM_001322.2	NP_001313.1	P09228	CYTT_HUMAN	cystatin SA	66					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of endopeptidase activity (GO:0010951)	extracellular space (GO:0005615)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|cervix(1)|large_intestine(1)|liver(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	10						CGCAGCAGGCGTCTGTAGTAC	0.557													ENSG00000170369																									Pancreas(193;496 3017 22514 29918)												0								G	CYS/ARG	3,4403	6.2+/-15.9	0,3,2200	105.0	85.0	92.0		196	0.9	0.0	20	dbSNP_132	92	3,8597	3.0+/-9.4	0,3,4297	yes	missense	CST2	NM_001322.2	180	0,6,6497	AA,AG,GG		0.0349,0.0681,0.0461	possibly-damaging	66/142	23807102	6,13000	2203	4300	6503	SO:0001583	missense	0			-	M19671	CCDS13161.1	20p11.2	2007-11-29			ENSG00000170369	ENSG00000170369			2474	protein-coding gene	gene with protein product	"""cystatin 2"""	123856					Standard	NM_001322		Approved		uc002wtq.1	P09228	OTTHUMG00000032086	ENST00000304725.2:c.196C>T	20.37:g.23807102G>A	ENSP00000307540:p.Arg66Cys		Q9UCQ7	Missense_Mutation	SNP	pfam_Prot_inh_cystat,smart_Prot_inh_cystat	p.R66C	ENST00000304725.2	37	c.196	CCDS13161.1	20	.	.	.	.	.	.	.	.	.	.	G	9.743	1.165527	0.21538	6.81E-4	3.49E-4	ENSG00000170369	ENST00000304725	T	0.28255	1.62	2.0	0.943	0.19531	Proteinase inhibitor I25, cystatin (2);	0.376195	0.24379	N	0.039032	T	0.43233	0.1238	M	0.91612	3.225	0.09310	N	0.999999	P	0.40211	0.707	P	0.45119	0.47	T	0.39800	-0.9596	10	0.62326	D	0.03	.	5.7627	0.18209	0.0:0.0:0.6868:0.3132	.	66	P09228	CYTT_HUMAN	C	66	ENSP00000307540:R66C	ENSP00000307540:R66C	R	-	1	0	CST2	23755102	0.154000	0.22792	0.011000	0.14972	0.041000	0.13682	0.699000	0.25586	0.135000	0.18707	0.298000	0.19748	CGC	rs112783512	CST2	-	pfam_Prot_inh_cystat,smart_Prot_inh_cystat		0.557	CST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST2	HGNC	protein_coding	OTTHUMT00000078352.2	0	0	0	53	53	33	0.00	0.00	G			23807102	-1	8	15	23	17	tier1	no_errors	ENST00000304725	ensembl	human	known	74_37	missense	25.81	46.88	SNP	0.008	A	8	23
MTUS2	23281	genome.wustl.edu	37	13	29933578	29933578	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr13:29933578C>A	ENST00000431530.3	+	6	3173	c.3115C>A	c.(3115-3117)Ctc>Atc	p.L1039I		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	1029	Localization to the growing distal tip of microtubules.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						CTTTGATGCCCTCGCCGTGGC	0.597													ENSG00000132938																																					0													20.0	24.0	23.0					13																	29933578		2085	4205	6290	SO:0001583	missense	0			-	AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.3115C>A	13.37:g.29933578C>A	ENSP00000392057:p.Leu1039Ile		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.L1039I	ENST00000431530.3	37	c.3115	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	C	7.095	0.572934	0.13623	.	.	ENSG00000132938	ENST00000431530	T	0.18338	2.22	4.91	-0.344	0.12628	.	0.322570	0.29133	N	0.013047	T	0.07413	0.0187	N	0.22421	0.69	0.21147	N	0.999778	P	0.40180	0.705	B	0.37422	0.249	T	0.17930	-1.0353	9	.	.	.	.	0.6689	0.00855	0.1677:0.3133:0.1646:0.3543	.	1029	Q5JR59	MTUS2_HUMAN	I	1039	ENSP00000392057:L1039I	.	L	+	1	0	MTUS2	28831578	0.063000	0.20901	0.000000	0.03702	0.114000	0.19823	0.352000	0.20113	0.004000	0.14682	0.591000	0.81541	CTC	-	MTUS2	-	NULL		0.597	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	0	0	0	70	70	73	0.00	0.00	C	XM_166270		29933578	+1	23	22	49	46	tier1	no_errors	ENST00000431530	ensembl	human	known	74_37	missense	31.94	32.35	SNP	0.001	A	23	49
MFN1	55669	genome.wustl.edu	37	3	179115513	179115513	+	IGR	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:179115513T>C	ENST00000471841.1	+	0	5224				RP11-145M9.4_ENST00000595265.1_lincRNA|AC007620.3_ENST00000600539.1_RNA|AC007620.3_ENST00000495081.2_RNA|AC007620.3_ENST00000598857.1_RNA	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1						mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GAGATATCCTTGCTGATGGCA	0.478													ENSG00000242539																																					0																																										SO:0001628	intergenic_variant	0			-	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385		3.37:g.179115513T>C			B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	R	SNP	-	NULL	ENST00000471841.1	37	NULL	CCDS3228.1	3																																																																																			-	AC007620.3	-	-		0.478	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242539	Clone_based_vega_gene	protein_coding	OTTHUMT00000348654.2	0	0	0	52	52	121	0.00	0.00	T	NM_017927		179115513	+1	11	34	27	64	tier1	no_errors	ENST00000495081	ensembl	human	known	74_37	rna	28.95	34.69	SNP	0.001	C	11	27
LRRC42	115353	genome.wustl.edu	37	1	54423865	54423865	+	Missense_Mutation	SNP	C	C	T	rs578181272		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:54423865C>T	ENST00000371370.3	+	4	1038	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	LRRC42_ENST00000319223.4_Missense_Mutation_p.R173W	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	173										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						TAAGTCTTTCCGGGAGCTGAC	0.468													ENSG00000116212	C|||	1	0.000199681	0.0	0.0	5008	,	,		16437	0.001		0.0	False		,,,				2504	0.0																0													132.0	115.0	121.0					1																	54423865		2203	4300	6503	SO:0001583	missense	0			-	AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.517C>T	1.37:g.54423865C>T	ENSP00000360421:p.Arg173Trp		D3DQ46|Q8N2Q8	Missense_Mutation	SNP	NULL	p.R173W	ENST00000371370.3	37	c.517	CCDS585.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.231631	0.95207	.	.	ENSG00000116212	ENST00000371370;ENST00000371368;ENST00000319223;ENST00000444987	T;T;T;T	0.31769	5.43;2.24;5.43;1.48	5.32	5.32	0.75619	.	0.276343	0.38837	N	0.001558	T	0.36991	0.0987	N	0.08118	0	0.58432	D	0.999994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70016	0.941;0.967;0.965	T	0.39603	-0.9606	10	0.41790	T	0.15	-18.7358	19.5787	0.95455	0.0:1.0:0.0:0.0	.	173;173;173	E7EP35;A6NL66;Q9Y546	.;.;LRC42_HUMAN	W	173	ENSP00000360421:R173W;ENSP00000360419:R173W;ENSP00000318185:R173W;ENSP00000389368:R173W	ENSP00000318185:R173W	R	+	1	2	LRRC42	54196453	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.272000	0.51616	2.941000	0.99782	0.655000	0.94253	CGG	-	LRRC42	-	NULL		0.468	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC42	HGNC	protein_coding	OTTHUMT00000023250.1	0	0	0	55	55	168	0.00	0.00	C	NM_052940		54423865	+1	11	38	37	122	tier1	no_errors	ENST00000319223	ensembl	human	known	74_37	missense	22.92	23.75	SNP	1.000	T	11	37
DUSP27	92235	genome.wustl.edu	37	1	167082993	167082993	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:167082993C>A	ENST00000361200.2	+	3	323	c.157C>A	c.(157-159)Ccc>Acc	p.P53T	DUSP27_ENST00000271385.5_Missense_Mutation_p.P53T|DUSP27_ENST00000443333.1_Missense_Mutation_p.P53T			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	53					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						TTTCATGGAACCCATTCACCT	0.458													ENSG00000198842																																					0													222.0	201.0	208.0					1																	167082993		2203	4300	6503	SO:0001583	missense	0			-	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.157C>A	1.37:g.167082993C>A	ENSP00000354483:p.Pro53Thr		A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.P53T	ENST00000361200.2	37	c.157	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622555	0.87460	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.11277	2.79;2.79;2.79	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000002	T	0.16938	0.0407	L	0.34521	1.04	0.58432	D	0.999991	D	0.89917	1.0	D	0.85130	0.997	T	0.01553	-1.1326	10	0.66056	D	0.02	-29.9861	17.5593	0.87901	0.0:1.0:0.0:0.0	.	53	Q5VZP5	DUS27_HUMAN	T	53	ENSP00000354483:P53T;ENSP00000271385:P53T;ENSP00000404874:P53T	ENSP00000271385:P53T	P	+	1	0	DUSP27	165349617	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	6.919000	0.75793	2.644000	0.89710	0.561000	0.74099	CCC	-	DUSP27	-	NULL		0.458	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	0	0	0	49	49	140	0.00	0.00	C	NM_001080426		167082993	+1	8	38	45	107	tier1	no_errors	ENST00000271385	ensembl	human	known	74_37	missense	15.09	26.21	SNP	1.000	A	8	45
MAGEC3	139081	genome.wustl.edu	37	X	140985392	140985392	+	Intron	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:140985392T>A	ENST00000298296.1	+	8	1728				MAGEC3_ENST00000544766.1_Nonsense_Mutation_p.Y318*|MAGEC3_ENST00000409007.1_Nonsense_Mutation_p.Y318*|MAGEC3_ENST00000443323.2_Nonsense_Mutation_p.Y238*|MAGEC3_ENST00000536088.1_Nonsense_Mutation_p.Y318*	NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3											NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					CTCCACGTTATGAATTTTTGT	0.478													ENSG00000165509																																					0													64.0	66.0	65.0					X																	140985392		2203	4300	6503	SO:0001627	intron_variant	0			-	AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.1729-23T>A	X.37:g.140985392T>A			Q3SYA7|Q5JZ43|Q9BZ80	Nonsense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.Y318*	ENST00000298296.1	37	c.954	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	t	31	5.077330	0.94000	.	.	ENSG00000165509	ENST00000536088;ENST00000443323;ENST00000544766;ENST00000409007	.	.	.	1.25	-2.5	0.06384	.	.	.	.	.	.	.	.	.	.	.	0.49299	D	0.999773	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.2024	0.03927	0.0:0.2478:0.3165:0.4356	.	.	.	.	X	318;238;318;318	.	.	Y	+	3	2	MAGEC3	140813058	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	-0.848000	0.04326	-0.782000	0.04541	0.235000	0.17854	TAT	-	MAGEC3	-	pfam_MAGE,pfscan_MAGE		0.478	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	0	0	0	76	76	82	0.00	0.00	T	NM_138702		140985392	+1	11	28	19	30	tier1	no_errors	ENST00000536088	ensembl	human	known	74_37	nonsense	36.67	48.28	SNP	0.001	A	11	19
RPAP3	79657	genome.wustl.edu	37	12	48063978	48063978	+	Missense_Mutation	SNP	A	A	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:48063978A>C	ENST00000005386.3	-	13	1553	c.1438T>G	c.(1438-1440)Tca>Gca	p.S480A	RPAP3_ENST00000380650.4_Missense_Mutation_p.S446A|RPAP3_ENST00000432584.3_Missense_Mutation_p.S321A	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	480										endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					TCTTGGCTTGAATTCTTCTTA	0.398													ENSG00000005175																																					0													196.0	186.0	189.0					12																	48063978		2203	4300	6503	SO:0001583	missense	0			-	AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.1438T>G	12.37:g.48063978A>C	ENSP00000005386:p.Ser480Ala		B4DRW9|Q6PHR5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S480A	ENST00000005386.3	37	c.1438	CCDS8753.1	12	.	.	.	.	.	.	.	.	.	.	A	10.74	1.436385	0.25813	.	.	ENSG00000005175	ENST00000005386;ENST00000432584;ENST00000380650	T;T;T	0.14516	2.93;2.5;2.92	5.84	0.764	0.18465	.	1.601630	0.02826	N	0.126160	T	0.10294	0.0252	L	0.36672	1.1	0.09310	N	1	B;B	0.14805	0.011;0.007	B;B	0.15052	0.012;0.005	T	0.27365	-1.0076	10	0.08179	T	0.78	.	4.0611	0.09839	0.4763:0.0:0.3672:0.1565	.	446;480	Q9H6T3-2;Q9H6T3	.;RPAP3_HUMAN	A	480;321;446	ENSP00000005386:S480A;ENSP00000401823:S321A;ENSP00000370024:S446A	ENSP00000005386:S480A	S	-	1	0	RPAP3	46350245	0.909000	0.30893	0.034000	0.17996	0.791000	0.44710	0.871000	0.28023	0.104000	0.17725	0.455000	0.32223	TCA	-	RPAP3	-	NULL		0.398	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP3	HGNC	protein_coding	OTTHUMT00000405340.1	0	0	0	50	50	101	0.00	0.00	A	NM_024604		48063978	-1	9	31	26	60	tier1	no_errors	ENST00000005386	ensembl	human	known	74_37	missense	25.71	33.33	SNP	0.055	C	9	26
TNRC6C	57690	genome.wustl.edu	37	17	76045614	76045614	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:76045614A>G	ENST00000588061.1	+	5	1198	c.471A>G	c.(469-471)caA>caG	p.Q157Q	TNRC6C_ENST00000335749.4_Silent_p.Q157Q|TNRC6C_ENST00000588847.1_Silent_p.Q157Q|TNRC6C_ENST00000301624.4_Silent_p.Q157Q|TNRC6C_ENST00000541771.1_Silent_p.Q157Q|TNRC6C_ENST00000544502.1_Silent_p.Q157Q			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	157	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TGCTGCCACAAGAGAGCACAG	0.483													ENSG00000078687																																					0													95.0	96.0	96.0					17																	76045614		2044	4188	6232	SO:0001819	synonymous_variant	0			-	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.471A>G	17.37:g.76045614A>G			G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.Q157	ENST00000588061.1	37	c.471	CCDS45798.1	17																																																																																			-	TNRC6C	-	NULL		0.483	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	0	0	0	46	46	159	0.00	0.00	A	NM_018996		76045614	+1	9	31	32	113	tier1	no_errors	ENST00000335749	ensembl	human	known	74_37	silent	21.95	21.53	SNP	0.777	G	9	32
PRKD3	23683	genome.wustl.edu	37	2	37505106	37505106	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:37505106A>T	ENST00000379066.1	-	9	1961	c.1199T>A	c.(1198-1200)cTa>cAa	p.L400Q	PRKD3_ENST00000234179.2_Missense_Mutation_p.L400Q			O94806	KPCD3_HUMAN	protein kinase D3	400					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				AACCCTCATTAGCGGAATATT	0.368													ENSG00000115825																									Melanoma(80;621 1355 8613 11814 51767)												0													196.0	161.0	173.0					2																	37505106		2203	4300	6503	SO:0001583	missense	0			-	AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1199T>A	2.37:g.37505106A>T	ENSP00000368356:p.Leu400Gln		D6W587|Q53TR7|Q8NEL8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_DAG/PE-bd	p.L400Q	ENST00000379066.1	37	c.1199	CCDS1789.1	2	.	.	.	.	.	.	.	.	.	.	A	26.3	4.728408	0.89390	.	.	ENSG00000115825	ENST00000379066;ENST00000234179	T;T	0.80738	-1.41;-1.41	5.41	5.41	0.78517	.	0.000000	0.64402	D	0.000004	D	0.89223	0.6654	M	0.73598	2.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90575	0.4525	10	0.87932	D	0	-13.8777	15.4495	0.75262	1.0:0.0:0.0:0.0	.	400;400	O94806-2;O94806	.;KPCD3_HUMAN	Q	400	ENSP00000368356:L400Q;ENSP00000234179:L400Q	ENSP00000234179:L400Q	L	-	2	0	PRKD3	37358610	1.000000	0.71417	0.977000	0.42913	0.996000	0.88848	9.335000	0.96500	2.044000	0.60594	0.533000	0.62120	CTA	-	PRKD3	-	NULL		0.368	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	0	0	0	53	53	140	0.00	0.00	A	NM_005813		37505106	-1	13	57	8	67	tier1	no_errors	ENST00000234179	ensembl	human	known	74_37	missense	61.90	45.97	SNP	1.000	T	13	8
PSD4	23550	genome.wustl.edu	37	2	113940242	113940242	+	Missense_Mutation	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:113940242T>A	ENST00000245796.6	+	2	404	c.209T>A	c.(208-210)gTg>gAg	p.V70E	PSD4_ENST00000465917.1_3'UTR|PSD4_ENST00000441564.3_Missense_Mutation_p.V70E	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	70					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGCTCCGGTGTGGAGCTCACA	0.607													ENSG00000125637																																					0													53.0	53.0	53.0					2																	113940242		2203	4300	6503	SO:0001583	missense	0			-	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.209T>A	2.37:g.113940242T>A	ENSP00000245796:p.Val70Glu		A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom,prints_PH_dom-spectrin-type	p.V70E	ENST00000245796.6	37	c.209	CCDS33276.1	2	.	.	.	.	.	.	.	.	.	.	T	14.71	2.616818	0.46736	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.12879	2.66;2.64	2.6	-0.603	0.11630	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	P;P	0.41498	0.752;0.637	B;B	0.32583	0.148;0.07	T	0.33624	-0.9861	9	0.52906	T	0.07	.	6.2378	0.20772	0.0:0.0:0.5365:0.4635	.	70;70	Q8NDX1-2;Q8NDX1	.;PSD4_HUMAN	E	70	ENSP00000245796:V70E;ENSP00000413997:V70E	ENSP00000245796:V70E	V	+	2	0	PSD4	113656713	0.002000	0.14202	0.019000	0.16419	0.206000	0.24218	-0.202000	0.09451	0.165000	0.19558	0.172000	0.16884	GTG	-	PSD4	-	NULL		0.607	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSD4	HGNC	protein_coding	OTTHUMT00000330789.1	0	0	0	49	49	99	0.00	0.00	T	NM_012455		113940242	+1	11	43	12	27	tier1	no_errors	ENST00000245796	ensembl	human	known	74_37	missense	47.83	61.43	SNP	0.002	A	11	12
CRISPLD1	83690	genome.wustl.edu	37	8	75928821	75928821	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:75928821C>T	ENST00000262207.4	+	7	1217	c.749C>T	c.(748-750)cCc>cTc	p.P250L	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.P62L|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.P64L	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	250					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			AGGTATTATCCCCCTCGAGAA	0.368													ENSG00000121005																																					0													117.0	122.0	121.0					8																	75928821		2203	4300	6503	SO:0001583	missense	0			-	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.749C>T	8.37:g.75928821C>T	ENSP00000262207:p.Pro250Leu		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.P250L	ENST00000262207.4	37	c.749	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	9.622	1.134214	0.21123	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;T	0.81415	0.3;-1.19;-1.49	4.98	4.98	0.66077	.	0.454838	0.25663	N	0.029133	T	0.67239	0.2872	N	0.08118	0	0.09310	N	0.999999	B;B	0.12630	0.006;0.006	B;B	0.11329	0.006;0.006	T	0.58463	-0.7632	10	0.45353	T	0.12	.	18.8032	0.92027	0.0:1.0:0.0:0.0	.	64;250	B7Z929;Q9H336	.;CRLD1_HUMAN	L	250;62;64	ENSP00000262207:P250L;ENSP00000430105:P62L;ENSP00000429746:P64L	ENSP00000262207:P250L	P	+	2	0	CRISPLD1	76091376	0.885000	0.30320	0.039000	0.18376	0.015000	0.08874	4.772000	0.62324	2.734000	0.93682	0.650000	0.86243	CCC	-	CRISPLD1	-	NULL		0.368	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	0	0	0	24	24	184	0.00	0.00	C	NM_031461		75928821	+1	6	33	31	203	tier1	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	16.22	13.98	SNP	0.166	T	6	31
PHLDB2	90102	genome.wustl.edu	37	3	111638036	111638036	+	Missense_Mutation	SNP	G	G	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:111638036G>T	ENST00000431670.2	+	4	2248	c.1837G>T	c.(1837-1839)Gat>Tat	p.D613Y	PHLDB2_ENST00000481953.1_Missense_Mutation_p.D613Y|PHLDB2_ENST00000393925.3_Missense_Mutation_p.D613Y|PHLDB2_ENST00000393923.3_Missense_Mutation_p.D640Y|PHLDB2_ENST00000412622.1_Missense_Mutation_p.D613Y|PHLDB2_ENST00000495180.1_Missense_Mutation_p.D199Y	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	613						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						AGACATAAATGATCAGATGGA	0.373													ENSG00000144824																																					0													110.0	111.0	111.0					3																	111638036		2203	4300	6503	SO:0001583	missense	0			-		CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.1837G>T	3.37:g.111638036G>T	ENSP00000405405:p.Asp613Tyr		A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D613Y	ENST00000431670.2	37	c.1837	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743873	0.69418	.	.	ENSG00000144824	ENST00000359729;ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.34667	1.42;1.46;1.43;1.43;1.46;1.43;1.35	5.41	5.41	0.78517	.	0.051668	0.85682	D	0.000000	T	0.54886	0.1886	L	0.51422	1.61	0.45718	D	0.998629	P;D;D;D	0.76494	0.901;0.994;0.999;0.999	P;P;D;D	0.72338	0.484;0.76;0.977;0.977	T	0.55016	-0.8206	10	0.72032	D	0.01	.	16.4822	0.84160	0.0:0.0:1.0:0.0	.	199;613;613;640	E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;PHLB2_HUMAN;.;.	Y	640;640;613;613;613;613;613;199	ENSP00000377500:D640Y;ENSP00000405405:D613Y;ENSP00000405292:D613Y;ENSP00000418296:D613Y;ENSP00000377502:D613Y;ENSP00000418319:D613Y;ENSP00000420303:D199Y	ENSP00000352764:D640Y	D	+	1	0	PHLDB2	113120726	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.422000	0.73357	2.684000	0.91462	0.561000	0.74099	GAT	-	PHLDB2	-	NULL		0.373	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	0	0	1	29	29	175	0.00	0.57	G	NM_145753		111638036	+1	15	39	18	124	tier1	no_errors	ENST00000393925	ensembl	human	known	74_37	missense	45.45	23.64	SNP	1.000	T	15	18
DLC1	10395	genome.wustl.edu	37	8	12990494	12990494	+	Intron	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:12990494C>T	ENST00000276297.4	-	6	1758				DLC1_ENST00000358919.2_5'UTR|DLC1_ENST00000512044.2_Intron	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						GCACATCAAGCACGGCAGGCG	0.701													ENSG00000164741																																					0													37.0	30.0	33.0					8																	12990494		2202	4299	6501	SO:0001627	intron_variant	0			-	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1349-17328G>A	8.37:g.12990494C>T			B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	R	SNP	-	NULL	ENST00000276297.4	37	NULL	CCDS5989.1	8																																																																																			-	DLC1	-	-		0.701	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	0	0	0	150	150	28	0.00	0.00	C	NM_182643, NM_006094		12990494	-1	32	9	75	15	tier1	no_errors	ENST00000515225	ensembl	human	known	74_37	rna	29.91	37.50	SNP	0.305	T	32	75
CASP8AP2	9994	genome.wustl.edu	37	6	90576105	90576105	+	RNA	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:90576105C>G	ENST00000551025.1	+	0	4533									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TTGCTGTACCCTCTTCTGAAC	0.308													ENSG00000118412																									Colon(187;1656 2025 17045 31481 39901)												0													56.0	49.0	51.0					6																	90576105		1822	4083	5905			0			-	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90576105C>G				R	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	CASP8AP2	-	-		0.308	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		0	0	0	28	28	117	0.00	0.00	C	NM_001137667		90576105	+1	4	33	10	147	tier1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	28.57	18.33	SNP	0.716	G	4	10
CLTCL1	8218	genome.wustl.edu	37	22	19187282	19187282	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr22:19187282T>C	ENST00000263200.10	-	24	3908	c.3836A>G	c.(3835-3837)cAt>cGt	p.H1279R	CLTCL1_ENST00000353891.5_Missense_Mutation_p.H1279R|CLTCL1_ENST00000442042.2_5'UTR|CLTCL1_ENST00000427926.1_Missense_Mutation_p.H1279R	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1279	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CTCATCTGCATGAATGACGAT	0.532			T	?	ALCL								ENSG00000070371																												Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	0													54.0	55.0	54.0					22																	19187282		2151	4253	6404	SO:0001583	missense	0			-		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.3836A>G	22.37:g.19187282T>C	ENSP00000445677:p.His1279Arg		B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.H1279R	ENST00000263200.10	37	c.3836	CCDS46662.1	22	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862601	0.71949	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.20069	2.1;2.1;2.1	3.99	3.99	0.46301	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52075	0.1712	M	0.91510	3.215	0.80722	D	1	D;D;P;P	0.55385	0.971;0.965;0.892;0.892	D;D;P;P	0.67900	0.954;0.921;0.901;0.86	T	0.63853	-0.6543	10	0.72032	D	0.01	-15.5828	13.0507	0.58952	0.0:0.0:0.0:1.0	.	1279;102;102;1279	P53675-2;B7Z1Z7;B7Z2Y4;P53675	.;.;.;CLH2_HUMAN	R	1279	ENSP00000439662:H1279R;ENSP00000445677:H1279R;ENSP00000441158:H1279R	ENSP00000445677:H1279R	H	-	2	0	CLTCL1	17567282	1.000000	0.71417	0.881000	0.34555	0.684000	0.39900	7.210000	0.77924	1.662000	0.50781	0.482000	0.46254	CAT	-	CLTCL1	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain		0.532	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CLTCL1	HGNC	protein_coding	OTTHUMT00000316397.5	0	0	0	50	50	54	0.00	0.00	T	NM_007098		19187282	-1	7	18	28	41	tier1	no_errors	ENST00000263200	ensembl	human	known	74_37	missense	20.00	30.51	SNP	1.000	C	7	28
CYP2A13	1553	genome.wustl.edu	37	19	41599673	41599673	+	Missense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:41599673G>A	ENST00000330436.3	+	6	970	c.970G>A	c.(970-972)Gag>Aag	p.E324K		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	324					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	CCCAGAGGTGGAGGGTAAGAC	0.592													ENSG00000197838																																					0													66.0	59.0	61.0					19																	41599673		2203	4300	6503	SO:0001583	missense	0			-	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.970G>A	19.37:g.41599673G>A	ENSP00000332679:p.Glu324Lys		Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.E324K	ENST00000330436.3	37	c.970	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	19.14	3.769746	0.69992	.	.	ENSG00000197838	ENST00000330436	T	0.68479	-0.33	4.46	4.46	0.54185	.	0.137149	0.48286	U	0.000184	T	0.62816	0.2459	L	0.34521	1.04	0.37489	D	0.916291	P	0.37688	0.605	P	0.46452	0.517	T	0.68315	-0.5441	10	0.49607	T	0.09	.	11.1486	0.48444	0.0:0.3123:0.6877:0.0	.	324	Q16696	CP2AD_HUMAN	K	324	ENSP00000332679:E324K	ENSP00000332679:E324K	E	+	1	0	CYP2A13	46291513	0.999000	0.42202	1.000000	0.80357	0.490000	0.33462	3.277000	0.51654	2.339000	0.79563	0.479000	0.44913	GAG	-	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I		0.592	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	0	0	0	62	62	108	0.00	0.00	G	NM_000766		41599673	+1	34	72	29	53	tier1	no_errors	ENST00000330436	ensembl	human	known	74_37	missense	53.97	57.60	SNP	1.000	A	34	29
RTL1	388015	genome.wustl.edu	37	14	101349306	101349306	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:101349306A>G	ENST00000534062.1	-	1	1878	c.1820T>C	c.(1819-1821)tTt>tCt	p.F607S	MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	607					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						ACACTCGTAAAAGGTCTCGCT	0.567													ENSG00000254656																																					0													57.0	52.0	53.0					14																	101349306		1568	3582	5150	SO:0001583	missense	0			-		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.1820T>C	14.37:g.101349306A>G	ENSP00000435342:p.Phe607Ser		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.F607S	ENST00000534062.1	37	c.1820	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	A	11.34	1.611227	0.28712	.	.	ENSG00000254656	ENST00000534062	T	0.22743	1.94	3.71	1.32	0.21799	.	0.480369	0.15662	N	0.250848	T	0.14787	0.0357	L	0.47716	1.5	0.09310	N	1	P	0.36616	0.561	B	0.36719	0.231	T	0.17258	-1.0375	10	0.19147	T	0.46	.	4.4793	0.11759	0.7269:0.0:0.1005:0.1726	.	607	E9PKS8	.	S	607	ENSP00000435342:F607S	ENSP00000435342:F607S	F	-	2	0	RTL1	100419059	0.102000	0.21896	0.002000	0.10522	0.915000	0.54546	1.667000	0.37471	0.275000	0.22094	0.482000	0.46254	TTT	-	RTL1	-	NULL		0.567	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	0	0	0	46	46	91	0.00	0.00	A	NM_001134888		101349306	-1	13	19	15	24	tier1	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	46.43	44.19	SNP	0.011	G	13	15
SEC14L1	6397	genome.wustl.edu	37	17	75208137	75208137	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:75208137C>G	ENST00000413679.2	+	15	2020	c.1717C>G	c.(1717-1719)Cca>Gca	p.P573A	SEC14L1_ENST00000392476.2_Missense_Mutation_p.P573A|SEC14L1_ENST00000436233.4_Missense_Mutation_p.P573A|SEC14L1_ENST00000585618.1_Missense_Mutation_p.P573A|SEC14L1_ENST00000431431.2_Missense_Mutation_p.P539A|SEC14L1_ENST00000430767.4_Missense_Mutation_p.P573A|SEC14L1_ENST00000591437.1_Missense_Mutation_p.P539A|SEC14L1_ENST00000443798.4_Missense_Mutation_p.P573A	NM_001143998.1|NM_001143999.1|NM_003003.3	NP_001137470|NP_001137471|NP_002994	Q92503	S14L1_HUMAN	SEC14-like 1 (S. cerevisiae)	573	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(2)	31						GTCGCCACAACCACCCAAAAA	0.532													ENSG00000129657																																					0													182.0	194.0	190.0					17																	75208137		2203	4300	6503	SO:0001583	missense	0			-	D67029	CCDS11752.1, CCDS42385.1, CCDS45789.1	17q25.2	2008-02-01	2001-11-28			ENSG00000129657			10698	protein-coding gene	gene with protein product		601504	"""SEC14 (S. cerevisiae)-like 1"""	SEC14L		8697811	Standard	NM_001143998		Approved	PRELID4A	uc002jto.3	Q92503		ENST00000413679.2:c.1717C>G	17.37:g.75208137C>G	ENSP00000394716:p.Pro573Ala		A8K4E8|B4DDI5|D5G3K1|Q99780	Missense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1	p.P573A	ENST00000413679.2	37	c.1717	CCDS11752.1	17	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769895	0.31320	.	.	ENSG00000129657	ENST00000392476;ENST00000443798;ENST00000436233;ENST00000430767;ENST00000413679;ENST00000431431	T;T;T;T;T;T	0.70045	-0.33;-0.33;-0.33;-0.33;-0.33;-0.45	5.19	4.19	0.49359	GOLD (2);	0.205225	0.52532	D	0.000075	T	0.49012	0.1532	L	0.28115	0.83	0.51233	D	0.999919	B;B	0.09022	0.002;0.001	B;B	0.12837	0.008;0.003	T	0.35251	-0.9796	10	0.13853	T	0.58	-11.7657	10.0246	0.42063	0.1558:0.694:0.1502:0.0	.	573;573	Q92503-2;Q92503	.;S14L1_HUMAN	A	573;573;573;573;573;539	ENSP00000376268:P573A;ENSP00000406030:P573A;ENSP00000390392:P573A;ENSP00000408169:P573A;ENSP00000394716:P573A;ENSP00000389838:P539A	ENSP00000376268:P573A	P	+	1	0	SEC14L1	72719732	1.000000	0.71417	0.687000	0.30102	0.726000	0.41606	3.298000	0.51818	1.254000	0.44035	0.655000	0.94253	CCA	-	SEC14L1	-	superfamily_GOLD,pfscan_GOLD		0.532	SEC14L1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC14L1	HGNC	protein_coding	OTTHUMT00000436240.1	0	0	0	25	25	9	0.00	0.00	C	NM_003003		75208137	+1	10	5	14	28	tier1	no_errors	ENST00000392476	ensembl	human	known	74_37	missense	41.67	15.15	SNP	1.000	G	10	14
DNAH17	8632	genome.wustl.edu	37	17	76424543	76424543	+	Splice_Site	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:76424543C>T	ENST00000389840.5	-	77	12757		c.e77+1		DNAH17_ENST00000585328.1_Intron|DNAH17_ENST00000586052.1_Intron			Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GTCCCTGTGACCCCCTCCTCA	0.617													ENSG00000187775																																					0													34.0	37.0	36.0					17																	76424543		2174	4222	6396	SO:0001630	splice_region_variant	0			-	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000389840.5:c.12632+1G>A	17.37:g.76424543C>T			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Splice_Site	SNP	-	e76+1	ENST00000389840.5	37	c.12632+1		17	.	.	.	.	.	.	.	.	.	.	C	4.195	0.034873	0.08101	.	.	ENSG00000187775	ENST00000389840	.	.	.	2.58	-0.962	0.10333	.	.	.	.	.	.	.	.	.	.	.	0.19775	N	0.999952	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.1691	0.42900	0.0:0.3722:0.6278:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH17	73936138	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.438000	0.06905	-0.131000	0.11578	-0.300000	0.09419	.	-	DH17	-	-		0.617	DNAH17-201	KNOWN	basic	protein_coding	DH17	HGNC	protein_coding		0	0	0	39	39	126	0.00	0.00	C	NM_173628	Intron	76424543	-1	21	89	8	43	tier1	no_errors	ENST00000389840	ensembl	human	known	74_37	splice_site	72.41	67.42	SNP	0.000	T	21	8
KDR	3791	genome.wustl.edu	37	4	55991451	55991451	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr4:55991451T>C	ENST00000263923.4	-	1	305	c.10A>G	c.(10-12)Aag>Gag	p.K4E		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	4					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AGCAGCACCTTGCTCTGCATC	0.662			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			ENSG00000128052																												Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													23.0	23.0	23.0					4																	55991451		2203	4300	6503	SO:0001583	missense	0			-	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.10A>G	4.37:g.55991451T>C	ENSP00000263923:p.Lys4Glu		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.K4E	ENST00000263923.4	37	c.10	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026064	0.35701	.	.	ENSG00000128052	ENST00000263923	T	0.75589	-0.95	4.56	0.725	0.18242	.	0.866399	0.10400	N	0.679328	T	0.58177	0.2104	L	0.43152	1.355	0.23649	N	0.997205	B;B	0.09022	0.002;0.0	B;B	0.08055	0.003;0.0	T	0.37709	-0.9694	10	0.09590	T	0.72	.	3.7964	0.08741	0.0:0.1954:0.1874:0.6171	.	4;4	P35968-2;P35968	.;VGFR2_HUMAN	E	4	ENSP00000263923:K4E	ENSP00000263923:K4E	K	-	1	0	KDR	55686208	0.995000	0.38212	0.932000	0.37286	0.393000	0.30537	0.763000	0.26517	0.140000	0.18849	0.459000	0.35465	AAG	-	KDR	-	NULL		0.662	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	0	0	0	95	95	18	0.00	0.00	T			55991451	-1	13	3	57	14	tier1	no_errors	ENST00000263923	ensembl	human	known	74_37	missense	18.31	17.65	SNP	0.948	C	13	57
KIAA0556	23247	genome.wustl.edu	37	16	27692640	27692640	+	Intron	SNP	G	G	A	rs559029197		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:27692640G>A	ENST00000261588.4	+	8	827				CTD-2049O4.1_ENST00000564893.1_RNA|KIAA0556_ENST00000567894.1_Intron	NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556							extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						gtaagtGAATGAATGATGAAC	0.403													ENSG00000261329	G|||	1	0.000199681	0.0008	0.0	5008	,	,		23596	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			-	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.809-80G>A	16.37:g.27692640G>A			A7E2C2	R	SNP	-	NULL	ENST00000261588.4	37	NULL	CCDS32415.1	16																																																																																			-	CTD-2049O4.1	-	-		0.403	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100128079	Clone_based_vega_gene	protein_coding	OTTHUMT00000433724.1	0	0	0	48	48	132	0.00	0.00	G	NM_015202		27692640	-1	32	102	14	77	tier1	no_errors	ENST00000564893	ensembl	human	known	74_37	rna	69.57	56.98	SNP	0.000	A	32	14
STOX1	219736	genome.wustl.edu	37	10	70641836	70641836	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:70641836C>A	ENST00000298596.6	+	2	516	c.433C>A	c.(433-435)Ctt>Att	p.L145I	STOX1_ENST00000421961.2_Missense_Mutation_p.L35I|STOX1_ENST00000399169.4_Missense_Mutation_p.L145I|STOX1_ENST00000399162.2_Missense_Mutation_p.L145I|STOX1_ENST00000399165.4_Missense_Mutation_p.L145I	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	145						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						GCAGGAATCACTTTTGGAGCG	0.343													ENSG00000165730																																					0													139.0	125.0	129.0					10																	70641836		1848	4093	5941	SO:0001583	missense	0			-	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.433C>A	10.37:g.70641836C>A	ENSP00000298596:p.Leu145Ile		A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.L145I	ENST00000298596.6	37	c.433	CCDS41535.1	10	.	.	.	.	.	.	.	.	.	.	C	13.27	2.187495	0.38609	.	.	ENSG00000165730	ENST00000399169;ENST00000298596;ENST00000399165;ENST00000399162;ENST00000421961	T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18	5.57	3.7	0.42460	Storkhead-box protein, winged-helix domain (1);	0.000000	0.56097	U	0.000036	T	0.81795	0.4898	L	0.52573	1.65	0.42532	D	0.993045	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;1.0;0.997	T	0.79955	-0.1585	10	0.38643	T	0.18	.	8.0455	0.30547	0.0:0.7327:0.0:0.2673	.	145;145;145	Q6ZVD7-3;Q6ZVD7;Q6ZVD7-2	.;STOX1_HUMAN;.	I	145;145;145;145;35	ENSP00000382121:L145I;ENSP00000298596:L145I;ENSP00000382118:L145I;ENSP00000382115:L145I;ENSP00000394509:L35I	ENSP00000298596:L145I	L	+	1	0	STOX1	70311842	0.520000	0.26250	0.071000	0.20095	0.870000	0.49936	1.153000	0.31676	1.494000	0.48533	0.591000	0.81541	CTT	-	STOX1	-	pfam_Storkhead-box_winged-helix		0.343	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX1	HGNC	protein_coding	OTTHUMT00000276849.3	0	0	0	74	74	148	0.00	0.00	C	NM_152709		70641836	+1	20	34	27	66	tier1	no_errors	ENST00000298596	ensembl	human	known	74_37	missense	42.55	34.00	SNP	0.705	A	20	27
DBH	1621	genome.wustl.edu	37	9	136521767	136521767	+	Silent	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr9:136521767C>A	ENST00000393056.2	+	10	1569	c.1557C>A	c.(1555-1557)atC>atA	p.I519I	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	519					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	TCCACCTCATCAACAGGTGAG	0.617													ENSG00000123454																																					0													43.0	39.0	41.0					9																	136521767		2203	4300	6503	SO:0001819	synonymous_variant	0			-	X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1557C>A	9.37:g.136521767C>A			Q5T381|Q96AG2	Silent	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.I519	ENST00000393056.2	37	c.1557	CCDS6977.2	9																																																																																			-	DBH	-	superfamily_PHM/PNGase_F_dom		0.617	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2	0	0	0	32	32	36	0.00	0.00	C	NM_000787		136521767	+1	7	14	6	17	tier1	no_errors	ENST00000393056	ensembl	human	known	74_37	silent	53.85	45.16	SNP	0.121	A	7	6
CFH	3075	genome.wustl.edu	37	1	196694299	196694299	+	Missense_Mutation	SNP	G	G	T	rs138890387		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:196694299G>T	ENST00000367429.4	+	12	1985	c.1745G>T	c.(1744-1746)cGc>cTc	p.R582L		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	582	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GTTCCTGATCGCAAGAAAGAC	0.348													ENSG00000000971																																					0													74.0	65.0	68.0					1																	196694299		2203	4300	6503	SO:0001583	missense	0			-	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.1745G>T	1.37:g.196694299G>T	ENSP00000356399:p.Arg582Leu		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R582L	ENST00000367429.4	37	c.1745	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	10.29	1.309039	0.23821	.	.	ENSG00000000971	ENST00000367429	T	0.72394	-0.65	5.74	2.72	0.32119	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.47340	0.1440	N	0.19112	0.55	0.09310	N	0.999991	B	0.02656	0.0	B	0.01281	0.0	T	0.28267	-1.0049	9	0.10636	T	0.68	.	3.8213	0.08836	0.1718:0.5754:0.166:0.0867	.	582	P08603	CFAH_HUMAN	L	582	ENSP00000356399:R582L	ENSP00000356399:R582L	R	+	2	0	CFH	194960922	0.002000	0.14202	0.077000	0.20336	0.003000	0.03518	0.287000	0.18920	1.581000	0.49865	-0.134000	0.14843	CGC	-	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.348	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	0	0	0	20	20	143	0.00	0.00	G	NM_000186		196694299	+1	13	73	14	77	tier1	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	48.15	48.34	SNP	0.005	T	13	14
PLXNA1	5361	genome.wustl.edu	37	3	126708266	126708266	+	Missense_Mutation	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:126708266T>A	ENST00000393409.2	+	1	830	c.830T>A	c.(829-831)tTc>tAc	p.F277Y	PLXNA1_ENST00000251772.4_Missense_Mutation_p.F254Y	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	277	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GGCGAGCACTTCTTCACGTCC	0.577													ENSG00000114554																																					0													116.0	114.0	114.0					3																	126708266		2203	4300	6503	SO:0001583	missense	0			-	X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.830T>A	3.37:g.126708266T>A	ENSP00000377061:p.Phe277Tyr			Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.F277Y	ENST00000393409.2	37	c.830	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	T	18.59	3.657361	0.67586	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.10860	2.83;2.83	4.25	4.25	0.50352	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.34193	0.0889	M	0.83692	2.655	0.46564	D	0.999106	D	0.76494	0.999	D	0.81914	0.995	T	0.15378	-1.0439	10	0.44086	T	0.13	.	13.5258	0.61594	0.0:0.0:0.0:1.0	.	277	Q9UIW2	PLXA1_HUMAN	Y	277;254	ENSP00000377061:F277Y;ENSP00000251772:F254Y	ENSP00000251772:F254Y	F	+	2	0	PLXNA1	128190956	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	5.890000	0.69774	1.793000	0.52555	0.402000	0.26972	TTC	-	PLX1	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.577	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLX1	HGNC	protein_coding	OTTHUMT00000356451.1	0	0	0	29	29	32	0.00	0.00	T	NM_032242		126708266	+1	9	20	18	36	tier1	no_errors	ENST00000393409	ensembl	human	known	74_37	missense	33.33	35.71	SNP	1.000	A	9	18
ZNF469	84627	genome.wustl.edu	37	16	88500498	88500498	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:88500498A>G	ENST00000437464.1	+	2	6536	c.6536A>G	c.(6535-6537)aAg>aGg	p.K2179R	ZNF469_ENST00000565624.1_Missense_Mutation_p.K2207R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						TGCGATCCCAAGGAAGCCCTG	0.637													ENSG00000225614																																					0													34.0	36.0	35.0					16																	88500498		692	1590	2282	SO:0001583	missense	0			-	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.6536A>G	16.37:g.88500498A>G	ENSP00000402343:p.Lys2179Arg			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K2179R	ENST00000437464.1	37	c.6536	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	A	9.755	1.168519	0.21621	.	.	ENSG00000225614	ENST00000437464	T	0.44881	0.91	4.57	-2.43	0.06522	.	.	.	.	.	T	0.24236	0.0587	N	0.19112	0.55	0.09310	N	1	P	0.42827	0.791	B	0.38755	0.281	T	0.16247	-1.0409	9	0.62326	D	0.03	.	7.7531	0.28909	0.3269:0.5797:0.0934:0.0	.	2179	Q96JG9	ZN469_HUMAN	R	2179	ENSP00000402343:K2179R	ENSP00000402343:K2179R	K	+	2	0	ZNF469	87027999	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.051000	0.14141	-0.522000	0.06417	0.459000	0.35465	AAG	-	ZNF469	-	NULL		0.637	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		0	0	0	125	125	65	0.00	0.00	A	NG_012236		88500498	+1	33	23	19	30	tier1	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	63.46	43.40	SNP	0.000	G	33	19
FTCD	10841	genome.wustl.edu	37	21	47570376	47570376	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr21:47570376C>T	ENST00000291670.5	-	6	743	c.700G>A	c.(700-702)Gtg>Atg	p.V234M	FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397748.1_Missense_Mutation_p.V234M|FTCD_ENST00000397746.3_Missense_Mutation_p.V234M|FTCD_ENST00000397743.1_Missense_Mutation_p.V234M|FTCD_ENST00000355384.2_Missense_Mutation_p.V234M|FTCD-AS1_ENST00000446649.1_RNA|FTCD_ENST00000359679.2_Missense_Mutation_p.V234M	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	234	Formiminotransferase C-subdomain. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TTGGTGGACACCTGAGCCAGG	0.587													ENSG00000160282																																					0													134.0	120.0	125.0					21																	47570376		2202	4300	6502	SO:0001583	missense	0			-	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.700G>A	21.37:g.47570376C>T	ENSP00000291670:p.Val234Met		B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.V234M	ENST00000291670.5	37	c.700	CCDS13731.1	21	.	.	.	.	.	.	.	.	.	.	C	29.4	5.002355	0.93227	.	.	ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000355384;ENST00000397746;ENST00000397743	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	4.83	4.83	0.62350	Formiminotransferas, N- and C-terminal subdomains (1);Formiminotransferase, C-terminal subdomain (2);Formiminotransferase catalytic domain (1);	0.130715	0.50627	D	0.000104	D	0.93657	0.7974	H	0.95004	3.61	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76575	0.981;0.98;0.988	D	0.95553	0.8622	10	0.87932	D	0	.	17.9601	0.89083	0.0:1.0:0.0:0.0	.	234;234;234	B7WPK3;O95954-2;O95954	.;.;FTCD_HUMAN	M	234	ENSP00000291670:V234M;ENSP00000380856:V234M;ENSP00000352707:V234M;ENSP00000347545:V234M;ENSP00000380854:V234M;ENSP00000380851:V234M	ENSP00000291670:V234M	V	-	1	0	FTCD	46394804	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.855000	0.69510	2.243000	0.73865	0.650000	0.86243	GTG	-	FTCD	-	pfam_Formiminotransferase_C,superfamily_FormiminoTrfase_N/C_subdom,tigrfam_Formiminotransferase_cat		0.587	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	HGNC	protein_coding	OTTHUMT00000206962.1	0	0	0	74	74	86	0.00	0.00	C	NM_006657		47570376	-1	39	78	22	24	tier1	no_errors	ENST00000359679	ensembl	human	known	74_37	missense	63.93	76.47	SNP	1.000	T	39	22
NBEAL2	23218	genome.wustl.edu	37	3	47045620	47045620	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:47045620C>T	ENST00000450053.3	+	37	6114	c.5935C>T	c.(5935-5937)Cgg>Tgg	p.R1979W	NBEAL2_ENST00000292309.5_Missense_Mutation_p.R1795W|NBEAL2_ENST00000383740.2_Missense_Mutation_p.R258W	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1979					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GGTCCACCTGCGGCGTTTCAA	0.602													ENSG00000160796																																					0													160.0	173.0	169.0					3																	47045620		2096	4208	6304	SO:0001583	missense	0			-	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5935C>T	3.37:g.47045620C>T	ENSP00000415034:p.Arg1979Trp		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1979W	ENST00000450053.3	37	c.5935	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.2|21.2	4.110068|4.110068	0.77210|0.77210	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000443829|ENST00000292309;ENST00000383740;ENST00000450053	.|T;T;T	.|0.70986	.|-0.37;-0.03;-0.53	4.92|4.92	4.01|4.01	0.46588|0.46588	.|PH-BEACH domain (1);	.|0.168990	.|0.49305	.|D	.|0.000150	D|D	0.84392|0.84392	0.5462|0.5462	M|M	0.86028|0.86028	2.79|2.79	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.86716|0.86716	0.1939|0.1939	5|10	.|0.87932	.|D	.|0	.|.	13.48|13.48	0.61330|0.61330	0.1565:0.8435:0.0:0.0|0.1565:0.8435:0.0:0.0	.|.	.|1795;1979	.|Q6ZNJ1-2;Q6ZNJ1	.|.;NBEL2_HUMAN	V|W	347|1795;258;1979	.|ENSP00000292309:R1795W;ENSP00000373246:R258W;ENSP00000415034:R1979W	.|ENSP00000292309:R1795W	A|R	+|+	2|1	0|2	NBEAL2|NBEAL2	47020624|47020624	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.936000|4.936000	0.63506|0.63506	2.573000|2.573000	0.86826|0.86826	0.561000|0.561000	0.74099|0.74099	GCG|CGG	-	NBEAL2	-	NULL		0.602	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	0	0	0	41	41	41	0.00	0.00	C	XM_291064		47045620	+1	8	12	19	34	tier1	no_errors	ENST00000450053	ensembl	human	known	74_37	missense	29.63	26.09	SNP	1.000	T	8	19
CSMD2	114784	genome.wustl.edu	37	1	34174865	34174865	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:34174865A>G	ENST00000373380.1	-	1	239	c.19T>C	c.(19-21)Ttt>Ctt	p.F7L	CSMD2_ENST00000373381.4_Intron|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	748						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCAGCTGGAAAGAGAATCACA	0.453													ENSG00000121904																																					0													59.0	54.0	56.0					1																	34174865		2203	4300	6503	SO:0001583	missense	0			-	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.19T>C	1.37:g.34174865A>G	ENSP00000362478:p.Phe7Leu		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.F7L	ENST00000373380.1	37	c.19		1	.	.	.	.	.	.	.	.	.	.	A	5.578	0.291488	0.10567	.	.	ENSG00000121904	ENST00000373380	T	0.16196	2.36	5.6	3.28	0.37604	.	.	.	.	.	T	0.09992	0.0245	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15867	-1.0422	7	.	.	.	.	7.3106	0.26473	0.6408:0.2847:0.0745:0.0	.	7	Q7Z408-2	.	L	7	ENSP00000362478:F7L	.	F	-	1	0	CSMD2	33947452	0.995000	0.38212	0.998000	0.56505	0.937000	0.57800	1.684000	0.37649	0.946000	0.37632	0.459000	0.35465	TTT	-	CSMD2	-	NULL		0.453	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	0	0	0	35	35	120	0.00	0.00	A	NM_052896		34174865	-1	7	35	16	69	tier1	no_errors	ENST00000373380	ensembl	human	known	74_37	missense	30.43	33.65	SNP	0.996	G	7	16
LRRIQ3	127255	genome.wustl.edu	37	1	74540395	74540395	+	Missense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:74540395G>A	ENST00000395089.1	-	5	946	c.947C>T	c.(946-948)cCa>cTa	p.P316L	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.P316L			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	316										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						TAGATCTTTTGGTTTTAATTC	0.229													ENSG00000162620																																					0													46.0	40.0	42.0					1																	74540395		1768	4017	5785	SO:0001583	missense	0			-	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.947C>T	1.37:g.74540395G>A	ENSP00000378524:p.Pro316Leu		A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	pfscan_IQ_motif_EF-hand-BS	p.P316L	ENST00000395089.1	37	c.947	CCDS41350.1	1	.	.	.	.	.	.	.	.	.	.	G	2.795	-0.250469	0.05867	.	.	ENSG00000162620	ENST00000417067;ENST00000395089;ENST00000354431	T;T	0.07800	3.16;3.16	4.4	1.01	0.19927	.	1.133360	0.06963	U	0.816640	T	0.01870	0.0059	N	0.22421	0.69	0.29372	N	0.863916	B	0.19706	0.038	B	0.16722	0.016	T	0.45469	-0.9259	10	0.39692	T	0.17	.	6.337	0.21302	0.0:0.1832:0.4408:0.376	.	316	A6PVS8	LRIQ3_HUMAN	L	27;316;316	ENSP00000378524:P316L;ENSP00000346414:P316L	ENSP00000346414:P316L	P	-	2	0	LRRIQ3	74312983	0.942000	0.31987	0.679000	0.29978	0.081000	0.17604	1.093000	0.30939	0.479000	0.27511	0.655000	0.94253	CCA	-	LRRIQ3	-	NULL		0.229	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	HGNC	protein_coding	OTTHUMT00000316539.1	0	0	0	55	55	145	0.00	0.00	G	NM_145258		74540395	-1	38	46	18	29	tier1	no_errors	ENST00000354431	ensembl	human	known	74_37	missense	67.86	60.53	SNP	0.960	A	38	18
POLR1E	64425	genome.wustl.edu	37	9	37486117	37486117	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr9:37486117C>G	ENST00000377798.4	+	1	186	c.73C>G	c.(73-75)Ctg>Gtg	p.L25V	POLR1E_ENST00000442009.2_5'UTR|POLR1E_ENST00000377792.3_5'Flank	NM_022490.1	NP_071935.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide E, 53kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	12				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		GAGAGCTGTACTGGGTAAAGA	0.642													ENSG00000137054																									Ovarian(116;843 1620 18506 32459 34463)												0													50.0	43.0	46.0					9																	37486117		2203	4297	6500	SO:0001583	missense	0			-	AK091294	CCDS6611.1	9p13.1	2013-01-21	2006-03-09	2006-03-09	ENSG00000137054	ENSG00000137054		"""RNA polymerase subunits"""	17631	protein-coding gene	gene with protein product	"""RNA polymerase I associated factor 53"""		"""polymerase (RNA) I associated factor 1"""	PRAF1		8641287	Standard	XM_005251547		Approved	FLJ13390, PAF53, FLJ13970	uc003zzy.1	Q9GZS1	OTTHUMG00000019920	ENST00000377798.4:c.73C>G	9.37:g.37486117C>G	ENSP00000367029:p.Leu25Val		O75395|Q5JTE3	Missense_Mutation	SNP	pfam_R_pol-assoc_fac_A49-like	p.L25V	ENST00000377798.4	37	c.73	CCDS6611.1	9	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273276	0.80580	.	.	ENSG00000137054	ENST00000377798;ENST00000421959	T	0.24908	1.83	5.21	5.21	0.72293	.	.	.	.	.	T	0.11024	0.0269	N	0.08118	0	0.80722	D	1	P;B	0.38788	0.647;0.347	B;B	0.32465	0.091;0.146	T	0.14868	-1.0457	9	0.07325	T	0.83	.	14.1269	0.65228	0.0:1.0:0.0:0.0	.	25;25	B4DW33;Q9GZS1-2	.;.	V	25	ENSP00000367029:L25V	ENSP00000367029:L25V	L	+	1	2	POLR1E	37476117	0.982000	0.34865	1.000000	0.80357	0.979000	0.70002	1.368000	0.34216	2.721000	0.93114	0.655000	0.94253	CTG	-	POLR1E	-	NULL		0.642	POLR1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1E	HGNC	protein_coding	OTTHUMT00000052464.1	0	0	0	153	153	52	0.00	0.00	C	NM_022490		37486117	+1	30	24	155	71	tier1	no_errors	ENST00000377798	ensembl	human	known	74_37	missense	16.22	25.26	SNP	0.997	G	30	155
KRT16P2	400578	genome.wustl.edu	37	17	16735609	16735609	+	RNA	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:16735609A>G	ENST00000579062.1	-	0	279									keratin 16 pseudogene 2																		TGCCTCTGGTACCAGTCACGG	0.587													ENSG00000227300																																					0																																												0			-			17p11.2	2010-02-25			ENSG00000227300	ENSG00000227300			37807	pseudogene	pseudogene							Standard	NR_029392		Approved		uc010vwr.1		OTTHUMG00000059177		17.37:g.16735609A>G				R	SNP	-	NULL	ENST00000579062.1	37	NULL		17																																																																																			-	KRT16P2	-	-		0.587	KRT16P2-002	KNOWN	basic	processed_transcript	KRT16P2	HGNC	pseudogene	OTTHUMT00000444288.2	0	0	0	289	289	62	0.00	0.00	A	NR_029392		16735609	-1	31	17	172	61	tier1	no_errors	ENST00000579062	ensembl	human	known	74_37	rna	15.27	21.79	SNP	1.000	G	31	172
BAZ1A	11177	genome.wustl.edu	37	14	35233923	35233923	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:35233923C>G	ENST00000382422.2	-	22	4093	c.3766G>C	c.(3766-3768)Gaa>Caa	p.E1256Q	BAZ1A_ENST00000360310.1_Missense_Mutation_p.E1256Q|BAZ1A_ENST00000358716.4_Missense_Mutation_p.E1224Q			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1256	Glu-rich.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		CTGActtcttcctcttcttga	0.398													ENSG00000198604																																					0													188.0	145.0	160.0					14																	35233923		2203	4300	6503	SO:0001583	missense	0			-	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.3766G>C	14.37:g.35233923C>G	ENSP00000371859:p.Glu1256Gln		Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.E1256Q	ENST00000382422.2	37	c.3766	CCDS9651.1	14	.	.	.	.	.	.	.	.	.	.	.	14.26	2.481727	0.44147	.	.	ENSG00000198604	ENST00000358716;ENST00000382422;ENST00000360310;ENST00000543083	T;T;T	0.52983	0.64;0.64;0.64	5.43	5.43	0.79202	.	0.508531	0.21036	N	0.081246	T	0.48978	0.1530	L	0.32530	0.975	0.51767	D	0.999933	P;P	0.46512	0.879;0.808	P;B	0.48677	0.586;0.382	T	0.49916	-0.8888	10	0.59425	D	0.04	.	17.0368	0.86478	0.0:1.0:0.0:0.0	.	1224;1256	Q9NRL2-2;Q9NRL2	.;BAZ1A_HUMAN	Q	1224;1256;1256;908	ENSP00000351555:E1224Q;ENSP00000371859:E1256Q;ENSP00000353458:E1256Q	ENSP00000351555:E1224Q	E	-	1	0	BAZ1A	34303674	0.999000	0.42202	0.982000	0.44146	0.660000	0.38997	3.840000	0.55843	2.558000	0.86282	0.563000	0.77884	GAA	-	BAZ1A	-	NULL		0.398	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1A	HGNC	protein_coding	OTTHUMT00000276646.1	0	0	0	38	38	120	0.00	0.00	C			35233923	-1	19	67	12	31	tier1	no_errors	ENST00000360310	ensembl	human	known	74_37	missense	61.29	67.68	SNP	1.000	G	19	12
THRB	7068	genome.wustl.edu	37	3	24164570	24164570	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:24164570A>G	ENST00000356447.4	-	10	1475	c.1191T>C	c.(1189-1191)gaT>gaC	p.D397D	THRB_ENST00000396671.2_Silent_p.D397D|THRB_ENST00000280696.5_Silent_p.D412D|THRB_ENST00000416420.1_Silent_p.D397D	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	397	Interaction with NR2F6.|Ligand-binding.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	GCAGGAAACTATCTTGGTACT	0.478													ENSG00000151090																									Melanoma(21;896 1043 15021 37958)												0													121.0	128.0	126.0					3																	24164570		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1191T>C	3.37:g.24164570A>G			B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D397	ENST00000356447.4	37	c.1191	CCDS2641.1	3																																																																																			-	THRB	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.478	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	HGNC	protein_coding	OTTHUMT00000252877.3	0	0	0	79	79	128	0.00	0.00	A	NM_000461		24164570	-1	9	40	79	189	tier1	no_errors	ENST00000356447	ensembl	human	known	74_37	silent	10.23	17.47	SNP	1.000	G	9	79
ZNF81	347344	genome.wustl.edu	37	X	47774883	47774883	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:47774883G>C	ENST00000376954.1	+	6	1206	c.838G>C	c.(838-840)Ggg>Cgg	p.G280R	ZNF81_ENST00000338637.7_Missense_Mutation_p.G280R			P51508	ZNF81_HUMAN	zinc finger protein 81	280					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(1)|skin(1)	4		all_lung(315;0.0973)				TACTGAATTTGGGAAGATCTT	0.378													ENSG00000197779																																					0													55.0	49.0	51.0					X																	47774883		1877	4100	5977	SO:0001583	missense	0			-	AK126949	CCDS43933.1	Xp11.23	2013-01-08	2006-05-12		ENSG00000197779	ENSG00000197779		"""Zinc fingers, C2H2-type"", ""-"""	13156	protein-coding gene	gene with protein product		314998	"""zinc finger protein 81 (HFZ20)"", ""mental retardation, X-linked 45"""	MRX45		8507979, 15121780	Standard	NM_007137		Approved	HFZ20	uc022bvq.1	P51508	OTTHUMG00000021462	ENST00000376954.1:c.838G>C	X.37:g.47774883G>C	ENSP00000366153:p.Gly280Arg		Q6RX22|Q96QH6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G280R	ENST00000376954.1	37	c.838	CCDS43933.1	X	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.702886	0.00719	.	.	ENSG00000197779	ENST00000376954;ENST00000338637	T;T	0.22743	1.94;1.94	3.92	3.06	0.35304	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.382752	0.19320	N	0.117170	T	0.27524	0.0676	M	0.81341	2.54	0.22728	N	0.998806	B	0.19583	0.037	B	0.26517	0.07	T	0.24404	-1.0161	10	0.59425	D	0.04	.	8.9134	0.35568	0.1151:0.0:0.8849:0.0	.	280	P51508	ZNF81_HUMAN	R	280	ENSP00000366153:G280R;ENSP00000341151:G280R	ENSP00000341151:G280R	G	+	1	0	ZNF81	47659827	1.000000	0.71417	0.257000	0.24404	0.193000	0.23685	4.797000	0.62503	1.028000	0.39785	0.600000	0.82982	GGG	-	ZNF81	-	pfscan_Znf_C2H2		0.378	ZNF81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF81	HGNC	protein_coding	OTTHUMT00000056455.2	0	0	0	102	102	206	0.00	0.00	G	NM_007137		47774883	+1	23	52	70	153	tier1	no_errors	ENST00000338637	ensembl	human	known	74_37	missense	24.21	25.37	SNP	1.000	C	23	70
SYCP3	50511	genome.wustl.edu	37	12	102122971	102122971	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:102122971C>G	ENST00000392927.3	-	8	704	c.573G>C	c.(571-573)aaG>aaC	p.K191N	SYCP3_ENST00000392924.1_Missense_Mutation_p.K191N|SYCP3_ENST00000266743.2_Missense_Mutation_p.K191N	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	191	Gln-rich.				male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						TATCATGATTCTTCTCCAACT	0.294													ENSG00000139351																																					0													71.0	74.0	73.0					12																	102122971		2198	4286	6484	SO:0001583	missense	0			-	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.573G>C	12.37:g.102122971C>G	ENSP00000376658:p.Lys191Asn			Missense_Mutation	SNP	pfam_Cor1/Xlr/Xmr	p.K191N	ENST00000392927.3	37	c.573	CCDS9087.1	12	.	.	.	.	.	.	.	.	.	.	C	17.09	3.301478	0.60195	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.65	3.8	0.43715	.	0.120460	0.56097	D	0.000033	T	0.78266	0.4256	M	0.83953	2.67	0.42698	D	0.9936	D	0.76494	0.999	D	0.75020	0.985	T	0.80407	-0.1395	9	0.54805	T	0.06	-6.5188	12.816	0.57665	0.0:0.881:0.0:0.119	.	191	Q8IZU3	SYCP3_HUMAN	N	191	.	ENSP00000266743:K191N	K	-	3	2	SYCP3	100647102	0.148000	0.22702	0.939000	0.37840	0.755000	0.42902	-0.034000	0.12225	2.663000	0.90544	0.455000	0.32223	AAG	-	SYCP3	-	pfam_Cor1/Xlr/Xmr		0.294	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	SYCP3	HGNC	protein_coding	OTTHUMT00000316478.2	0	0	0	32	32	118	0.00	0.00	C	NM_153694		102122971	-1	10	38	22	72	tier1	no_errors	ENST00000266743	ensembl	human	known	74_37	missense	31.25	34.55	SNP	0.982	G	10	22
PDE4C	5143	genome.wustl.edu	37	19	18327583	18327583	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:18327583G>A	ENST00000355502.3	-	16	2324	c.1453C>T	c.(1453-1455)Cga>Tga	p.R485*	AC068499.10_ENST00000594805.3_RNA|PDE4C_ENST00000262805.12_Nonsense_Mutation_p.R453*|PDE4C_ENST00000447275.3_Nonsense_Mutation_p.R379*|PDE4C_ENST00000594465.3_Nonsense_Mutation_p.R485*|PDE4C_ENST00000598111.2_Nonsense_Mutation_p.R200*|PDE4C_ENST00000539010.1_Nonsense_Mutation_p.R254*|PDE4C_ENST00000597297.1_Nonsense_Mutation_p.R255*|PDE4C_ENST00000594617.3_Nonsense_Mutation_p.R485*			Q08493	PDE4C_HUMAN	phosphodiesterase 4C, cAMP-specific	485					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular space (GO:0005615)|primary cilium (GO:0072372)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	33					Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	AGACTCAGTCGCTGCTTGGCG	0.617													ENSG00000105650																																					0													98.0	89.0	92.0					19																	18327583		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS12373.1, CCDS42523.1, CCDS46016.1	19p13.11	2010-06-24	2010-06-24			ENSG00000105650	3.1.4.17	"""Phosphodiesterases"""	8782	protein-coding gene	gene with protein product	"""phosphodiesterase E1 dunce homolog (Drosophila)"""	600128	"""phosphodiesterase 4C, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E1)"""	DPDE1			Standard	NM_001098818		Approved		uc002nik.4	Q08493		ENST00000355502.3:c.1453C>T	19.37:g.18327583G>A	ENSP00000347689:p.Arg485*		B3KTC4|Q9UN44|Q9UN45|Q9UN46|Q9UPJ6	Nonsense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.R485*	ENST00000355502.3	37	c.1453	CCDS12373.1	19	.	.	.	.	.	.	.	.	.	.	g	23.6	4.440831	0.83993	.	.	ENSG00000105650	ENST00000536045;ENST00000355502;ENST00000536507;ENST00000262805;ENST00000447275;ENST00000545961;ENST00000336173;ENST00000539010;ENST00000543547	.	.	.	4.52	-0.412	0.12367	.	0.206611	0.39759	N	0.001269	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.3984	0.11374	0.1826:0.0:0.5002:0.3173	.	.	.	.	X	564;485;473;453;379;291;199;254;594	.	ENSP00000262805:R453X	R	-	1	2	PDE4C	18188583	0.287000	0.24315	0.980000	0.43619	0.327000	0.28475	-0.263000	0.08670	-0.266000	0.09339	-0.530000	0.04314	CGA	-	PDE4C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom		0.617	PDE4C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4C	HGNC	protein_coding	OTTHUMT00000466295.1	0	0	0	44	44	32	0.00	0.00	G			18327583	-1	24	20	25	20	tier1	no_errors	ENST00000355502	ensembl	human	known	74_37	nonsense	48.98	50.00	SNP	1.000	A	24	25
FSCB	84075	genome.wustl.edu	37	14	44974526	44974526	+	Silent	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:44974526A>T	ENST00000340446.4	-	1	1956	c.1665T>A	c.(1663-1665)gcT>gcA	p.A555A	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	555	Ala-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CTTCAGCAGGAGCCTCTTCTG	0.507													ENSG00000189139																																					0													33.0	34.0	34.0					14																	44974526		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1665T>A	14.37:g.44974526A>T			Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.A555	ENST00000340446.4	37	c.1665	CCDS9679.1	14																																																																																			-	FSCB	-	NULL		0.507	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	0	0	0	53	53	49	0.00	0.00	A	NM_032135		44974526	-1	20	10	12	19	tier1	no_errors	ENST00000340446	ensembl	human	known	74_37	silent	62.50	34.48	SNP	0.000	T	20	12
WDR36	134430	genome.wustl.edu	37	5	110439579	110439579	+	Missense_Mutation	SNP	A	A	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:110439579A>C	ENST00000513710.2	+	7	864	c.860A>C	c.(859-861)cAa>cCa	p.Q287P	WDR36_ENST00000505303.1_Missense_Mutation_p.Q231P|WDR36_ENST00000506538.2_Missense_Mutation_p.Q287P			Q8NI36	WDR36_HUMAN	WD repeat domain 36	287					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AAGTTTCGTCAAGACTGGGGA	0.328													ENSG00000134987																																					0													63.0	66.0	65.0					5																	110439579		2201	4298	6499	SO:0001583	missense	0			-	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.860A>C	5.37:g.110439579A>C	ENSP00000424628:p.Gln287Pro		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q287P	ENST00000513710.2	37	c.860	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515832	0.85495	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.80909	-1.43;-1.43;3.35	5.21	5.21	0.72293	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88815	0.6539	M	0.70842	2.15	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.90164	0.4230	10	0.87932	D	0	-13.1049	15.3929	0.74760	1.0:0.0:0.0:0.0	.	287	Q8NI36	WDR36_HUMAN	P	287;287;231	ENSP00000423067:Q287P;ENSP00000424628:Q287P;ENSP00000422158:Q231P	ENSP00000422158:Q231P	Q	+	2	0	WDR36	110467478	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.026000	0.93700	2.095000	0.63458	0.260000	0.18958	CAA	-	WDR36	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.328	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	0	0	0	58	58	159	0.00	0.00	A	NM_139281		110439579	+1	12	35	15	77	tier1	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	44.44	31.25	SNP	1.000	C	12	15
CUBN	8029	genome.wustl.edu	37	10	16979734	16979734	+	Missense_Mutation	SNP	C	C	T	rs201513648		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:16979734C>T	ENST00000377833.4	-	39	5848	c.5783G>A	c.(5782-5784)gGt>gAt	p.G1928D		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1928	CUB 13. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGTCTGGGTACCACAGTAAGC	0.398													ENSG00000107611																																					0													65.0	70.0	69.0					10																	16979734		2203	4300	6503	SO:0001583	missense	0			-	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.5783G>A	10.37:g.16979734C>T	ENSP00000367064:p.Gly1928Asp		B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.G1928D	ENST00000377833.4	37	c.5783	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	24.7	4.555202	0.86231	.	.	ENSG00000107611	ENST00000377833	T	0.64991	-0.13	5.14	5.14	0.70334	CUB (5);	0.000000	0.39759	N	0.001267	D	0.82609	0.5074	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85642	0.1277	10	0.72032	D	0.01	.	18.9546	0.92654	0.0:1.0:0.0:0.0	.	1928	O60494	CUBN_HUMAN	D	1928	ENSP00000367064:G1928D	ENSP00000367064:G1928D	G	-	2	0	CUBN	17019740	1.000000	0.71417	0.980000	0.43619	0.857000	0.48899	6.780000	0.75063	2.531000	0.85337	0.591000	0.81541	GGT	-	CUBN	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.398	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	0	0	0	63	63	90	0.00	0.00	C	NM_001081		16979734	-1	24	58	14	43	tier1	no_errors	ENST00000377833	ensembl	human	known	74_37	missense	63.16	57.43	SNP	0.999	T	24	14
CSNK1G2	1455	genome.wustl.edu	37	19	1953888	1953888	+	Intron	SNP	G	G	A	rs538706376		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:1953888G>A	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000314315.3_RNA|CSNK1G2-AS1_ENST00000586395.1_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCAGCTGCGTTCTCAGAGG	0.642													ENSG00000180846	G|||	1	0.000199681	0.0	0.0	5008	,	,		18931	0.0		0.0	False		,,,				2504	0.001				Ovarian(91;880 1392 21236 36928 37598)												0													97.0	101.0	100.0					19																	1953888		2162	4261	6423	SO:0001627	intron_variant	0			-	AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+12471G>A	19.37:g.1953888G>A			B5BU42|O00704|Q8WUB1	R	SNP	-	NULL	ENST00000255641.8	37	NULL	CCDS12077.1	19																																																																																			-	CSNK1G2-AS1	-	-		0.642	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2-AS1	HGNC	protein_coding	OTTHUMT00000449287.1	0	0	0	20	20	62	0.00	0.00	G	NM_001319		1953888	-1	22	30	32	36	tier1	no_errors	ENST00000314315	ensembl	human	known	74_37	rna	40.74	45.45	SNP	0.002	A	22	32
OR51J1	79470	genome.wustl.edu	37	11	5424660	5424660	+	Missense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:5424660G>A	ENST00000332043.1	+	1	834	c.834G>A	c.(832-834)atG>atA	p.M278I	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA			Q9H342	O51J1_HUMAN	olfactory receptor, family 51, subfamily J, member 1 (gene/pseudogene)	278					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AAGCCATGATGGCCAATGCCT	0.493													ENSG00000184321																																					0																																										SO:0001583	missense	0			-			11p15.4	2012-08-09	2008-06-12	2004-03-10	ENSG00000184321	ENSG00000184321		"""GPCR / Class A : Olfactory receptors"""	14856	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily J, member 1"""	OR51J2, OR51J1P			Standard	NG_002252		Approved			Q9H342	OTTHUMG00000066666	ENST00000332043.1:c.834G>A	11.37:g.5424660G>A	ENSP00000332473:p.Met278Ile			Missense_Mutation	SNP	pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.M278I	ENST00000332043.1	37	c.834		11	.	.	.	.	.	.	.	.	.	.	G	13.78	2.338129	0.41398	.	.	ENSG00000184321	ENST00000332043	T	0.32753	1.44	5.25	3.34	0.38264	.	.	.	.	.	T	0.28001	0.0690	.	.	.	0.21105	N	0.999786	.	.	.	.	.	.	T	0.16482	-1.0401	6	0.36615	T	0.2	.	7.1778	0.25755	0.0794:0.0:0.6197:0.301	.	.	.	.	I	278	ENSP00000332473:M278I	ENSP00000332473:M278I	M	+	3	0	OR51J1	5381236	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	2.621000	0.46418	0.752000	0.32923	0.563000	0.77884	ATG	-	OR51J1	-	pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.493	OR51J1-001	KNOWN	basic|appris_principal	protein_coding	OR51J1	HGNC	protein_coding	OTTHUMT00000142957.1	0	0	0	64	64	113	0.00	0.00	G	NG_002252		5424660	+1	18	37	10	37	tier1	no_errors	ENST00000332043	ensembl	human	known	74_37	missense	62.07	50.00	SNP	0.994	A	18	10
RPL36	25873	genome.wustl.edu	37	19	5691405	5691405	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:5691405G>C	ENST00000577222.1	+	5	713	c.169G>C	c.(169-171)Gcc>Ccc	p.A57P	RPL36_ENST00000579446.1_Missense_Mutation_p.A57P|RPL36_ENST00000347512.3_Missense_Mutation_p.A57P|RPL36_ENST00000579649.1_Missense_Mutation_p.A57P|RPL36_ENST00000394580.2_Missense_Mutation_p.A57P			Q9Y3U8	RL36_HUMAN	ribosomal protein L36	57					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|upper_aerodigestive_tract(1)	2						CGAGCGGCGCGCCATGGAGTT	0.617											OREG0025183	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000130255																																					0													63.0	67.0	65.0					19																	5691405		2203	4300	6503	SO:0001583	missense	0			-		CCDS12147.1	19p13.2	2011-04-06				ENSG00000130255		"""L ribosomal proteins"""	13631	protein-coding gene	gene with protein product							Standard	NM_033643		Approved	DKFZp566B023, L36	uc002mcv.3	Q9Y3U8		ENST00000577222.1:c.169G>C	19.37:g.5691405G>C	ENSP00000464342:p.Ala57Pro	628	B2R4Y1|D6W634|Q6FIG1|Q9UQF6	Missense_Mutation	SNP	pfam_Ribosomal_L36e	p.A57P	ENST00000577222.1	37	c.169	CCDS12147.1	19	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090952	0.36855	.	.	ENSG00000130255	ENST00000347512;ENST00000394580	T;T	0.47177	0.85;0.85	4.31	3.27	0.37495	.	0.000000	0.85682	U	0.000000	T	0.54319	0.1851	M	0.81682	2.555	0.80722	D	1	B	0.25521	0.128	B	0.37422	0.249	T	0.55585	-0.8118	10	0.52906	T	0.07	.	9.9356	0.41550	0.1033:0.0:0.8967:0.0	.	57	Q9Y3U8	RL36_HUMAN	P	57	ENSP00000252543:A57P;ENSP00000378081:A57P	ENSP00000252543:A57P	A	+	1	0	RPL36	5642405	1.000000	0.71417	0.761000	0.31378	0.010000	0.07245	9.557000	0.98129	0.799000	0.34018	-0.373000	0.07131	GCC	-	RPL36	-	pfam_Ribosomal_L36e		0.617	RPL36-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	RPL36	HGNC	protein_coding	OTTHUMT00000442561.1	0	0	0	99	99	16	0.00	0.00	G	NM_015414		5691405	+1	14	10	55	21	tier1	no_errors	ENST00000347512	ensembl	human	known	74_37	missense	20.29	32.26	SNP	0.995	C	14	55
ATR	545	genome.wustl.edu	37	3	142278275	142278275	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:142278275A>G	ENST00000350721.4	-	7	1671	c.1550T>C	c.(1549-1551)tTc>tCc	p.F517S	ATR_ENST00000383101.3_Missense_Mutation_p.F453S	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	517					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ACAGTCCTTGAAAGTACGGCT	0.313								Other conserved DNA damage response genes					ENSG00000175054																																					0													67.0	64.0	65.0					3																	142278275		2203	4300	6503	SO:0001583	missense	0			-	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1550T>C	3.37:g.142278275A>G	ENSP00000343741:p.Phe517Ser		Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PIK-rel_kinase_FAT,pfam_UME,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_UME,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_HEAT_type_2,pfscan_PI3/4_kinase_cat_dom	p.F517S	ENST00000350721.4	37	c.1550	CCDS3124.1	3	.	.	.	.	.	.	.	.	.	.	A	3.137	-0.177147	0.06380	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.03094	4.05;4.05	5.34	-1.29	0.09288	Armadillo-type fold (1);	0.792860	0.12218	N	0.488648	T	0.02083	0.0065	N	0.19112	0.55	0.22888	N	0.998601	B	0.02656	0.0	B	0.01281	0.0	T	0.45101	-0.9284	10	0.44086	T	0.13	-2.5044	0.9766	0.01427	0.4369:0.1541:0.26:0.1489	.	517	Q13535	ATR_HUMAN	S	517;453;134	ENSP00000343741:F517S;ENSP00000372581:F453S	ENSP00000343741:F517S	F	-	2	0	ATR	143760965	0.999000	0.42202	0.851000	0.33527	0.031000	0.12232	0.477000	0.22196	0.127000	0.18452	-0.250000	0.11733	TTC	-	ATR	-	superfamily_ARM-type_fold		0.313	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATR	HGNC	protein_coding	OTTHUMT00000353995.2	0	0	0	22	22	180	0.00	0.00	A	NM_001184		142278275	-1	7	52	14	123	tier1	no_errors	ENST00000350721	ensembl	human	known	74_37	missense	33.33	29.55	SNP	0.686	G	7	14
KDM5B	10765	genome.wustl.edu	37	1	202702842	202702842	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:202702842A>T	ENST00000367265.3	-	23	4760	c.3596T>A	c.(3595-3597)tTc>tAc	p.F1199Y	KDM5B_ENST00000367264.2_Missense_Mutation_p.F1235Y	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1199					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						ACTGGTGTGGAAAGCATCCCT	0.488													ENSG00000117139																																					0													61.0	63.0	63.0					1																	202702842		2203	4300	6503	SO:0001583	missense	0			-	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3596T>A	1.37:g.202702842A>T	ENSP00000356234:p.Phe1199Tyr		O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_D-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_D-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_D-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_D-bd	p.F1235Y	ENST00000367265.3	37	c.3704	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	A	28.0	4.879414	0.91740	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.85556	-2.0;-2.0;-2.0	6.09	6.09	0.99107	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.043030	0.85682	D	0.000000	D	0.88865	0.6553	L	0.53780	1.695	0.80722	D	1	P;P	0.51351	0.944;0.934	P;P	0.55455	0.448;0.776	D	0.89383	0.3683	10	0.62326	D	0.03	-22.2269	16.6685	0.85259	1.0:0.0:0.0:0.0	.	1235;1199	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	Y	1199;1041;1235;1041	ENSP00000356234:F1199Y;ENSP00000356233:F1235Y;ENSP00000235790:F1041Y	ENSP00000235790:F1041Y	F	-	2	0	KDM5B	200969465	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.962000	0.93254	2.336000	0.79503	0.523000	0.50628	TTC	-	KDM5B	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger		0.488	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	0	0	0	33	33	114	0.00	0.00	A	NM_006618		202702842	-1	10	37	24	123	tier1	no_errors	ENST00000367264	ensembl	human	known	74_37	missense	29.41	22.98	SNP	1.000	T	10	24
BRIP1	83990	genome.wustl.edu	37	17	59761175	59761175	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:59761175T>C	ENST00000259008.2	-	20	3499	c.3232A>G	c.(3232-3234)Aag>Gag	p.K1078E		NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	1078					DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						GCATCAATCTTTAATGATGAA	0.383			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks					ENSG00000136492																											yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0													175.0	174.0	174.0					17																	59761175		2203	4300	6503	SO:0001583	missense	0			-	AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.3232A>G	17.37:g.59761175T>C	ENSP00000259008:p.Lys1078Glu		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_D_helicase_D-repair_Rad3	p.K1078E	ENST00000259008.2	37	c.3232	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	T	8.406	0.842967	0.16963	.	.	ENSG00000136492	ENST00000259008	T	0.77620	-1.11	5.44	4.35	0.52113	.	0.631577	0.16055	N	0.231791	T	0.65801	0.2726	L	0.32530	0.975	0.23113	N	0.998278	B	0.26935	0.164	B	0.22601	0.04	T	0.51671	-0.8676	9	.	.	.	-2.6799	10.6214	0.45483	0.0:0.0:0.1611:0.8389	.	1078	Q9BX63	FANCJ_HUMAN	E	1078	ENSP00000259008:K1078E	.	K	-	1	0	BRIP1	57115957	0.199000	0.23386	0.006000	0.13384	0.218000	0.24690	1.429000	0.34903	0.981000	0.38548	0.455000	0.32223	AAG	-	BRIP1	-	NULL		0.383	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1	0	0	0	32	32	132	0.00	0.00	T	NM_032043		59761175	-1	13	26	38	158	tier1	no_errors	ENST00000259008	ensembl	human	known	74_37	missense	25.49	14.13	SNP	0.031	C	13	38
OTOP3	347741	genome.wustl.edu	37	17	72939701	72939701	+	Splice_Site	SNP	G	G	T	rs374568232		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:72939701G>T	ENST00000328801.4	+	5	687	c.687G>T	c.(685-687)agG>agT	p.R229S		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	229						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					TTTCCCCCAGGTGTGGCCTGA	0.597													ENSG00000182938																																					0													105.0	72.0	83.0					17																	72939701		2203	4300	6503	SO:0001630	splice_region_variant	0			-	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.687-1G>T	17.37:g.72939701G>T				Missense_Mutation	SNP	pfam_Otopetrin	p.R229S	ENST00000328801.4	37	c.687	CCDS11709.1	17	.	.	.	.	.	.	.	.	.	.	G	15.92	2.974195	0.53720	.	.	ENSG00000182938	ENST00000328801	T	0.18016	2.24	4.9	2.89	0.33648	.	0.000000	0.85682	D	0.000000	T	0.26268	0.0641	M	0.80982	2.52	0.80722	D	1	D	0.54047	0.964	P	0.46585	0.521	T	0.02751	-1.1115	9	.	.	.	.	9.8973	0.41327	0.2515:0.0:0.7485:0.0	.	229	Q7RTS5	OTOP3_HUMAN	S	229	ENSP00000328090:R229S	.	R	+	3	2	OTOP3	70451296	1.000000	0.71417	1.000000	0.80357	0.701000	0.40568	1.604000	0.36804	0.220000	0.20860	-1.119000	0.02030	AGG	-	OTOP3	-	NULL		0.597	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP3	HGNC	protein_coding	OTTHUMT00000445308.1	0	0	0	43	43	52	0.00	0.00	G	NM_178233	Missense_Mutation	72939701	+1	11	24	37	38	tier1	no_errors	ENST00000328801	ensembl	human	known	74_37	missense	22.92	38.10	SNP	1.000	T	11	37
SYNE1	23345	genome.wustl.edu	37	6	152652933	152652933	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:152652933T>C	ENST00000367255.5	-	78	13488	c.12887A>G	c.(12886-12888)aAa>aGa	p.K4296R	SYNE1_ENST00000265368.4_Missense_Mutation_p.K4296R|SYNE1_ENST00000423061.1_Missense_Mutation_p.K4225R|SYNE1_ENST00000448038.1_Missense_Mutation_p.K4225R|SYNE1_ENST00000341594.5_Missense_Mutation_p.K4161R	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4296					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTTTGATCTTTCAGATCTTC	0.393										HNSCC(10;0.0054)			ENSG00000131018																																					0													99.0	97.0	98.0					6																	152652933		2203	4300	6503	SO:0001583	missense	0			-	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.12887A>G	6.37:g.152652933T>C	ENSP00000356224:p.Lys4296Arg		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K4296R	ENST00000367255.5	37	c.12887	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	11.01	1.512280	0.27036	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36	5.66	4.5	0.54988	.	0.000000	0.64402	D	0.000008	T	0.14743	0.0356	L	0.55103	1.725	0.80722	D	1	P;P;P;P	0.42078	0.77;0.66;0.66;0.77	B;B;B;B	0.36959	0.237;0.119;0.119;0.237	T	0.04522	-1.0945	10	0.12430	T	0.62	.	11.4868	0.50358	0.0:0.0699:0.0:0.9301	.	4296;4296;4296;4225	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	R	4296;4225;4296;4225;4161	ENSP00000356224:K4296R;ENSP00000396024:K4225R;ENSP00000265368:K4296R;ENSP00000390975:K4225R;ENSP00000341887:K4161R	ENSP00000265368:K4296R	K	-	2	0	SYNE1	152694626	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	6.258000	0.72487	0.992000	0.38840	0.482000	0.46254	AAA	-	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom		0.393	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	0	0	0	46	46	76	0.00	0.00	T	NM_182961		152652933	-1	17	39	34	83	tier1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	33.33	31.97	SNP	1.000	C	17	34
PKP4	8502	genome.wustl.edu	37	2	159517119	159517119	+	Intron	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:159517119A>G	ENST00000389759.3	+	13	2205				PKP4_ENST00000389757.3_Intron|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4						cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						ACCATTGTTAATGGGACATAA	0.353										HNSCC(62;0.18)			ENSG00000204380																																					0																																										SO:0001627	intron_variant	0			-	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2094-726A>G	2.37:g.159517119A>G			Q86W91	R	SNP	-	NULL	ENST00000389759.3	37	NULL	CCDS33305.1	2																																																																																			-	AC005042.4	-	-		0.353	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100129029	Clone_based_vega_gene	protein_coding	OTTHUMT00000333250.1	0	0	1	32	32	96	0.00	1.03	A			159517119	-1	9	28	12	34	tier1	no_errors	ENST00000342892	ensembl	human	known	74_37	rna	42.86	45.16	SNP	0.000	G	9	12
ACAT1	38	genome.wustl.edu	37	11	108010820	108010820	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:108010820A>G	ENST00000265838.4	+	7	699	c.608A>G	c.(607-609)aAg>aGg	p.K203R		NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	203					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	ACAGCAAAGAAGCTGAATATT	0.328													ENSG00000075239																																					0													58.0	60.0	59.0					11																	108010820		2201	4298	6499	SO:0001583	missense	0			-	D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.608A>G	11.37:g.108010820A>G	ENSP00000265838:p.Lys203Arg		B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.K203R	ENST00000265838.4	37	c.608	CCDS8339.1	11	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825416	0.71143	.	.	ENSG00000075239	ENST00000265838	D	0.90732	-2.72	5.99	5.99	0.97316	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.233912	0.49916	D	0.000127	D	0.88976	0.6584	L	0.49513	1.565	0.80722	D	1	B	0.18310	0.027	B	0.22880	0.042	D	0.85545	0.1218	10	0.66056	D	0.02	-22.4512	16.4943	0.84223	1.0:0.0:0.0:0.0	.	203	P24752	THIL_HUMAN	R	203	ENSP00000265838:K203R	ENSP00000265838:K203R	K	+	2	0	ACAT1	107516030	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	6.979000	0.76154	2.291000	0.77112	0.533000	0.62120	AAG	-	ACAT1	-	pfam_Thiolase_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase		0.328	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	HGNC	protein_coding	OTTHUMT00000389474.1	0	0	0	42	42	92	0.00	0.00	A	NM_000019		108010820	+1	8	19	11	29	tier1	no_errors	ENST00000265838	ensembl	human	known	74_37	missense	42.11	39.58	SNP	1.000	G	8	11
SMG1	23049	genome.wustl.edu	37	16	18859200	18859200	+	Missense_Mutation	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:18859200G>C	ENST00000446231.2	-	37	6191	c.5779C>G	c.(5779-5781)Cag>Gag	p.Q1927E	SMG1_ENST00000389467.3_Missense_Mutation_p.Q1927E			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1927	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TAACAATCCTGCATCATGGCT	0.398													ENSG00000157106																																					0													158.0	147.0	150.0					16																	18859200		1889	4112	6001	SO:0001583	missense	0			-	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.5779C>G	16.37:g.18859200G>C	ENSP00000402515:p.Gln1927Glu		O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q1927E	ENST00000446231.2	37	c.5779	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	18.34	3.603008	0.66445	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.64438	-0.1;-0.1	5.85	5.85	0.93711	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	T	0.68723	0.3032	L	0.27053	0.805	0.52099	D	0.999945	P;P	0.52577	0.954;0.924	D;P	0.65140	0.932;0.9	T	0.62709	-0.6797	10	0.24483	T	0.36	.	20.1624	0.98139	0.0:0.0:1.0:0.0	.	1787;1927	Q96Q15-2;Q96Q15	.;SMG1_HUMAN	E	1927	ENSP00000402515:Q1927E;ENSP00000374118:Q1927E	ENSP00000374118:Q1927E	Q	-	1	0	SMG1	18766701	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.822000	0.99363	2.764000	0.94973	0.591000	0.81541	CAG	-	SMG1	-	superfamily_ARM-type_fold		0.398	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	0	0	0	65	65	137	0.00	0.00	G	NM_015092		18859200	-1	13	64	54	154	tier1	no_errors	ENST00000389467	ensembl	human	known	74_37	missense	19.40	29.36	SNP	1.000	C	13	54
HDAC3	8841	genome.wustl.edu	37	5	141016128	141016128	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:141016128T>C	ENST00000305264.3	-	2	204	c.125A>G	c.(124-126)tAt>tGt	p.Y42C	RELL2_ENST00000444782.1_5'Flank|RELL2_ENST00000297164.3_5'Flank|RELL2_ENST00000518856.1_5'Flank|RELL2_ENST00000521367.1_5'Flank|FCHSD1_ENST00000523856.1_5'Flank	NM_003883.3	NP_003874.2	O15379	HDAC3_HUMAN	histone deacetylase 3	42	Histone deacetylase.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|protein deacetylation (GO:0006476)|regulation of mitotic cell cycle (GO:0007346)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|cyclin binding (GO:0030332)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Vorinostat(DB02546)	CATCTTCTTATAGAGACCGTA	0.612													ENSG00000171720																																					0													57.0	61.0	60.0					5																	141016128		2203	4300	6503	SO:0001583	missense	0			-	AF059650	CCDS4264.1	5q31.1-q31.2	2008-07-18			ENSG00000171720	ENSG00000171720	3.5.1.98		4854	protein-coding gene	gene with protein product		605166				9501169, 9464271	Standard	NM_003883		Approved	RPD3, HD3, RPD3-2	uc003llf.2	O15379	OTTHUMG00000129629	ENST00000305264.3:c.125A>G	5.37:g.141016128T>C	ENSP00000302967:p.Tyr42Cys		D3DQE1|O43268|Q9UEI5|Q9UEV0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.Y42C	ENST00000305264.3	37	c.125	CCDS4264.1	5	.	.	.	.	.	.	.	.	.	.	T	28.5	4.924403	0.92319	.	.	ENSG00000171720	ENST00000305264;ENST00000523353;ENST00000523088	T;T;T	0.74002	-0.8;1.52;1.52	5.26	5.26	0.73747	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	D	0.84534	0.5493	M	0.77616	2.38	0.80722	D	1	P;D	0.62365	0.953;0.991	B;P	0.61658	0.129;0.892	D	0.86870	0.2035	10	0.87932	D	0	-17.1518	14.9988	0.71455	0.0:0.0:0.0:1.0	.	42;42	E7ESJ6;O15379	.;HDAC3_HUMAN	C	42	ENSP00000302967:Y42C;ENSP00000430667:Y42C;ENSP00000429099:Y42C	ENSP00000302967:Y42C	Y	-	2	0	HDAC3	140996312	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.756000	0.85195	2.208000	0.71279	0.533000	0.62120	TAT	-	HDAC3	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1		0.612	HDAC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC3	HGNC	protein_coding	OTTHUMT00000251824.2	0	0	0	184	184	45	0.00	0.00	T	NM_003883		141016128	-1	71	35	100	25	tier1	no_errors	ENST00000305264	ensembl	human	known	74_37	missense	41.52	58.33	SNP	1.000	C	71	100
WDR87	83889	genome.wustl.edu	37	19	38378202	38378202	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:38378202T>C	ENST00000303868.5	-	6	6216	c.5992A>G	c.(5992-5994)Atg>Gtg	p.M1998V	WDR87_ENST00000447313.2_Missense_Mutation_p.M2037V	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1998	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						ACTTGAGTCATTTTCCTTTGT	0.413													ENSG00000171804																																					0													76.0	59.0	64.0					19																	38378202		692	1591	2283	SO:0001583	missense	0			-	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5992A>G	19.37:g.38378202T>C	ENSP00000368025:p.Met1998Val		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M2037V	ENST00000303868.5	37	c.6109	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	6.285	0.420676	0.11928	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.08896	3.04;3.04	4.7	-9.4	0.00616	.	.	.	.	.	T	0.02610	0.0079	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42224	-0.9464	9	0.41790	T	0.15	.	0.1094	0.00055	0.3129:0.2136:0.2506:0.223	.	1998;2037	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	V	2037;1998	ENSP00000405012:M2037V;ENSP00000368025:M1998V	ENSP00000368025:M1998V	M	-	1	0	WDR87	43070042	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.903000	0.04084	-1.219000	0.02597	-0.533000	0.04299	ATG	-	WDR87	-	superfamily_ARM-type_fold		0.413	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	0	0	0	51	51	142	0.00	0.00	T	XM_940478		38378202	-1	15	51	41	191	tier1	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	26.79	20.99	SNP	0.000	C	15	41
DTD2	112487	genome.wustl.edu	37	14	31917348	31917348	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:31917348A>G	ENST00000310850.4	-	3	610	c.494T>C	c.(493-495)tTa>tCa	p.L165S	CTD-2213F21.2_ENST00000502430.2_RNA|DTD2_ENST00000356180.4_Missense_Mutation_p.L165S|RP11-176H8.1_ENST00000547378.1_Intron	NM_080664.2	NP_542395.1	Q96FN9	DTD2_HUMAN	D-tyrosyl-tRNA deacylase 2 (putative)	165					D-amino acid catabolic process (GO:0019478)	cytoplasm (GO:0005737)	hydrolase activity, acting on ester bonds (GO:0016788)										AAACTCAATTAAGTGTGTGAA	0.368													ENSG00000129480																																					0													162.0	161.0	161.0					14																	31917348		2203	4300	6503	SO:0001583	missense	0			-	BC010618	CCDS9643.1	14q12	2012-09-25	2012-09-25	2012-09-25	ENSG00000129480	ENSG00000129480			20277	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 126"""	C14orf126			Standard	NM_080664		Approved	MGC9912	uc001wrj.3	Q96FN9	OTTHUMG00000140205	ENST00000310850.4:c.494T>C	14.37:g.31917348A>G	ENSP00000312224:p.Leu165Ser		D3DS87	Missense_Mutation	SNP	pfam_DTyrtR_deacyls,superfamily_DTD-like_dom	p.L165S	ENST00000310850.4	37	c.494	CCDS9643.1	14	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593589	0.86953	.	.	ENSG00000129480	ENST00000310850;ENST00000356180	T;T	0.51325	0.71;0.71	6.04	6.04	0.98038	D-Tyr tRNAtyr deacylase-like domain (2);	0.000000	0.85682	D	0.000000	T	0.64768	0.2628	M	0.76574	2.34	0.53688	D	0.999974	D	0.56746	0.977	P	0.56088	0.791	T	0.69011	-0.5258	10	0.87932	D	0	-9.6818	16.5885	0.84745	1.0:0.0:0.0:0.0	.	165	Q96FN9	DTD2_HUMAN	S	165	ENSP00000312224:L165S;ENSP00000348503:L165S	ENSP00000312224:L165S	L	-	2	0	C14orf126	30987099	1.000000	0.71417	0.839000	0.33178	0.987000	0.75469	8.538000	0.90634	2.317000	0.78254	0.460000	0.39030	TTA	-	DTD2	-	pfam_DTyrtR_deacyls,superfamily_DTD-like_dom		0.368	DTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTD2	HGNC	protein_coding	OTTHUMT00000276614.2	0	0	0	64	64	159	0.00	0.00	A	NM_080664		31917348	-1	9	49	37	117	tier1	no_errors	ENST00000310850	ensembl	human	known	74_37	missense	19.57	29.52	SNP	0.923	G	9	37
DTX4	23220	genome.wustl.edu	37	11	58956718	58956718	+	Missense_Mutation	SNP	G	G	A	rs376061897		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:58956718G>A	ENST00000227451.3	+	4	1185	c.1081G>A	c.(1081-1083)Gtc>Atc	p.V361I	DTX4_ENST00000532982.1_Missense_Mutation_p.V255I|DTX4_ENST00000531902.1_3'UTR	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	361					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				CCCACCCCCCGTCAGCAAGAG	0.562													ENSG00000110042																																					0								G	ILE/VAL	0,3768		0,0,1884	38.0	45.0	43.0		1081	5.6	1.0	11		43	1,8225		0,1,4112	no	missense	DTX4	NM_015177.1	29	0,1,5996	AA,AG,GG		0.0122,0.0,0.0083	possibly-damaging	361/620	58956718	1,11993	1884	4113	5997	SO:0001583	missense	0			-	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.1081G>A	11.37:g.58956718G>A	ENSP00000227451:p.Val361Ile		Q0VF38	Missense_Mutation	SNP	pfam_WWE-dom,pfam_Znf_C3HC4_RING-type,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.V361I	ENST00000227451.3	37	c.1081	CCDS44612.1	11	.	.	.	.	.	.	.	.	.	.	G	19.89	3.910833	0.72983	0.0	1.22E-4	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.12672	2.66;2.86	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.11024	0.0269	L	0.38838	1.175	0.58432	D	0.999992	P	0.37688	0.605	B	0.21151	0.033	T	0.10154	-1.0642	10	0.33141	T	0.24	.	18.4066	0.90538	0.0:0.0:1.0:0.0	.	361	Q9Y2E6	DTX4_HUMAN	I	255;361	ENSP00000434055:V255I;ENSP00000227451:V361I	ENSP00000227451:V361I	V	+	1	0	DTX4	58713294	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	5.642000	0.67888	2.634000	0.89283	0.563000	0.77884	GTC	-	DTX4	-	NULL		0.562	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX4	HGNC	protein_coding	OTTHUMT00000394228.1	0	0	1	55	55	93	0.00	1.06	G	XM_166213		58956718	+1	17	30	29	50	tier1	no_errors	ENST00000227451	ensembl	human	known	74_37	missense	36.96	37.50	SNP	0.999	A	17	29
NR2E1	7101	genome.wustl.edu	37	6	108489261	108489261	+	Intron	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:108489261A>T	ENST00000368986.4	+	1	733				NR2E1_ENST00000368983.3_Nonsense_Mutation_p.K11*	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1						aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		GGGAGCAGAGAAGGAGCCCTC	0.537													ENSG00000112333																																					0													12.0	13.0	13.0					6																	108489261		876	1990	2866	SO:0001627	intron_variant	0			-	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.25+1267A>T	6.37:g.108489261A>T			Q6ZMP8	Nonsense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.K11*	ENST00000368986.4	37	c.31	CCDS5063.1	6	.	.	.	.	.	.	.	.	.	.	A	37	6.155478	0.97334	.	.	ENSG00000112333	ENST00000368983	.	.	.	4.49	1.91	0.25777	.	38.409900	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	8.5676	0.33550	0.6155:0.3845:0.0:0.0	.	.	.	.	X	11	.	ENSP00000357979:K11X	K	+	1	0	NR2E1	108595954	0.038000	0.19896	0.499000	0.27577	0.730000	0.41778	0.284000	0.18864	0.288000	0.22398	0.459000	0.35465	AAG	-	NR2E1	-	NULL		0.537	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2E1	HGNC	protein_coding	OTTHUMT00000041712.2	0	0	0	87	87	113	0.00	0.00	A			108489261	+1	20	34	77	78	tier1	no_errors	ENST00000368983	ensembl	human	novel	74_37	nonsense	20.41	30.36	SNP	0.689	T	20	77
LONP1	9361	genome.wustl.edu	37	19	5707147	5707147	+	Missense_Mutation	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:5707147T>G	ENST00000360614.3	-	7	1227	c.1070A>C	c.(1069-1071)aAg>aCg	p.K357T	LONP1_ENST00000585374.1_Missense_Mutation_p.K243T|LONP1_ENST00000593119.1_Missense_Mutation_p.K293T|LONP1_ENST00000540670.2_Missense_Mutation_p.K161T|LONP1_ENST00000590729.1_Missense_Mutation_p.K227T	NM_004793.2	NP_004784.2			lon peptidase 1, mitochondrial											breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTACAGCCGCTTAGGAATCTG	0.607													ENSG00000196365																																					0													32.0	29.0	30.0					19																	5707147		2203	4300	6503	SO:0001583	missense	0			-	U02389	CCDS12148.1, CCDS62507.1, CCDS62508.1	19p13.2	2014-01-28	2006-10-20	2006-10-20	ENSG00000196365	ENSG00000196365		"""ATPases / AAA-type"", ""Serine peptidases / Serine peptidases"""	9479	protein-coding gene	gene with protein product		605490	"""protease, serine, 15"""	PRSS15		8248235, 8119403	Standard	NM_004793		Approved	LonHS, hLON, PIM1	uc002mcx.4	P36776		ENST00000360614.3:c.1070A>C	19.37:g.5707147T>G	ENSP00000353826:p.Lys357Thr			Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-2,pfam_D_helicase_Holl-junc_RuvB_N,pfam_Prk_AAA_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_P-loop_NTPase,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Lon_bac/euk-typ	p.K357T	ENST00000360614.3	37	c.1070	CCDS12148.1	19	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725971	0.69074	.	.	ENSG00000196365	ENST00000360614;ENST00000358403;ENST00000540670	T;T	0.44482	0.92;0.92	4.4	4.4	0.53042	Peptidase S16, lon N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.55417	0.1919	M	0.79475	2.455	0.58432	D	0.999999	P;P;P	0.45768	0.866;0.763;0.866	P;P;P	0.51974	0.686;0.686;0.686	T	0.60347	-0.7281	10	0.56958	D	0.05	-44.8785	11.588	0.50929	0.0:0.0:0.0:1.0	.	357;293;357	E5KMH8;Q8N8K8;P36776	.;.;LONM_HUMAN	T	357;321;161	ENSP00000353826:K357T;ENSP00000441523:K161T	ENSP00000351177:K321T	K	-	2	0	LONP1	5658147	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	3.999000	0.57031	1.626000	0.50381	0.459000	0.35465	AAG	-	LONP1	-	pfam_Pept_S16_N,smart_Pept_S16_N,tigrfam_Lon_bac/euk-typ		0.607	LONP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP1	HGNC	protein_coding	OTTHUMT00000451662.1	0	0	0	131	131	62	0.00	0.00	T	NM_004793		5707147	-1	33	26	83	74	tier1	no_errors	ENST00000360614	ensembl	human	known	74_37	missense	28.45	26.00	SNP	1.000	G	33	83
BAI1	575	genome.wustl.edu	37	8	143558855	143558855	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:143558855C>A	ENST00000517894.1	+	6	2226	c.1332C>A	c.(1330-1332)aaC>aaA	p.N444K	BAI1_ENST00000323289.5_Missense_Mutation_p.N444K			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	444	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TTGGGGGCAACCCCTGTGAGG	0.647													ENSG00000181790																																					0													44.0	53.0	50.0					8																	143558855		1981	4156	6137	SO:0001583	missense	0			-	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1332C>A	8.37:g.143558855C>A	ENSP00000430945:p.Asn444Lys			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.N444K	ENST00000517894.1	37	c.1332		8	.	.	.	.	.	.	.	.	.	.	C	7.660	0.684811	0.14973	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.50548	0.74;0.74	4.18	4.18	0.49190	.	0.291778	0.32190	U	0.006460	T	0.19927	0.0479	N	0.00869	-1.13	0.39288	D	0.964688	P	0.50528	0.936	P	0.45753	0.492	T	0.35325	-0.9793	10	0.02654	T	1	.	15.816	0.78599	0.0:1.0:0.0:0.0	.	444	E9PBK0	.	K	444	ENSP00000430945:N444K;ENSP00000313046:N444K	ENSP00000313046:N444K	N	+	3	2	BAI1	143555857	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.118000	0.31246	2.000000	0.58554	0.491000	0.48974	AAC	-	BAI1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.647	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	0	0	0	73	73	26	0.00	0.00	C	NM_001702		143558855	+1	31	29	22	14	tier1	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	58.49	67.44	SNP	1.000	A	31	22
MXRA5	25878	genome.wustl.edu	37	X	3238224	3238224	+	Silent	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:3238224T>A	ENST00000217939.6	-	5	5656	c.5502A>T	c.(5500-5502)tcA>tcT	p.S1834S		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	1834						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CAAAGAACTTTGAGCTGCTCT	0.493													ENSG00000101825																																					0													85.0	82.0	83.0					X																	3238224		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.5502A>T	X.37:g.3238224T>A			Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S1834	ENST00000217939.6	37	c.5502	CCDS14124.1	X																																																																																			-	MXRA5	-	NULL		0.493	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	0	0	0	61	61	35	0.00	0.00	T	NM_015419		3238224	-1	32	17	49	25	tier1	no_errors	ENST00000217939	ensembl	human	known	74_37	silent	39.51	40.48	SNP	0.000	A	32	49
PTPRF	5792	genome.wustl.edu	37	1	44035396	44035396	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:44035396T>C	ENST00000359947.4	+	6	855	c.515T>C	c.(514-516)tTc>tCc	p.F172S	PTPRF_ENST00000372414.3_Missense_Mutation_p.F172S|PTPRF_ENST00000372413.3_Missense_Mutation_p.F172S|PTPRF_ENST00000438120.1_Missense_Mutation_p.F172S	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	172	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TTCAAGGACTTCCTTCCTGTA	0.592													ENSG00000142949																																					0													71.0	68.0	69.0					1																	44035396		2203	4300	6503	SO:0001583	missense	0			-	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.515T>C	1.37:g.44035396T>C	ENSP00000353030:p.Phe172Ser		D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.F172S	ENST00000359947.4	37	c.515	CCDS489.2	1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424624	0.83667	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000437607	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.0	5.0	0.66597	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35708	N	0.003035	T	0.30166	0.0756	N	0.01202	-0.96	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;0.997;0.922	D;D;D;P	0.85130	0.997;0.996;0.92;0.697	T	0.50482	-0.8823	10	0.21540	T	0.41	.	15.0283	0.71687	0.0:0.0:0.0:1.0	.	172;172;172;172	Q5T020;P10586-2;P10586;Q5T019	.;.;PTPRF_HUMAN;.	S	172	ENSP00000353030:F172S;ENSP00000398822:F172S;ENSP00000361491:F172S;ENSP00000361490:F172S;ENSP00000413306:F172S	ENSP00000353030:F172S	F	+	2	0	PTPRF	43807983	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	8.040000	0.89188	2.026000	0.59711	0.459000	0.35465	TTC	-	PTPRF	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.592	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	0	0	1	34	34	86	0.00	1.15	T			44035396	+1	11	27	16	51	tier1	no_errors	ENST00000359947	ensembl	human	known	74_37	missense	40.74	34.62	SNP	1.000	C	11	16
PDZK1	5174	genome.wustl.edu	37	1	145761266	145761266	+	Missense_Mutation	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:145761266T>C	ENST00000344770.2	+	7	1152	c.1079T>C	c.(1078-1080)cTg>cCg	p.L360P	PDZK1_ENST00000417171.1_Missense_Mutation_p.L360P|PDZK1_ENST00000451928.2_Missense_Mutation_p.L249P	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	360					carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			CCCACTTCTCTGGAAGTCTCA	0.433													ENSG00000174827																																					0													53.0	58.0	56.0					1																	145761266		2201	4296	6497	SO:0001583	missense	0			-	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.1079T>C	1.37:g.145761266T>C	ENSP00000342143:p.Leu360Pro		B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L360P	ENST00000344770.2	37	c.1079	CCDS924.1	1	.	.	.	.	.	.	.	.	.	.	T	2.880	-0.231993	0.05983	.	.	ENSG00000174827	ENST00000417171;ENST00000451928;ENST00000344770	T;T;T	0.16457	2.34;2.34;2.34	5.38	-1.53	0.08611	PDZ/DHR/GLGF (1);	1.532860	0.03793	N	0.263163	T	0.02494	0.0076	N	0.12961	0.28	0.19300	N	0.999972	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.40194	-0.9576	10	0.21540	T	0.41	.	5.0411	0.14460	0.1389:0.3551:0.0:0.506	.	249;360	E7EU02;Q5T2W1	.;NHRF3_HUMAN	P	360;249;360	ENSP00000394485:L360P;ENSP00000403422:L249P;ENSP00000342143:L360P	ENSP00000342143:L360P	L	+	2	0	PDZK1	144472623	0.000000	0.05858	0.762000	0.31397	0.118000	0.20060	-0.351000	0.07711	0.046000	0.15833	-0.334000	0.08254	CTG	-	PDZK1	-	superfamily_PDZ		0.433	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZK1	HGNC	protein_coding	OTTHUMT00000038502.2	0	0	0	214	214	84	0.00	0.00	T	NM_002614		145761266	+1	31	19	155	101	tier1	no_errors	ENST00000344770	ensembl	human	known	74_37	missense	16.67	15.83	SNP	0.001	C	31	155
EFCAB13	124989	genome.wustl.edu	37	17	45518000	45518000	+	Nonsense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:45518000C>T	ENST00000331493.2	+	25	3253	c.2842C>T	c.(2842-2844)Caa>Taa	p.Q948*		NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	948						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										GAATATAAAACAACACAAGAT	0.313													ENSG00000178852																																					0													80.0	84.0	83.0					17																	45518000		2203	4293	6496	SO:0001587	stop_gained	0			-	BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.2842C>T	17.37:g.45518000C>T	ENSP00000332111:p.Gln948*		G3V128|Q49AG9	Nonsense_Mutation	SNP	NULL	p.Q948*	ENST00000331493.2	37	c.2842	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	.	37	6.284828	0.97440	.	.	ENSG00000178852	ENST00000331493	.	.	.	1.77	0.706	0.18133	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.169	0.15101	0.3845:0.6155:0.0:0.0	.	.	.	.	X	948	.	ENSP00000332111:Q948X	Q	+	1	0	C17orf57	42872999	0.022000	0.18835	0.042000	0.18584	0.242000	0.25591	0.028000	0.13644	0.255000	0.21593	0.306000	0.20318	CAA	-	EFCAB13	-	NULL		0.313	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	0	0	0	59	59	197	0.00	0.00	C	NM_152347		45518000	+1	33	122	33	127	tier1	no_errors	ENST00000331493	ensembl	human	known	74_37	nonsense	50.00	49.00	SNP	0.062	T	33	33
MDN1	23195	genome.wustl.edu	37	6	90448117	90448117	+	Missense_Mutation	SNP	G	G	A	rs543829019		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:90448117G>A	ENST00000369393.3	-	33	4766	c.4651C>T	c.(4651-4653)Cgt>Tgt	p.R1551C	MDN1_ENST00000428876.1_Missense_Mutation_p.R1551C			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1551					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AAATCTTCACGGCTTGTGCTT	0.398													ENSG00000112159	G|||	1	0.000199681	0.0	0.0	5008	,	,		18559	0.001		0.0	False		,,,				2504	0.0																0													117.0	109.0	112.0					6																	90448117		2203	4300	6503	SO:0001583	missense	0			-	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4651C>T	6.37:g.90448117G>A	ENSP00000358400:p.Arg1551Cys		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.R1551C	ENST00000369393.3	37	c.4651	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862309	0.71949	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.41758	0.99;0.99	5.69	5.69	0.88448	.	0.053545	0.85682	D	0.000000	T	0.50274	0.1606	M	0.82323	2.585	0.80722	D	1	D	0.64830	0.994	P	0.51657	0.676	T	0.57300	-0.7835	10	0.56958	D	0.05	.	15.4114	0.74923	0.0:0.0:0.8603:0.1397	.	1551	Q9NU22	MDN1_HUMAN	C	1551	ENSP00000358400:R1551C;ENSP00000413970:R1551C	ENSP00000358400:R1551C	R	-	1	0	MDN1	90504838	1.000000	0.71417	0.948000	0.38648	0.993000	0.82548	7.563000	0.82314	2.689000	0.91719	0.557000	0.71058	CGT	-	MDN1	-	superfamily_P-loop_NTPase,pirsf_Midasin		0.398	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	0	0	0	80	80	82	0.00	0.00	G			90448117	-1	28	43	30	68	tier1	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	48.28	38.74	SNP	1.000	A	28	30
UMPS	7372	genome.wustl.edu	37	3	124457073	124457073	+	Silent	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:124457073A>G	ENST00000232607.2	+	3	1075	c.969A>G	c.(967-969)aaA>aaG	p.K323K	UMPS_ENST00000538242.1_Silent_p.K145K|UMPS_ENST00000536109.1_Silent_p.K231K|UMPS_ENST00000413078.2_Silent_p.K145K|UMPS_ENST00000498715.1_3'UTR	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	323	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	ACACAGTGAAAAAGCAGTATG	0.368													ENSG00000114491																																					0													44.0	45.0	45.0					3																	124457073		2138	4277	6415	SO:0001819	synonymous_variant	0			-		CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.969A>G	3.37:g.124457073A>G			B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Silent	SNP	pfam_OMPdeCOase_dom,pfam_PRibTrfase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase,tigrfam_Or_phspho_trans_dom	p.K323	ENST00000232607.2	37	c.969	CCDS3029.1	3																																																																																			-	UMPS	-	pfam_OMPdeCOase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase		0.368	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UMPS	HGNC	protein_coding	OTTHUMT00000355271.1	0	0	0	12	12	166	0.00	0.00	A	NM_000373		124457073	+1	6	35	8	91	tier1	no_errors	ENST00000232607	ensembl	human	known	74_37	silent	42.86	27.78	SNP	1.000	G	6	8
SYT16	83851	genome.wustl.edu	37	14	62567381	62567381	+	Missense_Mutation	SNP	A	A	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:62567381A>G	ENST00000430451.2	+	6	2091	c.1894A>G	c.(1894-1896)Aaa>Gaa	p.K632E	RP11-355I22.2_ENST00000554252.1_lincRNA	NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	632					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GAAGGAAACCAAAGGCCAGCA	0.507													ENSG00000139973																																					0													113.0	119.0	117.0					14																	62567381		2043	4179	6222	SO:0001583	missense	0			-	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1894A>G	14.37:g.62567381A>G	ENSP00000394700:p.Lys632Glu		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.K632E	ENST00000430451.2	37	c.1894	CCDS45121.1	14	.	.	.	.	.	.	.	.	.	.	A	15.24	2.775327	0.49786	.	.	ENSG00000139973	ENST00000430451	T	0.72942	-0.7	5.76	4.63	0.57726	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.192531	0.46442	D	0.000296	T	0.66268	0.2772	L	0.60957	1.885	0.80722	D	1	P	0.37824	0.609	B	0.40864	0.342	T	0.66221	-0.5978	10	0.39692	T	0.17	-9.8854	8.3319	0.32191	0.7969:0.1337:0.0694:0.0	.	632	Q17RD7	SYT16_HUMAN	E	632	ENSP00000394700:K632E	ENSP00000394700:K632E	K	+	1	0	SYT16	61637134	0.912000	0.30974	1.000000	0.80357	0.993000	0.82548	1.926000	0.40084	2.191000	0.70037	0.533000	0.62120	AAA	-	SYT16	-	superfamily_C2_dom,smart_C2_dom		0.507	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1	0	0	0	61	61	153	0.00	0.00	A	NM_031914		62567381	+1	9	33	18	67	tier1	no_errors	ENST00000430451	ensembl	human	novel	74_37	missense	33.33	33.00	SNP	0.974	G	9	18
AHNAK	79026	genome.wustl.edu	37	11	62297347	62297347	+	Missense_Mutation	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:62297347T>A	ENST00000378024.4	-	5	4816	c.4542A>T	c.(4540-4542)aaA>aaT	p.K1514N	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	1514					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				ACTTGGGCATTTTTACCTTGG	0.512													ENSG00000124942																																					0													200.0	213.0	208.0					11																	62297347		2202	4299	6501	SO:0001583	missense	0			-	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.4542A>T	11.37:g.62297347T>A	ENSP00000367263:p.Lys1514Asn		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K1514N	ENST00000378024.4	37	c.4542	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	t	16.16	3.044840	0.55110	.	.	ENSG00000124942	ENST00000378024	T	0.00691	5.84	4.34	0.545	0.17190	.	0.149674	0.44285	D	0.000480	T	0.03263	0.0095	M	0.82923	2.615	0.34895	D	0.745963	D	0.65815	0.995	D	0.78314	0.991	T	0.44922	-0.9296	10	0.27785	T	0.31	.	9.0406	0.36316	0.0:0.43:0.0:0.57	.	1514	Q09666	AHNK_HUMAN	N	1514	ENSP00000367263:K1514N	ENSP00000367263:K1514N	K	-	3	2	AHNAK	62053923	0.018000	0.18449	0.965000	0.40720	0.929000	0.56500	-0.162000	0.10012	0.109000	0.17891	0.370000	0.22315	AAA	-	AHK	-	NULL		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK	HGNC	protein_coding	OTTHUMT00000395572.1	0	0	0	134	134	42	0.00	0.00	T	NM_024060		62297347	-1	21	21	69	33	tier1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	23.33	38.89	SNP	0.993	A	21	69
ZNF560	147741	genome.wustl.edu	37	19	9578410	9578410	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:9578410C>G	ENST00000301480.4	-	10	1426	c.1213G>C	c.(1213-1215)Ggg>Cgg	p.G405R		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TCCTTACACCCATAGGGCTTC	0.438													ENSG00000198028																																					0													80.0	81.0	81.0					19																	9578410		2203	4300	6503	SO:0001583	missense	0			-	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.1213G>C	19.37:g.9578410C>G	ENSP00000301480:p.Gly405Arg		Q495S9|Q495T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G405R	ENST00000301480.4	37	c.1213	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241997	0.58995	.	.	ENSG00000198028	ENST00000301480	T	0.16597	2.33	1.95	-0.443	0.12249	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04407	0.0121	N	0.01197	-0.965	0.09310	N	1	P	0.40360	0.714	B	0.37091	0.241	T	0.21314	-1.0249	9	0.35671	T	0.21	.	2.6892	0.05116	0.0:0.4069:0.2584:0.3348	.	405	Q96MR9	ZN560_HUMAN	R	405	ENSP00000301480:G405R	ENSP00000301480:G405R	G	-	1	0	ZNF560	9439410	0.000000	0.05858	0.000000	0.03702	0.916000	0.54674	-5.169000	0.00145	-0.039000	0.13602	0.491000	0.48974	GGG	-	ZNF560	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.438	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	0	0	0	29	29	70	0.00	0.00	C	NM_152476		9578410	-1	7	16	19	83	tier1	no_errors	ENST00000301480	ensembl	human	known	74_37	missense	26.92	16.16	SNP	0.001	G	7	19
HIVEP3	59269	genome.wustl.edu	37	1	42046979	42046979	+	Missense_Mutation	SNP	A	A	G	rs187400091	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:42046979A>G	ENST00000372583.1	-	4	4375	c.3490T>C	c.(3490-3492)Tcc>Ccc	p.S1164P	HIVEP3_ENST00000429157.2_Missense_Mutation_p.S1164P|HIVEP3_ENST00000372584.1_Missense_Mutation_p.S1164P|HIVEP3_ENST00000247584.5_Missense_Mutation_p.S1164P|HIVEP3_ENST00000460604.1_5'Flank	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	1164					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GCCTGGGTGGAGAAGAATTCT	0.577													ENSG00000127124	A|||	2	0.000399361	0.0	0.0	5008	,	,		17932	0.0		0.002	False		,,,				2504	0.0																0													138.0	123.0	128.0					1																	42046979		2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.3490T>C	1.37:g.42046979A>G	ENSP00000361664:p.Ser1164Pro		A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1164P	ENST00000372583.1	37	c.3490	CCDS463.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	A	3.669	-0.068014	0.07228	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	T;T;T;T	0.05081	3.51;3.5;3.5;3.51	4.61	-0.48	0.12085	.	0.293803	0.24791	N	0.035561	T	0.02047	0.0064	N	0.04880	-0.145	0.26369	N	0.976926	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.45804	-0.9236	10	0.02654	T	1	-6.3721	5.3284	0.15918	0.3885:0.2805:0.3311:0.0	.	1164;1164	Q5T1R4-2;Q5T1R4	.;ZEP3_HUMAN	P	1164	ENSP00000361665:S1164P;ENSP00000361664:S1164P;ENSP00000247584:S1164P;ENSP00000410828:S1164P	ENSP00000247584:S1164P	S	-	1	0	HIVEP3	41819566	0.990000	0.36364	0.994000	0.49952	0.795000	0.44927	0.420000	0.21263	-0.251000	0.09542	-0.456000	0.05471	TCC	rs187400091	HIVEP3	-	NULL		0.577	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	0	0	0	91	91	67	0.00	0.00	A	NM_024503		42046979	-1	14	17	45	65	tier1	no_errors	ENST00000247584	ensembl	human	known	74_37	missense	23.73	20.73	SNP	0.988	G	14	45
CYP27A1	1593	genome.wustl.edu	37	2	219647127	219647127	+	Silent	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:219647127T>G	ENST00000258415.4	+	1	649	c.222T>G	c.(220-222)gtT>gtG	p.V74V		NM_000784.3	NP_000775.1	Q02318	CP27A_HUMAN	cytochrome P450, family 27, subfamily A, polypeptide 1	74					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cholestanetriol 26-monooxygenase activity (GO:0047749)|cholesterol 26-hydroxylase activity (GO:0031073)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(3)|urinary_tract(1)	26		Renal(207;0.0474)		Epithelial(149;9.48e-07)|all cancers(144;0.000171)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00981)	Chenodeoxycholic acid(DB06777)|Cholecalciferol(DB00169)|Ergocalciferol(DB00153)|Pegvisomant(DB00082)	AGCTGTTCGTTCAAGGCTATG	0.632													ENSG00000135929																																					0													77.0	68.0	71.0					2																	219647127		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BC017044	CCDS2423.1	2q35	2013-09-19	2003-01-14		ENSG00000135929	ENSG00000135929		"""Cytochrome P450s"""	2605	protein-coding gene	gene with protein product	"""cerebrotendinous xanthomatosis"""	606530	"""cytochrome P450, subfamily XXVIIA (steroid 27-hydroxylase, cerebrotendinous xanthomatosis), polypeptide 1"""	CYP27		2019602	Standard	NM_000784		Approved	CTX, CP27	uc002viz.4	Q02318	OTTHUMG00000048238	ENST00000258415.4:c.222T>G	2.37:g.219647127T>G			A8K303|Q6LDB4|Q86YQ6	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.V74	ENST00000258415.4	37	c.222	CCDS2423.1	2																																																																																			-	CYP27A1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.632	CYP27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP27A1	HGNC	protein_coding	OTTHUMT00000109734.4	0	0	0	47	47	83	0.00	0.00	T			219647127	+1	9	37	15	29	tier1	no_errors	ENST00000258415	ensembl	human	known	74_37	silent	36.00	56.06	SNP	0.091	G	9	15
OR5AK2	390181	genome.wustl.edu	37	11	56757027	56757027	+	Silent	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:56757027C>T	ENST00000326855.2	+	1	681	c.639C>T	c.(637-639)gtC>gtT	p.V213V		NM_001005323.1	NP_001005323.1	Q8NH90	O5AK2_HUMAN	olfactory receptor, family 5, subfamily AK, member 2	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	21						CTGGGTTGGTCGTCATCTTTT	0.433													ENSG00000181273																																					0													232.0	207.0	215.0					11																	56757027		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AB065496	CCDS31538.1	11q11	2012-08-09			ENSG00000181273	ENSG00000181273		"""GPCR / Class A : Olfactory receptors"""	15251	protein-coding gene	gene with protein product							Standard	NM_001005323		Approved		uc010rjp.2	Q8NH90	OTTHUMG00000167019	ENST00000326855.2:c.639C>T	11.37:g.56757027C>T			B2RNZ9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V213	ENST00000326855.2	37	c.639	CCDS31538.1	11																																																																																			-	OR5AK2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.433	OR5AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AK2	HGNC	protein_coding	OTTHUMT00000392446.1	0	0	0	95	95	60	0.00	0.00	C	NM_001005323		56757027	+1	29	20	40	33	tier1	no_errors	ENST00000326855	ensembl	human	known	74_37	silent	42.03	37.74	SNP	0.000	T	29	40
CLTC	1213	genome.wustl.edu	37	17	57743601	57743601	+	Splice_Site	SNP	A	A	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:57743601A>C	ENST00000269122.3	+	11	2056	c.1782A>C	c.(1780-1782)caA>caC	p.Q594H	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Splice_Site_p.Q594H	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	594	Distal segment.|Heavy chain arm.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					ATGCGCCTCAAGTATGTGTTT	0.433			T	"""ALK, TFE3"""	"""ALCL, renal """								ENSG00000141367																												Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													131.0	120.0	124.0					17																	57743601		2203	4300	6503	SO:0001630	splice_region_variant	0			-	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.1782+1A>C	17.37:g.57743601A>C			D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.Q594H	ENST00000269122.3	37	c.1782	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	A	22.3	4.273205	0.80580	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.22336	1.96;1.96	5.44	0.727	0.18254	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.51805	0.1696	M	0.93763	3.455	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.85130	0.997;0.993	T	0.57289	-0.7837	10	0.87932	D	0	.	10.3857	0.44138	0.4809:0.0:0.5191:0.0	.	594;594	Q00610;Q00610-2	CLH1_HUMAN;.	H	594	ENSP00000269122:Q594H;ENSP00000376763:Q594H	ENSP00000269122:Q594H	Q	+	3	2	CLTC	55098383	1.000000	0.71417	0.958000	0.39756	0.986000	0.74619	2.052000	0.41316	-0.096000	0.12329	0.477000	0.44152	CAA	-	CLTC	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain		0.433	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	0	0	1	60	60	122	0.00	0.81	A	NM_004859	Missense_Mutation	57743601	+1	29	74	41	102	tier1	no_errors	ENST00000269122	ensembl	human	known	74_37	missense	41.43	42.05	SNP	1.000	C	29	41
CRISPLD1	83690	genome.wustl.edu	37	8	75928896	75928896	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:75928896C>T	ENST00000262207.4	+	7	1292	c.824C>T	c.(823-825)tCa>tTa	p.S275L	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.S87L|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.S89L	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	275					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CGGACAAGATCAGATGATAGT	0.393													ENSG00000121005																																					0													171.0	180.0	177.0					8																	75928896		2203	4300	6503	SO:0001583	missense	0			-	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.824C>T	8.37:g.75928896C>T	ENSP00000262207:p.Ser275Leu		B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.S275L	ENST00000262207.4	37	c.824	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	16.22	3.061757	0.55432	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;D	0.81821	0.25;-1.22;-1.54	4.98	4.98	0.66077	.	0.756062	0.12799	N	0.438188	T	0.75510	0.3859	L	0.34521	1.04	0.42406	D	0.992583	B;B	0.17038	0.009;0.02	B;B	0.14023	0.006;0.01	T	0.68014	-0.5521	10	0.44086	T	0.13	.	18.8032	0.92027	0.0:1.0:0.0:0.0	.	89;275	B7Z929;Q9H336	.;CRLD1_HUMAN	L	275;87;89	ENSP00000262207:S275L;ENSP00000430105:S87L;ENSP00000429746:S89L	ENSP00000262207:S275L	S	+	2	0	CRISPLD1	76091451	0.366000	0.25014	0.958000	0.39756	0.524000	0.34500	0.804000	0.27098	2.734000	0.93682	0.650000	0.86243	TCA	-	CRISPLD1	-	NULL		0.393	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	0	0	0	35	35	164	0.00	0.00	C	NM_031461		75928896	+1	6	27	43	206	tier1	no_errors	ENST00000262207	ensembl	human	known	74_37	missense	12.24	11.59	SNP	0.998	T	6	43
MACF1	23499	genome.wustl.edu	37	1	39800543	39800544	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:39800543_39800544delAG	ENST00000372915.3	+	36	8385_8386	c.8298_8299delAG	c.(8296-8301)atagatfs	p.D2767fs	MACF1_ENST00000564288.1_Frame_Shift_Del_p.D2762fs|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000289893.4_Frame_Shift_Del_p.D1202fs|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000567887.1_Frame_Shift_Del_p.D2799fs			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2767					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGATCCAAATAGATAGTTCAGA	0.371													ENSG00000127603																																					0																																										SO:0001589	frameshift_variant	0				AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8298_8299delAG	1.37:g.39800543_39800544delAG	ENSP00000362006:p.Asp2767fs		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.D2799fs	ENST00000372915.3	37	c.8394_8395		1																																																																																				MACF1	-	superfamily_RNaseH-like_dom		0.371	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	0	0	0	22	22	124	0.00	0.00	AG	NM_033044		39800544	+1	11	31	24	73	tier1	no_errors	ENST00000567887	ensembl	human	putative	74_37	frame_shift_del	31.43	29.81	DEL	0.714:0.727	-	11	24
SHPRH	257218	genome.wustl.edu	37	6	146206407	146206408	+	3'UTR	DEL	AC	AC	-	rs372379140		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr6:146206407_146206408delAC	ENST00000367505.2	-	0	6735_6736				RP11-545I5.3_ENST00000587540.1_RNA|SHPRH_ENST00000438092.2_3'UTR|RP11-545I5.3_ENST00000452617.1_RNA|RP11-545I5.3_ENST00000591489.1_RNA|RP11-545I5.3_ENST00000606388.1_RNA|SHPRH_ENST00000367503.3_3'UTR			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase						DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		tataaaaatAACAGTTTGATTT	0.267													ENSG00000235652																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.*1420GT>-	6.37:g.146206407_146206408delAC			Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	R	DEL	-	NULL	ENST00000367505.2	37	NULL	CCDS43513.2	6																																																																																				RP11-545I5.3	-	-		0.267	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100507557	Clone_based_vega_gene	protein_coding	OTTHUMT00000042571.2	0	0	0	9	9	100	0.00	0.00	AC	NM_173082		146206408	+1	7	42	5	56	tier1	no_errors	ENST00000606388	ensembl	human	known	74_37	rna	58.33	42.86	DEL	0.999:0.991	-	7	5
CARF	79800	genome.wustl.edu	37	2	203848307	203848308	+	Frame_Shift_Ins	INS	-	-	A	rs201520695	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:203848307_203848308insA	ENST00000402905.3	+	16	2459_2460	c.2138_2139insA	c.(2137-2142)gcaaaafs	p.AK713fs	CARF_ENST00000545253.1_Frame_Shift_Ins_p.AK625fs|WDR12_ENST00000477723.1_Intron|CARF_ENST00000428585.1_Frame_Shift_Ins_p.AK637fs|CARF_ENST00000545262.1_Frame_Shift_Ins_p.AK637fs|CARF_ENST00000320443.8_Frame_Shift_Ins_p.AK713fs|CARF_ENST00000438828.2_Frame_Shift_Ins_p.AK713fs|CARF_ENST00000414439.1_Frame_Shift_Ins_p.AK611fs	NM_001104586.1|NM_001282910.1|NM_001282911.1|NM_001282912.1	NP_001098056.1|NP_001269839.1|NP_001269840.1|NP_001269841.1	Q8N187	CARTF_HUMAN	calcium responsive transcription factor	713					cellular response to calcium ion (GO:0071277)|cellular response to potassium ion (GO:0035865)|positive regulation of transcription from RNA polymerase II promoter in response to calcium ion (GO:0061400)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCTATGGAAGCAAAAAAAACTG	0.327													ENSG00000138380	aAAAAAAA|AAAAAAAA|AAAAAAAAA|insertion	4	0.000798722	0.0	0.0014	5008	,	,		15628	0.0		0.003	False		,,,				2504	0.0																0									,	4,3484		0,4,1740					,	3.1	0.9			85	60,7742		0,60,3841	no	frameshift,frameshift	ALS2CR8	NM_024744.14,NM_001104586.1	,	0,64,5581	A1A1,A1R,RR		0.769,0.1147,0.5669	,	,		64,11226				SO:0001589	frameshift_variant	0				AB053309	CCDS42801.1, CCDS63091.1	2q33.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000138380	ENSG00000138380			14435	protein-coding gene	gene with protein product	"""calcium-response factor"""	607586	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 8"""	ALS2CR8		11586298, 11832226	Standard	XM_005246858		Approved	FLJ21579, CaRF, NYD-SP24	uc002uzo.2	Q8N187	OTTHUMG00000154528	ENST00000402905.3:c.2146dupA	2.37:g.203848315_203848315dupA	ENSP00000384006:p.Ala713fs		B4E1W7|G3V1K7|Q8ND29|Q8WXC0|Q96J78|Q96Q38|Q96Q39|Q9H712	Frame_Shift_Ins	INS	NULL	p.T716fs	ENST00000402905.3	37	c.2138_2139	CCDS42801.1	2																																																																																				CARF	-	NULL		0.327	CARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARF	HGNC	protein_coding	OTTHUMT00000335768.5	0	0	0	65	65	203	0.00	0.00	-	NM_001104586		203848308	+1	16	50	19	61	tier1	no_errors	ENST00000320443	ensembl	human	known	74_37	frame_shift_ins	45.71	45.05	INS	0.949:0.979	A	16	19
DALRD3	55152	genome.wustl.edu	37	3	49055208	49055209	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:49055208_49055209delCT	ENST00000341949.4	-	3	561_562	c.555_556delAG	c.(553-558)agagctfs	p.RA185fs	DALRD3_ENST00000440857.1_Frame_Shift_Del_p.RA18fs|DALRD3_ENST00000395462.4_Frame_Shift_Del_p.RA18fs|MIR191_ENST00000384873.1_RNA|DALRD3_ENST00000441576.2_Frame_Shift_Del_p.RA185fs|DALRD3_ENST00000313778.5_Frame_Shift_Del_p.RA18fs|NDUFAF3_ENST00000326912.4_5'Flank|MIR425_ENST00000362162.1_RNA|DALRD3_ENST00000496568.1_5'UTR	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	185					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGGGAGGAAGCTCTCTCCGAGG	0.619													ENSG00000178149																																					0																																										SO:0001589	frameshift_variant	0				BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.555_556delAG	3.37:g.49055212_49055213delCT	ENSP00000344989:p.Arg185fs		Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Frame_Shift_Del	DEL	pfam_DALR_anticod-bd,superfamily_tRsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.R185fs	ENST00000341949.4	37	c.556_555	CCDS33754.1	3																																																																																				DALRD3	-	NULL		0.619	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	0	0	0	87	87	72	0.00	0.00	CT	NM_018114		49055209	-1	14	18	47	51	tier1	no_errors	ENST00000341949	ensembl	human	known	74_37	frame_shift_del	22.95	26.09	DEL	0.000:0.000	-	14	47
ASH1L	55870	genome.wustl.edu	37	1	155447818	155447818	+	Frame_Shift_Del	DEL	T	T	-	rs151028549	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:155447818delT	ENST00000368346.3	-	3	5482	c.4843delA	c.(4843-4845)agafs	p.R1615fs	ASH1L_ENST00000392403.3_Frame_Shift_Del_p.R1615fs			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1615	Ser-rich.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TTTGAAACTCTGCAGCTGCCT	0.473													ENSG00000116539																																					0													94.0	98.0	97.0					1																	155447818		2203	4300	6503	SO:0001589	frameshift_variant	0				AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4843delA	1.37:g.155447818delT	ENSP00000357330:p.Arg1615fs		Q59GP1|Q5T714|Q5T715|Q9P2C7	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_D-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.R1615fs	ENST00000368346.3	37	c.4843		1																																																																																				ASH1L	-	NULL		0.473	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	0	0	0	51	51	121	0.00	0.00	T	NM_018489		155447818	-1	12	52	57	152	tier1	no_errors	ENST00000368346	ensembl	human	known	74_37	frame_shift_del	17.39	25.49	DEL	1.000	-	12	57
MYOM2	9172	genome.wustl.edu	37	8	2092920	2092920	+	3'UTR	DEL	C	C	-			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:2092920delC	ENST00000262113.4	+	0	4554				MYOM2_ENST00000523438.1_3'UTR|MYOM2_ENST00000520298.1_3'UTR	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		GTTTTCCTAGCCTGGAGATGG	0.587													ENSG00000036448																																					0													31.0	30.0	30.0					8																	2092920		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0					CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.*15C>-	8.37:g.2092920delC			Q7Z3Y2	R	DEL	-	NULL	ENST00000262113.4	37	NULL	CCDS5957.1	8																																																																																				MYOM2	-	-		0.587	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	0	0	0	49	49	74	0.00	0.00	C	NM_003970		2092920	+1	9	12	14	30	tier1	no_errors	ENST00000520298	ensembl	human	known	74_37	rna	39.13	28.57	DEL	0.001	-	9	14
DBF4	10926	genome.wustl.edu	37	7	87536511	87536512	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:87536511_87536512delAC	ENST00000265728.1	+	12	1562_1563	c.1058_1059delAC	c.(1057-1059)tacfs	p.Y353fs		NM_006716.3	NP_006707.1	Q9UBU7	DBF4A_HUMAN	DBF4 zinc finger	353					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)	nucleoplasm (GO:0005654)	enzyme activator activity (GO:0008047)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|skin(3)	28	Esophageal squamous(14;0.00202)	Breast(660;0.0334)				AGAATAAAATACAGTGTTGGAT	0.292													ENSG00000006634																																					0																																										SO:0001589	frameshift_variant	0				AF160876	CCDS5611.1	7q21.3	2014-02-17	2014-02-17		ENSG00000006634	ENSG00000006634		"""Zinc fingers, DBF-type"""	17364	protein-coding gene	gene with protein product	"""activator of S phase kinase"", ""chiffon homolog (Drosophila)"", ""zinc finger, DBF-type containing 1"", ""DBF4 zinc finger A"""	604281	"""DBF4 homolog (S. cerevisiae)"""			10373557, 10517317	Standard	NM_006716		Approved	ASK, chif, ZDBF1, DBF4A	uc003ujf.1	Q9UBU7	OTTHUMG00000131034	ENST00000265728.1:c.1058_1059delAC	7.37:g.87536511_87536512delAC	ENSP00000265728:p.Tyr353fs		A4D1D8|A8K954|O75226|Q75MS6|Q75N01|Q9Y2M6	Frame_Shift_Del	DEL	pfam_Znf_DBF,superfamily_BRCT_dom,smart_Znf_DBF	p.Y353fs	ENST00000265728.1	37	c.1058_1059	CCDS5611.1	7																																																																																				DBF4	-	NULL		0.292	DBF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBF4	HGNC	protein_coding	OTTHUMT00000253678.1	0	0	0	62	62	98	0.00	0.00	AC	NM_006716		87536512	+1	30	57	24	31	tier1	no_errors	ENST00000265728	ensembl	human	known	74_37	frame_shift_del	55.56	64.77	DEL	1.000:0.998	-	30	24
CALML5	51806	genome.wustl.edu	37	10	5541395	5541395	+	Missense_Mutation	SNP	C	C	T	rs564031513		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:5541395C>T	ENST00000380332.3	-	1	138	c.7G>A	c.(7-9)Ggt>Agt	p.G3S		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	3					epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.G3S(1)		biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						GTCAGCTCACCGGCCATGCCT	0.652													ENSG00000178372																									GBM(149;1055 3356 43077)												1	Substitution - Missense(1)	biliary_tract(1)											75.0	74.0	74.0					10																	5541395		2203	4300	6503	SO:0001583	missense	0			-	AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.7G>A	10.37:g.5541395C>T	ENSP00000369689:p.Gly3Ser		Q5SQI3|Q8IXU8	Missense_Mutation	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.G3S	ENST00000380332.3	37	c.7	CCDS7068.1	10	.	.	.	.	.	.	.	.	.	.	C	14.40	2.522651	0.44866	.	.	ENSG00000178372	ENST00000380332	T	0.35605	1.3	4.49	-0.106	0.13596	EF-hand-like domain (1);	0.831806	0.10493	N	0.668160	T	0.13457	0.0326	N	0.05124	-0.11	0.09310	N	1	P	0.39665	0.682	B	0.22880	0.042	T	0.11084	-1.0602	10	0.66056	D	0.02	-23.9492	8.3255	0.32153	0.0:0.4356:0.4713:0.0931	.	3	Q9NZT1	CALL5_HUMAN	S	3	ENSP00000369689:G3S	ENSP00000369689:G3S	G	-	1	0	CALML5	5531395	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.047000	0.11963	0.164000	0.19529	0.655000	0.94253	GGT	-	CALML5	-	NULL		0.652	CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML5	HGNC	protein_coding	OTTHUMT00000046556.1	0	0	0	27	27	60	0.00	0.00	C	NM_017422		5541395	-1	26	36	0	1	tier1	no_errors	ENST00000380332	ensembl	human	known	74_37	missense	100.00	97.30	SNP	0.001	T	26	0
AL359195.1	0	genome.wustl.edu	37	10	82012576	82012576	+	Missense_Mutation	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:82012576T>G	ENST00000356374.4	+	1	3111	c.94T>G	c.(94-96)Tcc>Gcc	p.S32A																								CAGCTGTCGGTCCTCCGGGAC	0.612													ENSG00000204038																																					0																																										SO:0001583	missense	0			-																												ENST00000356374.4:c.94T>G	10.37:g.82012576T>G	ENSP00000348738:p.Ser32Ala			Missense_Mutation	SNP	NULL	p.S32A	ENST00000356374.4	37	c.94		10	.	.	.	.	.	.	.	.	.	.	-	4.812	0.150925	0.09185	.	.	ENSG00000204038	ENST00000356374	.	.	.	0.977	-1.79	0.07932	.	.	.	.	.	T	0.32376	0.0827	.	.	.	.	.	.	.	.	.	.	.	.	T	0.42799	-0.9430	4	0.45353	T	0.12	.	3.5936	0.07998	0.3358:0.0:0.0:0.6641	.	.	.	.	A	32	.	ENSP00000348738:S32A	S	+	1	0	AL359195.1	82002556	0.000000	0.05858	0.022000	0.16811	0.022000	0.10575	-0.655000	0.05348	0.252000	0.21531	0.249000	0.18162	TCC	-	AL359195.1	-	NULL		0.612	AL359195.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000204038	Clone_based_ensembl_gene	protein_coding		0	0	0	35	35	18	0.00	0.00	T			82012576	+1	10	3	21	6	tier1	no_errors	ENST00000356374	ensembl	human	known	74_37	missense	32.26	33.33	SNP	0.001	G	10	21
BMS1P17	101101776	genome.wustl.edu	37	14	19891350	19891350	+	lincRNA	SNP	G	G	T	rs369289732		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:19891350G>T	ENST00000552602.1	-	0	293																											TGTGACCTTGGCCGTGTGGGC	0.542													ENSG00000244306																																					0																																												0			-																													14.37:g.19891350G>T				R	SNP	-	NULL	ENST00000552602.1	37	NULL		14																																																																																			-	CTD-2314B22.3	-	-		0.542	CTD-2314B22.3-003	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409412.1	0	0	0	15	15	11	0.00	0.00	G			19891350	-1	9	4	18	7	tier1	no_errors	ENST00000547285	ensembl	human	known	74_37	rna	33.33	36.36	SNP	0.029	T	9	18
HOXA7	3204	genome.wustl.edu	37	7	27192088	27192089	+	IGR	INS	-	-	GGCCT	rs117819065|rs71823962|rs145281130|rs3216926	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	-	-	-	GGCCT	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:27192088_27192089insGGCCT	ENST00000242159.3	-	0	2020				HOXA6_ENST00000521478.1_5'Flank|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000524304.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA7_ENST00000523796.2_5'Flank|RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000521231.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GGGAGCCGCCAGGCCTGGCCTG	0.693													ENSG00000273433		940	0.1877	0.0416	0.2334	5008	,	,		12775	0.1379		0.2843	False		,,,				2504	0.3047																0																																										SO:0001628	intergenic_variant	0					CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192094_27192098dupGGCCT			A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	R	INS	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																				RP1-170O19.22	-	-		0.693	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273433	Clone_based_vega_gene	protein_coding	OTTHUMT00000358695.1	0	0	0	5	5	5	0.00	0.00	-			27192089	-1	2	2	6	6	tier1	no_errors	ENST00000467897	ensembl	human	known	74_37	rna	25.00	25.00	INS	0.007:0.074	GGCCT	2	6
FAM19A5	25817	genome.wustl.edu	37	22	49042466	49042466	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr22:49042466C>T	ENST00000402357.1	+	2	303	c.170C>T	c.(169-171)cCt>cTt	p.P57L	FAM19A5_ENST00000358295.5_Missense_Mutation_p.P50L|FAM19A5_ENST00000473898.1_Intron	NM_001082967.1	NP_001076436.1	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A5	57						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(6)	7		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		AGCAGCCAGCCTCGGAGGACG	0.672													ENSG00000219438																																					0													26.0	33.0	31.0					22																	49042466		2083	4221	6304	SO:0001583	missense	0			-	AY325118	CCDS46728.1, CCDS46729.1	22q13.32	2005-09-20			ENSG00000219438	ENSG00000219438			21592	protein-coding gene	gene with protein product						15028294	Standard	NM_015381		Approved	TAFA-5	uc003bim.4	Q7Z5A7	OTTHUMG00000150308	ENST00000402357.1:c.170C>T	22.37:g.49042466C>T	ENSP00000383933:p.Pro57Leu		A6NII9|B0QZ13|B0QZ14|B0QZ15|O95902|Q5H9C4|Q6UWC9|Q8IXR8	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.P50L	ENST00000402357.1	37	c.149	CCDS46728.1	22	.	.	.	.	.	.	.	.	.	.	C	31	5.086990	0.94100	.	.	ENSG00000219438	ENST00000402357;ENST00000336769;ENST00000358295	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	T	0.77565	0.4149	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.961;0.997	T	0.79918	-0.1600	8	0.87932	D	0	.	17.3357	0.87280	0.0:1.0:0.0:0.0	.	50;57	Q7Z5A7-2;Q7Z5A7	.;F19A5_HUMAN	L	57;57;50	.	ENSP00000336812:P57L	P	+	2	0	FAM19A5	47428902	1.000000	0.71417	0.974000	0.42286	0.994000	0.84299	6.991000	0.76232	2.417000	0.82017	0.655000	0.94253	CCT	-	FAM19A5	-	pfam_Chemokine-like_FAM19A2		0.672	FAM19A5-003	PUTATIVE	basic|CCDS	protein_coding	FAM19A5	HGNC	protein_coding	OTTHUMT00000317504.1	0	0	0	170	170	16	0.00	0.00	C	NM_015381		49042466	+1	35	6	96	6	tier1	no_errors	ENST00000358295	ensembl	human	known	74_37	missense	26.72	50.00	SNP	1.000	T	35	96
HSD3B1	3283	genome.wustl.edu	37	1	120057126	120057126	+	Missense_Mutation	SNP	T	T	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:120057126T>G	ENST00000369413.3	+	4	1125	c.980T>G	c.(979-981)tTc>tGc	p.F327C	HSD3B1_ENST00000528909.1_Missense_Mutation_p.F327C|HSD3B1_ENST00000235547.6_Missense_Mutation_p.F329C			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	327					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	AATAGCGTATTCACCTTCTCT	0.493													ENSG00000203857																																					0													119.0	109.0	112.0					1																	120057126		2203	4300	6503	SO:0001583	missense	0			-	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.980T>G	1.37:g.120057126T>G	ENSP00000358421:p.Phe327Cys		A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_D-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_PKS_KR,pfam_NmrA	p.F329C	ENST00000369413.3	37	c.986	CCDS903.1	1	.	.	.	.	.	.	.	.	.	.	T	9.535	1.111812	0.20714	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	T;T;T	0.71817	-0.6;-0.6;-0.6	3.26	0.674	0.17946	.	0.000000	0.85682	D	0.000000	T	0.79522	0.4460	M	0.93106	3.38	0.49483	D	0.999794	D;D	0.89917	1.0;0.999	D;D	0.76071	0.987;0.929	T	0.78550	-0.2161	10	0.72032	D	0.01	-21.2337	6.8042	0.23768	0.3719:0.0:0.0:0.6281	.	329;327	Q5TDG2;P14060	.;3BHS1_HUMAN	C	327;329;327	ENSP00000358421:F327C;ENSP00000235547:F329C;ENSP00000432268:F327C	ENSP00000235547:F329C	F	+	2	0	HSD3B1	119858649	1.000000	0.71417	0.479000	0.27329	0.035000	0.12851	3.698000	0.54771	-0.001000	0.14495	-0.991000	0.02546	TTC	-	HSD3B1	-	NULL		0.493	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HSD3B1	HGNC	protein_coding	OTTHUMT00000034993.3	0	0	0	50	50	31	0.00	0.00	T	NM_000862		120057126	+1	19	26	1	2	tier1	no_errors	ENST00000235547	ensembl	human	known	74_37	missense	95.00	92.86	SNP	0.989	G	19	1
HYDIN	54768	genome.wustl.edu	37	16	71009037	71009037	+	Splice_Site	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:71009037A>T	ENST00000393567.2	-	31	4923		c.e31+1			NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein						cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GAAACCACTCACTTGGCCAGT	0.527													ENSG00000157423																																					0													2.0	2.0	2.0					16																	71009037		1234	2806	4040	SO:0001630	splice_region_variant	0			-	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.4772+1T>A	16.37:g.71009037A>T			A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Splice_Site	SNP	-	e30+2	ENST00000393567.2	37	c.4772+2	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	A	13.87	2.367578	0.42003	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5807	0.45255	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HYDIN	69566538	1.000000	0.71417	0.992000	0.48379	0.066000	0.16364	5.169000	0.64984	2.077000	0.62373	0.413000	0.27773	.	-	HYDIN	-	-		0.527	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	0	0	0	19	19	12	0.00	0.00	A		Intron	71009037	-1	12	4	8	1	tier1	no_errors	ENST00000393567	ensembl	human	putative	74_37	splice_site	60.00	80.00	SNP	0.995	T	12	8
OR1N1	138883	genome.wustl.edu	37	9	125289383	125289383	+	Missense_Mutation	SNP	G	G	T	rs539467595		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr9:125289383G>T	ENST00000304880.2	-	1	189	c.190C>A	c.(190-192)Ctg>Atg	p.L64M		NM_012363.1	NP_036495.1	Q8NGS0	OR1N1_HUMAN	olfactory receptor, family 1, subfamily N, member 1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|large_intestine(2)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						ACAAAAGACAGGTTGGCCAAG	0.498													ENSG00000171505																																					0													85.0	81.0	82.0					9																	125289383		2203	4300	6503	SO:0001583	missense	0			-	U86216	CCDS6844.1	9q34.11	2012-08-09			ENSG00000171505	ENSG00000171505		"""GPCR / Class A : Olfactory receptors"""	8221	protein-coding gene	gene with protein product				OR1N3		9500546	Standard	NM_012363		Approved	OR1-26	uc004bmn.1	Q8NGS0	OTTHUMG00000020608	ENST00000304880.2:c.190C>A	9.37:g.125289383G>T	ENSP00000306974:p.Leu64Met		A3KFM1|O43870|Q6IF16|Q96R93	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L64M	ENST00000304880.2	37	c.190	CCDS6844.1	9	.	.	.	.	.	.	.	.	.	.	G	14.55	2.568309	0.45798	.	.	ENSG00000171505	ENST00000304880	T	0.00590	6.36	3.55	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29218	U	0.012781	T	0.03095	0.0091	M	0.93808	3.46	0.28214	N	0.926792	D	0.89917	1.0	D	0.91635	0.999	T	0.12167	-1.0558	10	0.87932	D	0	.	6.0476	0.19768	0.4362:0.0:0.5638:0.0	.	64	Q8NGS0	OR1N1_HUMAN	M	64	ENSP00000306974:L64M	ENSP00000306974:L64M	L	-	1	2	OR1N1	124329204	0.000000	0.05858	0.634000	0.29324	0.893000	0.52053	-1.389000	0.02530	0.230000	0.21059	-0.284000	0.09977	CTG	-	OR1N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.498	OR1N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1N1	HGNC	protein_coding	OTTHUMT00000053938.1	0	0	0	67	67	120	0.00	0.00	G			125289383	-1	32	59	0	0	tier1	no_errors	ENST00000304880	ensembl	human	known	74_37	missense	100.00	100.00	SNP	0.973	T	32	0
P2RY6	5031	genome.wustl.edu	37	11	73008055	73008055	+	Missense_Mutation	SNP	C	C	G			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:73008055C>G	ENST00000393590.2	+	2	791	c.492C>G	c.(490-492)atC>atG	p.I164M	P2RY6_ENST00000349767.2_Missense_Mutation_p.I164M|P2RY6_ENST00000540124.1_Missense_Mutation_p.I164M|P2RY6_ENST00000393592.2_Missense_Mutation_p.I164M|P2RY6_ENST00000538328.1_Missense_Mutation_p.I164M|P2RY6_ENST00000393591.1_Missense_Mutation_p.I164M|P2RY6_ENST00000540342.1_Missense_Mutation_p.I164M|P2RY6_ENST00000542092.1_Missense_Mutation_p.I164M	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	164					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CCACAGCCATCTTCGCTGCCA	0.657													ENSG00000171631																																					0													57.0	47.0	51.0					11																	73008055		2195	4289	6484	SO:0001583	missense	0			-		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.492C>G	11.37:g.73008055C>G	ENSP00000377215:p.Ile164Met		Q15754	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_P2Y6_rcpt,prints_GPCR_Rhodpsn,prints_P2Y3_rcpt,prints_Protea_act_rcpt	p.I164M	ENST00000393590.2	37	c.492	CCDS8220.1	11	.	.	.	.	.	.	.	.	.	.	C	6.317	0.426626	0.11987	.	.	ENSG00000171631	ENST00000540342;ENST00000542092;ENST00000349767;ENST00000393592;ENST00000393591;ENST00000540124;ENST00000393590;ENST00000535931;ENST00000538328	T;T;T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	4.42	2.47	0.30058	GPCR, rhodopsin-like superfamily (1);	1.017110	0.07853	N	0.965029	T	0.61311	0.2337	L	0.32530	0.975	0.09310	N	1	B	0.21520	0.057	B	0.27170	0.077	T	0.51911	-0.8645	10	0.41790	T	0.15	.	8.4722	0.32993	0.3114:0.5378:0.1508:0.0	.	164	Q15077	P2RY6_HUMAN	M	164	ENSP00000443427:I164M;ENSP00000445652:I164M;ENSP00000309771:I164M;ENSP00000377217:I164M;ENSP00000377216:I164M;ENSP00000442551:I164M;ENSP00000377215:I164M;ENSP00000440770:I164M;ENSP00000442990:I164M	ENSP00000309771:I164M	I	+	3	3	P2RY6	72685703	0.998000	0.40836	0.700000	0.30305	0.534000	0.34807	1.670000	0.37502	0.549000	0.28973	0.491000	0.48974	ATC	-	P2RY6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.657	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	P2RY6	HGNC	protein_coding	OTTHUMT00000397349.1	0	0	0	48	48	10	0.00	0.00	C			73008055	+1	6	5	15	4	tier1	no_errors	ENST00000349767	ensembl	human	known	74_37	missense	28.57	55.56	SNP	0.220	G	6	15
OR8D1	283159	genome.wustl.edu	37	11	124180308	124180308	+	Missense_Mutation	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr11:124180308C>A	ENST00000357821.2	-	1	425	c.355G>T	c.(355-357)Gca>Tca	p.A119S		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		CGATCATATGCCATGGCAGTC	0.488													ENSG00000196341																																					0													81.0	73.0	76.0					11																	124180308		2201	4299	6500	SO:0001583	missense	0			-	AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.355G>T	11.37:g.124180308C>A	ENSP00000350474:p.Ala119Ser		B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A119S	ENST00000357821.2	37	c.355	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	c	17.65	3.442679	0.63067	.	.	ENSG00000196341	ENST00000357821	T	0.39787	1.06	4.29	3.32	0.38043	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36703	U	0.002449	T	0.52933	0.1765	L	0.49350	1.555	0.38465	D	0.947327	D	0.71674	0.998	P	0.62184	0.899	T	0.60464	-0.7258	10	0.72032	D	0.01	.	12.4664	0.55762	0.2749:0.7251:0.0:0.0	.	119	Q8WZ84	OR8D1_HUMAN	S	119	ENSP00000350474:A119S	ENSP00000350474:A119S	A	-	1	0	OR8D1	123685518	1.000000	0.71417	0.892000	0.35008	0.077000	0.17291	1.993000	0.40747	2.236000	0.73375	0.508000	0.49915	GCA	-	OR8D1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.488	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	0	0	0	61	61	127	0.00	0.00	C	NM_001002917		124180308	-1	14	35	0	0	tier1	no_errors	ENST00000357821	ensembl	human	known	74_37	missense	100.00	100.00	SNP	1.000	A	14	0
TET3	200424	genome.wustl.edu	37	2	74320711	74320711	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:74320711C>T	ENST00000409262.3	+	7	2780	c.2780C>T	c.(2779-2781)cCc>cTc	p.P927L		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	927					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)			NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GAAGGACGGCCCTTCGCGGGG	0.597													ENSG00000187605																																					0													69.0	74.0	72.0					2																	74320711		2052	4214	6266	SO:0001583	missense	0			-		CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2780C>T	2.37:g.74320711C>T	ENSP00000386869:p.Pro927Leu		A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	NULL	p.P927L	ENST00000409262.3	37	c.2780	CCDS46339.1	2	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566076	0.86439	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.14640	2.49	5.21	4.33	0.51752	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	0.000000	0.85682	D	0.000000	T	0.39809	0.1092	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.41610	-0.9499	10	0.87932	D	0	.	13.0025	0.58683	0.0:0.9208:0.0:0.0792	.	927	O43151	TET3_HUMAN	L	927	ENSP00000386869:P927L	ENSP00000233310:P927L	P	+	2	0	TET3	74174219	1.000000	0.71417	0.821000	0.32701	0.839000	0.47603	7.651000	0.83577	1.420000	0.47138	0.655000	0.94253	CCC	-	TET3	-	NULL		0.597	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	0	0	0	48	48	30	0.00	0.00	C			74320711	+1	22	30	1	0	tier1	no_errors	ENST00000409262	ensembl	human	known	74_37	missense	95.65	100.00	SNP	1.000	T	22	1
TP53	7157	genome.wustl.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	C	T	rs11540652		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr17:7577538C>T	ENST00000269305.4	-	7	932	c.743G>A	c.(742-744)cGg>cAg	p.R248Q	TP53_ENST00000420246.2_Missense_Mutation_p.R248Q|TP53_ENST00000455263.2_Missense_Mutation_p.R248Q|TP53_ENST00000413465.2_Missense_Mutation_p.R248Q|TP53_ENST00000445888.2_Missense_Mutation_p.R248Q|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.R248Q	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248Q(580)|p.R248L(75)|p.R248P(19)|p.R155Q(18)|p.0?(8)|p.?(5)|p.R155L(3)|p.R155P(2)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248fs*>39(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GATGGGCCTCCGGTTCATGCC	0.572	R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(HCC70_BREAST)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(KYSE150_OESOPHAGUS)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(NCIN87_STOMACH)|R248Q(NIHOVCAR3_OVARY)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(PC14_LUNG)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	725	Substitution - Missense(698)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(2)|Complex - compound substitution(1)	large_intestine(138)|breast(83)|haematopoietic_and_lymphoid_tissue(74)|lung(71)|upper_aerodigestive_tract(63)|central_nervous_system(46)|oesophagus(37)|urinary_tract(37)|ovary(36)|stomach(35)|endometrium(23)|skin(18)|prostate(11)|bone(10)|biliary_tract(9)|liver(9)|pancreas(7)|vulva(3)|kidney(3)|cervix(3)|peritoneum(2)|thyroid(2)|soft_tissue(1)|pituitary(1)|adrenal_gland(1)|small_intestine(1)|thymus(1)	GRCh37	CM920675	TP53	M	rs11540652	C	GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG,GLN/ARG	0,4406		0,0,2203	152.0	112.0	126.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	743,743,743,743,347,347,347	3.7	1.0	17	dbSNP_120	126	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	43,43,43,43,43,43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	248/394,248/394,248/347,248/342,116/262,116/210,116/215	7577538	1,13005	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.743G>A	17.37:g.7577538C>T	ENSP00000269305:p.Arg248Gln		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248Q	ENST00000269305.4	37	c.743	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822907	0.90873	0.0	1.16E-4	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99864	-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28;-7.28	4.62	3.65	0.41850	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99840	0.9927	M	0.88640	2.97	0.58432	A	0.999994	D;D;D;D;D;D	0.89917	1.0;0.994;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.91635	0.996;0.882;0.999;0.995;0.996;0.995	D	0.96819	0.9602	9	0.72032	D	0.01	-9.5643	10.6687	0.45745	0.0:0.9059:0.0:0.0941	rs11540652;rs11540652	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Q	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248Q;ENSP00000352610:R248Q;ENSP00000269305:R248Q;ENSP00000398846:R248Q;ENSP00000391127:R248Q;ENSP00000391478:R248Q;ENSP00000425104:R116Q;ENSP00000423862:R155Q	ENSP00000269305:R248Q	R	-	2	0	TP53	7518263	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.884000	0.69729	1.305000	0.44909	0.462000	0.41574	CGG	rs11540652	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	71	71	105	0.00	0.00	C	NM_000546		7577538	-1	71	114	0	0	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	100.00	100.00	SNP	1.000	T	71	0
TSPEAR	54084	genome.wustl.edu	37	21	45953680	45953680	+	Nonsense_Mutation	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr21:45953680G>A	ENST00000323084.4	-	3	495	c.430C>T	c.(430-432)Cga>Tga	p.R144*	TSPEAR_ENST00000397916.1_Nonsense_Mutation_p.R76*	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	144	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						AAGGACACTCGGGTCTGCCAG	0.692													ENSG00000175894																																					0													30.0	31.0	30.0					21																	45953680		2197	4288	6485	SO:0001587	stop_gained	0			-	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.430C>T	21.37:g.45953680G>A	ENSP00000321987:p.Arg144*			Nonsense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_EAR	p.R144*	ENST00000323084.4	37	c.430	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	g	25.7	4.664979	0.88251	.	.	ENSG00000175894	ENST00000323084;ENST00000397916;ENST00000341581	.	.	.	4.9	4.9	0.64082	.	0.266911	0.35739	N	0.003002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.4229	13.0983	0.59206	0.0:0.0:0.8395:0.1605	.	.	.	.	X	144;76;144	.	ENSP00000321987:R144X	R	-	1	2	TSPEAR	44778108	1.000000	0.71417	0.751000	0.31187	0.350000	0.29205	2.326000	0.43849	2.254000	0.74563	0.650000	0.86243	CGA	-	TSPEAR	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.692	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	0	0	0	67	67	6	0.00	0.00	G	NM_144991		45953680	-1	57	11	16	2	tier1	no_errors	ENST00000323084	ensembl	human	known	74_37	nonsense	77.03	84.62	SNP	0.101	A	57	16
RP11-146E13.4	0	genome.wustl.edu	37	14	19856755	19856755	+	lincRNA	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr14:19856755C>T	ENST00000548109.1	+	0	72																											GTCAACAAATCTACATTACCT	0.274													ENSG00000244306																																					0																																												0			-																													14.37:g.19856755C>T				R	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			-	CTD-2314B22.3	-	-		0.274	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	0	0	0	96	96	249	0.00	0.00	C			19856755	-1	9	4	81	194	tier1	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	10.00	2.02	SNP	0.018	T	9	81
TATDN1	83940	genome.wustl.edu	37	8	125498135	125498144	+	IGR	DEL	ACAGCTCAGC	ACAGCTCAGC	-			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	ACAGCTCAGC	ACAGCTCAGC	ACAGCTCAGC	-	ACAGCTCAGC	ACAGCTCAGC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr8:125498135_125498144delACAGCTCAGC	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Frame_Shift_Del_p.YSSA82fs|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TTTTACACGTACAGCTCAGCCTTTCTGTTA	0.376													ENSG00000170881																																					0																																										SO:0001628	intergenic_variant	0				AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125498135_125498144delACAGCTCAGC			B2R5J0|Q8TD02|Q9BY40	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.Y82fs	ENST00000276692.6	37	c.245_254	CCDS6351.1	8																																																																																				RNF139	-	NULL		0.376	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF139	HGNC	protein_coding	OTTHUMT00000381655.1	0	0	0	126	126	126	0.00	0.00	ACAGCTCAGC	NM_032026		125498144	+1	8	8	111	111	tier1	no_errors	ENST00000303545	ensembl	human	known	74_37	frame_shift_del	6.72	6.72	DEL	1.000:1.000:1.000:1.000:0.999:0.974:0.827:0.753:1.000:1.000	-	8	111
DGKK	139189	genome.wustl.edu	37	X	50213247	50213247	+	RNA	SNP	T	T	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:50213247T>A	ENST00000376025.2	-	0	490							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					tggggcaacttctggagtcag	0.657													ENSG00000204466																																					0													30.0	35.0	33.0					X																	50213247		1889	4085	5974			0			-	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50213247T>A			B2RP91	R	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			-	DGKK	-	-		0.657	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	0	0	1	62	62	32	0.00	3.03	T	NM_001013742		50213247	-1	36	22	28	17	tier1	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	56.25	56.41	SNP	0.123	A	36	28
LOC728660	728660	genome.wustl.edu	37	X	139099820	139099820	+	lincRNA	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chrX:139099820A>T	ENST00000417426.1	+	0	206																											GAAGAAAATCATAAAGGTTAA	0.393													ENSG00000233145																																					0																																												0			-																													X.37:g.139099820A>T				R	SNP	-	NULL	ENST00000417426.1	37	NULL		X																																																																																			-	RP11-364B14.1	-	-		0.393	RP11-364B14.1-001	KNOWN	basic	lincRNA	ENSG00000233145	Clone_based_vega_gene	lincRNA	OTTHUMT00000058573.1	0	0	2	47	47	121	0.00	1.63	A			139099820	+1	9	37	12	35	tier1	no_errors	ENST00000417426	ensembl	human	known	74_37	rna	42.86	51.39	SNP	0.000	T	9	12
FBXL2	25827	genome.wustl.edu	37	3	33318974	33318974	+	5'UTR	SNP	G	G	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:33318974G>C	ENST00000484457.1	+	0	61				FBXL2_ENST00000507198.1_5'UTR|FBXL2_ENST00000538181.1_5'UTR|FBXL2_ENST00000446237.3_5'UTR|FBXL2_ENST00000283627.6_3'UTR|FBXL2_ENST00000538892.1_5'UTR	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						GTGTGACTTCGGGCTGTGGGC	0.746													ENSG00000153558																																					0													10.0	11.0	10.0					3																	33318974		2129	4121	6250	SO:0001623	5_prime_UTR_variant	0			-	AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.-31G>C	3.37:g.33318974G>C				R	SNP	-	NULL	ENST00000484457.1	37	NULL	CCDS2658.1	3																																																																																			-	FBXL2	-	-		0.746	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL2	HGNC	protein_coding	OTTHUMT00000253245.2	0	0	0	24	24	7	0.00	0.00	G	NM_012157		33318974	+1	7	1	32	2	tier1	no_errors	ENST00000283627	ensembl	human	known	74_37	rna	17.95	33.33	SNP	0.017	C	7	32
ZNF324B	388569	genome.wustl.edu	37	19	58967494	58967495	+	Missense_Mutation	DNP	AA	AA	TG			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr19:58967494_58967495AA>TG	ENST00000336614.4	+	4	1290_1291	c.1183_1184AA>TG	c.(1183-1185)AAg>TGg	p.K395W	ZNF324B_ENST00000391696.1_Missense_Mutation_p.K385W|ZNF324B_ENST00000545523.1_Missense_Mutation_p.K395W	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	395					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CACAGGCGAGAAGCCCTTCGTA	0.658													ENSG00000249471																																					0																																										SO:0001583	missense	0			-	AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		Exception_encountered	19.37:g.58967494_58967495delinsTG	ENSP00000337473:p.Lys395Trp		B2RTZ6|Q6ZMX8|Q6ZS42	Nonsense_Mutation|Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K395*|p.K395R	ENST00000336614.4	37	c.1183|c.1184	CCDS33138.1	19																																																																																			-	ZNF324B	-	pfscan_Znf_C2H2		0.658	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	HGNC	protein_coding	OTTHUMT00000467038.1	0	0	0	90	90	9	0.00	0.00	A	NM_207395		58967494|58967495	+1	21|20	1	64|65	6	tier1	no_errors	ENST00000336614	ensembl	human	known	74_37	nonsense|missense	24.71|23.53	14.29	SNP	1.000	T|G	20	64
RP11-782C8.2	0	genome.wustl.edu	37	1	143210195	143210195	+	lincRNA	SNP	T	T	C			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr1:143210195T>C	ENST00000412204.2	-	0	875				RP11-782C8.1_ENST00000438000.1_lincRNA																							CAGCATTTGTTTTTTTAACAA	0.318													ENSG00000232274																																					0																																												0			-																													1.37:g.143210195T>C				R	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			-	RP11-782C8.2	-	-		0.318	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	0	0	0	215	215	2	0.00	0.00	T			143210195	-1	38	0	180	3	tier1	no_errors	ENST00000412204	ensembl	human	known	74_37	rna	17.43	0.00	SNP	0.005	C	38	180
LOC100996643	100996643	genome.wustl.edu	37	9	67291163	67291163	+	RNA	SNP	A	A	G	rs672441	byFrequency	TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr9:67291163A>G	ENST00000432011.2	+	0	284																											CAGGCTGTCTATGGAGCCAAA	0.368													ENSG00000228522																																					0																																												0			-																													9.37:g.67291163A>G				R	SNP	-	NULL	ENST00000432011.2	37	NULL		9																																																																																			rs200595877	RP11-236F9.2	-	-		0.368	RP11-236F9.2-002	KNOWN	basic	processed_transcript	LOC100996643	Clone_based_vega_gene	pseudogene	OTTHUMT00000143981.2	0	0	0	54	54	4	0.00	0.00	A			67291163	+1	5	0	36	4	tier1	no_errors	ENST00000432011	ensembl	human	known	74_37	rna	12.20	0.00	SNP	1.000	G	5	36
LOC441666	441666	genome.wustl.edu	37	10	42832502	42832503	+	RNA	INS	-	-	TATCA	rs368679059		TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr10:42832502_42832503insTATCA	ENST00000609841.1	-	0	1400_1401					NR_024380.1																						CCCCTATCAATTATGTTTAGTA	0.366													ENSG00000215146																																					0																																												0																																10.37:g.42832502_42832503insTATCA				R	INS	-	NULL	ENST00000609841.1	37	NULL		10																																																																																				RP11-313J2.1	-	-		0.366	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	0	0	0	2	2	2	0.00	0.00	-			42832503	-1	0	0	1	1	tier1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.995:0.996	TATCA	0	1
PCOLCE2	26577	genome.wustl.edu	37	3	142607822	142607823	+	5'UTR	INS	-	-	GCTCACACTGGCAGCAGCGCTG			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr3:142607822_142607823insGCTCACACTGGCAGCAGCGCTG	ENST00000295992.3	-	0	222_223				PCOLCE2_ENST00000485766.1_5'Flank|PCOLCE2_ENST00000461818.1_5'UTR	NM_013363.3	NP_037495.1	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2						positive regulation of peptidase activity (GO:0010952)	extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|peptidase activator activity (GO:0016504)			NS(1)|endometrium(1)|large_intestine(11)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	32						CTCACACCGCCGCTCACACTGG	0.772													ENSG00000163710																																					0																																										SO:0001623	5_prime_UTR_variant	0				AF098269	CCDS3127.1	3q21-q24	2008-07-18			ENSG00000163710	ENSG00000163710			8739	protein-coding gene	gene with protein product		607064				10873381	Standard	NM_013363		Approved	PCPE2	uc003evd.3	Q9UKZ9	OTTHUMG00000159312	ENST00000295992.3:c.-85->CAGCGCTGCTGCCAGTGTGAGC	3.37:g.142607822_142607823insGCTCACACTGGCAGCAGCGCTG			B2RCH9|D3DNG4|Q9BRH3	R	INS	-	NULL	ENST00000295992.3	37	NULL	CCDS3127.1	3																																																																																				PCOLCE2	-	-		0.772	PCOLCE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCOLCE2	HGNC	protein_coding	OTTHUMT00000354509.1	0	0	0	0	0	0	0.00	0.00	-	NM_013363		142607823	-1	0	0	0	0	tier1	no_errors	ENST00000461818	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.000:0.000	GCTCACACTGGCAGCAGCGCTG	0	0
TELO2	9894	genome.wustl.edu	37	16	1545430	1545430	+	Missense_Mutation	SNP	A	A	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr16:1545430A>T	ENST00000262319.6	+	3	698	c.419A>T	c.(418-420)cAg>cTg	p.Q140L		NM_016111.3	NP_057195.2	Q9Y4R8	TELO2_HUMAN	telomere maintenance 2	140					regulation of TOR signaling (GO:0032006)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	protein complex binding (GO:0032403)			NS(1)|endometrium(1)|kidney(5)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	19		Hepatocellular(780;0.219)				ATGGAGGCGCAGTGTCGGCAG	0.687													ENSG00000100726																																					0													13.0	12.0	12.0					16																	1545430		2154	4239	6393	SO:0001583	missense	0			-	AL080126	CCDS32363.1	16p13.3	2013-08-06	2013-08-06		ENSG00000100726	ENSG00000100726			29099	protein-coding gene	gene with protein product		611140	"""TEL2, telomere maintenance 2, homolog (S. cerevisiae)"""			9734811, 11230166, 12670948	Standard	NM_016111		Approved	KIAA0683, hCLK2, TEL2	uc002cly.3	Q9Y4R8	OTTHUMG00000044471	ENST00000262319.6:c.419A>T	16.37:g.1545430A>T	ENSP00000262319:p.Gln140Leu		D3DU73|O75168|Q7LDV4|Q9BR21	Missense_Mutation	SNP	pfam_Telomere_length_regulation_dom,superfamily_ARM-type_fold	p.Q140L	ENST00000262319.6	37	c.419	CCDS32363.1	16	.	.	.	.	.	.	.	.	.	.	A	2.984	-0.209619	0.06140	.	.	ENSG00000100726	ENST00000262319	D	0.84730	-1.89	5.33	4.2	0.49525	.	0.840330	0.10979	N	0.612898	T	0.79347	0.4430	M	0.63428	1.95	0.27658	N	0.947163	B	0.28512	0.214	B	0.21360	0.034	T	0.65809	-0.6078	10	0.11485	T	0.65	-37.9427	7.7011	0.28623	0.6213:0.0:0.0:0.3787	.	140	Q9Y4R8	TELO2_HUMAN	L	140	ENSP00000262319:Q140L	ENSP00000262319:Q140L	Q	+	2	0	TELO2	1485431	0.992000	0.36948	0.987000	0.45799	0.086000	0.17979	1.337000	0.33862	2.014000	0.59158	0.533000	0.62120	CAG	-	TELO2	-	NULL		0.687	TELO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TELO2	HGNC	protein_coding	OTTHUMT00000103602.2	0	0	0	39	39	1	0.00	0.00	A	NM_016111		1545430	+1	7	1	26	2	tier1	no_errors	ENST00000262319	ensembl	human	known	74_37	missense	21.21	33.33	SNP	0.766	T	7	26
WNT6	7475	genome.wustl.edu	37	2	219724739	219724739	+	5'UTR	SNP	G	G	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr2:219724739G>A	ENST00000233948.3	+	0	196				WNT6_ENST00000486233.1_3'UTR	NM_006522.3	NP_006513.1	Q9Y6F9	WNT6_HUMAN	wingless-type MMTV integration site family, member 6						axis specification (GO:0009798)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|epithelial-mesenchymal cell signaling (GO:0060684)|nephron tubule formation (GO:0072079)|neuron differentiation (GO:0030182)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of gene expression (GO:0010628)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription, DNA-templated (GO:0045893)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(1)|ovary(2)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.53e-07)|all cancers(144;9.3e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGCCCACCCGGGCGGCCGTA	0.786													ENSG00000115596																																					0													2.0	3.0	3.0					2																	219724739		1605	3211	4816	SO:0001623	5_prime_UTR_variant	0			-	AF079522	CCDS2425.1	2q35	2008-05-23			ENSG00000115596	ENSG00000115596		"""Wingless-type MMTV integration sites"""	12785	protein-coding gene	gene with protein product		604663				10343101, 11350055	Standard	NM_006522		Approved		uc002vjc.1	Q9Y6F9	OTTHUMG00000133082	ENST00000233948.3:c.-22G>A	2.37:g.219724739G>A			Q9H1J6|Q9H238	R	SNP	-	NULL	ENST00000233948.3	37	NULL	CCDS2425.1	2																																																																																			-	WNT6	-	-		0.786	WNT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT6	HGNC	protein_coding	OTTHUMT00000256727.2	0	0	0	9	9	1	0.00	0.00	G	NM_006522		219724739	+1	6	0	4	0	tier1	no_errors	ENST00000486233	ensembl	human	putative	74_37	rna	60.00	0.00	SNP	0.000	A	6	4
PCDHB14	56122	genome.wustl.edu	37	5	140604757	140604757	+	Silent	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr5:140604757C>T	ENST00000239449.4	+	1	1680	c.1680C>T	c.(1678-1680)ttC>ttT	p.F560F	PCDHB14_ENST00000515856.2_Silent_p.F407F	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	560	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACTCGCCCTTCGTGCTGTACC	0.721													ENSG00000120327																									Ovarian(141;50 1831 27899 33809 37648)												0																																										SO:0001819	synonymous_variant	0			-	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.1680C>T	5.37:g.140604757C>T			B4DPE2|Q4FZA4|Q4KN11	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F560	ENST00000239449.4	37	c.1680	CCDS4256.1	5																																																																																			-	PCDHB14	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.721	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB14	HGNC	protein_coding	OTTHUMT00000251814.2	0	0	0	150	150	1	0.00	0.00	C	NM_018934		140604757	+1	50	2	139	0	tier1	no_errors	ENST00000239449	ensembl	human	known	74_37	silent	26.46	100.00	SNP	0.766	T	50	139
TNRC18	84629	genome.wustl.edu	37	7	5347940	5347940	+	Missense_Mutation	SNP	C	C	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:5347940C>T	ENST00000430969.1	-	30	9052	c.8704G>A	c.(8704-8706)Gcg>Acg	p.A2902T	TNRC18_ENST00000399537.4_Missense_Mutation_p.A2902T	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2902	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		TGGTATAGCGCGCGCTGCGGG	0.637													ENSG00000182095																																					0													31.0	29.0	30.0					7																	5347940		2041	4169	6210	SO:0001583	missense	0			-	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.8704G>A	7.37:g.5347940C>T	ENSP00000395538:p.Ala2902Thr		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.A2902T	ENST00000430969.1	37	c.8704	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	c	16.72	3.200560	0.58126	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	D;D	0.85629	-2.01;-2.01	4.65	4.65	0.58169	Bromo adjacent homology (BAH) domain (3);	.	.	.	.	D	0.92004	0.7467	M	0.73962	2.25	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.93238	0.6623	9	0.87932	D	0	.	17.1047	0.86659	0.0:1.0:0.0:0.0	.	2902	O15417	TNC18_HUMAN	T	2902	ENSP00000382452:A2902T;ENSP00000395538:A2902T	ENSP00000382452:A2902T	A	-	1	0	TNRC18	5314466	1.000000	0.71417	0.996000	0.52242	0.368000	0.29767	7.265000	0.78442	2.100000	0.63781	0.555000	0.69702	GCG	-	TNRC18	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom		0.637	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		0	0	0	59	59	0	0.00	0.00	C			5347940	-1	14	2	40	1	tier1	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	25.93	66.67	SNP	1.000	T	14	40
BCL2L14	79370	genome.wustl.edu	37	12	12232253	12232253	+	Missense_Mutation	SNP	G	G	T			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr12:12232253G>T	ENST00000308721.5	+	2	220	c.14G>T	c.(13-15)aGt>aTt	p.S5I	BCL2L14_ENST00000396367.1_Missense_Mutation_p.S5I|BCL2L14_ENST00000396369.1_Missense_Mutation_p.S5I|BCL2L14_ENST00000586576.1_Missense_Mutation_p.S38I|BCL2L14_ENST00000266434.4_Missense_Mutation_p.S5I|BCL2L14_ENST00000589718.1_Missense_Mutation_p.S5I	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	5					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		TGTAGCACCAGTGGGTGTGAC	0.483													ENSG00000121380																																					0													142.0	127.0	132.0					12																	12232253		2203	4300	6503	SO:0001583	missense	0			-	AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.14G>T	12.37:g.12232253G>T	ENSP00000309132:p.Ser5Ile		A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	pfscan_Bcl2-like	p.S5I	ENST00000308721.5	37	c.14	CCDS8645.1	12	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518151	0.44763	.	.	ENSG00000121380	ENST00000464885;ENST00000461264;ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	.	.	.	4.11	4.11	0.48088	.	0.398924	0.24568	N	0.037404	T	0.66376	0.2783	M	0.73962	2.25	0.29896	N	0.8248	D;D	0.89917	0.999;1.0	D;D	0.87578	0.976;0.998	T	0.65018	-0.6270	9	0.87932	D	0	-6.0632	12.1533	0.54062	0.0:0.0:1.0:0.0	.	5;5	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	I	5;8;5;5;5;5	.	ENSP00000266434:S5I	S	+	2	0	BCL2L14	12123520	0.604000	0.26932	0.719000	0.30619	0.302000	0.27658	1.783000	0.38664	2.590000	0.87494	0.563000	0.77884	AGT	-	BCL2L14	-	NULL		0.483	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L14	HGNC	protein_coding	OTTHUMT00000355994.3	0	0	0	50	50	161	0.00	0.00	G	NM_030766		12232253	+1	4	2	27	170	tier1	no_errors	ENST00000308721	ensembl	human	known	74_37	missense	12.90	1.16	SNP	0.729	T	4	27
AC005013.5	0	genome.wustl.edu	37	7	28996605	28996605	+	lincRNA	SNP	C	C	A			TCGA-WP-A9GB-01A-11D-A37C-09	TCGA-WP-A9GB-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	8abdeb14-fa39-4bbc-8181-7196573b2629	765fa923-05c1-4fbe-a8dc-ba3c987c84d5	g.chr7:28996605C>A	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							TAGATCCAGCCGATAAAGGGC	0.692													ENSG00000176734																																					0													5.0	6.0	6.0					7																	28996605		1755	3762	5517			0			-																													7.37:g.28996605C>A				R	SNP	-	NULL	ENST00000436594.1	37	NULL		7																																																																																			-	TRIL	-	-		0.692	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	TRIL	HGNC	lincRNA	OTTHUMT00000327953.3	0	0	0	25	25	19	0.00	0.00	C			28996605	-1	11	2	19	22	tier1	no_errors	ENST00000322982	ensembl	human	known	74_37	rna	36.67	8.33	SNP	1.000	A	11	19
