#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
RARB	5915	genome.wustl.edu	37	3	25622051	25622051	+	Missense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:25622051C>A	ENST00000404969.1	+	5	645	c.645C>A	c.(643-645)gaC>gaA	p.D215E	RARB_ENST00000458646.1_Missense_Mutation_p.D96E|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000330688.4_Missense_Mutation_p.D208E|RARB_ENST00000437042.2_Missense_Mutation_p.D96E			P10826	RARB_HUMAN	retinoic acid receptor, beta	215	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	CCAGTGCTGACCATCGAGTCC	0.473													ENSG00000077092																																					0													93.0	86.0	88.0					3																	25622051		2203	4300	6503	SO:0001583	missense	0			-	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.645C>A	3.37:g.25622051C>A	ENSP00000385865:p.Asp215Glu		P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.D215E	ENST00000404969.1	37	c.645		3	.	.	.	.	.	.	.	.	.	.	C	7.954	0.745542	0.15710	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32	5.2	1.93	0.25924	Nuclear hormone receptor, ligand-binding (2);	0.049752	0.85682	D	0.000000	T	0.14614	0.0353	N	0.05078	-0.115	0.38228	D	0.940943	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08700	-1.0709	10	0.20519	T	0.43	.	6.4962	0.22144	0.0:0.5023:0.2643:0.2334	.	215;208	P10826;F1D8S6	RARB_HUMAN;.	E	215;215;215;96;208;96	ENSP00000373282:D215E;ENSP00000385865:D215E;ENSP00000398840:D96E;ENSP00000332296:D208E;ENSP00000391391:D96E	ENSP00000332296:D208E	D	+	3	2	RARB	25597055	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	0.938000	0.28965	0.588000	0.29660	-0.440000	0.05779	GAC	-	RARB	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_Retinoic_acid_rcpt		0.473	RARB-201	KNOWN	basic	protein_coding	RARB	HGNC	protein_coding		0	0	1	56	56	70	0.00	1.39	C	NM_000965, NM_016152		25622051	+1	20	38	15	43	tier1	no_errors	ENST00000404969	ensembl	human	known	74_37	missense	57.14	46.91	SNP	0.997	A	20	15
RP11-65D24.2	0	genome.wustl.edu	37	13	112240744	112240744	+	3'UTR	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr13:112240744C>T	ENST00000607406.1	+	0	197				RP11-65D24.2_ENST00000375713.1_Intron																							ACCTCACAGCCGGGAGGAGAC	0.532													ENSG00000204398																																					0																																										SO:0001624	3_prime_UTR_variant	0			-																												ENST00000607406.1:c.*194C>T	13.37:g.112240744C>T				R	SNP	-	NULL	ENST00000607406.1	37	NULL		13																																																																																			-	RP11-65D24.2	-	-		0.532	RP11-65D24.2-002	KNOWN	basic	processed_transcript	ENSG00000204398	Clone_based_vega_gene	protein_coding	OTTHUMT00000471073.1	0	0	0	39	39	56	0.00	0.00	C			112240744	+1	12	23	23	27	tier1	no_errors	ENST00000607406	ensembl	human	known	74_37	rna	34.29	46.00	SNP	0.000	T	12	23
KCNMB3	27094	genome.wustl.edu	37	3	178968712	178968712	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:178968712G>A	ENST00000314235.5	-	2	590	c.79C>T	c.(79-81)Cct>Tct	p.P27S	KCNMB3_ENST00000497599.1_Missense_Mutation_p.P25S|KCNMB3_ENST00000392685.2_Missense_Mutation_p.P23S|KCNMB3_ENST00000349697.2_Missense_Mutation_p.P25S|KCNMB3_ENST00000485523.1_Missense_Mutation_p.P5S	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	27					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CCTGAGGCAGGAAAGGCTGTC	0.522													ENSG00000171121																																					0													116.0	108.0	111.0					3																	178968712		2203	4300	6503	SO:0001583	missense	0			-	AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.79C>T	3.37:g.178968712G>A	ENSP00000319370:p.Pro27Ser		B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_bsu	p.P27S	ENST00000314235.5	37	c.79	CCDS3226.1	3	.	.	.	.	.	.	.	.	.	.	G	7.748	0.702789	0.15172	.	.	ENSG00000171121	ENST00000497599;ENST00000392685;ENST00000349697;ENST00000314235;ENST00000485523	T;T;T;T;T	0.16597	2.33;3.09;3.06;3.09;3.03	6.07	-2.26	0.06867	.	1.472700	0.04038	N	0.302650	T	0.04724	0.0128	N	0.01874	-0.695	0.09310	N	1	B;B;B;B;B	0.12630	0.0;0.001;0.001;0.006;0.003	B;B;B;B;B	0.10450	0.001;0.003;0.003;0.005;0.002	T	0.27606	-1.0069	10	0.02654	T	1	-11.5657	2.8077	0.05432	0.3266:0.1341:0.4086:0.1307	.	25;25;5;23;27	E9PER5;Q9NPA1-2;Q9NPA1-4;Q9NPA1-3;Q9NPA1	.;.;.;.;KCMB3_HUMAN	S	25;23;25;27;5	ENSP00000417091:P25S;ENSP00000376451:P23S;ENSP00000327866:P25S;ENSP00000319370:P27S;ENSP00000418536:P5S	ENSP00000319370:P27S	P	-	1	0	KCNMB3	180451406	0.006000	0.16342	0.000000	0.03702	0.636000	0.38137	-0.235000	0.09016	-0.622000	0.05626	0.650000	0.86243	CCT	-	KCNMB3	-	NULL		0.522	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	KCNMB3	HGNC	protein_coding	OTTHUMT00000348484.1	0	0	0	45	45	78	0.00	0.00	G			178968712	-1	23	35	24	36	tier1	no_errors	ENST00000314235	ensembl	human	known	74_37	missense	48.94	49.30	SNP	0.002	A	23	24
C6orf165	154313	genome.wustl.edu	37	6	88119637	88119637	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:88119637T>C	ENST00000507897.1	+	2	163	c.80T>C	c.(79-81)aTt>aCt	p.I27T	C6ORF165_ENST00000369562.4_Missense_Mutation_p.I27T			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	27										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		CATGGAGAGATTGTTTCTGAA	0.353													ENSG00000272514																																					0													142.0	147.0	145.0					6																	88119637		2203	4300	6503	SO:0001583	missense	0			-	BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.80T>C	6.37:g.88119637T>C	ENSP00000426769:p.Ile27Thr		A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	pfam_DUF3508	p.I27T	ENST00000507897.1	37	c.80	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	T	0.917	-0.717133	0.03182	.	.	ENSG00000213204	ENST00000369562;ENST00000480123	T;T	0.27720	1.65;1.65	5.39	2.73	0.32206	.	0.602100	0.17226	N	0.182152	T	0.02230	0.0069	N	0.01109	-1.01	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.47045	-0.9147	10	0.10111	T	0.7	.	6.3819	0.21540	0.0:0.3494:0.0:0.6506	.	27;27	Q8IYR0;E1P509	CF165_HUMAN;.	T	27	ENSP00000358575:I27T;ENSP00000422494:I27T	ENSP00000358575:I27T	I	+	2	0	C6orf165	88176356	0.004000	0.15560	0.612000	0.29024	0.930000	0.56654	1.314000	0.33597	0.983000	0.38602	0.533000	0.62120	ATT	-	C6ORF165	-	NULL		0.353	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	Uniprot_gn	protein_coding	OTTHUMT00000470406.1	0	0	0	210	210	133	0.00	0.00	T	NM_178823		88119637	+1	63	57	62	72	tier1	no_errors	ENST00000369562	ensembl	human	known	74_37	missense	50.40	44.19	SNP	0.100	C	63	62
SVILP1	645954	genome.wustl.edu	37	10	30987307	30987307	+	RNA	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:30987307G>T	ENST00000435645.1	+	0	440									supervillin pseudogene 1																		AGCTGCTGGAGACCCAAAAGA	0.418													ENSG00000234814																																					0																																												0			-			10p11.23	2012-12-20			ENSG00000234814	ENSG00000234814			44959	pseudogene	pseudogene							Standard	NR_036438		Approved				OTTHUMG00000017900		10.37:g.30987307G>T				R	SNP	-	NULL	ENST00000435645.1	37	NULL		10																																																																																			-	SVILP1	-	-		0.418	SVILP1-002	KNOWN	basic	processed_transcript	SVILP1	HGNC	pseudogene	OTTHUMT00000331601.1	0	0	0	84	84	81	0.00	0.00	G			30987307	+1	30	40	48	63	tier1	no_errors	ENST00000435645	ensembl	human	known	74_37	rna	38.46	38.83	SNP	0.996	T	30	48
TSC22D2	9819	genome.wustl.edu	37	3	150128722	150128722	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:150128722C>T	ENST00000361875.3	+	1	2601	c.1585C>T	c.(1585-1587)Cca>Tca	p.P529S	TSC22D2_ENST00000361136.2_Missense_Mutation_p.P529S	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	529					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TGTTACTATGCCAAATGTACC	0.612													ENSG00000196428																																					0													59.0	61.0	60.0					3																	150128722		2203	4300	6503	SO:0001583	missense	0			-	AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.1585C>T	3.37:g.150128722C>T	ENSP00000354543:p.Pro529Ser		D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.P529S	ENST00000361875.3	37	c.1585	CCDS3149.1	3	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097662	0.56075	.	.	ENSG00000196428	ENST00000543241;ENST00000361875;ENST00000361136	T;T	0.39229	1.13;1.09	4.56	2.77	0.32553	.	0.000000	0.50627	D	0.000111	T	0.47948	0.1473	L	0.32530	0.975	0.36424	D	0.864463	D;D	0.67145	0.996;0.994	D;P	0.67382	0.951;0.895	T	0.52801	-0.8527	10	0.48119	T	0.1	.	10.2395	0.43303	0.0:0.8354:0.0:0.1646	.	529;529	O75157-2;O75157	.;T22D2_HUMAN	S	2;529;529	ENSP00000354543:P529S;ENSP00000354893:P529S	ENSP00000354893:P529S	P	+	1	0	TSC22D2	151611412	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	2.794000	0.47853	0.383000	0.24910	0.563000	0.77884	CCA	-	TSC22D2	-	NULL		0.612	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	0	0	0	58	58	48	0.00	0.00	C	NM_014779		150128722	+1	18	17	20	27	tier1	no_errors	ENST00000361875	ensembl	human	known	74_37	missense	47.37	38.64	SNP	1.000	T	18	20
STK36	27148	genome.wustl.edu	37	2	219563973	219563973	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:219563973C>T	ENST00000295709.3	+	26	3985	c.3706C>T	c.(3706-3708)Cgg>Tgg	p.R1236W	STK36_ENST00000392105.3_Missense_Mutation_p.R1215W|STK36_ENST00000440309.1_Missense_Mutation_p.R1236W|STK36_ENST00000392106.2_Missense_Mutation_p.R1215W	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		AGTACCCCAGCGGCTCCTAGA	0.582													ENSG00000163482																																					0													49.0	52.0	51.0					2																	219563973		2203	4300	6503	SO:0001583	missense	0			-	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3706C>T	2.37:g.219563973C>T	ENSP00000295709:p.Arg1236Trp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1236W	ENST00000295709.3	37	c.3706	CCDS2421.1	2	.	.	.	.	.	.	.	.	.	.	C	16.72	3.202376	0.58234	.	.	ENSG00000163482	ENST00000295709;ENST00000392106;ENST00000392105;ENST00000440309	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.77	3.82	0.43975	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.41396	D	0.000900	T	0.34193	0.0889	L	0.50333	1.59	0.30901	N	0.729324	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.981;0.978;0.928	T	0.30031	-0.9992	10	0.66056	D	0.02	-24.276	13.47	0.61278	0.4064:0.5936:0.0:0.0	.	1215;1215;1236	A8MU99;Q9NRP7-2;Q9NRP7	.;.;STK36_HUMAN	W	1236;1215;1215;1236	ENSP00000295709:R1236W;ENSP00000375955:R1215W;ENSP00000375954:R1215W;ENSP00000394095:R1236W	ENSP00000295709:R1236W	R	+	1	2	STK36	219272217	0.027000	0.19231	1.000000	0.80357	0.846000	0.48090	-0.202000	0.09451	1.385000	0.46445	0.561000	0.74099	CGG	-	STK36	-	superfamily_ARM-type_fold		0.582	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK36	HGNC	protein_coding	OTTHUMT00000256723.2	0	0	0	42	42	81	0.00	0.00	C			219563973	+1	10	29	9	46	tier1	no_errors	ENST00000295709	ensembl	human	known	74_37	missense	52.63	38.67	SNP	0.994	T	10	9
LINC00933	100506874	genome.wustl.edu	37	15	85121416	85121416	+	RNA	SNP	A	A	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:85121416A>T	ENST00000557887.1	+	0	616					NR_038273.1|NR_038274.1				long intergenic non-protein coding RNA 933																		GGATTCTCTGAATCGGAAGTT	0.413													ENSG00000259728																																					0																																												0			-			15q25.2	2013-05-29			ENSG00000259728	ENSG00000259728		"""Long non-coding RNAs"""	48625	non-coding RNA	RNA, long non-coding							Standard	NR_038273		Approved				OTTHUMG00000172445		15.37:g.85121416A>T				R	SNP	-	NULL	ENST00000557887.1	37	NULL		15																																																																																			-	LINC00933	-	-		0.413	LINC00933-001	KNOWN	basic	processed_transcript	LINC00933	HGNC	pseudogene	OTTHUMT00000418591.1	0	0	0	19	19	46	0.00	0.00	A			85121416	+1	3	3	6	26	tier1	no_errors	ENST00000557887	ensembl	human	known	74_37	rna	33.33	10.34	SNP	0.235	T	3	6
TENM3	55714	genome.wustl.edu	37	4	183650181	183650181	+	Missense_Mutation	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:183650181A>C	ENST00000511685.1	+	14	2555	c.2432A>C	c.(2431-2433)tAt>tCt	p.Y811S	TENM3_ENST00000406950.2_Missense_Mutation_p.Y811S|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	811					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AATCAGCCCTATTGTCGGGGA	0.478													ENSG00000218336																																					0													84.0	81.0	82.0					4																	183650181		1933	4153	6086	SO:0001583	missense	0			-	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2432A>C	4.37:g.183650181A>C	ENSP00000424226:p.Tyr811Ser		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.Y811S	ENST00000511685.1	37	c.2432	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	A	9.129	1.010874	0.19277	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.10668	2.85;2.85	5.14	2.61	0.31194	.	.	.	.	.	T	0.06005	0.0156	N	0.11892	0.195	0.53688	D	0.99997	B	0.06786	0.001	B	0.04013	0.001	T	0.27468	-1.0073	9	0.62326	D	0.03	.	7.0216	0.24916	0.6073:0.1346:0.0:0.258	.	811	Q9P273	TEN3_HUMAN	S	811	ENSP00000424226:Y811S;ENSP00000385276:Y811S	ENSP00000385276:Y811S	Y	+	2	0	ODZ3	183887175	1.000000	0.71417	0.990000	0.47175	0.400000	0.30750	3.193000	0.50997	0.383000	0.24910	0.460000	0.39030	TAT	-	TENM3	-	NULL		0.478	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	0	0	0	72	72	97	0.00	0.00	A			183650181	+1	29	43	24	64	tier1	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	54.72	40.19	SNP	1.000	C	29	24
SYT6	148281	genome.wustl.edu	37	1	114646326	114646326	+	Silent	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:114646326T>C	ENST00000610222.1	-	4	1235	c.1089A>G	c.(1087-1089)ggA>ggG	p.G363G	SYT6_ENST00000393296.1_Silent_p.G363G|SYT6_ENST00000609117.1_Silent_p.G278G|SYT6_ENST00000607941.1_Silent_p.G278G|SYT6_ENST00000369547.1_Silent_p.G278G			Q5T7P8	SYT6_HUMAN	synaptotagmin VI	363	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				acrosomal vesicle exocytosis (GO:0060478)	cell junction (GO:0030054)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	clathrin binding (GO:0030276)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|syntaxin binding (GO:0019905)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACATGATCTCTCCCAAGTCCA	0.557													ENSG00000134207																																					0													111.0	78.0	89.0					1																	114646326		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS871.1	1p13.1	2013-01-21			ENSG00000134207	ENSG00000134207		"""Synaptotagmins"""	18638	protein-coding gene	gene with protein product		607718				11543631	Standard	NM_205848		Approved		uc021orz.1	Q5T7P8	OTTHUMG00000011755	ENST00000610222.1:c.1089A>G	1.37:g.114646326T>C			B1AMB8|B3KPK1	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.G363	ENST00000610222.1	37	c.1089		1																																																																																			-	SYT6	-	superfamily_C2_dom		0.557	SYT6-004	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SYT6	HGNC	protein_coding	OTTHUMT00000314819.2	0	0	0	48	48	75	0.00	0.00	T	NM_205848		114646326	-1	11	26	22	41	tier1	no_errors	ENST00000393296	ensembl	human	known	74_37	silent	33.33	38.81	SNP	0.716	C	11	22
RBP3	5949	genome.wustl.edu	37	10	48389030	48389030	+	Silent	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:48389030G>A	ENST00000224600.4	-	1	1961	c.1848C>T	c.(1846-1848)atC>atT	p.I616I	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	616	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	CGGCCAGCACGATGGCATCGG	0.672													ENSG00000107618																																					0													31.0	32.0	32.0					10																	48389030		2196	4292	6488	SO:0001819	synonymous_variant	0			-	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.1848C>T	10.37:g.48389030G>A			Q0QD34|Q5VSR0|Q8IXN0	Silent	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.I616	ENST00000224600.4	37	c.1848	CCDS7218.1	10																																																																																			-	RBP3	-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd		0.672	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	0	0	0	75	75	38	0.00	0.00	G	NM_002900		48389030	-1	4	5	32	25	tier1	no_errors	ENST00000224600	ensembl	human	known	74_37	silent	11.11	16.67	SNP	0.981	A	4	32
MIR202	574448	genome.wustl.edu	37	10	135061186	135061186	+	RNA	SNP	G	G	A	rs570376093	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr10:135061186G>A	ENST00000300167.6	-	0	114				MIR202_ENST00000553459.1_RNA|MIR202_ENST00000362219.2_RNA					microRNA 202																		CGGGCAGCAGGGAGAAGTCGG	0.677													ENSG00000166917	G|||	3	0.000599042	0.0	0.0	5008	,	,		12340	0.002		0.0	False		,,,				2504	0.001																0													10.0	16.0	14.0					10																	135061186		691	1590	2281			0			-			10q26.3	2011-09-12		2008-12-18	ENSG00000199089	ENSG00000278352		"""ncRNAs / Micro RNAs"""	32080	non-coding RNA	RNA, micro				MIRN202			Standard	NR_030170		Approved	hsa-mir-202	uc009ybh.2				10.37:g.135061186G>A				R	SNP	-	NULL	ENST00000300167.6	37	NULL		10																																																																																			-	MIR202	-	-		0.677	MIR202-001	KNOWN	basic|exp_conf	antisense	MIR202	HGNC	antisense	OTTHUMT00000409806.1	0	0	0	92	92	63	0.00	0.00	G	NR_030170		135061186	-1	32	22	42	11	tier1	no_errors	ENST00000300167	ensembl	human	known	74_37	rna	43.24	66.67	SNP	0.018	A	32	42
PRR27	401137	genome.wustl.edu	37	4	71024318	71024318	+	Missense_Mutation	SNP	T	T	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:71024318T>A	ENST00000344526.5	+	3	538	c.349T>A	c.(349-351)Ttt>Att	p.F117I	C4orf40_ENST00000502441.2_3'UTR|C4orf40_ENST00000502294.1_Missense_Mutation_p.F117I	NM_214711.3	NP_999876.2	Q6MZM9	PRR27_HUMAN		117	Ala/Pro-rich.					extracellular vesicular exosome (GO:0070062)				breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12						TCCTTCAAGGTTTTTTTCAGC	0.547													ENSG00000187533																																					0													148.0	152.0	151.0					4																	71024318		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000344526.5:c.349T>A	4.37:g.71024318T>A	ENSP00000343172:p.Phe117Ile		A8MXP0|Q6MZR6	Missense_Mutation	SNP	NULL	p.F117I	ENST00000344526.5	37	c.349	CCDS3535.1	4	.	.	.	.	.	.	.	.	.	.	T	2.451	-0.326363	0.05350	.	.	ENSG00000187533	ENST00000502294;ENST00000344526	T;T	0.27890	1.64;1.64	2.91	-4.36	0.03645	.	.	.	.	.	T	0.08179	0.0204	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.23619	-1.0183	9	0.32370	T	0.25	9.0E-4	0.3708	0.00379	0.2991:0.1896:0.13:0.3813	.	117	Q6MZM9	CD040_HUMAN	I	117	ENSP00000426249:F117I;ENSP00000343172:F117I	ENSP00000343172:F117I	F	+	1	0	C4orf40	71058907	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.424000	0.07025	-0.459000	0.07013	-2.739000	0.00128	TTT	-	C4orf40	-	NULL		0.547	C4orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf40	HGNC	protein_coding	OTTHUMT00000251558.1	0	0	0	56	56	95	0.00	0.00	T			71024318	+1	17	40	25	39	tier1	no_errors	ENST00000344526	ensembl	human	known	74_37	missense	40.48	50.63	SNP	0.000	A	17	25
AHNAK	79026	genome.wustl.edu	37	11	62286210	62286210	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:62286210G>A	ENST00000378024.4	-	5	15953	c.15679C>T	c.(15679-15681)Cca>Tca	p.P5227S	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5227					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTTGCTTCTGGACCTTGCAGA	0.512													ENSG00000124942																																					0													141.0	121.0	127.0					11																	62286210		2202	4299	6501	SO:0001583	missense	0			-	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15679C>T	11.37:g.62286210G>A	ENSP00000367263:p.Pro5227Ser		A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P5227S	ENST00000378024.4	37	c.15679	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	G	16.67	3.188882	0.57909	.	.	ENSG00000124942	ENST00000378024	T	0.03152	4.03	4.99	4.99	0.66335	.	0.000000	0.45606	D	0.000352	T	0.18383	0.0441	M	0.74546	2.27	0.34187	D	0.671663	D	0.71674	0.998	D	0.87578	0.998	T	0.10520	-1.0626	10	0.39692	T	0.17	-4.1066	17.896	0.88888	0.0:0.0:1.0:0.0	.	5227	Q09666	AHNK_HUMAN	S	5227	ENSP00000367263:P5227S	ENSP00000367263:P5227S	P	-	1	0	AHNAK	62042786	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.369000	0.44231	2.308000	0.77769	0.643000	0.83706	CCA	-	AHK	-	NULL		0.512	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHK	HGNC	protein_coding	OTTHUMT00000395572.1	0	0	0	43	43	117	0.00	0.00	G	NM_024060		62286210	-1	17	52	17	54	tier1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	50.00	49.06	SNP	1.000	A	17	17
FRMD1	79981	genome.wustl.edu	37	6	168464403	168464403	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:168464403G>A	ENST00000283309.6	-	6	746	c.682C>T	c.(682-684)Cgg>Tgg	p.R228W	FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_5'UTR|FRMD1_ENST00000440994.2_Missense_Mutation_p.R160W	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	228	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)		p.R228W(1)		endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		GGCATGTGCCGGAGGATGTAG	0.657													ENSG00000153303																									GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												1	Substitution - Missense(1)	ovary(1)											103.0	86.0	92.0					6																	168464403		2203	4300	6503	SO:0001583	missense	0			-		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.682C>T	6.37:g.168464403G>A	ENSP00000283309:p.Arg228Trp		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.R228W	ENST00000283309.6	37	c.682	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	11.08	1.532869	0.27387	.	.	ENSG00000153303	ENST00000283309;ENST00000440994	T;T	0.78707	-1.2;-1.2	2.83	0.191	0.15130	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.506221	0.18349	U	0.143925	T	0.77425	0.4128	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;P	0.65140	0.932;0.932;0.888	T	0.77104	-0.2711	10	0.87932	D	0	.	9.1883	0.37184	0.0:0.0:0.3699:0.6301	.	140;228;160	B7Z8G9;Q8N878;Q8N878-2	.;FRMD1_HUMAN;.	W	228;160	ENSP00000283309:R228W;ENSP00000414115:R160W	ENSP00000283309:R228W	R	-	1	2	FRMD1	168207252	0.549000	0.26481	0.003000	0.11579	0.137000	0.21094	-0.029000	0.12329	-0.172000	0.10779	0.305000	0.20034	CGG	-	FRMD1	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	0	0	0	30	30	59	0.00	0.00	G	NM_024919		168464403	-1	16	31	21	48	tier1	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	43.24	39.24	SNP	0.938	A	16	21
TEX10	54881	genome.wustl.edu	37	9	103109310	103109310	+	Missense_Mutation	SNP	C	C	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:103109310C>A	ENST00000374902.4	-	3	735	c.559G>T	c.(559-561)Gta>Tta	p.V187L	TEX10_ENST00000537512.1_Missense_Mutation_p.V122L|TEX10_ENST00000535814.1_Missense_Mutation_p.V190L	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	187						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		ATAAGTTCTACAAAATTCTTA	0.408													ENSG00000136891																																					0													67.0	71.0	70.0					9																	103109310		2203	4300	6503	SO:0001583	missense	0			-	AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.559G>T	9.37:g.103109310C>A	ENSP00000364037:p.Val187Leu		B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	pfam_IPI1/TEX10,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.V187L	ENST00000374902.4	37	c.559	CCDS6748.1	9	.	.	.	.	.	.	.	.	.	.	C	7.044	0.563062	0.13498	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000537512	T;T;T	0.61392	0.11;0.11;0.11	5.32	5.32	0.75619	Armadillo-like helical (1);Armadillo-type fold (1);	0.065999	0.64402	D	0.000007	T	0.33206	0.0855	N	0.03084	-0.415	0.45318	D	0.998312	B;B;B	0.21520	0.057;0.057;0.016	B;B;B	0.29942	0.109;0.066;0.049	T	0.25847	-1.0120	10	0.06494	T	0.89	-8.8888	13.9026	0.63815	0.1522:0.8478:0.0:0.0	.	122;190;187	B7Z9D5;B4DYV2;Q9NXF1	.;.;TEX10_HUMAN	L	190;187;122	ENSP00000444555:V190L;ENSP00000364037:V187L;ENSP00000438120:V122L	ENSP00000364037:V187L	V	-	1	0	TEX10	102149131	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.166000	0.50785	2.484000	0.83849	0.591000	0.81541	GTA	-	TEX10	-	pfam_IPI1/TEX10,superfamily_ARM-type_fold		0.408	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1	0	0	0	30	30	86	0.00	0.00	C	NM_017746		103109310	-1	16	41	11	40	tier1	no_errors	ENST00000374902	ensembl	human	known	74_37	missense	59.26	50.62	SNP	1.000	A	16	11
FUZ	80199	genome.wustl.edu	37	19	50315965	50315965	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:50315965T>C	ENST00000313777.4	-	2	303	c.140A>G	c.(139-141)aAt>aGt	p.N47S	FUZ_ENST00000445575.2_Missense_Mutation_p.N47S|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000526575.1_Missense_Mutation_p.N47S|FUZ_ENST00000534008.1_5'UTR|FUZ_ENST00000528094.1_Missense_Mutation_p.N47S|FUZ_ENST00000533418.1_5'UTR	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	47					cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		GTGGACTCCATTGAGGGAACC	0.572													ENSG00000010361																																					0													104.0	93.0	97.0					19																	50315965		2203	4300	6503	SO:0001583	missense	0			-	BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.140A>G	19.37:g.50315965T>C	ENSP00000313309:p.Asn47Ser		B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	NULL	p.N47S	ENST00000313777.4	37	c.140	CCDS12781.1	19	.	.	.	.	.	.	.	.	.	.	T	25.9	4.681243	0.88542	.	.	ENSG00000010361	ENST00000525130;ENST00000528094;ENST00000529634;ENST00000525370;ENST00000313777;ENST00000445575;ENST00000421740;ENST00000526575	T;T;T;T;T;T	0.72167	-0.46;-0.45;-0.46;-0.61;-0.63;-0.46	5.41	5.41	0.78517	.	0.055575	0.64402	D	0.000002	D	0.82939	0.5146	M	0.75085	2.285	0.49130	D	0.999754	D;D;D	0.89917	0.998;1.0;1.0	P;D;D	0.87578	0.879;0.996;0.998	D	0.85087	0.0949	10	0.87932	D	0	-11.0987	13.0152	0.58753	0.0:0.0:0.0:1.0	.	47;47;47	B4DHF8;Q9BT04-3;Q9BT04	.;.;FUZZY_HUMAN	S	47	ENSP00000433492:N47S;ENSP00000435177:N47S;ENSP00000431420:N47S;ENSP00000313309:N47S;ENSP00000408018:N47S;ENSP00000433164:N47S	ENSP00000313309:N47S	N	-	2	0	FUZ	55007777	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.324000	0.65863	2.076000	0.62316	0.374000	0.22700	AAT	-	FUZ	-	NULL		0.572	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUZ	HGNC	protein_coding	OTTHUMT00000393986.1	0	0	0	51	51	99	0.00	0.00	T	NM_025129		50315965	-1	21	32	24	46	tier1	no_errors	ENST00000313777	ensembl	human	known	74_37	missense	46.67	41.03	SNP	1.000	C	21	24
TLN2	83660	genome.wustl.edu	37	15	63055879	63055879	+	Silent	SNP	C	C	T	rs370731939		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr15:63055879C>T	ENST00000561311.1	+	39	5309	c.5079C>T	c.(5077-5079)gaC>gaT	p.D1693D	TLN2_ENST00000472902.1_Silent_p.D86D|TLN2_ENST00000306829.6_Silent_p.D1693D			Q9Y4G6	TLN2_HUMAN	talin 2	1693					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CCACGAGGGACGACATCTCTG	0.572													ENSG00000171914																																					0													28.0	26.0	27.0					15																	63055879		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5079C>T	15.37:g.63055879C>T			A6NLB8	Silent	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.D1693	ENST00000561311.1	37	c.5079	CCDS32261.1	15																																																																																			-	TLN2	-	superfamily_Vinculin/catenin		0.572	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	0	0	1	33	33	89	0.00	1.11	C			63055879	+1	23	54	12	43	tier1	no_errors	ENST00000306829	ensembl	human	known	74_37	silent	65.71	55.67	SNP	0.962	T	23	12
MOSPD1	56180	genome.wustl.edu	37	X	134033514	134033514	+	5'UTR	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:134033514A>C	ENST00000370783.3	-	0	136				MOSPD1_ENST00000370777.1_5'UTR|MOSPD1_ENST00000370779.4_5'UTR|MOSPD1_ENST00000491609.1_5'UTR	NM_019556.1	NP_062456.1	Q9UJG1	MSPD1_HUMAN	motile sperm domain containing 1						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)	9	Acute lymphoblastic leukemia(192;0.000127)					TCTCAAATCTATTTTGGACTT	0.368													ENSG00000101928																																					0													61.0	63.0	62.0					X																	134033514		2200	4299	6499	SO:0001623	5_prime_UTR_variant	0			-	Z83826	CCDS14645.1	Xq26.3	2008-02-05			ENSG00000101928	ENSG00000101928			25235	protein-coding gene	gene with protein product		300674				15533722	Standard	XM_005262446		Approved	dJ473B4	uc004eyb.3	Q9UJG1	OTTHUMG00000035315	ENST00000370783.3:c.-51T>G	X.37:g.134033514A>C			B2RE62|D3DTG5|Q5H9C5|Q5H9C7	R	SNP	-	NULL	ENST00000370783.3	37	NULL	CCDS14645.1	X																																																																																			-	MOSPD1	-	-		0.368	MOSPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MOSPD1	HGNC	protein_coding	OTTHUMT00000085439.1	0	0	0	65	65	100	0.00	0.00	A	NM_019556		134033514	-1	29	53	23	58	tier1	no_errors	ENST00000462060	ensembl	human	known	74_37	rna	55.77	47.75	SNP	0.873	C	29	23
LOC643201	643201	genome.wustl.edu	37	5	175583878	175583878	+	lincRNA	SNP	G	G	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:175583878G>T	ENST00000515403.1	-	0	1426				RP11-826N14.4_ENST00000510029.1_lincRNA	NR_036494.1																						CAGATCTCAAGTCTTCAGTCA	0.428													ENSG00000248596																																					0																																												0			-																													5.37:g.175583878G>T				R	SNP	-	NULL	ENST00000515403.1	37	NULL		5																																																																																			-	RP11-844P9.2	-	-		0.428	RP11-844P9.2-001	KNOWN	basic	lincRNA	LOC643201	Clone_based_vega_gene	lincRNA	OTTHUMT00000371986.1	0	0	0	48	48	128	0.00	0.00	G			175583878	-1	4	23	37	118	tier1	no_errors	ENST00000515403	ensembl	human	known	74_37	rna	9.76	16.20	SNP	0.940	T	4	37
SLC7A9	11136	genome.wustl.edu	37	19	33349358	33349358	+	Missense_Mutation	SNP	A	A	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:33349358A>C	ENST00000023064.4	-	9	1156	c.965T>G	c.(964-966)tTc>tGc	p.F322C	SLC7A9_ENST00000590341.1_Missense_Mutation_p.F322C|SLC7A9_ENST00000587772.1_Missense_Mutation_p.F322C	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	322					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	GCCCGCTGTGAAGCAGGTCCC	0.552													ENSG00000021488																									GBM(181;1335 2108 9644 44178 46689)												0													73.0	59.0	64.0					19																	33349358		2203	4300	6503	SO:0001583	missense	0			-	AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.965T>G	19.37:g.33349358A>C	ENSP00000023064:p.Phe322Cys		B2R9A6	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.F322C	ENST00000023064.4	37	c.965	CCDS12425.1	19	.	.	.	.	.	.	.	.	.	.	A	22.6	4.310662	0.81358	.	.	ENSG00000021488	ENST00000023064	D	0.90620	-2.7	5.36	5.36	0.76844	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.97210	0.9088	H	0.98048	4.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98748	1.0719	10	0.87932	D	0	.	15.3624	0.74487	1.0:0.0:0.0:0.0	.	322;322	Q53FY4;P82251	.;BAT1_HUMAN	C	322	ENSP00000023064:F322C	ENSP00000023064:F322C	F	-	2	0	SLC7A9	38041198	1.000000	0.71417	0.704000	0.30370	0.895000	0.52256	9.310000	0.96267	2.048000	0.60808	0.379000	0.24179	TTC	-	SLC7A9	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1		0.552	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	HGNC	protein_coding	OTTHUMT00000450585.1	0	0	0	37	37	82	0.00	0.00	A			33349358	-1	8	23	17	46	tier1	no_errors	ENST00000023064	ensembl	human	known	74_37	missense	32.00	33.33	SNP	1.000	C	8	17
CENPU	79682	genome.wustl.edu	37	4	185652114	185652114	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:185652114C>T	ENST00000281453.5	-	2	126	c.56G>A	c.(55-57)cGt>cAt	p.R19H	MLF1IP_ENST00000541971.1_Missense_Mutation_p.R19H	NM_024629.3	NP_078905.2														endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|stomach(1)	13		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Hepatocellular(41;0.000519)|Colorectal(36;0.00172)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.0299)|all_hematologic(60;0.0592)|Medulloblastoma(177;0.146)		all cancers(43;7.83e-28)|Epithelial(43;2.56e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.5e-11)|Colorectal(24;3.27e-06)|STAD - Stomach adenocarcinoma(60;2.66e-05)|GBM - Glioblastoma multiforme(59;3.16e-05)|BRCA - Breast invasive adenocarcinoma(30;0.000252)|COAD - Colon adenocarcinoma(29;0.000512)|LUSC - Lung squamous cell carcinoma(40;0.01)|READ - Rectum adenocarcinoma(43;0.0419)		GTTCTTTGAACGTCTTGCGCT	0.323													ENSG00000151725																																					0													109.0	102.0	104.0					4																	185652114		2202	4298	6500	SO:0001583	missense	0			-																												ENST00000281453.5:c.56G>A	4.37:g.185652114C>T	ENSP00000281453:p.Arg19His			Missense_Mutation	SNP	NULL	p.R19H	ENST00000281453.5	37	c.56	CCDS3838.1	4	.	.	.	.	.	.	.	.	.	.	c	3.081	-0.188996	0.06299	.	.	ENSG00000151725	ENST00000281453;ENST00000541665;ENST00000541971	T;T	0.14766	2.5;2.48	4.09	-8.18	0.01053	.	3.824880	0.00520	N	0.000191	T	0.05593	0.0147	N	0.12182	0.205	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.0	T	0.30387	-0.9980	10	0.12430	T	0.62	-15.7673	3.2582	0.06839	0.0982:0.2218:0.398:0.282	.	19;19	Q09GN1;Q71F23	.;CENPU_HUMAN	H	19	ENSP00000281453:R19H;ENSP00000445862:R19H	ENSP00000281453:R19H	R	-	2	0	MLF1IP	185889108	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.289000	0.02780	-2.766000	0.00367	-1.088000	0.02184	CGT	-	MLF1IP	-	NULL		0.323	MLF1IP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLF1IP	HGNC	protein_coding	OTTHUMT00000360841.2	0	0	0	86	86	104	0.00	0.00	C			185652114	-1	8	17	35	89	tier1	no_errors	ENST00000281453	ensembl	human	known	74_37	missense	18.60	16.04	SNP	0.000	T	8	35
PPP2R2A	5520	genome.wustl.edu	37	8	26218555	26218555	+	Silent	SNP	T	T	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:26218555T>G	ENST00000380737.3	+	6	854	c.525T>G	c.(523-525)gcT>gcG	p.A175A	PPP2R2A_ENST00000315985.7_Silent_p.A185A	NM_002717.3	NP_002708.1	P63151	2ABA_HUMAN	protein phosphatase 2, regulatory subunit B, alpha	175					G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|response to morphine (GO:0043278)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(1)|large_intestine(2)|ovary(1)	4		all_cancers(63;0.086)|Ovarian(32;2.61e-05)|all_epithelial(46;0.0514)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.000754)|Epithelial(17;3.02e-15)|all cancers(2;1.52e-13)|OV - Ovarian serous cystadenocarcinoma(2;1.89e-10)|Colorectal(74;0.155)		TTGCCAATGCTCATACATATC	0.353													ENSG00000221914																																					0													149.0	144.0	146.0					8																	26218555		2203	4300	6503	SO:0001819	synonymous_variant	0			-	M64929	CCDS34867.1, CCDS55213.1	8p21.2	2013-01-10	2010-04-14		ENSG00000221914	ENSG00000221914	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9304	protein-coding gene	gene with protein product	"""PP2A subunit B isoform alpha"""	604941	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, alpha isoform"""			1849734	Standard	NM_001177591		Approved	PR52A, PR55A, B55A		P63151	OTTHUMG00000163850	ENST00000380737.3:c.525T>G	8.37:g.26218555T>G			B2RBU8|B4E1T7|P50409|Q00007	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.A175	ENST00000380737.3	37	c.525	CCDS34867.1	8																																																																																			-	PPP2R2A	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55		0.353	PPP2R2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2A	HGNC	protein_coding	OTTHUMT00000375954.2	0	0	0	82	82	102	0.00	0.00	T	NM_002717		26218555	+1	27	46	40	52	tier1	no_errors	ENST00000380737	ensembl	human	known	74_37	silent	40.30	46.94	SNP	0.997	G	27	40
OR1S1	219959	genome.wustl.edu	37	11	57982690	57982690	+	Silent	SNP	A	A	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:57982690A>T	ENST00000309433.6	+	1	474	c.474A>T	c.(472-474)acA>acT	p.T158T		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TTTTGCTCACAGTCATCTCAT	0.468													ENSG00000172774																																					0													213.0	201.0	205.0					11																	57982690		2201	4296	6497	SO:0001819	synonymous_variant	0			-	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.474A>T	11.37:g.57982690A>T			Q6IFG3	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T158	ENST00000309433.6	37	c.474	CCDS31546.1	11																																																																																			-	OR1S1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.468	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	HGNC	protein_coding	OTTHUMT00000394705.1	0	0	0	43	43	108	0.00	0.00	A	NM_001004458		57982690	+1	27	44	10	49	tier1	no_errors	ENST00000309433	ensembl	human	known	74_37	silent	72.97	47.31	SNP	0.000	T	27	10
ETAA1	54465	genome.wustl.edu	37	2	67631536	67631539	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TTCT	TTCT	TTCT	-	TTCT	TTCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:67631536_67631539delTTCT	ENST00000272342.5	+	5	1852_1855	c.1722_1725delTTCT	c.(1720-1725)ggttctfs	p.GS574fs	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	574						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						CAAAAGTAGGTTCTTTCTTTGATG	0.358													ENSG00000143971																																					0																																										SO:0001589	frameshift_variant	0				AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.1722_1725delTTCT	2.37:g.67631540_67631543delTTCT	ENSP00000272342:p.Gly574fs		Q05BT7|Q53SC4	Frame_Shift_Del	DEL	NULL	p.F576fs	ENST00000272342.5	37	c.1722_1725	CCDS1882.1	2																																																																																				ETAA1	-	NULL		0.358	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	0	0	0	20	20	145	0.00	0.00	TTCT	NM_019002		67631539	+1	5	56	16	79	tier1	no_errors	ENST00000272342	ensembl	human	known	74_37	frame_shift_del	23.81	41.48	DEL	0.011:0.116:0.932:0.987	-	5	16
HYLS1	219844	genome.wustl.edu	37	11	125770156	125770158	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CTT	CTT	CTT	-	CTT	CTT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:125770156_125770158delCTT	ENST00000425380.2	+	3	1674_1676	c.893_895delCTT	c.(892-897)ccttct>cct	p.S299del	RP11-680F20.9_ENST00000533033.2_RNA|PUS3_ENST00000227474.3_Intron|HYLS1_ENST00000526028.1_In_Frame_Del_p.S299del|HYLS1_ENST00000356438.3_In_Frame_Del_p.S299del	NM_001134793.1	NP_001128265.1	Q96M11	HYLS1_HUMAN	hydrolethalus syndrome 1	299						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|skin(3)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0446)		CCTCTTTCTCCTTCTTAAATCTT	0.409													ENSG00000198331																									Esophageal Squamous(172;2590 2636 8884 10471)												0									,,	0,4264		0,0,2132					,,	5.3	1.0			69	1,8253		0,1,4126	no	coding,intron,coding	PUS3,HYLS1	NM_145014.2,NM_031307.3,NM_001134793.1	,,	0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080	,,	,,		1,12517				SO:0001651	inframe_deletion	0				AK057477	CCDS8467.1	11q24	2014-06-18				ENSG00000198331			26558	protein-coding gene	gene with protein product		610693				15843405	Standard	NM_145014		Approved	FLJ32915	uc009zbv.3	Q96M11		ENST00000425380.2:c.893_895delCTT	11.37:g.125770159_125770161delCTT	ENSP00000414884:p.Ser299del		B3KXI8|Q96BX9	In_Frame_Del	DEL	NULL	p.S299in_frame_del	ENST00000425380.2	37	c.893_895	CCDS8467.1	11																																																																																				HYLS1	-	NULL		0.409	HYLS1-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HYLS1	HGNC	protein_coding	OTTHUMT00000386733.1	0	0	0	52	52	95	0.00	0.00	CTT	NM_145014		125770158	+1	20	58	18	67	tier1	no_errors	ENST00000356438	ensembl	human	known	74_37	in_frame_del	52.63	46.40	DEL	1.000:1.000:1.000	-	20	18
TRIM52	84851	genome.wustl.edu	37	5	180687743	180687746	+	Frame_Shift_Del	DEL	CAAG	CAAG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CAAG	CAAG	CAAG	-	CAAG	CAAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr5:180687743_180687746delCAAG	ENST00000327767.4	-	1	373_376	c.69_72delCTTG	c.(67-72)tgcttgfs	p.CL23fs	TRIM52-AS1_ENST00000433265.3_RNA|TRIM52-AS1_ENST00000514146.1_RNA|CTC-338M12.4_ENST00000511331.1_RNA|TRIM52_ENST00000514805.1_5'UTR|TRIM52-AS1_ENST00000507434.1_RNA|TRIM52-AS1_ENST00000509252.1_RNA	NM_032765.2	NP_116154.1	Q96A61	TRI52_HUMAN	tripartite motif containing 52	23					positive regulation of NF-kappaB transcription factor activity (GO:0051092)	intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)|stomach(1)	8	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.0106)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0588)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.232)		TGAAGTAATCCAAGCAGATGGCAC	0.578													ENSG00000183718																																					0																																										SO:0001589	frameshift_variant	0					CCDS4467.1	5q35.3	2013-01-09	2011-01-25		ENSG00000183718	ENSG00000183718		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19024	protein-coding gene	gene with protein product			"""tripartite motif-containing 52"""				Standard	NM_032765		Approved	RNF102	uc003mnp.3	Q96A61	OTTHUMG00000130964	ENST00000327767.4:c.69_72delCTTG	5.37:g.180687743_180687746delCAAG	ENSP00000332152:p.Cys23fs			Frame_Shift_Del	DEL	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.C23fs	ENST00000327767.4	37	c.72_69	CCDS4467.1	5																																																																																				TRIM52	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.578	TRIM52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM52	HGNC	protein_coding	OTTHUMT00000253572.3	0	0	0	40	40	104	0.00	0.00	CAAG	NM_032765		180687746	-1	14	33	19	48	tier1	no_errors	ENST00000327767	ensembl	human	known	74_37	frame_shift_del	42.42	40.74	DEL	1.000:1.000:1.000:1.000	-	14	19
NPDC1	56654	genome.wustl.edu	37	9	139935530	139935531	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:139935530_139935531delCT	ENST00000371601.4	-	3	581_582	c.368_369delAG	c.(367-369)cagfs	p.Q123fs	NPDC1_ENST00000488145.1_5'UTR|NPDC1_ENST00000371600.3_Frame_Shift_Del_p.Q201fs	NM_015392.3	NP_056207.3	Q9NQX5	NPDC1_HUMAN	neural proliferation, differentiation and control, 1	123						integral component of membrane (GO:0016021)				NS(1)|large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	5	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		CCGGGAGCCGCTGTCGGTCCTT	0.653													ENSG00000107281																																					0																																										SO:0001589	frameshift_variant	0				AF285836	CCDS7024.1	9q34.3	2008-07-21			ENSG00000107281	ENSG00000107281			7899	protein-coding gene	gene with protein product		605798				11245976	Standard	NM_015392		Approved	DKFZp586J0523, CAB-, CAB1	uc004ckt.2	Q9NQX5	OTTHUMG00000020956	ENST00000371601.4:c.368_369delAG	9.37:g.139935530_139935531delCT	ENSP00000360660:p.Gln123fs		Q5SPY8|Q9BTD6|Q9BXT3|Q9NQS2|Q9Y434	Frame_Shift_Del	DEL	pfam_NPDC1	p.Q201fs	ENST00000371601.4	37	c.603_602	CCDS7024.1	9																																																																																				NPDC1	-	pfam_NPDC1		0.653	NPDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPDC1	HGNC	protein_coding	OTTHUMT00000055182.1	0	0	0	84	84	49	0.00	0.00	CT	NM_015392		139935531	-1	27	11	34	16	tier1	no_errors	ENST00000371600	ensembl	human	known	74_37	frame_shift_del	44.26	40.74	DEL	0.001:0.001	-	27	34
RSL1D1	26156	genome.wustl.edu	37	16	11941583	11941584	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:11941583_11941584delTT	ENST00000571133.1	-	3	397_398	c.325_326delAA	c.(325-327)aagfs	p.K109fs	RSL1D1_ENST00000542106.1_5'UTR	NM_015659.2	NP_056474.2	O76021	RL1D1_HUMAN	ribosomal L1 domain containing 1	109					osteoblast differentiation (GO:0001649)|regulation of apoptotic process (GO:0042981)|regulation of cellular senescence (GO:2000772)|regulation of protein localization (GO:0032880)	membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	15						CTGTTCTGTCTTTTCAGGAGTT	0.337													ENSG00000171490																																					0																																										SO:0001589	frameshift_variant	0				AY154473	CCDS10551.1	16p13.13	2011-08-12			ENSG00000171490	ENSG00000171490			24534	protein-coding gene	gene with protein product		615874				15334068, 9859858	Standard	NM_015659		Approved	PBK1, L12, DKFZP564M182, CSIG, UTP30	uc002dbp.1	O76021	OTTHUMG00000129824	ENST00000571133.1:c.325_326delAA	16.37:g.11941585_11941586delTT	ENSP00000460871:p.Lys109fs		B4DJ58|D3DUG7|Q2M1T7|Q6PL22|Q8IWS7|Q8WUZ1|Q9HDA9|Q9Y3Z9	Frame_Shift_Del	DEL	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like	p.K109fs	ENST00000571133.1	37	c.326_325	CCDS10551.1	16																																																																																				RSL1D1	-	pfam_Ribosomal_L1/biogenesis,superfamily_Ribosomal_L1-like		0.337	RSL1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSL1D1	HGNC	protein_coding	OTTHUMT00000252059.2	0	0	0	68	68	130	0.00	0.00	TT	NM_015659		11941584	-1	29	104	31	60	tier1	no_errors	ENST00000571133	ensembl	human	known	74_37	frame_shift_del	48.33	63.41	DEL	0.995:0.892	-	29	31
PRKAR2B	5577	genome.wustl.edu	37	7	106786808	106786809	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TA	TA	TA	-	TA	TA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:106786808_106786809delTA	ENST00000265717.4	+	6	902_903	c.643_644delTA	c.(643-645)tatfs	p.Y215fs		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	215					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						TGTTGGTAACTATGATAATCGT	0.416													ENSG00000005249																																					0																																										SO:0001589	frameshift_variant	0					CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.643_644delTA	7.37:g.106786808_106786809delTA	ENSP00000265717:p.Tyr215fs		A4D0R9	Frame_Shift_Del	DEL	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.Y215fs	ENST00000265717.4	37	c.643_644	CCDS5740.1	7																																																																																				PRKAR2B	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom		0.416	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR2B	HGNC	protein_coding	OTTHUMT00000268386.1	0	0	0	84	84	175	0.00	0.00	TA			106786809	+1	24	49	37	95	tier1	no_errors	ENST00000265717	ensembl	human	known	74_37	frame_shift_del	39.34	34.03	DEL	1.000:1.000	-	24	37
IRF3	3661	genome.wustl.edu	37	19	50165229	50165230	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AC	AC	AC	-	AC	AC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr19:50165229_50165230delAC	ENST00000597198.1	-	6	1338_1339	c.957_958delGT	c.(955-960)gtgtttfs	p.F320fs	IRF3_ENST00000599680.1_5'Flank|IRF3_ENST00000599144.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000596822.1_Intron|IRF3_ENST00000309877.7_Frame_Shift_Del_p.F320fs|IRF3_ENST00000600911.1_Frame_Shift_Del_p.F320fs|IRF3_ENST00000593922.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000596765.1_Intron|IRF3_ENST00000599223.1_Intron|IRF3_ENST00000377135.4_Intron|IRF3_ENST00000598808.1_Frame_Shift_Del_p.F174fs|IRF3_ENST00000377139.3_Frame_Shift_Del_p.F320fs|IRF3_ENST00000601291.1_Frame_Shift_Del_p.F320fs|IRF3_ENST00000600022.1_Intron			Q14653	IRF3_HUMAN	interferon regulatory factor 3	320	Involved in HERC5 binding.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dsRNA (GO:0071359)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage apoptotic process (GO:0071888)|MDA-5 signaling pathway (GO:0039530)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of defense response to virus by host (GO:0050689)|negative regulation of interferon-beta biosynthetic process (GO:0045358)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|programmed necrotic cell death (GO:0097300)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(2)|lung(4)|ovary(2)|stomach(1)	10		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.02)		CCCAGGTCAAACACGCCTCCTT	0.609													ENSG00000126456																																					0																																										SO:0001589	frameshift_variant	0					CCDS12775.1, CCDS56099.1, CCDS59407.1, CCDS59408.1, CCDS59409.1	19q13.3-q13.4	2008-07-16				ENSG00000126456			6118	protein-coding gene	gene with protein product		603734				8524823	Standard	NM_001571		Approved		uc002pow.3	Q14653		ENST00000597198.1:c.957_958delGT	19.37:g.50165231_50165232delAC	ENSP00000469113:p.Phe320fs		A8K7L2|B2RAZ3|Q5FBY1|Q5FBY2|Q5FBY4|Q7Z5G6	Frame_Shift_Del	DEL	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_D-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_D-bd_dom,prints_Interferon_reg_fact_D-bd_dom	p.F320fs	ENST00000597198.1	37	c.958_957	CCDS12775.1	19																																																																																				IRF3	-	pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain		0.609	IRF3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IRF3	HGNC	protein_coding	OTTHUMT00000465962.1	0	0	0	67	67	118	0.00	0.00	AC	NM_001571		50165230	-1	21	23	28	44	tier1	no_errors	ENST00000309877	ensembl	human	known	74_37	frame_shift_del	42.86	34.33	DEL	0.004:0.003	-	21	28
ATRX	546	genome.wustl.edu	37	X	76939473	76939474	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chrX:76939473_76939474delTT	ENST00000373344.5	-	9	1488_1489	c.1274_1275delAA	c.(1273-1275)aaafs	p.K425fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.K387fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	425					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATTTTTCTCTTTGTTTACAGC	0.361			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome						ENSG00000085224																												Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)																																								SO:0001589	frameshift_variant	0				U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1274_1275delAA	X.37:g.76939473_76939474delTT	ENSP00000362441:p.Lys425fs		D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K425fs	ENST00000373344.5	37	c.1275_1274	CCDS14434.1	X																																																																																				ATRX	-	NULL		0.361	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	0	0	0	53	53	150	0.00	0.00	TT	NM_000489		76939474	-1	15	66	3	27	tier1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	83.33	70.97	DEL	0.312:0.307	-	15	3
UGGT1	56886	genome.wustl.edu	37	2	128900693	128900694	+	Frame_Shift_Del	DEL	AA	AA	-	rs142665549	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AA	AA	AA	-	AA	AA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr2:128900693_128900694delAA	ENST00000259253.6	+	17	1792_1793	c.1745_1746delAA	c.(1744-1746)gaafs	p.E582fs	UGGT1_ENST00000375990.3_Frame_Shift_Del_p.E558fs	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	582					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						AGGACTGGAGAAAAAGTGAAAG	0.351													ENSG00000136731																																					0																																										SO:0001589	frameshift_variant	0				AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.1745_1746delAA	2.37:g.128900695_128900696delAA	ENSP00000259253:p.Glu582fs		Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Frame_Shift_Del	DEL	pfam_UDP-g_GGtrans	p.K583fs	ENST00000259253.6	37	c.1745_1746	CCDS2154.1	2																																																																																				UGGT1	-	NULL		0.351	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	0	0	0	99	99	114	0.00	0.00	AA	NM_020120		128900694	+1	19	64	25	86	tier1	no_errors	ENST00000259253	ensembl	human	known	74_37	frame_shift_del	43.18	42.67	DEL	0.996:0.531	-	19	25
AFM	173	genome.wustl.edu	37	4	74347514	74347514	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:74347514delG	ENST00000226355.3	+	1	115	c.22delG	c.(22-24)ggtfs	p.G8fs		NM_001133.2	NP_001124.1	P43652	AFAM_HUMAN	afamin	8					vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	vitamin E binding (GO:0008431)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	Breast(15;0.00102)		Epithelial(6;5.69e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|all cancers(17;0.000555)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAAACTTACAGGTTTTATTTT	0.308													ENSG00000079557																																					0													37.0	40.0	39.0					4																	74347514		2190	4277	6467	SO:0001589	frameshift_variant	0				L32140	CCDS3557.1	4q13.3	2008-06-11			ENSG00000079557	ENSG00000079557			316	protein-coding gene	gene with protein product		104145				7517938	Standard	NM_001133		Approved	ALB2, ALBA	uc003hhb.3	P43652	OTTHUMG00000130004	ENST00000226355.3:c.22delG	4.37:g.74347514delG	ENSP00000226355:p.Gly8fs		A8K3E1|Q32MR3|Q4W5C5	Frame_Shift_Del	DEL	pirsf_Serum_albumin/AFP,pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_ALB/AFP/VDB,prints_Alpha-fetoprotein	p.G8fs	ENST00000226355.3	37	c.22	CCDS3557.1	4																																																																																				AFM	-	pirsf_Serum_albumin/AFP		0.308	AFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFM	HGNC	protein_coding	OTTHUMT00000252275.2	0	0	0	99	99	82	0.00	0.00	G			74347514	+1	16	34	35	44	tier1	no_errors	ENST00000226355	ensembl	human	known	74_37	frame_shift_del	31.37	43.59	DEL	0.856	-	16	35
TADA3	10474	genome.wustl.edu	37	3	9827049	9827050	+	Frame_Shift_Del	DEL	CT	CT	-	rs377606064		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:9827049_9827050delCT	ENST00000301964.2	-	7	1428_1429	c.870_871delAG	c.(868-873)tcagggfs	p.G291fs	TADA3_ENST00000343450.2_Frame_Shift_Del_p.G291fs|TADA3_ENST00000440161.1_Frame_Shift_Del_p.G291fs	NM_006354.2	NP_006345.1	O75528	TADA3_HUMAN	transcriptional adaptor 3	291					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|intracellular estrogen receptor signaling pathway (GO:0030520)|mitotic nuclear division (GO:0007067)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of histone deacetylation (GO:0031063)|regulation of protein phosphorylation (GO:0001932)|regulation of protein stability (GO:0031647)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of tubulin deacetylation (GO:0090043)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|intracellular (GO:0005622)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16						CCGTCAGCCCCTGATTCTTTCC	0.5													ENSG00000171148																																					0																																										SO:0001589	frameshift_variant	0				AF069733	CCDS2583.1, CCDS2584.1	3p25.3	2010-08-13	2009-10-02	2009-10-02	ENSG00000171148	ENSG00000171148			19422	protein-coding gene	gene with protein product		602945	"""transcriptional adaptor 3 (NGG1 homolog, yeast)-like"""	TADA3L		9674425, 11707411	Standard	NM_006354		Approved	FLJ20221, FLJ21329, ADA3, hADA3, NGG1	uc010hcn.2	O75528	OTTHUMG00000128440	ENST00000301964.2:c.870_871delAG	3.37:g.9827049_9827050delCT	ENSP00000307684:p.Gly291fs		Q6FI83|Q9UFS2	Frame_Shift_Del	DEL	pfam_Histone_AcTrfase_su3	p.A292fs	ENST00000301964.2	37	c.871_870	CCDS2583.1	3																																																																																				TADA3	-	NULL		0.500	TADA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA3	HGNC	protein_coding	OTTHUMT00000250236.1	0	0	0	85	85	111	0.00	0.00	CT			9827050	-1	12	44	24	61	tier1	no_errors	ENST00000301964	ensembl	human	known	74_37	frame_shift_del	33.33	41.90	DEL	0.617:0.028	-	12	24
MICALL1	85377	genome.wustl.edu	37	22	38323604	38323605	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	CT	CT	CT	-	CT	CT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr22:38323604_38323605delCT	ENST00000215957.6	+	9	1778_1779	c.1652_1653delCT	c.(1651-1653)cctfs	p.P551fs	MICALL1_ENST00000402631.1_3'UTR	NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	551	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					CCTGGAAACCCTGTCAGCCTCT	0.629													ENSG00000100139																																					0																																										SO:0001589	frameshift_variant	0				BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.1652_1653delCT	22.37:g.38323604_38323605delCT	ENSP00000215957:p.Pro551fs		Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Frame_Shift_Del	DEL	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.P551fs	ENST00000215957.6	37	c.1652_1653	CCDS13961.1	22																																																																																				MICALL1	-	NULL		0.629	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL1	HGNC	protein_coding	OTTHUMT00000319545.4	0	0	0	129	129	107	0.00	0.00	CT	NM_033386		38323605	+1	52	46	8	10	tier1	no_errors	ENST00000215957	ensembl	human	known	74_37	frame_shift_del	86.67	82.14	DEL	0.572:0.475	-	52	8
TOPAZ1	375337	genome.wustl.edu	37	3	44346765	44346766	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TA	TA	TA	-	TA	TA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:44346765_44346766delTA	ENST00000309765.4	+	14	4159_4160	c.3991_3992delTA	c.(3991-3993)tatfs	p.Y1331fs		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	1331						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										CACAAAAAACTATGAAGATGAA	0.342													ENSG00000173769																																					0																																										SO:0001589	frameshift_variant	0				AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.3991_3992delTA	3.37:g.44346765_44346766delTA	ENSP00000310303:p.Tyr1331fs			Frame_Shift_Del	DEL	NULL	p.Y1331fs	ENST00000309765.4	37	c.3991_3992	CCDS46809.1	3																																																																																				TOPAZ1	-	NULL		0.342	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPAZ1	HGNC	protein_coding	OTTHUMT00000343247.1	0	0	0	60	60	149	0.00	0.00	TA	NM_001145030		44346766	+1	12	74	27	89	tier1	no_errors	ENST00000309765	ensembl	human	known	74_37	frame_shift_del	30.77	45.40	DEL	0.462:0.000	-	12	27
MGME1	92667	genome.wustl.edu	37	20	17956397	17956398	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr20:17956397_17956398delAG	ENST00000377710.5	+	3	870_871	c.582_583delAG	c.(580-585)aaagagfs	p.E195fs	MGME1_ENST00000377709.1_Frame_Shift_Del_p.E115fs|MGME1_ENST00000377704.4_Intron|MGME1_ENST00000467391.1_Intron	NM_052865.2	NP_443097.1			mitochondrial genome maintenance exonuclease 1																		AAACCTTAAAAGAGAGAGATGA	0.436													ENSG00000125871																																					0																																										SO:0001589	frameshift_variant	0					CCDS13131.1	20p11.23	2013-08-29	2013-01-11	2013-01-11	ENSG00000125871	ENSG00000125871			16205	protein-coding gene	gene with protein product		615076	"""chromosome 20 open reading frame 72"""	C20orf72		23313956, 23358826, 23434322	Standard	NM_052865		Approved	bA504H3.4, DDK1	uc002wqh.3	Q9BQP7	OTTHUMG00000031955	ENST00000377710.5:c.582_583delAG	20.37:g.17956403_17956404delAG	ENSP00000366939:p.Glu195fs			Frame_Shift_Del	DEL	superfamily_Restrct_endonuc-II-like	p.D197fs	ENST00000377710.5	37	c.582_583	CCDS13131.1	20																																																																																				MGME1	-	NULL		0.436	MGME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGME1	HGNC	protein_coding	OTTHUMT00000078139.1	0	0	0	53	53	146	0.00	0.00	AG	NM_052865		17956398	+1	17	56	36	68	tier1	no_errors	ENST00000377710	ensembl	human	known	74_37	frame_shift_del	32.08	45.16	DEL	0.395:0.212	-	17	36
ATMIN	23300	genome.wustl.edu	37	16	81077734	81077735	+	Frame_Shift_Del	DEL	AT	AT	-	rs535702865|rs541174089	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AT	AT	AT	-	AT	AT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:81077734_81077735delAT	ENST00000299575.4	+	4	1655_1656	c.1631_1632delAT	c.(1630-1632)catfs	p.H544fs	ATMIN_ENST00000564241.1_Frame_Shift_Del_p.H388fs|ATMIN_ENST00000566488.1_Frame_Shift_Del_p.H388fs|ATMIN_ENST00000539819.1_3'UTR	NM_015251.2	NP_056066.2	O43313	ATMIN_HUMAN	ATM interactor	544					cellular response to DNA damage stimulus (GO:0006974)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dynein binding (GO:0045502)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	20						ACAGTAACTCATAGTTTGTTAC	0.356													ENSG00000166454																																					0																																										SO:0001589	frameshift_variant	0				BC002701	CCDS32494.1, CCDS73917.1	16q23.2	2013-01-07			ENSG00000166454	ENSG00000166454		"""Zinc fingers, C2H2-type"""	29034	protein-coding gene	gene with protein product	"""ATM/ATR-Substrate Chk2-Interacting Zn++-finger protein"", ""ATM INteracting protein"""	614693				15933716, 17525732, 19001856	Standard	XM_005255866		Approved	ASCIZ, KIAA0431, ZNF822	uc002ffz.1	O43313	OTTHUMG00000176469	ENST00000299575.4:c.1631_1632delAT	16.37:g.81077734_81077735delAT	ENSP00000299575:p.His544fs		A8K4H8|Q68DC9	Frame_Shift_Del	DEL	smart_Znf_C2H2-like	p.H544fs	ENST00000299575.4	37	c.1631_1632	CCDS32494.1	16																																																																																				ATMIN	-	NULL		0.356	ATMIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATMIN	HGNC	protein_coding	OTTHUMT00000432140.1	0	0	0	50	50	15	0.00	0.00	AT	NM_015251		81077735	+1	9	10	20	3	tier1	no_errors	ENST00000299575	ensembl	human	known	74_37	frame_shift_del	31.03	76.92	DEL	0.052:0.000	-	9	20
COQ9	57017	genome.wustl.edu	37	16	57493517	57493519	+	In_Frame_Del	DEL	ACA	ACA	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	ACA	ACA	ACA	-	ACA	ACA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:57493517_57493519delACA	ENST00000262507.6	+	7	821_823	c.752_754delACA	c.(751-756)tacaac>tac	p.N252del	COQ9_ENST00000567072.1_In_Frame_Del_p.N217del|POLR2C_ENST00000219252.5_5'Flank|AC009052.12_ENST00000567090.1_RNA|COQ9_ENST00000567933.1_In_Frame_Del_p.N141del	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	252					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						GCTGCCATCTACAACACAACAGA	0.532													ENSG00000088682																																					0																																										SO:0001651	inframe_deletion	0				BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.752_754delACA	16.37:g.57493520_57493522delACA	ENSP00000262507:p.Asn252del		A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	In_Frame_Del	DEL	pfam_COQ9,superfamily_Homeodomain-like,tigrfam_Ubiq_biosynth_COQ9	p.N252in_frame_del	ENST00000262507.6	37	c.752_754	CCDS32459.1	16																																																																																				COQ9	-	pfam_COQ9,tigrfam_Ubiq_biosynth_COQ9		0.532	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ9	HGNC	protein_coding	OTTHUMT00000432598.3	0	0	0	36	36	69	0.00	0.00	ACA	NM_020312		57493519	+1	18	22	5	7	tier1	no_errors	ENST00000262507	ensembl	human	known	74_37	in_frame_del	78.26	75.86	DEL	1.000:1.000:1.000	-	18	5
LETM1	3954	genome.wustl.edu	37	4	1824837	1824837	+	Missense_Mutation	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr4:1824837C>T	ENST00000302787.2	-	9	1650	c.1354G>A	c.(1354-1356)Gtg>Atg	p.V452M		NM_012318.2	NP_036450.1	O95202	LETM1_HUMAN	leucine zipper-EF-hand containing transmembrane protein 1	452					cristae formation (GO:0042407)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(2)|large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	13			all cancers(2;0.00756)|OV - Ovarian serous cystadenocarcinoma(23;0.00989)|Epithelial(3;0.0141)			ACCTCGGCCACTTTCACCTGT	0.632													ENSG00000168924																																					0													101.0	96.0	97.0					4																	1824837		2203	4300	6503	SO:0001583	missense	0			-	AF061025	CCDS3355.1	4p16.3	2013-01-10			ENSG00000168924	ENSG00000168924		"""EF-hand domain containing"""	6556	protein-coding gene	gene with protein product	"""Mdm38 homolog (yeast)"""	604407				10486213	Standard	NM_012318		Approved		uc003gdv.3	O95202	OTTHUMG00000121149	ENST00000302787.2:c.1354G>A	4.37:g.1824837C>T	ENSP00000305653:p.Val452Met		B4DED2|Q9UF65	Missense_Mutation	SNP	pfam_LETM1,pfscan_EF_hand_dom	p.V452M	ENST00000302787.2	37	c.1354	CCDS3355.1	4	.	.	.	.	.	.	.	.	.	.	C	17.57	3.423647	0.62733	.	.	ENSG00000168924	ENST00000302787	.	.	.	4.87	4.87	0.63330	.	0.537879	0.19531	N	0.112059	T	0.61311	0.2337	L	0.51422	1.61	0.49915	D	0.999839	D	0.53885	0.963	P	0.47673	0.554	T	0.67296	-0.5706	9	0.72032	D	0.01	-12.6623	17.9976	0.89188	0.0:1.0:0.0:0.0	.	452	O95202	LETM1_HUMAN	M	452	.	ENSP00000305653:V452M	V	-	1	0	LETM1	1794635	0.985000	0.35326	0.413000	0.26509	0.136000	0.21042	7.344000	0.79328	2.242000	0.73789	0.491000	0.48974	GTG	-	LETM1	-	NULL		0.632	LETM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LETM1	HGNC	protein_coding	OTTHUMT00000241634.1	0	0	0	65	65	49	0.00	0.00	C			1824837	-1	10	15	6	2	tier1	no_errors	ENST00000302787	ensembl	human	known	74_37	missense	62.50	88.24	SNP	0.993	T	10	6
MTFR1	9650	genome.wustl.edu	37	8	66620234	66620237	+	Frame_Shift_Del	DEL	AGAG	AGAG	-	rs150478914		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AGAG	AGAG	AGAG	-	AGAG	AGAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:66620234_66620237delAGAG	ENST00000262146.4	+	7	1047_1050	c.921_924delAGAG	c.(919-924)tcagagfs	p.SE307fs	MTFR1_ENST00000458689.2_Frame_Shift_Del_p.SE274fs	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1	307					aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			AGGCCACCTCAGAGAGAGTGTTGG	0.412													ENSG00000066855																																					0																																										SO:0001589	frameshift_variant	0					CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.921_924delAGAG	8.37:g.66620238_66620241delAGAG	ENSP00000262146:p.Ser307fs		E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Frame_Shift_Del	DEL	pfam_Mtfr1	p.R309fs	ENST00000262146.4	37	c.921_924	CCDS6182.1	8																																																																																				MTFR1	-	NULL		0.412	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFR1	HGNC	protein_coding	OTTHUMT00000378894.1	0	0	0	58	58	98	0.00	0.00	AGAG	NM_014637		66620237	+1	19	27	8	9	tier1	no_errors	ENST00000262146	ensembl	human	known	74_37	frame_shift_del	70.37	75.00	DEL	0.994:0.993:0.944:0.308	-	19	8
PLXNB2	23654	genome.wustl.edu	37	22	50718148	50718148	+	Missense_Mutation	SNP	T	T	C			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr22:50718148T>C	ENST00000449103.1	-	27	4440	c.4300A>G	c.(4300-4302)Aag>Gag	p.K1434E	PLXNB2_ENST00000359337.4_Missense_Mutation_p.K1434E			O15031	PLXB2_HUMAN	plexin B2	1434					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ACCGGGCCCTTTTCCACCTGA	0.602													ENSG00000196576																																					0													149.0	164.0	159.0					22																	50718148		1950	4134	6084	SO:0001583	missense	0			-		CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4300A>G	22.37:g.50718148T>C	ENSP00000409171:p.Lys1434Glu		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.K1434E	ENST00000449103.1	37	c.4300	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259702	0.80246	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000399964	T;T	0.23348	1.91;1.91	4.17	4.17	0.49024	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.58264	0.2110	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.69468	-0.5137	10	0.87932	D	0	.	13.6445	0.62272	0.0:0.0:0.0:1.0	.	1434	O15031	PLXB2_HUMAN	E	1434;1434;66	ENSP00000409171:K1434E;ENSP00000352288:K1434E	ENSP00000352288:K1434E	K	-	1	0	PLXNB2	49060275	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	5.876000	0.69667	1.867000	0.54127	0.379000	0.24179	AAG	-	PLXNB2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot		0.602	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	0	0	0	90	90	119	0.00	0.00	T	NM_012401		50718148	-1	26	57	4	7	tier1	no_errors	ENST00000359337	ensembl	human	known	74_37	missense	86.67	89.06	SNP	1.000	C	26	4
SETD1A	9739	genome.wustl.edu	37	16	30992058	30992059	+	Splice_Site	DEL	AG	AG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AG	AG	AG	-	AG	AG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:30992058_30992059delAG	ENST00000262519.8	+	16	5267		c.e16-1			NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A						histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TGTGTCTCACAGGGGACGAACC	0.678													ENSG00000099381																																					0										1,4261		0,1,2130						4.3	1.0			42	0,8252		0,0,4126	no	splice-3	SETD1A	NM_014712.1		0,1,6256	A1A1,A1R,RR		0.0,0.0235,0.0080				1,12513				SO:0001630	splice_region_variant	0				AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.4582-1AG>-	16.37:g.30992058_30992059delAG			A6NP62|Q6PIF3|Q8TAJ6	Splice_Site	DEL	-	e15-1	ENST00000262519.8	37	c.4582-2_4582-1	CCDS32435.1	16																																																																																				SETD1A	-	-		0.678	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	0	0	0	68	68	19	0.00	0.00	AG	NM_014712	Intron	30992059	+1	31	8	33	9	tier1	no_errors	ENST00000262519	ensembl	human	known	74_37	splice_site_del	48.44	47.06	DEL	1.000:1.000	-	31	33
TONSL	4796	genome.wustl.edu	37	8	145660403	145660403	+	Silent	SNP	G	G	A	rs558700548		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr8:145660403G>A	ENST00000409379.3	-	19	3032	c.3003C>T	c.(3001-3003)gaC>gaT	p.D1001D	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1001					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GGCTCACCTCGTCATTGCTCT	0.682													ENSG00000160949	G|||	1	0.000199681	0.0	0.0	5008	,	,		16355	0.001		0.0	False		,,,				2504	0.0																0													22.0	24.0	23.0					8																	145660403		2200	4299	6499	SO:0001819	synonymous_variant	0			-		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3003C>T	8.37:g.145660403G>A			B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.D1001	ENST00000409379.3	37	c.3003	CCDS34968.2	8																																																																																			-	TONSL	-	NULL		0.682	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	HGNC	protein_coding	OTTHUMT00000329668.2	0	0	0	95	95	15	0.00	0.00	G	NM_013432		145660403	-1	27	6	4	1	tier1	no_errors	ENST00000409379	ensembl	human	known	74_37	silent	87.10	85.71	SNP	0.999	A	27	4
TP53	7157	genome.wustl.edu	37	17	7579346	7579348	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	AAG	AAG	AAG	-	AAG	AAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr17:7579346_7579348delAAG	ENST00000269305.4	-	4	528_530	c.339_341delCTT	c.(337-342)ttcttg>ttg	p.F113del	TP53_ENST00000359597.4_In_Frame_Del_p.F113del|TP53_ENST00000420246.2_In_Frame_Del_p.F113del|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_In_Frame_Del_p.F113del|TP53_ENST00000445888.2_In_Frame_Del_p.F113del|TP53_ENST00000413465.2_In_Frame_Del_p.F113del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.L114*(4)|p.F113L(3)|p.G59fs*23(3)|p.F113C(2)|p.F113del(2)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)|p.L114fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCCAGAATGCAAGAAGCCCAGAC	0.601		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	31	Deletion - Frameshift(9)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(5)|Substitution - Nonsense(4)	lung(5)|breast(5)|upper_aerodigestive_tract(4)|urinary_tract(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|biliary_tract(1)|liver(1)|oesophagus(1)	GRCh37	CD084237	TP53	D																																				SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.339_341delCTT	17.37:g.7579349_7579351delAAG	ENSP00000269305:p.Phe113del		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F113in_frame_del	ENST00000269305.4	37	c.341_339	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd		0.601	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	124	124	146	0.00	0.00	AAG	NM_000546		7579348	-1	30	41	4	7	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_del	88.24	85.42	DEL	0.998:1.000:1.000	-	30	4
ZNF469	84627	genome.wustl.edu	37	16	88504643	88504643	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:88504643delC	ENST00000437464.1	+	2	10681	c.10681delC	c.(10681-10683)cctfs	p.P3561fs	ZNF469_ENST00000565624.1_Frame_Shift_Del_p.P3589fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	3561					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGCCCCGGGCCTCTTCTCCA	0.672													ENSG00000225614																																					0													14.0	19.0	17.0					16																	88504643		692	1587	2279	SO:0001589	frameshift_variant	0				AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.10681delC	16.37:g.88504643delC	ENSP00000402343:p.Pro3561fs			Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P3561fs	ENST00000437464.1	37	c.10681	CCDS45544.1	16																																																																																				ZNF469	-	NULL		0.672	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		0	0	0	57	57	15	0.00	0.00	C	NG_012236		88504643	+1	28	5	19	7	tier1	no_errors	ENST00000437464	ensembl	human	known	74_37	frame_shift_del	59.57	41.67	DEL	0.000	-	28	19
ORM1	5004	genome.wustl.edu	37	9	117087474	117087474	+	3'UTR	SNP	C	C	G			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:117087474C>G	ENST00000477456.1	+	0	365				ORM1_ENST00000259396.8_Intron			P02763	A1AG1_HUMAN	orosomucoid 1						acute-phase response (GO:0006953)|inflammatory response (GO:0006954)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|large_intestine(4)|lung(2)	8		Myeloproliferative disorder(63;0.163)			Abiraterone(DB05812)|Acenocoumarol(DB01418)|Ajmaline(DB01426)|Alfentanil(DB00802)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aprindine(DB01429)|Bupropion(DB01156)|Canagliflozin(DB08907)|Celecoxib(DB00482)|Chlorpromazine(DB00477)|Desipramine(DB01151)|Disopyramide(DB00280)|Doxazosin(DB00590)|Doxepin(DB01142)|Erlotinib(DB00530)|Fluoxetine(DB00472)|Gefitinib(DB00317)|Imatinib(DB00619)|Imipramine(DB00458)|Ivacaftor(DB08820)|Maprotiline(DB00934)|Mirabegron(DB08893)|Nateglinide(DB00731)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxycodone(DB00497)|Penbutolol(DB01359)|Pethidine(DB00454)|Phenprocoumon(DB00946)|Pitavastatin(DB08860)|Prazosin(DB00457)|Propranolol(DB00571)|Quinidine(DB00908)|Saquinavir(DB01232)|Tacrolimus(DB00864)|Tamsulosin(DB00706)|Telaprevir(DB05521)|Thalidomide(DB01041)|Trazodone(DB00656)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Vismodegib(DB08828)|Warfarin(DB00682)	TGTCCATGGCCCAACTTGGGC	0.567													ENSG00000229314																																					0													47.0	50.0	49.0					9																	117087474		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			-		CCDS6803.1	9q32	2013-09-19			ENSG00000229314	ENSG00000229314		"""Lipocalins"""	8498	protein-coding gene	gene with protein product		138600					Standard	NM_000607		Approved		uc004bik.4	P02763	OTTHUMG00000021012	ENST00000477456.1:c.*362C>G	9.37:g.117087474C>G			B7ZKQ5|Q5T539|Q5U067|Q8TC16	R	SNP	-	NULL	ENST00000477456.1	37	NULL		9																																																																																			-	ORM1	-	-		0.567	ORM1-002	KNOWN	basic	processed_transcript	ORM1	HGNC	protein_coding	OTTHUMT00000055427.1	0	0	1	108	108	406	0.00	0.25	C			117087474	+1	13	28	87	464	tier1	no_errors	ENST00000477456	ensembl	human	known	74_37	rna	13.00	5.68	SNP	0.001	G	13	87
ARHGAP31	57514	genome.wustl.edu	37	3	119133104	119133134	+	Frame_Shift_Del	DEL	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	-	rs368591462|rs183837502|rs139659618	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	-	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:119133104_119133134delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	ENST00000264245.4	+	12	2860_2890	c.2328_2358delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	c.(2326-2358)aatctgtctcctccactcccacctgctcctcccfs	p.NLSPPLPPAPP776fs		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	776	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						GCCCAGGCAATCTGTCTCCTCCACTCCCACCTGCTCCTCCCCCTCCAACTC	0.558													ENSG00000031081																									Pancreas(7;176 297 5394 51128 51241)												0																																										SO:0001589	frameshift_variant	0					CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2328_2358delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	3.37:g.119133104_119133134delTCTGTCTCCTCCACTCCCACCTGCTCCTCCC	ENSP00000264245:p.Asn776fs		Q9ULL6	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S778fs	ENST00000264245.4	37	c.2328_2358	CCDS43135.1	3																																																																																				ARHGAP31	-	NULL		0.558	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	0	0	0	117	117	117	0.00	0.00	TCTGTCTCCTCCACTCCCACCTGCTCCTCCC			119133134	+1	4	4	73	73	tier1	no_errors	ENST00000264245	ensembl	human	known	74_37	frame_shift_del	5.19	5.19	DEL	0.057:0.059:0.035:0.024:0.028:0.051:0.004:0.013:0.021:0.004:0.002:0.000:0.000:0.004:0.007:0.006:0.007:0.007:0.006:0.919:0.985:0.990:1.000:1.000:0.998:0.987:1.000:0.998:1.000:1.000:0.990	-	4	73
MALAT1	378938	genome.wustl.edu	37	11	65268614	65268614	+	lincRNA	SNP	C	C	T	rs539201929		TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr11:65268614C>T	ENST00000534336.1	+	0	3382				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AATAGATGACCTGTTTTTACT	0.373													ENSG00000251562																																					0													61.0	67.0	65.0					11																	65268614		874	1988	2862			0			-	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268614C>T				R	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	MALAT1	-	-		0.373	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	0	0	2	43	43	146	0.00	1.35	C	NR_002819		65268614	+1	21	71	23	66	tier1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	47.73	51.82	SNP	0.000	T	21	23
AMY1C	278	genome.wustl.edu	37	1	104297408	104297408	+	Missense_Mutation	SNP	G	G	A			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr1:104297408G>A	ENST00000370079.3	+	7	1137	c.1073G>A	c.(1072-1074)cGt>cAt	p.R358H		NM_001008219.1	NP_001008220.1	P04745	AMY1_HUMAN	amylase, alpha 1C (salivary)	358					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			lung(5)|skin(3)	8		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)		TCAAGCTACCGTTGGCCAAGA	0.323													ENSG00000187733																																					0																																										SO:0001583	missense	0			-		CCDS30784.1	1p21	2012-10-02	2007-05-03		ENSG00000187733	ENSG00000187733	3.2.1.1		476	protein-coding gene	gene with protein product		104702	"""amylase, alpha 1C; salivary"""	AMY1			Standard	XM_005270761		Approved			P04745	OTTHUMG00000011045	ENST00000370079.3:c.1073G>A	1.37:g.104297408G>A	ENSP00000359096:p.Arg358His		A6NJS5|A8K8H6|Q13763|Q5T083	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.R358H	ENST00000370079.3	37	c.1073	CCDS30784.1	1	.	.	.	.	.	.	.	.	.	.	G	3.071	-0.191123	0.06299	.	.	ENSG00000187733	ENST00000370079	.	.	.	2.23	1.23	0.21249	.	0.055619	0.64402	D	0.000002	T	0.35856	0.0946	L	0.45228	1.405	0.50313	D	0.999863	.	.	.	.	.	.	T	0.12319	-1.0552	7	0.22109	T	0.4	.	9.1661	0.37052	0.1186:0.0:0.8814:0.0	.	.	.	.	H	358	.	ENSP00000359096:R358H	R	+	2	0	AMY1C	104098931	0.710000	0.27896	0.524000	0.27887	0.466000	0.32739	2.272000	0.43373	0.228000	0.21019	0.184000	0.17185	CGT	-	AMY1C	-	superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom		0.323	AMY1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY1C	HGNC	protein_coding	OTTHUMT00000030375.1	0	0	0	19	19	9	0.00	0.00	G	NM_001008219		104297408	+1	10	1	1	0	tier1	no_errors	ENST00000370079	ensembl	human	known	74_37	missense	90.91	100.00	SNP	0.998	A	10	1
CTD-2555A7.2	0	genome.wustl.edu	37	16	89119157	89119157	+	lincRNA	DEL	T	T	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr16:89119157delT	ENST00000537498.1	-	0	216																											GGCACGCTTCTTTTTTTTTTT	0.567													ENSG00000256982																																					0																																												0																																16.37:g.89119157delT				R	DEL	-	NULL	ENST00000537498.1	37	NULL		16																																																																																				CTD-2555A7.2	-	-		0.567	CTD-2555A7.2-001	KNOWN	basic	lincRNA	ENSG00000256982	Clone_based_vega_gene	lincRNA	OTTHUMT00000430645.1	0	0	0	26	26	5	0.00	0.00	T			89119157	-1	3	1	15	3	tier1	no_errors	ENST00000537498	ensembl	human	known	74_37	rna	16.67	25.00	DEL	0.003	-	3	15
NSUN5	55695	genome.wustl.edu	37	7	72717970	72717973	+	Frame_Shift_Del	DEL	GCAT	GCAT	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	GCAT	GCAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr7:72717970_72717973delGCAT	ENST00000252594.6	-	8	1010_1013	c.995_998delATGC	c.(994-999)catgccfs	p.HA332fs	NSUN5_ENST00000438747.2_Frame_Shift_Del_p.HA332fs|NSUN5_ENST00000310326.8_Frame_Shift_Del_p.HA332fs|NSUN5_ENST00000428206.1_Frame_Shift_Del_p.HA294fs			Q96P11	NSUN5_HUMAN	NOP2/Sun domain family, member 5	332					rRNA processing (GO:0006364)	nucleolus (GO:0005730)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|large_intestine(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	8		Lung NSC(55;0.163)				CCCTGCCAGGGCATGCAGACGCAC	0.618													ENSG00000130305																																					0																																										SO:0001589	frameshift_variant	0				AF420249	CCDS5546.1, CCDS5547.1, CCDS55118.1, CCDS55119.1	7q11.23	2010-04-08	2009-11-23	2005-01-14	ENSG00000130305	ENSG00000130305		"""NOP2/Sun domain containing"""	16385	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 5A"""	615732	"""Williams Beuren syndrome chromosome region 20A"", ""NOL1/NOP2/Sun domain family, member 5"""	WBSCR20, WBSCR20A		11978965, 12073013	Standard	NM_148956		Approved	NOL1R, p120, (NOL1), FLJ10267, NSUN5A, Ynl022cL	uc011kev.2	Q96P11	OTTHUMG00000129869	ENST00000252594.6:c.995_998delATGC	7.37:g.72717970_72717973delGCAT	ENSP00000252594:p.His332fs		B3KX04|B4DP79|G3V0G9|Q6ZUI8|Q96HT9|Q9NW70	Frame_Shift_Del	DEL	pfam_Fmu/NOL1/Nop2p,prints_RCMT	p.H332fs	ENST00000252594.6	37	c.998_995	CCDS5547.1	7																																																																																				NSUN5	-	pfam_Fmu/NOL1/Nop2p		0.618	NSUN5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	NSUN5	HGNC	protein_coding	OTTHUMT00000252113.1	0	0	0	85	85	12	0.00	0.00	GCAT	NM_148956		72717973	-1	27	1	34	3	tier1	no_errors	ENST00000438747	ensembl	human	known	74_37	frame_shift_del	44.26	25.00	DEL	0.962:0.948:0.057:0.066	-	27	34
CNTNAP3B	728577	genome.wustl.edu	37	9	43915500	43915500	+	Missense_Mutation	SNP	G	G	C	rs587604741	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr9:43915500G>C	ENST00000377564.3	+	22	3976	c.3583G>C	c.(3583-3585)Ggc>Cgc	p.G1195R	CNTNAP3B_ENST00000467854.1_3'UTR	NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	1195	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						CACCGTCCGCGGCCACGTGGC	0.791													ENSG00000154529	.|||	44	0.00878594	0.0076	0.0058	5008	,	,		7477	0.0119		0.007	False		,,,				2504	0.0112																0																																										SO:0001583	missense	0			-	BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.3583G>C	9.37:g.43915500G>C	ENSP00000366787:p.Gly1195Arg		B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G1195R	ENST00000377564.3	37	c.3583	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711004	0.68730	.	.	ENSG00000154529	ENST00000377564	D	0.90732	-2.72	2.28	1.31	0.21738	.	.	.	.	.	D	0.92374	0.7580	M	0.79926	2.475	0.51482	D	0.999921	.	.	.	.	.	.	D	0.90154	0.4223	7	0.72032	D	0.01	.	7.2767	0.26288	0.0:0.0:0.7356:0.2644	.	.	.	.	R	1195	ENSP00000366787:G1195R	ENSP00000366787:G1195R	G	+	1	0	CNTNAP3B	43855496	1.000000	0.71417	0.010000	0.14722	0.372000	0.29890	5.792000	0.69052	0.278000	0.22164	0.064000	0.15345	GGC	-	CNTP3B	-	pfscan_Laminin_G		0.791	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP3B	HGNC	protein_coding	OTTHUMT00000036930.3	0	0	0	14	14	0	0.00	0.00	G			43915500	+1	4	0	9	0	tier1	no_errors	ENST00000377564	ensembl	human	known	74_37	missense	30.77	0.00	SNP	0.363	C	4	9
RP11-146E13.4	0	genome.wustl.edu	37	14	19855845	19855845	+	lincRNA	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr14:19855845C>T	ENST00000548109.1	+	0	72																											CAGTGTGGCTCTGGACTCACC	0.647													ENSG00000244306																																					0																																												0			-																													14.37:g.19855845C>T				R	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			-	CTD-2314B22.3	-	-		0.647	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	0	0	0	9	9	0	0.00	0.00	C			19855845	-1	4	0	7	1	tier1	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	36.36	0.00	SNP	0.998	T	4	7
KHDC1	80759	genome.wustl.edu	37	6	73972779	73972793	+	Intron	DEL	GCGGCGGCGGCGGCA	GCGGCGGCGGCGGCA	-	rs28641970|rs373485269|rs574127460	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	GCGGCGGCGGCGGCA	GCGGCGGCGGCGGCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:73972779_73972793delGCGGCGGCGGCGGCA	ENST00000370384.3	-	3	707				AC019205.1_ENST00000584443.1_RNA|RP11-257K9.8_ENST00000423730.3_5'UTR|KHDC1_ENST00000257765.5_5'UTR|RP11-398K22.12_ENST00000441363.1_RNA|RP11-398K22.12_ENST00000442007.1_RNA	NM_001251874.1	NP_001238803.1	Q4VXA5	KHDC1_HUMAN	KH homology domain containing 1							integral component of membrane (GO:0016021)	RNA binding (GO:0003723)			large_intestine(1)|lung(4)|skin(1)	6						ggcggcggcggcggcggcggcggcagcggcggcag	0.749											OREG0003897	type=REGULATORY REGION|Gene=BC031876|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	ENSG00000263378																																					0																																										SO:0001627	intron_variant	0					CCDS43480.1, CCDS59027.1	6q13	2014-05-15	2007-11-13	2007-11-13	ENSG00000135314	ENSG00000135314			21366	protein-coding gene	gene with protein product		611688	"""chromosome 6 open reading frame 148"""	C6orf148		17913455	Standard	NM_030568		Approved	MGC10818, bA257K9.4, NDG1	uc003pgn.4	Q4VXA5	OTTHUMG00000015030	ENST00000370384.3:c.207-20526TGCCGCCGCCGCCGC>-	6.37:g.73972779_73972793delGCGGCGGCGGCGGCA		1149	Q5JSQ7|Q8WTV2|Q96NQ5	R	DEL	-	NULL	ENST00000370384.3	37	NULL	CCDS59027.1	6																																																																																				AC019205.1	-	-		0.749	KHDC1-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000263378	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000148103.2	0	0	0	0	0	0	0.00	0.00	GCGGCGGCGGCGGCA	NM_030568		73972793	+1	1	1	0	0	tier1	no_errors	ENST00000584443	ensembl	human	novel	74_37	rna	100.00	100.00	DEL	0.010:0.008:0.003:0.004:0.002:0.001:0.002:0.003:0.003:0.012:0.028:0.028:0.029:0.029:0.028	-	1	0
FGF9	2254	genome.wustl.edu	37	13	22275848	22275849	+	3'UTR	INS	-	-	TGTGTG	rs138451360|rs377431851|rs112896362|rs61706549|rs201279299|rs79021222|rs9796160|rs71093347|rs398037423	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr13:22275848_22275849insTGTGTG	ENST00000382353.5	+	0	1431_1432				FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9						angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		GAgtgtgtgtatgtgtgtgtgt	0.525													ENSG00000102678																									Melanoma(195;1939 2127 12623 13963 52730)												0																																										SO:0001624	3_prime_UTR_variant	0				D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.*275->TGTGTG	13.37:g.22275849_22275854dupTGTGTG			A8K427|Q3SY32	R	INS	-	NULL	ENST00000382353.5	37	NULL	CCDS9298.1	13																																																																																				FGF9	-	-		0.525	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	HGNC	protein_coding	OTTHUMT00000046002.2	0	0	0	0	0	0	0.00	0.00	-			22275849	+1	0	0	1	1	tier1	no_errors	ENST00000478546	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.004:0.000	TGTGTG	0	1
KRTAP10-9	386676	genome.wustl.edu	37	21	46048196	46048197	+	3'UTR	INS	-	-	CGCTGGT	rs181355860|rs587633163|rs61263042	byFrequency	TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr21:46048196_46048197insCGCTGGT	ENST00000397911.3	+	0	1157_1158				KRTAP10-9_ENST00000484861.1_3'UTR|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9							keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCACAACCCTCCGCTGGTCGCT	0.693													ENSG00000221837		1171	0.233826	0.2458	0.2536	5008	,	,		10044	0.1855		0.2952	False		,,,				2504	0.1902																0																																										SO:0001624	3_prime_UTR_variant	0				AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.*230->CGCTGGT	21.37:g.46048197_46048203dupCGCTGGT			A2RRG1|A6NIR9|Q70LJ1	R	INS	-	NULL	ENST00000397911.3	37	NULL	CCDS42961.1	21																																																																																				KRTAP10-9	-	-		0.693	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	0	0	0	0	0	0	0.00	0.00	-			46048197	+1	0	0	1	1	tier1	no_errors	ENST00000484861	ensembl	human	known	74_37	rna	0.00	0.00	INS	0.001:0.001	CGCTGGT	0	1
SHOX2	6474	genome.wustl.edu	37	3	157816014	157816014	+	Silent	SNP	C	C	T			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr3:157816014C>T	ENST00000425436.3	-	5	823	c.798G>A	c.(796-798)ccG>ccA	p.P266P	SHOX2_ENST00000441443.2_Silent_p.P125P|SHOX2_ENST00000389589.4_Silent_p.P290P|SHOX2_ENST00000490689.2_Silent_p.P125P|SHOX2_ENST00000483851.2_Silent_p.P254P	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	266					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CGGCCAGGTGCGGATGCAGGT	0.672													ENSG00000168779																																					0													59.0	63.0	61.0					3																	157816014		2203	4298	6501	SO:0001819	synonymous_variant	0			-	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.798G>A	3.37:g.157816014C>T			O60465|O60467|O60903	Silent	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.P290	ENST00000425436.3	37	c.870	CCDS43164.1	3	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069828	0.36566	.	.	ENSG00000168779	ENST00000555977	.	.	.	5.12	4.2	0.49525	.	.	.	.	.	T	0.53077	0.1774	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50381	-0.8835	4	.	.	.	.	4.666	0.12666	0.1708:0.6359:0.0:0.1933	.	.	.	.	H	157	.	.	R	-	2	0	SHOX2	159298708	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.864000	0.27926	1.181000	0.42912	-0.345000	0.07892	CGC	-	SHOX2	-	NULL		0.672	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHOX2	HGNC	protein_coding	OTTHUMT00000352057.2	0	0	0	37	37	3	0.00	0.00	C			157816014	-1	4	0	37	6	tier1	no_errors	ENST00000389589	ensembl	human	known	74_37	silent	9.76	0.00	SNP	1.000	T	4	37
TULP4	56995	genome.wustl.edu	37	6	158923753	158923753	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X2-A95T-01A-11D-A37C-09	TCGA-X2-A95T-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	eae14da4-7965-48f3-919d-f1a4d02028a4	9de98674-1ec6-4f41-99e7-4628c6bd23f5	g.chr6:158923753delG	ENST00000367097.3	+	13	4415	c.3058delG	c.(3058-3060)gggfs	p.G1021fs	TULP4_ENST00000367094.2_Intron	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	1021					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.V1022fs*80(1)		endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGGCGGGCCCGGGGGGGTGGT	0.721													ENSG00000130338																																					1	Insertion - Frameshift(1)	large_intestine(1)							,	20,3782		2,16,1883					,	-2.0	0.0			7	44,7448		4,36,3706	no	frameshift,intron	TULP4	NM_020245.3,NM_001007466.1	,	6,52,5589	A1A1,A1R,RR		0.5873,0.526,0.5667	,	,		64,11230				SO:0001589	frameshift_variant	0					CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.3058delG	6.37:g.158923753delG	ENSP00000356064:p.Gly1021fs		Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Frame_Shift_Del	DEL	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V1022fs	ENST00000367097.3	37	c.3058	CCDS34561.1	6																																																																																				TULP4	-	NULL		0.721	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	0	0	0	35	35	0	0.00	0.00	G	NM_020245		158923753	+1	2	0	16	4	tier1	no_errors	ENST00000367097	ensembl	human	known	74_37	frame_shift_del	11.11	0.00	DEL	0.001	-	2	16
