#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PAX9	5083	genome.wustl.edu	37	14	37145611	37145611	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr14:37145611A>G	ENST00000361487.6	+	4	1205	c.980A>G	c.(979-981)cAg>cGg	p.Q327R	PAX9_ENST00000554201.1_3'UTR|PAX9_ENST00000402703.2_Missense_Mutation_p.Q327R			P55771	PAX9_HUMAN	paired box 9	327					cellular response to growth factor stimulus (GO:0071363)|endoderm development (GO:0007492)|face morphogenesis (GO:0060325)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|regulation of odontogenesis (GO:0042481)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(3)	12	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)		AAGGGAATGCAGGCAGCCAGA	0.577													ENSG00000198807																																					0													106.0	91.0	96.0					14																	37145611		2203	4300	6503	SO:0001583	missense	0			-	AJ238381	CCDS9662.1	14q13.3	2007-07-12	2007-07-12		ENSG00000198807	ENSG00000198807		"""Paired boxes"""	8623	protein-coding gene	gene with protein product		167416	"""paired box gene 9"""			7981748	Standard	NM_006194		Approved		uc001wty.4	P55771	OTTHUMG00000140251	ENST00000361487.6:c.980A>G	14.37:g.37145611A>G	ENSP00000355245:p.Gln327Arg		Q99582|Q9UQR4	Missense_Mutation	SNP	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.Q327R	ENST00000361487.6	37	c.980	CCDS9662.1	14	.	.	.	.	.	.	.	.	.	.	A	11.52	1.664451	0.29604	.	.	ENSG00000198807	ENST00000402703;ENST00000361487	D;D	0.98835	-5.17;-5.17	6.16	4.96	0.65561	.	0.294047	0.39834	N	0.001255	D	0.96537	0.8870	L	0.47716	1.5	0.27376	N	0.955547	B	0.19817	0.039	B	0.10450	0.005	D	0.90928	0.4788	10	0.30078	T	0.28	.	12.6913	0.56976	0.7584:0.2416:0.0:0.0	.	327	P55771	PAX9_HUMAN	R	327	ENSP00000384817:Q327R;ENSP00000355245:Q327R	ENSP00000355245:Q327R	Q	+	2	0	PAX9	36215362	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.498000	0.53302	2.367000	0.80283	0.528000	0.53228	CAG	-	PAX9	-	NULL		0.577	PAX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX9	HGNC	protein_coding	OTTHUMT00000276733.2	0	0	0	88	88	99	0.00	0.00	A			37145611	+1	10	18	49	40	tier1	no_errors	ENST00000361487	ensembl	human	known	74_37	missense	16.95	31.03	SNP	1.000	G	10	49
OR6X1	390260	genome.wustl.edu	37	11	123624968	123624968	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:123624968T>C	ENST00000327930.2	-	1	285	c.259A>G	c.(259-261)Aga>Gga	p.R87G		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ATTACTGTTCTTGCCACTACA	0.463													ENSG00000221931																																					0													151.0	147.0	148.0					11																	123624968		2202	4299	6501	SO:0001583	missense	0			-	AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.259A>G	11.37:g.123624968T>C	ENSP00000333724:p.Arg87Gly		B9EGW9|Q6IFA0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R87G	ENST00000327930.2	37	c.259	CCDS31695.1	11	.	.	.	.	.	.	.	.	.	.	T	6.957	0.546465	0.13312	.	.	ENSG00000221931	ENST00000327930	T	0.03035	4.07	4.19	3.06	0.35304	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03783	0.0107	L	0.39397	1.21	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40232	-0.9574	9	0.72032	D	0.01	-0.0108	4.2772	0.10815	0.0:0.1077:0.2042:0.6881	.	87	Q8NH79	OR6X1_HUMAN	G	87	ENSP00000333724:R87G	ENSP00000333724:R87G	R	-	1	2	OR6X1	123130178	0.000000	0.05858	0.001000	0.08648	0.766000	0.43426	0.258000	0.18387	0.674000	0.31244	0.528000	0.53228	AGA	-	OR6X1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.463	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	0	0	0	124	124	133	0.00	0.00	T	NM_001005188		123624968	-1	15	9	49	35	tier1	no_errors	ENST00000327930	ensembl	human	known	74_37	missense	23.44	20.45	SNP	0.000	C	15	49
TMEM163	81615	genome.wustl.edu	37	2	135260492	135260492	+	Missense_Mutation	SNP	T	T	G	rs371144714		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:135260492T>G	ENST00000281924.6	-	5	599	c.535A>C	c.(535-537)Act>Cct	p.T179P		NM_030923.4	NP_112185.1	Q8TC26	TM163_HUMAN	transmembrane protein 163	179						cell junction (GO:0030054)|early endosome membrane (GO:0031901)|integral component of synaptic vesicle membrane (GO:0030285)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(8)|stomach(1)|urinary_tract(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.154)		AGCAGCCTAGTTGAGAGGTCA	0.507													ENSG00000152128																																					0													128.0	104.0	112.0					2																	135260492		2203	4300	6503	SO:0001583	missense	0			-		CCDS2172.1	2q21.3	2008-02-05			ENSG00000152128	ENSG00000152128			25380	protein-coding gene	gene with protein product						17623043	Standard	NM_030923		Approved	DKFZP566N034, SV31	uc002ttx.3	Q8TC26	OTTHUMG00000131713	ENST00000281924.6:c.535A>C	2.37:g.135260492T>G	ENSP00000281924:p.Thr179Pro		Q53QM3|Q53SV7|Q69YH3|Q9UFG3	Missense_Mutation	SNP	NULL	p.T179P	ENST00000281924.6	37	c.535	CCDS2172.1	2	.	.	.	.	.	.	.	.	.	.	T	19.30	3.800594	0.70567	.	.	ENSG00000152128	ENST00000281924	T	0.63913	-0.07	6.06	6.06	0.98353	.	0.172694	0.49916	D	0.000122	T	0.69824	0.3154	L	0.44542	1.39	0.41969	D	0.990744	D	0.60575	0.988	P	0.61201	0.885	T	0.67296	-0.5706	10	0.30854	T	0.27	.	15.5919	0.76537	0.0:0.0:0.0:1.0	.	179	Q8TC26	TM163_HUMAN	P	179	ENSP00000281924:T179P	ENSP00000281924:T179P	T	-	1	0	TMEM163	134976962	1.000000	0.71417	0.326000	0.25389	0.994000	0.84299	7.114000	0.77103	2.324000	0.78689	0.533000	0.62120	ACT	-	TMEM163	-	NULL		0.507	TMEM163-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM163	HGNC	protein_coding	OTTHUMT00000254631.2	0	0	0	161	161	151	0.00	0.00	T	NM_030923		135260492	-1	17	44	76	75	tier1	no_errors	ENST00000281924	ensembl	human	known	74_37	missense	18.28	36.97	SNP	0.932	G	17	76
CARM1P1	100130873	genome.wustl.edu	37	9	2943570	2943570	+	IGR	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr9:2943570A>T								AL589675.1 (19160 upstream) : CARM1P1 (48491 downstream)																							ATTACCAAAAATTGGCTCTGG	0.428													ENSG00000227835																																					0																																										SO:0001628	intergenic_variant	0			-																													9.37:g.2943570A>T				R	SNP	-	NULL		37	NULL		9																																																																																			-	CARM1P1	-	-	0	0.428					CARM1P1	HGNC			0	0	0	151	151	112	0.00	0.00	A			2943570	-1	25	26	50	72	tier1	no_errors	ENST00000492533	ensembl	human	known	74_37	rna	32.89	26.53	SNP	1.000	T	25	50
TMEM67	91147	genome.wustl.edu	37	8	94827670	94827670	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr8:94827670C>G	ENST00000453321.3	+	27	2960	c.2902C>G	c.(2902-2904)Caa>Gaa	p.Q968E	TMEM67_ENST00000409623.3_Missense_Mutation_p.Q887E	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	968					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			ATATCTACAACAAGAGGTAAA	0.303													ENSG00000164953																																					0													100.0	93.0	95.0					8																	94827670		2202	4297	6499	SO:0001583	missense	0			-	BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2902C>G	8.37:g.94827670C>G	ENSP00000389998:p.Gln968Glu		B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	pfam_Meckelin,superfamily_Growth_fac_rcpt_N_dom	p.Q968E	ENST00000453321.3	37	c.2902	CCDS6258.2	8	.	.	.	.	.	.	.	.	.	.	C	17.22	3.335086	0.60853	.	.	ENSG00000164953	ENST00000453321;ENST00000409623	D;D	0.96459	-4.02;-4.02	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.96722	0.8930	M	0.72118	2.19	0.80722	D	1	D;P	0.54601	0.967;0.905	P;P	0.50860	0.604;0.652	D	0.95260	0.8368	10	0.24483	T	0.36	-10.3669	19.9658	0.97266	0.0:1.0:0.0:0.0	.	968;887	Q5HYA8;G5E9H2	MKS3_HUMAN;.	E	968;887	ENSP00000389998:Q968E;ENSP00000386966:Q887E	ENSP00000314488:Q958E	Q	+	1	0	TMEM67	94896846	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	7.426000	0.80270	2.721000	0.93114	0.591000	0.81541	CAA	-	TMEM67	-	pfam_Meckelin		0.303	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	HGNC	protein_coding	OTTHUMT00000329641.2	0	0	0	86	86	50	0.00	0.00	C	NM_153704		94827670	+1	21	17	48	93	tier1	no_errors	ENST00000453321	ensembl	human	known	74_37	missense	30.43	15.32	SNP	1.000	G	21	48
DNAH2	146754	genome.wustl.edu	37	17	7644169	7644169	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:7644169C>G	ENST00000572933.1	+	11	3008	c.1548C>G	c.(1546-1548)taC>taG	p.Y516*	DNAH2_ENST00000389173.2_Nonsense_Mutation_p.Y516*|DNAH2_ENST00000082259.3_Nonsense_Mutation_p.Y598*|DNAH2_ENST00000570791.1_Nonsense_Mutation_p.Y598*			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	516	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TGGATCTCTACATGCTGTTCA	0.587													ENSG00000183914																																					0													128.0	117.0	121.0					17																	7644169		2203	4300	6503	SO:0001587	stop_gained	0			-	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.1548C>G	17.37:g.7644169C>G	ENSP00000458355:p.Tyr516*		A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Y516*	ENST00000572933.1	37	c.1548	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	38	6.692288	0.97768	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	.	.	.	5.13	3.13	0.36017	.	0.475392	0.22314	N	0.061694	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.794	0.46449	0.0:0.8411:0.0:0.1589	.	.	.	.	X	516;516;598	.	ENSP00000082259:Y598X	Y	+	3	2	DNAH2	7584894	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.685000	0.37659	0.594000	0.29761	-0.300000	0.09419	TAC	-	DH2	-	pfam_Dynein_heavy_dom-1		0.587	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH2	HGNC	protein_coding	OTTHUMT00000440241.1	0	0	0	77	77	121	0.00	0.00	C	NM_020877		7644169	+1	25	31	41	58	tier1	no_errors	ENST00000389173	ensembl	human	known	74_37	nonsense	37.88	34.83	SNP	1.000	G	25	41
SFXN1	94081	genome.wustl.edu	37	5	174936049	174936049	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:174936049C>T	ENST00000321442.5	+	3	433	c.179C>T	c.(178-180)cCt>cTt	p.P60L	SFXN1_ENST00000502393.1_Missense_Mutation_p.P60L	NM_022754.5	NP_073591.2	Q9H9B4	SFXN1_HUMAN	sideroflexin 1	60					erythrocyte differentiation (GO:0030218)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(3)	15	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGAATTGTTCCTCCTGGTCTT	0.373													ENSG00000164466																																					0													132.0	131.0	131.0					5																	174936049		2203	4300	6503	SO:0001583	missense	0			-	AF327346	CCDS4394.1	5q35.3	2008-02-05			ENSG00000164466	ENSG00000164466		"""Sideroflexins"""	16085	protein-coding gene	gene with protein product		615569					Standard	NM_022754		Approved	FLJ12876	uc003mda.2	Q9H9B4	OTTHUMG00000130555	ENST00000321442.5:c.179C>T	5.37:g.174936049C>T	ENSP00000316905:p.Pro60Leu		B3KPW3|D3DQN2|Q9HA53	Missense_Mutation	SNP	pfam_Mtc,tigrfam_Mtc	p.P60L	ENST00000321442.5	37	c.179	CCDS4394.1	5	.	.	.	.	.	.	.	.	.	.	C	12.61	1.988769	0.35131	.	.	ENSG00000164466	ENST00000507017;ENST00000321442;ENST00000506963	T;T;T	0.28454	1.61;1.61;1.61	5.23	4.36	0.52297	.	0.244211	0.40554	N	0.001067	T	0.26666	0.0652	L	0.49699	1.58	0.25657	N	0.98604	B	0.02656	0.0	B	0.15052	0.012	T	0.19484	-1.0304	10	0.49607	T	0.09	-16.2702	7.8299	0.29336	0.1603:0.7585:0.0:0.0812	.	60	Q9H9B4	SFXN1_HUMAN	L	60	ENSP00000420961:P60L;ENSP00000316905:P60L;ENSP00000421467:P60L	ENSP00000316905:P60L	P	+	2	0	SFXN1	174868655	0.365000	0.25006	0.193000	0.23327	0.884000	0.51177	4.609000	0.61148	1.206000	0.43276	0.555000	0.69702	CCT	-	SFXN1	-	pfam_Mtc,tigrfam_Mtc		0.373	SFXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN1	HGNC	protein_coding	OTTHUMT00000252980.2	0	0	0	95	95	75	0.00	0.00	C	NM_022754		174936049	+1	10	24	50	45	tier1	no_errors	ENST00000321442	ensembl	human	known	74_37	missense	16.67	34.78	SNP	0.203	T	10	50
SRPX	8406	genome.wustl.edu	37	X	38031204	38031204	+	Silent	SNP	C	C	T	rs555263149		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chrX:38031204C>T	ENST00000378533.3	-	4	562	c.456G>A	c.(454-456)acG>acA	p.T152T	TM4SF2_ENST00000465127.1_Intron|SRPX_ENST00000343800.6_Silent_p.T139T|SRPX_ENST00000538295.1_Silent_p.T152T|SRPX_ENST00000544439.1_Silent_p.T132T|SRPX_ENST00000432886.2_Intron	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	152	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						CCCCTTTCAACGTGTATCCTG	0.532													ENSG00000101955	C|||	1	0.000264901	0.0	0.0	3775	,	,		13997	0.0		0.0	False		,,,				2504	0.001																0													113.0	94.0	100.0					X																	38031204		2202	4300	6502	SO:0001819	synonymous_variant	0			-	U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.456G>A	X.37:g.38031204C>T			A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Silent	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.T152	ENST00000378533.3	37	c.456	CCDS14245.1	X																																																																																			-	SRPX	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.532	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX	HGNC	protein_coding	OTTHUMT00000056243.1	0	0	0	83	83	78	0.00	0.00	C	NM_006307		38031204	-1	15	17	25	22	tier1	no_errors	ENST00000378533	ensembl	human	known	74_37	silent	37.50	43.59	SNP	0.003	T	15	25
MUC16	94025	genome.wustl.edu	37	19	9084637	9084637	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr19:9084637G>A	ENST00000397910.4	-	1	7381	c.7178C>T	c.(7177-7179)cCc>cTc	p.P2393L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2393	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGCTAGTGGGACTGATGGA	0.468													ENSG00000181143																																					0													116.0	115.0	115.0					19																	9084637		1975	4173	6148	SO:0001583	missense	0			-	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7178C>T	19.37:g.9084637G>A	ENSP00000381008:p.Pro2393Leu		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P2393L	ENST00000397910.4	37	c.7178	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.668	-0.509747	0.04231	.	.	ENSG00000181143	ENST00000397910	T	0.03212	4.01	0.225	0.225	0.15325	.	.	.	.	.	T	0.05364	0.0142	N	0.08118	0	.	.	.	D	0.69078	0.997	D	0.68483	0.958	T	0.41822	-0.9487	7	0.87932	D	0	.	.	.	.	.	2393	B5ME49	.	L	2393	ENSP00000381008:P2393L	ENSP00000381008:P2393L	P	-	2	0	MUC16	8945637	0.016000	0.18221	0.035000	0.18076	0.036000	0.12997	-0.270000	0.08584	0.300000	0.22699	0.305000	0.20034	CCC	-	MUC16	-	NULL		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	0	0	0	113	113	140	0.00	0.00	G	NM_024690		9084637	-1	10	25	35	66	tier1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	22.22	27.47	SNP	0.042	A	10	35
AGXT2	64902	genome.wustl.edu	37	5	35033586	35033586	+	Silent	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:35033586A>T	ENST00000231420.6	-	6	854	c.654T>A	c.(652-654)ccT>ccA	p.P218P	AC010368.1_ENST00000390793.2_RNA	NM_031900.3	NP_114106.1	Q9BYV1	AGT2_HUMAN	alanine--glyoxylate aminotransferase 2	218					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process, by transamination (GO:0019481)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-3-amino-2-methylpropionate-pyruvate transaminase activity (GO:0047305)|alanine-glyoxylate transaminase activity (GO:0008453)|beta-alanine-pyruvate transaminase activity (GO:0016223)|pyridoxal phosphate binding (GO:0030170)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(18)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	41	all_lung(31;4.52e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)	GBM - Glioblastoma multiforme(108;0.181)	Glycine(DB00145)|L-Alanine(DB00160)|Pyruvic acid(DB00119)	CTGTCCCACCAGGGAGTTCCA	0.463													ENSG00000113492																																					0													99.0	86.0	90.0					5																	35033586		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ292204	CCDS3908.1	5p13	2010-05-07	2010-05-07		ENSG00000113492	ENSG00000113492	2.6.1.44		14412	protein-coding gene	gene with protein product	"""beta-alanine-pyruvate aminotransferase"", ""beta-ALAAT II"""	612471	"""alanine-glyoxylate aminotransferase 2"""			15240345	Standard	NM_031900		Approved	AGT2	uc003jjf.3	Q9BYV1	OTTHUMG00000090788	ENST00000231420.6:c.654T>A	5.37:g.35033586A>T			B7ZM47|E9PDL7|Q53FB4|Q53FY7|Q53G03|Q5W7Q1	Silent	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase	p.P218	ENST00000231420.6	37	c.654	CCDS3908.1	5																																																																																			-	AGXT2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase		0.463	AGXT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2	HGNC	protein_coding	OTTHUMT00000207574.2	0	0	0	115	115	127	0.00	0.00	A	NM_031900		35033586	-1	14	32	50	97	tier1	no_errors	ENST00000231420	ensembl	human	known	74_37	silent	21.88	24.81	SNP	0.300	T	14	50
EML5	161436	genome.wustl.edu	37	14	89110777	89110777	+	Splice_Site	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr14:89110777C>A	ENST00000380664.5	-	28	4082	c.4083G>T	c.(4081-4083)gaG>gaT	p.E1361D	EML5_ENST00000554922.1_Splice_Site_p.E1369D|EML5_ENST00000352093.5_Splice_Site_p.E1323D			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1361						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TTTTCCTTACCTCTATAGGTC	0.428													ENSG00000165521																																					0													158.0	148.0	151.0					14																	89110777		1870	4090	5960	SO:0001630	splice_region_variant	0			-	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4083+1G>T	14.37:g.89110777C>A			B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1369D	ENST00000380664.5	37	c.4107	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	16.52	3.146804	0.57151	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.31769	1.48;1.48;1.48	5.0	5.0	0.66597	HELP (1);WD40 repeat-like-containing domain (1);	0.065914	0.64402	D	0.000013	T	0.42337	0.1198	L	0.42245	1.32	0.58432	D	0.999995	B;P	0.50156	0.032;0.932	B;P	0.54544	0.03;0.755	T	0.11591	-1.0581	9	.	.	.	-16.2142	18.2954	0.90145	0.0:1.0:0.0:0.0	.	1369;1361	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	D	1369;1323;1361	ENSP00000451998:E1369D;ENSP00000298315:E1323D;ENSP00000370039:E1361D	.	E	-	3	2	EML5	88180530	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	7.338000	0.79269	2.319000	0.78375	0.655000	0.94253	GAG	-	EML5	-	pfam_HELP		0.428	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	0	0	0	75	75	84	0.00	0.00	C		Missense_Mutation	89110777	-1	8	21	46	73	tier1	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	14.81	22.34	SNP	1.000	A	8	46
CFTR	1080	genome.wustl.edu	37	7	117199633	117199633	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:117199633A>G	ENST00000003084.6	+	11	1640	c.1508A>G	c.(1507-1509)aAa>aGa	p.K503R	CFTR_ENST00000454343.1_Missense_Mutation_p.K442R|AC000111.3_ENST00000441019.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	503	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GGCACCATTAAAGAAAATATC	0.373									Cystic Fibrosis				ENSG00000001626																																					0													91.0	92.0	92.0					7																	117199633		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	CF	-	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1508A>G	7.37:g.117199633A>G	ENSP00000003084:p.Lys503Arg		Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.K503R	ENST00000003084.6	37	c.1508	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	A	6.890	0.533613	0.13188	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.93189	-3.18;-3.18;-3.18	5.48	5.48	0.80851	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.047201	0.85682	D	0.000000	D	0.83709	0.5313	N	0.03324	-0.35	0.50632	D	0.99988	B	0.18013	0.025	B	0.29716	0.106	T	0.79037	-0.1967	10	0.02654	T	1	-28.9055	15.8605	0.79017	1.0:0.0:0.0:0.0	.	503	P13569	CFTR_HUMAN	R	503;442;473	ENSP00000003084:K503R;ENSP00000403677:K442R;ENSP00000389119:K473R	ENSP00000003084:K503R	K	+	2	0	CFTR	116986869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.877000	0.69675	2.197000	0.70478	0.533000	0.62120	AAA	-	CFTR	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel		0.373	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	0	0	0	96	96	59	0.00	0.00	A	NM_000492		117199633	+1	11	18	28	29	tier1	no_errors	ENST00000003084	ensembl	human	known	74_37	missense	28.21	38.30	SNP	1.000	G	11	28
EPHA7	2045	genome.wustl.edu	37	6	94066667	94066667	+	Silent	SNP	G	G	A	rs200560907		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr6:94066667G>A	ENST00000369303.4	-	5	1276	c.1092C>T	c.(1090-1092)acC>acT	p.T364T		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	364	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ATATTCTGTAGGTCACATCGT	0.483													ENSG00000135333																																					0													156.0	135.0	142.0					6																	94066667		2203	4300	6503	SO:0001819	synonymous_variant	0			-	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.1092C>T	6.37:g.94066667G>A			A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.T364	ENST00000369303.4	37	c.1092	CCDS5031.1	6																																																																																			rs200560907	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.483	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	0	0	0	152	152	127	0.00	0.00	G			94066667	-1	9	22	46	51	tier1	no_errors	ENST00000369303	ensembl	human	known	74_37	silent	16.36	30.14	SNP	1.000	A	9	46
PRLR	5618	genome.wustl.edu	37	5	35068325	35068325	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:35068325A>T	ENST00000382002.5	-	9	1274	c.848T>A	c.(847-849)cTg>cAg	p.L283Q	PRLR_ENST00000542609.1_Missense_Mutation_p.L283Q|PRLR_ENST00000348262.3_Intron|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000511486.1_Missense_Mutation_p.L182Q|PRLR_ENST00000513753.1_Missense_Mutation_p.L283Q|PRLR_ENST00000231423.3_Missense_Mutation_p.L283Q|PRLR_ENST00000342362.5_Missense_Mutation_p.L182Q|PRLR_ENST00000310101.5_Missense_Mutation_p.L283Q|PRLR_ENST00000509934.1_5'Flank	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	283					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	TACCTCCAACAGATGAGCATC	0.428													ENSG00000113494																																					0													173.0	155.0	161.0					5																	35068325		2203	4300	6503	SO:0001583	missense	0			-		CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.848T>A	5.37:g.35068325A>T	ENSP00000371432:p.Leu283Gln		B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L283Q	ENST00000382002.5	37	c.848	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	A	23.7	4.451157	0.84209	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000542609;ENST00000342362;ENST00000382002;ENST00000511486;ENST00000310101	D;D;D;T;T;T;T	0.86769	-1.51;-2.17;-1.89;-0.9;-0.9;-0.9;-1.48	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.94101	3.495	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.997;0.998	D	0.96338	0.9249	10	0.87932	D	0	-10.4519	15.9649	0.79961	1.0:0.0:0.0:0.0	.	283;182;283;283	P16471;P16471-2;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	Q	283;283;283;182;283;182;283	ENSP00000231423:L283Q;ENSP00000424841:L283Q;ENSP00000441813:L283Q;ENSP00000339213:L182Q;ENSP00000371432:L283Q;ENSP00000422556:L182Q;ENSP00000309008:L283Q	ENSP00000231423:L283Q	L	-	2	0	PRLR	35104082	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	7.954000	0.87848	2.232000	0.73038	0.533000	0.62120	CTG	-	PRLR	-	NULL		0.428	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	0	0	0	152	152	103	0.00	0.00	A			35068325	-1	22	19	61	64	tier1	no_errors	ENST00000382002	ensembl	human	known	74_37	missense	26.51	22.89	SNP	1.000	T	22	61
MIR646HG	284757	genome.wustl.edu	37	20	58883614	58883614	+	lincRNA	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr20:58883614A>T	ENST00000432910.1	+	0	332				MIR646_ENST00000385067.1_RNA	NR_046099.1																						ctgaggcctcaggctcagtgg	0.567													ENSG00000207802																																					0													65.0	64.0	64.0					20																	58883614		1568	3582	5150			0			-																													20.37:g.58883614A>T				R	SNP	-	NULL	ENST00000432910.1	37	NULL		20																																																																																			-	MIR646	-	-		0.567	RP5-1043L13.1-001	KNOWN	basic	lincRNA	MIR646	HGNC	lincRNA	OTTHUMT00000079947.1	0	0	0	72	72	36	0.00	0.00	A			58883614	+1	7	11	76	74	tier1	no_errors	ENST00000385067	ensembl	human	known	74_37	rna	8.43	12.94	SNP	0.001	T	7	76
GRIN3A	116443	genome.wustl.edu	37	9	104449456	104449456	+	Silent	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr9:104449456T>C	ENST00000361820.3	-	2	1326	c.726A>G	c.(724-726)ttA>ttG	p.L242L		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	242					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATGAATTTTCTAAACTCAGTT	0.368													ENSG00000198785																																					0													73.0	74.0	73.0					9																	104449456		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.726A>G	9.37:g.104449456T>C			B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.L242	ENST00000361820.3	37	c.726	CCDS6758.1	9																																																																																			-	GRIN3A	-	superfamily_Peripla_BP_I		0.368	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	0	0	0	76	76	78	0.00	0.00	T			104449456	-1	7	9	23	62	tier1	no_errors	ENST00000361820	ensembl	human	known	74_37	silent	23.33	12.68	SNP	1.000	C	7	23
MUC6	4588	genome.wustl.edu	37	11	1018666	1018666	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:1018666G>C	ENST00000421673.2	-	31	4185	c.4135C>G	c.(4135-4137)Caa>Gaa	p.Q1379E		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1379	Pro-rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCGTGGGTTGTCCTGGCTGT	0.607													ENSG00000184956																																					0													173.0	197.0	189.0					11																	1018666		2171	4270	6441	SO:0001583	missense	0			-	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.4135C>G	11.37:g.1018666G>C	ENSP00000406861:p.Gln1379Glu		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.Q1379E	ENST00000421673.2	37	c.4135	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	g	7.533	0.659046	0.14645	.	.	ENSG00000184956	ENST00000421673	T	0.17213	2.29	1.39	0.436	0.16549	.	.	.	.	.	T	0.06234	0.0161	N	0.14661	0.345	0.09310	N	1	B	0.24426	0.103	B	0.09377	0.004	T	0.38866	-0.9641	9	0.02654	T	1	.	3.7332	0.08500	0.2518:0.0:0.7482:0.0	.	1379	Q6W4X9	MUC6_HUMAN	E	1379	ENSP00000406861:Q1379E	ENSP00000406861:Q1379E	Q	-	1	0	MUC6	1008666	0.000000	0.05858	0.000000	0.03702	0.509000	0.34042	-1.052000	0.03503	0.171000	0.19730	0.298000	0.19748	CAA	-	MUC6	-	NULL		0.607	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	0	0	0	180	180	152	0.00	0.00	G	XM_290540		1018666	-1	27	19	58	45	tier1	no_errors	ENST00000421673	ensembl	human	known	74_37	missense	31.76	29.23	SNP	0.000	C	27	58
CTRC	11330	genome.wustl.edu	37	1	15768968	15768968	+	Missense_Mutation	SNP	G	G	A	rs367979183		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:15768968G>A	ENST00000375949.4	+	4	282	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_Silent_p.P22P	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	86	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)	p.V86M(1)		endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCGTGTGGCCGTGGGAAAGAA	0.617													ENSG00000162438																																					1	Substitution - Missense(1)	large_intestine(1)						G	MET/VAL	0,4406		0,0,2203	132.0	87.0	102.0		256	2.5	1.0	1		102	1,8599		0,1,4299	no	missense	CTRC	NM_007272.2	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	86/269	15768968	1,13005	2203	4300	6503	SO:0001583	missense	0			-	BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.256G>A	1.37:g.15768968G>A	ENSP00000365116:p.Val86Met		A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.V86M	ENST00000375949.4	37	c.256	CCDS156.1	1	.	.	.	.	.	.	.	.	.	.	.	6.056	0.378699	0.11466	0.0	1.16E-4	ENSG00000162438	ENST00000375949	D	0.89552	-2.53	4.39	2.52	0.30459	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.239260	0.35436	N	0.003206	D	0.83142	0.5190	L	0.53729	1.69	0.80722	D	1	B;B	0.29612	0.251;0.039	B;B	0.23018	0.043;0.017	T	0.81104	-0.1084	10	0.59425	D	0.04	-11.4298	7.8498	0.29448	0.0:0.5931:0.3171:0.0898	.	86;86	A8MTQ9;Q99895	.;CTRC_HUMAN	M	86	ENSP00000365116:V86M	ENSP00000365116:V86M	V	+	1	0	CTRC	15641555	0.004000	0.15560	0.999000	0.59377	0.017000	0.09413	-0.006000	0.12833	1.204000	0.43247	-0.234000	0.12200	GTG	-	CTRC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.617	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTRC	HGNC	protein_coding	OTTHUMT00000006435.1	0	0	0	104	104	127	0.00	0.00	G	NM_007272		15768968	+1	42	88	16	36	tier1	no_errors	ENST00000375949	ensembl	human	known	74_37	missense	72.41	70.40	SNP	0.336	A	42	16
VEZT	55591	genome.wustl.edu	37	12	95693942	95693942	+	Splice_Site	SNP	C	C	T	rs529936457		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr12:95693942C>T	ENST00000436874.1	+	12	1938	c.1833C>T	c.(1831-1833)gcC>gcT	p.A611A	VEZT_ENST00000261219.6_Splice_Site_p.A563A|VEZT_ENST00000356859.4_3'UTR	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	611					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						tatttGAAGCCGTGTTGAAAT	0.303													ENSG00000028203	C|||	1	0.000199681	0.0	0.0	5008	,	,		15726	0.0		0.0	False		,,,				2504	0.001																0													12.0	10.0	11.0					12																	95693942		1723	3909	5632	SO:0001630	splice_region_variant	0			-	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.1832-1C>T	12.37:g.95693942C>T			Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Silent	SNP	NULL	p.A611	ENST00000436874.1	37	c.1833	CCDS44954.1	12																																																																																			-	VEZT	-	NULL		0.303	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEZT	HGNC	protein_coding	OTTHUMT00000407804.2	0	0	0	150	150	48	0.00	0.00	C	NM_017599	Silent	95693942	+1	18	25	50	30	tier1	no_errors	ENST00000436874	ensembl	human	known	74_37	silent	26.47	44.64	SNP	1.000	T	18	50
SEMA3C	10512	genome.wustl.edu	37	7	80374308	80374308	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:80374308C>G	ENST00000265361.3	-	18	2719	c.2158G>C	c.(2158-2160)Gat>Cat	p.D720H	SEMA3C_ENST00000419255.2_Missense_Mutation_p.D720H|SEMA3C_ENST00000544525.1_Missense_Mutation_p.D738H	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	720					axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGTGATTCATCTCCCTGCTGA	0.458													ENSG00000075223																																					0													154.0	140.0	145.0					7																	80374308		2203	4300	6503	SO:0001583	missense	0			-	AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.2158G>C	7.37:g.80374308C>G	ENSP00000265361:p.Asp720His		B4DRL8	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Ig_I-set,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,pfscan_Semap_dom,pfscan_Ig-like_dom	p.D738H	ENST00000265361.3	37	c.2212	CCDS5596.1	7	.	.	.	.	.	.	.	.	.	.	C	5.822	0.335856	0.11013	.	.	ENSG00000075223	ENST00000265361;ENST00000419255;ENST00000544525	T;T;T	0.26373	1.75;1.75;1.74	5.43	5.43	0.79202	.	0.540246	0.20281	N	0.095453	T	0.17831	0.0428	N	0.08118	0	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.002	T	0.07158	-1.0787	10	0.51188	T	0.08	.	19.2296	0.93833	0.0:1.0:0.0:0.0	.	738;720	F5H1Z7;Q99985	.;SEM3C_HUMAN	H	720;720;738	ENSP00000265361:D720H;ENSP00000411193:D720H;ENSP00000445649:D738H	ENSP00000265361:D720H	D	-	1	0	SEMA3C	80212244	0.989000	0.36119	0.246000	0.24233	0.024000	0.10985	3.736000	0.55052	2.560000	0.86352	0.557000	0.71058	GAT	-	SEMA3C	-	NULL		0.458	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	HGNC	protein_coding	OTTHUMT00000253279.1	0	0	0	71	71	99	0.00	0.00	C	NM_006379		80374308	-1	15	17	24	32	tier1	no_errors	ENST00000544525	ensembl	human	known	74_37	missense	38.46	34.69	SNP	0.521	G	15	24
FAT2	2196	genome.wustl.edu	37	5	150930375	150930375	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:150930375G>A	ENST00000261800.5	-	7	4366	c.4354C>T	c.(4354-4356)Cgt>Tgt	p.R1452C		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1452	Cadherin 13. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACTTCATAACGAGTTTCCAGA	0.537													ENSG00000086570																																					0													88.0	85.0	86.0					5																	150930375		2203	4300	6503	SO:0001583	missense	0			-	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.4354C>T	5.37:g.150930375G>A	ENSP00000261800:p.Arg1452Cys		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R1452C	ENST00000261800.5	37	c.4354	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580863	0.28180	.	.	ENSG00000086570	ENST00000261800	T	0.61158	0.13	5.0	4.1	0.47936	Cadherin (2);Cadherin-like (1);	0.822775	0.10897	N	0.622075	T	0.49338	0.1551	L	0.56280	1.765	0.09310	N	1	P	0.47762	0.9	B	0.34038	0.174	T	0.38520	-0.9657	10	0.52906	T	0.07	.	12.3038	0.54889	0.0:0.0:0.6918:0.3082	.	1452	Q9NYQ8	FAT2_HUMAN	C	1452	ENSP00000261800:R1452C	ENSP00000261800:R1452C	R	-	1	0	FAT2	150910568	1.000000	0.71417	0.103000	0.21229	0.494000	0.33585	4.293000	0.59037	1.040000	0.40099	0.655000	0.94253	CGT	-	FAT2	-	superfamily_Cadherin-like,pfscan_Cadherin		0.537	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	0	0	0	76	76	137	0.00	0.00	G	NM_001447		150930375	-1	19	16	27	43	tier1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	40.43	27.12	SNP	0.053	A	19	27
SLCO2B1	11309	genome.wustl.edu	37	11	74911337	74911337	+	Silent	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:74911337G>A	ENST00000289575.5	+	11	2063	c.1668G>A	c.(1666-1668)acG>acA	p.T556T	SLCO2B1_ENST00000454962.2_Silent_p.T329T|SLCO2B1_ENST00000428359.2_Silent_p.T534T|SLCO2B1_ENST00000532236.1_Silent_p.T440T|SLCO2B1_ENST00000525650.1_Silent_p.T412T|SLCO2B1_ENST00000531756.1_Silent_p.T301T|SLCO2B1_ENST00000341411.4_Silent_p.T329T	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	556					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	GCGACTCAACGTGCAGCCATC	0.602													ENSG00000137491																																					0													126.0	114.0	118.0					11																	74911337		2200	4293	6493	SO:0001819	synonymous_variant	0			-	AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.1668G>A	11.37:g.74911337G>A			A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.T556	ENST00000289575.5	37	c.1668	CCDS8235.1	11																																																																																			-	SLCO2B1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter		0.602	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLCO2B1	HGNC	protein_coding	OTTHUMT00000383933.1	0	0	0	51	51	32	0.00	0.00	G	NM_007256		74911337	+1	14	9	6	18	tier1	no_errors	ENST00000289575	ensembl	human	known	74_37	silent	70.00	33.33	SNP	0.994	A	14	6
GBA	2629	genome.wustl.edu	37	1	155205042	155205042	+	Silent	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:155205042C>T	ENST00000327247.5	-	11	1681	c.1449G>A	c.(1447-1449)ctG>ctA	p.L483L	GBA_ENST00000428024.3_Silent_p.L396L|GBA_ENST00000536770.1_Silent_p.L370L|GBA_ENST00000427500.3_Silent_p.L434L|GBA_ENST00000368373.3_Silent_p.L483L|AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000493842.1_5'Flank	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	483			L -> P (in GD1 and GD2; common mutation; associated with susceptibility to Parkinson disease; gene conversion; very low activity; alters protein stability). {ECO:0000269|PubMed:10360404, ECO:0000269|PubMed:10447266, ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:15605411, ECO:0000269|PubMed:19286695, ECO:0000269|PubMed:7627184, ECO:0000269|PubMed:8937765, ECO:0000269|PubMed:9061570, ECO:0000269|PubMed:9217217, ECO:0000269|PubMed:9851895}.|L -> R (in GD; severe).		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CCACTGCGTCCAGGTCGTTCT	0.582									Gaucher disease type I				ENSG00000177628																																					0													98.0	85.0	90.0					1																	155205042		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	glucocerebrosidase insufficiency	-	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.1449G>A	1.37:g.155205042C>T			A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Silent	SNP	pfam_Glyco_hydro_30,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_30	p.L483	ENST00000327247.5	37	c.1449	CCDS1102.1	1																																																																																			-	GBA	-	pfam_Glyco_hydro_30		0.582	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GBA	HGNC	protein_coding	OTTHUMT00000087204.1	0	0	0	128	128	76	0.00	0.00	C	NM_000157		155205042	-1	17	17	39	46	tier1	no_errors	ENST00000327247	ensembl	human	known	74_37	silent	30.36	26.98	SNP	1.000	T	17	39
MYH7	4625	genome.wustl.edu	37	14	23902315	23902315	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr14:23902315C>T	ENST00000355349.3	-	4	485	c.323G>A	c.(322-324)cGc>cAc	p.R108H		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	108	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GGAGCCGTAGCGATCCTTGAG	0.567													ENSG00000092054																																					0													234.0	159.0	184.0					14																	23902315		2203	4300	6503	SO:0001583	missense	0			-	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.323G>A	14.37:g.23902315C>T	ENSP00000347507:p.Arg108His		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R108H	ENST00000355349.3	37	c.323	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	c	16.13	3.036950	0.54896	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.98531	-4.98	3.76	3.76	0.43208	Myosin head, motor domain (2);	.	.	.	.	D	0.99211	0.9726	H	0.99770	4.765	0.58432	D	0.999999	B	0.32283	0.362	B	0.43889	0.435	D	0.99937	1.1366	9	0.87932	D	0	.	16.1486	0.81594	0.0:1.0:0.0:0.0	.	108	P12883	MYH7_HUMAN	H	108	ENSP00000347507:R108H	ENSP00000347507:R108H	R	-	2	0	MYH7	22972155	1.000000	0.71417	0.781000	0.31783	0.018000	0.09664	7.487000	0.81328	2.095000	0.63458	0.455000	0.32223	CGC	-	MYH7	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.567	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	0	0	0	116	116	55	0.00	0.00	C	NM_000257		23902315	-1	18	9	59	20	tier1	no_errors	ENST00000355349	ensembl	human	known	74_37	missense	23.38	30.00	SNP	1.000	T	18	59
KIF4A	24137	genome.wustl.edu	37	X	69595981	69595981	+	Missense_Mutation	SNP	G	G	A	rs35473790	byFrequency	TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chrX:69595981G>A	ENST00000374403.3	+	18	2037	c.1955G>A	c.(1954-1956)cGt>cAt	p.R652H	KIF4A_ENST00000374388.3_Missense_Mutation_p.R652H	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	652					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CAGTTAATGCGTCAAATGAAA	0.358													ENSG00000090889	G|||	2	0.000529801	0.0	0.0029	3775	,	,		14013	0.0		0.0	False		,,,				2504	0.0																0								G	HIS/ARG	2,3833		0,2,1630,571	79.0	73.0	75.0		1955	4.8	1.0	X	dbSNP_126	75	0,6728		0,0,2428,1872	yes	missense	KIF4A	NM_012310.4	29	0,2,4058,2443	AA,AG,GG,G		0.0,0.0522,0.0189	probably-damaging	652/1233	69595981	2,10561	2203	4300	6503	SO:0001583	missense	0			-	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1955G>A	X.37:g.69595981G>A	ENSP00000363524:p.Arg652His		B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R652H	ENST00000374403.3	37	c.1955	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	17.71	3.457185	0.63401	5.22E-4	0.0	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.18174	2.23;2.23	4.79	4.79	0.61399	.	0.000000	0.56097	D	0.000024	T	0.15478	0.0373	L	0.46157	1.445	0.80722	D	1	P;B	0.36535	0.557;0.354	B;B	0.28784	0.066;0.094	T	0.03641	-1.1017	10	0.87932	D	0	.	14.2249	0.65853	0.0:0.0:1.0:0.0	rs35473790	652;652	O95239;O95239-2	KIF4A_HUMAN;.	H	652	ENSP00000363509:R652H;ENSP00000363524:R652H	ENSP00000363509:R652H	R	+	2	0	KIF4A	69512706	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.335000	0.65929	2.347000	0.79759	0.594000	0.82650	CGT	rs35473790	KIF4A	-	NULL		0.358	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	0	0	0	78	78	5	0.00	0.00	G	NM_012310		69595981	+1	22	3	62	14	tier1	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	26.19	17.65	SNP	1.000	A	22	62
CD22	933	genome.wustl.edu	37	19	35835957	35835957	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr19:35835957G>C	ENST00000085219.5	+	11	2202	c.2136G>C	c.(2134-2136)tgG>tgC	p.W712C	CD22_ENST00000594250.1_Missense_Mutation_p.W535C|CD22_ENST00000536635.2_Missense_Mutation_p.W624C|CD22_ENST00000544992.2_Missense_Mutation_p.W712C|CD22_ENST00000341773.6_Missense_Mutation_p.W535C|CD22_ENST00000270311.6_Intron|CD22_ENST00000419549.2_Missense_Mutation_p.W540C|MIR5196_ENST00000578146.1_RNA	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	712					cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TTCTCAGTTGGAAGAGGACAC	0.557													ENSG00000012124																									Ovarian(42;1009 1133 23674 26041)												0													84.0	92.0	89.0					19																	35835957		2203	4300	6503	SO:0001583	missense	0			-	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.2136G>C	19.37:g.35835957G>C	ENSP00000085219:p.Trp712Cys		F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.W712C	ENST00000085219.5	37	c.2136	CCDS12457.1	19	.	.	.	.	.	.	.	.	.	.	G	14.75	2.627424	0.46944	.	.	ENSG00000012124	ENST00000085219;ENST00000536635;ENST00000341773;ENST00000544992;ENST00000419549	T;T;T;T;T	0.57273	0.92;0.53;0.41;0.88;0.99	5.32	5.32	0.75619	.	0.156294	0.30752	N	0.008957	T	0.71904	0.3395	M	0.76574	2.34	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.85130	0.95;0.992;0.996;0.921;0.997	T	0.75255	-0.3382	10	0.87932	D	0	.	14.497	0.67694	0.0:0.0:1.0:0.0	.	540;712;624;712;535	Q32M46;F5GYU4;F5H7U3;P20273;P20273-2	.;.;.;CD22_HUMAN;.	C	712;624;535;712;540	ENSP00000085219:W712C;ENSP00000442279:W624C;ENSP00000339349:W535C;ENSP00000441237:W712C;ENSP00000403822:W540C	ENSP00000085219:W712C	W	+	3	0	CD22	40527797	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	2.863000	0.48396	2.504000	0.84457	0.563000	0.77884	TGG	-	CD22	-	NULL		0.557	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	0	0	0	78	78	55	0.00	0.00	G	NM_001771		35835957	+1	17	7	40	35	tier1	no_errors	ENST00000085219	ensembl	human	known	74_37	missense	29.82	16.67	SNP	1.000	C	17	40
TCAIM	285343	genome.wustl.edu	37	3	44437985	44437985	+	Silent	SNP	A	A	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:44437985A>G	ENST00000342649.4	+	7	1216	c.789A>G	c.(787-789)gcA>gcG	p.A263A	TCAIM_ENST00000417237.1_Silent_p.A263A	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	263						mitochondrion (GO:0005739)											TTAAAAAAGCAAAAGGTAAAC	0.403													ENSG00000179152																																					0													31.0	30.0	30.0					3																	44437985		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.789A>G	3.37:g.44437985A>G			A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Silent	SNP	NULL	p.A263	ENST00000342649.4	37	c.789	CCDS2712.1	3																																																																																			-	TCAIM	-	NULL		0.403	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCAIM	HGNC	protein_coding	OTTHUMT00000256655.2	0	0	0	73	73	100	0.00	0.00	A	NM_173826		44437985	+1	32	48	13	13	tier1	no_errors	ENST00000342649	ensembl	human	known	74_37	silent	71.11	78.69	SNP	0.000	G	32	13
FAM160A1	729830	genome.wustl.edu	37	4	152559829	152559829	+	Splice_Site	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr4:152559829C>G	ENST00000505231.1	+	7	1306	c.1147C>G	c.(1147-1149)Ctt>Gtt	p.L383V	FAM160A1_ENST00000435205.1_Splice_Site_p.L383V			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	383										endometrium(2)|kidney(1)	3						TGCTTCCCAGCTTTGTGTGGT	0.378													ENSG00000164142																																					0													247.0	194.0	210.0					4																	152559829		692	1591	2283	SO:0001630	splice_region_variant	0			-		CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1147-1C>G	4.37:g.152559829C>G			Q6ZUS2	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.L383V	ENST00000505231.1	37	c.1147	CCDS47146.1	4	.	.	.	.	.	.	.	.	.	.	C	18.37	3.608077	0.66558	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.28454	1.61;1.61	5.59	5.59	0.84812	.	.	.	.	.	T	0.61949	0.2388	M	0.86651	2.83	0.47698	D	0.999497	D	0.55605	0.972	D	0.64687	0.928	T	0.65615	-0.6125	8	.	.	.	.	19.64	0.95754	0.0:1.0:0.0:0.0	.	383	Q05DH4	F16A1_HUMAN	V	383	ENSP00000413196:L383V;ENSP00000421580:L383V	.	L	+	1	0	FAM160A1	152779279	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	2.811000	0.47986	2.652000	0.90054	0.585000	0.79938	CTT	-	FAM160A1	-	pfam_RetinoicA-induced_16-like		0.378	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	0	0	0	188	188	87	0.00	0.00	C	NM_001109977	Missense_Mutation	152559829	+1	27	26	85	64	tier1	no_errors	ENST00000435205	ensembl	human	known	74_37	missense	24.11	28.89	SNP	1.000	G	27	85
RARS2	57038	genome.wustl.edu	37	6	88228563	88228563	+	Silent	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr6:88228563C>A	ENST00000369536.5	-	15	1329	c.1284G>T	c.(1282-1284)ggG>ggT	p.G428G	RARS2_ENST00000497828.1_5'UTR	NM_020320.3	NP_064716.2	Q5T160	SYRM_HUMAN	arginyl-tRNA synthetase 2, mitochondrial	428					arginyl-tRNA aminoacylation (GO:0006420)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0456)		GTGCTGCGAGCCCGACCCTCT	0.468													ENSG00000146282																																					0													85.0	83.0	84.0					6																	88228563		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK093934	CCDS5011.1	6q16.1	2011-07-01	2007-09-27	2007-02-23	ENSG00000146282	ENSG00000146282	6.1.1.19	"""Aminoacyl tRNA synthetases / Class I"""	21406	protein-coding gene	gene with protein product	"""arginine tRNA ligase 2, mitochondrial (putative)"""	611524	"""arginyl-tRNA synthetase-like"""	RARSL		17847012	Standard	NM_020320		Approved	MGC14993, MGC23778, PRO1992, dJ382I10.6, DALRD2	uc003pme.3	Q5T160	OTTHUMG00000015178	ENST00000369536.5:c.1284G>T	6.37:g.88228563C>A			B2RDT7|Q96FU5|Q9H8K8	Silent	SNP	pfam_Arg-tR-synth_Ia_core,pfam_DALR_anticod-bd,superfamily_tRsynth_1a_anticodon-bd,superfamily_Arg-tR-synth_N,smart_DALR_anticod-bd,prints_Arg-tR-synth_Ia_core,tigrfam_Arg-tR-ligase_Ia	p.G428	ENST00000369536.5	37	c.1284	CCDS5011.1	6																																																																																			-	RARS2	-	pfam_Arg-tR-synth_Ia_core,tigrfam_Arg-tR-ligase_Ia		0.468	RARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RARS2	HGNC	protein_coding	OTTHUMT00000041448.1	0	0	0	86	86	126	0.00	0.00	C	NM_020320		88228563	-1	38	52	14	17	tier1	no_errors	ENST00000369536	ensembl	human	known	74_37	silent	73.08	75.36	SNP	0.651	A	38	14
KLK9	284366	genome.wustl.edu	37	19	51506971	51506971	+	Missense_Mutation	SNP	C	C	A	rs199604724		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr19:51506971C>A	ENST00000594211.1	-	4	592	c.592G>T	c.(592-594)Ggt>Tgt	p.G198C	KLK8_ENST00000320838.5_5'Flank|KLK8_ENST00000347619.4_5'Flank|KLK8_ENST00000593490.1_5'Flank|KLK9_ENST00000250366.6_Missense_Mutation_p.G198C|KLK9_ENST00000376832.4_Missense_Mutation_p.G198C|CTB-147C22.9_ENST00000594512.1_RNA|KLK8_ENST00000391806.2_5'Flank|KLK8_ENST00000291726.7_5'Flank|KLK8_ENST00000600767.1_5'Flank			Q9UKQ9	KLK9_HUMAN	kallikrein-related peptidase 9	198	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)	7		all_neural(266;0.0652)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TGGCAGGAACCTCGGCCCCCC	0.592													ENSG00000269741																																					0													77.0	68.0	71.0					19																	51506971		2203	4300	6503	SO:0001583	missense	0			-	AF135026	CCDS12816.1	19q13.33	2008-02-05	2006-10-27					"""Kallikreins"""	6370	protein-coding gene	gene with protein product		605504	"""kallikrein 9"""			16800724, 16800723	Standard	NM_012315		Approved	KLK-L3	uc002pux.1	Q9UKQ9		ENST00000594211.1:c.592G>T	19.37:g.51506971C>A	ENSP00000469417:p.Gly198Cys		Q6QA55	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G198C	ENST00000594211.1	37	c.592	CCDS12816.1	19	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027004	0.75390	.	.	ENSG00000213022	ENST00000376832;ENST00000250366	D;D	0.93953	-3.32;-3.32	4.68	4.68	0.58851	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.95714	0.8606	M	0.65320	2	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.976	D	0.95944	0.8949	9	0.87932	D	0	.	15.4784	0.75504	0.0:1.0:0.0:0.0	.	198;198	Q2XQG6;Q9UKQ9	.;KLK9_HUMAN	C	198	ENSP00000366028:G198C;ENSP00000250366:G198C	ENSP00000250366:G198C	G	-	1	0	KLK9	56198783	0.997000	0.39634	0.951000	0.38953	0.929000	0.56500	3.978000	0.56881	2.598000	0.87819	0.561000	0.74099	GGT	-	KLK9	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A		0.592	KLK9-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KLK9	Uniprot_gn	protein_coding	OTTHUMT00000465226.1	0	0	0	87	87	85	0.00	0.00	C	NM_012315		51506971	-1	9	13	56	42	tier1	no_errors	ENST00000250366	ensembl	human	known	74_37	missense	13.85	23.64	SNP	0.994	A	9	56
ANKRD62	342850	genome.wustl.edu	37	18	12115475	12115475	+	Silent	SNP	T	T	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr18:12115475T>G	ENST00000587848.2	+	10	1347	c.1182T>G	c.(1180-1182)ccT>ccG	p.P394P	ANKRD62_ENST00000418274.2_3'UTR|ANKRD62_ENST00000314074.8_Silent_p.P380P			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	394										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATGAGTTGCCTTACTCTGATG	0.343													ENSG00000181626																																					0																																										SO:0001819	synonymous_variant	0			-	BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1182T>G	18.37:g.12115475T>G				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P380	ENST00000587848.2	37	c.1140		18																																																																																			-	ANKRD62	-	NULL		0.343	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	0	0	0	107	107	42	0.00	0.00	T	XM_001715728		12115475	+1	4	4	16	15	tier1	no_errors	ENST00000314074	ensembl	human	known	74_37	silent	20.00	21.05	SNP	0.001	G	4	16
PIK3R3	8503	genome.wustl.edu	37	1	46546420	46546420	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:46546420G>T	ENST00000262741.5	-	2	798	c.109C>A	c.(109-111)Ctt>Att	p.L37I	PIK3R3_ENST00000354242.4_Missense_Mutation_p.L37I|PIK3R3_ENST00000423209.1_Missense_Mutation_p.L37I|PIK3R3_ENST00000540385.1_Missense_Mutation_p.L83I|PIK3R3_ENST00000372006.1_Missense_Mutation_p.L37I|PIK3R3_ENST00000340332.6_Intron|PIK3R3_ENST00000420542.1_Missense_Mutation_p.L37I	NM_003629.3	NP_003620.3	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3 (gamma)	37	Pro-rich.				insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)			endometrium(1)|large_intestine(5)|lung(6)|prostate(2)	14	Acute lymphoblastic leukemia(166;0.155)				Isoprenaline(DB01064)	TTTGGTGGAAGAGCTAGAAGA	0.393													ENSG00000117461																																					0													198.0	208.0	204.0					1																	46546420		2203	4300	6503	SO:0001583	missense	0			-	BC021622	CCDS529.1	1p34.1	2013-02-14	2008-02-04		ENSG00000117461	ENSG00000117461		"""SH2 domain containing"""	8981	protein-coding gene	gene with protein product		606076				9524259	Standard	NM_003629		Approved	p55	uc001cpb.4	Q92569	OTTHUMG00000008096	ENST00000262741.5:c.109C>A	1.37:g.46546420G>T	ENSP00000262741:p.Leu37Ile		B2R9C1|D3DQ12|O60482|Q5T4P1|Q5T4P2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_PI3kinase_P85,prints_SH2	p.L83I	ENST00000262741.5	37	c.247	CCDS529.1	1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.158795	0.57368	.	.	ENSG00000117461	ENST00000372006;ENST00000262741;ENST00000420542;ENST00000354242;ENST00000540385;ENST00000423209;ENST00000425892	T;T;T;D;T;D;T	0.82255	-1.42;-1.42;-1.42;-1.59;-1.45;-1.59;0.88	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.90752	0.7097	M	0.76838	2.35	0.80722	D	1	D;P;B;B	0.71674	0.998;0.717;0.437;0.278	D;B;B;B	0.77557	0.99;0.165;0.143;0.051	D	0.89887	0.4034	10	0.37606	T	0.19	.	17.591	0.87997	0.0:0.0:1.0:0.0	.	83;70;37;37	F6TDL0;Q7Z3W2;Q92569-2;Q92569	.;.;.;P55G_HUMAN	I	37;37;37;37;83;37;37	ENSP00000361075:L37I;ENSP00000262741:L37I;ENSP00000412546:L37I;ENSP00000346188:L37I;ENSP00000439913:L83I;ENSP00000391431:L37I;ENSP00000416647:L37I	ENSP00000262741:L37I	L	-	1	0	PIK3R3	46319007	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.543000	0.82106	2.521000	0.84997	0.467000	0.42956	CTT	-	PIK3R3	-	NULL		0.393	PIK3R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R3	HGNC	protein_coding	OTTHUMT00000022171.1	0	0	0	119	119	97	0.00	0.00	G	NM_003629		46546420	-1	16	26	53	79	tier1	no_errors	ENST00000540385	ensembl	human	known	74_37	missense	23.19	24.76	SNP	1.000	T	16	53
ZNF215	7762	genome.wustl.edu	37	11	6977493	6977493	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:6977493C>A	ENST00000278319.5	+	7	1873	c.1285C>A	c.(1285-1287)Cat>Aat	p.H429N	ZNF215_ENST00000414517.2_Missense_Mutation_p.H429N|ZNF215_ENST00000529903.1_Intron	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	429					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		TCAAAAACTTCATGCTGAAGC	0.393													ENSG00000149054																																					0													78.0	77.0	77.0					11																	6977493		2201	4296	6497	SO:0001583	missense	0			-	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.1285C>A	11.37:g.6977493C>A	ENSP00000278319:p.His429Asn		Q96C84	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.H429N	ENST00000278319.5	37	c.1285	CCDS7775.1	11	.	.	.	.	.	.	.	.	.	.	C	15.80	2.941175	0.53079	.	.	ENSG00000149054	ENST00000278319;ENST00000414517	T;T	0.70869	-0.52;-0.52	4.74	3.83	0.44106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44285	D	0.000461	D	0.82692	0.5092	M	0.84156	2.68	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	D	0.84741	0.0751	10	0.87932	D	0	-13.2613	10.8648	0.46849	0.0:0.9077:0.0:0.0923	.	429	Q9UL58	ZN215_HUMAN	N	429	ENSP00000278319:H429N;ENSP00000393202:H429N	ENSP00000278319:H429N	H	+	1	0	ZNF215	6934069	1.000000	0.71417	0.378000	0.26068	0.331000	0.28603	7.141000	0.77330	1.366000	0.46076	0.655000	0.94253	CAT	-	ZNF215	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF215	HGNC	protein_coding	OTTHUMT00000384550.1	0	0	0	134	134	132	0.00	0.00	C			6977493	+1	14	26	46	52	tier1	no_errors	ENST00000278319	ensembl	human	known	74_37	missense	23.33	33.33	SNP	0.994	A	14	46
DOCK11	139818	genome.wustl.edu	37	X	117677515	117677515	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chrX:117677515C>A	ENST00000276202.7	+	4	414	c.351C>A	c.(349-351)taC>taA	p.Y117*	DOCK11_ENST00000276204.6_Nonsense_Mutation_p.Y117*	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	117	Interaction with activated CDC42. {ECO:0000250}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TGGTAAACTACAAGTATGAGG	0.353													ENSG00000147251																																					0													172.0	151.0	158.0					X																	117677515		2203	4300	6503	SO:0001587	stop_gained	0			-	AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.351C>A	X.37:g.117677515C>A	ENSP00000276202:p.Tyr117*		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Nonsense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Y117*	ENST00000276202.7	37	c.351	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	C	36	5.960679	0.97151	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	5.79	3.65	0.41850	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.7349	9.4507	0.38725	0.0:0.7913:0.0:0.2087	.	.	.	.	X	117	.	ENSP00000276202:Y117X	Y	+	3	2	DOCK11	117561543	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	1.972000	0.40540	0.395000	0.25257	0.544000	0.68410	TAC	-	DOCK11	-	pfam_DOCK_C/D_N		0.353	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	0	0	0	146	146	69	0.00	0.00	C	NM_144658		117677515	+1	96	71	58	37	tier1	no_errors	ENST00000276202	ensembl	human	known	74_37	nonsense	61.94	65.74	SNP	1.000	A	96	58
SLC5A10	125206	genome.wustl.edu	37	17	18880226	18880226	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:18880226C>G	ENST00000395645.3	+	9	924	c.906C>G	c.(904-906)atC>atG	p.I302M	SLC5A10_ENST00000395643.2_Missense_Mutation_p.I275M|SLC5A10_ENST00000395642.1_Missense_Mutation_p.I219M|SLC5A10_ENST00000317977.6_Missense_Mutation_p.I219M|FAM83G_ENST00000388995.6_Intron|SLC5A10_ENST00000417251.2_Missense_Mutation_p.I302M|FAM83G_ENST00000585154.2_Intron|SLC5A10_ENST00000395647.2_Missense_Mutation_p.I302M|FAM83G_ENST00000345041.4_Intron	NM_001042450.2	NP_001035915.1	A0PJK1	SC5AA_HUMAN	solute carrier family 5 (sodium/sugar cotransporter), member 10	302					sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(3)|ovary(3)|prostate(3)|skin(3)	24						CGGGCTCCATCCTGGCCAGCT	0.637													ENSG00000154025																																					0													123.0	93.0	103.0					17																	18880226		2203	4300	6503	SO:0001583	missense	0			-		CCDS11201.2, CCDS42275.1, CCDS59277.1, CCDS59278.1, CCDS74008.1	17p11.2	2013-07-19	2013-07-19		ENSG00000154025	ENSG00000154025		"""Solute carriers"""	23155	protein-coding gene	gene with protein product			"""solute carrier family 5 (sodium/glucose cotransporter), member 10"""				Standard	NM_152351		Approved	SGLT5	uc002gut.2	A0PJK1	OTTHUMG00000178143	ENST00000395645.3:c.906C>G	17.37:g.18880226C>G	ENSP00000379007:p.Ile302Met		A8MUC9|B4DPI0|B7WPR4|Q6P5X0|Q8IXM4|Q96LQ1	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.I302M	ENST00000395645.3	37	c.906	CCDS42275.1	17	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380013	0.82682	.	.	ENSG00000154025	ENST00000317977;ENST00000395647;ENST00000395642;ENST00000417251;ENST00000395645;ENST00000395643	D;D;D;D;D;D	0.90197	-2.63;-2.63;-2.63;-2.63;-2.63;-2.63	5.97	2.87	0.33458	.	0.000000	0.85682	D	0.000000	D	0.94522	0.8236	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.997;0.998;0.997;0.997	D;D;D;D;D	0.75020	0.985;0.975;0.985;0.975;0.975	D	0.93230	0.6616	10	0.87932	D	0	.	8.7972	0.34887	0.0:0.7379:0.1251:0.137	.	302;275;302;302;219	B4DPI0;A0PJK1-2;A0PJK1;A0PJK1-4;A0PJK1-3	.;.;SC5AA_HUMAN;.;.	M	219;302;219;302;302;275	ENSP00000324346:I219M;ENSP00000379008:I302M;ENSP00000379004:I219M;ENSP00000401875:I302M;ENSP00000379007:I302M;ENSP00000379005:I275M	ENSP00000324346:I219M	I	+	3	3	SLC5A10	18820951	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.178000	0.42519	0.391000	0.25143	0.655000	0.94253	ATC	-	SLC5A10	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.637	SLC5A10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A10	HGNC	protein_coding	OTTHUMT00000132129.2	0	0	0	72	72	69	0.00	0.00	C	NM_152351		18880226	+1	26	14	111	96	tier1	no_errors	ENST00000395647	ensembl	human	known	74_37	missense	18.84	12.73	SNP	1.000	G	26	111
DDX46	9879	genome.wustl.edu	37	5	134106633	134106633	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:134106633A>G	ENST00000354283.4	+	4	526	c.391A>G	c.(391-393)Aaa>Gaa	p.K131E	DDX46_ENST00000452510.2_Missense_Mutation_p.K131E			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	131					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGAAAGTTCTAAAGAGAAGAA	0.299													ENSG00000145833																									Colon(13;391 453 4901 21675 24897)												0													49.0	57.0	54.0					5																	134106633		2203	4299	6502	SO:0001583	missense	0			-		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.391A>G	5.37:g.134106633A>G	ENSP00000346236:p.Lys131Glu		O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	pfam_D/R_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_R_helicase_DEAD_Q_motif	p.K131E	ENST00000354283.4	37	c.391	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	A	7.859	0.725701	0.15439	.	.	ENSG00000145833	ENST00000452510;ENST00000537371;ENST00000354283	T;T	0.33216	1.42;1.42	4.75	4.75	0.60458	.	0.215295	0.48767	D	0.000177	T	0.15869	0.0382	N	0.14661	0.345	0.34107	D	0.662537	B	0.23854	0.092	B	0.19666	0.026	T	0.12167	-1.0558	10	0.02654	T	1	-25.2715	13.3789	0.60757	1.0:0.0:0.0:0.0	.	131	Q7L014	DDX46_HUMAN	E	131	ENSP00000416534:K131E;ENSP00000346236:K131E	ENSP00000346236:K131E	K	+	1	0	DDX46	134134532	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	3.153000	0.50685	1.887000	0.54652	0.477000	0.44152	AAA	-	DDX46	-	NULL		0.299	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	HGNC	protein_coding	OTTHUMT00000371584.1	0	0	1	158	158	59	0.00	1.67	A	NM_014829		134106633	+1	25	21	51	37	tier1	no_errors	ENST00000452510	ensembl	human	known	74_37	missense	32.89	36.21	SNP	1.000	G	25	51
PDE1A	5136	genome.wustl.edu	37	2	183106701	183106701	+	Intron	SNP	T	T	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:183106701T>A	ENST00000410103.1	-	4	299				PDE1A_ENST00000435564.1_Intron|PDE1A_ENST00000351439.5_Intron|PDE1A_ENST00000331935.6_Intron|PDE1A_ENST00000358139.2_Intron|PDE1A_ENST00000346717.4_5'Flank|PDE1A_ENST00000409365.1_Intron|PDE1A_ENST00000482538.1_5'UTR|PDE1A_ENST00000456212.1_Intron|PDE1A_ENST00000536095.1_Intron	NM_001003683.2	NP_001003683.1	P54750	PDE1A_HUMAN	phosphodiesterase 1A, calmodulin-dependent						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of smooth muscle cell apoptotic process (GO:0034391)|regulation of smooth muscle cell proliferation (GO:0048660)|signal transduction (GO:0007165)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			endometrium(5)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(2)	35			OV - Ovarian serous cystadenocarcinoma(117;0.061)		Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	CTTGAAAATATCACTACTTTA	0.328													ENSG00000115252																																					0																																										SO:0001627	intron_variant	0			-		CCDS2285.1, CCDS33344.1, CCDS58741.1, CCDS74612.1	2q32.1	2008-03-18			ENSG00000115252	ENSG00000115252	3.1.4.17	"""Phosphodiesterases"""	8774	protein-coding gene	gene with protein product		171890				8557689, 11342109	Standard	NM_005019		Approved		uc010zfq.2	P54750	OTTHUMG00000132596	ENST00000410103.1:c.216-1682A>T	2.37:g.183106701T>A			D3DPG5|Q86VZ0|Q9C0K8|Q9C0K9|Q9C0L0|Q9C0L1|Q9C0L2|Q9C0L3|Q9C0L4|Q9UFX3	R	SNP	-	NULL	ENST00000410103.1	37	NULL	CCDS33344.1	2																																																																																			-	PDE1A	-	-		0.328	PDE1A-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PDE1A	HGNC	protein_coding	OTTHUMT00000334356.1	1	1	0	110	110	49	0.90	0.00	T			183106701	-1	23	50	27	47	tier1	no_errors	ENST00000482538	ensembl	human	known	74_37	rna	46.00	51.55	SNP	0.000	A	23	27
UNC13C	440279	genome.wustl.edu	37	15	54592542	54592542	+	Silent	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr15:54592542T>C	ENST00000260323.11	+	12	4239	c.4239T>C	c.(4237-4239)taT>taC	p.Y1413Y	UNC13C_ENST00000545554.1_Silent_p.Y1413Y|UNC13C_ENST00000537900.1_Silent_p.Y1411Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1413					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTATGCGTTATGGAATTGAAT	0.358													ENSG00000137766																																					0													99.0	90.0	93.0					15																	54592542		1843	4127	5970	SO:0001819	synonymous_variant	0			-	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4239T>C	15.37:g.54592542T>C			Q0P613|Q8ND48|Q96NP3	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Y1413	ENST00000260323.11	37	c.4239	CCDS45264.1	15																																																																																			-	UNC13C	-	NULL		0.358	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	0	0	0	107	107	82	0.00	0.00	T	NM_173166		54592542	+1	13	24	70	83	tier1	no_errors	ENST00000260323	ensembl	human	known	74_37	silent	15.48	22.43	SNP	0.999	C	13	70
SNHG16	100507246	genome.wustl.edu	37	17	74557646	74557646	+	RNA	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:74557646G>A	ENST00000363315.1	+	0	156				SNHG16_ENST00000364968.1_RNA|SNORD1B_ENST00000363091.1_RNA					small nucleolar RNA host gene 16 (non-protein coding)																		TGCTTTGCCGGAAACAAGTGA	0.428													ENSG00000163597																																					0																																												0			-	BC042949, BC100293, AB447886		17q25.1	2014-02-13			ENSG00000163597	ENSG00000163597		"""Long non-coding RNAs"", ""-"""	44352	non-coding RNA	RNA, long non-coding	"""non-coding RNA expressed in aggressive neuroblastoma"""					19287950, 21147498, 24519959	Standard	NR_038109		Approved	ncRAN	uc002jsd.2		OTTHUMG00000132201		17.37:g.74557646G>A				R	SNP	-	NULL	ENST00000363315.1	37	NULL		17																																																																																			-	SNHG16	-	-		0.428	SNHG16-201	KNOWN	basic	snoRNA	SNHG16	HGNC	processed_transcript		0	0	0	135	135	131	0.00	0.00	G	NR_038108		74557646	+1	39	56	135	141	tier1	no_errors	ENST00000591956	ensembl	human	known	74_37	rna	22.29	28.43	SNP	0.000	A	39	135
ANKRD62	342850	genome.wustl.edu	37	18	12115472	12115472	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr18:12115472G>T	ENST00000587848.2	+	10	1344	c.1179G>T	c.(1177-1179)ttG>ttT	p.L393F	ANKRD62_ENST00000418274.2_3'UTR|ANKRD62_ENST00000314074.8_Missense_Mutation_p.L379F			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	393										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATGATGAGTTGCCTTACTCTG	0.353													ENSG00000181626																																					0																																										SO:0001583	missense	0			-	BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1179G>T	18.37:g.12115472G>T	ENSP00000467740:p.Leu393Phe			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L379F	ENST00000587848.2	37	c.1137		18	.	.	.	.	.	.	.	.	.	.	G	9.767	1.171775	0.21704	.	.	ENSG00000181626	ENST00000314074;ENST00000418274	T;T	0.33865	1.39;1.39	1.69	0.787	0.18596	.	.	.	.	.	T	0.20820	0.0501	L	0.46819	1.47	0.09310	N	1	P	0.44344	0.833	B	0.30401	0.115	T	0.13442	-1.0509	9	0.30854	T	0.27	.	3.8851	0.09094	0.2346:0.0:0.7654:0.0	.	393	A6NC57	ANR62_HUMAN	F	379;115	ENSP00000326572:L379F;ENSP00000405628:L115F	ENSP00000326572:L379F	L	+	3	2	ANKRD62	12105472	0.004000	0.15560	0.002000	0.10522	0.008000	0.06430	0.417000	0.21214	0.265000	0.21872	0.313000	0.20887	TTG	-	ANKRD62	-	NULL		0.353	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	0	0	0	102	102	43	0.00	0.00	G	XM_001715728		12115472	+1	5	4	15	15	tier1	no_errors	ENST00000314074	ensembl	human	known	74_37	missense	25.00	21.05	SNP	0.002	T	5	15
AC134698.1	0	genome.wustl.edu	37	8	43415844	43415844	+	RNA	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr8:43415844G>T	ENST00000408368.1	+	0	34																											tctcactggggcctccaAAtg	0.522													ENSG00000221295																																					0																																												0			-																													8.37:g.43415844G>T				R	SNP	-	NULL	ENST00000408368.1	37	NULL		8																																																																																			-	AC134698.1	-	-		0.522	AC134698.1-201	NOVEL	basic	miRNA	ENSG00000221295	Clone_based_ensembl_gene	miRNA		1	1	0	173	173	22	0.57	0.00	G			43415844	+1	29	5	80	21	tier1	no_errors	ENST00000408368	ensembl	human	novel	74_37	rna	26.61	19.23	SNP	0.000	T	29	80
ZNF488	118738	genome.wustl.edu	37	10	48371038	48371038	+	Missense_Mutation	SNP	G	G	T	rs150285927		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr10:48371038G>T	ENST00000395702.2	+	2	733	c.506G>T	c.(505-507)cGa>cTa	p.R169L	ZNF488_ENST00000494156.1_3'UTR|ZNF488_ENST00000586537.1_Missense_Mutation_p.R62L			Q96MN9	ZN488_HUMAN	zinc finger protein 488	169					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						CCAACCAAGCGACCAGCAGAG	0.582													ENSG00000165388																																					0													72.0	71.0	71.0					10																	48371038		2203	4300	6503	SO:0001583	missense	0			-	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.506G>T	10.37:g.48371038G>T	ENSP00000379054:p.Arg169Leu		Q05CE0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R169L	ENST00000395702.2	37	c.506	CCDS7217.1	10	.	.	.	.	.	.	.	.	.	.	G	14.64	2.596223	0.46318	.	.	ENSG00000165388	ENST00000395702	T	0.23754	1.89	5.55	2.67	0.31697	.	1.052760	0.07456	N	0.899755	T	0.15912	0.0383	N	0.19112	0.55	0.21220	N	0.99976	B	0.31026	0.304	B	0.26416	0.069	T	0.28396	-1.0045	10	0.40728	T	0.16	.	6.1132	0.20112	0.1554:0.0:0.6942:0.1505	.	169	Q96MN9	ZN488_HUMAN	L	169	ENSP00000379054:R169L	ENSP00000379054:R169L	R	+	2	0	ZNF488	47991044	0.572000	0.26668	0.001000	0.08648	0.291000	0.27294	2.262000	0.43285	0.295000	0.22570	0.561000	0.74099	CGA	-	ZNF488	-	NULL		0.582	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF488	HGNC	protein_coding	OTTHUMT00000314632.1	0	0	0	78	78	103	0.00	0.00	G	NM_153034		48371038	+1	13	31	24	24	tier1	no_errors	ENST00000395702	ensembl	human	known	74_37	missense	35.14	56.36	SNP	0.559	T	13	24
SRL	6345	genome.wustl.edu	37	16	4257559	4257559	+	Intron	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr16:4257559G>A	ENST00000399609.3	-	2	74				SRL_ENST00000537996.1_Intron	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin							sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						CTTTGGCTCTGCTGTCCCTGC	0.672													ENSG00000185739																																					0																																										SO:0001627	intron_variant	0			-	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.62-2924C>T	16.37:g.4257559G>A				Missense_Mutation	SNP	NULL	p.A203V	ENST00000399609.3	37	c.608	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	g	18.56	3.650819	0.67472	.	.	ENSG00000185739	ENST00000330063	.	.	.	4.68	1.65	0.23941	.	.	.	.	.	T	0.25082	0.0609	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23583	-1.0184	5	0.25751	T	0.34	-1.2497	5.4251	0.16421	0.2497:0.1452:0.6051:0.0	.	.	.	.	V	203	.	ENSP00000333285:A203V	A	-	2	0	SRL	4197560	0.000000	0.05858	0.000000	0.03702	0.516000	0.34256	-0.101000	0.10973	0.301000	0.22738	0.447000	0.29281	GCA	-	SRL	-	NULL		0.672	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	0	0	0	77	77	30	0.00	0.00	G	XM_064152		4257559	-1	13	9	73	29	tier1	no_errors	ENST00000572111	ensembl	human	known	74_37	missense	15.12	23.68	SNP	0.000	A	13	73
FREM2	341640	genome.wustl.edu	37	13	39438633	39438633	+	Missense_Mutation	SNP	C	C	T	rs115492820		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr13:39438633C>T	ENST00000280481.7	+	16	8089	c.7873C>T	c.(7873-7875)Cgc>Tgc	p.R2625C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2625					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R2625C(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CACTACCTTGCGCTTCTACCG	0.453													ENSG00000150893																																					1	Substitution - Missense(1)	prostate(1)											150.0	139.0	142.0					13																	39438633		2203	4300	6503	SO:0001583	missense	0			-	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.7873C>T	13.37:g.39438633C>T	ENSP00000280481:p.Arg2625Cys		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.R2625C	ENST00000280481.7	37	c.7873	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583810	0.65992	.	.	ENSG00000150893	ENST00000280481	T	0.22743	1.94	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.54870	0.1885	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.62282	-0.6887	10	0.87932	D	0	.	19.3324	0.94297	0.0:1.0:0.0:0.0	.	2625;2625	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	C	2625	ENSP00000280481:R2625C	ENSP00000280481:R2625C	R	+	1	0	FREM2	38336633	1.000000	0.71417	0.991000	0.47740	0.352000	0.29268	3.875000	0.56108	2.651000	0.90000	0.650000	0.86243	CGC	-	FREM2	-	NULL		0.453	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	0	0	0	87	87	126	0.00	0.00	C	NM_207361		39438633	+1	31	43	39	50	tier1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	44.29	46.24	SNP	1.000	T	31	39
TMC6	11322	genome.wustl.edu	37	17	76117083	76117083	+	Intron	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:76117083C>T	ENST00000590602.1	-	12	1695				TMC6_ENST00000322914.3_Intron|TMC6_ENST00000306591.7_Intron|TMC6_ENST00000392467.3_Intron|TMC6_ENST00000591436.1_Intron|TMC6_ENST00000322933.4_Intron|TMC6_ENST00000589553.1_Missense_Mutation_p.A289T|TMC6_ENST00000592076.1_Intron			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6						ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TTTTCATGTGCGGCCACACAC	0.602													ENSG00000141524																																					0													44.0	43.0	44.0					17																	76117083		2203	4300	6503	SO:0001627	intron_variant	0			-	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1535+10G>A	17.37:g.76117083C>T			O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	NULL	p.A289T	ENST00000590602.1	37	c.865	CCDS32748.1	17																																																																																			-	TMC6	-	NULL		0.602	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1	1	1	0	137	137	65	0.72	0.00	C			76117083	-1	53	52	85	76	tier1	no_errors	ENST00000589553	ensembl	human	known	74_37	missense	38.13	40.62	SNP	0.000	T	53	85
TNFRSF11B	4982	genome.wustl.edu	37	8	119945327	119945327	+	Silent	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr8:119945327T>C	ENST00000297350.4	-	2	621	c.243A>G	c.(241-243)ctA>ctG	p.L81L		NM_002546.3	NP_002537.3	O00300	TR11B_HUMAN	tumor necrosis factor receptor superfamily, member 11b	81					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|negative regulation of bone resorption (GO:0045779)|negative regulation of odontogenesis of dentin-containing tooth (GO:0042489)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to magnesium ion (GO:0032026)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(3)|endometrium(4)|large_intestine(6)|lung(7)|prostate(3)|skin(1)	25	all_cancers(13;3.71e-26)|Lung NSC(37;1.69e-07)|Ovarian(258;0.018)|all_neural(195;0.0592)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00193)			GGCTGCAGTATAGACACTCGT	0.562													ENSG00000164761																																					0													160.0	143.0	148.0					8																	119945327		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U94332	CCDS6326.1	8q24	2008-07-31	2008-07-31		ENSG00000164761	ENSG00000164761		"""Tumor necrosis factor receptor superfamily"""	11909	protein-coding gene	gene with protein product		602643	"""osteoprotegerin"""	OPG		9108485	Standard	NM_002546		Approved	OCIF, TR1	uc003yon.4	O00300	OTTHUMG00000164969	ENST00000297350.4:c.243A>G	8.37:g.119945327T>C			B2R9A8|O60236|Q53FX6|Q9UHP4	Silent	SNP	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death_domain,superfamily_DEATH-like_dom,smart_TNFR/NGFR_Cys_rich_reg,smart_Death_domain,prints_TNFR_11B,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg	p.L81	ENST00000297350.4	37	c.243	CCDS6326.1	8																																																																																			-	TNFRSF11B	-	pirsf_TNFR_11B,pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_11,pfscan_TNFR/NGFR_Cys_rich_reg		0.562	TNFRSF11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF11B	HGNC	protein_coding	OTTHUMT00000381220.1	0	0	0	51	51	43	0.00	0.00	T			119945327	-1	9	7	36	22	tier1	no_errors	ENST00000297350	ensembl	human	known	74_37	silent	20.00	24.14	SNP	0.845	C	9	36
GAD2	2572	genome.wustl.edu	37	10	26518625	26518625	+	Silent	SNP	C	C	T	rs145045666		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr10:26518625C>T	ENST00000376261.3	+	7	1262	c.759C>T	c.(757-759)atC>atT	p.I253I	GAD2_ENST00000259271.3_Silent_p.I253I	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	253					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)	p.I253I(2)		central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCATGATGATCGCACGCTTTA	0.428													ENSG00000136750																																					2	Substitution - coding silent(2)	lung(1)|skin(1)						C	,	0,4406		0,0,2203	222.0	179.0	193.0		759,759	-10.7	0.1	10	dbSNP_134	193	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GAD2	NM_000818.2,NM_001134366.1	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	253/586,253/586	26518625	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.759C>T	10.37:g.26518625C>T			Q9UD87	Silent	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase	p.I253	ENST00000376261.3	37	c.759	CCDS7149.1	10																																																																																			rs145045666	GAD2	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase		0.428	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	GAD2	HGNC	protein_coding	OTTHUMT00000047255.1	0	0	0	71	71	74	0.00	0.00	C	NM_000818		26518625	+1	36	31	17	12	tier1	no_errors	ENST00000259271	ensembl	human	known	74_37	silent	67.92	72.09	SNP	0.538	T	36	17
CDH12	1010	genome.wustl.edu	37	5	21975456	21975456	+	Silent	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:21975456T>C	ENST00000382254.1	-	6	1356	c.270A>G	c.(268-270)aaA>aaG	p.K90K	CDH12_ENST00000522262.1_Silent_p.K90K|CDH12_ENST00000504376.2_Silent_p.K90K	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	90	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						AGAGGGTGTATTTCACAGTGC	0.463										HNSCC(59;0.17)			ENSG00000154162																																					0													67.0	67.0	67.0					5																	21975456		2046	3889	5935	SO:0001819	synonymous_variant	0			-	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.270A>G	5.37:g.21975456T>C			B2RBT1|B7Z2U6|Q86UD2	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K90	ENST00000382254.1	37	c.270	CCDS3890.1	5																																																																																			-	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.463	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	0	0	0	566	566	117	0.00	0.00	T	NM_004061		21975456	-1	94	16	171	31	tier1	no_errors	ENST00000382254	ensembl	human	known	74_37	silent	35.47	34.04	SNP	1.000	C	94	171
LOXHD1	125336	genome.wustl.edu	37	18	44063558	44063558	+	Silent	SNP	G	G	A	rs374858340		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr18:44063558G>A	ENST00000398722.4	-	33	5498	c.5499C>T	c.(5497-5499)taC>taT	p.Y1833Y	LOXHD1_ENST00000398705.2_Silent_p.Y350Y|LOXHD1_ENST00000300591.6_Silent_p.Y1000Y|LOXHD1_ENST00000398686.4_Silent_p.Y350Y|LOXHD1_ENST00000579038.1_Silent_p.Y904Y|LOXHD1_ENST00000582408.1_Silent_p.Y938Y|LOXHD1_ENST00000536736.1_Silent_p.Y2049Y|LOXHD1_ENST00000441551.2_Silent_p.Y1905Y|LOXHD1_ENST00000441893.2_Silent_p.Y982Y			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1833	PLAT 13. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						ACACATTGCCGTACTCCATCT	0.572													ENSG00000167210																																					0								G	,,,	0,1384		0,0,692	99.0	78.0	85.0		3000,1050,1050,6147	-7.5	0.1	18		85	1,3181		0,1,1590	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	LOXHD1	NM_001145472.2,NM_001145473.2,NM_001173129.1,NM_144612.6	,,,	0,1,2282	AA,AG,GG		0.0314,0.0,0.0219	,,,	1000/1115,350/513,350/458,2049/2212	44063558	1,4565	692	1591	2283	SO:0001819	synonymous_variant	0			-	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5499C>T	18.37:g.44063558G>A			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.Y2049	ENST00000398722.4	37	c.6147		18																																																																																			-	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pfscan_PLAT/LH2_dom		0.572	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		0	0	0	104	104	67	0.00	0.00	G	NM_144612		44063558	-1	19	12	53	33	tier1	no_errors	ENST00000536736	ensembl	human	known	74_37	silent	26.39	26.67	SNP	0.057	A	19	53
ESR2	2100	genome.wustl.edu	37	14	64724010	64724010	+	Missense_Mutation	SNP	C	C	T	rs553390407		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr14:64724010C>T	ENST00000341099.4	-	6	1442	c.1025G>A	c.(1024-1026)gGg>gAg	p.G342E	ESR2_ENST00000554572.1_Missense_Mutation_p.G342E|ESR2_ENST00000553796.1_Missense_Mutation_p.G342E|ESR2_ENST00000557772.1_Missense_Mutation_p.G342E|ESR2_ENST00000555278.1_Missense_Mutation_p.G342E|ESR2_ENST00000542956.1_Missense_Mutation_p.G342E|ESR2_ENST00000357782.2_Missense_Mutation_p.G342E|ESR2_ENST00000353772.3_Missense_Mutation_p.G342E|ESR2_ENST00000358599.5_Missense_Mutation_p.G342E|ESR2_ENST00000267525.6_Intron|ESR2_ENST00000555483.1_5'UTR	NM_001437.2	NP_001428.1	Q92731	ESR2_HUMAN	estrogen receptor 2 (ER beta)	342	Steroid-binding.				brain development (GO:0007420)|cell-cell signaling (GO:0007267)|epithelial cell maturation involved in prostate gland development (GO:0060743)|extracellular negative regulation of signal transduction (GO:1900116)|gene expression (GO:0010467)|hormone-mediated apoptotic signaling pathway (GO:0008628)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|ovarian follicle development (GO:0001541)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|uterus development (GO:0060065)|vagina development (GO:0060068)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor antagonist activity (GO:0048019)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	23				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estropipate(DB04574)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CCACATCAGCCCCATCATTAA	0.517													ENSG00000140009	C|||	1	0.000199681	0.0008	0.0	5008	,	,		17614	0.0		0.0	False		,,,				2504	0.0																0													137.0	133.0	134.0					14																	64724010		2203	4300	6503	SO:0001583	missense	0			-	X99101	CCDS9762.1, CCDS32096.1, CCDS55920.1, CCDS61469.1, CCDS61470.1	14q21-q22	2013-01-16			ENSG00000140009	ENSG00000140009		"""Nuclear hormone receptors"""	3468	protein-coding gene	gene with protein product		601663				8769313	Standard	NM_001214902		Approved	NR3A2, Erb	uc001xha.1	Q92731	OTTHUMG00000141306	ENST00000341099.4:c.1025G>A	14.37:g.64724010C>T	ENSP00000343925:p.Gly342Glu		A8K8K5|G3V5M5|O60608|O60685|O60702|O60703|O75583|O75584|Q0MWT5|Q0MWT6|Q86Z31|Q9UEV6|Q9UHD3|Q9UQK9	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Estrogen_rcpt_beta_N,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.G342E	ENST00000341099.4	37	c.1025	CCDS9762.1	14	.	.	.	.	.	.	.	.	.	.	C	34	5.359421	0.95854	.	.	ENSG00000140009	ENST00000556275;ENST00000542956;ENST00000554572;ENST00000353772;ENST00000358599;ENST00000555278;ENST00000553796;ENST00000357782;ENST00000557772;ENST00000341099	D;D;D;D;D;D;D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85;-3.85	5.96	5.96	0.96718	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98492	0.9497	M	0.93375	3.41	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;0.999;1.0	D	0.98839	1.0754	10	0.87932	D	0	.	20.422	0.99049	0.0:1.0:0.0:0.0	.	342;342;342;342	Q92731;Q92731-6;Q92731-5;F1D8N3	ESR2_HUMAN;.;.;.	E	342	ENSP00000452485:G342E;ENSP00000441792:G342E;ENSP00000450699:G342E;ENSP00000335551:G342E;ENSP00000351412:G342E;ENSP00000450488:G342E;ENSP00000452426:G342E;ENSP00000350427:G342E;ENSP00000451582:G342E;ENSP00000343925:G342E	ENSP00000343925:G342E	G	-	2	0	ESR2	63793763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.747000	0.85070	2.832000	0.97577	0.655000	0.94253	GGG	-	ESR2	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.517	ESR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESR2	HGNC	protein_coding	OTTHUMT00000280621.1	0	0	0	88	88	95	0.00	0.00	C			64724010	-1	20	27	28	61	tier1	no_errors	ENST00000341099	ensembl	human	known	74_37	missense	41.67	30.68	SNP	1.000	T	20	28
GAR1	54433	genome.wustl.edu	37	4	110743600	110743600	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr4:110743600G>A	ENST00000226796.6	+	5	791	c.527G>A	c.(526-528)cGa>cAa	p.R176Q	GAR1_ENST00000394631.3_Missense_Mutation_p.R176Q	NM_018983.3	NP_061856.1	Q9NY12	GAR1_HUMAN	GAR1 ribonucleoprotein	176	RGG-box 2.				cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|pseudouridine synthesis (GO:0001522)|rRNA processing (GO:0006364)	box H/ACA snoRNP complex (GO:0031429)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cation channel activity (GO:0005261)|poly(A) RNA binding (GO:0044822)	p.R176L(1)		kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	9						aggggaggccgaggaggagga	0.498													ENSG00000109534																																					1	Substitution - Missense(1)	lung(1)											33.0	33.0	33.0					4																	110743600		2203	4300	6503	SO:0001583	missense	0			-	AJ276003	CCDS34050.1	4q	2013-07-31	2013-07-31	2008-10-13	ENSG00000109534	ENSG00000109534			14264	protein-coding gene	gene with protein product		606468	"""nucleolar protein family A, member 1 (H/ACA small nucleolar RNPs)"", ""GAR1 ribonucleoprotein homolog (yeast)"""	NOLA1		10757788	Standard	XM_005263069		Approved		uc003hzu.3	Q9NY12	OTTHUMG00000161108	ENST00000226796.6:c.527G>A	4.37:g.110743600G>A	ENSP00000226796:p.Arg176Gln		Q5MJQ2	Missense_Mutation	SNP	pfam_H/ACA_rnp_Gar1/Naf1,superfamily_Transl_B-barrel	p.R176Q	ENST00000226796.6	37	c.527	CCDS34050.1	4	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575622	0.65878	.	.	ENSG00000109534	ENST00000394631;ENST00000226796	T;T	0.28895	1.59;1.59	5.33	4.49	0.54785	.	0.193513	0.40728	N	0.001028	T	0.32704	0.0838	M	0.61703	1.905	0.46061	D	0.998843	B;B	0.06786	0.0;0.001	B;B	0.08055	0.001;0.003	T	0.09907	-1.0653	10	0.48119	T	0.1	.	13.6471	0.62288	0.0759:0.0:0.9241:0.0	.	176;176	Q9NY12-2;Q9NY12	.;GAR1_HUMAN	Q	176	ENSP00000378127:R176Q;ENSP00000226796:R176Q	ENSP00000226796:R176Q	R	+	2	0	GAR1	110963049	1.000000	0.71417	0.198000	0.23420	0.971000	0.66376	7.219000	0.78000	1.243000	0.43853	0.650000	0.86243	CGA	-	GAR1	-	pfam_H/ACA_rnp_Gar1/Naf1		0.498	GAR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GAR1	HGNC	protein_coding	OTTHUMT00000363810.2	0	0	0	88	88	119	0.00	0.00	G			110743600	+1	22	15	49	41	tier1	no_errors	ENST00000226796	ensembl	human	known	74_37	missense	30.99	26.79	SNP	0.692	A	22	49
CCL3	6348	genome.wustl.edu	37	17	34416094	34416094	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:34416094C>T	ENST00000225245.5	-	3	285	c.203G>A	c.(202-204)cGa>cAa	p.R68Q	AC069363.1_ENST00000441575.1_RNA|AC069363.1_ENST00000592728.1_RNA|AC069363.1_ENST00000590992.1_RNA	NM_002983.2	NP_002974.1	P10147	CCL3_HUMAN	chemokine (C-C motif) ligand 3	68		Involved in GAG binding.			astrocyte cell migration (GO:0043615)|behavior (GO:0007610)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|cell activation (GO:0001775)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to organic cyclic compound (GO:0071407)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|eosinophil degranulation (GO:0043308)|exocytosis (GO:0006887)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymphocyte chemotaxis (GO:0048247)|macrophage chemotaxis (GO:0048246)|MAPK cascade (GO:0000165)|monocyte chemotaxis (GO:0002548)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|negative regulation of osteoclast differentiation (GO:0045671)|neutrophil chemotaxis (GO:0030593)|osteoblast differentiation (GO:0001649)|positive chemotaxis (GO:0050918)|positive regulation of calcium ion import (GO:0090280)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell migration (GO:0030335)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of tumor necrosis factor production (GO:0032760)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to cholesterol (GO:0070723)|response to toxic substance (GO:0009636)|signaling (GO:0023052)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)	calcium-dependent protein kinase C activity (GO:0004698)|CCR1 chemokine receptor binding (GO:0031726)|CCR5 chemokine receptor binding (GO:0031730)|chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|protein kinase activity (GO:0004672)			breast(2)|lung(3)|urinary_tract(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGCCGGCTTCGCTTGGTTAG	0.597													ENSG00000006075																																					0													109.0	109.0	109.0					17																	34416094		2203	4300	6503	SO:0001583	missense	0			-	M23178	CCDS11307.1	17q12	2014-05-06	2002-08-22	2002-08-23	ENSG00000006075	ENSG00000277632		"""Chemokine ligands"", ""Endogenous ligands"""	10627	protein-coding gene	gene with protein product		182283	"""small inducible cytokine A3 (homologous to mouse Mip-1a)"""	SCYA3			Standard	NM_002983		Approved	G0S19-1, LD78ALPHA, MIP-1-alpha	uc002hkv.3	P10147	OTTHUMG00000188413	ENST00000225245.5:c.203G>A	17.37:g.34416094C>T	ENSP00000225245:p.Arg68Gln			Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R68Q	ENST00000225245.5	37	c.203	CCDS11307.1	17	.	.	.	.	.	.	.	.	.	.	.	15.25	2.778830	0.49891	.	.	ENSG00000006075	ENST00000225245	T	0.05025	3.51	5.82	-5.86	0.02304	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.754623	0.12169	N	0.493209	T	0.15349	0.0370	.	.	.	0.37367	D	0.911476	D	0.67145	0.996	P	0.58620	0.842	T	0.20273	-1.0280	9	0.51188	T	0.08	.	15.0724	0.72049	0.0:0.1582:0.0:0.8418	.	68	P10147	CCL3_HUMAN	Q	68	ENSP00000225245:R68Q	ENSP00000225245:R68Q	R	-	2	0	CCL3	31440207	0.000000	0.05858	0.502000	0.27614	0.050000	0.14768	-1.119000	0.03276	-0.904000	0.03876	-0.145000	0.13849	CGA	-	CCL3	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom		0.597	CCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL3	HGNC	protein_coding	OTTHUMT00000256581.1	0	0	0	369	369	13	0.00	0.00	C	NM_002983		34416094	-1	31	5	191	11	tier1	no_errors	ENST00000225245	ensembl	human	known	74_37	missense	13.96	31.25	SNP	0.587	T	31	191
TSGA10	80705	genome.wustl.edu	37	2	99726018	99726018	+	5'UTR	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:99726018A>T	ENST00000410001.1	-	0	512				TSGA10_ENST00000393483.3_Intron|TSGA10_ENST00000355053.4_Intron|TSGA10_ENST00000542655.1_Intron|TSGA10_ENST00000539964.1_5'UTR|TSGA10_ENST00000478090.1_5'UTR			Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						ATCTAAAATTATCTTGCCAAA	0.303													ENSG00000135951																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000410001.1:c.-116T>A	2.37:g.99726018A>T			B7Z925|D3DVH7|Q8NEP0|Q9BWX0	R	SNP	-	NULL	ENST00000410001.1	37	NULL	CCDS2037.1	2																																																																																			-	TSGA10	-	-		0.303	TSGA10-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000329920.1	0	0	0	73	73	39	0.00	0.00	A	NM_182911		99726018	-1	12	17	53	61	tier1	no_errors	ENST00000471174	ensembl	human	known	74_37	rna	18.46	21.79	SNP	1.000	T	12	53
IL25	64806	genome.wustl.edu	37	14	23844881	23844881	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr14:23844881G>A	ENST00000329715.2	+	2	584	c.326G>A	c.(325-327)cGt>cAt	p.R109H	CMTM5_ENST00000342473.4_5'Flank|CMTM5_ENST00000339180.4_5'Flank|CMTM5_ENST00000382809.2_5'Flank|CMTM5_ENST00000397227.3_5'Flank|IL25_ENST00000397242.2_Missense_Mutation_p.R93H|CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000359320.3_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	109					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		TACCACGCCCGTTGCCTGTGC	0.632													ENSG00000166090																																					0													92.0	92.0	92.0					14																	23844881		2203	4300	6503	SO:0001583	missense	0			-	AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.326G>A	14.37:g.23844881G>A	ENSP00000328111:p.Arg109His		Q2M3F0|Q8IZV3|Q8WXB0	Missense_Mutation	SNP	pfam_IL-17_fam	p.R109H	ENST00000329715.2	37	c.326	CCDS9597.1	14	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002157	0.74932	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.57273	0.41;0.41	4.6	3.71	0.42584	.	0.113462	0.40640	N	0.001059	T	0.62307	0.2417	L	0.51422	1.61	0.32325	N	0.56185	D;B	0.89917	1.0;0.163	D;B	0.75484	0.986;0.042	T	0.68424	-0.5412	10	0.56958	D	0.05	-24.8202	8.15	0.31134	0.1085:0.0:0.8915:0.0	.	109;93	Q9H293;Q9H293-2	IL25_HUMAN;.	H	93;109	ENSP00000380417:R93H;ENSP00000328111:R109H	ENSP00000328111:R109H	R	+	2	0	IL25	22914721	0.107000	0.21998	0.943000	0.38184	0.973000	0.67179	0.630000	0.24553	1.162000	0.42619	0.561000	0.74099	CGT	-	IL25	-	pfam_IL-17_fam		0.632	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL25	HGNC	protein_coding	OTTHUMT00000071789.2	0	0	0	103	103	65	0.00	0.00	G			23844881	+1	14	8	59	23	tier1	no_errors	ENST00000329715	ensembl	human	known	74_37	missense	19.18	25.81	SNP	0.940	A	14	59
RAB3GAP2	25782	genome.wustl.edu	37	1	220355632	220355632	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:220355632C>A	ENST00000358951.2	-	21	2393	c.2277G>T	c.(2275-2277)ttG>ttT	p.L759F		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	759					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		CAGCCGACTCCAAAGTGTGAC	0.428													ENSG00000118873																																					0													144.0	135.0	138.0					1																	220355632		2203	4300	6503	SO:0001583	missense	0			-	AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.2277G>T	1.37:g.220355632C>A	ENSP00000351832:p.Leu759Phe		A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.L759F	ENST00000358951.2	37	c.2277	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708572	0.89018	.	.	ENSG00000118873	ENST00000358951	T	0.36157	1.27	5.82	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.49729	0.1574	L	0.39898	1.24	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	T	0.40794	-0.9544	10	0.31617	T	0.26	.	14.7822	0.69774	0.0:0.9308:0.0:0.0692	.	759	Q9H2M9	RBGPR_HUMAN	F	759	ENSP00000351832:L759F	ENSP00000351832:L759F	L	-	3	2	RAB3GAP2	218422255	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	1.961000	0.40432	1.465000	0.48006	0.650000	0.86243	TTG	-	RAB3GAP2	-	NULL		0.428	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	0	0	1	72	72	130	0.00	0.75	C	NM_012414		220355632	-1	22	48	8	21	tier1	no_errors	ENST00000358951	ensembl	human	known	74_37	missense	73.33	69.57	SNP	1.000	A	22	8
PHACTR1	221692	genome.wustl.edu	37	6	13281385	13281385	+	Intron	SNP	G	G	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr6:13281385G>C	ENST00000379335.3	+	3	306				PHACTR1_ENST00000332995.7_Intron|RP1-257A7.4_ENST00000606150.1_RNA|PHACTR1_ENST00000379329.1_Intron|RP1-257A7.4_ENST00000399446.2_RNA|PHACTR1_ENST00000457702.2_Intron			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1						actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GTTCACTCCAGACTCTGCCAT	0.463													ENSG00000215022																																					0																																										SO:0001627	intron_variant	0			-	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379335.3:c.202-2269G>C	6.37:g.13281385G>C			A8K1V2|Q3MJ93|Q5JSJ2	R	SNP	-	NULL	ENST00000379335.3	37	NULL		6																																																																																			-	RP1-257A7.4	-	-		0.463	PHACTR1-003	KNOWN	basic|appris_candidate	protein_coding	ENSG00000215022	Clone_based_vega_gene	protein_coding	OTTHUMT00000039878.1	0	0	0	55	55	121	0.00	0.00	G	XM_166420		13281385	-1	10	18	15	64	tier1	no_errors	ENST00000606150	ensembl	human	known	74_37	rna	40.00	21.95	SNP	0.308	C	10	15
CXCL14	9547	genome.wustl.edu	37	5	134907552	134907552	+	Nonsense_Mutation	SNP	G	G	C	rs2547	byFrequency	TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:134907552G>C	ENST00000337225.5	-	4	791	c.327C>G	c.(325-327)taC>taG	p.Y109*	CTC-321K16.1_ENST00000509372.1_RNA|CXCL14_ENST00000512158.1_Nonsense_Mutation_p.Y97*	NM_004887.4	NP_004878.2	O95715	CXL14_HUMAN	chemokine (C-X-C motif) ligand 14	109					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|inner ear development (GO:0048839)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	chemokine activity (GO:0008009)			large_intestine(2)|lung(2)|prostate(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCTATTCTTCGTAGACCCTGG	0.433													ENSG00000145824																																					0													62.0	62.0	62.0					5																	134907552		2203	4300	6503	SO:0001587	stop_gained	0			-	AF073957	CCDS4188.1	5q31	2010-04-30	2002-08-22	2002-08-23	ENSG00000145824	ENSG00000145824			10640	protein-coding gene	gene with protein product	"""breast and kidney"""	604186	"""small inducible cytokine subfamily B (Cys-X-Cys), member 14 (BRAK)"""	SCYB14		10049774	Standard	NM_004887		Approved	BRAK, NJAC, bolekine, Kec, MIP-2g, BMAC, KS1	uc003lay.3	O95715	OTTHUMG00000129139	ENST00000337225.5:c.327C>G	5.37:g.134907552G>C	ENSP00000337065:p.Tyr109*		B3KQU8|Q6UW97|Q86U69|Q9BTR1|Q9NS21	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom	p.Y109*	ENST00000337225.5	37	c.327	CCDS4188.1	5	.	.	.	.	.	.	.	.	.	.	G	38	6.778123	0.97833	.	.	ENSG00000145824	ENST00000337225;ENST00000512158	.	.	.	4.64	-0.269	0.12930	.	0.083102	0.50627	D	0.000108	.	.	.	.	.	.	0.37117	P	0.09937300000000004	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.0532	7.6316	0.28243	0.5583:0.0:0.4417:0.0	.	.	.	.	X	109;97	.	ENSP00000337065:Y109X	Y	-	3	2	CXCL14	134935451	0.995000	0.38212	0.998000	0.56505	0.986000	0.74619	0.117000	0.15583	0.024000	0.15214	0.655000	0.94253	TAC	-	CXCL14	-	NULL		0.433	CXCL14-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL14	HGNC	protein_coding		0	0	0	97	97	70	0.00	0.00	G	NM_004887		134907552	-1	10	14	32	33	tier1	no_errors	ENST00000337225	ensembl	human	known	74_37	nonsense	23.81	29.79	SNP	0.998	C	10	32
RPS13	6207	genome.wustl.edu	37	11	17099248	17099248	+	5'UTR	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:17099248C>G	ENST00000525634.1	-	0	86				PIK3C2A_ENST00000531428.1_5'Flank|SNORD14B_ENST00000364533.1_RNA|RPS13_ENST00000228140.2_5'Flank|RPS13_ENST00000526895.1_5'UTR|SNORD14A_ENST00000606526.1_RNA			P62277	RS13_HUMAN	ribosomal protein S13						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of RNA splicing (GO:0033119)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)	5						GGAAGCCACCCAACACGCAGG	0.637													ENSG00000110700																																					0													31.0	40.0	37.0					11																	17099248		692	1591	2283	SO:0001623	5_prime_UTR_variant	0			-	X79239	CCDS7823.1	11p	2011-04-05			ENSG00000110700	ENSG00000110700		"""S ribosomal proteins"""	10386	protein-coding gene	gene with protein product	"""40S ribosomal protein S13"""	180476				8332508, 9582194	Standard	NM_001017		Approved	S13	uc001mmp.3	P62277	OTTHUMG00000165988	ENST00000525634.1:c.-60G>C	11.37:g.17099248C>G			B2R549|P19116|Q02546|Q29200|Q498Y0	R	SNP	-	NULL	ENST00000525634.1	37	NULL	CCDS7823.1	11																																																																																			-	RPS13	-	-		0.637	RPS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS13	HGNC	protein_coding	OTTHUMT00000387320.2	0	0	0	47	47	47	0.00	0.00	C	NM_001017		17099248	-1	9	12	24	13	tier1	no_errors	ENST00000526895	ensembl	human	known	74_37	rna	27.27	48.00	SNP	0.000	G	9	24
SCO1	6341	genome.wustl.edu	37	17	10590121	10590121	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:10590121C>G	ENST00000255390.5	-	5	754	c.694G>C	c.(694-696)Gaa>Caa	p.E232Q	SCO1_ENST00000577427.1_Missense_Mutation_p.E201Q|CTC-297N7.10_ENST00000584139.1_RNA	NM_004589.2	NP_004580.1	O75880	SCO1_HUMAN	SCO1 cytochrome c oxidase assembly protein	232					cellular copper ion homeostasis (GO:0006878)|copper ion transport (GO:0006825)|generation of precursor metabolites and energy (GO:0006091)|respiratory chain complex IV assembly (GO:0008535)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|myofibril (GO:0030016)	copper ion binding (GO:0005507)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	10						TCGACCTCTTCTCTCGTGCCA	0.418													ENSG00000133028																									Melanoma(128;591 1731 19711 31891 44645)												0													126.0	124.0	125.0					17																	10590121		2203	4300	6503	SO:0001583	missense	0			-	AF026852	CCDS11158.1	17p13.1	2012-10-15	2012-10-15		ENSG00000133028	ENSG00000133028		"""Mitochondrial respiratory chain complex assembly factors"""	10603	protein-coding gene	gene with protein product		603644	"""SCO (cytochrome oxidase deficient, yeast) homolog 1"", ""SCO cytochrome oxidase deficient homolog 1 (yeast)"""	SCOD1		9878253	Standard	NM_004589		Approved		uc002gmr.4	O75880	OTTHUMG00000130364	ENST00000255390.5:c.694G>C	17.37:g.10590121C>G	ENSP00000255390:p.Glu232Gln		B2RDM0	Missense_Mutation	SNP	pfam_SCO1/SenC,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2	p.E232Q	ENST00000255390.5	37	c.694	CCDS11158.1	17	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697197	0.48202	.	.	ENSG00000133028	ENST00000255390;ENST00000396047	D	0.88818	-2.43	5.88	3.57	0.40892	Thioredoxin-like fold (2);	0.251518	0.45606	D	0.000343	D	0.92489	0.7615	M	0.64676	1.99	0.36665	D	0.878165	D;P	0.67145	0.996;0.948	D;P	0.71184	0.972;0.711	D	0.94349	0.7577	10	0.56958	D	0.05	-16.9981	13.5491	0.61721	0.0:0.8534:0.0:0.1466	.	201;232	A8MY34;O75880	.;SCO1_HUMAN	Q	232;201	ENSP00000255390:E232Q	ENSP00000255390:E232Q	E	-	1	0	SCO1	10530846	1.000000	0.71417	0.980000	0.43619	0.063000	0.16089	5.759000	0.68785	1.495000	0.48549	0.555000	0.69702	GAA	-	SCO1	-	pfam_SCO1/SenC,pfam_AhpC/TSA,superfamily_Thioredoxin-like_fold,pirsf_Synth_of_cyt-c-oxidase_Sco1/2		0.418	SCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCO1	HGNC	protein_coding	OTTHUMT00000252729.2	0	0	0	72	72	96	0.00	0.00	C	NM_004589		10590121	-1	9	20	95	90	tier1	no_errors	ENST00000255390	ensembl	human	known	74_37	missense	8.65	18.18	SNP	0.616	G	9	95
SPAM1	6677	genome.wustl.edu	37	7	123594537	123594537	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:123594537C>T	ENST00000439500.1	+	4	1526	c.913C>T	c.(913-915)Cgc>Tgc	p.R305C	SPAM1_ENST00000223028.7_Missense_Mutation_p.R305C|SPAM1_ENST00000402183.2_Missense_Mutation_p.R305C|SPAM1_ENST00000460182.1_Missense_Mutation_p.R305C|SPAM1_ENST00000340011.5_Missense_Mutation_p.R305C	NM_001174045.1|NM_001174046.1	NP_001167516.1|NP_001167517.1	P38567	HYALP_HUMAN	sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding)	305					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	hyalurononglucosaminidase activity (GO:0004415)	p.R305S(2)		breast(1)|cervix(1)|endometrium(3)|kidney(5)|large_intestine(5)|lung(23)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TGCATATACCCGCATAGTTTT	0.388													ENSG00000106304																																					2	Substitution - Missense(2)	large_intestine(2)											36.0	36.0	36.0					7																	123594537		2203	4299	6502	SO:0001583	missense	0			-	L13781	CCDS5790.1, CCDS5791.1	7q31	2008-05-02			ENSG00000106304	ENSG00000106304			11217	protein-coding gene	gene with protein product		600930				8282124, 8575780	Standard	NM_153189		Approved	HYAL5, PH-20, SPAG15	uc003vle.3	P38567	OTTHUMG00000157284	ENST00000439500.1:c.913C>T	7.37:g.123594537C>T	ENSP00000402123:p.Arg305Cys		Q8TC30	Missense_Mutation	SNP	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase,prints_Hyaluronidase	p.R305C	ENST00000439500.1	37	c.913	CCDS5791.1	7	.	.	.	.	.	.	.	.	.	.	C	17.40	3.379524	0.61845	.	.	ENSG00000106304	ENST00000402183;ENST00000460182;ENST00000340011;ENST00000439500;ENST00000223028	T;T;T;T;T	0.27256	1.68;1.68;1.68;1.68;1.68	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.105283	0.64402	D	0.000004	T	0.66655	0.2811	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75283	-0.3372	9	.	.	.	-25.9732	19.8676	0.96824	0.0:1.0:0.0:0.0	.	305;305	Q8TC30;P38567	.;HYALP_HUMAN	C	305	ENSP00000386028:R305C;ENSP00000417934:R305C;ENSP00000345849:R305C;ENSP00000402123:R305C;ENSP00000223028:R305C	.	R	+	1	0	SPAM1	123381773	0.993000	0.37304	0.524000	0.27887	0.057000	0.15508	3.101000	0.50283	2.941000	0.99782	0.655000	0.94253	CGC	-	SPAM1	-	pfam_Hyaluronidase,superfamily_Glycoside_hydrolase_SF,pirsf_Hyaluronidase		0.388	SPAM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPAM1	HGNC	protein_coding	OTTHUMT00000348309.1	0	0	0	125	125	123	0.00	0.00	C			123594537	+1	25	19	27	29	tier1	no_errors	ENST00000340011	ensembl	human	known	74_37	missense	48.08	39.58	SNP	0.999	T	25	27
ATP8A2	51761	genome.wustl.edu	37	13	26436460	26436460	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr13:26436460G>A	ENST00000381655.2	+	33	3239	c.3097G>A	c.(3097-3099)Gga>Aga	p.G1033R	ATP8A2_ENST00000255283.8_Missense_Mutation_p.G968R|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	993					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GGCTGTCTGGGGAAGCATGCT	0.527													ENSG00000132932																																					0													154.0	144.0	148.0					13																	26436460		2015	4177	6192	SO:0001583	missense	0			-	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3097G>A	13.37:g.26436460G>A	ENSP00000371070:p.Gly1033Arg		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.G1033R	ENST00000381655.2	37	c.3097	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.145540	0.77888	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.75260	-0.92;-0.92	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.89111	0.6622	M	0.89534	3.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.993;0.997;0.993	D	0.91014	0.4852	10	0.87932	D	0	.	18.2203	0.89899	0.0:0.0:1.0:0.0	.	968;813;993	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	R	1033;968;813	ENSP00000371070:G1033R;ENSP00000255283:G968R	ENSP00000255283:G968R	G	+	1	0	ATP8A2	25334460	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	9.010000	0.93611	2.586000	0.87340	0.655000	0.94253	GGA	-	ATP8A2	-	tigrfam_ATPase_P-typ_Plipid-transp		0.527	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	0	0	0	132	132	110	0.00	0.00	G	NM_016529		26436460	+1	26	27	99	92	tier1	no_errors	ENST00000381655	ensembl	human	known	74_37	missense	20.80	22.50	SNP	1.000	A	26	99
LRP2	4036	genome.wustl.edu	37	2	170012824	170012824	+	Silent	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:170012824C>A	ENST00000263816.3	-	65	12396	c.12111G>T	c.(12109-12111)acG>acT	p.T4037T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4037	EGF-like 15; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)	p.T4037T(1)		biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACTCATAGACGTGAAGCCAT	0.438													ENSG00000081479																																					1	Substitution - coding silent(1)	lung(1)											190.0	175.0	180.0					2																	170012824		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12111G>T	2.37:g.170012824C>A			O00711|Q16215	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T4037	ENST00000263816.3	37	c.12111	CCDS2232.1	2																																																																																			-	LRP2	-	superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom		0.438	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	0	0	0	189	189	142	0.00	0.00	C	NM_004525		170012824	-1	17	34	91	88	tier1	no_errors	ENST00000263816	ensembl	human	known	74_37	silent	15.74	27.87	SNP	0.070	A	17	91
SNHG16	100507246	genome.wustl.edu	37	17	74557433	74557433	+	RNA	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:74557433G>A	ENST00000363315.1	+	0	156				SNHG16_ENST00000364968.1_RNA|SNORD1B_ENST00000363091.1_RNA					small nucleolar RNA host gene 16 (non-protein coding)																		TGTGGCAGCTGCTCTGAACCA	0.483													ENSG00000163597																																					0																																												0			-	BC042949, BC100293, AB447886		17q25.1	2014-02-13			ENSG00000163597	ENSG00000163597		"""Long non-coding RNAs"", ""-"""	44352	non-coding RNA	RNA, long non-coding	"""non-coding RNA expressed in aggressive neuroblastoma"""					19287950, 21147498, 24519959	Standard	NR_038109		Approved	ncRAN	uc002jsd.2		OTTHUMG00000132201		17.37:g.74557433G>A				R	SNP	-	NULL	ENST00000363315.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	G	8.047	0.765167	0.15914	.	.	ENSG00000163597	ENST00000448136	.	.	.	1.99	-2.59	0.06209	.	.	.	.	.	T	0.26412	0.0645	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38478	-0.9659	5	0.87932	D	0	.	0.5861	0.00720	0.179:0.2412:0.3361:0.2438	.	.	.	.	T	23	.	ENSP00000394384:A23T	A	+	1	0	AC090699.1	72069028	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-1.140000	0.03210	-0.233000	0.09797	-0.320000	0.08662	GCT	-	SNHG16	-	-		0.483	SNHG16-201	KNOWN	basic	snoRNA	SNHG16	HGNC	processed_transcript		0	0	0	72	72	185	0.00	0.00	G	NR_038108		74557433	+1	20	44	66	113	tier1	no_errors	ENST00000448136	ensembl	human	known	74_37	rna	23.26	27.85	SNP	0.000	A	20	66
HAVCR2	84868	genome.wustl.edu	37	5	156533780	156533780	+	Silent	SNP	T	T	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:156533780T>C	ENST00000307851.4	-	2	982	c.252A>G	c.(250-252)ctA>ctG	p.L84L	HAVCR2_ENST00000522593.1_Silent_p.L84L|HAVCR2_ENST00000517358.1_5'UTR|CTB-120L21.1_ENST00000517708.1_RNA	NM_032782.4	NP_116171.3	Q8TDQ0	HAVR2_HUMAN	hepatitis A virus cellular receptor 2	84	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				cervix(1)|large_intestine(4)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	22	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AATCCCCATTTAGCCAGTATC	0.498													ENSG00000135077																																					0													155.0	143.0	147.0					5																	156533780		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK027334	CCDS4333.1	5q34	2014-01-14			ENSG00000135077	ENSG00000135077		"""Immunoglobulin superfamily / V-set domain containing"""	18437	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 3"""	606652				11823861	Standard	NM_032782		Approved	Tim-3, TIM3, FLJ14428, TIMD3	uc003lwk.2	Q8TDQ0	OTTHUMG00000130249	ENST00000307851.4:c.252A>G	5.37:g.156533780T>C			B2RAY2|Q8WW60|Q96K94	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.L84	ENST00000307851.4	37	c.252	CCDS4333.1	5																																																																																			-	HAVCR2	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.498	HAVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAVCR2	HGNC	protein_coding	OTTHUMT00000252574.2	0	0	0	107	107	135	0.00	0.00	T			156533780	-1	18	22	38	47	tier1	no_errors	ENST00000307851	ensembl	human	known	74_37	silent	32.14	31.88	SNP	0.671	C	18	38
CHD5	26038	genome.wustl.edu	37	1	6195407	6195407	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:6195407T>A	ENST00000262450.3	-	18	2852	c.2753A>T	c.(2752-2754)aAg>aTg	p.K918M	CHD5_ENST00000378021.1_De_novo_Start_InFrame	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		ATGCAGCTTCTTGATCTGGTC	0.582													ENSG00000116254																																					0													77.0	76.0	76.0					1																	6195407		2203	4300	6503	SO:0001583	missense	0			-	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.2753A>T	1.37:g.6195407T>A	ENSP00000262450:p.Lys918Met		A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.K918M	ENST00000262450.3	37	c.2753	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429596	0.83776	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000536802;ENST00000538279	D	0.93426	-3.22	4.8	4.8	0.61643	SNF2-related (1);	0.000000	0.85682	D	0.000000	D	0.94335	0.8179	L	0.31845	0.965	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95188	0.8305	10	0.87932	D	0	-37.9288	14.6572	0.68841	0.0:0.0:0.0:1.0	.	918	Q8TDI0	CHD5_HUMAN	M	918;434;326;326	ENSP00000262450:K918M	ENSP00000262450:K918M	K	-	2	0	CHD5	6117994	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.854000	0.86942	1.938000	0.56188	0.459000	0.35465	AAG	-	CHD5	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.582	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	0	0	0	60	60	65	0.00	0.00	T	NM_015557		6195407	-1	19	11	49	27	tier1	no_errors	ENST00000262450	ensembl	human	known	74_37	missense	27.94	28.95	SNP	1.000	A	19	49
TECTA	7007	genome.wustl.edu	37	11	121061441	121061441	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:121061441G>T	ENST00000392793.1	+	24	6665	c.6394G>T	c.(6394-6396)Gtc>Ttc	p.V2132F	TECTA_ENST00000264037.2_Missense_Mutation_p.V2132F			O75443	TECTA_HUMAN	tectorin alpha	2132					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGAACTTCAAGTCTGGACGCT	0.393													ENSG00000109927																																					0													104.0	94.0	98.0					11																	121061441		2203	4299	6502	SO:0001583	missense	0			-	AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6394G>T	11.37:g.121061441G>T	ENSP00000376543:p.Val2132Phe			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.V2132F	ENST00000392793.1	37	c.6394	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380406	0.24944	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.38560	1.13;1.13	5.19	4.28	0.50868	.	0.229289	0.30593	N	0.009287	T	0.26048	0.0635	N	0.19112	0.55	0.28239	N	0.925787	P	0.37015	0.578	B	0.30029	0.11	T	0.13926	-1.0491	10	0.56958	D	0.05	.	12.4102	0.55464	0.0826:0.0:0.9173:0.0	.	2132	O75443	TECTA_HUMAN	F	2132	ENSP00000376543:V2132F;ENSP00000264037:V2132F	ENSP00000264037:V2132F	V	+	1	0	TECTA	120566651	0.983000	0.35010	0.613000	0.29037	0.147000	0.21601	2.226000	0.42963	1.173000	0.42796	0.650000	0.86243	GTC	-	TECTA	-	NULL		0.393	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	0	0	0	111	111	74	0.00	0.00	G	NM_005422		121061441	+1	19	20	19	23	tier1	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	50.00	46.51	SNP	0.984	T	19	19
ZNF971P	100419895	genome.wustl.edu	37	16	34681870	34681870	+	RNA	SNP	A	A	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr16:34681870A>T	ENST00000568619.1	-	0	609																											TGTGCTTGAAAGGAACTGAGG	0.328													ENSG00000214581																																					0																																												0			-																													16.37:g.34681870A>T				R	SNP	-	NULL	ENST00000568619.1	37	NULL		16																																																																																			-	RP11-80F22.10	-	-		0.328	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	0	0	0	32	32	55	0.00	0.00	A			34681870	-1	10	20	23	65	tier1	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	30.30	23.53	SNP	0.019	T	10	23
AMMECR1L	83607	genome.wustl.edu	37	2	128644476	128644476	+	5'Flank	SNP	A	A	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:128644476A>C	ENST00000272647.5	-	0	0				AMMECR1L_ENST00000393001.1_5'Flank|RP11-395A13.2_ENST00000609350.1_lincRNA	NM_001199140.1	NP_001186069.1	Q6DCA0	AMERL_HUMAN	AMMECR1-like											central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	9	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		CCGATTGATCACATTCTTCAG	0.418													ENSG00000272667																																					0													4.0	4.0	4.0					2																	128644476		613	1459	2072	SO:0001631	upstream_gene_variant	0			-		CCDS2152.1	2q21	2012-11-15	2012-11-15		ENSG00000144233	ENSG00000144233			28658	protein-coding gene	gene with protein product			"""AMME chromosomal region gene 1-like"""				Standard	NM_001199140		Approved	MGC4268	uc002tpl.3	Q6DCA0	OTTHUMG00000131535		2.37:g.128644476A>C	Exception_encountered		B4E276	R	SNP	-	NULL	ENST00000272647.5	37	NULL	CCDS2152.1	2																																																																																			-	RP11-395A13.2	-	-		0.418	AMMECR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000272667	Clone_based_vega_gene	protein_coding	OTTHUMT00000254392.1	0	0	0	139	139	88	0.00	0.00	A	NM_031445		128644476	+1	19	21	102	107	tier1	no_errors	ENST00000609350	ensembl	human	known	74_37	rna	15.70	16.41	SNP	0.002	C	19	102
AGR2	10551	genome.wustl.edu	37	7	16834610	16834610	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:16834610C>A	ENST00000419304.2	-	7	580	c.428G>T	c.(427-429)gGa>gTa	p.G143V	AGR2_ENST00000419572.2_Missense_Mutation_p.G163V|AGR2_ENST00000401412.1_Missense_Mutation_p.G143V	NM_006408.3	NP_006399.1	O95994	AGR2_HUMAN	anterior gradient 2	143					lung goblet cell differentiation (GO:0060480)|mucus secretion (GO:0070254)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	dystroglycan binding (GO:0002162)			endometrium(2)|lung(1)|prostate(1)|skin(2)	6	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		TGAATATCTTCCAGTGATATC	0.413													ENSG00000106541																																					0													140.0	114.0	123.0					7																	16834610		2203	4300	6503	SO:0001583	missense	0			-	AF038451	CCDS5364.1	7p21.3	2013-07-31	2013-07-31		ENSG00000106541	ENSG00000106541		"""Protein disulfide isomerases"""	328	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 17"""	606358	"""anterior gradient 2 homolog (Xenopus laevis)"""			9790916	Standard	NM_006408		Approved	XAG-2, HAG-2, AG2, PDIA17	uc003str.3	O95994	OTTHUMG00000023446	ENST00000419304.2:c.428G>T	7.37:g.16834610C>A	ENSP00000391490:p.Gly143Val			Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.G163V	ENST00000419304.2	37	c.488	CCDS5364.1	7	.	.	.	.	.	.	.	.	.	.	C	28.6	4.931096	0.92389	.	.	ENSG00000106541	ENST00000419304;ENST00000450569;ENST00000419572;ENST00000401412	T;T;T	0.59502	0.26;0.26;0.26	5.78	5.78	0.91487	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.76849	0.4045	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.77993	-0.2378	10	0.87932	D	0	-15.329	19.6222	0.95663	0.0:1.0:0.0:0.0	.	143	O95994	AGR2_HUMAN	V	143;73;163;143	ENSP00000391490:G143V;ENSP00000388342:G163V;ENSP00000386025:G143V	ENSP00000386025:G143V	G	-	2	0	AGR2	16801135	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.191000	0.77763	2.744000	0.94065	0.563000	0.77884	GGA	-	AGR2	-	superfamily_Thioredoxin-like_fold		0.413	AGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGR2	HGNC	protein_coding	OTTHUMT00000207594.2	0	0	0	99	99	79	0.00	0.00	C	NM_006408		16834610	-1	12	19	45	41	tier1	no_errors	ENST00000419572	ensembl	human	known	74_37	missense	21.05	31.67	SNP	1.000	A	12	45
SNHG16	100507246	genome.wustl.edu	37	17	74557370	74557370	+	RNA	SNP	G	G	C			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr17:74557370G>C	ENST00000363315.1	+	0	156				SNHG16_ENST00000364968.1_RNA|SNORD1B_ENST00000363091.1_RNA					small nucleolar RNA host gene 16 (non-protein coding)																		CTCTTCCCAGGTGCAGTCAGC	0.458													ENSG00000163597																																					0																																												0			-	BC042949, BC100293, AB447886		17q25.1	2014-02-13			ENSG00000163597	ENSG00000163597		"""Long non-coding RNAs"", ""-"""	44352	non-coding RNA	RNA, long non-coding	"""non-coding RNA expressed in aggressive neuroblastoma"""					19287950, 21147498, 24519959	Standard	NR_038109		Approved	ncRAN	uc002jsd.2		OTTHUMG00000132201		17.37:g.74557370G>C				R	SNP	-	NULL	ENST00000363315.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	G	9.044	0.990396	0.18966	.	.	ENSG00000163597	ENST00000448136	.	.	.	4.02	1.88	0.25563	.	.	.	.	.	T	0.51635	0.1686	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43491	-0.9388	4	.	.	.	.	5.0203	0.14358	0.1128:0.0:0.6834:0.2038	.	.	.	.	L	2	.	.	V	+	1	0	AC090699.1	72068965	0.904000	0.30761	0.094000	0.20943	0.012000	0.07955	0.554000	0.23407	0.913000	0.36797	0.555000	0.69702	GTG	-	SNHG16	-	-		0.458	SNHG16-201	KNOWN	basic	snoRNA	SNHG16	HGNC	processed_transcript		0	0	0	75	75	126	0.00	0.00	G	NR_038108		74557370	+1	26	28	53	84	tier1	no_errors	ENST00000448136	ensembl	human	known	74_37	rna	32.91	25.00	SNP	0.022	C	26	53
TRHDE	29953	genome.wustl.edu	37	12	72866951	72866951	+	Silent	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr12:72866951C>A	ENST00000261180.4	+	5	1536	c.1440C>A	c.(1438-1440)ggC>ggA	p.G480G		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	480					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TCTATCCTGGCTGGAACATGG	0.418													ENSG00000072657																																					0													263.0	233.0	243.0					12																	72866951		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1440C>A	12.37:g.72866951C>A			A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.G480	ENST00000261180.4	37	c.1440	CCDS9004.1	12																																																																																			-	TRHDE	-	pfam_Peptidase_M1_N		0.418	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	0	0	0	66	66	125	0.00	0.00	C	NM_013381		72866951	+1	8	32	27	113	tier1	no_errors	ENST00000261180	ensembl	human	known	74_37	silent	22.86	22.07	SNP	1.000	A	8	27
MME	4311	genome.wustl.edu	37	3	154834539	154834539	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:154834539delC	ENST00000460393.1	+	6	646	c.526delC	c.(526-528)caafs	p.Q176fs	MME_ENST00000462745.1_Frame_Shift_Del_p.Q176fs|MME_ENST00000492661.1_Frame_Shift_Del_p.Q176fs|MME_ENST00000493237.1_Frame_Shift_Del_p.Q176fs|MME_ENST00000360490.2_Frame_Shift_Del_p.Q176fs	NM_000902.3|NM_007287.2	NP_000893.2|NP_009218.2	P08473	NEP_HUMAN	membrane metallo-endopeptidase	176					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cellular protein metabolic process (GO:0044267)|cellular response to cytokine stimulus (GO:0071345)|cellular response to UV-A (GO:0071492)|cellular response to UV-B (GO:0071493)|creatinine metabolic process (GO:0046449)|kidney development (GO:0001822)|peptide metabolic process (GO:0006518)|proteolysis (GO:0006508)|replicative senescence (GO:0090399)|sensory perception of pain (GO:0019233)	axon (GO:0030424)|brush border (GO:0005903)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(31)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)|Liraglutide(DB06655)	AAACTGGGAGCAAAAATATGG	0.338													ENSG00000196549																																					0													55.0	57.0	56.0					3																	154834539		2200	4300	6500	SO:0001589	frameshift_variant	0					CCDS3172.1	3q25.2	2012-01-31	2007-02-21		ENSG00000196549	ENSG00000196549	3.4.24.11	"""CD molecules"""	7154	protein-coding gene	gene with protein product	"""neutral endopeptidase"", ""enkephalinase"", ""neprilysin"""	120520					Standard	NM_007287		Approved	CALLA, CD10, NEP	uc003fad.1	P08473	OTTHUMG00000158455	ENST00000460393.1:c.526delC	3.37:g.154834539delC	ENSP00000418525:p.Gln176fs		A8K6U6|D3DNJ9|Q3MIX4	Frame_Shift_Del	DEL	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.Q176fs	ENST00000460393.1	37	c.526	CCDS3172.1	3																																																																																				MME	-	pfam_Peptidase_M13_N		0.338	MME-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MME	HGNC	protein_coding	OTTHUMT00000351076.1	0	0	0	66	66	97	0.00	0.00	C	NM_000902		154834539	+1	11	25	38	84	tier1	no_errors	ENST00000360490	ensembl	human	known	74_37	frame_shift_del	22.45	22.94	DEL	0.001	-	11	38
PRPF38A	84950	genome.wustl.edu	37	1	52874411	52874412	+	Intron	INS	-	-	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	-	-	-	T	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr1:52874411_52874412insT	ENST00000257181.9	+	3	598				snoU13_ENST00000458879.1_RNA|PRPF38A_ENST00000474048.1_Intron	NM_032864.3	NP_116253.2	Q8NAV1	PR38A_HUMAN	pre-mRNA processing factor 38A						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			cervix(2)|kidney(1)|large_intestine(2)|liver(1)|lung(2)|stomach(1)	9						GCCAGTTTTTATTTTACCAGTA	0.391													ENSG00000134748																																					0																																										SO:0001627	intron_variant	0				AK092038	CCDS567.1	1p32.3	2013-10-03	2013-10-03		ENSG00000134748	ENSG00000134748			25930	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing A"""			12477932	Standard	NM_032864		Approved	FLJ14936, Prp38	uc001ctw.4	Q8NAV1	OTTHUMG00000008199	ENST00000257181.9:c.412+49->T	1.37:g.52874415_52874415dupT			Q96JW1|Q9BVZ8	R	INS	-	NULL	ENST00000257181.9	37	NULL	CCDS567.1	1																																																																																				PRPF38A	-	-		0.391	PRPF38A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38A	HGNC	protein_coding	OTTHUMT00000022459.2	0	0	0	73	73	120	0.00	0.00	-	NM_032864		52874412	+1	27	63	20	31	tier1	no_errors	ENST00000487160	ensembl	human	known	74_37	rna	57.45	67.02	INS	0.000:0.865	T	27	20
GOLGA2	2801	genome.wustl.edu	37	9	131028291	131028291	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr9:131028291delT	ENST00000421699.2	-	9	621	c.609delA	c.(607-609)aaafs	p.K203fs	GOLGA2_ENST00000609374.1_Frame_Shift_Del_p.K191fs	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	203					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GGTGGCATTCTTTCTTTTCCT	0.527													ENSG00000167110																																					0													191.0	171.0	178.0					9																	131028291		2203	4300	6503	SO:0001589	frameshift_variant	0				L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.609delA	9.37:g.131028291delT	ENSP00000416097:p.Lys203fs		Q6GRM9|Q9BRB0|Q9NYF9	Frame_Shift_Del	DEL	superfamily_CofA_tubulin-bd	p.E204fs	ENST00000421699.2	37	c.609	CCDS6896.2	9																																																																																				GOLGA2	-	NULL		0.527	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2	0	0	0	215	215	82	0.00	0.00	T	NM_004486		131028291	-1	45	26	68	30	tier1	no_errors	ENST00000421699	ensembl	human	known	74_37	frame_shift_del	39.82	46.43	DEL	0.997	-	45	68
FAT3	120114	genome.wustl.edu	37	11	92495307	92495307	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:92495307delT	ENST00000298047.6	+	4	3972	c.3955delT	c.(3955-3957)tttfs	p.F1319fs	FAT3_ENST00000525166.1_Frame_Shift_Del_p.F1169fs|RP11-203F8.1_ENST00000529884.1_RNA|FAT3_ENST00000409404.2_Frame_Shift_Del_p.F1319fs			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1319	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TAGAAAGCAGTTTACAGCAGG	0.448										TCGA Ovarian(4;0.039)			ENSG00000165323																																					0													72.0	69.0	70.0					11																	92495307		1885	4125	6010	SO:0001589	frameshift_variant	0				AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3955delT	11.37:g.92495307delT	ENSP00000298047:p.Phe1319fs		B5MDB0|Q96AU6	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.F1319fs	ENST00000298047.6	37	c.3955		11																																																																																				FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.448	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		0	0	0	86	86	96	0.00	0.00	T	NM_001008781		92495307	+1	23	50	13	21	tier1	no_errors	ENST00000298047	ensembl	human	known	74_37	frame_shift_del	63.89	70.42	DEL	1.000	-	23	13
CTNND2	1501	genome.wustl.edu	37	5	11084014	11084014	+	Intron	SNP	C	C	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:11084014C>A	ENST00000304623.8	-	16	2827				CTNND2_ENST00000495388.2_Intron|CTNND2_ENST00000458100.2_Intron|CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000359640.2_Intron|CTNND2_ENST00000511377.1_Intron	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						AGGGAGCCCCCTCTGGCAGTG	0.597													ENSG00000169862																																					0																																										SO:0001627	intron_variant	0			-	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2638-1056G>T	5.37:g.11084014C>A			B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E651D	ENST00000304623.8	37	c.1953	CCDS3881.1	5																																																																																			-	CTNND2	-	superfamily_ARM-type_fold		0.597	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1	0	0	0	161	161	6	0.00	0.00	C	NM_001332		11084014	-1	25	6	84	2	tier1	no_errors	ENST00000513588	ensembl	human	known	74_37	missense	22.94	75.00	SNP	1.000	A	25	84
EFCAB12	90288	genome.wustl.edu	37	3	129137259	129137259	+	Silent	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:129137259G>T	ENST00000505956.1	-	3	681	c.519C>A	c.(517-519)cgC>cgA	p.R173R	EFCAB12_ENST00000326085.3_Silent_p.R173R	NM_207307.1	NP_997190.1	Q6NXP0	EFC12_HUMAN	EF-hand calcium binding domain 12	173							calcium ion binding (GO:0005509)										GCACCATCTGGCGGGACAGCC	0.607													ENSG00000172771																																					0													26.0	26.0	26.0					3																	129137259		1893	4113	6006	SO:0001819	synonymous_variant	0			-	AK096099	CCDS54638.1	3q21.3	2013-01-10	2012-07-20	2012-07-20	ENSG00000172771	ENSG00000172771		"""EF-hand domain containing"""	28061	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 25"""	C3orf25			Standard	NM_207307		Approved		uc003emg.3	Q6NXP0	OTTHUMG00000159464	ENST00000505956.1:c.519C>A	3.37:g.129137259G>T			Q69YX4	Silent	SNP	pfscan_EF_hand_dom	p.R173	ENST00000505956.1	37	c.519	CCDS54638.1	3																																																																																			-	EFCAB12	-	NULL		0.607	EFCAB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB12	HGNC	protein_coding	OTTHUMT00000355530.1	0	0	0	41	41	19	0.00	0.00	G	NM_207307		129137259	-1	16	2	21	3	tier1	no_errors	ENST00000326085	ensembl	human	known	74_37	silent	43.24	40.00	SNP	0.000	T	16	21
EXD3	54932	genome.wustl.edu	37	9	140267432	140267432	+	Silent	SNP	G	G	A	rs534339635	byFrequency	TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr9:140267432G>A	ENST00000340951.4	-	5	582	c.387C>T	c.(385-387)ttC>ttT	p.F129F	EXD3_ENST00000479452.1_Silent_p.F129F|EXD3_ENST00000342129.4_5'UTR|EXD3_ENST00000475006.1_5'UTR	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CCTGCAGCTGGAAGATGCTGG	0.657													ENSG00000187609																																					0													38.0	47.0	44.0					9																	140267432		2096	4218	6314	SO:0001819	synonymous_variant	0			-		CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.387C>T	9.37:g.140267432G>A			Q6P1M1|Q8IXT8	Silent	SNP	pfam_Mut7-C_Rse_dom,pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.F129	ENST00000340951.4	37	c.387	CCDS48066.1	9																																																																																			-	EXD3	-	NULL		0.657	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXD3	HGNC	protein_coding	OTTHUMT00000343182.1	0	0	0	144	144	15	0.00	0.00	G	NM_017820		140267432	-1	23	4	62	6	tier1	no_errors	ENST00000340951	ensembl	human	known	74_37	silent	26.74	40.00	SNP	1.000	A	23	62
MAGEB16	139604	genome.wustl.edu	37	X	35820764	35820764	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chrX:35820764T>A	ENST00000399989.1	+	2	730	c.451T>A	c.(451-453)Ttc>Atc	p.F151I	MAGEB16_ENST00000399985.1_Missense_Mutation_p.F151I|MAGEB16_ENST00000399992.1_Missense_Mutation_p.F183I|MAGEB16_ENST00000399987.1_Missense_Mutation_p.F151I|MAGEB16_ENST00000399988.1_Missense_Mutation_p.F151I	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	151	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						TGAGAGCCACTTCTCTGAGAT	0.448													ENSG00000189023																																					0													80.0	78.0	79.0					X																	35820764		2032	4173	6205	SO:0001583	missense	0			-		CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.451T>A	X.37:g.35820764T>A	ENSP00000382871:p.Phe151Ile		A8MU30	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.F183I	ENST00000399989.1	37	c.547	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	T	13.69	2.311988	0.40895	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.06933	3.24;3.24;3.24;3.24;3.24	3.13	1.95	0.26073	.	0.246954	0.42420	D	0.000720	T	0.29783	0.0744	M	0.92367	3.3	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.09862	-1.0655	10	0.72032	D	0.01	.	4.6964	0.12806	0.0:0.1523:0.0:0.8477	.	151	A2A368	MAGBG_HUMAN	I	151;183;151;151;151	ENSP00000382870:F151I;ENSP00000382874:F183I;ENSP00000382869:F151I;ENSP00000382871:F151I;ENSP00000382867:F151I	ENSP00000382867:F151I	F	+	1	0	MAGEB16	35730685	0.004000	0.15560	0.001000	0.08648	0.046000	0.14306	1.101000	0.31037	0.446000	0.26666	-0.544000	0.04233	TTC	-	MAGEB16	-	pfam_MAGE,pfscan_MAGE		0.448	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	HGNC	protein_coding	OTTHUMT00000251034.1	0	0	0	38	38	29	0.00	0.00	T			35820764	+1	7	11	4	7	tier1	no_errors	ENST00000399992	ensembl	human	known	74_37	missense	63.64	61.11	SNP	0.001	A	7	4
LHFPL1	340596	genome.wustl.edu	37	X	111914311	111914311	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chrX:111914311A>G	ENST00000371968.3	-	2	547	c.308T>C	c.(307-309)gTc>gCc	p.V103A	LHFPL1_ENST00000536453.1_Missense_Mutation_p.V103A|LHFPL1_ENST00000478229.1_Intron	NM_178175.3	NP_835469.1	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1	103						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)	13						GCAACCCAGGACAGCAGCTAG	0.577													ENSG00000182508																																					0													82.0	64.0	70.0					X																	111914311		2203	4300	6503	SO:0001583	missense	0			-	AY217350	CCDS14562.1	Xq23	2008-02-05			ENSG00000182508	ENSG00000182508			6587	protein-coding gene	gene with protein product		300566				10329012	Standard	NM_178175		Approved		uc004epq.3	Q86WI0	OTTHUMG00000022214	ENST00000371968.3:c.308T>C	X.37:g.111914311A>G	ENSP00000361036:p.Val103Ala		A8K1N1|Q496M9|Q496N0|Q6UXU2	Missense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.V103A	ENST00000371968.3	37	c.308	CCDS14562.1	X	.	.	.	.	.	.	.	.	.	.	A	18.80	3.701089	0.68501	.	.	ENSG00000182508	ENST00000371968;ENST00000536453	T;T	0.74526	-0.85;-0.85	5.29	5.29	0.74685	.	0.128495	0.49916	D	0.000127	T	0.69070	0.3070	L	0.55990	1.75	0.43417	D	0.995565	B;B	0.33000	0.149;0.393	B;B	0.31751	0.118;0.135	T	0.70565	-0.4837	10	0.52906	T	0.07	-36.4754	11.9977	0.53212	1.0:0.0:0.0:0.0	.	103;103	Q86WI0-2;Q86WI0	.;LHPL1_HUMAN	A	103	ENSP00000361036:V103A;ENSP00000444573:V103A	ENSP00000361036:V103A	V	-	2	0	LHFPL1	111800967	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.761000	0.91691	1.962000	0.57031	0.486000	0.48141	GTC	-	LHFPL1	-	pfam_Lipome_HGMIC_fus_partner-like		0.577	LHFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHFPL1	HGNC	protein_coding	OTTHUMT00000057947.1	0	0	0	22	22	17	0.00	0.00	A	NM_178175		111914311	-1	44	27	5	0	tier1	no_errors	ENST00000371968	ensembl	human	known	74_37	missense	89.80	100.00	SNP	1.000	G	44	5
WNK2	65268	genome.wustl.edu	37	9	96080210	96080210	+	Silent	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr9:96080210C>T	ENST00000297954.4	+	30	6795	c.6795C>T	c.(6793-6795)ccC>ccT	p.P2265P	WNK2_ENST00000349097.3_Intron|WNK2_ENST00000395477.2_Intron|WNK2_ENST00000356055.3_Intron|WNK2_ENST00000471076.1_Intron|WNK2_ENST00000427277.2_Intron|WNK2_ENST00000395475.2_Intron	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2265					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						TCCGAGTCCCCCCCACCGCCT	0.677													ENSG00000165238																																					0													25.0	25.0	25.0					9																	96080210		876	1991	2867	SO:0001819	synonymous_variant	0			-	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6795C>T	9.37:g.96080210C>T			Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P2265	ENST00000297954.4	37	c.6795		9																																																																																			-	WNK2	-	NULL		0.677	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	0	0	0	111	111	24	0.00	0.00	C	NM_006648		96080210	+1	29	8	38	7	tier1	no_errors	ENST00000297954	ensembl	human	known	74_37	silent	43.28	53.33	SNP	0.000	T	29	38
IGDCC4	57722	genome.wustl.edu	37	15	65674432	65674432	+	3'UTR	SNP	T	T	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr15:65674432T>A	ENST00000352385.2	-	0	5877				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TTTTCTTCTTTAAAAAAAAAA	0.353													ENSG00000103742																																					0																																										SO:0001624	3_prime_UTR_variant	0			-		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*1915A>T	15.37:g.65674432T>A			Q9HCE4	R	SNP	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			-	IGDCC4	-	-		0.353	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	0	0	1	82	82	50	0.00	1.96	T	NM_020962		65674432	-1	5	5	45	69	tier1	no_errors	ENST00000558048	ensembl	human	known	74_37	rna	10.00	6.67	SNP	0.000	A	5	45
CABIN1	23523	genome.wustl.edu	37	22	24459595	24459614	+	Splice_Site	DEL	TTCCTGGCGCTGCAGGTTAG	TTCCTGGCGCTGCAGGTTAG	-	rs376253454|rs534384469|rs373229152		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	TTCCTGGCGCTGCAGGTTAG	TTCCTGGCGCTGCAGGTTAG	TTCCTGGCGCTGCAGGTTAG	-	TTCCTGGCGCTGCAGGTTAG	TTCCTGGCGCTGCAGGTTAG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr22:24459595_24459614delTTCCTGGCGCTGCAGGTTAG	ENST00000398319.2	+	14	2255_2269	c.1870_1884delTTCCTGGCGCTGCAGGTTAG	c.(1870-1884)ttcctggcgctgcagdel	p.FLALQ624fs	CABIN1_ENST00000405822.2_Splice_Site_p.FLALQ574fs|CABIN1_ENST00000263119.5_Splice_Site_p.FLALQ624fs	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	624					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.A626V(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GAAGGCTCGCTTCCTGGCGCTGCAGGTTAGTTCCATGGTC	0.568													ENSG00000099991																																					1	Substitution - Missense(1)	endometrium(1)																																								SO:0001630	splice_region_variant	0				AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.1884+1TTCCTGGCGCTGCAGGTTAG>-	22.37:g.24459595_24459614delTTCCTGGCGCTGCAGGTTAG			G5E9F3|Q6PHY0|Q9Y460	Splice_Site	DEL	-	e14-1	ENST00000398319.2	37	c.1884+16_1884+1	CCDS13823.1	22																																																																																				CABIN1	-	-		0.568	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	0	0	0	124	124	124	0.00	0.00	TTCCTGGCGCTGCAGGTTAG	NM_012295	Frame_Shift_Del	24459614	+1	5	5	46	46	tier1	no_errors	ENST00000263119	ensembl	human	known	74_37	splice_site_del	9.80	9.80	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.179:0.730:0.999:1.000:1.000:1.000:1.000:1.000:1.000:0.613:0.610:0.813	-	5	46
CD200	4345	genome.wustl.edu	37	3	112068589	112068589	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:112068589G>T	ENST00000315711.8	+	5	782	c.725G>T	c.(724-726)aGc>aTc	p.S242I	CD200_ENST00000383681.3_Missense_Mutation_p.S168I|CD200_ENST00000473539.1_Missense_Mutation_p.S267I	NM_005944.5	NP_005935.4	P41217	OX2G_HUMAN	CD200 molecule	242					regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16		Acute lymphoblastic leukemia(4;1.7e-08)|all_hematologic(4;8.82e-05)				CTATTGCTAAGCATTGTTTCC	0.403													ENSG00000091972																																					0													130.0	117.0	121.0					3																	112068589		2203	4300	6503	SO:0001583	missense	0			-		CCDS2965.1, CCDS33818.1	3q13.2	2013-09-20	2006-03-28	2004-09-01	ENSG00000091972	ENSG00000091972		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7203	protein-coding gene	gene with protein product		155970	"""antigen identified by monoclonal antibody MRC OX-2"", ""CD200 antigen"""	MOX1, MOX2			Standard	XM_005247482		Approved	MRC, OX-2	uc003dyw.3	P41217	OTTHUMG00000159248	ENST00000315711.8:c.725G>T	3.37:g.112068589G>T	ENSP00000312766:p.Ser242Ile		B3KQI1|B4DLW9|D3DN65|Q6J2Q6|Q6PIQ4|Q8TB85|Q9H3J3	Missense_Mutation	SNP	pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S267I	ENST00000315711.8	37	c.800	CCDS2965.1	3	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744500	0.69418	.	.	ENSG00000091972	ENST00000315711;ENST00000473539;ENST00000383681	T;T;T	0.71222	1.09;-0.55;-0.51	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000003	T	0.75019	0.3793	L	0.29908	0.895	0.31198	N	0.700125	D;D;D;D;D	0.76494	0.999;0.997;0.995;0.997;0.997	D;D;D;D;D	0.80764	0.942;0.994;0.986;0.994;0.994	T	0.74140	-0.3761	10	0.39692	T	0.17	-20.6995	14.1585	0.65432	0.0:0.0:1.0:0.0	.	242;168;168;242;267	P41217;F8W7G1;B4DDZ6;P41217-2;P41217-3	OX2G_HUMAN;.;.;.;.	I	242;267;168	ENSP00000312766:S242I;ENSP00000420298:S267I;ENSP00000373179:S168I	ENSP00000312766:S242I	S	+	2	0	CD200	113551279	1.000000	0.71417	0.993000	0.49108	0.682000	0.39822	2.836000	0.48183	2.696000	0.92011	0.655000	0.94253	AGC	-	CD200	-	NULL		0.403	CD200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200	HGNC	protein_coding	OTTHUMT00000354078.1	0	0	2	128	128	99	0.00	1.98	G			112068589	+1	43	34	33	46	tier1	no_errors	ENST00000473539	ensembl	human	known	74_37	missense	56.58	42.50	SNP	0.856	T	43	33
ANKEF1	63926	genome.wustl.edu	37	20	10033785	10033785	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr20:10033785G>T	ENST00000378380.3	+	8	2225	c.1896G>T	c.(1894-1896)aaG>aaT	p.K632N	SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000378392.1_Missense_Mutation_p.K632N	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	632							calcium ion binding (GO:0005509)										ACGTTGCAAAGGCATATGCTG	0.338													ENSG00000132623																																					0													124.0	135.0	131.0					20																	10033785		2203	4300	6503	SO:0001583	missense	0			-	AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1896G>T	20.37:g.10033785G>T	ENSP00000367631:p.Lys632Asn		B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EF_hand_dom,prints_Ankyrin_rpt	p.K632N	ENST00000378380.3	37	c.1896	CCDS13108.1	20	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378377	0.42207	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.71222	-0.55;-0.55	5.39	-0.603	0.11630	Ankyrin repeat-containing domain (3);	0.293580	0.41294	D	0.000917	T	0.56247	0.1972	L	0.52823	1.66	0.40378	D	0.979418	P	0.43477	0.808	B	0.35607	0.206	T	0.53655	-0.8408	10	0.21540	T	0.41	0.0022	10.4711	0.44638	0.5033:0.0:0.4967:0.0	.	632	Q9NU02	ANKR5_HUMAN	N	632	ENSP00000367644:K632N;ENSP00000367631:K632N	ENSP00000367631:K632N	K	+	3	2	ANKRD5	9981785	0.989000	0.36119	0.996000	0.52242	0.920000	0.55202	0.161000	0.16481	0.013000	0.14918	0.655000	0.94253	AAG	-	ANKEF1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.338	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANKEF1	HGNC	protein_coding	OTTHUMT00000077968.2	0	0	1	85	85	49	0.00	2.00	G	NM_022096		10033785	+1	10	16	48	41	tier1	no_errors	ENST00000378380	ensembl	human	known	74_37	missense	17.24	27.59	SNP	0.908	T	10	48
PMS2P1	5379	genome.wustl.edu	37	7	99928404	99928404	+	RNA	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:99928404G>A	ENST00000365043.1	-	0	96																											TTTTCCTTATgctagtcaagt	0.323													ENSG00000201913																																					0																																												0			-																													7.37:g.99928404G>A				R	SNP	-	NULL	ENST00000365043.1	37	NULL		7																																																																																			-	Y_R	-	-		0.323	Y_RNA.337-201	NOVEL	basic	misc_RNA	ENSG00000201913	RFAM	misc_RNA		0	0	0	47	47	0	0.00	0.00	G			99928404	-1	5	0	17	0	tier1	no_errors	ENST00000365043	ensembl	human	novel	74_37	rna	22.73	0.00	SNP	0.025	A	5	17
ESYT2	57488	genome.wustl.edu	37	7	158534291	158534291	+	Silent	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr7:158534291C>T	ENST00000251527.5	-	17	2237	c.2172G>A	c.(2170-2172)ccG>ccA	p.P724P	ESYT2_ENST00000435514.2_Silent_p.P159P	NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	752					endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						TGCTGGGGGTCGGCTCCTTGA	0.657													ENSG00000117868																																					0													45.0	44.0	44.0					7																	158534291		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.2172G>A	7.37:g.158534291C>T			A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P724	ENST00000251527.5	37	c.2172	CCDS34791.1	7	.	.	.	.	.	.	.	.	.	.	c	11.33	1.606112	0.28623	.	.	ENSG00000117868	ENST00000429474	.	.	.	5.11	2.14	0.27477	.	.	.	.	.	T	0.37679	0.1012	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.05517	-1.0880	5	0.13470	T	0.59	-18.4531	5.6085	0.17392	0.0727:0.1188:0.5829:0.2257	.	.	.	.	Q	507	.	ENSP00000395865:R507Q	R	-	2	0	ESYT2	158227052	0.988000	0.35896	1.000000	0.80357	0.122000	0.20287	0.136000	0.15974	0.679000	0.31345	-0.743000	0.03520	CGA	-	ESYT2	-	NULL		0.657	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	0	0	0	149	149	19	0.00	0.00	C	NM_020728		158534291	-1	16	0	14	0	tier1	no_errors	ENST00000251527	ensembl	human	known	74_37	silent	53.33	0.00	SNP	0.999	T	16	14
AC079610.1	0	genome.wustl.edu	37	2	213628371	213628372	+	RNA	INS	-	-	TGTGTG			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr2:213628371_213628372insTGTGTG	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							atatatatatatatatatatat	0.168													ENSG00000221388																																					0																																												0																																2.37:g.213628371_213628372insTGTGTG				R	INS	-	NULL	ENST00000415387.1	37	NULL		2																																																																																				AC093865.1	-	-		0.168	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	Clone_based_ensembl_gene	sense_overlapping	OTTHUMT00000337265.1	0	0	0	0	0	0	0.00	0.00	-			213628372	-1	0	0	0	0	tier1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	0.00	0.00	INS	0.068:0.063	TGTGTG	0	0
LOC101930127	101930127	genome.wustl.edu	37	11	134599	134599	+	RNA	SNP	G	G	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr11:134599G>T	ENST00000527297.1	+	0	235																											AGGCTGGGAGGCAGGAGCTGG	0.507													ENSG00000230724																																					0																																												0			-																													11.37:g.134599G>T				R	SNP	-	NULL	ENST00000527297.1	37	NULL		11																																																																																			-	LINC01001	-	-		0.507	RP11-304M2.3-001	KNOWN	basic	antisense	LINC01001	HGNC	antisense	OTTHUMT00000384758.1	0	0	0	100	100	3	0.00	0.00	G			134599	-1	5	0	38	0	tier1	no_errors	ENST00000527683	ensembl	human	known	74_37	rna	11.63	0.00	SNP	0.881	T	5	38
MUC4	4585	genome.wustl.edu	37	3	195513887	195513887	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:195513887G>A	ENST00000463781.3	-	2	5023	c.4564C>T	c.(4564-4566)Cct>Tct	p.P1522S	MUC4_ENST00000475231.1_Missense_Mutation_p.P1522S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGGTGACAGGAAGAGGGGTG	0.567													ENSG00000145113																																					0													3.0	3.0	3.0					3																	195513887		561	1295	1856	SO:0001583	missense	0			-	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.4564C>T	3.37:g.195513887G>A	ENSP00000417498:p.Pro1522Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P1522S	ENST00000463781.3	37	c.4564	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	6.265	0.416994	0.11870	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.29397	1.57;1.57	0.844	0.844	0.18943	.	.	.	.	.	T	0.18923	0.0454	N	0.19112	0.55	0.09310	N	1	P	0.47604	0.898	B	0.42959	0.403	T	0.12451	-1.0547	8	.	.	.	.	7.477	0.27382	1.0E-4:0.0:0.9999:0.0	.	1522	E7ESK3	.	S	1522	ENSP00000417498:P1522S;ENSP00000420243:P1522S	.	P	-	1	0	MUC4	196998282	0.000000	0.05858	0.056000	0.19401	0.057000	0.15508	-0.537000	0.06128	0.088000	0.17205	0.089000	0.15464	CCT	-	MUC4	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	0	0	0	55	55	1	0.00	0.00	G	NM_018406		195513887	-1	18	1	63	0	tier1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	22.22	100.00	SNP	0.000	A	18	63
PCDHB2	56133	genome.wustl.edu	37	5	140476099	140476099	+	Silent	SNP	C	C	T	rs576325225		TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr5:140476099C>T	ENST00000194155.4	+	1	1873	c.1725C>T	c.(1723-1725)acC>acT	p.T575T		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	575	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.711													ENSG00000112852																																					0													7.0	10.0	9.0					5																	140476099		1890	3678	5568	SO:0001819	synonymous_variant	0			-	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.1725C>T	5.37:g.140476099C>T			Q4KMU1	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T575	ENST00000194155.4	37	c.1725	CCDS4244.1	5																																																																																			-	PCDHB2	-	superfamily_Cadherin-like		0.711	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	0	0	0	96	96	3	0.00	0.00	C	NM_018936		140476099	+1	13	0	49	0	tier1	no_errors	ENST00000194155	ensembl	human	known	74_37	silent	20.97	0.00	SNP	0.962	T	13	49
REXO1L1P	254958	genome.wustl.edu	37	8	86573758	86573758	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr8:86573758G>A	ENST00000379010.2	-	1	1968	c.1969C>T	c.(1969-1971)Cgc>Tgc	p.R657C		NM_172239.4	NP_758439.4														endometrium(1)|lung(4)	5						ATCTGGGCGCGCTGTCGGACC	0.667													ENSG00000205176																																					0													3.0	3.0	3.0					8																	86573758		1547	3210	4757	SO:0001583	missense	0			-																												ENST00000379010.2:c.1969C>T	8.37:g.86573758G>A	ENSP00000368295:p.Arg657Cys			Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/D_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.R657C	ENST00000379010.2	37	c.1969		8	.	.	.	.	.	.	.	.	.	.	G	9.950	1.219917	0.22373	.	.	ENSG00000205176	ENST00000379010	T	0.19394	2.15	0.793	-1.59	0.08453	Exonuclease (1);	0.303860	0.28312	U	0.015817	T	0.23766	0.0575	L	0.47190	1.495	0.09310	N	1	D	0.67145	0.996	P	0.58210	0.835	T	0.22765	-1.0207	10	0.72032	D	0.01	.	2.2872	0.04129	0.0:0.3299:0.3415:0.3286	.	657	Q8IX06	GOR_HUMAN	C	657	ENSP00000368295:R657C	ENSP00000368295:R657C	R	-	1	0	REXO1L1	86761010	0.062000	0.20869	0.005000	0.12908	0.005000	0.04900	0.143000	0.16115	-1.147000	0.02851	-1.141000	0.01876	CGC	-	REXO1L1	-	smart_Exonuclease		0.667	REXO1L1-001	PUTATIVE	basic|appris_principal	protein_coding	REXO1L1	HGNC	protein_coding	OTTHUMT00000381106.1	0	0	0	217	217	0	0.00	0.00	G			86573758	-1	26	0	172	1	tier1	no_errors	ENST00000379010	ensembl	human	putative	74_37	missense	13.07	0.00	SNP	0.000	A	26	172
YTHDC1	91746	genome.wustl.edu	37	4	69202908	69202908	+	Silent	SNP	C	C	T	rs548927284	byFrequency	TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr4:69202908C>T	ENST00000344157.4	-	4	1055	c.720G>A	c.(718-720)gaG>gaA	p.E240E	YTHDC1_ENST00000355665.3_Silent_p.E240E|YTHDC1_ENST00000579690.1_Silent_p.E240E	NM_001031732.2	NP_001026902.1	Q96MU7	YTDC1_HUMAN	YTH domain containing 1	240	Glu-rich.				mRNA splice site selection (GO:0006376)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	30						cctcctcctcctcttcctcct	0.478													ENSG00000083896																																					0													141.0	100.0	114.0					4																	69202908		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK098515	CCDS3522.2, CCDS33992.1	4q13.3	2009-01-14			ENSG00000083896	ENSG00000083896			30626	protein-coding gene	gene with protein product						12368078, 10564280	Standard	XM_005265706		Approved	YT521, KIAA1966, YT521-B	uc003hdx.3	Q96MU7	OTTHUMG00000129306	ENST00000344157.4:c.720G>A	4.37:g.69202908C>T			Q4W5Q3|Q7Z622|Q8TF35	Silent	SNP	pfam_YTH_domain,pfscan_YTH_domain	p.E240	ENST00000344157.4	37	c.720	CCDS33992.1	4																																																																																			-	YTHDC1	-	NULL		0.478	YTHDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	YTHDC1	HGNC	protein_coding	OTTHUMT00000251437.1	0	0	0	52	52	0	0.00	0.00	C	NM_133370		69202908	-1	4	0	23	0	tier1	no_errors	ENST00000344157	ensembl	human	known	74_37	silent	14.81	0.00	SNP	0.914	T	4	23
ZNF536	9745	genome.wustl.edu	37	19	30935152	30935152	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr19:30935152C>T	ENST00000355537.3	+	2	830	c.683C>T	c.(682-684)cCg>cTg	p.P228L		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	228					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					AAGCCCCCGCCGCACGCCCAG	0.736													ENSG00000198597																																					0													3.0	3.0	3.0					19																	30935152		1717	3361	5078	SO:0001583	missense	0			-		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.683C>T	19.37:g.30935152C>T	ENSP00000347730:p.Pro228Leu		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P228L	ENST00000355537.3	37	c.683	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	1.576	-0.532883	0.04112	.	.	ENSG00000198597	ENST00000355537	T	0.08807	3.05	5.92	3.79	0.43588	.	0.609346	0.19037	N	0.124393	T	0.04952	0.0133	N	0.14661	0.345	0.09310	N	0.999995	B;B	0.23185	0.0;0.081	B;B	0.18561	0.0;0.022	T	0.40346	-0.9568	10	0.27785	T	0.31	-11.1058	8.8567	0.35231	0.3776:0.5532:0.0:0.0692	.	228;228	A7E228;O15090	.;ZN536_HUMAN	L	228	ENSP00000347730:P228L	ENSP00000347730:P228L	P	+	2	0	ZNF536	35626992	0.090000	0.21635	0.956000	0.39512	0.299000	0.27559	0.793000	0.26944	0.835000	0.34877	0.655000	0.94253	CCG	-	ZNF536	-	NULL		0.736	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	0	0	0	27	27	4	0.00	0.00	C	NM_014717		30935152	+1	8	3	6	5	tier1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	57.14	37.50	SNP	0.148	T	8	6
ARIH2OS	646450	genome.wustl.edu	37	3	48955912	48955920	+	In_Frame_Del	DEL	GGGGTGTAG	GGGGTGTAG	-			TCGA-X6-A7W8-01A-21D-A351-09	TCGA-X6-A7W8-10A-01D-A351-09	GGGGTGTAG	GGGGTGTAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d0652dca-c89d-47f8-a18f-551c96c2c9ba	f1797d64-b9fe-40ab-bd49-793905d5c8d8	g.chr3:48955912_48955920delGGGGTGTAG	ENST00000408959.2	-	1	898_906	c.663_671delCTACACCCC	c.(661-672)gcctacaccccg>gcg	p.YTP222del	ARIH2_ENST00000449376.1_5'Flank|ARIH2_ENST00000356401.4_5'Flank	NM_001123040.1	NP_001116512.1	Q8N7S6	ARI2O_HUMAN	ariadne homolog 2 opposite strand	222						integral component of membrane (GO:0016021)											CGACCGCCTCGGGGTGTAGGCAGAATTTC	0.641													ENSG00000221883																																					0																																										SO:0001651	inframe_deletion	0				DA461567	CCDS43088.1	3p21.31	2012-10-08	2012-10-08	2012-10-08	ENSG00000221883	ENSG00000221883			34425	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 71"""	C3orf71			Standard	NM_001123040		Approved		uc010hkk.1	Q8N7S6	OTTHUMG00000156672	ENST00000408959.2:c.663_671delCTACACCCC	3.37:g.48955912_48955920delGGGGTGTAG	ENSP00000386193:p.Tyr222_Pro224del			In_Frame_Del	DEL	NULL	p.YTP222in_frame_del	ENST00000408959.2	37	c.671_663	CCDS43088.1	3																																																																																				ARIH2OS	-	NULL		0.641	ARIH2OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH2OS	HGNC	protein_coding	OTTHUMT00000345247.1	0	0	0	68	68	68	0.00	0.00	GGGGTGTAG	NM_001123040		48955920	-1	3	3	42	42	tier1	no_errors	ENST00000408959	ensembl	human	known	74_37	in_frame_del	6.67	6.67	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000	-	3	42
