#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
PPFIA2	8499	genome.wustl.edu	37	12	81777917	81777917	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:81777917C>A	ENST00000549396.1	-	9	1029	c.869G>T	c.(868-870)cGt>cTt	p.R290L	PPFIA2_ENST00000548586.1_Missense_Mutation_p.R290L|PPFIA2_ENST00000545296.2_5'UTR|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R290L|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R191L|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R137L|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R290L|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R272L|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R272L|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R216L|RP11-315E17.1_ENST00000546936.1_RNA	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	290	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						GGCTGCTAAACGTTCTTTCAT	0.403													ENSG00000139220																																					0													125.0	121.0	122.0					12																	81777917		1880	4110	5990	SO:0001583	missense	0			-	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.869G>T	12.37:g.81777917C>A	ENSP00000450337:p.Arg290Leu		B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R290L	ENST00000549396.1	37	c.869	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.531909|5.531909	0.96446|0.96446	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948|ENST00000548790	T;T;T;T;T;T;T|.	0.79352|.	1.17;1.17;1.17;-1.26;1.17;1.17;1.17|.	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77678|0.77678	0.4166|0.4166	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	D;D|.	0.67145|.	0.996;0.987|.	D;D|.	0.79108|.	0.992;0.953|.	T|T	0.75852|0.75852	-0.3171|-0.3171	10|5	0.62326|.	D|.	0.03|.	-11.9479|-11.9479	19.9576|19.9576	0.97228|0.97228	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	190;290|.	B7Z4H8;O75334|.	.;LIPA2_HUMAN|.	L|F	290;272;216;301;272;290;191;290|108	ENSP00000450337:R290L;ENSP00000450298:R272L;ENSP00000385093:R216L;ENSP00000327416:R272L;ENSP00000449338:R290L;ENSP00000388373:R191L;ENSP00000447868:R290L|.	ENSP00000327416:R272L|.	R|V	-|-	2|1	0|0	PPFIA2|PPFIA2	80302048|80302048	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.998000|0.998000	0.95712|0.95712	7.776000|7.776000	0.85560|0.85560	2.720000|2.720000	0.93068|0.93068	0.557000|0.557000	0.71058|0.71058	CGT|GTT	-	PPFIA2	-	NULL		0.403	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	0	0	1	51	51	149	0.00	0.66	C			81777917	-1	10	18	21	36	tier1	no_errors	ENST00000549396	ensembl	human	known	74_37	missense	32.26	33.33	SNP	1.000	A	10	21
CKAP2	26586	genome.wustl.edu	37	13	53048039	53048039	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:53048039T>C	ENST00000378037.5	+	8	1715	c.1625T>C	c.(1624-1626)gTa>gCa	p.V542A	CKAP2_ENST00000490903.1_Missense_Mutation_p.V493A|CKAP2_ENST00000258607.5_Missense_Mutation_p.V541A	NM_001098525.1|NM_018204.3	NP_001091995.1|NP_060674.3			cytoskeleton associated protein 2											breast(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(3)|skin(1)|urinary_tract(1)	20		Breast(56;0.000207)|Lung NSC(96;0.00212)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.6e-08)		GGTGTTGATGTAGATCCAGAA	0.328													ENSG00000136108																																					0													93.0	101.0	98.0					13																	53048039		2203	4300	6503	SO:0001583	missense	0			-	AF177227	CCDS9435.1, CCDS41893.1, CCDS66557.1, CCDS73578.1	13q14	2014-03-21			ENSG00000136108	ENSG00000136108			1990	protein-coding gene	gene with protein product		611569				9771967	Standard	XM_005266343		Approved	LB1, FLJ10749, se20-10, TMAP	uc001vgv.2	Q8WWK9	OTTHUMG00000016967	ENST00000378037.5:c.1625T>C	13.37:g.53048039T>C	ENSP00000367276:p.Val542Ala			Missense_Mutation	SNP	NULL	p.V542A	ENST00000378037.5	37	c.1625	CCDS41893.1	13	.	.	.	.	.	.	.	.	.	.	.	0.329	-0.957110	0.02267	.	.	ENSG00000136108	ENST00000258607;ENST00000378037;ENST00000490903	T;T;T	0.21361	2.01;2.01;2.01	5.91	-1.1	0.09872	.	1.446920	0.04408	N	0.365504	T	0.16938	0.0407	L	0.53249	1.67	0.09310	N	1	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.21546	0.035;0.035;0.035	T	0.23368	-1.0190	10	0.13108	T	0.6	-0.6036	1.8007	0.03071	0.1261:0.2838:0.1302:0.4599	.	493;542;541	E9PD90;Q8WWK9;B2RMQ4	.;CKAP2_HUMAN;.	A	541;542;493	ENSP00000258607:V541A;ENSP00000367276:V542A;ENSP00000417830:V493A	ENSP00000258607:V541A	V	+	2	0	CKAP2	51946040	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	-0.110000	0.10824	-0.100000	0.12241	-0.256000	0.11100	GTA	-	CKAP2	-	NULL		0.328	CKAP2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CKAP2	HGNC	protein_coding	OTTHUMT00000355010.2	0	0	0	113	113	220	0.00	0.00	T			53048039	+1	17	33	54	96	tier1	no_errors	ENST00000378037	ensembl	human	known	74_37	missense	23.94	25.58	SNP	0.000	C	17	54
NUF2	83540	genome.wustl.edu	37	1	163313591	163313591	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:163313591T>G	ENST00000271452.3	+	10	1017	c.738T>G	c.(736-738)gaT>gaG	p.D246E	NUF2_ENST00000367900.3_Missense_Mutation_p.D246E|NUF2_ENST00000524800.1_Missense_Mutation_p.D246E	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	246	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AAATTGTGGATTCTCCAGAGA	0.274													ENSG00000143228																																					0													24.0	29.0	27.0					1																	163313591		2149	4249	6398	SO:0001583	missense	0			-	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.738T>G	1.37:g.163313591T>G	ENSP00000271452:p.Asp246Glu		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	pfam_Kinetochore_Nuf2	p.D246E	ENST00000271452.3	37	c.738	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	T	4.698	0.129875	0.08981	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.28454	1.64;1.61;1.61	4.83	-2.34	0.06704	.	0.101007	0.64402	N	0.000002	T	0.02342	0.0072	N	0.11427	0.14	0.28485	N	0.914772	B;B	0.17268	0.021;0.021	B;B	0.14023	0.01;0.01	T	0.32481	-0.9905	9	0.02654	T	1	-18.4689	2.4131	0.04430	0.1461:0.4114:0.1502:0.2923	.	246;246	E9PQC4;Q9BZD4	.;NUF2_HUMAN	E	246	ENSP00000436888:D246E;ENSP00000356875:D246E;ENSP00000271452:D246E	ENSP00000271452:D246E	D	+	3	2	NUF2	161580215	0.992000	0.36948	0.995000	0.50966	0.992000	0.81027	-0.038000	0.12144	-0.247000	0.09597	0.477000	0.44152	GAT	-	NUF2	-	NULL		0.274	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	0	0	0	281	281	207	0.00	0.00	T	NM_145697		163313591	+1	13	9	129	70	tier1	no_errors	ENST00000271452	ensembl	human	known	74_37	missense	9.15	11.39	SNP	0.980	G	13	129
UBE2J1	51465	genome.wustl.edu	37	6	90045027	90045027	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:90045027G>T	ENST00000435041.2	-	6	830	c.552C>A	c.(550-552)agC>agA	p.S184R		NM_016021.2	NP_057105.2	Q9Y385	UB2J1_HUMAN	ubiquitin-conjugating enzyme E2, J1	184					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(11)|stomach(1)	18		all_cancers(76;1.65e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;2.5e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0139)		GTACCTTAAAGCTTATTTGCC	0.398													ENSG00000198833																																					0													91.0	93.0	92.0					6																	90045027		2203	4300	6503	SO:0001583	missense	0			-	AJ245898	CCDS5021.1	6q15	2014-01-28	2012-06-08		ENSG00000198833	ENSG00000198833		"""Ubiquitin-conjugating enzymes E2"""	17598	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J1 (UBC6 homolog, yeast)"""			10708578	Standard	NM_016021		Approved	HSPC153, CGI-76, NCUBE1, UBC6	uc003pnc.3	Q9Y385	OTTHUMG00000016337	ENST00000435041.2:c.552C>A	6.37:g.90045027G>T	ENSP00000451261:p.Ser184Arg		A8K3F9|Q53F25|Q5W0N4|Q9BZ32|Q9NQL3|Q9NY66|Q9P011|Q9P0S0|Q9UF10	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S184R	ENST00000435041.2	37	c.552	CCDS5021.1	6	.	.	.	.	.	.	.	.	.	.	G	13.11	2.139528	0.37728	.	.	ENSG00000198833	ENST00000435041;ENST00000536477	T	0.64803	-0.12	6.03	3.64	0.41730	Ubiquitin-conjugating enzyme/RWD-like (1);	0.119583	0.85682	D	0.000000	T	0.39600	0.1084	M	0.68952	2.095	0.48288	D	0.999622	B	0.14805	0.011	B	0.14578	0.011	T	0.27123	-1.0083	10	0.29301	T	0.29	-8.979	9.2316	0.37441	0.7802:0.0:0.2198:0.0	.	184	Q9Y385	UB2J1_HUMAN	R	184;169	ENSP00000451261:S184R	ENSP00000354684:S184R	S	-	3	2	UBE2J1	90101746	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	0.971000	0.29396	0.532000	0.28657	-0.351000	0.07748	AGC	-	UBE2J1	-	NULL		0.398	UBE2J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2J1	HGNC	protein_coding	OTTHUMT00000043742.2	0	0	1	53	53	197	0.00	0.51	G	NM_016021		90045027	-1	10	27	37	121	tier1	no_errors	ENST00000435041	ensembl	human	known	74_37	missense	20.83	18.24	SNP	1.000	T	10	37
OR2V2	285659	genome.wustl.edu	37	5	180582647	180582647	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:180582647G>A	ENST00000328275.1	+	1	705	c.705G>A	c.(703-705)tgG>tgA	p.W235*		NM_206880.1	NP_996763.1	Q96R30	OR2V2_HUMAN	olfactory receptor, family 2, subfamily V, member 2	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20	all_cancers(89;8.26e-06)|all_epithelial(37;1.02e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.0103)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.0652)|all_lung(500;0.149)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCAGGCCTGGAAAAAGGCCC	0.567													ENSG00000182613																																					0													145.0	140.0	142.0					5																	180582647		2203	4300	6503	SO:0001587	stop_gained	0			-	AL161615	CCDS4461.1	5q35.3	2012-08-09			ENSG00000182613	ENSG00000182613		"""GPCR / Class A : Olfactory receptors"""	15341	protein-coding gene	gene with protein product				OR2V3			Standard	NM_206880		Approved	OST713	uc011dhj.2	Q96R30	OTTHUMG00000130933	ENST00000328275.1:c.705G>A	5.37:g.180582647G>A	ENSP00000332185:p.Trp235*		Q6IFL6|Q8NGV1	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.W235*	ENST00000328275.1	37	c.705	CCDS4461.1	5	.	.	.	.	.	.	.	.	.	.	.	4.556	0.103235	0.08731	.	.	ENSG00000182613	ENST00000328275	.	.	.	3.48	-6.95	0.01628	.	2.265590	0.02537	N	0.094241	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	6.4091	0.21680	0.1086:0.0964:0.6352:0.1597	.	.	.	.	X	235	.	ENSP00000332185:W235X	W	+	3	0	OR2V2	180515253	0.000000	0.05858	0.004000	0.12327	0.079000	0.17450	-1.623000	0.02040	-1.089000	0.03073	0.305000	0.20034	TGG	-	OR2V2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.567	OR2V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V2	HGNC	protein_coding	OTTHUMT00000253529.1	0	0	0	73	73	105	0.00	0.00	G			180582647	+1	16	12	19	31	tier1	no_errors	ENST00000328275	ensembl	human	known	74_37	nonsense	45.71	27.91	SNP	0.005	A	16	19
IFNA1	3439	genome.wustl.edu	37	9	21440957	21440957	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:21440957A>T	ENST00000276927.1	+	1	518	c.451A>T	c.(451-453)Act>Tct	p.T151S		NM_024013.2	NP_076918.1	P01562	IFNA1_HUMAN	interferon, alpha 1	151					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)	7				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CCGAAGAATCACTCTCTATCT	0.473													ENSG00000197919																																					0													39.0	47.0	44.0					9																	21440957		2166	4251	6417	SO:0001583	missense	0			-		CCDS6508.1	9p22	2010-12-10			ENSG00000197919	ENSG00000197919		"""Interferons"""	5417	protein-coding gene	gene with protein product	"""IFN-alpha 1b"", ""interferon alpha 1b"""	147660				1385305	Standard	NM_024013		Approved	IFNA@, IFL, IFN, IFN-ALPHA, IFNA13, IFN-alphaD	uc003zpd.2	P01562	OTTHUMG00000019673	ENST00000276927.1:c.451A>T	9.37:g.21440957A>T	ENSP00000276927:p.Thr151Ser		D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.T151S	ENST00000276927.1	37	c.451	CCDS6508.1	9	.	.	.	.	.	.	.	.	.	.	A	10.95	1.497007	0.26861	.	.	ENSG00000197919	ENST00000276927	T	0.03272	3.99	3.21	-6.43	0.01926	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.100060	0.06754	N	0.780602	T	0.02807	0.0084	L	0.39633	1.23	0.09310	N	1	B	0.06786	0.001	B	0.17433	0.018	T	0.43861	-0.9365	10	0.23302	T	0.38	.	2.8643	0.05596	0.2434:0.445:0.0878:0.2238	.	151	P01562	IFNA1_HUMAN	S	151	ENSP00000276927:T151S	ENSP00000276927:T151S	T	+	1	0	IFNA1	21430957	0.000000	0.05858	0.000000	0.03702	0.918000	0.54935	-3.705000	0.00388	-2.343000	0.00623	0.491000	0.48974	ACT	-	IF1	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta		0.473	IFNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IF1	HGNC	protein_coding	OTTHUMT00000051902.1	0	0	0	42	42	28	0.00	0.00	A	NM_024013		21440957	+1	13	6	17	13	tier1	no_errors	ENST00000276927	ensembl	human	known	74_37	missense	43.33	31.58	SNP	0.000	T	13	17
HOOK1	51361	genome.wustl.edu	37	1	60330673	60330673	+	Intron	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:60330673T>A	ENST00000371208.3	+	18	1918				HOOK1_ENST00000395561.2_Intron|HOOK1_ENST00000465876.1_Intron	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1						early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					TTTTGGCACCTGCCGTGTGCC	0.403													ENSG00000134709																																					0																																										SO:0001627	intron_variant	0			-	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1662-162T>A	1.37:g.60330673T>A			A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	R	SNP	-	NULL	ENST00000371208.3	37	NULL	CCDS612.1	1																																																																																			-	HOOK1	-	-		0.403	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	0	0	0	22	22	243	0.00	0.00	T	NM_015888		60330673	+1	7	54	12	48	tier1	no_errors	ENST00000466803	ensembl	human	known	74_37	rna	36.84	52.94	SNP	0.000	A	7	12
APOB	338	genome.wustl.edu	37	2	21247913	21247913	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:21247913G>T	ENST00000233242.1	-	16	2455	c.2328C>A	c.(2326-2328)taC>taA	p.Y776*	APOB_ENST00000399256.4_Nonsense_Mutation_p.Y776*	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	776					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGATGCGGAGGTAGGCTCTGG	0.493													ENSG00000084674																																					0													94.0	96.0	95.0					2																	21247913		2203	4300	6503	SO:0001587	stop_gained	0			-	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2328C>A	2.37:g.21247913G>T	ENSP00000233242:p.Tyr776*		O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.Y776*	ENST00000233242.1	37	c.2328	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.228076	0.98717	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	.	.	.	5.7	4.58	0.56647	.	0.121727	0.37261	N	0.002175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.1262	0.42652	0.2056:0.0:0.7944:0.0	.	.	.	.	X	776	.	ENSP00000233242:Y776X	Y	-	3	2	APOB	21101418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.977000	0.49297	1.196000	0.43129	0.655000	0.94253	TAC	-	APOB	-	pfam_Vitellinogen_open_b-sht,superfamily_Lipid_transp_b-sht_shell		0.493	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	0	0	0	84	84	216	0.00	0.00	G			21247913	-1	23	41	47	102	tier1	no_errors	ENST00000233242	ensembl	human	known	74_37	nonsense	32.86	28.47	SNP	1.000	T	23	47
LGALS7B	653499	genome.wustl.edu	37	19	39281369	39281369	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:39281369G>A	ENST00000314980.4	+	3	152	c.136G>A	c.(136-138)Gat>Aat	p.D46N		NM_001042507.3	NP_001035972.1	P47929	LEG7_HUMAN	lectin, galactoside-binding, soluble, 7B	46	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|heterophilic cell-cell adhesion (GO:0007157)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carbohydrate binding (GO:0030246)										GCAGGGCTCCGATGCCGCCCT	0.642													ENSG00000178934																																					0													35.0	38.0	37.0					19																	39281369		2201	4298	6499	SO:0001583	missense	0			-		CCDS42565.1	19q13.2	2011-08-04			ENSG00000178934	ENSG00000178934		"""Lectins, galactoside-binding"""	34447	protein-coding gene	gene with protein product	"""galectin 7B"""						Standard	NM_001042507		Approved	GAL7	uc002ojf.4	P47929		ENST00000314980.4:c.136G>A	19.37:g.39281369G>A	ENSP00000313571:p.Asp46Asn		Q6IB87	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD	p.D46N	ENST00000314980.4	37	c.136	CCDS42565.1	19	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632873	0.67015	.	.	ENSG00000178934	ENST00000314980	T	0.20881	2.04	4.31	4.31	0.51392	.	0.336624	0.25419	N	0.030807	T	0.31327	0.0793	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.10086	-1.0645	7	0.59425	D	0.04	-50.8757	13.8728	0.63629	0.0:0.0:1.0:0.0	.	.	.	.	N	46	ENSP00000313571:D46N	ENSP00000313571:D46N	D	+	1	0	LGALS7B	43973209	0.032000	0.19561	0.010000	0.14722	0.001000	0.01503	1.553000	0.36255	2.241000	0.73720	0.650000	0.86243	GAT	-	LGALS7B	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl_sf,smart_Galectin_CRD		0.642	LGALS7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS7B	HGNC	protein_coding	OTTHUMT00000462638.1	0	0	0	265	265	67	0.00	0.00	G			39281369	+1	24	10	192	69	tier1	no_errors	ENST00000314980	ensembl	human	known	74_37	missense	11.11	12.66	SNP	0.022	A	24	192
FRMD4B	23150	genome.wustl.edu	37	3	69230187	69230187	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:69230187C>A	ENST00000398540.3	-	21	2797	c.2714G>T	c.(2713-2715)cGg>cTg	p.R905L	FRMD4B_ENST00000542259.1_Missense_Mutation_p.R851L|FRMD4B_ENST00000478263.1_Missense_Mutation_p.R557L	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	905					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CCCAGAGGCCCGCTGGTACCA	0.587													ENSG00000114541																																					0													75.0	72.0	73.0					3																	69230187		1987	4185	6172	SO:0001583	missense	0			-	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2714G>T	3.37:g.69230187C>A	ENSP00000381549:p.Arg905Leu		Q8TAI3	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.R905L	ENST00000398540.3	37	c.2714	CCDS46863.1	3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898813	0.91962	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.94184	-3.37;-3.32	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.96617	0.8896	M	0.71036	2.16	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.96565	0.9418	10	0.87932	D	0	-16.9233	20.1141	0.97919	0.0:1.0:0.0:0.0	.	749;905	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	L	905;851;557	ENSP00000381549:R905L;ENSP00000437658:R851L	ENSP00000381549:R905L	R	-	2	0	FRMD4B	69312877	1.000000	0.71417	1.000000	0.80357	0.791000	0.44710	7.487000	0.81328	2.757000	0.94681	0.591000	0.81541	CGG	-	FRMD4B	-	NULL		0.587	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD4B	HGNC	protein_coding	OTTHUMT00000352111.1	0	0	0	40	40	55	0.00	0.00	C			69230187	-1	14	12	29	33	tier1	no_errors	ENST00000398540	ensembl	human	known	74_37	missense	32.56	26.67	SNP	1.000	A	14	29
NRG3	10718	genome.wustl.edu	37	10	84745311	84745311	+	Missense_Mutation	SNP	C	C	A	rs201882406		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:84745311C>A	ENST00000404547.1	+	10	2113	c.2113C>A	c.(2113-2115)Caa>Aaa	p.Q705K	NRG3_ENST00000372142.2_Missense_Mutation_p.Q484K|NRG3_ENST00000556918.1_Missense_Mutation_p.Q511K|NRG3_ENST00000537893.1_Missense_Mutation_p.Q331K|NRG3_ENST00000372141.2_Missense_Mutation_p.Q681K|NRG3_ENST00000545131.1_Missense_Mutation_p.Q331K|NRG3_ENST00000404576.2_Missense_Mutation_p.Q485K			P56975	NRG3_HUMAN	neuregulin 3	705					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		ACGAGAGGCGCAATTTGTCTT	0.463													ENSG00000185737																																					0													76.0	73.0	74.0					10																	84745311		2203	4300	6503	SO:0001583	missense	0			-	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.2113C>A	10.37:g.84745311C>A	ENSP00000384796:p.Gln705Lys		A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfscan_EG-like_dom	p.Q705K	ENST00000404547.1	37	c.2113	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358138	0.24598	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.52295	1.3;1.29;1.31;0.67;1.24;0.78;0.78	5.15	5.15	0.70609	.	0.088628	0.48767	D	0.000161	T	0.34193	0.0889	N	0.21448	0.665	0.38282	D	0.94245	B;B;B;B	0.20887	0.049;0.049;0.02;0.049	B;B;B;B	0.22152	0.008;0.038;0.026;0.008	T	0.24225	-1.0166	10	0.44086	T	0.13	-33.2025	11.5654	0.50802	0.1784:0.8216:0.0:0.0	.	680;705;484;681	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	K	681;705;680;484;485;511;331;331	ENSP00000361214:Q681K;ENSP00000384796:Q705K;ENSP00000361215:Q484K;ENSP00000385804:Q485K;ENSP00000451376:Q511K;ENSP00000441201:Q331K;ENSP00000440377:Q331K	ENSP00000361214:Q681K	Q	+	1	0	NRG3	84735291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.612000	0.46343	2.567000	0.86603	0.591000	0.81541	CAA	-	NRG3	-	NULL		0.463	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	0	0	0	63	63	225	0.00	0.00	C	XM_166086		84745311	+1	15	43	20	61	tier1	no_errors	ENST00000404547	ensembl	human	known	74_37	missense	42.86	41.35	SNP	1.000	A	15	20
PLCL1	5334	genome.wustl.edu	37	2	198948489	198948489	+	Nonsense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:198948489C>G	ENST00000428675.1	+	2	646	c.248C>G	c.(247-249)tCa>tGa	p.S83*	PLCL1_ENST00000437704.2_5'Flank	NM_006226.3	NP_006217.3	Q15111	PLCL1_HUMAN	phospholipase C-like 1	83	Interaction with PPP1C.				gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|inositol 1,4,5 trisphosphate binding (GO:0070679)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(14)|lung(44)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	80					Quinacrine(DB01103)	CAGGATCCTTCAAACCAAAAA	0.348													ENSG00000115896																																					0													43.0	44.0	44.0					2																	198948489		2200	4300	6500	SO:0001587	stop_gained	0			-	D42108	CCDS2326.1, CCDS2326.2	2q33	2014-06-13	2002-02-18	2002-02-22	ENSG00000115896	ENSG00000115896			9063	protein-coding gene	gene with protein product	"""phospholipase C related, but catalytically inactive protein"", ""protein phosphatase 1, regulatory subunit 127"""	600597	"""phospholipase C, epsilon"""	PLCE		7633416	Standard	NM_006226		Approved	PLC-L, PLCL, PRIP, PPP1R127	uc010fsp.3	Q15111	OTTHUMG00000132750	ENST00000428675.1:c.248C>G	2.37:g.198948489C>G	ENSP00000402861:p.Ser83*		Q3MJ90|Q53SD3|Q7Z3S3	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.S83*	ENST00000428675.1	37	c.248	CCDS2326.2	2	.	.	.	.	.	.	.	.	.	.	C	37	6.628777	0.97718	.	.	ENSG00000115896	ENST00000428675	.	.	.	5.67	5.67	0.87782	.	0.619946	0.12011	U	0.507868	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1421	0.98061	0.0:1.0:0.0:0.0	.	.	.	.	X	83	.	.	S	+	2	0	PLCL1	198656734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.238000	0.78173	2.836000	0.97738	0.655000	0.94253	TCA	-	PLCL1	-	NULL		0.348	PLCL1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCL1	HGNC	protein_coding	OTTHUMT00000340210.1	0	0	0	63	63	214	0.00	0.00	C	NM_006226		198948489	+1	6	32	23	67	tier1	no_errors	ENST00000428675	ensembl	human	known	74_37	nonsense	20.69	32.00	SNP	1.000	G	6	23
FASN	2194	genome.wustl.edu	37	17	80042811	80042811	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:80042811G>C	ENST00000306749.2	-	26	4646	c.4428C>G	c.(4426-4428)aaC>aaG	p.N1476K	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1476					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGCTGCTGAGGTTGGAGAGCA	0.677													ENSG00000169710																									Colon(59;314 1043 11189 28578 32273)												0													14.0	12.0	13.0					17																	80042811		2059	4082	6141	SO:0001583	missense	0			-	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4428C>G	17.37:g.80042811G>C	ENSP00000304592:p.Asn1476Lys		Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Acyl_transferase,pfam_Ketoacyl_synth_N,pfam_Thioesterase,pfam_PKS_KR,pfam_DH_sc/Rdtase_SDR,pfam_Ketoacyl_synth_C,pfam_ADH_C,pfam_Acyl_carrier_prot-like,pfam_Methyltransf_12,pfam_Methyltransf_11,superfamily_Thiolase-like,superfamily_Acyl_Trfase/lysoPLipase,superfamily_GroES-like,superfamily_Acyl_carrier_prot-like,superfamily_Malonyl_transacylase_ACP-bd,smart_PKS_Beta-ketoAc_synthase_dom,smart_PKS_acyl_transferase,smart_PKS_dehydratase,smart_PKS_ER,smart_PKS/FAS_KR,smart_PKS_PP-bd,pfscan_Acyl_carrier_prot-like	p.N1476K	ENST00000306749.2	37	c.4428	CCDS11801.1	17	.	.	.	.	.	.	.	.	.	.	G	7.660	0.684781	0.14973	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.25414	1.8	3.54	3.54	0.40534	.	0.175826	0.48286	D	0.000196	T	0.22085	0.0532	L	0.49126	1.545	0.46478	D	0.999065	P	0.37423	0.594	B	0.30316	0.114	T	0.15263	-1.0443	10	0.66056	D	0.02	-35.9713	13.4136	0.60956	0.0:0.0:1.0:0.0	.	1476	P49327	FAS_HUMAN	K	1476;441	ENSP00000304592:N1476K	ENSP00000304592:N1476K	N	-	3	2	FASN	77636100	1.000000	0.71417	1.000000	0.80357	0.095000	0.18619	1.414000	0.34736	1.772000	0.52199	0.313000	0.20887	AAC	-	FASN	-	NULL		0.677	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASN	HGNC	protein_coding	OTTHUMT00000442369.1	0	0	0	71	71	14	0.00	0.00	G	NM_004104		80042811	-1	18	5	90	10	tier1	no_errors	ENST00000306749	ensembl	human	known	74_37	missense	16.67	33.33	SNP	1.000	C	18	90
SNX29	92017	genome.wustl.edu	37	16	12497352	12497352	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:12497352G>A	ENST00000566228.1	+	18	2072	c.2003G>A	c.(2002-2004)cGg>cAg	p.R668Q	SNX29_ENST00000306030.3_Missense_Mutation_p.R283Q|SNX29_ENST00000323433.4_Missense_Mutation_p.R283Q	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	668	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.					extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						GTGTTTCTCCGGGGCAAAGCA	0.478													ENSG00000048471																																					0																																										SO:0001583	missense	0			-	AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2003G>A	16.37:g.12497352G>A	ENSP00000456480:p.Arg668Gln		B5MDW2|Q8N2X2|Q9HA26	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.R283Q	ENST00000566228.1	37	c.848	CCDS10553.2	16	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146214	0.77888	.	.	ENSG00000048471	ENST00000306030;ENST00000323433	T;T	0.30714	1.52;1.52	5.24	5.24	0.73138	.	0.069170	0.64402	D	0.000011	T	0.35653	0.0939	L	0.41906	1.305	0.29358	N	0.864899	.	.	.	.	.	.	T	0.17531	-1.0366	8	0.29301	T	0.29	-18.0607	16.3313	0.83015	0.0:0.0:1.0:0.0	.	.	.	.	Q	283	ENSP00000306940:R283Q;ENSP00000322226:R283Q	ENSP00000306940:R283Q	R	+	2	0	SNX29	12404853	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.229000	0.65316	2.440000	0.82611	0.561000	0.74099	CGG	-	SNX29	-	superfamily_Phox,smart_Phox,pfscan_Phox		0.478	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1	0	0	0	78	78	204	0.00	0.00	G			12497352	+1	8	33	36	90	tier1	no_errors	ENST00000306030	ensembl	human	known	74_37	missense	18.18	26.83	SNP	1.000	A	8	36
SCNN1G	6340	genome.wustl.edu	37	16	23197815	23197815	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:23197815G>A	ENST00000300061.2	+	2	366	c.223G>A	c.(223-225)Gtc>Atc	p.V75I		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	75					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)	p.V75I(1)		NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CGCCCTCCTCGTCTTCTCCTT	0.577													ENSG00000166828																																					1	Substitution - Missense(1)	large_intestine(1)											65.0	60.0	62.0					16																	23197815		2197	4300	6497	SO:0001583	missense	0			-	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.223G>A	16.37:g.23197815G>A	ENSP00000300061:p.Val75Ile		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V75I	ENST00000300061.2	37	c.223	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	2.750	-0.260215	0.05791	.	.	ENSG00000166828	ENST00000300061	T	0.61040	0.14	5.34	1.13	0.20643	.	0.827160	0.10918	N	0.619769	T	0.23926	0.0579	N	0.02721	-0.515	0.22728	N	0.99881	B	0.14012	0.009	B	0.12156	0.007	T	0.28839	-1.0031	10	0.02654	T	1	-35.0795	4.6443	0.12565	0.3562:0.2467:0.3971:0.0	.	75	P51170	SCNNG_HUMAN	I	75	ENSP00000300061:V75I	ENSP00000300061:V75I	V	+	1	0	SCNN1G	23105316	0.012000	0.17670	0.482000	0.27366	0.934000	0.57294	-0.027000	0.12371	0.220000	0.20860	0.563000	0.77884	GTC	-	SCNN1G	-	pfam_Na+channel_ASC,tigrfam_EnaC		0.577	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1	0	0	0	29	29	107	0.00	0.00	G	NM_001039		23197815	+1	3	16	6	19	tier1	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	33.33	45.71	SNP	0.713	A	3	6
CDCP2	200008	genome.wustl.edu	37	1	54610408	54610408	+	Missense_Mutation	SNP	T	T	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:54610408T>G	ENST00000371330.1	-	2	1005	c.158A>C	c.(157-159)aAc>aCc	p.N53T	RP11-446E24.4_ENST00000525949.1_5'UTR|RP11-446E24.4_ENST00000311841.7_3'UTR	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	53	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					extracellular region (GO:0005576)				kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						GCACTCTGTGTTGTAGGGGTA	0.567													ENSG00000157211																																					0													81.0	65.0	70.0					1																	54610408		2203	4300	6503	SO:0001583	missense	0			-		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.158A>C	1.37:g.54610408T>G	ENSP00000360381:p.Asn53Thr		Q6ZWJ3	Missense_Mutation	SNP	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	p.N53T	ENST00000371330.1	37	c.158	CCDS588.2	1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138756	0.77775	.	.	ENSG00000157211	ENST00000371330	T	0.34472	1.36	5.51	5.51	0.81932	CUB (5);	0.307475	0.35646	N	0.003065	T	0.54515	0.1863	M	0.87547	2.89	0.40672	D	0.982224	D	0.53151	0.958	P	0.49140	0.601	T	0.66396	-0.5934	10	0.66056	D	0.02	-29.0875	15.6251	0.76848	0.0:0.0:0.0:1.0	.	53	Q5VXM1	CDCP2_HUMAN	T	53	ENSP00000360381:N53T	ENSP00000360381:N53T	N	-	2	0	CDCP2	54382996	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.136000	0.71703	2.093000	0.63338	0.482000	0.46254	AAC	-	CDCP2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.567	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CDCP2	HGNC	protein_coding	OTTHUMT00000022209.2	0	0	0	68	68	165	0.00	0.00	T	NM_201546		54610408	-1	14	32	38	102	tier1	no_errors	ENST00000371330	ensembl	human	novel	74_37	missense	26.92	23.88	SNP	1.000	G	14	38
ZFP37	7539	genome.wustl.edu	37	9	115806243	115806243	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:115806243T>C	ENST00000374227.3	-	4	682	c.655A>G	c.(655-657)Aca>Gca	p.T219A	ZFP37_ENST00000553380.1_Missense_Mutation_p.T234A|ZFP37_ENST00000555206.1_Missense_Mutation_p.T220A	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						CCTTTCCTTGTATCAGATAAG	0.343													ENSG00000136866																																					0													240.0	235.0	237.0					9																	115806243		2203	4299	6502	SO:0001583	missense	0			-	AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.655A>G	9.37:g.115806243T>C	ENSP00000363344:p.Thr219Ala		A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T234A	ENST00000374227.3	37	c.700	CCDS6787.1	9	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.489607	0.01018	.	.	ENSG00000136866	ENST00000374227;ENST00000555206;ENST00000553380	T;T;T	0.05319	3.53;3.46;3.53	4.28	3.15	0.36227	.	0.726173	0.11897	N	0.519050	T	0.05227	0.0139	L	0.31845	0.965	0.09310	N	1	B;B;B	0.28291	0.206;0.206;0.131	B;B;B	0.28305	0.088;0.088;0.04	T	0.42498	-0.9448	10	0.23891	T	0.37	-0.3295	5.9026	0.18976	0.0:0.1189:0.0:0.8811	.	220;234;219	G3V3L7;Q9Y6Q3-2;Q9Y6Q3	.;.;ZFP37_HUMAN	A	219;220;234	ENSP00000363344:T219A;ENSP00000451310:T220A;ENSP00000452552:T234A	ENSP00000363344:T219A	T	-	1	0	ZFP37	114846064	0.006000	0.16342	0.262000	0.24481	0.036000	0.12997	1.306000	0.33505	0.995000	0.38917	0.533000	0.62120	ACA	-	ZFP37	-	NULL		0.343	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	0	0	0	37	37	213	0.00	0.00	T	NM_003408		115806243	-1	8	48	12	68	tier1	no_errors	ENST00000553380	ensembl	human	known	74_37	missense	40.00	41.38	SNP	0.150	C	8	12
CD300LG	146894	genome.wustl.edu	37	17	41930355	41930355	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:41930355C>A	ENST00000317310.4	+	3	496	c.455C>A	c.(454-456)gCt>gAt	p.A152D	CD300LG_ENST00000293396.8_Intron|CD300LG_ENST00000586233.1_Intron|CD300LG_ENST00000377203.4_Intron|CD300LG_ENST00000539718.1_Missense_Mutation_p.A152D	NM_145273.3	NP_660316.2	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g	152					immune system process (GO:0002376)|immunoglobulin transcytosis in epithelial cells (GO:0002414)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|skin(4)	19		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		AAGGCAAAAGCTCAGCAAACC	0.587													ENSG00000161649																																					0													138.0	129.0	132.0					17																	41930355		2203	4300	6503	SO:0001583	missense	0			-	BC025395	CCDS11470.1, CCDS54131.1, CCDS54132.1, CCDS54133.1	17q21.31	2013-01-11	2006-03-29					"""Immunoglobulin superfamily / V-set domain containing"""	30455	protein-coding gene	gene with protein product	"""nepmucin"""	610520	"""CD300 antigen like family member G"""			16876123, 16754720	Standard	NM_001168322		Approved	Trem4, CLM9	uc002iem.3	Q6UXG3		ENST00000317310.4:c.455C>A	17.37:g.41930355C>A	ENSP00000321005:p.Ala152Asp		B4DNY5|F5H7P9|F8W9M3|Q8IX38|Q8IX39|Q8TA95	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.A152D	ENST00000317310.4	37	c.455	CCDS11470.1	17	.	.	.	.	.	.	.	.	.	.	C	3.556	-0.090617	0.07053	.	.	ENSG00000161649	ENST00000317310;ENST00000539718	T;T	0.07688	3.19;3.17	3.04	2.07	0.26955	.	0.616946	0.13478	N	0.384908	T	0.06781	0.0173	N	0.19112	0.55	0.09310	N	1	P;P	0.39250	0.665;0.535	B;B	0.43728	0.429;0.247	T	0.34104	-0.9842	10	0.36615	T	0.2	.	6.1104	0.20097	0.0:0.8568:0.0:0.1432	.	152;152	F5H7P9;Q6UXG3	.;CLM9_HUMAN	D	152	ENSP00000321005:A152D;ENSP00000442368:A152D	ENSP00000321005:A152D	A	+	2	0	CD300LG	39285881	0.040000	0.19996	0.024000	0.17045	0.018000	0.09664	0.505000	0.22642	0.857000	0.35407	0.462000	0.41574	GCT	-	CD300LG	-	NULL		0.587	CD300LG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD300LG	HGNC	protein_coding	OTTHUMT00000457646.1	0	0	0	70	70	129	0.00	0.00	C	NM_145273		41930355	+1	23	34	39	68	tier1	no_errors	ENST00000317310	ensembl	human	known	74_37	missense	37.10	33.33	SNP	0.029	A	23	39
TERT	7015	genome.wustl.edu	37	5	1293552	1293552	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:1293552G>A	ENST00000310581.5	-	2	1506	c.1449C>T	c.(1447-1449)aaC>aaT	p.N483N	TERT_ENST00000334602.6_Silent_p.N483N|TERT_ENST00000508104.2_Silent_p.N483N|TERT_ENST00000296820.5_Silent_p.N483N|TERT_ENST00000522877.1_5'Flank	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	483	QFP motif.|RNA-interacting domain 2.|Required for oligomerization.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	AGCGGCGTTCGTTGTGCCTGG	0.662									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis				ENSG00000164362																																					0													33.0	33.0	33.0					5																	1293552		2193	4300	6493	SO:0001819	synonymous_variant	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	-	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.1449C>T	5.37:g.1293552G>A			O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.N483	ENST00000310581.5	37	c.1449	CCDS3861.2	5																																																																																			-	TERT	-	pfam_Telomerase_RBD,smart_Telomerase_RBD		0.662	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	0	0	0	29	29	62	0.00	0.00	G			1293552	-1	15	32	33	50	tier1	no_errors	ENST00000310581	ensembl	human	known	74_37	silent	31.25	39.02	SNP	0.984	A	15	33
CDH6	1004	genome.wustl.edu	37	5	31317976	31317976	+	Silent	SNP	G	G	T	rs145080455		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:31317976G>T	ENST00000265071.2	+	11	2092	c.1827G>T	c.(1825-1827)acG>acT	p.T609T	CDH6_ENST00000514738.1_Silent_p.T554T	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	609					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCCACCCCACGGGACTGAGCA	0.592													ENSG00000113361																																					0													66.0	64.0	65.0					5																	31317976		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1827G>T	5.37:g.31317976G>T			A8K5H5|Q9BWS0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T609	ENST00000265071.2	37	c.1827	CCDS3894.1	5																																																																																			-	CDH6	-	pfscan_Cadherin		0.592	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	0	0	0	48	48	136	0.00	0.00	G	NM_004932		31317976	+1	5	17	39	85	tier1	no_errors	ENST00000265071	ensembl	human	known	74_37	silent	11.11	16.50	SNP	0.996	T	5	39
USH2A	7399	genome.wustl.edu	37	1	216062047	216062047	+	Silent	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:216062047G>T	ENST00000307340.3	-	41	8330	c.7944C>A	c.(7942-7944)acC>acA	p.T2648T	USH2A_ENST00000366943.2_Silent_p.T2648T|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2648	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CATTGGGGTGGGTAGGGGGTT	0.498										HNSCC(13;0.011)			ENSG00000042781																																					0													71.0	79.0	76.0					1																	216062047		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7944C>A	1.37:g.216062047G>T			Q5VVM9|Q6S362|Q9NS27	Silent	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.T2648	ENST00000307340.3	37	c.7944	CCDS31025.1	1																																																																																			-	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.498	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	0	0	0	40	40	197	0.00	0.00	G	NM_007123		216062047	-1	6	41	16	53	tier1	no_errors	ENST00000366943	ensembl	human	known	74_37	silent	27.27	43.62	SNP	0.000	T	6	16
SYT9	143425	genome.wustl.edu	37	11	7334914	7334914	+	Silent	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr11:7334914C>A	ENST00000318881.6	+	3	1023	c.786C>A	c.(784-786)atC>atA	p.I262I	SYT9_ENST00000396716.2_Silent_p.I230I	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	262	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)	p.I262I(1)		NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		ATGTCAAGATCTATTTGCTTC	0.413													ENSG00000170743																																					1	Substitution - coding silent(1)	large_intestine(1)											136.0	135.0	136.0					11																	7334914		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.786C>A	11.37:g.7334914C>A				Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.I262	ENST00000318881.6	37	c.786	CCDS7778.1	11																																																																																			-	SYT9	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_C2_dom		0.413	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT9	HGNC	protein_coding	OTTHUMT00000384483.1	0	0	0	48	48	225	0.00	0.00	C	NM_175733		7334914	+1	11	24	27	103	tier1	no_errors	ENST00000318881	ensembl	human	known	74_37	silent	28.95	18.90	SNP	1.000	A	11	27
MAN2A2	4122	genome.wustl.edu	37	15	91456916	91456916	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:91456916A>G	ENST00000559717.1	+	19	3250	c.2791A>G	c.(2791-2793)Atc>Gtc	p.I931V	MAN2A2_ENST00000431652.2_Missense_Mutation_p.I439V|MAN2A2_ENST00000430376.2_Missense_Mutation_p.I121V|MAN2A2_ENST00000360468.3_Missense_Mutation_p.I931V			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	931					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CATGGCCTATATCCAGGACGC	0.612													ENSG00000196547																																					0													45.0	38.0	40.0					15																	91456916		2198	4298	6496	SO:0001583	missense	0			-	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.2791A>G	15.37:g.91456916A>G	ENSP00000452948:p.Ile931Val		A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.I931V	ENST00000559717.1	37	c.2791	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	A	15.95	2.983811	0.53827	.	.	ENSG00000196547	ENST00000360468;ENST00000431652;ENST00000430376	D;D;D	0.87650	-2.28;-2.28;-2.28	4.98	3.85	0.44370	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.275088	0.40908	D	0.000991	D	0.90971	0.7161	M	0.79123	2.44	0.80722	D	1	P;B;B	0.39352	0.669;0.107;0.215	P;B;B	0.52554	0.702;0.391;0.384	D	0.90428	0.4422	10	0.56958	D	0.05	-31.2907	11.6398	0.51227	0.8432:0.1568:0.0:0.0	.	439;559;931	B4DEU9;B4DIK4;P49641	.;.;MA2A2_HUMAN	V	931;439;121	ENSP00000353655:I931V;ENSP00000388221:I439V;ENSP00000394372:I121V	ENSP00000353655:I931V	I	+	1	0	MAN2A2	89257920	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.134000	0.71689	0.934000	0.37316	0.397000	0.26171	ATC	-	MAN2A2	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom		0.612	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	HGNC	protein_coding	OTTHUMT00000418246.5	0	0	0	27	27	107	0.00	0.00	A	NM_006122		91456916	+1	4	18	23	78	tier1	no_errors	ENST00000360468	ensembl	human	known	74_37	missense	14.81	18.75	SNP	1.000	G	4	23
ZBED9	114821	genome.wustl.edu	37	6	28554200	28554200	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:28554200G>T	ENST00000452236.2	-	1	912	c.295C>A	c.(295-297)Cag>Aag	p.Q99K	SCAND3_ENST00000530247.1_Intron|RP5-1186N24.3_ENST00000499525.1_RNA	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						GTCAGGAACTGCTCCAGCACC	0.552													ENSG00000232040																																					0													108.0	108.0	108.0					6																	28554200		2203	4300	6503	SO:0001583	missense	0			-																												ENST00000452236.2:c.295C>A	6.37:g.28554200G>T	ENSP00000395259:p.Gln99Lys			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.Q99K	ENST00000452236.2	37	c.295	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100950	0.76983	.	.	ENSG00000232040	ENST00000452236	T	0.16324	2.35	3.46	3.46	0.39613	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.37945	0.1022	M	0.91459	3.21	0.30929	N	0.727151	P	0.51537	0.946	D	0.69307	0.963	T	0.32851	-0.9891	9	0.87932	D	0	.	12.8515	0.57860	0.0:0.0:1.0:0.0	.	99	Q6R2W3	SCND3_HUMAN	K	99	ENSP00000395259:Q99K	ENSP00000395259:Q99K	Q	-	1	0	SCAND3	28662179	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.615000	0.67702	1.938000	0.56188	0.655000	0.94253	CAG	-	SCAND3	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.552	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	0	0	0	67	67	82	0.00	0.00	G			28554200	-1	9	29	56	54	tier1	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	13.85	34.94	SNP	1.000	T	9	56
PLEKHA2	59339	genome.wustl.edu	37	8	38793524	38793524	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:38793524G>C	ENST00000521746.1	+	3	388	c.154G>C	c.(154-156)Ggg>Cgg	p.G52R	PLEKHA2_ENST00000420274.1_Missense_Mutation_p.G52R|PLEKHA2_ENST00000388745.4_3'UTR			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	52	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			TCTGGCAATGGGGGCAGGAGC	0.453													ENSG00000169499																																					0													138.0	136.0	136.0					8																	38793524		1916	4135	6051	SO:0001583	missense	0			-	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.154G>C	8.37:g.38793524G>C	ENSP00000430938:p.Gly52Arg			Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G52R	ENST00000521746.1	37	c.154		8	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059180	0.76074	.	.	ENSG00000169499	ENST00000521746;ENST00000420274;ENST00000535929;ENST00000519640	T;T;T	0.74526	-0.85;-0.85;-0.85	5.78	5.78	0.91487	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.84483	0.5482	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85090	0.0951	10	0.87932	D	0	.	15.8585	0.79005	0.0:0.0:1.0:0.0	.	52;52	Q9HB19;A8K727	PKHA2_HUMAN;.	R	52;52;2;52	ENSP00000430938:G52R;ENSP00000393860:G52R;ENSP00000429956:G52R	ENSP00000393860:G52R	G	+	1	0	PLEKHA2	38912681	0.999000	0.42202	0.963000	0.40424	0.819000	0.46315	3.458000	0.53014	2.890000	0.99128	0.655000	0.94253	GGG	-	PLEKHA2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.453	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	HGNC	protein_coding	OTTHUMT00000377068.1	0	0	0	86	86	181	0.00	0.00	G	NM_021623		38793524	+1	14	62	5	26	tier1	no_errors	ENST00000420274	ensembl	human	known	74_37	missense	73.68	69.66	SNP	0.986	C	14	5
CDH12	1010	genome.wustl.edu	37	5	21751881	21751881	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:21751881C>T	ENST00000382254.1	-	15	3436	c.2350G>A	c.(2350-2352)Gaa>Aaa	p.E784K	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.E784K|RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000522262.1_Missense_Mutation_p.E744K	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	784					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CTCTCTTCTTCGCCAAACATG	0.443										HNSCC(59;0.17)			ENSG00000154162																																					0													81.0	82.0	82.0					5																	21751881		2203	4300	6503	SO:0001583	missense	0			-	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.2350G>A	5.37:g.21751881C>T	ENSP00000371689:p.Glu784Lys		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E784K	ENST00000382254.1	37	c.2350	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	12.45	1.940972	0.34283	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.75938	-0.98;-0.98;-0.98	5.34	5.34	0.76211	Cadherin, cytoplasmic domain (1);	0.052208	0.85682	D	0.000000	T	0.65471	0.2694	L	0.40543	1.245	0.52501	D	0.999957	B;B	0.21452	0.01;0.056	B;B	0.18263	0.021;0.011	T	0.61959	-0.6955	10	0.39692	T	0.17	.	12.4075	0.55449	0.0:0.9228:0.0:0.0772	.	744;784	B7Z2U6;P55289	.;CAD12_HUMAN	K	784;784;744	ENSP00000423577:E784K;ENSP00000371689:E784K;ENSP00000428786:E744K	ENSP00000371689:E784K	E	-	1	0	CDH12	21787638	1.000000	0.71417	0.935000	0.37517	0.930000	0.56654	5.355000	0.66046	2.496000	0.84212	0.467000	0.42956	GAA	-	CDH12	-	pfam_Cadherin_cytoplasmic-dom		0.443	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	0	0	0	49	49	149	0.00	0.00	C	NM_004061		21751881	-1	36	105	12	49	tier1	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	75.00	67.74	SNP	0.998	T	36	12
ACSM4	341392	genome.wustl.edu	37	12	7480905	7480905	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:7480905C>A	ENST00000399422.4	+	13	1727	c.1679C>A	c.(1678-1680)cCa>cAa	p.P560Q		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	560					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						CAAGAACTCCCAAAGACAATC	0.398													ENSG00000215009																																					0													70.0	63.0	65.0					12																	7480905		1840	4095	5935	SO:0001583	missense	0			-		CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1679C>A	12.37:g.7480905C>A	ENSP00000382349:p.Pro560Gln		A8MTI6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.P560Q	ENST00000399422.4	37	c.1679	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	C	17.35	3.367989	0.61513	.	.	ENSG00000215009	ENST00000399422	T	0.72725	-0.68	2.64	2.64	0.31445	.	0.000000	0.38959	U	0.001514	D	0.87819	0.6273	H	0.97103	3.94	0.52099	D	0.999944	D	0.89917	1.0	D	0.97110	1.0	D	0.90529	0.4494	10	0.87932	D	0	0.1466	11.4235	0.49996	0.0:1.0:0.0:0.0	.	560	P0C7M7	ACSM4_HUMAN	Q	560	ENSP00000382349:P560Q	ENSP00000382349:P560Q	P	+	2	0	ACSM4	7372172	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.029000	0.70895	1.789000	0.52484	0.591000	0.81541	CCA	-	ACSM4	-	NULL		0.398	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	0	0	0	84	84	304	0.00	0.00	C	NM_001080454		7480905	+1	16	46	43	187	tier1	no_errors	ENST00000399422	ensembl	human	novel	74_37	missense	27.12	19.74	SNP	1.000	A	16	43
MYO1H	283446	genome.wustl.edu	37	12	109845713	109845713	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:109845713A>G	ENST00000431443.2	+	9	1102	c.1102A>G	c.(1102-1104)Aac>Gac	p.N368D	MYO1H_ENST00000310903.5_Missense_Mutation_p.N368D	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	368	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						CTCCTTAGTTAACAAGGTTGG	0.418													ENSG00000174527																																					0													170.0	162.0	165.0					12																	109845713		1980	4140	6120	SO:0001583	missense	0			-		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.1102A>G	12.37:g.109845713A>G	ENSP00000444076:p.Asn368Asp		F5H3C6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.N368D	ENST00000431443.2	37	c.1102		12	.	.	.	.	.	.	.	.	.	.	A	15.62	2.887033	0.52014	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	D;D	0.87103	-2.21;-2.21	5.06	5.06	0.68205	.	.	.	.	.	D	0.91209	0.7230	L	0.53561	1.675	0.44619	D	0.99759	D	0.89917	1.0	D	0.91635	0.999	D	0.90656	0.4586	9	0.40728	T	0.16	.	14.3179	0.66465	1.0:0.0:0.0:0.0	.	368	F5H3C6	.	D	368	ENSP00000439182:N368D;ENSP00000444076:N368D	ENSP00000439182:N368D	N	+	1	0	MYO1H	108330096	1.000000	0.71417	0.988000	0.46212	0.118000	0.20060	7.287000	0.78681	2.051000	0.60960	0.397000	0.26171	AAC	-	MYO1H	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.418	MYO1H-201	KNOWN	basic	protein_coding	MYO1H	HGNC	protein_coding		0	0	0	119	119	262	0.00	0.00	A	NM_173597		109845713	+1	23	56	49	116	tier1	no_errors	ENST00000431443	ensembl	human	known	74_37	missense	31.94	32.56	SNP	1.000	G	23	49
YTHDC2	64848	genome.wustl.edu	37	5	112871433	112871433	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:112871433C>A	ENST00000161863.4	+	7	1253	c.1040C>A	c.(1039-1041)tCt>tAt	p.S347Y	YTHDC2_ENST00000515883.1_Missense_Mutation_p.S347Y	NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	347	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		CTAATTCTTTCTAGTGCTGCC	0.303													ENSG00000047188																																					0													62.0	68.0	66.0					5																	112871433		2201	4298	6499	SO:0001583	missense	0			-	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.1040C>A	5.37:g.112871433C>A	ENSP00000161863:p.Ser347Tyr		B2RP66	Missense_Mutation	SNP	pfam_YTH_domain,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_D/R_helicase_DEAD/DEAH_N,pfam_DUF1605,pfam_R3H_ss-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_R3H_ss-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_R3H_ss-bd,pfscan_YTH_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S347Y	ENST00000161863.4	37	c.1040	CCDS4113.1	5	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796856	0.70567	.	.	ENSG00000047188	ENST00000161863;ENST00000515883;ENST00000511372	T;T	0.09350	2.99;2.99	5.61	5.61	0.85477	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.054046	0.85682	D	0.000000	T	0.37598	0.1009	M	0.77103	2.36	0.53688	D	0.999971	D	0.89917	1.0	D	0.79108	0.992	T	0.11591	-1.0581	10	0.87932	D	0	.	19.6493	0.95794	0.0:1.0:0.0:0.0	.	347	Q9H6S0	YTDC2_HUMAN	Y	347;347;257	ENSP00000161863:S347Y;ENSP00000423101:S347Y	ENSP00000161863:S347Y	S	+	2	0	YTHDC2	112899332	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.663000	0.68038	2.638000	0.89438	0.650000	0.86243	TCT	-	YTHDC2	-	pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.303	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDC2	HGNC	protein_coding	OTTHUMT00000250776.2	0	0	0	81	81	230	0.00	0.00	C	NM_022828		112871433	+1	17	29	32	93	tier1	no_errors	ENST00000161863	ensembl	human	known	74_37	missense	34.69	23.77	SNP	1.000	A	17	32
MYZAP	100820829	genome.wustl.edu	37	15	57918073	57918073	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:57918073G>C	ENST00000267853.5	+	5	602	c.508G>C	c.(508-510)Gat>Cat	p.D170H	GCOM1_ENST00000380560.2_Intron|GCOM1_ENST00000587652.1_Missense_Mutation_p.D170H|GCOM1_ENST00000380561.2_Missense_Mutation_p.D139H|GCOM1_ENST00000380569.2_Missense_Mutation_p.D170H|GCOM1_ENST00000380568.3_Missense_Mutation_p.D170H|GCOM1_ENST00000574161.1_Missense_Mutation_p.D170H|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000396180.1_Missense_Mutation_p.D139H|MYZAP_ENST00000380565.4_Missense_Mutation_p.D170H|GCOM1_ENST00000572390.1_Missense_Mutation_p.D170H			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	170					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											CTTGGCATCAGATTCCATTGG	0.488													ENSG00000137878																																					0													125.0	107.0	113.0					15																	57918073		2192	4292	6484	SO:0001583	missense	0			-	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.508G>C	15.37:g.57918073G>C	ENSP00000267853:p.Asp170His		D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	NULL	p.D170H	ENST00000267853.5	37	c.508	CCDS10162.1	15	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098124	0.56183	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T	0.34275	1.37;1.37;1.37;1.37;1.37;1.37	5.81	5.81	0.92471	.	0.094116	0.64402	D	0.000001	T	0.57080	0.2029	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.71870	0.957;0.957;0.975;0.975	T	0.53899	-0.8373	10	0.54805	T	0.06	-30.9752	18.851	0.92230	0.0:0.0:1.0:0.0	.	170;170;170;170	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	H	170;139;139;170;170;170	ENSP00000369943:D170H;ENSP00000369935:D139H;ENSP00000379483:D139H;ENSP00000267853:D170H;ENSP00000369939:D170H;ENSP00000369942:D170H	ENSP00000267853:D170H	D	+	1	0	GCOM1	55705365	1.000000	0.71417	0.932000	0.37286	0.243000	0.25628	6.707000	0.74654	2.747000	0.94245	0.650000	0.86243	GAT	-	GCOM1	-	NULL		0.488	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCOM1	HGNC	protein_coding	OTTHUMT00000255716.2	0	0	0	33	33	175	0.00	0.00	G	NM_001018100		57918073	+1	3	36	7	44	tier1	no_errors	ENST00000380569	ensembl	human	known	74_37	missense	30.00	45.00	SNP	0.994	C	3	7
TP53	7157	genome.wustl.edu	37	17	7577136	7577136	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577136T>A	ENST00000269305.4	-	8	991	c.802A>T	c.(802-804)Aac>Tac	p.N268Y	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.N268Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.N268Y|TP53_ENST00000455263.2_Missense_Mutation_p.N268Y|TP53_ENST00000420246.2_Missense_Mutation_p.N268Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	268	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.N268H(3)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.N268fs*77(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.N268fs*8(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)|p.N268F(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCAAAGCTGTTCCGTCCCAGT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Deletion - In frame(8)|Whole gene deletion(8)|Substitution - Missense(4)|Unknown(3)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|lung(3)|large_intestine(2)|central_nervous_system(2)|urinary_tract(2)|oesophagus(2)|breast(2)|thyroid(1)|stomach(1)|eye(1)|ovary(1)											55.0	49.0	51.0					17																	7577136		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.802A>T	17.37:g.7577136T>A	ENSP00000269305:p.Asn268Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N268Y	ENST00000269305.4	37	c.802	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193991	0.58017	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99762	-6.67;-6.67;-6.67;-6.67;-6.67;-6.67	5.13	-4.52	0.03472	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.596147	0.17821	N	0.160851	D	0.99184	0.9717	L	0.45581	1.43	0.09310	N	0.999999	D;B;D;D	0.67145	0.995;0.138;0.992;0.996	D;B;D;D	0.74348	0.956;0.117;0.962;0.983	D	0.96648	0.9479	10	0.87932	D	0	-6.849	2.6577	0.05017	0.1106:0.3308:0.3293:0.2293	.	268;268;268;268	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	Y	268;268;268;268;268;257;136	ENSP00000352610:N268Y;ENSP00000269305:N268Y;ENSP00000398846:N268Y;ENSP00000391127:N268Y;ENSP00000391478:N268Y;ENSP00000425104:N136Y	ENSP00000269305:N268Y	N	-	1	0	TP53	7517861	0.001000	0.12720	0.074000	0.20217	0.886000	0.51366	-0.220000	0.09215	-0.688000	0.05155	0.379000	0.24179	AAC	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	1	27	27	189	0.00	0.53	T	NM_000546		7577136	-1	18	85	2	26	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	90.00	75.89	SNP	0.001	A	18	2
COL6A6	131873	genome.wustl.edu	37	3	130282278	130282278	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:130282278A>T	ENST00000358511.6	+	2	462	c.431A>T	c.(430-432)gAg>gTg	p.E144V	COL6A6_ENST00000453409.2_Missense_Mutation_p.E144V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	144	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCTGAGTCTGAGGATAATGTG	0.498													ENSG00000206384																																					0													48.0	48.0	48.0					3																	130282278		1901	4122	6023	SO:0001583	missense	0			-	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.431A>T	3.37:g.130282278A>T	ENSP00000351310:p.Glu144Val		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E144V	ENST00000358511.6	37	c.431	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	A	17.43	3.386518	0.61956	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.78364	-1.17;-1.17	5.21	5.21	0.72293	von Willebrand factor, type A (3);	0.101584	0.43260	D	0.000596	D	0.84942	0.5584	M	0.69185	2.1	0.28192	N	0.927723	D	0.64830	0.994	P	0.61658	0.892	T	0.80410	-0.1394	10	0.49607	T	0.09	.	15.0383	0.71767	1.0:0.0:0.0:0.0	.	144	A6NMZ7	CO6A6_HUMAN	V	144	ENSP00000351310:E144V;ENSP00000399236:E144V	ENSP00000351310:E144V	E	+	2	0	COL6A6	131764968	0.976000	0.34144	0.995000	0.50966	0.769000	0.43574	2.462000	0.45049	2.090000	0.63153	0.459000	0.35465	GAG	-	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	0	0	0	57	57	82	0.00	0.00	A	NM_001102608		130282278	+1	7	15	35	40	tier1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	16.67	27.27	SNP	0.895	T	7	35
KCNA6	3742	genome.wustl.edu	37	12	4919890	4919890	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:4919890A>T	ENST00000280684.3	+	1	1549	c.683A>T	c.(682-684)gAa>gTa	p.E228V	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.E228V			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	228					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GAGGAGGATGAAGACGATTCC	0.552										HNSCC(72;0.22)			ENSG00000151079																																					0													88.0	88.0	88.0					12																	4919890		2203	4300	6503	SO:0001583	missense	0			-	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.683A>T	12.37:g.4919890A>T	ENSP00000280684:p.Glu228Val			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E228V	ENST00000280684.3	37	c.683	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	A	0.244	-1.011687	0.02095	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97209	-4.29;-4.29	5.64	5.64	0.86602	.	2.916220	0.01570	N	0.020525	D	0.92433	0.7598	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.82977	-0.0189	10	0.26408	T	0.33	.	7.0966	0.25313	0.7752:0.1486:0.0763:0.0	.	228	P17658	KCNA6_HUMAN	V	228	ENSP00000408321:E228V;ENSP00000280684:E228V	ENSP00000280684:E228V	E	+	2	0	KCNA6	4790151	0.054000	0.20591	0.109000	0.21407	0.057000	0.15508	0.804000	0.27098	2.152000	0.67230	0.533000	0.62120	GAA	-	KC6	-	prints_K_chnl_volt-dep_Kv1.6		0.552	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KC6	HGNC	protein_coding	OTTHUMT00000398909.1	0	0	0	67	67	162	0.00	0.00	A	NM_002235		4919890	+1	9	31	52	100	tier1	no_errors	ENST00000280684	ensembl	human	known	74_37	missense	14.75	23.66	SNP	0.070	T	9	52
TMEM200A	114801	genome.wustl.edu	37	6	130762280	130762280	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:130762280G>C	ENST00000296978.3	+	3	1584	c.713G>C	c.(712-714)aGt>aCt	p.S238T	TMEM200A_ENST00000392429.1_Missense_Mutation_p.S238T|TMEM200A_ENST00000545622.1_Missense_Mutation_p.S238T	NM_001258276.1|NM_001258277.1|NM_001258278.1	NP_001245205.1|NP_001245206.1|NP_001245207.1	Q86VY9	T200A_HUMAN	transmembrane protein 200A	238						integral component of membrane (GO:0016021)				NS(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(30)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GAAGGTAAGAGTTCTGGGCAT	0.493													ENSG00000164484																																					0													67.0	64.0	65.0					6																	130762280		2203	4300	6503	SO:0001583	missense	0			-	AB067500	CCDS5140.1	6q23.1	2009-09-04	2007-12-18	2007-12-18	ENSG00000164484	ENSG00000164484			21075	protein-coding gene	gene with protein product			"""KIAA1913"""	KIAA1913		15722956	Standard	NM_001258276		Approved	TTMC	uc010kfh.4	Q86VY9	OTTHUMG00000015557	ENST00000296978.3:c.713G>C	6.37:g.130762280G>C	ENSP00000296978:p.Ser238Thr		Q96PX5	Missense_Mutation	SNP	pfam_DUF2371_TMEM200	p.S238T	ENST00000296978.3	37	c.713	CCDS5140.1	6	.	.	.	.	.	.	.	.	.	.	G	0.426	-0.905837	0.02453	.	.	ENSG00000164484	ENST00000296978;ENST00000545622;ENST00000392429	.	.	.	5.93	3.1	0.35709	.	0.574086	0.20413	N	0.092840	T	0.10637	0.0260	L	0.31664	0.95	0.09310	N	0.999993	B	0.02656	0.0	B	0.01281	0.0	T	0.25950	-1.0117	9	0.21540	T	0.41	-23.7235	7.0026	0.24817	0.2048:0.3516:0.4436:0.0	.	238	Q86VY9	T200A_HUMAN	T	238	.	ENSP00000296978:S238T	S	+	2	0	TMEM200A	130803973	0.950000	0.32346	0.858000	0.33744	0.217000	0.24651	1.534000	0.36051	0.800000	0.34041	0.655000	0.94253	AGT	-	TMEM200A	-	NULL		0.493	TMEM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM200A	HGNC	protein_coding	OTTHUMT00000042201.1	0	0	0	39	39	152	0.00	0.00	G	NM_052913		130762280	+1	5	15	16	81	tier1	no_errors	ENST00000296978	ensembl	human	known	74_37	missense	23.81	15.62	SNP	0.372	C	5	16
ASPDH	554235	genome.wustl.edu	37	19	51015485	51015485	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:51015485C>T	ENST00000389208.4	-	6	777	c.716G>A	c.(715-717)aGc>aAc	p.S239N	ASPDH_ENST00000376916.3_Missense_Mutation_p.S134N|JOSD2_ENST00000595669.1_5'Flank|JOSD2_ENST00000598418.1_5'Flank|JOSD2_ENST00000601423.1_5'Flank|ASPDH_ENST00000597030.1_5'UTR|JOSD2_ENST00000391815.3_5'Flank	NM_001114598.1	NP_001108070.1	A6ND91	ASPD_HUMAN	aspartate dehydrogenase domain containing	239					NAD biosynthetic process (GO:0009435)|NADP catabolic process (GO:0006742)		aspartate dehydrogenase activity (GO:0033735)|NADP binding (GO:0050661)			endometrium(1)|large_intestine(1)|lung(1)	3						CACAGCAAAGCTTCGGCCCGT	0.692													ENSG00000204653																																					0													23.0	29.0	27.0					19																	51015485		2201	4300	6501	SO:0001583	missense	0			-		CCDS33082.1, CCDS46153.1	19q13.33	2012-10-02			ENSG00000204653	ENSG00000204653			33856	protein-coding gene	gene with protein product							Standard	NM_001024656		Approved		uc010enz.3	A6ND91		ENST00000389208.4:c.716G>A	19.37:g.51015485C>T	ENSP00000373860:p.Ser239Asn		Q6NZ37	Missense_Mutation	SNP	pfam_Asp_DH,pfam_Asp/hSer_DH_D-bd	p.S239N	ENST00000389208.4	37	c.716	CCDS46153.1	19	.	.	.	.	.	.	.	.	.	.	C	11.06	1.528809	0.27387	.	.	ENSG00000204653	ENST00000376916;ENST00000389208	T;T	0.45668	0.89;0.89	3.47	1.04	0.20106	Aspartate dehydrogenase (1);	1.248550	0.06032	N	0.653346	T	0.30166	0.0756	L	0.36672	1.1	0.22620	N	0.998922	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.22208	-1.0223	10	0.25751	T	0.34	-5.5901	4.2875	0.10862	0.0:0.6233:0.238:0.1387	.	239;134	A6ND91;A6ND91-2	ASPD_HUMAN;.	N	134;239	ENSP00000366114:S134N;ENSP00000373860:S239N	ENSP00000366114:S134N	S	-	2	0	ASPDH	55707297	0.001000	0.12720	0.650000	0.29550	0.916000	0.54674	-0.180000	0.09754	0.591000	0.29711	0.462000	0.41574	AGC	-	ASPDH	-	pfam_Asp_DH		0.692	ASPDH-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPDH	HGNC	protein_coding	OTTHUMT00000464861.1	0	0	0	54	54	29	0.00	0.00	C	NM_001024656		51015485	-1	6	11	30	17	tier1	no_errors	ENST00000389208	ensembl	human	known	74_37	missense	16.67	39.29	SNP	0.613	T	6	30
KIAA1468	57614	genome.wustl.edu	37	18	59947038	59947038	+	Intron	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:59947038T>C	ENST00000398130.2	+	23	3199				KIAA1468_ENST00000256858.6_Missense_Mutation_p.V1034A	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468											autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				GAAACTCTGGTAGCTCAGAGG	0.498													ENSG00000134444																																					0																																										SO:0001627	intron_variant	0			-	BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.2968-555T>C	18.37:g.59947038T>C				Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.V1034A	ENST00000398130.2	37	c.3101	CCDS11979.2	18	.	.	.	.	.	.	.	.	.	.	T	14.53	2.563725	0.45694	.	.	ENSG00000134444	ENST00000256858	T	0.03951	3.75	5.72	5.72	0.89469	.	.	.	.	.	T	0.15089	0.0364	.	.	.	0.80722	D	1	D	0.63046	0.992	P	0.56434	0.798	T	0.00430	-1.1744	7	.	.	.	-15.6187	16.2988	0.82793	0.0:0.0:0.0:1.0	.	1034	Q9P260-2	.	A	1034	ENSP00000256858:V1034A	.	V	+	2	0	KIAA1468	58098018	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.965000	0.87945	2.311000	0.77944	0.533000	0.62120	GTA	-	KIAA1468	-	superfamily_ARM-type_fold		0.498	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1	0	0	0	70	70	207	0.00	0.00	T	NM_020854		59947038	+1	16	30	29	82	tier1	no_errors	ENST00000256858	ensembl	human	known	74_37	missense	35.56	26.55	SNP	1.000	C	16	29
TP53	7157	genome.wustl.edu	37	17	7577137	7577137	+	Silent	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577137C>T	ENST00000269305.4	-	8	990	c.801G>A	c.(799-801)cgG>cgA	p.R267R	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Silent_p.R267R|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Silent_p.R267R|TP53_ENST00000455263.2_Silent_p.R267R|TP53_ENST00000420246.2_Silent_p.R267R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	267	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation; dbSNP:rs55832599). {ECO:0000269|PubMed:16959974}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.R267R(4)|p.?(3)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.G262_S269delGNLLGRNS(2)|p.G266fs*4(1)|p.N268fs*77(1)|p.L265_K305del41(1)|p.E258fs*71(1)|p.N268fs*8(1)|p.L265_R267delLGR(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)|p.R267fs*78(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAAAGCTGTTCCGTCCCAGTA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	30	Deletion - In frame(9)|Whole gene deletion(8)|Deletion - Frameshift(5)|Substitution - coding silent(4)|Unknown(3)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|breast(3)|lung(3)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(2)|urinary_tract(2)|stomach(1)|eye(1)|ovary(1)|pancreas(1)											54.0	48.0	50.0					17																	7577137		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.801G>A	17.37:g.7577137C>T			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Silent	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R267	ENST00000269305.4	37	c.801	CCDS11118.1	17																																																																																			-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	27	27	190	0.00	0.00	C	NM_000546		7577137	-1	18	85	2	26	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	silent	90.00	76.58	SNP	0.001	T	18	2
MAPK6	5597	genome.wustl.edu	37	15	52338058	52338058	+	5'UTR	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:52338058G>C	ENST00000261845.5	+	0	208				MAPK6_ENST00000558841.1_3'UTR	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6						cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		CGGTAGCTTTGATTGTGATTG	0.418													ENSG00000069956																																					0																																										SO:0001623	5_prime_UTR_variant	0			-	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.-600G>C	15.37:g.52338058G>C			B2R945|B5BU65|Q68DH4|Q8IYN8	R	SNP	-	NULL	ENST00000261845.5	37	NULL	CCDS10147.1	15																																																																																			-	MAPK6	-	-		0.418	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK6	HGNC	protein_coding	OTTHUMT00000254841.2	0	0	0	80	80	84	0.00	0.00	G	NM_002748		52338058	+1	9	14	24	30	tier1	no_errors	ENST00000558063	ensembl	human	putative	74_37	rna	27.27	31.82	SNP	1.000	C	9	24
NBPF22P	285622	genome.wustl.edu	37	5	85578685	85578685	+	RNA	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr5:85578685G>C	ENST00000590707.1	+	0	408					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		GCAATCAGCAGTTCCGAGACC	0.478													ENSG00000205449																																					0																																												0			-	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85578685G>C				R	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			-	NBPF22P	-	-		0.478	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	0	0	0	156	156	79	0.00	0.00	G	XM_208333		85578685	+1	26	14	87	42	tier1	no_errors	ENST00000590707	ensembl	human	known	74_37	rna	23.01	25.00	SNP	0.004	C	26	87
GBP7	388646	genome.wustl.edu	37	1	89618012	89618012	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:89618012C>A	ENST00000294671.2	-	5	702	c.564G>T	c.(562-564)aaG>aaT	p.K188N		NM_207398.2	NP_997281.2	Q8N8V2	GBP7_HUMAN	guanylate binding protein 7	188	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Lung NSC(277;0.0908)		all cancers(265;0.00835)|Epithelial(280;0.0322)		GTCCATCTAACTTCAGCTCCA	0.473													ENSG00000213512																																					0													145.0	143.0	144.0					1																	89618012		2203	4300	6503	SO:0001583	missense	0			-	AK096141	CCDS720.1	1p22.2	2008-02-05			ENSG00000213512	ENSG00000213512			29606	protein-coding gene	gene with protein product		612468					Standard	NM_207398		Approved	FLJ38822, GBP4L	uc001dna.2	Q8N8V2	OTTHUMG00000010659	ENST00000294671.2:c.564G>T	1.37:g.89618012C>A	ENSP00000294671:p.Lys188Asn			Missense_Mutation	SNP	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.K188N	ENST00000294671.2	37	c.564	CCDS720.1	1	.	.	.	.	.	.	.	.	.	.	C	3.530	-0.096028	0.07010	.	.	ENSG00000213512	ENST00000294671	T	0.75704	-0.96	3.37	1.39	0.22231	Guanylate-binding protein, N-terminal (1);	0.619511	0.16790	N	0.199422	T	0.53610	0.1807	M	0.75150	2.29	0.26019	N	0.981892	B	0.15473	0.013	B	0.20577	0.03	T	0.54275	-0.8318	10	0.51188	T	0.08	.	7.2319	0.26046	0.1939:0.6183:0.1878:0.0	.	188	Q8N8V2	GBP7_HUMAN	N	188	ENSP00000294671:K188N	ENSP00000294671:K188N	K	-	3	2	GBP7	89390600	0.000000	0.05858	0.194000	0.23346	0.063000	0.16089	-0.189000	0.09629	0.145000	0.18977	-1.036000	0.02392	AAG	-	GBP7	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase		0.473	GBP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP7	HGNC	protein_coding	OTTHUMT00000029401.1	0	0	0	64	64	179	0.00	0.00	C	NM_207398		89618012	-1	11	30	33	95	tier1	no_errors	ENST00000294671	ensembl	human	known	74_37	missense	25.00	23.44	SNP	0.981	A	11	33
ARPP19	10776	genome.wustl.edu	37	15	52844135	52844135	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:52844135C>T	ENST00000566423.1	-	4	468	c.335G>A	c.(334-336)gGc>gAc	p.G112D	ARPP19_ENST00000563277.1_Missense_Mutation_p.G96D|ARPP19_ENST00000567669.1_Missense_Mutation_p.G112D|ARPP19_ENST00000563566.1_Missense_Mutation_p.G96D|ARPP19_ENST00000569723.1_Missense_Mutation_p.G71D|ARPP19_ENST00000249822.4_Missense_Mutation_p.G112D|ARPP19_ENST00000569281.2_Missense_Mutation_p.G112D|ARPP19_ENST00000561650.1_Missense_Mutation_p.G96D|ARPP19_ENST00000561971.1_Missense_Mutation_p.G131D|ARPP19_ENST00000564163.1_Missense_Mutation_p.G131D|ARPP19_ENST00000565288.1_5'UTR|ARPP19_ENST00000568196.1_Missense_Mutation_p.G96D			P56211	ARP19_HUMAN	cAMP-regulated phosphoprotein, 19kDa	112					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of glucose import (GO:0046326)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	phosphatase inhibitor activity (GO:0019212)|potassium channel regulator activity (GO:0015459)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						TCTTAATCAGCCAGCCAGCTT	0.443													ENSG00000128989																																					0													135.0	130.0	132.0					15																	52844135		2194	4293	6487	SO:0001583	missense	0			-	AF084555	CCDS32242.1	15q11.2	2009-04-20	2009-04-20		ENSG00000128989	ENSG00000128989			16967	protein-coding gene	gene with protein product	"""endosulfine alpha-like"""	605487				11279279, 8687439	Standard	NM_006628		Approved	ARPP-19, ARPP-16, ARPP16, ENSAL	uc002acd.1	P56211		ENST00000566423.1:c.335G>A	15.37:g.52844135C>T	ENSP00000455625:p.Gly112Asp		B2R497|Q6IAM2|Q86TA6|Q9UD70	Missense_Mutation	SNP	pfam_Endosulphine	p.G112D	ENST00000566423.1	37	c.335	CCDS32242.1	15	.	.	.	.	.	.	.	.	.	.	.	25.0	4.590995	0.86851	.	.	ENSG00000128989	ENST00000249822	.	.	.	5.88	5.88	0.94601	.	0.045192	0.85682	N	0.000000	T	0.74261	0.3693	L	0.57536	1.79	0.80722	D	1	D	0.71674	0.998	P	0.56823	0.807	T	0.75396	-0.3332	9	0.87932	D	0	.	20.3148	0.98648	0.0:1.0:0.0:0.0	.	112	P56211	ARP19_HUMAN	D	112	.	ENSP00000249822:G112D	G	-	2	0	ARPP19	50631427	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.951000	0.70273	2.818000	0.97014	0.644000	0.83932	GGC	-	ARPP19	-	NULL		0.443	ARPP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP19	HGNC	protein_coding	OTTHUMT00000419834.1	0	0	0	56	56	64	0.00	0.00	C	NM_006628		52844135	-1	8	17	18	16	tier1	no_errors	ENST00000249822	ensembl	human	known	74_37	missense	30.77	51.52	SNP	1.000	T	8	18
CRISP3	10321	genome.wustl.edu	37	6	49705150	49705150	+	5'Flank	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:49705150A>T	ENST00000393666.1	-	0	0				CRISP3_ENST00000263045.4_Intron|CRISP3_ENST00000423399.2_Intron|CRISP3_ENST00000371159.4_Missense_Mutation_p.F18Y|CRISP3_ENST00000433368.2_Intron			P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3						defense response (GO:0006952)|innate immune response (GO:0045087)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|specific granule (GO:0042581)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|skin(6)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			ATCTGCATTAAAATGATTGGT	0.433													ENSG00000096006																																					0													55.0	54.0	54.0					6																	49705150		2203	4300	6503	SO:0001631	upstream_gene_variant	0			-	X94323	CCDS4929.1, CCDS4929.2, CCDS55019.1	6p12.3	2008-02-05			ENSG00000096006	ENSG00000096006			16904	protein-coding gene	gene with protein product						8665901, 12223513	Standard	NM_006061		Approved	SGP28, CRISP-3, CRS3, dJ442L6.3, Aeg2	uc003ozs.3	P54108	OTTHUMG00000014823		6.37:g.49705150A>T	Exception_encountered		A8K9S1|B2R8I8|Q15512|Q3MJ82|Q53FA9|Q5JW83|Q9H108	Missense_Mutation	SNP	pfam_CAP_domain,pfam_Cysteine_rich_secretory,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.F18Y	ENST00000393666.1	37	c.53		6	.	.	.	.	.	.	.	.	.	.	A	8.048	0.765320	0.15914	.	.	ENSG00000096006	ENST00000371159	T	0.08193	3.12	4.35	-6.62	0.01813	.	.	.	.	.	T	0.01029	0.0034	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46596	-0.9180	5	.	.	.	.	1.4161	0.02302	0.1612:0.1999:0.3814:0.2574	.	.	.	.	Y	18	ENSP00000360201:F18Y	.	F	-	2	0	CRISP3	49813109	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.229000	0.09098	-1.277000	0.02411	-0.385000	0.06624	TTT	-	CRISP3	-	NULL		0.433	CRISP3-201	KNOWN	basic|appris_principal	protein_coding	CRISP3	HGNC	protein_coding		0	0	0	60	60	267	0.00	0.00	A	NM_006061		49705150	-1	10	42	30	90	tier1	no_errors	ENST00000371159	ensembl	human	novel	74_37	missense	25.00	31.82	SNP	0.000	T	10	30
CP	1356	genome.wustl.edu	37	3	148928119	148928119	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr3:148928119T>A	ENST00000264613.6	-	3	704	c.442A>T	c.(442-444)Aaa>Taa	p.K148*		NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	148	F5/8 type A 1.|Plastocyanin-like 1.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GGATATACTTTGTCATCTGCT	0.423													ENSG00000047457																																					0													161.0	149.0	153.0					3																	148928119		2203	4300	6503	SO:0001587	stop_gained	0			-	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.442A>T	3.37:g.148928119T>A	ENSP00000264613:p.Lys148*		Q14063|Q2PP18|Q9UKS4	Nonsense_Mutation	SNP	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.K148*	ENST00000264613.6	37	c.442	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019956	0.75275	.	.	ENSG00000047457	ENST00000264613	.	.	.	5.8	4.57	0.56435	.	0.336726	0.35378	N	0.003258	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-24.3738	5.1079	0.14794	0.0:0.148:0.1645:0.6876	.	.	.	.	X	148	.	ENSP00000264613:K148X	K	-	1	0	CP	150410809	1.000000	0.71417	0.987000	0.45799	0.053000	0.15095	0.828000	0.27435	2.207000	0.71202	0.455000	0.32223	AAA	-	CP	-	pfam_Cu-oxidase_3,superfamily_Cupredoxin		0.423	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	HGNC	protein_coding	OTTHUMT00000317498.1	0	0	0	87	87	264	0.00	0.00	T	NM_000096		148928119	-1	20	36	40	103	tier1	no_errors	ENST00000264613	ensembl	human	known	74_37	nonsense	33.33	25.90	SNP	1.000	A	20	40
SFMBT2	57713	genome.wustl.edu	37	10	7262457	7262457	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:7262457C>A	ENST00000361972.4	-	11	1336	c.1246G>T	c.(1246-1248)Gct>Tct	p.A416S	SFMBT2_ENST00000397167.1_Missense_Mutation_p.A416S	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	416					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						GGGTTCACAGCTTCAAGTTTC	0.532													ENSG00000198879																																					0													210.0	187.0	195.0					10																	7262457		2203	4300	6503	SO:0001583	missense	0			-	AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1246G>T	10.37:g.7262457C>A	ENSP00000355109:p.Ala416Ser		A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.A416S	ENST00000361972.4	37	c.1246	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	C	27.3	4.822159	0.90873	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.45276	0.9;0.9	5.4	5.4	0.78164	.	0.047328	0.85682	D	0.000000	T	0.63271	0.2497	M	0.88775	2.98	0.80722	D	1	P	0.45283	0.855	P	0.49502	0.613	T	0.71731	-0.4504	10	0.87932	D	0	.	18.7763	0.91912	0.0:1.0:0.0:0.0	.	416	Q5VUG0	SMBT2_HUMAN	S	416	ENSP00000355109:A416S;ENSP00000380353:A416S	ENSP00000355109:A416S	A	-	1	0	SFMBT2	7302463	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.037000	0.70956	2.530000	0.85305	0.563000	0.77884	GCT	-	SFMBT2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt		0.532	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	0	0	0	94	94	177	0.00	0.00	C	NM_001029880		7262457	-1	13	32	86	145	tier1	no_errors	ENST00000361972	ensembl	human	known	74_37	missense	13.13	18.08	SNP	1.000	A	13	86
FOXD3	27022	genome.wustl.edu	37	1	63789443	63789443	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:63789443G>C	ENST00000371116.2	+	1	714	c.714G>C	c.(712-714)aaG>aaC	p.K238N	RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	238					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						AACGCTTCAAGCGCCACCAGC	0.697													ENSG00000187140																									Pancreas(68;276 1750 11966 31252)												0													30.0	37.0	35.0					1																	63789443		2203	4298	6501	SO:0001583	missense	0			-	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.714G>C	1.37:g.63789443G>C	ENSP00000360157:p.Lys238Asn		Q9BYM2|Q9UDD1	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,prints_TF_fork_head,pfscan_TF_fork_head	p.K238N	ENST00000371116.2	37	c.714	CCDS624.1	1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545991	0.65198	.	.	ENSG00000187140	ENST00000371116	D	0.95656	-3.77	2.39	2.39	0.29439	.	0.065901	0.56097	U	0.000030	D	0.93789	0.8014	L	0.27053	0.805	0.58432	D	0.999992	D	0.71674	0.998	D	0.65684	0.937	D	0.94449	0.7665	10	0.87932	D	0	.	13.457	0.61204	0.0:0.0:1.0:0.0	.	238	Q9UJU5	FOXD3_HUMAN	N	238	ENSP00000360157:K238N	ENSP00000360157:K238N	K	+	3	2	FOXD3	63562031	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.310000	0.65780	1.641000	0.50575	0.460000	0.39030	AAG	-	FOXD3	-	NULL		0.697	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD3	HGNC	protein_coding	OTTHUMT00000025331.1	0	0	0	66	66	17	0.00	0.00	G			63789443	+1	23	2	29	15	tier1	no_errors	ENST00000371116	ensembl	human	known	74_37	missense	44.23	11.76	SNP	1.000	C	23	29
PPRC1	23082	genome.wustl.edu	37	10	103901296	103901296	+	Missense_Mutation	SNP	G	G	T	rs201069737		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr10:103901296G>T	ENST00000278070.2	+	5	3070	c.3031G>T	c.(3031-3033)Gtt>Ttt	p.V1011F	PPRC1_ENST00000370012.1_5'UTR|PPRC1_ENST00000413464.2_Missense_Mutation_p.V1011F	NM_015062.3	NP_055877.3	Q5VV67	PPRC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator-related 1	1011	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(10)|lung(19)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	56		Colorectal(252;0.122)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		TGGGAGAGCTGTTCCCCAACC	0.582													ENSG00000148840																																					0													48.0	50.0	49.0					10																	103901296		2203	4300	6503	SO:0001583	missense	0			-	AF325193	CCDS7529.1, CCDS73186.1	10q24.32	2013-02-12	2006-10-17		ENSG00000148840	ENSG00000148840		"""RNA binding motif (RRM) containing"""	30025	protein-coding gene	gene with protein product			"""peroxisome proliferative activated receptor, gamma, coactivator-related 1"""			9628581, 11340167	Standard	XM_005269656		Approved	PRC, KIAA0595, MGC74642	uc001kum.3	Q5VV67	OTTHUMG00000018948	ENST00000278070.2:c.3031G>T	10.37:g.103901296G>T	ENSP00000278070:p.Val1011Phe		Q5VV66|Q6P3U5|Q6P3W1|Q76N31|Q9BUJ3|Q9BZE5|Q9Y4E0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V1011F	ENST00000278070.2	37	c.3031	CCDS7529.1	10	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603924	0.28534	.	.	ENSG00000148840	ENST00000278070;ENST00000413464	T;T	0.26810	1.74;1.71	5.79	1.62	0.23740	.	0.839629	0.10485	N	0.669114	T	0.20455	0.0492	L	0.29908	0.895	0.09310	N	1	P;P;P	0.42409	0.779;0.773;0.664	B;B;B	0.43155	0.233;0.41;0.233	T	0.14200	-1.0481	10	0.62326	D	0.03	.	6.6553	0.22984	0.0693:0.2326:0.5787:0.1194	.	1011;891;1011	E7EVG6;Q5VV67-2;Q5VV67	.;.;PPRC1_HUMAN	F	1011	ENSP00000278070:V1011F;ENSP00000399743:V1011F	ENSP00000278070:V1011F	V	+	1	0	PPRC1	103891286	0.001000	0.12720	0.984000	0.44739	0.335000	0.28730	0.391000	0.20784	0.783000	0.33636	0.462000	0.41574	GTT	-	PPRC1	-	NULL		0.582	PPRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPRC1	HGNC	protein_coding	OTTHUMT00000050021.1	0	0	0	37	37	157	0.00	0.00	G	NM_015062		103901296	+1	15	34	16	58	tier1	no_errors	ENST00000278070	ensembl	human	known	74_37	missense	48.39	36.96	SNP	0.000	T	15	16
ZNF521	25925	genome.wustl.edu	37	18	22806657	22806657	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr18:22806657A>T	ENST00000361524.3	-	4	1373	c.1225T>A	c.(1225-1227)Tac>Aac	p.Y409N	ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Missense_Mutation_p.Y189N|ZNF521_ENST00000538137.2_Missense_Mutation_p.Y409N	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	409					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TTGTTGCAGTAAATACAGCTG	0.443			T	PAX5	ALL								ENSG00000198795																												Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													95.0	92.0	93.0					18																	22806657		2203	4300	6503	SO:0001583	missense	0			-	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1225T>A	18.37:g.22806657A>T	ENSP00000354794:p.Tyr409Asn		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y409N	ENST00000361524.3	37	c.1225	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	A	10.97	1.501063	0.26861	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.10382	2.88;2.92	6.16	6.16	0.99307	Zinc finger, C2H2-like (1);	0.059313	0.64402	D	0.000001	T	0.22666	0.0547	L	0.29908	0.895	0.47276	D	0.999378	D	0.76494	0.999	D	0.68943	0.961	T	0.00712	-1.1598	10	0.49607	T	0.09	-43.2009	16.8061	0.85666	1.0:0.0:0.0:0.0	.	409	Q96K83	ZN521_HUMAN	N	409;443;409	ENSP00000354794:Y409N;ENSP00000382352:Y409N	ENSP00000354794:Y409N	Y	-	1	0	ZNF521	21060655	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.367000	0.80283	0.528000	0.53228	TAC	-	ZNF521	-	smart_Znf_C2H2-like		0.443	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	0	0	0	60	60	188	0.00	0.00	A	NM_015461		22806657	-1	14	33	27	94	tier1	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	34.15	25.98	SNP	1.000	T	14	27
MGA	23269	genome.wustl.edu	37	15	41989072	41989072	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr15:41989072C>G	ENST00000570161.1	+	2	1864	c.1864C>G	c.(1864-1866)Ctc>Gtc	p.L622V	MGA_ENST00000389936.4_Missense_Mutation_p.L622V|MGA_ENST00000566586.1_Missense_Mutation_p.L622V|MGA_ENST00000545763.1_Missense_Mutation_p.L622V|MGA_ENST00000219905.7_Missense_Mutation_p.L622V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AAAATTGAAACTCTGTAAGGC	0.438													ENSG00000174197																																					0													24.0	22.0	23.0					15																	41989072		1866	4100	5966	SO:0001583	missense	0			-	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1864C>G	15.37:g.41989072C>G	ENSP00000457035:p.Leu622Val		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_D-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.L622V	ENST00000570161.1	37	c.1864	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630510	0.28978	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.43294	0.95;0.95;0.95	5.21	2.25	0.28309	.	5.602340	0.00166	N	0.000002	T	0.35219	0.0924	N	0.24115	0.695	0.23238	N	0.998063	P;B	0.44090	0.826;0.062	B;B	0.42522	0.39;0.014	T	0.25572	-1.0128	10	0.66056	D	0.02	.	6.4956	0.22140	0.1343:0.6494:0.0:0.2162	.	622;622	F5H7K2;E7ENI0	.;.	V	622	ENSP00000219905:L622V;ENSP00000374586:L622V;ENSP00000442467:L622V	ENSP00000219905:L622V	L	+	1	0	MGA	39776364	0.893000	0.30496	0.997000	0.53966	0.814000	0.46013	0.199000	0.17237	0.197000	0.20387	0.462000	0.41574	CTC	-	MGA	-	NULL		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	0	0	0	71	71	300	0.00	0.00	C	NM_001164273.1		41989072	+1	13	36	26	91	tier1	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	33.33	28.35	SNP	0.983	G	13	26
NOTCH3	4854	genome.wustl.edu	37	19	15271540	15271540	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:15271540A>T	ENST00000263388.2	-	33	6974	c.6899T>A	c.(6898-6900)cTt>cAt	p.L2300H		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	2300					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GGCCTGAGCAAGGGAGCTGGG	0.642													ENSG00000074181																																					0													53.0	62.0	59.0					19																	15271540		2203	4300	6503	SO:0001583	missense	0			-	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.6899T>A	19.37:g.15271540A>T	ENSP00000263388:p.Leu2300His		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.L2300H	ENST00000263388.2	37	c.6899	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	A	13.31	2.197781	0.38806	.	.	ENSG00000074181	ENST00000263388	D	0.82526	-1.62	3.77	2.65	0.31530	.	.	.	.	.	T	0.71298	0.3323	N	0.08118	0	0.09310	N	1	D	0.56746	0.977	P	0.49708	0.62	T	0.61019	-0.7147	9	0.42905	T	0.14	.	7.5307	0.27681	0.8084:0.0:0.0:0.1916	.	2300	Q9UM47	NOTC3_HUMAN	H	2300	ENSP00000263388:L2300H	ENSP00000263388:L2300H	L	-	2	0	NOTCH3	15132540	0.066000	0.20996	0.012000	0.15200	0.935000	0.57460	0.031000	0.13710	1.720000	0.51447	0.482000	0.46254	CTT	-	NOTCH3	-	pirsf_Notch		0.642	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	0	0	0	76	76	56	0.00	0.00	A	NM_000435		15271540	-1	12	7	40	24	tier1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	23.08	22.58	SNP	0.024	T	12	40
KCNA6	3742	genome.wustl.edu	37	12	4919850	4919850	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:4919850T>A	ENST00000280684.3	+	1	1509	c.643T>A	c.(643-645)Tcc>Acc	p.S215T	RP11-234B24.4_ENST00000542988.1_lincRNA|KCNA6_ENST00000433855.1_Missense_Mutation_p.S215T			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	215					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	GAGTCGAGTCTCCCCAGTTTC	0.537										HNSCC(72;0.22)			ENSG00000151079																																					0													75.0	71.0	72.0					12																	4919850		2203	4300	6503	SO:0001583	missense	0			-	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.643T>A	12.37:g.4919850T>A	ENSP00000280684:p.Ser215Thr			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.6,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S215T	ENST00000280684.3	37	c.643	CCDS8534.1	12	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.840936	0.00573	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.97161	-4.27;-4.27	5.43	3.09	0.35607	.	.	.	.	.	D	0.92463	0.7607	L	0.38175	1.15	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.81300	-0.0995	9	0.10377	T	0.69	.	7.0734	0.25191	0.0:0.0861:0.3444:0.5695	.	215	P17658	KCNA6_HUMAN	T	215	ENSP00000408321:S215T;ENSP00000280684:S215T	ENSP00000280684:S215T	S	+	1	0	KCNA6	4790111	0.067000	0.21026	0.022000	0.16811	0.051000	0.14879	1.567000	0.36407	0.869000	0.35703	0.533000	0.62120	TCC	-	KC6	-	NULL		0.537	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KC6	HGNC	protein_coding	OTTHUMT00000398909.1	0	0	0	39	39	170	0.00	0.00	T	NM_002235		4919850	+1	7	26	33	105	tier1	no_errors	ENST00000280684	ensembl	human	known	74_37	missense	17.50	19.85	SNP	0.000	A	7	33
PCSK5	5125	genome.wustl.edu	37	9	78710840	78710840	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr9:78710840C>T	ENST00000545128.1	+	8	1467	c.929C>T	c.(928-930)gCa>gTa	p.A310V	PCSK5_ENST00000376752.4_Missense_Mutation_p.A310V|PCSK5_ENST00000376767.3_Missense_Mutation_p.A310V	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	310	Peptidase S8.				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						TTTGTTTGGGCATCTGGAAAT	0.493													ENSG00000099139																																					0													166.0	148.0	154.0					9																	78710840		2203	4300	6503	SO:0001583	missense	0			-		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.929C>T	9.37:g.78710840C>T	ENSP00000446280:p.Ala310Val		F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt_N_dom,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EG-like_dom,prints_Peptidase_S8_subtilisin-rel	p.A310V	ENST00000545128.1	37	c.929	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.360161	0.95877	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000376767;ENST00000396108;ENST00000376752	D;D;D	0.90620	-2.7;-2.7;-2.7	5.69	5.69	0.88448	.	0.050288	0.85682	D	0.000000	D	0.97854	0.9295	H	0.99415	4.555	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.926	D	0.98953	1.0795	10	0.66056	D	0.02	-17.6705	19.8169	0.96573	0.0:1.0:0.0:0.0	.	310;310	Q92824-2;B1AMG5	.;.	V	310;13;310;310;310	ENSP00000446280:A310V;ENSP00000365958:A310V;ENSP00000365943:A310V	ENSP00000365943:A310V	A	+	2	0	PCSK5	77900660	1.000000	0.71417	0.968000	0.41197	0.990000	0.78478	7.487000	0.81328	2.689000	0.91719	0.460000	0.39030	GCA	-	PCSK5	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom		0.493	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		0	0	0	48	48	222	0.00	0.00	C			78710840	+1	9	31	35	119	tier1	no_errors	ENST00000545128	ensembl	human	known	74_37	missense	20.00	20.67	SNP	1.000	T	9	35
NUF2	83540	genome.wustl.edu	37	1	163313586	163313586	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:163313586G>A	ENST00000271452.3	+	10	1012	c.733G>A	c.(733-735)Gtg>Atg	p.V245M	NUF2_ENST00000367900.3_Missense_Mutation_p.V245M|NUF2_ENST00000524800.1_Missense_Mutation_p.V245M	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	245	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					AACAAAAATTGTGGATTCTCC	0.269													ENSG00000143228																																					0													24.0	28.0	27.0					1																	163313586		2147	4252	6399	SO:0001583	missense	0			-	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.733G>A	1.37:g.163313586G>A	ENSP00000271452:p.Val245Met		Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	pfam_Kinetochore_Nuf2	p.V245M	ENST00000271452.3	37	c.733	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.076618	0.76415	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.60171	0.7;0.21;0.21	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.66607	0.2806	M	0.61703	1.905	0.43430	D	0.995591	D;D	0.89917	1.0;1.0	D;D	0.73380	0.972;0.98	T	0.67397	-0.5681	9	0.49607	T	0.09	-19.7177	15.3094	0.74019	0.0:0.0:1.0:0.0	.	245;245	E9PQC4;Q9BZD4	.;NUF2_HUMAN	M	245	ENSP00000436888:V245M;ENSP00000356875:V245M;ENSP00000271452:V245M	ENSP00000271452:V245M	V	+	1	0	NUF2	161580210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.171000	0.64996	2.680000	0.91292	0.585000	0.79938	GTG	-	NUF2	-	NULL		0.269	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	0	0	0	279	279	207	0.00	0.00	G	NM_145697		163313586	+1	16	8	125	72	tier1	no_errors	ENST00000271452	ensembl	human	known	74_37	missense	11.35	10.00	SNP	1.000	A	16	125
SCML2	10389	genome.wustl.edu	37	X	18259309	18259309	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chrX:18259309T>C	ENST00000251900.4	-	0	2324				SCML2_ENST00000491988.1_5'UTR|SCML2_ENST00000398048.3_3'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					GAGAAATACTTTTAAATTAAA	0.269													ENSG00000102098																									Esophageal Squamous(100;1252 1965 19021 35517)												0																																										SO:0001624	3_prime_UTR_variant	0			-	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*62A>G	X.37:g.18259309T>C			Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	R	SNP	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	SCML2	-	-		0.269	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1	0	0	0	49	49	161	0.00	0.00	T	NM_006089		18259309	-1	17	47	28	119	tier1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	37.78	28.14	SNP	0.043	C	17	28
CDCA2	157313	genome.wustl.edu	37	8	25337454	25337454	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:25337454G>A	ENST00000330560.3	+	8	1323	c.846G>A	c.(844-846)gtG>gtA	p.V282V	CDCA2_ENST00000521098.2_3'UTR|CDCA2_ENST00000380665.3_Silent_p.V267V	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	282					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ACTGTGTAGTGGGCAAAGGAT	0.453													ENSG00000184661																																					0													127.0	106.0	113.0					8																	25337454		2203	4300	6503	SO:0001819	synonymous_variant	0			-	BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.846G>A	8.37:g.25337454G>A			Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Silent	SNP	NULL	p.V282	ENST00000330560.3	37	c.846	CCDS6049.1	8																																																																																			-	CDCA2	-	NULL		0.453	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	0	0	0	57	57	148	0.00	0.00	G	NM_152562		25337454	+1	11	29	13	28	tier1	no_errors	ENST00000330560	ensembl	human	known	74_37	silent	45.83	50.88	SNP	0.002	A	11	13
UNKL	64718	genome.wustl.edu	37	16	1464016	1464016	+	Missense_Mutation	SNP	A	A	G	rs202202852		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:1464016A>G	ENST00000389221.4	-	2	117	c.118T>C	c.(118-120)Tca>Cca	p.S40P	UNKL_ENST00000503648.1_5'UTR|UNKL_ENST00000301712.5_Missense_Mutation_p.S40P|UNKL_ENST00000397462.1_Missense_Mutation_p.S40P|UNKL_ENST00000508903.2_Missense_Mutation_p.S40P|LA16c-312E8.2_ENST00000568554.1_RNA	NM_001193388.1	NP_001180317	Q9H9P5	UNKL_HUMAN	unkempt family zinc finger-like	40					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Hepatocellular(780;0.0893)				TTGTGCTGTGAAAACAGGGGG	0.662											OREG0023546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000059145	A|||	1	0.000199681	0.0	0.0014	5008	,	,		13997	0.0		0.0	False		,,,				2504	0.0																0													23.0	20.0	21.0					16																	1464016		2072	4062	6134	SO:0001583	missense	0			GMAF=0.0005	BC011924	CCDS32359.1, CCDS53980.1, CCDS61787.1	16p13.3	2014-03-10	2013-10-17		ENSG00000059145	ENSG00000059145		"""Zinc fingers, CCCH-type domain containing"""	14184	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 28"", ""unkempt homolog (Drosophila)-like"""	C16orf28		20148946	Standard	NM_001193389		Approved	ZC3HDC5L, ZC3H5L, FLJ23360	uc031qup.1	Q9H9P5	OTTHUMG00000128553	ENST00000389221.4:c.118T>C	16.37:g.1464016A>G	ENSP00000373873:p.Ser40Pro	596	B0QYN6|B1GXI8|Q96EV1|Q96RZ1|Q9BWL5|Q9H5K0|Q9UJJ8	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.S40P	ENST00000389221.4	37	c.118	CCDS53981.1	16	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	A	14.71	2.616339	0.46736	.	.	ENSG00000059145	ENST00000389221;ENST00000508903;ENST00000397462;ENST00000301712	T	0.64438	-0.1	3.98	-6.64	0.01801	.	0.449133	0.19472	N	0.113432	T	0.24736	0.0600	N	0.02011	-0.69	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.01961	-1.1239	10	0.30078	T	0.28	.	7.3858	0.26882	0.502:0.2035:0.2945:0.0	.	40	Q9H9P5-5	.	P	40	ENSP00000373873:S40P	ENSP00000301712:S40P	S	-	1	0	UNKL	1404017	0.019000	0.18553	0.817000	0.32601	0.969000	0.65631	-0.721000	0.04963	-0.901000	0.03891	0.460000	0.39030	TCA	rs202202852	UNKL	-	NULL		0.662	UNKL-201	KNOWN	basic|CCDS	protein_coding	UNKL	HGNC	protein_coding		0	0	0	61	61	66	0.00	0.00	A	NM_001037125		1464016	-1	14	16	14	23	tier1	no_errors	ENST00000397462	ensembl	human	known	74_37	missense	50.00	41.03	SNP	0.942	G	14	14
SLURP1	57152	genome.wustl.edu	37	8	143823300	143823300	+	Silent	SNP	G	G	T	rs187775640		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr8:143823300G>T	ENST00000246515.1	-	2	124	c.99C>A	c.(97-99)acC>acA	p.T33T		NM_020427.2	NP_065160.1	P55000	SLUR1_HUMAN	secreted LY6/PLAUR domain containing 1	33	UPAR/Ly6.				cell activation (GO:0001775)|cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			breast(1)|lung(7)|ovary(1)	9	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					AGGAAGCACTGGTCATGGGCT	0.637													ENSG00000126233																																					0													102.0	95.0	97.0					8																	143823300		2202	4299	6501	SO:0001819	synonymous_variant	0			-	AY579080	CCDS6387.1	8q24.3	2004-11-16			ENSG00000126233	ENSG00000126233			18746	protein-coding gene	gene with protein product	"""lymphocyte antigen 6-like secreted"", ""ARS component B"""	606119				11285253, 10211827	Standard	NM_020427		Approved	ARS, ANUP, MDM, ArsB, LY6LS	uc003ywy.3	P55000	OTTHUMG00000164685	ENST00000246515.1:c.99C>A	8.37:g.143823300G>T			Q53YJ6|Q6PUA6|Q92483	Silent	SNP	pfam_LY6_UPAR	p.T33	ENST00000246515.1	37	c.99	CCDS6387.1	8																																																																																			-	SLURP1	-	pfam_LY6_UPAR		0.637	SLURP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLURP1	HGNC	protein_coding	OTTHUMT00000379741.1	0	0	0	62	62	78	0.00	0.00	G	NM_020427		143823300	-1	5	4	42	36	tier1	no_errors	ENST00000246515	ensembl	human	known	74_37	silent	10.64	10.00	SNP	0.000	T	5	42
CFAP54	144535	genome.wustl.edu	37	12	96883406	96883406	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr12:96883406C>A	ENST00000524981.4	+	1	42	c.19C>A	c.(19-21)Ccc>Acc	p.P7T	C12orf55_ENST00000298953.3_Missense_Mutation_p.P7T			Q96N23	CL055_HUMAN		7																	GCAGGGCTCCCCCTCGAGCTC	0.697											OREG0022044	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000188596																																					0																																										SO:0001583	missense	0			-																												ENST00000524981.4:c.19C>A	12.37:g.96883406C>A	ENSP00000431759:p.Pro7Thr	1324		Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.P7T	ENST00000524981.4	37	c.19		12	.	.	.	.	.	.	.	.	.	.	C	9.159	1.018240	0.19355	.	.	ENSG00000188596	ENST00000553778;ENST00000524981;ENST00000298953	T;T	0.20332	2.09;2.08	4.03	-8.07	0.01098	.	3.477460	0.00832	N	0.001661	T	0.08133	0.0203	N	0.08118	0	0.09310	N	0.999992	B	0.02656	0.0	B	0.04013	0.001	T	0.20405	-1.0276	10	0.25751	T	0.34	16.2101	1.8571	0.03181	0.4388:0.2956:0.1038:0.1619	.	7	G3V4Y4	.	T	7	ENSP00000452066:P7T;ENSP00000298953:P7T	ENSP00000298953:P7T	P	+	1	0	C12orf63	95407537	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-2.247000	0.01190	-2.807000	0.00349	-0.397000	0.06425	CCC	-	C12orf55	-	NULL		0.697	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	0	0	0	82	82	39	0.00	0.00	C			96883406	+1	10	7	31	30	tier1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	23.81	18.92	SNP	0.000	A	10	31
MYBPC2	4606	genome.wustl.edu	37	19	50949209	50949209	+	Silent	SNP	G	G	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr19:50949209G>A	ENST00000357701.5	+	12	1257	c.1206G>A	c.(1204-1206)aaG>aaA	p.K402K		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	402	Ig-like C2-type 3.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		AGGACGGGAAGCGCCACATCC	0.567													ENSG00000086967																																					0													67.0	71.0	70.0					19																	50949209		2066	4200	6266	SO:0001819	synonymous_variant	0			-		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1206G>A	19.37:g.50949209G>A			A1L4G9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K402	ENST00000357701.5	37	c.1206	CCDS46152.1	19																																																																																			-	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.567	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	0	0	1	63	63	190	0.00	0.52	G	NM_004533		50949209	+1	14	30	16	38	tier1	no_errors	ENST00000357701	ensembl	human	known	74_37	silent	46.67	44.12	SNP	1.000	A	14	16
BFAR	51283	genome.wustl.edu	37	16	14761590	14761590	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr16:14761590A>G	ENST00000261658.2	+	8	1536	c.1259A>G	c.(1258-1260)aAc>aGc	p.N420S	BFAR_ENST00000563082.1_3'UTR|BFAR_ENST00000563971.1_Missense_Mutation_p.N295S|BFAR_ENST00000426842.2_Missense_Mutation_p.N292S	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	420					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						TTTGTTTGCAACTGTTTGTTT	0.498													ENSG00000103429																																					0													145.0	139.0	141.0					16																	14761590		2197	4300	6497	SO:0001583	missense	0			-	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.1259A>G	16.37:g.14761590A>G	ENSP00000261658:p.Asn420Ser		A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.N420S	ENST00000261658.2	37	c.1259	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615018	0.87359	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.52295	3.02;0.67	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.52008	0.1708	L	0.27053	0.805	0.58432	D	0.999998	P;D;D	0.67145	0.941;0.996;0.996	P;P;P	0.58266	0.504;0.836;0.76	T	0.57015	-0.7883	10	0.87932	D	0	.	14.938	0.70973	1.0:0.0:0.0:0.0	.	292;420;420	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	S	420;292	ENSP00000261658:N420S;ENSP00000400634:N292S	ENSP00000261658:N420S	N	+	2	0	BFAR	14669091	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.280000	0.78610	2.121000	0.65114	0.460000	0.39030	AAC	-	BFAR	-	NULL		0.498	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	0	0	1	76	76	233	0.00	0.43	A	NM_016561		14761590	+1	17	42	29	119	tier1	no_errors	ENST00000261658	ensembl	human	known	74_37	missense	36.96	26.09	SNP	1.000	G	17	29
STX7	8417	genome.wustl.edu	37	6	132781974	132781974	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr6:132781974delT	ENST00000367941.2	-	10	822	c.709delA	c.(709-711)accfs	p.T237fs		NM_003569.2	NP_003560.2	O15400	STX7_HUMAN	syntaxin 7	237					intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)|synaptic vesicle exocytosis (GO:0016079)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(1)|lung(5)	19	Breast(56;0.0615)			OV - Ovarian serous cystadenocarcinoma(155;0.00532)|GBM - Glioblastoma multiforme(226;0.0114)		ATGCACAGGGTTTTTCTGGAT	0.378													ENSG00000079950																																					0													128.0	116.0	120.0					6																	132781974		2203	4300	6503	SO:0001589	frameshift_variant	0				U77942	CCDS5153.1	6q23.1	2008-02-05			ENSG00000079950	ENSG00000079950			11442	protein-coding gene	gene with protein product		603217				9358037	Standard	NM_003569		Approved		uc003qdg.2	O15400	OTTHUMG00000015577	ENST00000367941.2:c.709delA	6.37:g.132781974delT	ENSP00000356918:p.Thr237fs		E1P579|Q5SZW2|Q96ES9	Frame_Shift_Del	DEL	pfam_T_SRE_dom,pfam_Syntaxin_N,superfamily_t-SRE,smart_Syntaxin_N,smart_T_SRE_dom,pfscan_T_SRE_dom	p.T237fs	ENST00000367941.2	37	c.709	CCDS5153.1	6																																																																																				STX7	-	NULL		0.378	STX7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	STX7	HGNC	protein_coding	OTTHUMT00000042252.2	0	0	0	43	43	131	0.00	0.00	T			132781974	-1	6	12	21	54	tier1	no_errors	ENST00000367941	ensembl	human	known	74_37	frame_shift_del	22.22	18.18	DEL	1.000	-	6	21
TP53	7157	genome.wustl.edu	37	17	7577134	7577134	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:7577134delG	ENST00000269305.4	-	8	993	c.804delC	c.(802-804)aacfs	p.N268fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.N268fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.N268fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.N268fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.N268fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	268	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		N -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|N -> H (in sporadic cancers; somatic mutation).|N -> I (in sporadic cancers; somatic mutation).|N -> K (in a sporadic cancer; somatic mutation).|N -> S (in sporadic cancers; somatic mutation).|N -> Y (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.G262_F270delGNLLGRNSF(2)|p.G266_E271delGRNSFE(2)|p.N268N(2)|p.?(2)|p.G262_S269delGNLLGRNS(2)|p.L265_K305del41(1)|p.E258fs*71(1)|p.G266_N268delGRN(1)|p.G262fs*2(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTCAAAGCTGTTCCGTCCCA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	22	Deletion - In frame(8)|Whole gene deletion(8)|Unknown(2)|Substitution - coding silent(2)|Deletion - Frameshift(2)	lung(4)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|stomach(1)|urinary_tract(1)|oesophagus(1)|breast(1)|eye(1)|ovary(1)											56.0	50.0	52.0					17																	7577134		2203	4300	6503	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.804delC	17.37:g.7577134delG	ENSP00000269305:p.Asn268fs		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.N268fs	ENST00000269305.4	37	c.804	CCDS11118.1	17																																																																																				TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	28	28	189	0.00	0.00	G	NM_000546		7577134	-1	16	83	3	28	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	84.21	74.77	DEL	0.425	-	16	3
ZEB2	9839	genome.wustl.edu	37	2	145157714	145157715	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	TT	TT	TT	-	TT	TT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:145157714_145157715delTT	ENST00000558170.2	-	8	2223_2224	c.1039_1040delAA	c.(1039-1041)aatfs	p.N347fs	ZEB2_ENST00000539609.3_Frame_Shift_Del_p.N323fs|ZEB2_ENST00000409487.3_Frame_Shift_Del_p.N347fs|ZEB2_ENST00000303660.4_Frame_Shift_Del_p.N347fs	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	347					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CGTCTTGATATTGTTTCTCATT	0.396													ENSG00000169554																									Melanoma(33;1235 1264 5755 16332)												0																																										SO:0001589	frameshift_variant	0				AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.1039_1040delAA	2.37:g.145157714_145157715delTT	ENSP00000454157:p.Asn347fs		A0JP09|B7Z2P2|F5H814|Q9UED1	Frame_Shift_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.N347fs	ENST00000558170.2	37	c.1040_1039	CCDS2186.1	2																																																																																				ZEB2	-	NULL		0.396	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2	HGNC	protein_coding	OTTHUMT00000254778.5	0	0	0	104	104	232	0.00	0.00	TT	NM_014795		145157715	-1	13	36	51	139	tier1	no_errors	ENST00000303660	ensembl	human	known	74_37	frame_shift_del	20.31	20.57	DEL	1.000:1.000	-	13	51
SLC8A3	6547	genome.wustl.edu	37	14	70634157	70634157	+	Frame_Shift_Del	DEL	G	G	-	rs144107599		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr14:70634157delG	ENST00000381269.2	-	2	1736	c.983delC	c.(982-984)ccafs	p.P328fs	SLC8A3_ENST00000534137.1_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000357887.3_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000356921.2_Frame_Shift_Del_p.P328fs|SLC8A3_ENST00000528359.1_Frame_Shift_Del_p.P328fs	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	328					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GTCCTTCTCTGGGTGTTTTTG	0.507													ENSG00000100678																																					0													93.0	97.0	96.0					14																	70634157		2203	4300	6503	SO:0001589	frameshift_variant	0				AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.983delC	14.37:g.70634157delG	ENSP00000370669:p.Pro328fs		Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Frame_Shift_Del	DEL	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.P328fs	ENST00000381269.2	37	c.983	CCDS35498.1	14																																																																																				SLC8A3	-	tigrfam_Na_Ca_Ex		0.507	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC8A3	HGNC	protein_coding	OTTHUMT00000390736.1	0	0	0	52	52	214	0.00	0.00	G			70634157	-1	7	36	20	46	tier1	no_errors	ENST00000381269	ensembl	human	known	74_37	frame_shift_del	25.93	43.90	DEL	1.000	-	7	20
AKAP11	11215	genome.wustl.edu	37	13	42875991	42875991	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	-	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr13:42875991delA	ENST00000025301.2	+	8	3284	c.3109delA	c.(3109-3111)aagfs	p.K1037fs		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1037					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		ATCTGACTTGAAGGAATCTGC	0.423													ENSG00000023516																																					0													106.0	102.0	103.0					13																	42875991		2203	4300	6503	SO:0001589	frameshift_variant	0				AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3109delA	13.37:g.42875991delA	ENSP00000025301:p.Lys1037fs		O75124|Q9NUK7	Frame_Shift_Del	DEL	NULL	p.K1037fs	ENST00000025301.2	37	c.3109	CCDS9383.1	13																																																																																				AKAP11	-	NULL		0.423	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	HGNC	protein_coding	OTTHUMT00000044700.2	0	0	0	75	75	229	0.00	0.00	A	NM_016248		42875991	+1	14	39	55	147	tier1	no_errors	ENST00000025301	ensembl	human	known	74_37	frame_shift_del	20.29	20.97	DEL	0.393	-	14	55
SLC12A9	56996	genome.wustl.edu	37	7	100459181	100459192	+	In_Frame_Del	DEL	TCAGCCAGGCCT	TCAGCCAGGCCT	-	rs548604660	byFrequency	TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	TCAGCCAGGCCT	TCAGCCAGGCCT	TCAGCCAGGCCT	-	TCAGCCAGGCCT	TCAGCCAGGCCT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr7:100459181_100459192delTCAGCCAGGCCT	ENST00000354161.3	+	11	1636_1647	c.1511_1522delTCAGCCAGGCCT	c.(1510-1524)gtcagccaggccttg>gtg	p.SQAL505del	SLC12A9_ENST00000415287.1_In_Frame_Del_p.SQAL416del|SLC12A9_ENST00000540482.1_In_Frame_Del_p.SQAL505del|SLC12A9_ENST00000275729.3_In_Frame_Del_p.SQAL416del|SLC12A9_ENST00000428758.1_In_Frame_Del_p.SQAL505del	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	505					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					TGGGGCTATGTCAGCCAGGCCTTGCTTTTCCA	0.642													ENSG00000146828																																					0																																										SO:0001651	inframe_deletion	0				AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.1511_1522delTCAGCCAGGCCT	7.37:g.100459181_100459192delTCAGCCAGGCCT	ENSP00000275730:p.Ser505_Leu508del		B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	In_Frame_Del	DEL	pfam_AA-permease/SLC12A_dom	p.SQAL505in_frame_del	ENST00000354161.3	37	c.1511_1522	CCDS5707.1	7																																																																																				SLC12A9	-	pfam_AA-permease/SLC12A_dom		0.642	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A9	HGNC	protein_coding	OTTHUMT00000342837.1	0	0	0	30	30	30	0.00	0.00	TCAGCCAGGCCT	NM_020246		100459192	+1	5	5	12	12	tier1	no_errors	ENST00000354161	ensembl	human	known	74_37	in_frame_del	29.41	29.41	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.992:0.999	-	5	12
TSHZ2	128553	genome.wustl.edu	37	20	51872532	51872539	+	Frame_Shift_Del	DEL	GTCCAACT	GTCCAACT	-	rs377415955		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	GTCCAACT	GTCCAACT	GTCCAACT	-	GTCCAACT	GTCCAACT	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr20:51872532_51872539delGTCCAACT	ENST00000371497.5	+	2	3422_3429	c.2535_2542delGTCCAACT	c.(2533-2544)cagtccaactggfs	p.SNW846fs	TSHZ2_ENST00000603338.2_Frame_Shift_Del_p.SNW843fs|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Frame_Shift_Del_p.SNW843fs	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	846					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAGGCCGGCAGTCCAACTGGAATCCTCA	0.524													ENSG00000182463																																					0																																										SO:0001589	frameshift_variant	0				AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2535_2542delGTCCAACT	20.37:g.51872532_51872539delGTCCAACT	ENSP00000360552:p.Ser846fs		B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Frame_Shift_Del	DEL	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.S846fs	ENST00000371497.5	37	c.2535_2542	CCDS33490.1	20																																																																																				TSHZ2	-	superfamily_Homeodomain-like,smart_Homeobox_dom		0.524	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	0	0	0	197	197	197	0.00	0.00	GTCCAACT	NM_173485		51872539	+1	14	14	114	114	tier1	no_errors	ENST00000371497	ensembl	human	known	74_37	frame_shift_del	10.94	10.94	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-	14	114
SLC2A7	155184	genome.wustl.edu	37	1	9070297	9070297	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	-	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:9070297delG	ENST00000400906.1	-	9	1020	c.1021delC	c.(1021-1023)cttfs	p.L341fs		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	341					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CGCTCCACAAGGACAGCCTGG	0.672													ENSG00000197241																																					0													11.0	10.0	10.0					1																	9070297		2028	3970	5998	SO:0001589	frameshift_variant	0				AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.1021delC	1.37:g.9070297delG	ENSP00000383698:p.Leu341fs		A2A333	Frame_Shift_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.V342fs	ENST00000400906.1	37	c.1021	CCDS98.2	1																																																																																				SLC2A7	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.672	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	HGNC	protein_coding	OTTHUMT00000127768.3	0	0	0	76	76	31	0.00	0.00	G	NM_207420		9070297	-1	21	4	82	36	tier1	no_errors	ENST00000400906	ensembl	human	known	74_37	frame_shift_del	20.39	10.00	DEL	0.000	-	21	82
ARHGEF4	50649	genome.wustl.edu	37	2	131803760	131803760	+	Nonstop_Mutation	SNP	T	T	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:131803760T>C	ENST00000326016.5	+	14	2590	c.2071T>C	c.(2071-2073)Tga>Cga	p.*691R	ARHGEF4_ENST00000525839.1_3'UTR|ARHGEF4_ENST00000409303.1_Nonstop_Mutation_p.*631R|ARHGEF4_ENST00000355771.3_Nonstop_Mutation_p.*620R|ARHGEF4_ENST00000428230.2_Nonstop_Mutation_p.*193R|ARHGEF4_ENST00000392953.3_3'UTR	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4	0					apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		CTTCCGCAAGTGAACTGGTCC	0.667													ENSG00000136002																																					0													26.0	29.0	28.0					2																	131803760		2201	4299	6500	SO:0001578	stop_lost	0			-	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657	ENST00000326016.5:c.2071T>C	2.37:g.131803760T>C	ENSP00000316845:p.*691Argext*91		Q9HDC6|Q9UPP0	Nonstop_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.*691R	ENST00000326016.5	37	c.2071	CCDS2165.1	2	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526615	0.85706	.	.	ENSG00000136002	ENST00000326016;ENST00000438985;ENST00000428230;ENST00000409303;ENST00000355771	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4949	0.61419	0.0:0.0:0.0:1.0	.	.	.	.	R	691;373;193;631;620	.	.	X	+	1	0	ARHGEF4	131520230	1.000000	0.71417	1.000000	0.80357	0.714000	0.41099	4.654000	0.61469	2.089000	0.63090	0.379000	0.24179	TGA	-	ARHGEF4	-	NULL		0.667	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	HGNC	protein_coding	OTTHUMT00000254554.4	0	0	0	84	84	47	0.00	0.00	T			131803760	+1	18	8	36	9	tier1	no_errors	ENST00000326016	ensembl	human	known	74_37	nonstop	33.33	47.06	SNP	1.000	C	18	36
IGFN1	91156	genome.wustl.edu	37	1	201190739	201190739	+	Missense_Mutation	SNP	G	G	A	rs375687736		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:201190739G>A	ENST00000335211.4	+	19	10196	c.10066G>A	c.(10066-10068)Gtg>Atg	p.V3356M	RP11-567E21.3_ENST00000453155.1_RNA|IGFN1_ENST00000295591.8_Missense_Mutation_p.V516M	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	899						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TGTGGGCACCGTGCCAGTCAC	0.642													ENSG00000163395	G|||	1	0.000199681	0.0	0.0	5008	,	,		18431	0.0		0.001	False		,,,				2504	0.0																0								G	MET/VAL	0,4406		0,0,2203	53.0	45.0	48.0		10066	2.7	0.1	1		48	1,8599	1.2+/-3.3	0,1,4299	no	missense	IGFN1	NM_001164586.1	21	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	3356/3709	201190739	1,13005	2203	4300	6503	SO:0001583	missense	0			-	AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.10066G>A	1.37:g.201190739G>A	ENSP00000334714:p.Val3356Met		F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V3356M	ENST00000335211.4	37	c.10066	CCDS53455.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.44|11.44	1.639433|1.639433	0.29157|0.29157	0.0|0.0	1.16E-4|1.16E-4	ENSG00000163395|ENSG00000163395	ENST00000412892|ENST00000335211;ENST00000295591	.|T;T	.|0.61392	.|0.11;0.11	4.64|4.64	2.71|2.71	0.32032|0.32032	.|.	.|0.645104	.|0.13642	.|N	.|0.372870	T|T	0.68366|0.68366	0.2993|0.2993	M|M	0.87456|0.87456	2.885|2.885	0.09310|0.09310	N|N	1|1	.|D	.|0.54964	.|0.969	.|P	.|0.54060	.|0.741	T|T	0.58070|0.58070	-0.7701|-0.7701	5|10	.|0.45353	.|T	.|0.12	.|.	5.2243|5.2243	0.15385|0.15385	0.1763:0.0:0.66:0.1637|0.1763:0.0:0.66:0.1637	.|.	.|3356	.|F8WAI1	.|.	H|M	773|3356;516	.|ENSP00000334714:V3356M;ENSP00000295591:V516M	.|ENSP00000295591:V516M	R|V	+|+	2|1	0|0	IGFN1|IGFN1	199457362|199457362	0.000000|0.000000	0.05858|0.05858	0.105000|0.105000	0.21289|0.21289	0.074000|0.074000	0.17049|0.17049	-0.069000|-0.069000	0.11542|0.11542	0.367000|0.367000	0.24454|0.24454	-0.704000|-0.704000	0.03662|0.03662	CGT|GTG	-	IGFN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		0	0	0	52	52	50	0.00	0.00	G	NM_178275		201190739	+1	30	22	8	4	tier1	no_errors	ENST00000335211	ensembl	human	known	74_37	missense	76.92	84.62	SNP	0.000	A	30	8
SREBF1	6720	genome.wustl.edu	37	17	17719281	17719281	+	Missense_Mutation	SNP	G	G	T	rs529689353		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr17:17719281G>T	ENST00000261646.5	-	12	2460	c.2276C>A	c.(2275-2277)gCc>gAc	p.A759D	SREBF1_ENST00000355815.4_Missense_Mutation_p.A789D|MIR33B_ENST00000385104.1_RNA|SREBF1_ENST00000395757.1_Missense_Mutation_p.A505D|SREBF1_ENST00000338854.5_Missense_Mutation_p.A759D	NM_004176.4	NP_004167.3	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription factor 1	759					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|cellular response to starvation (GO:0009267)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|negative regulation of insulin secretion (GO:0046676)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of fatty acid metabolic process (GO:0019217)|regulation of heart rate by chemical signal (GO:0003062)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucagon (GO:0033762)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|sterol response element binding (GO:0032810)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	14						CCACTGCATGGCAGGAGGCAC	0.652													ENSG00000072310																																					0													55.0	52.0	53.0					17																	17719281		2203	4300	6503	SO:0001583	missense	0			-	BC057388	CCDS11189.1, CCDS32583.1	17p11.2	2013-05-21			ENSG00000072310	ENSG00000072310		"""Basic helix-loop-helix proteins"""	11289	protein-coding gene	gene with protein product		184756				8402897, 7759101	Standard	NM_001005291		Approved	SREBP1, bHLHd1, SREBP-1c	uc002grt.2	P36956	OTTHUMG00000059313	ENST00000261646.5:c.2276C>A	17.37:g.17719281G>T	ENSP00000261646:p.Ala759Asp		B0I4X3|B0I4X4|D3DXC4|Q16062|Q59F52|Q6P4R7|Q6PFW7|Q6PJ36|Q8TAK9	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.A789D	ENST00000261646.5	37	c.2366	CCDS11189.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.808490|2.808490	0.50421|0.50421	.|.	.|.	ENSG00000072310|ENSG00000072310	ENST00000338854;ENST00000355815;ENST00000261646;ENST00000395757;ENST00000395756;ENST00000418712;ENST00000423161;ENST00000447641|ENST00000395751	T;T;T;T|.	0.13196|.	2.61;2.61;2.61;2.61|.	5.2|5.2	4.11|4.11	0.48088|0.48088	.|.	0.063428|.	0.64402|.	D|.	0.000008|.	T|.	0.60183|.	0.2249|.	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	P;D;P|.	0.59357|.	0.954;0.985;0.948|.	P;P;P|.	0.61533|.	0.779;0.89;0.802|.	T|.	0.57236|.	-0.7846|.	10|.	0.36615|.	T|.	0.2|.	-13.4023|-13.4023	13.5083|13.5083	0.61497|0.61497	0.0831:0.0:0.9169:0.0|0.0831:0.0:0.9169:0.0	.|.	759;789;378|.	P36956;P36956-4;A8MTU8|.	SRBP1_HUMAN;.;.|.	D|X	759;789;759;505;378;596;685;84|766	ENSP00000345822:A759D;ENSP00000348069:A789D;ENSP00000261646:A759D;ENSP00000379106:A505D|.	ENSP00000261646:A759D|.	A|C	-|-	2|3	0|2	SREBF1|SREBF1	17660006|17660006	1.000000|1.000000	0.71417|0.71417	0.946000|0.946000	0.38457|0.38457	0.965000|0.965000	0.64279|0.64279	6.514000|6.514000	0.73746|0.73746	1.150000|1.150000	0.42419|0.42419	0.561000|0.561000	0.74099|0.74099	GCC|TGC	-	SREBF1	-	NULL		0.652	SREBF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF1	HGNC	protein_coding	OTTHUMT00000131771.1	0	0	0	59	59	26	0.00	0.00	G	NM_004176		17719281	-1	10	5	25	8	tier1	no_errors	ENST00000355815	ensembl	human	known	74_37	missense	28.57	38.46	SNP	1.000	T	10	25
CD84	8832	genome.wustl.edu	37	1	160549203	160549203	+	Silent	SNP	A	A	G			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:160549203A>G	ENST00000311224.4	-	1	91	c.25T>C	c.(25-27)Ttg>Ctg	p.L9L	CD84_ENST00000368054.3_Silent_p.L9L|CD84_ENST00000368048.3_Silent_p.L9L|CD84_ENST00000368051.3_Silent_p.L9L|CD84_ENST00000368047.3_5'UTR|CD84_ENST00000534968.1_Silent_p.L9L	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	9					blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			CAAAGGAGCAAGATCCATAGG	0.453													ENSG00000066294																																					0													152.0	136.0	141.0					1																	160549203		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.25T>C	1.37:g.160549203A>G			B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Silent	SNP	pfscan_Ig-like_dom	p.L9	ENST00000311224.4	37	c.25	CCDS53396.1	1																																																																																			-	CD84	-	NULL		0.453	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	0	0	0	71	71	207	0.00	0.00	A	NM_003874		160549203	-1	7	8	18	101	tier1	no_errors	ENST00000534968	ensembl	human	known	74_37	silent	28.00	7.34	SNP	0.999	G	7	18
ACTR5	79913	genome.wustl.edu	37	20	37380900	37380900	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr20:37380900G>C	ENST00000243903.4	+	3	769	c.732G>C	c.(730-732)gaG>gaC	p.E244D		NM_024855.3	NP_079131.3	Q9H9F9	ARP5_HUMAN	ARP5 actin-related protein 5 homolog (yeast)	244					DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|UV-damage excision repair (GO:0070914)	cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleus (GO:0005634)				kidney(2)|large_intestine(2)|liver(1)|lung(5)|skin(2)	12		Myeloproliferative disorder(115;0.00878)				GCATGGAGGAGATTCTGCATG	0.527													ENSG00000101442																																					0													107.0	87.0	94.0					20																	37380900		2203	4300	6503	SO:0001583	missense	0			-	AK022847	CCDS13308.1	20q12	2011-07-06	2001-11-28		ENSG00000101442	ENSG00000101442		"""INO80 complex subunits"""	14671	protein-coding gene	gene with protein product	"""INO80 complex subunit M"""		"""ARP5 (actin-related protein 5, yeast) homolog"""			16230350	Standard	NM_024855		Approved	FLJ12785, Arp5, INO80M	uc002xjd.2	Q9H9F9	OTTHUMG00000032456	ENST00000243903.4:c.732G>C	20.37:g.37380900G>C	ENSP00000243903:p.Glu244Asp		Q86WF7|Q8IUY5|Q8N724|Q9BRN0|Q9BVB7	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.E244D	ENST00000243903.4	37	c.732	CCDS13308.1	20	.	.	.	.	.	.	.	.	.	.	G	19.36	3.812981	0.70912	.	.	ENSG00000101442	ENST00000243903	T	0.06687	3.27	5.62	3.29	0.37713	.	0.000000	0.85682	D	0.000000	T	0.12518	0.0304	N	0.17082	0.46	0.48185	D	0.999607	D	0.76494	0.999	D	0.80764	0.994	T	0.12734	-1.0536	10	0.38643	T	0.18	-32.7063	9.48	0.38895	0.2766:0.0:0.7234:0.0	.	244	Q9H9F9	ARP5_HUMAN	D	244	ENSP00000243903:E244D	ENSP00000243903:E244D	E	+	3	2	ACTR5	36814314	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.166000	0.42406	1.505000	0.48720	0.561000	0.74099	GAG	-	ACTR5	-	pfam_Actin-related,smart_Actin-related		0.527	ACTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR5	HGNC	protein_coding	OTTHUMT00000079205.2	0	0	0	71	71	84	0.00	0.00	G	NM_024855		37380900	+1	7	4	41	67	tier1	no_errors	ENST00000243903	ensembl	human	known	74_37	missense	14.58	5.63	SNP	1.000	C	7	41
PAPOLG	64895	genome.wustl.edu	37	2	60997608	60997608	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr2:60997608T>A	ENST00000238714.3	+	6	703	c.454T>A	c.(454-456)Ttt>Att	p.F152I		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	152		Interaction with RNA. {ECO:0000250}.			mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGAAGATGCCTTTGTACCTGT	0.284													ENSG00000115421																									GBM(183;1497 2932 21839 46797)												0													176.0	168.0	171.0					2																	60997608		2202	4298	6500	SO:0001583	missense	0			-	AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.454T>A	2.37:g.60997608T>A	ENSP00000238714:p.Phe152Ile		B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Missense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_R-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.F152I	ENST00000238714.3	37	c.454	CCDS1863.1	2	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517330	0.85495	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.73	5.73	0.89815	Nucleotidyl transferase domain (1);Poly(A) polymerase, central domain (1);	0.097735	0.64402	D	0.000001	T	0.76814	0.4040	M	0.88906	2.99	0.80722	D	1	P	0.35242	0.492	B	0.40982	0.345	T	0.80591	-0.1314	9	0.87932	D	0	-15.3485	15.9756	0.80060	0.0:0.0:0.0:1.0	.	152	Q9BWT3	PAPOG_HUMAN	I	152	.	ENSP00000238714:F152I	F	+	1	0	PAPOLG	60851112	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.653000	0.83643	2.313000	0.78055	0.454000	0.30748	TTT	-	PAPOLG	-	pfam_PolA_pol_cen_dom,pfam_Nucleotidyltransferase,pirsf_PolyA_polymerase		0.284	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLG	HGNC	protein_coding	OTTHUMT00000251577.3	0	0	2	101	101	314	0.00	0.63	T	NM_022894		60997608	+1	16	41	45	107	tier1	no_errors	ENST00000238714	ensembl	human	known	74_37	missense	26.23	27.70	SNP	1.000	A	16	45
INPP5B	3633	genome.wustl.edu	37	1	38411475	38411476	+	Frame_Shift_Ins	INS	-	-	A			TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr1:38411475_38411476insA	ENST00000373026.1	-	2	104_105	c.104_105insT	c.(103-105)ctcfs	p.L35fs	INPP5B_ENST00000373024.3_Frame_Shift_Ins_p.L35fs|INPP5B_ENST00000373023.2_Frame_Shift_Ins_p.L35fs|INPP5B_ENST00000373021.1_Frame_Shift_Ins_p.L35fs			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	35	PH.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CGAGTCCCAGGAGGCGGCTCTG	0.668													ENSG00000204084																																					0																																										SO:0001589	frameshift_variant	0				M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.105dupT	1.37:g.38411476_38411476dupA	ENSP00000362117:p.Leu35fs		C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Frame_Shift_Ins	INS	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L36fs	ENST00000373026.1	37	c.105_104		1																																																																																				INPP5B	-	NULL		0.668	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	HGNC	protein_coding	OTTHUMT00000012968.1	0	0	0	49	49	21	0.00	0.00	-	NM_005540		38411476	-1	2	0	16	4	tier1	no_errors	ENST00000373023	ensembl	human	known	74_37	frame_shift_ins	11.11	0.00	INS	1.000:1.000	A	2	16
BCR	613	genome.wustl.edu	37	22	23658274	23658275	+	3'UTR	INS	-	-	TTC	rs199982774|rs202178919		TCGA-X6-A8C2-01A-11D-A36J-09	TCGA-X6-A8C2-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c9802b37-e213-4a7a-afcd-5822502fb968	18d5c618-c91c-4714-9683-ec3098cb28bd	g.chr22:23658274_23658275insTTC	ENST00000305877.8	+	0	5132_5133				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CATTCTTGGCTTTCTTTTTCTT	0.47			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								ENSG00000186716																												Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										SO:0001624	3_prime_UTR_variant	0					CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*566->TTC	22.37:g.23658275_23658277dupTTC			P78501|Q12842|Q4LE80|Q6NZI3	R	INS	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																				BCR	-	-		0.470	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	0	0	0	8	8	0	0.00	0.00	-	NM_004327		23658275	+1	2	0	7	0	tier1	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	22.22	0.00	INS	0.000:0.000	TTC	2	7
