#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
SYCP2L	221711	genome.wustl.edu	37	6	10961632	10961632	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:10961632G>T	ENST00000283141.6	+	27	2646	c.2350G>T	c.(2350-2352)Gtt>Ttt	p.V784F		NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	784						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TGAGAAGGAGGTTCTGGTAAG	0.383													ENSG00000153157																																					0													119.0	110.0	113.0					6																	10961632		1848	4100	5948	SO:0001583	missense	0			-	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.2350G>T	6.37:g.10961632G>T	ENSP00000283141:p.Val784Phe		A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	NULL	p.V784F	ENST00000283141.6	37	c.2350	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	G	12.33	1.904505	0.33628	.	.	ENSG00000153157	ENST00000283141	T	0.18174	2.23	5.49	2.72	0.32119	.	0.823632	0.10734	N	0.640271	T	0.10937	0.0267	L	0.41236	1.265	0.09310	N	1	P	0.52061	0.95	P	0.53006	0.715	T	0.14476	-1.0471	10	0.66056	D	0.02	-1.8676	7.1043	0.25354	0.262:0.0:0.738:0.0	.	784	Q5T4T6	SYC2L_HUMAN	F	784	ENSP00000283141:V784F	ENSP00000283141:V784F	V	+	1	0	SYCP2L	11069618	0.000000	0.05858	0.029000	0.17559	0.098000	0.18820	0.297000	0.19101	1.309000	0.44985	0.655000	0.94253	GTT	-	SYCP2L	-	NULL		0.383	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3	1	1	0	106	106	139	0.93	0.00	G	NM_194299		10961632	+1	35	41	17	36	tier1	no_errors	ENST00000283141	ensembl	human	known	74_37	missense	67.31	53.25	SNP	0.001	T	35	17
CNR1	1268	genome.wustl.edu	37	6	88853662	88853662	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:88853662C>A	ENST00000537554.1	-	2	4894	c.1332G>T	c.(1330-1332)agG>agT	p.R444S	CNR1_ENST00000535130.1_Missense_Mutation_p.R444S|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000369501.2_Missense_Mutation_p.R444S|CNR1_ENST00000468898.1_Missense_Mutation_p.R411S|CNR1_ENST00000428600.2_Missense_Mutation_p.R444S|CNR1_ENST00000549890.1_Missense_Mutation_p.R444S|CNR1_ENST00000549716.1_Missense_Mutation_p.R383S|CNR1_ENST00000369499.2_Missense_Mutation_p.R444S	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	444					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TTTCTGCGGCCCTGTGAACAC	0.562													ENSG00000118432																																					0													218.0	196.0	203.0					6																	88853662		2203	4300	6503	SO:0001583	missense	0			-	AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1332G>T	6.37:g.88853662C>A	ENSP00000441046:p.Arg444Ser		B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Canbinoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Canbinoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.R444S	ENST00000537554.1	37	c.1332	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	C	5.555	0.287344	0.10513	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.75938	-0.93;-0.93;-0.93;-0.93;-0.93;-0.98;-0.93;-0.86	5.94	3.21	0.36854	.	0.000000	0.85682	D	0.000000	T	0.34135	0.0887	L	0.27053	0.805	0.80722	D	1	B;B	0.30634	0.288;0.099	B;B	0.26969	0.075;0.025	T	0.15780	-1.0425	10	0.12766	T	0.61	.	6.5034	0.22182	0.0:0.6643:0.131:0.2046	.	411;444	P21554-3;P21554	.;CNR1_HUMAN	S	444;444;444;444;444;411;444;383	ENSP00000358513:R444S;ENSP00000442689:R444S;ENSP00000441046:R444S;ENSP00000358511:R444S;ENSP00000446819:R444S;ENSP00000420188:R411S;ENSP00000412192:R444S;ENSP00000449549:R383S	ENSP00000358511:R444S	R	-	3	2	CNR1	88910381	1.000000	0.71417	0.998000	0.56505	0.052000	0.14988	1.592000	0.36676	0.411000	0.25702	-0.175000	0.13238	AGG	-	CNR1	-	pirsf_Canbinoid_rcpt_1,prints_Canbinoid_rcpt_1		0.562	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	0	0	0	48	48	93	0.00	0.00	C			88853662	-1	14	26	21	53	tier1	no_errors	ENST00000369499	ensembl	human	known	74_37	missense	40.00	32.91	SNP	1.000	A	14	21
SLC25A3P1	163742	genome.wustl.edu	37	1	53904702	53904702	+	RNA	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:53904702A>T	ENST00000566100.1	-	0	536									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		GACCTCGTAAAGGCCGAACTT	0.657													ENSG00000236253																																					0																																												0			-			1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53904702A>T				R	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			-	SLC25A3P1	-	-		0.657	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	0	0	0	22	22	51	0.00	0.00	A	NM_178501		53904702	-1	11	17	14	42	tier1	no_errors	ENST00000562700	ensembl	human	known	74_37	rna	44.00	28.33	SNP	1.000	T	11	14
C1orf106	55765	genome.wustl.edu	37	1	200883099	200883099	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:200883099T>C	ENST00000367342.4	+	0	2534				C1orf106_ENST00000465162.1_3'UTR	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106											endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						CCTTGGGAGTTCTCCAACGCT	0.532													ENSG00000163362																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.*342T>C	1.37:g.200883099T>C			B4E1K9|E9PFY0|Q9NV65|Q9NVI0	R	SNP	-	NULL	ENST00000367342.4	37	NULL		1																																																																																			-	C1orf106	-	-		0.532	C1orf106-001	KNOWN	basic	protein_coding	C1orf106	HGNC	protein_coding	OTTHUMT00000087057.2	0	0	0	28	28	62	0.00	0.00	T	NM_018265		200883099	+1	9	39	18	68	tier1	no_errors	ENST00000465162	ensembl	human	known	74_37	rna	33.33	36.11	SNP	0.002	C	9	18
CXCR1	3577	genome.wustl.edu	37	2	219029327	219029327	+	Missense_Mutation	SNP	C	C	T	rs538588993		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:219029327C>T	ENST00000295683.2	-	2	728	c.608G>A	c.(607-609)cGg>cAg	p.R203Q		NM_000634.2	NP_000625.1	P25024	CXCR1_HUMAN	chemokine (C-X-C motif) receptor 1	203					cell surface receptor signaling pathway (GO:0007166)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|dendritic cell chemotaxis (GO:0002407)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|interleukin-8-mediated signaling pathway (GO:0038112)|receptor internalization (GO:0031623)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)|G-protein coupled receptor activity (GO:0004930)|interleukin-8 binding (GO:0019959)|interleukin-8 receptor activity (GO:0004918)	p.R203Q(1)		endometrium(1)|large_intestine(2)|lung(7)|prostate(3)	13					Ketoprofen(DB01009)	AGGCAGGATCCGCAACACCAT	0.522													ENSG00000163464	C|||	1	0.000199681	0.0008	0.0	5008	,	,		23628	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	prostate(1)											106.0	93.0	97.0					2																	219029327		2203	4300	6503	SO:0001583	missense	0			-	U11870	CCDS2409.1	2q35	2012-08-08	2009-11-25	2009-11-25	ENSG00000163464	ENSG00000163464		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"", ""Interleukins and interleukin receptors"""	6026	protein-coding gene	gene with protein product		146929	"""interleukin 8 receptor, alpha"""	CMKAR1, IL8RA		1303245, 1427896	Standard	NM_000634		Approved	CKR-1, CDw128a, CD181	uc002vhc.3	P25024	OTTHUMG00000133108	ENST00000295683.2:c.608G>A	2.37:g.219029327C>T	ENSP00000295683:p.Arg203Gln		B2R6Q3|Q2YEF8|Q2YEG4|Q2YEG5|Q2YEG7|Q2YEG8|Q53R18|Q6IN95|Q8N6T6|Q9P2T8|Q9P2T9|Q9P2U0|Q9P2U1|Q9P2U2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn,prints_Chemokine_CXCR1,prints_Chemokine_rcpt,prints_Chemokine_CXCR4	p.R203Q	ENST00000295683.2	37	c.608	CCDS2409.1	2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.984602	0.93044	.	.	ENSG00000163464	ENST00000295683;ENST00000421691	T	0.37058	1.22	4.74	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.179642	0.48767	D	0.000179	T	0.53802	0.1819	L	0.59967	1.855	0.49915	D	0.999835	D	0.60160	0.987	P	0.62491	0.903	T	0.54063	-0.8349	10	0.46703	T	0.11	.	16.859	0.86013	0.0:1.0:0.0:0.0	.	203	P25024	CXCR1_HUMAN	Q	203;147	ENSP00000295683:R203Q	ENSP00000295683:R203Q	R	-	2	0	CXCR1	218737572	0.992000	0.36948	0.274000	0.24659	0.968000	0.65278	4.840000	0.62817	2.314000	0.78098	0.561000	0.74099	CGG	-	CXCR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CXCR_1/2,prints_GPCR_Rhodpsn		0.522	CXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCR1	HGNC	protein_coding	OTTHUMT00000256773.2	0	0	0	50	50	119	0.00	0.00	C	NM_000634		219029327	-1	12	23	48	81	tier1	no_errors	ENST00000295683	ensembl	human	known	74_37	missense	20.00	22.12	SNP	0.997	T	12	48
PITPNC1	26207	genome.wustl.edu	37	17	65683225	65683225	+	Intron	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:65683225T>A	ENST00000581322.1	+	9	682				PITPNC1_ENST00000580974.1_Missense_Mutation_p.H242Q|PITPNC1_ENST00000335257.6_Intron|PITPNC1_ENST00000299954.9_Missense_Mutation_p.H242Q			Q9UKF7	PITC1_HUMAN	phosphatidylinositol transfer protein, cytoplasmic 1						phospholipid transport (GO:0015914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)			breast(1)|kidney(2)|large_intestine(3)|liver(2)|lung(4)|prostate(2)|skin(3)	17	all_cancers(12;3.03e-10)		BRCA - Breast invasive adenocarcinoma(8;2.08e-08)|Colorectal(3;0.198)			AAAACATGCATGAACAAACCA	0.388													ENSG00000154217																																					0													159.0	153.0	155.0					17																	65683225		1933	4122	6055	SO:0001627	intron_variant	0			-	AF171102	CCDS58587.1, CCDS58588.1	17q24.3	2008-02-05							21045	protein-coding gene	gene with protein product		605134				10531358	Standard	NM_012417		Approved	RDGBB1, RDGBB, RDGB-BETA	uc002jgc.4	Q9UKF7		ENST00000581322.1:c.683-5463T>A	17.37:g.65683225T>A			A8K473|J3QR20|Q96I07	Missense_Mutation	SNP	pfam_PI_transfer,prints_PI_transfer	p.H242Q	ENST00000581322.1	37	c.726	CCDS58588.1	17	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059535	0.36373	.	.	ENSG00000154217	ENST00000299954	T	0.38077	1.16	5.13	5.13	0.70059	.	.	.	.	.	T	0.05960	0.0155	N	0.00017	-2.835	0.22521	N	0.999023	B	0.06786	0.001	B	0.06405	0.002	T	0.11251	-1.0595	9	0.02654	T	1	.	11.2641	0.49099	0.0:0.0:0.1527:0.8472	.	242	Q9UKF7-2	.	Q	242	ENSP00000299954:H242Q	ENSP00000299954:H242Q	H	+	3	2	PITPNC1	63113687	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.092000	0.64511	2.046000	0.60703	0.482000	0.46254	CAT	-	PITPNC1	-	pfam_PI_transfer		0.388	PITPNC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNC1	HGNC	protein_coding	OTTHUMT00000447194.1	0	0	0	67	67	108	0.00	0.00	T	NM_012417		65683225	+1	25	50	61	68	tier1	no_errors	ENST00000299954	ensembl	human	known	74_37	missense	29.07	42.37	SNP	1.000	A	25	61
ZNF521	25925	genome.wustl.edu	37	18	22932142	22932142	+	5'Flank	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:22932142G>C	ENST00000361524.3	-	0	0				ZNF521_ENST00000579111.1_5'UTR|ZNF521_ENST00000538137.2_5'Flank|ZNF521_ENST00000584787.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CTCACACACAGACAGAGGGGC	0.662			T	PAX5	ALL								ENSG00000198795																												Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													80.0	81.0	81.0					18																	22932142		876	1991	2867	SO:0001631	upstream_gene_variant	0			-	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83			18.37:g.22932142G>C	Exception_encountered		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	R	SNP	-	NULL	ENST00000361524.3	37	NULL	CCDS32806.1	18																																																																																			-	ZNF521	-	-		0.662	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	0	0	0	65	65	33	0.00	0.00	G	NM_015461		22932142	-1	18	13	39	33	tier1	no_errors	ENST00000579111	ensembl	human	known	74_37	rna	31.03	28.26	SNP	1.000	C	18	39
SGOL2	151246	genome.wustl.edu	37	2	201437697	201437697	+	Nonsense_Mutation	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:201437697T>A	ENST00000357799.4	+	7	2726	c.2628T>A	c.(2626-2628)tgT>tgA	p.C876*		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	876					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						GAAATTTATGTGATTATGACA	0.303													ENSG00000163535																																					0													82.0	84.0	83.0					2																	201437697		1805	4054	5859	SO:0001587	stop_gained	0			-	AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2628T>A	2.37:g.201437697T>A	ENSP00000350447:p.Cys876*		Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Nonsense_Mutation	SNP	NULL	p.C876*	ENST00000357799.4	37	c.2628	CCDS42796.1	2	.	.	.	.	.	.	.	.	.	.	T	21.9	4.216796	0.79352	.	.	ENSG00000163535	ENST00000357799	.	.	.	4.7	3.55	0.40652	.	0.757356	0.11335	N	0.574592	.	.	.	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	0.3911	6.9437	0.24506	0.0:0.1035:0.0:0.8965	.	.	.	.	X	876	.	ENSP00000350447:C876X	C	+	3	2	SGOL2	201145942	0.001000	0.12720	0.018000	0.16275	0.054000	0.15201	0.113000	0.15499	0.947000	0.37659	0.477000	0.44152	TGT	-	SGOL2	-	NULL		0.303	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1	0	0	0	42	42	63	0.00	0.00	T	NM_152524		201437697	+1	13	24	39	66	tier1	no_errors	ENST00000357799	ensembl	human	known	74_37	nonsense	25.00	26.67	SNP	0.012	A	13	39
KRT23	25984	genome.wustl.edu	37	17	39081634	39081634	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:39081634G>A	ENST00000209718.3	-	7	1538	c.1114C>T	c.(1114-1116)Cga>Tga	p.R372*	AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000436344.3_Nonsense_Mutation_p.R235*	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	372	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R372R(1)		central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				AGGAGCCGTCGGTACGTGGTG	0.557													ENSG00000108244																																					1	Substitution - coding silent(1)	lung(1)											199.0	152.0	168.0					17																	39081634		2203	4300	6503	SO:0001587	stop_gained	0			-	AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.1114C>T	17.37:g.39081634G>A	ENSP00000209718:p.Arg372*		A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Nonsense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.R372*	ENST00000209718.3	37	c.1114	CCDS11380.1	17	.	.	.	.	.	.	.	.	.	.	G	38	6.752212	0.97813	.	.	ENSG00000108244	ENST00000209718;ENST00000436344	.	.	.	5.49	5.49	0.81192	.	0.131519	0.35936	N	0.002893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3809	0.94532	0.0:0.0:1.0:0.0	.	.	.	.	X	372;235	.	ENSP00000209718:R372X	R	-	1	2	KRT23	36335160	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.762000	0.62250	2.581000	0.87130	0.655000	0.94253	CGA	-	KRT23	-	pfam_IF		0.557	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT23	HGNC	protein_coding	OTTHUMT00000257223.1	0	0	0	48	48	71	0.00	0.00	G			39081634	-1	9	31	21	79	tier1	no_errors	ENST00000209718	ensembl	human	known	74_37	nonsense	30.00	28.18	SNP	1.000	A	9	21
TLR4	7099	genome.wustl.edu	37	9	120466787	120466787	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:120466787C>A	ENST00000355622.6	+	1	138	c.37C>A	c.(37-39)Cca>Aca	p.P13T	TLR4_ENST00000394487.4_5'UTR|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	13					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	GACTCTGATCCCAGCCATGGC	0.592													ENSG00000136869																																					0													63.0	62.0	62.0					9																	120466787		2203	4300	6503	SO:0001583	missense	0			-	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.37C>A	9.37:g.120466787C>A	ENSP00000363089:p.Pro13Thr		A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.P13T	ENST00000355622.6	37	c.37	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	14.32	2.498943	0.44455	.	.	ENSG00000136869	ENST00000355622	T	0.36699	1.24	5.42	-0.378	0.12497	.	1.122620	0.06652	N	0.762877	T	0.19886	0.0478	L	0.29908	0.895	0.18873	N	0.999988	P	0.44627	0.839	B	0.33454	0.164	T	0.20472	-1.0274	10	0.40728	T	0.16	.	4.3046	0.10940	0.49:0.3282:0.0:0.1818	.	13	O00206	TLR4_HUMAN	T	13	ENSP00000363089:P13T	ENSP00000363089:P13T	P	+	1	0	TLR4	119506608	0.025000	0.19082	0.967000	0.41034	0.809000	0.45718	0.006000	0.13152	0.237000	0.21200	0.557000	0.71058	CCA	-	TLR4	-	pirsf_Toll-like_receptor		0.592	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	0	0	0	19	19	28	0.00	0.00	C	NM_138554		120466787	+1	5	13	20	21	tier1	no_errors	ENST00000355622	ensembl	human	known	74_37	missense	20.00	38.24	SNP	0.720	A	5	20
OR6C2	341416	genome.wustl.edu	37	12	55846256	55846256	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:55846256G>T	ENST00000322678.1	+	1	259	c.259G>T	c.(259-261)Gac>Tac	p.D87Y	RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA	NM_054105.1	NP_473446.1	Q9NZP2	OR6C2_HUMAN	olfactory receptor, family 6, subfamily C, member 2	87					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(5)|lung(8)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	23						ATCAATGGGGGACAATACCAT	0.368													ENSG00000179695																																					0													141.0	142.0	142.0					12																	55846256		2203	4299	6502	SO:0001583	missense	0			-	AF179766	CCDS31824.1	12q13.2	2012-08-09				ENSG00000179695		"""GPCR / Class A : Olfactory receptors"""	15436	protein-coding gene	gene with protein product							Standard	NM_054105		Approved	OR6C67	uc001sgz.1	Q9NZP2	OTTHUMG00000169957	ENST00000322678.1:c.259G>T	12.37:g.55846256G>T	ENSP00000323606:p.Asp87Tyr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D87Y	ENST00000322678.1	37	c.259	CCDS31824.1	12	.	.	.	.	.	.	.	.	.	.	G	13.57	2.275717	0.40294	.	.	ENSG00000179695	ENST00000322678	T	0.02974	4.09	5.42	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.193967	0.35646	N	0.003069	T	0.09468	0.0233	M	0.64567	1.98	0.09310	N	1	D	0.76494	0.999	D	0.71870	0.975	T	0.08207	-1.0733	10	0.72032	D	0.01	.	5.6019	0.17359	0.0753:0.1395:0.6407:0.1445	.	87	Q9NZP2	OR6C2_HUMAN	Y	87	ENSP00000323606:D87Y	ENSP00000323606:D87Y	D	+	1	0	OR6C2	54132523	0.000000	0.05858	0.016000	0.15963	0.005000	0.04900	-0.991000	0.03728	0.865000	0.35603	-0.175000	0.13238	GAC	-	OR6C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.368	OR6C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C2	HGNC	protein_coding	OTTHUMT00000406676.1	0	0	0	74	74	87	0.00	0.00	G	NM_054105		55846256	+1	22	33	45	70	tier1	no_errors	ENST00000322678	ensembl	human	known	74_37	missense	32.84	32.04	SNP	0.005	T	22	45
CXorf57	55086	genome.wustl.edu	37	X	105905498	105905498	+	Silent	SNP	C	C	T	rs140805762	byFrequency	TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:105905498C>T	ENST00000372548.4	+	12	2341	c.2232C>T	c.(2230-2232)agC>agT	p.S744S	CXorf57_ENST00000372544.2_Silent_p.S647S|CXorf57_ENST00000497124.1_3'UTR	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	744							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						ATTTTAAGAGCGCCCGAAGCC	0.358													ENSG00000147231																																					0								C	,	0,3833		0,0,0,1631,571	71.0	69.0	69.0		1941,2232	-3.3	0.1	X	dbSNP_134	69	3,6725		0,2,1,2426,1871	no	coding-synonymous,coding-synonymous	CXorf57	NM_001184782.1,NM_018015.5	,	0,2,1,4057,2442	TT,TC,T,CC,C		0.0446,0.0,0.0284	,	647/759,744/856	105905498	3,10558	2202	4300	6502	SO:0001819	synonymous_variant	0			-	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.2232C>T	X.37:g.105905498C>T			H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Silent	SNP	superfamily_-bd_OB-fold	p.S744	ENST00000372548.4	37	c.2232	CCDS14519.1	X																																																																																			rs140805762	CXorf57	-	NULL		0.358	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf57	HGNC	protein_coding	OTTHUMT00000057800.2	0	0	0	83	83	116	0.00	0.00	C	NM_018015		105905498	+1	26	42	40	88	tier1	no_errors	ENST00000372548	ensembl	human	known	74_37	silent	39.39	32.31	SNP	0.525	T	26	40
CDRT15L2	256223	genome.wustl.edu	37	17	20483823	20483823	+	Silent	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:20483823C>A	ENST00000399044.1	+	2	647	c.627C>A	c.(625-627)acC>acA	p.T209T	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	209						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						TCGCCGGAACCACAGCCCTGC	0.537													ENSG00000214819																																					0																																										SO:0001819	synonymous_variant	0			-		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.627C>A	17.37:g.20483823C>A				Silent	SNP	NULL	p.T209	ENST00000399044.1	37	c.627	CCDS54096.1	17																																																																																			-	CDRT15L2	-	NULL		0.537	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT15L2	HGNC	protein_coding	OTTHUMT00000132432.3	0	0	0	54	54	58	0.00	0.00	C	XM_170840		20483823	+1	20	12	68	95	tier1	no_errors	ENST00000399044	ensembl	human	known	74_37	silent	22.73	11.21	SNP	0.031	A	20	68
RGAG4	340526	genome.wustl.edu	37	X	71349949	71349949	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:71349949G>A	ENST00000545866.1	-	1	1809	c.1442C>T	c.(1441-1443)aCt>aTt	p.T481I	RGAG4_ENST00000609883.1_Missense_Mutation_p.T481I|NHSL2_ENST00000540800.1_Intron	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	481										cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					GGGGCCAGAAGTCTGGGATGA	0.547													ENSG00000242732																																					0													92.0	92.0	92.0					X																	71349949		2128	4210	6338	SO:0001583	missense	0			-	AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1442C>T	X.37:g.71349949G>A	ENSP00000441366:p.Thr481Ile		A7E2W7|Q8NCM4|Q9NPX1	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom	p.T481I	ENST00000545866.1	37	c.1442	CCDS55446.1	X	.	.	.	.	.	.	.	.	.	.	G	11.27	1.590151	0.28357	.	.	ENSG00000242732	ENST00000545866;ENST00000479991	T;T	0.21734	1.99;1.99	3.87	2.03	0.26663	.	.	.	.	.	T	0.10895	0.0266	N	0.19112	0.55	0.18873	N	0.999989	B	0.20550	0.046	B	0.14578	0.011	T	0.34329	-0.9833	8	.	.	.	-1.0359	3.9849	0.09511	0.1198:0.0:0.462:0.4182	.	481	Q5HYW3	RGAG4_HUMAN	I	481	ENSP00000441366:T481I;ENSP00000418667:T481I	.	T	-	2	0	RGAG4	71266674	0.997000	0.39634	0.248000	0.24265	0.051000	0.14879	1.325000	0.33724	0.395000	0.25257	0.500000	0.49745	ACT	-	RGAG4	-	NULL		0.547	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	0	0	0	89	89	109	0.00	0.00	G	NM_001024455		71349949	-1	32	61	41	78	tier1	no_errors	ENST00000479991	ensembl	human	known	74_37	missense	43.84	43.88	SNP	0.206	A	32	41
PPP1R9B	84687	genome.wustl.edu	37	17	48211791	48211791	+	3'UTR	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:48211791T>C	ENST00000316878.6	-	0	3355				PPP1R9B_ENST00000501501.2_5'UTR|AC002401.1_ENST00000451776.1_RNA	NM_032595.3	NP_115984.3	Q96SB3	NEB2_HUMAN	protein phosphatase 1, regulatory subunit 9B						actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to morphine (GO:0071315)|dendrite development (GO:0016358)|filopodium assembly (GO:0046847)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of cell proliferation (GO:0042127)|regulation of exit from mitosis (GO:0007096)|regulation of opioid receptor signaling pathway (GO:2000474)|regulation of protein phosphorylation (GO:0001932)|RNA splicing (GO:0008380)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|protein phosphatase type 1 complex (GO:0000164)|ruffle membrane (GO:0032587)|synapse (GO:0045202)	protein phosphatase 1 binding (GO:0008157)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8						GACCTGACTCTCCAGGGAGAA	0.622													ENSG00000108819																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AJ401189	CCDS74102.1	17q21.33	2013-01-31	2011-10-04	2001-07-02	ENSG00000108819	ENSG00000108819		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9298	protein-coding gene	gene with protein product	"""spinophilin"", ""Neurabin-2"""	603325	"""protein phosphatase 1, regulatory subunit 9B, spinophilin"", ""protein phosphatase 1, regulatory (inhibitor) subunit 9B"""	PPP1R6, PPP1R9		9275233	Standard	NM_032595		Approved	Spn, SPINO	uc002iqh.4	Q96SB3	OTTHUMG00000162008	ENST00000316878.6:c.*905A>G	17.37:g.48211791T>C			Q8TCR9	R	SNP	-	NULL	ENST00000316878.6	37	NULL		17																																																																																			-	PPP1R9B	-	-		0.622	PPP1R9B-201	KNOWN	basic|appris_principal	protein_coding	PPP1R9B	HGNC	protein_coding		0	0	0	27	27	79	0.00	0.00	T	NM_032595		48211791	-1	11	12	17	53	tier1	no_errors	ENST00000501501	ensembl	human	known	74_37	rna	39.29	18.46	SNP	0.464	C	11	17
MKRN3	7681	genome.wustl.edu	37	15	23811311	23811311	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:23811311A>T	ENST00000314520.3	+	1	858	c.382A>T	c.(382-384)Act>Tct	p.T128S	MKRN3_ENST00000564592.1_Intron|MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	128					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GAAGATGGCCACTGAGGGTGG	0.612													ENSG00000179455																																					0													48.0	51.0	50.0					15																	23811311		2203	4300	6503	SO:0001583	missense	0			-	U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.382A>T	15.37:g.23811311A>T	ENSP00000313881:p.Thr128Ser			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.T128S	ENST00000314520.3	37	c.382	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	A	8.295	0.818543	0.16607	.	.	ENSG00000179455	ENST00000314520	T	0.29655	1.56	3.74	-5.23	0.02798	.	0.367003	0.27739	N	0.018054	T	0.15046	0.0363	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26538	-1.0100	10	0.15499	T	0.54	.	6.013	0.19586	0.2606:0.3092:0.4302:0.0	.	128	Q13064	MKRN3_HUMAN	S	128	ENSP00000313881:T128S	ENSP00000313881:T128S	T	+	1	0	MKRN3	21362404	0.000000	0.05858	0.000000	0.03702	0.075000	0.17131	-0.353000	0.07691	-1.114000	0.02977	0.460000	0.39030	ACT	-	MKRN3	-	NULL		0.612	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	0	0	0	53	53	23	0.00	0.00	A	NM_005664		23811311	+1	12	8	39	19	tier1	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	23.53	29.63	SNP	0.000	T	12	39
CCDC87	55231	genome.wustl.edu	37	11	66358959	66358959	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:66358959C>G	ENST00000333861.3	-	1	1595	c.1528G>C	c.(1528-1530)Gat>Cat	p.D510H	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'Flank	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	510					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGCCCTTGATCAAAATGTAAG	0.453													ENSG00000182791																																					0													94.0	96.0	95.0					11																	66358959		2200	4295	6495	SO:0001583	missense	0			-	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.1528G>C	11.37:g.66358959C>G	ENSP00000328487:p.Asp510His		Q8NE76	Missense_Mutation	SNP	pfam_MAP65_Ase1_PRC1	p.D510H	ENST00000333861.3	37	c.1528	CCDS8145.1	11	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641435	0.29157	.	.	ENSG00000182791	ENST00000333861	T	0.47528	0.84	5.3	4.39	0.52855	.	0.306069	0.23164	N	0.051208	T	0.59074	0.2167	M	0.66939	2.045	0.21064	N	0.999793	D	0.65815	0.995	P	0.57960	0.83	T	0.53844	-0.8381	10	0.72032	D	0.01	.	9.7672	0.40567	0.0:0.9077:0.0:0.0923	.	510	Q9NVE4	CCD87_HUMAN	H	510	ENSP00000328487:D510H	ENSP00000328487:D510H	D	-	1	0	CCDC87	66115535	0.999000	0.42202	0.090000	0.20809	0.053000	0.15095	2.526000	0.45607	1.478000	0.48253	0.563000	0.77884	GAT	-	CCDC87	-	NULL		0.453	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC87	HGNC	protein_coding	OTTHUMT00000393825.1	0	0	0	96	96	94	0.00	0.00	C	NM_018219		66358959	-1	27	46	46	74	tier1	no_errors	ENST00000333861	ensembl	human	known	74_37	missense	36.99	38.33	SNP	0.358	G	27	46
ADAMTS20	80070	genome.wustl.edu	37	12	43826172	43826172	+	Nonsense_Mutation	SNP	G	G	A	rs200767698		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:43826172G>A	ENST00000389420.3	-	21	3030	c.3031C>T	c.(3031-3033)Cga>Tga	p.R1011*	ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.R1011*|ADAMTS20_ENST00000395541.2_Nonsense_Mutation_p.R165*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1011	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R1011R(1)		breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTCGTCACTCGGGACAGTTCT	0.443													ENSG00000173157																																					1	Substitution - coding silent(1)	lung(1)						G	stop/ARG	0,4406		0,0,2203	121.0	116.0	118.0		3031	4.1	0.1	12		118	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	ADAMTS20	NM_025003.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		1011/1911	43826172	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			-	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3031C>T	12.37:g.43826172G>A	ENSP00000374071:p.Arg1011*		A6NNC9|J3QT00	Nonsense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R1011*	ENST00000389420.3	37	c.3031	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	40	8.237412	0.98719	0.0	1.16E-4	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	.	.	.	5.04	4.07	0.47477	.	0.303544	0.22113	N	0.064444	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	11.0308	0.47772	0.0:0.0:0.6377:0.3623	.	.	.	.	X	1011;177;165;1011;1011	.	ENSP00000374068:R1011X	R	-	1	2	ADAMTS20	42112439	0.096000	0.21769	0.067000	0.19924	0.892000	0.51952	2.439000	0.44846	2.706000	0.92434	0.655000	0.94253	CGA	rs200767698	ADAMTS20	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.443	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	0	0	0	50	50	93	0.00	0.00	G	NM_025003		43826172	-1	16	24	43	76	tier1	no_errors	ENST00000389420	ensembl	human	known	74_37	nonsense	27.12	23.76	SNP	0.669	A	16	43
UBQLNL	143630	genome.wustl.edu	37	11	5537632	5537632	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:5537632T>C	ENST00000380184.1	-	1	303	c.40A>G	c.(40-42)Agt>Ggt	p.S14G	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	14										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		GGACATCCACTCTGGGACATC	0.532													ENSG00000175518																																					0													78.0	77.0	78.0					11																	5537632		2201	4297	6498	SO:0001583	missense	0			-	AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.40A>G	11.37:g.5537632T>C	ENSP00000369531:p.Ser14Gly		Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.S14G	ENST00000380184.1	37	c.40	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	T	3.786	-0.044715	0.07452	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.40476	1.03	4.94	1.05	0.20165	.	0.608853	0.15582	N	0.254825	T	0.27134	0.0665	L	0.42245	1.32	0.09310	N	1	B	0.33694	0.421	B	0.30646	0.118	T	0.13764	-1.0497	10	0.21014	T	0.42	.	4.8849	0.13697	0.3303:0.0:0.1716:0.4981	.	14	Q8IYU4	UBQLN_HUMAN	G	14	ENSP00000369531:S14G	ENSP00000369531:S14G	S	-	1	0	UBQLNL	5494208	0.008000	0.16893	0.022000	0.16811	0.023000	0.10783	-0.256000	0.08757	0.004000	0.14682	0.528000	0.53228	AGT	-	UBQLNL	-	NULL		0.532	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	HGNC	protein_coding	OTTHUMT00000143386.1	0	0	0	49	49	41	0.00	0.00	T	NM_145053		5537632	-1	9	18	32	38	tier1	no_errors	ENST00000380184	ensembl	human	putative	74_37	missense	21.95	32.14	SNP	0.138	C	9	32
KBTBD8	84541	genome.wustl.edu	37	3	67049586	67049586	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr3:67049586C>A	ENST00000417314.2	+	2	247	c.198C>A	c.(196-198)aaC>aaA	p.N66K	KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000295568.4_Missense_Mutation_p.N40K|KBTBD8_ENST00000469661.1_3'UTR			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	66	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GTCATAGAAACGTTCTTGCTG	0.438													ENSG00000163376																																					0													185.0	172.0	177.0					3																	67049586		2203	4300	6503	SO:0001583	missense	0			-	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.198C>A	3.37:g.67049586C>A	ENSP00000401878:p.Asn66Lys		B4DTW6|Q96JI5	Missense_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.N66K	ENST00000417314.2	37	c.198	CCDS2906.2	3	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702546	0.68501	.	.	ENSG00000163376	ENST00000295568;ENST00000417314;ENST00000460784	T;T;T	0.66815	-0.23;-0.23;-0.23	5.62	4.73	0.59995	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.136504	0.64402	D	0.000003	T	0.75361	0.3839	M	0.87971	2.92	0.48696	D	0.999697	P	0.48503	0.911	P	0.53722	0.733	T	0.78505	-0.2178	10	0.72032	D	0.01	.	4.796	0.13272	0.0:0.6311:0.2121:0.1569	.	66	Q8NFY9	KBTB8_HUMAN	K	40;66;40	ENSP00000295568:N40K;ENSP00000401878:N66K;ENSP00000418075:N40K	ENSP00000295568:N40K	N	+	3	2	KBTBD8	67132276	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.948000	0.56660	2.809000	0.96659	0.467000	0.42956	AAC	-	KBTBD8	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.438	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD8	HGNC	protein_coding	OTTHUMT00000352189.1	0	0	1	131	131	113	0.00	0.88	C	NM_032505		67049586	+1	35	50	58	77	tier1	no_errors	ENST00000417314	ensembl	human	known	74_37	missense	37.63	39.37	SNP	1.000	A	35	58
DNAAF1	123872	genome.wustl.edu	37	16	84203706	84203706	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:84203706G>A	ENST00000378553.5	+	8	1396	c.1272G>A	c.(1270-1272)tcG>tcA	p.S424S	DNAAF1_ENST00000334315.5_Intron|DNAAF1_ENST00000563818.1_3'UTR	NM_178452.4	NP_848547.4	Q8NEP3	DAAF1_HUMAN	dynein, axonemal, assembly factor 1	424	Pro-rich.				axonemal dynein complex assembly (GO:0070286)|cilium morphogenesis (GO:0060271)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|left/right pattern formation (GO:0060972)|lung development (GO:0030324)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|regulation of cilium beat frequency (GO:0003356)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dynein binding (GO:0045502)			NS(1)|endometrium(7)|kidney(1)|large_intestine(6)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(4)|urinary_tract(1)	41						TGCTACTGTCGTCACCTGTGG	0.622													ENSG00000154099																																					0													61.0	64.0	63.0					16																	84203706		2200	4300	6500	SO:0001819	synonymous_variant	0			-	BC024009	CCDS10943.2	16q24.1	2012-05-03	2011-06-09	2011-06-09	ENSG00000154099	ENSG00000154099			30539	protein-coding gene	gene with protein product	"""outer row dynein assembly 7 homolog (Chlamydomonas)"""	613190	"""leucine rich repeat containing 50"""	LRRC50		19944405	Standard	NM_178452		Approved	FLJ25330, ODA7, CILD13	uc002fhl.4	Q8NEP3	OTTHUMG00000128517	ENST00000378553.5:c.1272G>A	16.37:g.84203706G>A			B4DJA3|Q69YI8|Q69YJ0|Q69YW5|Q96LP3|Q96MB6	Silent	SNP	NULL	p.S424	ENST00000378553.5	37	c.1272	CCDS10943.2	16																																																																																			-	DAF1	-	NULL		0.622	DNAAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAF1	HGNC	protein_coding	OTTHUMT00000250328.3	1	1	0	111	111	73	0.89	0.00	G	NM_178452		84203706	+1	11	8	59	54	tier1	no_errors	ENST00000378553	ensembl	human	known	74_37	silent	15.71	12.70	SNP	0.000	A	11	59
PTGER2	5732	genome.wustl.edu	37	14	52794155	52794155	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:52794155A>C	ENST00000245457.5	+	2	1214	c.1060A>C	c.(1060-1062)Aaa>Caa	p.K354Q	PTGER2_ENST00000557436.1_Missense_Mutation_p.K99Q	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	354					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AGATGCCAGTAAACAGGCTGA	0.388													ENSG00000125384																																					0													72.0	69.0	70.0					14																	52794155		2203	4300	6503	SO:0001583	missense	0			-		CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.1060A>C	14.37:g.52794155A>C	ENSP00000245457:p.Lys354Gln		D3DSC0|Q52LG8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.K354Q	ENST00000245457.5	37	c.1060	CCDS9708.1	14	.	.	.	.	.	.	.	.	.	.	A	12.59	1.983739	0.35036	.	.	ENSG00000125384	ENST00000557436;ENST00000245457	T;T	0.37584	1.19;1.19	4.17	4.17	0.49024	.	0.962638	0.08656	N	0.913219	T	0.30262	0.0759	L	0.43152	1.355	0.27051	N	0.96378	P	0.44877	0.845	B	0.39379	0.298	T	0.12889	-1.0530	10	0.41790	T	0.15	-5.4298	7.1891	0.25816	0.8017:0.0:0.0:0.1983	.	354	P43116	PE2R2_HUMAN	Q	99;354	ENSP00000450933:K99Q;ENSP00000245457:K354Q	ENSP00000245457:K354Q	K	+	1	0	PTGER2	51863905	0.482000	0.25948	0.970000	0.41538	0.988000	0.76386	2.621000	0.46418	2.112000	0.64535	0.533000	0.62120	AAA	-	PTGER2	-	NULL		0.388	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	HGNC	protein_coding	OTTHUMT00000276890.1	0	0	0	50	50	104	0.00	0.00	A			52794155	+1	9	24	12	14	tier1	no_errors	ENST00000245457	ensembl	human	known	74_37	missense	42.86	63.16	SNP	0.956	C	9	12
NOBOX	135935	genome.wustl.edu	37	7	144101737	144101737	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:144101737C>A	ENST00000467773.1	-	2	121	c.122G>T	c.(121-123)gGa>gTa	p.G41V	NOBOX_ENST00000483238.1_Missense_Mutation_p.G41V|NOBOX_ENST00000223140.5_5'Flank	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	41					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CCGGTACAGTCCACACACAGG	0.537													ENSG00000106410																																					0													106.0	114.0	111.0					7																	144101737		1977	4159	6136	SO:0001583	missense	0			-			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.122G>T	7.37:g.144101737C>A	ENSP00000419457:p.Gly41Val		A6NCD3|A8MZN5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G41V	ENST00000467773.1	37	c.122		7	.	.	.	.	.	.	.	.	.	.	C	1.108	-0.658954	0.03454	.	.	ENSG00000106410	ENST00000483238;ENST00000467773	D;D	0.95171	-3.62;-3.63	1.37	-2.73	0.05950	.	.	.	.	.	D	0.83050	0.5170	N	0.08118	0	0.09310	N	1	B	0.15930	0.015	B	0.09377	0.004	T	0.64597	-0.6370	9	0.62326	D	0.03	.	0.5262	0.00620	0.1885:0.3134:0.1893:0.3088	.	41	O60393	NOBOX_HUMAN	V	41	ENSP00000419565:G41V;ENSP00000419457:G41V	ENSP00000419457:G41V	G	-	2	0	NOBOX	143732670	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.602000	0.02079	-2.469000	0.00531	-1.407000	0.01130	GGA	-	NOBOX	-	NULL		0.537	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	0	0	0	74	74	102	0.00	0.00	C	XM_001134420		144101737	-1	31	39	60	72	tier1	no_errors	ENST00000467773	ensembl	human	known	74_37	missense	34.07	35.14	SNP	0.000	A	31	60
PLK4	10733	genome.wustl.edu	37	4	128812805	128812805	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:128812805C>T	ENST00000270861.5	+	9	2281	c.2007C>T	c.(2005-2007)aaC>aaT	p.N669N	PLK4_ENST00000513090.1_Silent_p.N637N|PLK4_ENST00000507249.1_Silent_p.N608N|PLK4_ENST00000514379.1_Silent_p.N628N|RNU6-583P_ENST00000516012.1_RNA|PLK4_ENST00000515069.1_Silent_p.N591N	NM_014264.4	NP_055079.3	O00444	PLK4_HUMAN	polo-like kinase 4	669					centriole replication (GO:0007099)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of centriole replication (GO:0046601)|protein phosphorylation (GO:0006468)|trophoblast giant cell differentiation (GO:0060707)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	31						CTACTGACAACATCAGTAGGT	0.318													ENSG00000142731																									Colon(135;508 1718 19061 31832 42879)												0													89.0	97.0	94.0					4																	128812805		2203	4300	6503	SO:0001819	synonymous_variant	0			-	Y13115	CCDS3735.1, CCDS54803.1, CCDS54804.1	4q27-q28	2013-01-18	2010-06-24	2004-01-28	ENSG00000142731	ENSG00000142731			11397	protein-coding gene	gene with protein product		605031	"""serine/threonine kinase 18"", ""polo-like kinase 4 (Drosophila)"""	STK18			Standard	NM_014264		Approved	Sak	uc003ifo.3	O00444	OTTHUMG00000133301	ENST00000270861.5:c.2007C>T	4.37:g.128812805C>T			B2RAL0|B7Z837|B7Z8G7|Q8IYF0|Q96Q95|Q9UD84|Q9UDE2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.N669	ENST00000270861.5	37	c.2007	CCDS3735.1	4																																																																																			-	PLK4	-	NULL		0.318	PLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK4	HGNC	protein_coding	OTTHUMT00000257095.3	0	0	1	260	260	99	0.00	1.00	C			128812805	+1	106	28	155	58	tier1	no_errors	ENST00000270861	ensembl	human	known	74_37	silent	40.61	32.18	SNP	1.000	T	106	155
FLJ36000	284124	genome.wustl.edu	37	17	21911294	21911294	+	lincRNA	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:21911294C>G	ENST00000581223.2	+	0	2019					NR_027084.1																						gtgtgtgtCTCCTATtctctc	0.493													ENSG00000266795																																					0																																												0			-																													17.37:g.21911294C>G				R	SNP	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			-	RP11-744K17.9	-	-		0.493	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	Clone_based_vega_gene	lincRNA	OTTHUMT00000451067.1	0	0	0	11	11	55	0.00	0.00	C			21911294	+1	5	32	4	93	tier1	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	55.56	25.20	SNP	0.089	G	5	4
ZSCAN32	54925	genome.wustl.edu	37	16	3434294	3434294	+	Intron	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:3434294A>C	ENST00000396852.4	-	6	1542				ZSCAN32_ENST00000574940.1_3'UTR|ZSCAN32_ENST00000304926.3_Intron|ZSCAN32_ENST00000439568.2_Intron|ZSCAN32_ENST00000422427.2_3'UTR|NAA60_ENST00000576906.1_3'UTR|ZSCAN32_ENST00000396846.3_Intron	NM_001284527.1|NM_001284529.1	NP_001271456.1|NP_001271458.1	Q9NX65	ZSC32_HUMAN	zinc finger and SCAN domain containing 32						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)										TGTAAAATGCAAGGGGAATAA	0.423													ENSG00000262621																																					0																																										SO:0001627	intron_variant	0			-	AK000424	CCDS10503.1, CCDS66920.1, CCDS66921.1	16p13.3	2013-01-09	2013-01-09	2013-01-09	ENSG00000140987	ENSG00000140987		"""-"", ""Zinc fingers, C2H2-type"""	20812	protein-coding gene	gene with protein product			"""zinc finger protein 434"""	ZNF434			Standard	XM_005255402		Approved	FLJ20417	uc002cux.4	Q9NX65	OTTHUMG00000129357	ENST00000396852.4:c.1234+164T>G	16.37:g.3434294A>C			B4DWL5|C9JB03|Q6WMU8|Q7Z6G2|Q8NFX8|Q9BU74	R	SNP	-	NULL	ENST00000396852.4	37	NULL		16																																																																																			-	A60	-	-		0.423	ZSCAN32-002	KNOWN	basic|appris_principal	protein_coding	A60	Uniprot_gn	protein_coding	OTTHUMT00000251509.2	0	0	0	18	18	115	0.00	0.00	A	NM_017810		3434294	+1	11	45	18	99	tier1	no_errors	ENST00000576906	ensembl	human	known	74_37	rna	37.93	31.25	SNP	0.002	C	11	18
SUPT20H	55578	genome.wustl.edu	37	13	37614582	37614582	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:37614582T>C	ENST00000350612.6	-	9	747	c.527A>G	c.(526-528)gAt>gGt	p.D176G	SUPT20H_ENST00000360252.4_Missense_Mutation_p.D177G|SUPT20H_ENST00000475892.1_Missense_Mutation_p.D176G|SUPT20H_ENST00000542180.1_Missense_Mutation_p.D164G|SUPT20H_ENST00000464744.1_Missense_Mutation_p.D177G|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000356185.3_Missense_Mutation_p.D177G	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	176					autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										TGAATGTACATCACAAATTAA	0.254													ENSG00000102710																																					0													37.0	41.0	40.0					13																	37614582		2196	4290	6486	SO:0001583	missense	0			-	AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.527A>G	13.37:g.37614582T>C	ENSP00000218894:p.Asp176Gly		E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.D176G	ENST00000350612.6	37	c.527	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	T	28.6	4.934359	0.92458	.	.	ENSG00000102710	ENST00000360252;ENST00000475892;ENST00000350612;ENST00000356185;ENST00000536874;ENST00000464744;ENST00000542180;ENST00000497318	T;T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29;0.29	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.80428	0.4621	M	0.88775	2.98	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.996;0.999;1.0;1.0;1.0	D	0.84292	0.0500	10	0.87932	D	0	-21.1557	16.358	0.83243	0.0:0.0:0.0:1.0	.	164;176;176;177;177;176	B4E2D5;B3KNI1;E7ER46;A8K8L1;Q8NEM7-2;Q8NEM7	.;.;.;.;.;FA48A_HUMAN	G	177;176;176;177;176;177;164;177	ENSP00000353388:D177G;ENSP00000417510:D176G;ENSP00000218894:D176G;ENSP00000348512:D177G;ENSP00000419754:D177G;ENSP00000439000:D164G;ENSP00000420170:D177G	ENSP00000218894:D176G	D	-	2	0	FAM48A	36512582	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.985000	0.88162	2.260000	0.74910	0.528000	0.53228	GAT	-	SUPT20H	-	pfam_Spt20		0.254	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SUPT20H	HGNC	protein_coding	OTTHUMT00000354766.1	0	0	0	132	132	65	0.00	0.00	T	NM_017569		37614582	-1	18	21	58	30	tier1	no_errors	ENST00000350612	ensembl	human	known	74_37	missense	23.68	41.18	SNP	1.000	C	18	58
SPTAN1	6709	genome.wustl.edu	37	9	131378035	131378035	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:131378035C>T	ENST00000372731.4	+	40	5368	c.5258C>T	c.(5257-5259)gCg>gTg	p.A1753V	SPTAN1_ENST00000358161.5_Missense_Mutation_p.A1758V|SPTAN1_ENST00000372739.3_Missense_Mutation_p.A1758V	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1753					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AAGAGCATGGCGGCCTCCCGG	0.572													ENSG00000197694																									NSCLC(120;833 1744 2558 35612 37579)												0													82.0	74.0	77.0					9																	131378035		2203	4300	6503	SO:0001583	missense	0			-	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.5258C>T	9.37:g.131378035C>T	ENSP00000361816:p.Ala1753Val		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.A1758V	ENST00000372731.4	37	c.5273	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831452	0.91036	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719;ENST00000372721	T;T;T	0.51574	0.7;0.7;0.7	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.72431	0.3459	M	0.79693	2.465	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.78314	0.883;0.985;0.991	T	0.74624	-0.3603	10	0.66056	D	0.02	.	19.8677	0.96824	0.0:1.0:0.0:0.0	.	1733;1758;1753	Q13813-3;Q13813-2;Q13813	.;.;SPTA2_HUMAN	V	1758;1753;1758;1733;2	ENSP00000350882:A1758V;ENSP00000361816:A1753V;ENSP00000361824:A1758V	ENSP00000350882:A1758V	A	+	2	0	SPTAN1	130417856	1.000000	0.71417	0.964000	0.40570	0.957000	0.61999	7.429000	0.80309	2.709000	0.92574	0.655000	0.94253	GCG	-	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.572	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	0	0	0	49	49	94	0.00	0.00	C	NM_003127		131378035	+1	21	40	42	51	tier1	no_errors	ENST00000358161	ensembl	human	known	74_37	missense	33.33	43.96	SNP	1.000	T	21	42
ATP1A2	477	genome.wustl.edu	37	1	160100061	160100061	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:160100061G>C	ENST00000361216.3	+	12	1720	c.1631G>C	c.(1630-1632)gGa>gCa	p.G544A	ATP1A2_ENST00000392233.3_Missense_Mutation_p.G544A	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	544					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GAGCTGGGGGGACTTGGGGAG	0.617													ENSG00000018625																																					0													57.0	58.0	58.0					1																	160100061		2203	4300	6503	SO:0001583	missense	0			-	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1631G>C	1.37:g.160100061G>C	ENSP00000354490:p.Gly544Ala		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.G544A	ENST00000361216.3	37	c.1631	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.25|18.25	3.583103|3.583103	0.65992|0.65992	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|T;T	.|0.79352	.|-1.26;-1.26	4.61|4.61	4.61|4.61	0.57282|0.57282	.|ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76399|0.76399	0.3982|0.3982	N|N	0.21373|0.21373	0.66|0.66	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.63880	.|0.993;0.992;0.993	.|D;D;D	.|0.71414	.|0.973;0.954;0.973	T|T	0.81618|0.81618	-0.0851|-0.0851	5|10	.|0.87932	.|D	.|0	.|.	16.564|16.564	0.84574|0.84574	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|544;444;544	.|B1AKY9;F5GXJ7;P50993	.|.;.;AT1A2_HUMAN	H|A	255|544;544;247	.|ENSP00000354490:G544A;ENSP00000376066:G544A	.|ENSP00000354490:G544A	D|G	+|+	1|2	0|0	ATP1A2|ATP1A2	158366685|158366685	1.000000|1.000000	0.71417|0.71417	0.870000|0.870000	0.34147|0.34147	0.853000|0.853000	0.48598|0.48598	9.614000|9.614000	0.98353|0.98353	2.283000|2.283000	0.76528|0.76528	0.511000|0.511000	0.50034|0.50034	GAC|GGA	-	ATP1A2	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC		0.617	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2	0	0	0	91	91	37	0.00	0.00	G	NM_000702		160100061	+1	44	17	63	35	tier1	no_errors	ENST00000361216	ensembl	human	known	74_37	missense	40.74	32.69	SNP	1.000	C	44	63
METTL13	51603	genome.wustl.edu	37	1	171755160	171755160	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:171755160C>G	ENST00000361735.3	+	3	1321	c.1055C>G	c.(1054-1056)gCt>gGt	p.A352G	METTL13_ENST00000362019.3_Missense_Mutation_p.A266G|METTL13_ENST00000367737.5_Missense_Mutation_p.A196G|METTL13_ENST00000458517.1_Missense_Mutation_p.A351G	NM_015935.4	NP_057019.3	Q8N6R0	MET13_HUMAN	methyltransferase like 13	352							methyltransferase activity (GO:0008168)			breast(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(8)|lung(17)|stomach(3)	41						CACATCCAAGCTGAGCTGTCG	0.577													ENSG00000010165																																					0													58.0	49.0	52.0					1																	171755160		2203	4300	6503	SO:0001583	missense	0			-	AF132936	CCDS1299.1, CCDS1300.1, CCDS30936.1	1q24-q25.3	2009-02-23	2009-02-23	2009-02-23	ENSG00000010165	ENSG00000010165			24248	protein-coding gene	gene with protein product			"""KIAA0859"""	KIAA0859		10810093, 10048485	Standard	NM_001007239		Approved	CGI-01	uc001ghz.3	Q8N6R0	OTTHUMG00000034912	ENST00000361735.3:c.1055C>G	1.37:g.171755160C>G	ENSP00000354920:p.Ala352Gly		A6NFK0|A8K6S5|O94940|Q53EZ6|Q5TGP9|Q5TGQ0|Q8N2P8|Q96J11|Q96SQ0|Q9Y2Z1|Q9Y3M6	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Spermidine/spermine_synthase	p.A352G	ENST00000361735.3	37	c.1055	CCDS1299.1	1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019075	0.54576	.	.	ENSG00000010165	ENST00000458517;ENST00000362019;ENST00000367737;ENST00000361735	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.36	3.37	0.38596	.	0.425513	0.26321	N	0.025053	T	0.36441	0.0967	L	0.50333	1.59	0.35953	D	0.834052	B;D;P	0.57257	0.048;0.979;0.488	B;P;B	0.56434	0.02;0.798;0.114	T	0.13710	-1.0499	10	0.23891	T	0.37	-29.6773	13.5459	0.61705	0.2809:0.7191:0.0:0.0	.	351;196;352	B4E2X3;Q8N6R0-1;Q8N6R0	.;.;MTL13_HUMAN	G	351;266;196;352	ENSP00000401955:A351G;ENSP00000355393:A266G;ENSP00000356711:A196G;ENSP00000354920:A352G	ENSP00000354920:A352G	A	+	2	0	METTL13	170021783	0.998000	0.40836	0.896000	0.35187	0.917000	0.54804	3.762000	0.55250	1.448000	0.47680	0.561000	0.74099	GCT	-	METTL13	-	NULL		0.577	METTL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL13	HGNC	protein_coding	OTTHUMT00000084528.5	0	0	0	58	58	64	0.00	0.00	C	NM_014955		171755160	+1	15	23	26	34	tier1	no_errors	ENST00000361735	ensembl	human	known	74_37	missense	36.59	40.35	SNP	0.986	G	15	26
LONRF3	79836	genome.wustl.edu	37	X	118124458	118124458	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chrX:118124458A>T	ENST00000371628.3	+	5	1381	c.1350A>T	c.(1348-1350)aaA>aaT	p.K450N	LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000422289.2_Missense_Mutation_p.K194N|LONRF3_ENST00000304778.7_Missense_Mutation_p.K409N	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	450							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						AGGGGGACAAACCTGCTCTCA	0.463													ENSG00000175556																																					0													301.0	197.0	232.0					X																	118124458		2203	4300	6503	SO:0001583	missense	0			-	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1350A>T	X.37:g.118124458A>T	ENSP00000360690:p.Lys450Asn		Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.K450N	ENST00000371628.3	37	c.1350	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.950|3.950	-0.012430|-0.012430	0.07727|0.07727	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;D|.	0.84944|.	-1.48;-1.48;-1.28;-1.92|.	5.3|5.3	-7.84|-7.84	0.01196|0.01196	.|.	0.923976|.	0.09337|.	N|.	0.816066|.	T|T	0.23094|0.23094	0.0558|0.0558	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.09022|.	0.001;0.002;0.001|.	B;B;B|.	0.13407|.	0.002;0.009;0.002|.	T|T	0.30534|0.30534	-0.9975|-0.9975	10|5	0.18710|.	T|.	0.47|.	-3.9896|-3.9896	8.6628|8.6628	0.34103|0.34103	0.1446:0.0976:0.605:0.1528|0.1446:0.0976:0.605:0.1528	.|.	194;409;450|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	N|S	409;409;450;194|216	ENSP00000360691:K409N;ENSP00000307732:K409N;ENSP00000360690:K450N;ENSP00000408894:K194N|.	ENSP00000307732:K409N|.	K|T	+|+	3|1	2|0	LONRF3|LONRF3	118008486|118008486	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.036000|0.036000	0.12997|0.12997	-0.130000|-0.130000	0.10498|0.10498	-1.394000|-1.394000	0.02077|0.02077	0.486000|0.486000	0.48141|0.48141	AAA|ACC	-	LONRF3	-	NULL		0.463	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	HGNC	protein_coding	OTTHUMT00000355124.2	0	0	0	38	38	77	0.00	0.00	A	NM_024778		118124458	+1	7	13	56	102	tier1	no_errors	ENST00000371628	ensembl	human	known	74_37	missense	11.11	11.30	SNP	0.000	T	7	56
NBPF22P	285622	genome.wustl.edu	37	5	85581534	85581534	+	RNA	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:85581534T>A	ENST00000590707.1	+	0	554					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AGGGGACCACTGAGAGTAGAC	0.507													ENSG00000205449																																					0																																												0			-	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85581534T>A				R	SNP	-	NULL	ENST00000590707.1	37	NULL		5																																																																																			-	NBPF22P	-	-		0.507	NBPF22P-004	KNOWN	basic	processed_transcript	NBPF22P	HGNC	pseudogene	OTTHUMT00000453100.1	0	0	0	237	237	13	0.00	0.00	T	XM_208333		85581534	+1	39	4	190	19	tier1	no_errors	ENST00000590707	ensembl	human	known	74_37	rna	17.03	17.39	SNP	0.000	A	39	190
NOBOX	135935	genome.wustl.edu	37	7	144101743	144101743	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:144101743A>G	ENST00000467773.1	-	2	115	c.116T>C	c.(115-117)gTg>gCg	p.V39A	NOBOX_ENST00000483238.1_Missense_Mutation_p.V39A|NOBOX_ENST00000223140.5_5'Flank	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	39					oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					CAGTCCACACACAGGAAATTC	0.517													ENSG00000106410																																					0													107.0	115.0	112.0					7																	144101743		1971	4157	6128	SO:0001583	missense	0			-			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.116T>C	7.37:g.144101743A>G	ENSP00000419457:p.Val39Ala		A6NCD3|A8MZN5	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V39A	ENST00000467773.1	37	c.116		7	.	.	.	.	.	.	.	.	.	.	A	6.825	0.521398	0.13005	.	.	ENSG00000106410	ENST00000483238;ENST00000467773	D;D	0.94497	-3.3;-3.44	2.28	-2.44	0.06502	.	.	.	.	.	D	0.85617	0.5738	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.73300	-0.4026	9	0.87932	D	0	.	4.3668	0.11228	0.5387:0.3295:0.0:0.1318	.	39	O60393	NOBOX_HUMAN	A	39	ENSP00000419565:V39A;ENSP00000419457:V39A	ENSP00000419457:V39A	V	-	2	0	NOBOX	143732676	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.932000	0.01554	-0.655000	0.05387	-1.627000	0.00785	GTG	-	NOBOX	-	NULL		0.517	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	HGNC	protein_coding	OTTHUMT00000350095.1	0	0	0	71	71	104	0.00	0.00	A	XM_001134420		144101743	-1	31	40	64	71	tier1	no_errors	ENST00000467773	ensembl	human	known	74_37	missense	32.63	36.04	SNP	0.000	G	31	64
DNAH7	56171	genome.wustl.edu	37	2	196642547	196642547	+	Missense_Mutation	SNP	A	A	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:196642547A>T	ENST00000312428.6	-	59	11141	c.11041T>A	c.(11041-11043)Tat>Aat	p.Y3681N	DNAH7_ENST00000409063.1_Missense_Mutation_p.Y164N	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3681					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GGAACAAAATAGATGCCACTT	0.378													ENSG00000118997																																					0													118.0	112.0	114.0					2																	196642547		1961	4151	6112	SO:0001583	missense	0			-	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11041T>A	2.37:g.196642547A>T	ENSP00000311273:p.Tyr3681Asn		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.Y3681N	ENST00000312428.6	37	c.11041	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	A	21.1	4.093925	0.76870	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.08370	3.1;3.1	4.98	4.98	0.66077	Dynein heavy chain (1);	1.798840	0.02983	N	0.145827	T	0.53126	0.1777	H	0.98525	4.255	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.41662	-0.9496	10	0.87932	D	0	.	14.4951	0.67680	1.0:0.0:0.0:0.0	.	3681	Q8WXX0	DYH7_HUMAN	N	3681;164	ENSP00000311273:Y3681N;ENSP00000386912:Y164N	ENSP00000311273:Y3681N	Y	-	1	0	DNAH7	196350792	1.000000	0.71417	0.997000	0.53966	0.816000	0.46133	8.590000	0.90821	2.088000	0.63022	0.533000	0.62120	TAT	-	DH7	-	pfam_Dynein_heavy_dom		0.378	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH7	HGNC	protein_coding	OTTHUMT00000335202.3	0	0	0	44	44	76	0.00	0.00	A	NM_018897		196642547	-1	34	52	29	53	tier1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	53.97	49.52	SNP	1.000	T	34	29
MUC12	10071	genome.wustl.edu	37	7	100655696	100655696	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr7:100655696G>A	ENST00000379442.3	+	9	15800	c.15800G>A	c.(15799-15801)aGa>aAa	p.R5267K	RP11-395B7.4_ENST00000448513.1_RNA|RP11-395B7.4_ENST00000441882.1_RNA|MUC12_ENST00000536621.1_Missense_Mutation_p.R5124K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	5267	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AATGAAACTAGAACAACTCTT	0.453													ENSG00000205277																																					0													140.0	118.0	125.0					7																	100655696		692	1591	2283	SO:0001583	missense	0			-	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.15800G>A	7.37:g.100655696G>A	ENSP00000368755:p.Arg5267Lys		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.R5124K	ENST00000379442.3	37	c.15371		7	.	.	.	.	.	.	.	.	.	.	G	4.697	0.129592	0.08981	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.38722	1.12;1.12	2.43	-3.64	0.04515	.	2.114760	0.02970	N	0.144283	T	0.15782	0.0380	N	0.01576	-0.805	0.09310	N	1	.	.	.	.	.	.	T	0.19679	-1.0298	8	0.13108	T	0.6	.	8.3242	0.32147	0.3667:0.0:0.6333:0.0	.	.	.	.	K	5267;5124	ENSP00000368755:R5267K;ENSP00000441929:R5124K	ENSP00000368755:R5267K	R	+	2	0	MUC12	100442416	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.409000	0.02483	-0.821000	0.04312	-1.130000	0.01982	AGA	-	MUC12	-	pfam_SEA_dom		0.453	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	0	0	0	78	78	108	0.00	0.00	G	XM_379904		100655696	+1	19	50	52	55	tier1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	26.76	47.62	SNP	0.000	A	19	52
ABCA4	24	genome.wustl.edu	37	1	94544976	94544976	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:94544976G>A	ENST00000370225.3	-	9	1227	c.1141C>T	c.(1141-1143)Cct>Tct	p.P381S	ABCA4_ENST00000535735.1_Missense_Mutation_p.P381S	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	381					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTGGTTAAAGGATTTGACTCC	0.448													ENSG00000198691																																					0													85.0	82.0	83.0					1																	94544976		2203	4300	6503	SO:0001583	missense	0			-	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.1141C>T	1.37:g.94544976G>A	ENSP00000359245:p.Pro381Ser		O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.P381S	ENST00000370225.3	37	c.1141	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855822	0.51376	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.89617	-2.54;-2.54	5.36	3.46	0.39613	.	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	M	0.77313	2.365	0.53688	D	0.999974	D;B	0.71674	0.998;0.36	D;B	0.74348	0.983;0.143	D	0.90574	0.4524	10	0.56958	D	0.05	.	8.8152	0.34991	0.0699:0.0:0.6631:0.267	.	381;381	F5H6E5;P78363	.;ABCA4_HUMAN	S	381	ENSP00000359245:P381S;ENSP00000437682:P381S	ENSP00000359245:P381S	P	-	1	0	ABCA4	94317564	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.070000	0.71220	0.813000	0.34350	0.561000	0.74099	CCT	-	ABCA4	-	tigrfam_Rim_ABC_transpt		0.448	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	0	0	0	86	86	93	0.00	0.00	G	NM_000350		94544976	-1	38	32	56	67	tier1	no_errors	ENST00000370225	ensembl	human	known	74_37	missense	40.43	32.32	SNP	1.000	A	38	56
CRMP1	1400	genome.wustl.edu	37	4	5857892	5857892	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:5857892C>T	ENST00000397890.2	-	4	670	c.456G>A	c.(454-456)ctG>ctA	p.L152L	CRMP1_ENST00000512574.1_Silent_p.L150L|CRMP1_ENST00000324989.7_Silent_p.L266L|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	152					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCAGCACCTCCAGCTCCTCCC	0.512													ENSG00000072832																																					0													109.0	94.0	99.0					4																	5857892		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.456G>A	4.37:g.5857892C>T			A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.L266	ENST00000397890.2	37	c.798	CCDS43207.1	4																																																																																			-	CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.512	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	0	0	0	62	62	105	0.00	0.00	C	NM_001313		5857892	-1	19	27	37	74	tier1	no_errors	ENST00000324989	ensembl	human	known	74_37	silent	33.93	26.73	SNP	1.000	T	19	37
MYO5B	4645	genome.wustl.edu	37	18	47463703	47463703	+	Missense_Mutation	SNP	T	T	A	rs199813207		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:47463703T>A	ENST00000285039.7	-	15	2116	c.1817A>T	c.(1816-1818)aAg>aTg	p.K606M		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	606	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGATGACCCCTTCCCAGGGGT	0.527													ENSG00000167306																																					0													80.0	79.0	79.0					18																	47463703		1965	4159	6124	SO:0001583	missense	0			-	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1817A>T	18.37:g.47463703T>A	ENSP00000285039:p.Lys606Met		B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K606M	ENST00000285039.7	37	c.1817	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	T	13.54	2.266528	0.40095	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.88124	-2.34	5.01	3.81	0.43845	Myosin head, motor domain (2);	0.542264	0.16677	N	0.204134	D	0.84880	0.5570	L	0.28192	0.835	0.80722	D	1	P;B	0.48834	0.916;0.075	P;B	0.53450	0.726;0.139	T	0.81984	-0.0682	10	0.46703	T	0.11	.	10.0152	0.42010	0.0:0.0829:0.0:0.9171	.	605;606	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	M	606;605	ENSP00000285039:K606M	ENSP00000285039:K606M	K	-	2	0	MYO5B	45717701	1.000000	0.71417	0.391000	0.26233	0.060000	0.15804	3.024000	0.49674	0.726000	0.32339	0.454000	0.30748	AAG	-	MYO5B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.527	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	0	0	0	76	76	85	0.00	0.00	T			47463703	-1	32	30	54	69	tier1	no_errors	ENST00000285039	ensembl	human	known	74_37	missense	37.21	30.30	SNP	1.000	A	32	54
PIGN	23556	genome.wustl.edu	37	18	59739931	59739931	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr18:59739931C>T	ENST00000357637.5	-	30	3062	c.2647G>A	c.(2647-2649)Ggc>Agc	p.G883S	PIGN_ENST00000400334.3_Missense_Mutation_p.G883S	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	883					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				AGCCAGCTGCCATAATCCTTG	0.318													ENSG00000197563																																					0													36.0	37.0	37.0					18																	59739931		1810	4074	5884	SO:0001583	missense	0			-	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2647G>A	18.37:g.59739931C>T	ENSP00000350263:p.Gly883Ser		Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.G883S	ENST00000357637.5	37	c.2647	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	C	33	5.247546	0.95305	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	D;D	0.91237	-2.81;-2.81	5.97	5.97	0.96955	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.115209	0.64402	D	0.000016	D	0.96661	0.8910	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96638	0.9472	10	0.59425	D	0.04	-11.3808	19.2039	0.93722	0.0:1.0:0.0:0.0	.	883;883	B2RCI8;O95427	.;PIGN_HUMAN	S	883	ENSP00000350263:G883S;ENSP00000383188:G883S	ENSP00000350263:G883S	G	-	1	0	PIGN	57890911	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.178000	0.71968	2.833000	0.97629	0.585000	0.79938	GGC	-	PIGN	-	pfam_GPI_EtnP_transferase_1_C		0.318	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	0	0	0	112	112	50	0.00	0.00	C	NM_176787		59739931	-1	29	9	58	47	tier1	no_errors	ENST00000357637	ensembl	human	known	74_37	missense	33.33	16.07	SNP	1.000	T	29	58
PDE5A	8654	genome.wustl.edu	37	4	120549677	120549677	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:120549677G>A	ENST00000354960.3	-	1	469	c.150C>T	c.(148-150)acC>acT	p.T50T	PDE5A_ENST00000264805.5_5'Flank|PDE5A_ENST00000394439.1_5'Flank	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	50					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CTTCTTACCTGGTGGCTTTTC	0.542											OREG0016307	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000138735																																					0													86.0	81.0	83.0					4																	120549677		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.150C>T	4.37:g.120549677G>A		1504	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.T50	ENST00000354960.3	37	c.150	CCDS3713.1	4																																																																																			-	PDE5A	-	NULL		0.542	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	1	1	0	116	116	97	0.85	0.00	G	NM_001083		120549677	-1	35	46	48	79	tier1	no_errors	ENST00000354960	ensembl	human	known	74_37	silent	42.17	36.80	SNP	1.000	A	35	48
ZNF436	80818	genome.wustl.edu	37	1	23695985	23695985	+	5'Flank	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:23695985C>G	ENST00000314011.4	-	0	0				ZNF436_ENST00000374608.3_5'Flank|C1orf213_ENST00000454117.1_Silent_p.V65V|C1orf213_ENST00000335648.3_Silent_p.V65V|C1orf213_ENST00000518821.1_Intron|C1orf213_ENST00000458053.1_Intron|Y_RNA_ENST00000364535.1_RNA|C1orf213_ENST00000437367.2_Silent_p.V65V	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ACGGGCAGGTCCCGGAGGTCT	0.567													ENSG00000249087																																					0													58.0	62.0	61.0					1																	23695985		2203	4300	6503	SO:0001631	upstream_gene_variant	0			-	AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232		1.37:g.23695985C>G	Exception_encountered		Q658I9	Silent	SNP	NULL	p.V65	ENST00000314011.4	37	c.195	CCDS233.1	1																																																																																			-	C1orf213	-	NULL		0.567	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf213	HGNC	protein_coding	OTTHUMT00000008908.1	0	0	0	72	72	65	0.00	0.00	C	NM_030634		23695985	+1	27	27	47	42	tier1	no_errors	ENST00000335648	ensembl	human	known	74_37	silent	36.49	39.13	SNP	0.009	G	27	47
MEDAG	84935	genome.wustl.edu	37	13	31491582	31491582	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:31491582G>T	ENST00000380482.4	+	2	646	c.321G>T	c.(319-321)agG>agT	p.R107S	TEX26-AS1_ENST00000592950.1_RNA|TEX26-AS1_ENST00000590344.1_RNA|TEX26-AS1_ENST00000586464.1_RNA|TEX26-AS1_ENST00000593246.1_RNA|TEX26-AS1_ENST00000588726.1_RNA|TEX26-AS1_ENST00000590721.1_RNA|TEX26-AS1_ENST00000586973.1_RNA|TEX26-AS1_ENST00000451495.2_RNA|TEX26-AS1_ENST00000585870.1_RNA	NM_032849.3	NP_116238	Q5VYS4	MEDAG_HUMAN	mesenteric estrogen-dependent adipogenesis	107					positive regulation of fat cell differentiation (GO:0045600)	cytoplasm (GO:0005737)											AAGACTACAGGGAAACTATAT	0.348													ENSG00000102802																																					0													140.0	137.0	138.0					13																	31491582		2203	4300	6503	SO:0001583	missense	0			-	AB055407	CCDS9338.1	13q12.3	2013-10-11	2012-09-26	2012-09-26	ENSG00000102802	ENSG00000102802			25926	protein-coding gene	gene with protein product	"""mesenteric estrogen-dependent adipose 4"", ""activated in W/Wv mouse stomach 3 homolog"""		"""chromosome 13 open reading frame 33"""	C13orf33		22510272	Standard	NM_032849		Approved	FLJ14834, AWMS3, MEDA-4	uc001uth.4	Q5VYS4	OTTHUMG00000016679	ENST00000380482.4:c.321G>T	13.37:g.31491582G>T	ENSP00000369849:p.Arg107Ser		Q8IXF1|Q96K26|Q96NC8	Missense_Mutation	SNP	NULL	p.R107S	ENST00000380482.4	37	c.321	CCDS9338.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.10|18.10	3.549304|3.549304	0.65311|0.65311	.|.	.|.	ENSG00000102802|ENSG00000102802	ENST00000428944|ENST00000380482	.|T	.|0.58060	.|0.36	5.56|5.56	4.58|4.58	0.56647|0.56647	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57607|0.57607	0.2065|0.2065	L|L	0.32530|0.32530	0.975|0.975	0.34415|0.34415	D|D	0.6968|0.6968	.|D	.|0.61080	.|0.989	.|D	.|0.75020	.|0.985	T|T	0.68135|0.68135	-0.5489|-0.5489	5|10	.|0.72032	.|D	.|0.01	-11.8896|-11.8896	7.2181|7.2181	0.25971|0.25971	0.2324:0.0:0.7676:0.0|0.2324:0.0:0.7676:0.0	.|.	.|107	.|Q5VYS4	.|CM033_HUMAN	V|S	44|107	.|ENSP00000369849:R107S	.|ENSP00000369849:R107S	G|R	+|+	2|3	0|2	C13orf33|C13orf33	30389582|30389582	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.956000|0.956000	0.61745|0.61745	2.485000|2.485000	0.45250|0.45250	1.095000|1.095000	0.41419|0.41419	0.563000|0.563000	0.77884|0.77884	GGG|AGG	-	MEDAG	-	NULL		0.348	MEDAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEDAG	HGNC	protein_coding	OTTHUMT00000044375.1	0	0	0	89	89	121	0.00	0.00	G	NM_032849		31491582	+1	18	44	30	37	tier1	no_errors	ENST00000380482	ensembl	human	known	74_37	missense	37.50	54.32	SNP	1.000	T	18	30
CRMP1	1400	genome.wustl.edu	37	4	5857870	5857870	+	Splice_Site	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:5857870C>G	ENST00000397890.2	-	4	692	c.478G>C	c.(478-480)Ggc>Cgc	p.G160R	CRMP1_ENST00000512574.1_Splice_Site_p.G158R|CRMP1_ENST00000324989.7_Splice_Site_p.G274R|CRMP1_ENST00000511535.1_5'UTR	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	160					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TTTAACTGACCTTTGTCCTGC	0.512													ENSG00000072832																																					0													100.0	87.0	91.0					4																	5857870		2203	4300	6503	SO:0001630	splice_region_variant	0			-	D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.478+1G>C	4.37:g.5857870C>G			A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.G274R	ENST00000397890.2	37	c.820	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	c	19.91	3.913958	0.72983	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	D;D;D	0.94650	-3.48;-3.48;-3.48	3.09	3.09	0.35607	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.119994	0.56097	D	0.000027	D	0.98172	0.9396	H	0.97983	4.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98860	1.0762	9	.	.	.	-14.7024	13.358	0.60640	0.0:1.0:0.0:0.0	.	274;158;160;97	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	R	274;160;160;158	ENSP00000321606:G274R;ENSP00000380987:G160R;ENSP00000425742:G158R	.	G	-	1	0	CRMP1	5908771	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	7.118000	0.77137	1.577000	0.49804	0.537000	0.68136	GGC	-	CRMP1	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.512	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	0	0	0	57	57	103	0.00	0.00	C	NM_001313	Missense_Mutation	5857870	-1	19	32	34	79	tier1	no_errors	ENST00000324989	ensembl	human	known	74_37	missense	35.85	28.83	SNP	1.000	G	19	34
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y|TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M							132.0	103.0	113.0					17																	7577568		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_D-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_D-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	-	TP53	-	pfam_p53_D-bd,superfamily_p53-like_TF_D-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	0	0	0	52	52	83	0.00	0.00	C	NM_000546		7577568	-1	11	18	15	14	tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	42.31	56.25	SNP	1.000	T	11	15
C9orf3	84909	genome.wustl.edu	37	9	97522564	97522564	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:97522564C>T	ENST00000375315.2	+	1	499	c.499C>T	c.(499-501)Ctg>Ttg	p.L167L	C9orf3_ENST00000277198.2_Silent_p.L167L|C9orf3_ENST00000297979.5_Silent_p.L167L	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	167					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		TGTGCCAGGTCTGGAAAAATT	0.458													ENSG00000148120																																					0													138.0	136.0	137.0					9																	97522564		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.499C>T	9.37:g.97522564C>T			Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Silent	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.L167	ENST00000375315.2	37	c.499	CCDS55328.1	9																																																																																			-	C9orf3	-	NULL		0.458	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		0	0	0	73	73	113	0.00	0.00	C	NM_032823		97522564	+1	25	57	32	78	tier1	no_errors	ENST00000375315	ensembl	human	known	74_37	silent	43.86	42.22	SNP	0.998	T	25	32
NRXN1	9378	genome.wustl.edu	37	2	50280726	50280726	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:50280726G>A	ENST00000406316.2	-	20	5197	c.3721C>T	c.(3721-3723)Cgt>Tgt	p.R1241C	NRXN1_ENST00000405472.3_Missense_Mutation_p.R1263C|NRXN1_ENST00000404971.1_Missense_Mutation_p.R1311C|NRXN1_ENST00000402717.3_Missense_Mutation_p.R1263C|NRXN1_ENST00000406859.3_Missense_Mutation_p.R1241C|NRXN1_ENST00000401669.2_Missense_Mutation_p.R1271C|NRXN1_ENST00000342183.5_Missense_Mutation_p.R206C|NRXN1_ENST00000401710.1_Missense_Mutation_p.R259C	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1241	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			GTGAGCTGACGCCCTGTAAAA	0.413													ENSG00000179915																																					0													56.0	58.0	57.0					2																	50280726		2203	4300	6503	SO:0001583	missense	0			-	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3721C>T	2.37:g.50280726G>A	ENSP00000384311:p.Arg1241Cys		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.R1263C	ENST00000406316.2	37	c.3787	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489993	0.64074	.	.	ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T;T;T	0.79352	0.91;-1.17;-1.26;-1.17;-1.26;-1.26;-1.26;-1.17	5.65	5.65	0.86999	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.52532	U	0.000077	D	0.90431	0.7004	M	0.88310	2.945	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.993;0.997	P;D;P;P	0.79784	0.803;0.993;0.808;0.802	D	0.91626	0.5315	10	0.87932	D	0	.	19.7195	0.96136	0.0:0.0:1.0:0.0	.	1311;206;1241;1263	Q9ULB1-3;P58400;F8WB18;A7E294	.;NRX1B_HUMAN;.;.	C	206;160;259;1311;1241;1263;1271;1312;1263;1241	ENSP00000341184:R206C;ENSP00000385580:R259C;ENSP00000385142:R1311C;ENSP00000384311:R1241C;ENSP00000434015:R1263C;ENSP00000385017:R1271C;ENSP00000385434:R1263C;ENSP00000385681:R1241C	ENSP00000341184:R206C	R	-	1	0	NRXN1	50134230	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.663000	0.90544	0.655000	0.94253	CGT	-	NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.413	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	0	0	0	50	50	55	0.00	0.00	G			50280726	-1	14	23	20	30	tier1	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	41.18	43.40	SNP	1.000	A	14	20
KIAA2012	100652824	genome.wustl.edu	37	2	202965106	202965106	+	Silent	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:202965106C>T	ENST00000541917.1	+	7	1462	c.1089C>T	c.(1087-1089)ctC>ctT	p.L363L	AC079354.1_ENST00000409515.3_3'UTR|AC079354.1_ENST00000295844.3_Silent_p.L419L																							AAAGAAGCCTCTTCCCTCCTG	0.453													ENSG00000182329																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000541917.1:c.1089C>T	2.37:g.202965106C>T				Silent	SNP	NULL	p.L363	ENST00000541917.1	37	c.1089		2																																																																																			-	AC079354.1	-	NULL		0.453	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	Clone_based_vega_gene	protein_coding		0	0	0	24	24	60	0.00	0.00	C			202965106	+1	16	43	13	40	tier1	no_errors	ENST00000541917	ensembl	human	known	74_37	silent	55.17	51.81	SNP	0.516	T	16	13
PTPRQ	374462	genome.wustl.edu	37	12	81015850	81015850	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:81015850A>G	ENST00000266688.5	+	38	5611	c.5611A>G	c.(5611-5613)Aga>Gga	p.R1871G				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1917					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						ATTTAAATTTAGAGCTACAAA	0.239													ENSG00000139304																																					0													47.0	44.0	45.0					12																	81015850		687	1535	2222	SO:0001583	missense	0			-	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5611A>G	12.37:g.81015850A>G	ENSP00000266688:p.Arg1871Gly			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1871G	ENST00000266688.5	37	c.5611		12	.	.	.	.	.	.	.	.	.	.	A	16.49	3.137743	0.56936	.	.	ENSG00000139304	ENST00000266688	T	0.58210	0.35	4.81	3.68	0.42216	.	.	.	.	.	T	0.69708	0.3141	.	.	.	0.49051	D	0.999749	D	0.89917	1.0	D	0.73708	0.981	T	0.71108	-0.4688	8	0.59425	D	0.04	.	10.8445	0.46735	0.6535:0.3465:0.0:0.0	.	1917	Q9UMZ3	PTPRQ_HUMAN	G	1871	ENSP00000266688:R1871G	ENSP00000266688:R1871G	R	+	1	2	PTPRQ	79539981	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.151000	0.42263	0.812000	0.34326	0.482000	0.46254	AGA	-	PTPRQ	-	NULL		0.239	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		0	0	0	81	81	56	0.00	0.00	A	NM_001145026		81015850	+1	12	32	44	43	tier1	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	21.43	42.67	SNP	1.000	G	12	44
POLE	5426	genome.wustl.edu	37	12	133252732	133252732	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr12:133252732G>C	ENST00000320574.5	-	10	1011	c.968C>G	c.(967-969)aCc>aGc	p.T323S	POLE_ENST00000535270.1_Missense_Mutation_p.T296S	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	323					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TGGCTTGGGGGTGAACTCAAA	0.468								DNA polymerases (catalytic subunits)					ENSG00000177084																																					0													93.0	95.0	95.0					12																	133252732		2203	4300	6503	SO:0001583	missense	0			-		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.968C>G	12.37:g.133252732G>C	ENSP00000322570:p.Thr323Ser		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_D_pol_e_suA_C,pfam_D-dir_D_pol_B_exonuc,pfam_D-dir_D_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_D-dir_D_pol_B	p.T323S	ENST00000320574.5	37	c.968	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002679	0.93227	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577	T;T;T;T	0.13089	2.62;2.62;2.62;2.62	5.81	5.81	0.92471	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	M	0.61703	1.905	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.72982	0.979;0.951	T	0.01940	-1.1243	10	0.59425	D	0.04	.	20.0804	0.97772	0.0:0.0:1.0:0.0	.	296;323	F5H1D6;Q07864	.;DPOE1_HUMAN	S	323;334;296;103;258	ENSP00000322570:T323S;ENSP00000406383:T334S;ENSP00000445753:T296S;ENSP00000442519:T103S	ENSP00000322570:T323S	T	-	2	0	POLE	131762805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.762000	0.98944	2.738000	0.93877	0.655000	0.94253	ACC	-	POLE	-	pfam_D-dir_D_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_D-dir_D_pol_B		0.468	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	0	0	0	67	67	152	0.00	0.00	G	NM_006231		133252732	-1	20	39	36	96	tier1	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	35.71	28.26	SNP	1.000	C	20	36
STK10	6793	genome.wustl.edu	37	5	171583763	171583763	+	Silent	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:171583763A>G	ENST00000176763.5	-	2	529	c.186T>C	c.(184-186)gcT>gcC	p.A62A		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	62	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.			A -> V (in Ref. 5; AAH70077). {ECO:0000305}.	cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTTGGCCGCAGCCAAAGCAC	0.552													ENSG00000072786																																					0													162.0	126.0	138.0					5																	171583763		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.186T>C	5.37:g.171583763A>G			A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Silent	SNP	pfam_PKK,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A62	ENST00000176763.5	37	c.186	CCDS34290.1	5																																																																																			-	STK10	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.552	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	0	0	0	33	33	54	0.00	0.00	A	NM_005990		171583763	-1	10	33	4	20	tier1	no_errors	ENST00000176763	ensembl	human	known	74_37	silent	71.43	62.26	SNP	0.024	G	10	4
FNBP4	23360	genome.wustl.edu	37	11	47776104	47776104	+	Silent	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:47776104A>G	ENST00000263773.5	-	3	438	c.426T>C	c.(424-426)gaT>gaC	p.D142D	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	142						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						CCAATGTACTATCAATATCAG	0.423													ENSG00000109920																																					0													272.0	267.0	268.0					11																	47776104		2030	4173	6203	SO:0001819	synonymous_variant	0			-	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.426T>C	11.37:g.47776104A>G			Q9H985|Q9NT81|Q9Y2L7	Silent	SNP	pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.D142	ENST00000263773.5	37	c.426	CCDS41644.1	11																																																																																			-	FNBP4	-	NULL		0.423	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNBP4	HGNC	protein_coding	OTTHUMT00000390237.3	0	0	0	87	87	132	0.00	0.00	A			47776104	-1	26	60	36	98	tier1	no_errors	ENST00000263773	ensembl	human	known	74_37	silent	41.94	37.97	SNP	0.998	G	26	36
CTNNA2	1496	genome.wustl.edu	37	2	80101392	80101392	+	Missense_Mutation	SNP	A	A	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A	A	C	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr2:80101392A>C	ENST00000402739.4	+	5	781	c.776A>C	c.(775-777)cAa>cCa	p.Q259P	CTNNA2_ENST00000361291.4_Missense_Mutation_p.Q293P|CTNNA2_ENST00000540488.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000541047.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000496558.1_Missense_Mutation_p.Q259P|CTNNA2_ENST00000466387.1_Missense_Mutation_p.Q259P	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	259					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						AATGCTGCTCAAGCTACCTCG	0.577													ENSG00000066032																																					0													45.0	49.0	48.0					2																	80101392		2073	4204	6277	SO:0001583	missense	0			-		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.776A>C	2.37:g.80101392A>C	ENSP00000384638:p.Gln259Pro		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.Q293P	ENST00000402739.4	37	c.878		2	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719406	0.89205	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.72211	0.3432	M	0.86502	2.82	0.80722	D	1	D;D;D	0.61697	0.985;0.99;0.99	D;D;D	0.66716	0.946;0.939;0.939	T	0.77613	-0.2522	10	0.66056	D	0.02	.	15.9971	0.80260	1.0:0.0:0.0:0.0	.	259;259;259	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	P	259;259;293;259;259;259	ENSP00000418191:Q259P;ENSP00000419295:Q259P;ENSP00000355398:Q293P;ENSP00000384638:Q259P;ENSP00000444675:Q259P;ENSP00000441705:Q259P	ENSP00000355398:Q293P	Q	+	2	0	CTNNA2	79954900	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.175000	0.68902	0.528000	0.53228	CAA	-	CTN2	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.577	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTN2	HGNC	protein_coding	OTTHUMT00000328511.4	0	0	0	74	74	45	0.00	0.00	A	NM_004389		80101392	+1	29	24	28	28	tier1	no_errors	ENST00000361291	ensembl	human	known	74_37	missense	50.88	46.15	SNP	1.000	C	29	28
EFTUD1	79631	genome.wustl.edu	37	15	82450161	82450161	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:82450161G>A	ENST00000268206.7	-	17	2091	c.1923C>T	c.(1921-1923)aaC>aaT	p.N641N	EFTUD1_ENST00000359445.3_Silent_p.N590N	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	641					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						GATCAGCCTGGTTTAACAGTT	0.398													ENSG00000140598																																					0													111.0	106.0	107.0					15																	82450161		1884	4105	5989	SO:0001819	synonymous_variant	0			-	AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1923C>T	15.37:g.82450161G>A			A6NKY5|B7Z6I0|Q9H8Z6	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_EFG_V,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_EFG_III-V,superfamily_Transl_B-barrel,smart_EFG_V,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.N641	ENST00000268206.7	37	c.1923	CCDS42071.1	15																																																																																			-	EFTUD1	-	superfamily_EFG_III-V		0.398	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	0	0	0	81	81	109	0.00	0.00	G	NM_024580		82450161	-1	28	33	94	76	tier1	no_errors	ENST00000268206	ensembl	human	known	74_37	silent	22.95	30.28	SNP	1.000	A	28	94
IFNL1	282618	genome.wustl.edu	37	19	39789057	39789057	+	Silent	SNP	T	T	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:39789057T>A	ENST00000333625.2	+	5	601	c.504T>A	c.(502-504)tcT>tcA	p.S168S		NM_172140.1	NP_742152.1	Q8IU54	IFNL1_HUMAN	interferon, lambda 1	168					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of cell proliferation (GO:0008285)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of memory T cell differentiation (GO:0043381)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of immune response (GO:0050778)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-28 receptor complex (GO:0032002)	interleukin-28 receptor binding (GO:0032003)|receptor binding (GO:0005102)										TGGAGGCATCTGTCACCTTCA	0.617													ENSG00000182393																																					0													108.0	107.0	107.0					19																	39789057		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AY129150	CCDS12531.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000182393	ENSG00000182393		"""Interferons"""	18363	protein-coding gene	gene with protein product		607403	"""interleukin 29"", ""interleukin 29 (interferon, lambda 1)"""	IL29			Standard	NM_172140		Approved	IL-29	uc002okv.3	Q8IU54		ENST00000333625.2:c.504T>A	19.37:g.39789057T>A			A0AV25|Q17R34	Silent	SNP	NULL	p.S168	ENST00000333625.2	37	c.504	CCDS12531.1	19																																																																																			-	IFNL1	-	NULL		0.617	IFNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNL1	HGNC	protein_coding	OTTHUMT00000463834.1	0	0	0	158	158	71	0.00	0.00	T	NM_172140		39789057	+1	51	19	54	36	tier1	no_errors	ENST00000333625	ensembl	human	known	74_37	silent	47.66	34.55	SNP	0.881	A	51	54
PTGER2	5732	genome.wustl.edu	37	14	52794162	52794166	+	Frame_Shift_Del	DEL	CTGAC	CTGAC	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	CTGAC	CTGAC	CTGAC	-	CTGAC	CTGAC	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr14:52794162_52794166delCTGAC	ENST00000245457.5	+	2	1221_1225	c.1067_1071delCTGAC	c.(1066-1071)gctgacfs	p.AD356fs	PTGER2_ENST00000557436.1_Frame_Shift_Del_p.AD101fs	NM_000956.3	NP_000947.2	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	356					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cellular response to prostaglandin E stimulus (GO:0071380)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cell proliferation (GO:0042127)|response to lipopolysaccharide (GO:0032496)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin E receptor activity (GO:0004957)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Dinoprostone(DB00917)|Misoprostol(DB00929)	AGTAAACAGGCTGACCTTTGAGGTC	0.376													ENSG00000125384																																					0																																										SO:0001589	frameshift_variant	0					CCDS9708.1	14q22	2012-08-08	2002-08-29		ENSG00000125384	ENSG00000125384		"""GPCR / Class A : Prostanoid receptors"""	9594	protein-coding gene	gene with protein product		176804	"""prostaglandin E receptor 2 (subtype EP2), 53kD"""			8250933, 7759114	Standard	NM_000956		Approved	EP2	uc001wzr.3	P43116	OTTHUMG00000140300	ENST00000245457.5:c.1067_1071delCTGAC	14.37:g.52794162_52794166delCTGAC	ENSP00000245457:p.Ala356fs		D3DSC0|Q52LG8	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP2_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.D357fs	ENST00000245457.5	37	c.1067_1071	CCDS9708.1	14																																																																																				PTGER2	-	NULL		0.376	PTGER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGER2	HGNC	protein_coding	OTTHUMT00000276890.1	0	0	0	103	103	103	0.00	0.00	CTGAC			52794166	+1	22	22	15	15	tier1	no_errors	ENST00000245457	ensembl	human	known	74_37	frame_shift_del	59.46	59.46	DEL	0.018:0.888:0.956:0.966:0.958	-	22	15
COL22A1	169044	genome.wustl.edu	37	8	139767724	139767724	+	Splice_Site	DEL	C	C	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	-	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr8:139767724delC	ENST00000303045.6	-	20	2424		c.e20+1		COL22A1_ENST00000435777.1_Splice_Site	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTGCCTCTTACCTGTTCCCCT	0.507										HNSCC(7;0.00092)			ENSG00000169436																																					0													350.0	305.0	320.0					8																	139767724		2203	4300	6503	SO:0001630	splice_region_variant	0				AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1977+1G>-	8.37:g.139767724delC			B7ZMH0|C9K0G4|Q8IVT9	Splice_Site	DEL	-	e19+1	ENST00000303045.6	37	c.1977+1	CCDS6376.1	8																																																																																				COL22A1	-	-		0.507	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	0	0	0	89	89	92	0.00	0.00	C	XM_291257	Intron	139767724	-1	19	33	56	56	tier1	no_errors	ENST00000303045	ensembl	human	known	74_37	splice_site_del	25.33	37.08	DEL	1.000	-	19	56
BAHCC1	57597	genome.wustl.edu	37	17	79411747	79411747	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:79411747G>A	ENST00000307745.7	+	12	2566	c.2566G>A	c.(2566-2568)Gtg>Atg	p.V856M																								CCCCGCCTCCGTGGCTGGCCC	0.726													ENSG00000171282																																					0													28.0	36.0	34.0					17																	79411747		1998	4149	6147	SO:0001583	missense	0			-																												ENST00000307745.7:c.2566G>A	17.37:g.79411747G>A	ENSP00000303486:p.Val856Met			Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.V856M	ENST00000307745.7	37	c.2566		17	.	.	.	.	.	.	.	.	.	.	G	5.074	0.199331	0.09652	.	.	ENSG00000171282	ENST00000307745	T	0.54279	0.58	4.63	3.58	0.41010	.	0.492500	0.16564	N	0.208921	T	0.23688	0.0573	N	0.11724	0.165	0.35090	D	0.764245	B;P	0.38729	0.269;0.644	B;B	0.26693	0.019;0.072	T	0.21586	-1.0241	10	0.32370	T	0.25	.	3.9825	0.09501	0.3243:0.0:0.6757:0.0	.	856;856	Q9P281;F8WBW8	BAHC1_HUMAN;.	M	856	ENSP00000303486:V856M	ENSP00000303486:V856M	V	+	1	0	AC110285.1	77026342	1.000000	0.71417	0.937000	0.37676	0.109000	0.19521	5.566000	0.67372	2.381000	0.81170	0.491000	0.48974	GTG	-	RP11-1055B8.7	-	NULL		0.726	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	Clone_based_vega_gene	protein_coding		0	0	0	13	13	17	0.00	0.00	G			79411747	+1	6	6	5	8	tier1	no_errors	ENST00000307745	ensembl	human	known	74_37	missense	54.55	42.86	SNP	0.993	A	6	5
BRSK2	9024	genome.wustl.edu	37	11	1467009	1467009	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr11:1467009C>G	ENST00000528841.1	+	12	1482	c.1098C>G	c.(1096-1098)gaC>gaG	p.D366E	BRSK2_ENST00000531197.1_Missense_Mutation_p.D366E|BRSK2_ENST00000544817.1_Missense_Mutation_p.D61E|BRSK2_ENST00000308230.5_Missense_Mutation_p.D366E|BRSK2_ENST00000526678.1_Missense_Mutation_p.D366E|BRSK2_ENST00000308219.9_Missense_Mutation_p.D366E|BRSK2_ENST00000382179.1_Missense_Mutation_p.D412E|BRSK2_ENST00000528710.1_Missense_Mutation_p.D306E			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	366					actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGCGTGTGGACTCCCCGATGC	0.716													ENSG00000174672																																					0													37.0	48.0	44.0					11																	1467009		2127	4251	6378	SO:0001583	missense	0			-	AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.1098C>G	11.37:g.1467009C>G	ENSP00000432000:p.Asp366Glu		B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D412E	ENST00000528841.1	37	c.1236	CCDS58107.1	11	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498469	0.85069	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179;ENST00000544817	T;T;T;T;T;T;T;T	0.73152	-0.7;-0.69;-0.7;-0.72;-0.7;1.91;-0.55;-0.42	4.18	3.25	0.37280	Protein kinase-like domain (1);	0.000000	0.85682	U	0.000000	D	0.82719	0.5098	M	0.84326	2.69	0.50313	D	0.999867	D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.99;0.999;0.999;1.0	T	0.83078	-0.0139	10	0.59425	D	0.04	.	9.8543	0.41077	0.0:0.8291:0.0:0.1709	.	366;412;366;366;366	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	E	366;366;366;366;366;306;412;61	ENSP00000310697:D366E;ENSP00000431152:D366E;ENSP00000310805:D366E;ENSP00000432000:D366E;ENSP00000433370:D366E;ENSP00000433235:D306E;ENSP00000371614:D412E;ENSP00000445168:D61E	ENSP00000310697:D366E	D	+	3	2	BRSK2	1423585	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.707000	0.54838	0.956000	0.37904	0.462000	0.41574	GAC	-	BRSK2	-	superfamily_Kinase-like_dom		0.716	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRSK2	HGNC	protein_coding	OTTHUMT00000393033.1	0	0	0	85	85	18	0.00	0.00	C	NM_003957		1467009	+1	43	6	79	4	tier1	no_errors	ENST00000382179	ensembl	human	known	74_37	missense	35.25	60.00	SNP	1.000	G	43	79
FAM53A	152877	genome.wustl.edu	37	4	1670402	1670402	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr4:1670402C>T	ENST00000308132.6	-	2	259	c.67G>A	c.(67-69)Gct>Act	p.A23T	FAM53A_ENST00000461064.1_Missense_Mutation_p.A23T|FAM53A_ENST00000489363.1_Missense_Mutation_p.A23T|FAM53A_ENST00000472884.2_Missense_Mutation_p.A23T	NM_001174070.1	NP_001167541.1	Q6NSI3	FA53A_HUMAN	family with sequence similarity 53, member A	23						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			ACCGGGCCAGCCTCCGCCTTG	0.657													ENSG00000174137																																					0													75.0	67.0	70.0					4																	1670402		2203	4300	6503	SO:0001583	missense	0			-	BC070112	CCDS33939.1, CCDS75091.1	4p16.3	2005-08-09			ENSG00000174137	ENSG00000174137			31860	protein-coding gene	gene with protein product							Standard	NM_001013622		Approved	DNTNP	uc021xkl.1	Q6NSI3	OTTHUMG00000159855	ENST00000308132.6:c.67G>A	4.37:g.1670402C>T	ENSP00000310057:p.Ala23Thr		Q6ZUL5	Missense_Mutation	SNP	NULL	p.A23T	ENST00000308132.6	37	c.67	CCDS33939.1	4	.	.	.	.	.	.	.	.	.	.	C	11.80	1.745920	0.30955	.	.	ENSG00000174137	ENST00000308132;ENST00000489363;ENST00000461064;ENST00000472884;ENST00000463238	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	3.97	2.8	0.32819	.	0.920676	0.08943	U	0.871313	T	0.49321	0.1550	L	0.54323	1.7	0.24983	N	0.991581	D;D	0.65815	0.995;0.993	P;D	0.63033	0.894;0.91	T	0.41520	-0.9504	10	0.17832	T	0.49	-1.7239	4.0168	0.09647	0.0:0.714:0.0:0.286	.	23;23	Q6NSI3;C9JYQ7	FA53A_HUMAN;.	T	23	ENSP00000310057:A23T;ENSP00000419044:A23T;ENSP00000418243:A23T;ENSP00000426260:A23T;ENSP00000417615:A23T	ENSP00000310057:A23T	A	-	1	0	FAM53A	1640200	0.455000	0.25736	0.937000	0.37676	0.154000	0.21943	0.547000	0.23299	1.932000	0.55993	0.462000	0.41574	GCT	-	FAM53A	-	NULL		0.657	FAM53A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM53A	HGNC	protein_coding	OTTHUMT00000359224.1	0	0	0	47	47	11	0.00	0.00	C	NM_001013622		1670402	-1	22	5	20	7	tier1	no_errors	ENST00000308132	ensembl	human	known	74_37	missense	52.38	41.67	SNP	0.946	T	22	20
HID1	283987	genome.wustl.edu	37	17	72950352	72950352	+	Missense_Mutation	SNP	C	C	T	rs566625537		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr17:72950352C>T	ENST00000425042.2	-	14	1822	c.1745G>A	c.(1744-1746)cGg>cAg	p.R582Q		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	582					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											AGGTGTCCGCCGGCGCCGCTG	0.692													ENSG00000167861	C|||	1	0.000199681	0.0	0.0	5008	,	,		15282	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	0			-		CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.1745G>A	17.37:g.72950352C>T	ENSP00000413520:p.Arg582Gln		Q8N5L6|Q8TE83|Q9NT34	Missense_Mutation	SNP	pfam_Dymeclin	p.R582Q	ENST00000425042.2	37	c.1745	CCDS32726.1	17	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175750	0.38413	.	.	ENSG00000167861	ENST00000525426;ENST00000425042;ENST00000318565	.	.	.	4.47	4.47	0.54385	.	0.160773	0.52532	D	0.000078	T	0.33323	0.0859	N	0.20401	0.57	0.45035	D	0.998053	B	0.16603	0.018	B	0.20184	0.028	T	0.17289	-1.0374	9	0.34782	T	0.22	-25.6466	5.8677	0.18786	0.0:0.7421:0.0:0.2579	.	582	Q8IV36	CQ028_HUMAN	Q	354;582;354	.	ENSP00000317795:R354Q	R	-	2	0	C17orf28	70461947	1.000000	0.71417	0.896000	0.35187	0.361000	0.29550	3.589000	0.53972	2.026000	0.59711	0.561000	0.74099	CGG	-	HID1	-	NULL		0.692	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HID1	HGNC	protein_coding	OTTHUMT00000390011.2	0	0	0	50	50	7	0.00	0.00	C	NM_030630		72950352	-1	35	4	32	0	tier1	no_errors	ENST00000425042	ensembl	human	known	74_37	missense	52.24	100.00	SNP	0.927	T	35	32
HTR6	3362	genome.wustl.edu	37	1	19992517	19992517	+	Missense_Mutation	SNP	C	C	T	rs201177761		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:19992517C>T	ENST00000289753.1	+	1	738	c.271C>T	c.(271-273)Cgc>Tgc	p.R91C		NM_000871.1	NP_000862.1	P50406	5HT6R_HUMAN	5-hydroxytryptamine (serotonin) receptor 6, G protein-coupled	91					brain development (GO:0007420)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|long-term synaptic potentiation (GO:0060291)|negative regulation of acetylcholine secretion, neurotransmission (GO:0014058)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|synaptic transmission (GO:0007268)	cilium (GO:0005929)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)|serotonin receptor activity (GO:0004993)			endometrium(1)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.81e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.00117)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Asenapine(DB06216)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Iloperidone(DB04946)|Imipramine(DB00458)|Loxapine(DB00408)|Mianserin(DB06148)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Quetiapine(DB01224)|Sertindole(DB06144)|Ziprasidone(DB00246)	GCTGTACGGGCGCTGGGTGCT	0.657													ENSG00000158748																									Esophageal Squamous(168;1879 2619 6848 21062)												0													44.0	43.0	43.0					1																	19992517		2202	4298	6500	SO:0001583	missense	0			-	L41147	CCDS197.1	1p36-p35	2012-08-08	2012-02-03		ENSG00000158748	ENSG00000158748		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5301	protein-coding gene	gene with protein product		601109	"""5-hydroxytryptamine (serotonin) receptor 6"""			8522988	Standard	NM_000871		Approved	5-HT6, 5-HT6R	uc001bcl.3	P50406	OTTHUMG00000002713	ENST00000289753.1:c.271C>T	1.37:g.19992517C>T	ENSP00000289753:p.Arg91Cys		Q13640|Q5TGZ1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT6_rcpt,prints_GPCR_Rhodpsn	p.R91C	ENST00000289753.1	37	c.271	CCDS197.1	1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584345	0.65992	.	.	ENSG00000158748	ENST00000289753	T	0.73258	-0.73	4.17	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.253351	0.41001	D	0.000970	T	0.65801	0.2726	N	0.17594	0.5	0.31124	N	0.708518	D	0.69078	0.997	P	0.58266	0.836	T	0.65861	-0.6065	9	.	.	.	.	10.8437	0.46730	0.1891:0.8109:0.0:0.0	.	91	P50406	5HT6R_HUMAN	C	91	ENSP00000289753:R91C	.	R	+	1	0	HTR6	19865104	0.992000	0.36948	1.000000	0.80357	0.986000	0.74619	1.490000	0.35573	2.048000	0.60808	0.485000	0.47835	CGC	rs201177761	HTR6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT6_rcpt		0.657	HTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR6	HGNC	protein_coding	OTTHUMT00000007704.1	0	0	0	24	24	15	0.00	0.00	C	NM_000871		19992517	+1	6	13	11	2	tier1	no_errors	ENST00000289753	ensembl	human	known	74_37	missense	35.29	86.67	SNP	1.000	T	6	11
ZNF700	90592	genome.wustl.edu	37	19	12060266	12060266	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:12060266G>A	ENST00000254321.5	+	4	1570	c.1427G>A	c.(1426-1428)tGt>tAt	p.C476Y	ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.C458Y|ZNF763_ENST00000590798.1_Intron|CTD-2006C1.12_ENST00000586394.1_RNA	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	476					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CCCTATGAATGTAAGGAATGT	0.418													ENSG00000196757																																					0													74.0	75.0	75.0					19																	12060266		2203	4300	6503	SO:0001583	missense	0			-	AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1427G>A	19.37:g.12060266G>A	ENSP00000254321:p.Cys476Tyr		B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C476Y	ENST00000254321.5	37	c.1427	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	g	14.86	2.662913	0.47572	.	.	ENSG00000196757	ENST00000254321	D	0.85088	-1.94	0.606	0.606	0.17559	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93651	0.7972	H	0.96333	3.805	0.25831	N	0.984169	D	0.89917	1.0	D	0.97110	1.0	D	0.84245	0.0474	9	0.87932	D	0	.	8.6677	0.34132	0.0:0.0:1.0:0.0	.	476	Q9H0M5	ZN700_HUMAN	Y	476	ENSP00000254321:C476Y	ENSP00000254321:C476Y	C	+	2	0	ZNF700	11921266	1.000000	0.71417	0.343000	0.25615	0.312000	0.27988	4.193000	0.58385	0.577000	0.29470	0.195000	0.17529	TGT	-	ZNF700	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	0	0	0	54	54	49	0.00	0.00	G	NM_144566		12060266	+1	12	20	11	7	tier1	no_errors	ENST00000254321	ensembl	human	known	74_37	missense	52.17	74.07	SNP	0.514	A	12	11
RGMB	285704	genome.wustl.edu	37	5	98115446	98115446	+	Missense_Mutation	SNP	G	G	A	rs35699029		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:98115446G>A	ENST00000513185.1	+	2	735	c.299G>A	c.(298-300)cGt>cAt	p.R100H	RGMB_ENST00000504776.1_3'UTR|RGMB_ENST00000308234.7_Missense_Mutation_p.R141H			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	100					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		AAAGCCTGCCGTGGCAACCTG	0.537													ENSG00000174136																																					0													72.0	74.0	73.0					5																	98115446		1961	4147	6108	SO:0001583	missense	0			-	AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.299G>A	5.37:g.98115446G>A	ENSP00000423256:p.Arg100His		D6R9A0|Q8NC92	Missense_Mutation	SNP	pfam_RGM_C,pfam_RGM_N	p.R141H	ENST00000513185.1	37	c.422		5	.	.	.	.	.	.	.	.	.	.	G	33	5.288456	0.95517	.	.	ENSG00000174136	ENST00000308234;ENST00000513185	D;D	0.98028	-4.67;-4.67	5.4	5.4	0.78164	Repulsive guidance molecule, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98432	0.9478	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99053	1.0828	10	0.54805	T	0.06	-14.6506	19.5247	0.95199	0.0:0.0:1.0:0.0	rs35699029	100	Q6NW40	RGMB_HUMAN	H	141;100	ENSP00000308219:R141H;ENSP00000423256:R100H	ENSP00000308219:R141H	R	+	2	0	RGMB	98143346	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.420000	0.97426	2.689000	0.91719	0.563000	0.77884	CGT	rs35699029	RGMB	-	pfam_RGM_N		0.537	RGMB-003	KNOWN	basic	protein_coding	RGMB	HGNC	protein_coding	OTTHUMT00000370308.1	0	0	0	43	43	73	0.00	0.00	G	NM_173670		98115446	+1	6	8	54	90	tier1	no_errors	ENST00000308234	ensembl	human	known	74_37	missense	10.00	8.16	SNP	1.000	A	6	54
TIAL1	7073	genome.wustl.edu	37	10	121341975	121341975	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr10:121341975C>T	ENST00000436547.2	-	3	268	c.224G>A	c.(223-225)gGa>gAa	p.G75E	TIAL1_ENST00000369093.2_Missense_Mutation_p.G92E|TIAL1_ENST00000369092.4_5'UTR	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	75	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TCTTACCTTTCCCAAAATTTT	0.368													ENSG00000151923																																					0													133.0	146.0	141.0					10																	121341975		2202	4298	6500	SO:0001583	missense	0			-	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.224G>A	10.37:g.121341975C>T	ENSP00000394902:p.Gly75Glu		A8K3T0|A8K4L9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.G92E	ENST00000436547.2	37	c.275	CCDS7613.1	10	.	.	.	.	.	.	.	.	.	.	C	24.3	4.512942	0.85389	.	.	ENSG00000151923	ENST00000369093;ENST00000436547;ENST00000412524;ENST00000369086	T;T;T;T	0.54866	2.65;0.55;2.65;2.65	6.02	6.02	0.97574	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	M	0.66560	2.04	0.80722	D	1	B;D	0.76494	0.278;0.999	B;D	0.77557	0.413;0.99	T	0.69154	-0.5220	10	0.44086	T	0.13	-16.0465	20.5373	0.99239	0.0:1.0:0.0:0.0	.	92;75	A8K4L9;Q01085	.;TIAR_HUMAN	E	92;75;36;36	ENSP00000358089:G92E;ENSP00000394902:G75E;ENSP00000403573:G36E;ENSP00000358082:G36E	ENSP00000358082:G36E	G	-	2	0	TIAL1	121331965	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.656000	0.83736	2.857000	0.98124	0.650000	0.86243	GGA	-	TIAL1	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.368	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAL1	HGNC	protein_coding	OTTHUMT00000050672.2	0	0	0	39	39	87	0.00	0.00	C	NM_022333, NM_003252		121341975	-1	6	5	14	53	tier1	no_errors	ENST00000369093	ensembl	human	known	74_37	missense	30.00	8.62	SNP	1.000	T	6	14
CROCC	9696	genome.wustl.edu	37	1	17263172	17263172	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:17263172C>T	ENST00000375541.5	+	9	1066	c.997C>T	c.(997-999)Cga>Tga	p.R333*	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CCGGACATCACGAGCTGTCCA	0.662													ENSG00000058453																																					0													8.0	9.0	8.0					1																	17263172		2116	4149	6265	SO:0001587	stop_gained	0			-	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.997C>T	1.37:g.17263172C>T	ENSP00000364691:p.Arg333*			Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_t-SRE	p.R333*	ENST00000375541.5	37	c.997	CCDS30616.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758184	0.89843	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	.	.	.	3.91	0.854	0.19007	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.8443	0.23980	0.3246:0.5889:0.0:0.0865	.	.	.	.	X	333;214	.	ENSP00000364691:R333X	R	+	1	2	CROCC	17135759	0.623000	0.27094	0.002000	0.10522	0.389000	0.30415	1.194000	0.32174	0.075000	0.16796	-0.362000	0.07510	CGA	-	CROCC	-	NULL		0.662	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	0	0	0	83	83	6	0.00	0.00	C	NM_014675		17263172	+1	4	0	36	4	tier1	no_errors	ENST00000375541	ensembl	human	known	74_37	nonsense	10.00	0.00	SNP	0.350	T	4	36
ALPL	249	genome.wustl.edu	37	1	21887130	21887130	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:21887130G>A	ENST00000374840.3	+	3	323	c.73G>A	c.(73-75)Gac>Aac	p.D25N	ALPL_ENST00000374832.1_Missense_Mutation_p.D25N|ALPL_ENST00000468526.1_3'UTR|ALPL_ENST00000539907.1_5'UTR|ALPL_ENST00000540617.1_5'UTR|ALPL_ENST00000425315.2_Missense_Mutation_p.D25N	NM_000478.4	NP_000469.3	P05186	PPBT_HUMAN	alkaline phosphatase, liver/bone/kidney	25					cellular response to organic cyclic compound (GO:0071407)|cementum mineralization (GO:0071529)|developmental process involved in reproduction (GO:0003006)|endochondral ossification (GO:0001958)|osteoblast differentiation (GO:0001649)|response to antibiotic (GO:0046677)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)	anchored component of membrane (GO:0031225)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	26		all_lung(284;2.19e-05)|Lung NSC(340;2.22e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;8.7e-28)|COAD - Colon adenocarcinoma(152;1.57e-05)|GBM - Glioblastoma multiforme(114;2.66e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000177)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00856)|READ - Rectum adenocarcinoma(331;0.0623)|Lung(427;0.146)	Amifostine(DB01143)|Fospropofol(DB06716)	GAAAGAGAAAGACCCCAAGTA	0.502													ENSG00000162551																																					0													89.0	89.0	89.0					1																	21887130		2203	4300	6503	SO:0001583	missense	0			-	BC021289	CCDS217.1, CCDS53274.1, CCDS53275.1	1p36.12	2008-02-05			ENSG00000162551	ENSG00000162551	3.1.3.1		438	protein-coding gene	gene with protein product		171760		HOPS		3532105, 3446011	Standard	NM_001127501		Approved	TNSALP	uc001bet.3	P05186	OTTHUMG00000002949	ENST00000374840.3:c.73G>A	1.37:g.21887130G>A	ENSP00000363973:p.Asp25Asn		A1A4E7|B2RMP8|B7Z387|B7Z4Y6|O75090|Q2TAI7|Q59EJ7|Q5BKZ5|Q5VTG5|Q6NZI8|Q8WU32|Q9UBK0	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.D25N	ENST00000374840.3	37	c.73	CCDS217.1	1	.	.	.	.	.	.	.	.	.	.	G	5.935	0.356616	0.11239	.	.	ENSG00000162551	ENST00000374840;ENST00000374832;ENST00000425315	D;D;D	0.95821	-3.82;-3.82;-3.82	5.71	4.7	0.59300	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.307211	0.40064	N	0.001200	D	0.88991	0.6588	N	0.20610	0.595	0.80722	D	1	B	0.16802	0.019	B	0.12837	0.008	D	0.83381	0.0012	10	0.11485	T	0.65	-13.4106	11.5449	0.50688	0.118:0.0:0.882:0.0	.	25	P05186	PPBT_HUMAN	N	25	ENSP00000363973:D25N;ENSP00000363965:D25N;ENSP00000394765:D25N	ENSP00000363965:D25N	D	+	1	0	ALPL	21759717	1.000000	0.71417	1.000000	0.80357	0.597000	0.36814	0.729000	0.26028	2.698000	0.92095	0.561000	0.74099	GAC	-	ALPL	-	superfamily_Alkaline_phosphatase_core		0.502	ALPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALPL	HGNC	protein_coding	OTTHUMT00000008202.1	0	0	0	60	60	91	0.00	0.00	G	NM_000478		21887130	+1	8	4	57	58	tier1	no_errors	ENST00000374832	ensembl	human	known	74_37	missense	12.31	6.45	SNP	1.000	A	8	57
FAM138C	654835	genome.wustl.edu	37	9	35199	35199	+	lincRNA	SNP	A	A	G	rs9408059		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:35199A>G	ENST00000449442.2	-	0	403									family with sequence similarity 138, member C																		tgggaggctgaggtgggagga	0.438													ENSG00000218839																																					0																																												0			-			9p24.3	2013-01-30			ENSG00000218839	ENSG00000218839		"""Long non-coding RNAs"""	32333	non-coding RNA	RNA, long non-coding						11779631, 15233989	Standard	NR_026822		Approved	F379	uc003zfv.3		OTTHUMG00000019422		9.37:g.35199A>G				R	SNP	-	NULL	ENST00000449442.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	A	1.738	-0.492428	0.04322	.	.	ENSG00000218839	ENST00000449442;ENST00000305248	.	.	.	0.185	-0.371	0.12525	.	.	.	.	.	T	0.33990	0.0882	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31752	-0.9932	4	0.52906	T	0.07	.	.	.	.	.	.	.	.	P	28	.	ENSP00000303458:S28P	S	-	1	0	FAM138C	25199	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.686000	0.05161	-0.785000	0.04522	-0.782000	0.03352	TCA	-	FAM138C	-	-		0.438	FAM138C-001	KNOWN	basic	lincRNA	FAM138C	HGNC	lincRNA	OTTHUMT00000051450.2	0	0	0	31	31	0	0.00	0.00	A	NR_026822		35199	-1	4	0	24	0	tier1	no_errors	ENST00000305248	ensembl	human	known	74_37	rna	14.29	0.00	SNP	0.000	G	4	24
PHPT1	29085	genome.wustl.edu	37	9	139748197	139748197	+	IGR	SNP	C	C	T			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:139748197C>T	ENST00000247665.10	+	0	890				MAMDC4_ENST00000317446.2_Intron|MAMDC4_ENST00000485732.1_3'UTR|MAMDC4_ENST00000445819.1_Intron	NM_014172.4	NP_054891.2	Q9NRX4	PHP14_HUMAN	phosphohistidine phosphatase 1						negative regulation of ATP citrate synthase activity (GO:2000984)|negative regulation of lyase activity (GO:0051350)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-histidine dephosphorylation (GO:0035971)|positive regulation of cell motility (GO:2000147)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|protein dephosphorylation (GO:0006470)|regulation of actin cytoskeleton reorganization (GO:2000249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	calcium channel inhibitor activity (GO:0019855)|ion channel binding (GO:0044325)|phosphohistidine phosphatase activity (GO:0008969)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|large_intestine(1)|lung(1)	3	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		ACAAGCAGGGCCGCAGCTGCC	0.697													ENSG00000177943																																					0													13.0	17.0	15.0					9																	139748197		2165	4271	6436	SO:0001628	intergenic_variant	0			-	AF131857	CCDS7009.1, CCDS48060.1	9q34.3	2008-02-05			ENSG00000054148	ENSG00000054148	3.1.3.-		30033	protein-coding gene	gene with protein product	"""phosphohistidine phosphatase 14kDa"", "" sex-regulated protein janus-a"""	610167				11042152, 8619474	Standard	NM_014172		Approved	PHP14, HSPC141, CGI-202, DKFZp564M173, bA216L13.10	uc004cjq.4	Q9NRX4	OTTHUMG00000020950		9.37:g.139748197C>T			B1AMX0|B1AMX1|Q9H0Y3	R	SNP	-	NULL	ENST00000247665.10	37	NULL	CCDS7009.1	9																																																																																			-	MAMDC4	-	-		0.697	PHPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAMDC4	HGNC	protein_coding	OTTHUMT00000055150.1	0	0	0	75	75	6	0.00	0.00	C	NM_014172		139748197	+1	25	1	42	9	tier1	no_errors	ENST00000485732	ensembl	human	known	74_37	rna	36.76	10.00	SNP	0.007	T	25	42
FAM230A	653203	genome.wustl.edu	37	22	20709186	20709186	+	Silent	SNP	C	C	T	rs370050776		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr22:20709186C>T	ENST00000434783.3	+	8	1102	c.918C>T	c.(916-918)gcC>gcT	p.A306A	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		ACGAGGACGCCGCCCAGGGCA	0.672													ENSG00000188280																																					0																																										SO:0001819	synonymous_variant	0			-	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.918C>T	22.37:g.20709186C>T				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.A306	ENST00000434783.3	37	c.918		22																																																																																			-	FAM230A	-	superfamily_Kinase-like_dom		0.672	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	0	0	0	83	83	2	0.00	0.00	C			20709186	+1	10	0	67	4	tier1	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	12.82	0.00	SNP	0.021	T	10	67
FAM230A	653203	genome.wustl.edu	37	22	20709232	20709232	+	Missense_Mutation	SNP	G	G	C	rs376485229|rs71186655		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr22:20709232G>C	ENST00000434783.3	+	8	1148	c.964G>C	c.(964-966)Gag>Cag	p.E322Q	USP41_ENST00000454608.2_Intron|USP41_ENST00000486536.2_Intron					family with sequence similarity 230, member A																		CATCGCGAACGAGGATGCCGC	0.667													ENSG00000188280																																					0																																										SO:0001583	missense	0			-	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.964G>C	22.37:g.20709232G>C	ENSP00000463576:p.Glu322Gln			Missense_Mutation	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.E322Q	ENST00000434783.3	37	c.964		22																																																																																			-	FAM230A	-	superfamily_Kinase-like_dom		0.667	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	0	0	0	73	73	1	0.00	0.00	G			20709232	+1	8	0	63	0	tier1	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	11.27	0.00	SNP	0.008	C	8	63
GOLGA8I	283796	genome.wustl.edu	37	15	23264792	23264792	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr15:23264792A>G	ENST00000450802.3	+	16	1494	c.1396A>G	c.(1396-1398)Aag>Gag	p.K466E	AC091565.1_ENST00000459619.1_RNA|RN7SL495P_ENST00000461817.2_RNA	NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	466						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											CCTGGAGGAGAAGGCAGACCT	0.547													ENSG00000153666																																					0																																										SO:0001583	missense	0			-	AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.1396A>G	15.37:g.23264792A>G	ENSP00000399637:p.Lys466Glu			Missense_Mutation	SNP	NULL	p.K466E	ENST00000450802.3	37	c.1396		15	.	.	.	.	.	.	.	.	.	.	.	11.22	1.574318	0.28092	.	.	ENSG00000153666	ENST00000450802	D	0.90004	-2.6	0.829	0.829	0.18847	.	.	.	.	.	D	0.83903	0.5355	.	.	.	.	.	.	.	.	.	.	.	.	T	0.79804	-0.1649	5	0.30078	T	0.28	.	5.9935	0.19480	1.0:0.0:0.0:0.0	.	.	.	.	E	466	ENSP00000399637:K466E	ENSP00000399637:K466E	K	+	1	0	GOLGA8IP	20816233	1.000000	0.71417	0.029000	0.17559	0.254000	0.26022	4.588000	0.60999	0.652000	0.30806	0.092000	0.15492	AAG	-	GOLGA8I	-	NULL		0.547	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	HGNC	protein_coding	OTTHUMT00000251213.2	0	0	0	100	100	0	0.00	0.00	A	NR_024074		23264792	+1	33	0	41	1	tier1	no_errors	ENST00000450802	ensembl	human	known	74_37	missense	44.59	0.00	SNP	1.000	G	33	41
TRIM39	56658	genome.wustl.edu	37	6	30294912	30294912	+	Intron	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr6:30294912G>A	ENST00000376656.4	+	1	152				TRIM39_ENST00000396548.1_Intron|HCG18_ENST00000454129.1_RNA|TRIM39_ENST00000540416.1_Intron|TRIM39_ENST00000376659.5_5'Flank|HCG18_ENST00000444126.1_RNA|HCG18_ENST00000602290.1_RNA|HCG18_ENST00000412685.2_RNA|HCG18_ENST00000413358.2_RNA|HCG18_ENST00000426882.1_RNA|HCG18_ENST00000449544.1_RNA|TRIM39_ENST00000396547.1_5'Flank|TRIM39-RPP21_ENST00000513556.1_5'Flank|HCG17_ENST00000453558.1_lincRNA|HCG18_ENST00000602498.1_RNA|HCG18_ENST00000438412.1_RNA|HCG18_ENST00000454269.1_RNA|TRIM39_ENST00000396551.3_Intron|HCG18_ENST00000602550.1_RNA	NM_021253.3	NP_067076.2	Q9HCM9	TRI39_HUMAN	tripartite motif containing 39						apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of apoptotic signaling pathway (GO:2001235)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			ovary(3)	3						CCTCGGGCCCGGGCGGACGTT	0.771													ENSG00000231074																																					0																																										SO:0001627	intron_variant	0			-	BC034985	CCDS34377.1, CCDS34378.1	6p22.1	2013-01-09	2011-01-25	2002-06-07	ENSG00000204599	ENSG00000204599		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10065	protein-coding gene	gene with protein product		605700	"""ring finger protein 23"", ""tripartite motif-containing 39"""	RNF23		11006080	Standard	NM_021253		Approved			Q9HCM9	OTTHUMG00000031066	ENST00000376656.4:c.-161+140G>A	6.37:g.30294912G>A			Q5STG3|Q5STG4|Q76BL3|Q8IYT9|Q96IB6	R	SNP	-	NULL	ENST00000376656.4	37	NULL	CCDS34377.1	6																																																																																			-	HCG18	-	-		0.771	TRIM39-201	KNOWN	basic|CCDS	protein_coding	HCG18	HGNC	protein_coding		0	0	0	20	20	0	0.00	0.00	G	NM_172016		30294912	-1	6	0	8	0	tier1	no_errors	ENST00000426882	ensembl	human	known	74_37	rna	42.86	0.00	SNP	0.845	A	6	8
SRGAP2B	647135	genome.wustl.edu	37	1	144013941	144013941	+	RNA	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr1:144013941C>G	ENST00000467933.1	+	0	956							P0DMP2	SRG2B_HUMAN	SLIT-ROBO Rho GTPase activating protein 2B						nervous system development (GO:0007399)												AATGCCTGGACCAGCAGTGTG	0.502													ENSG00000196369																																					0																																												0			-		CCDS72854.1	1q21.1	2014-07-10	2013-02-13	2012-05-08	ENSG00000196369	ENSG00000196369			35237	protein-coding gene	gene with protein product		614703	"""SLIT-ROBO Rho GTPase activating protein 2 pseudogene 2"", ""SLIT-ROBO Rho GTPase activating protein 2B (pseudogene)"""	SRGAP2P2		22559943, 22559944	Standard	NM_001271870		Approved		uc010oxm.1	P0DMP2	OTTHUMG00000041442		1.37:g.144013941C>G				R	SNP	-	NULL	ENST00000467933.1	37	NULL		1																																																																																			-	SRGAP2B	-	-		0.502	SRGAP2B-002	KNOWN	basic	processed_transcript	SRGAP2B	HGNC	pseudogene	OTTHUMT00000352915.1	0	0	0	121	121	140	0.00	0.00	C	NM_001271870		144013941	+1	12	2	104	174	tier1	no_errors	ENST00000467933	ensembl	human	known	74_37	rna	10.34	1.14	SNP	1.000	G	12	104
XAB2	56949	genome.wustl.edu	37	19	7691075	7691075	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr19:7691075T>C	ENST00000358368.4	-	5	641	c.604A>G	c.(604-606)Acc>Gcc	p.T202A	XAB2_ENST00000534844.1_Missense_Mutation_p.T199A	NM_020196.2	NP_064581.2	Q9HCS7	SYF1_HUMAN	XPA binding protein 2	202					blastocyst development (GO:0001824)|DNA repair (GO:0006281)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	26						TTCACCACGGTGGCCAGGCGC	0.657								Direct reversal of damage;Nucleotide excision repair (NER)					ENSG00000076924																																					0													103.0	110.0	107.0					19																	7691075		2203	4300	6503	SO:0001583	missense	0			-	AB026111	CCDS32892.1	19p13.3	2013-08-21				ENSG00000076924			14089	protein-coding gene	gene with protein product	"""SYF1 homolog, RNA splicing factor (S. cerevisiae)"", ""SYF1 pre-mRNA-splicing factor"""	610850				10944529	Standard	NM_020196		Approved	HCNP, HCRN, SYF1, NTC90	uc002mgx.3	Q9HCS7		ENST00000358368.4:c.604A>G	19.37:g.7691075T>C	ENSP00000351137:p.Thr202Ala		Q8TET6|Q96HB0|Q96IW0|Q9NRG6|Q9ULP3	Missense_Mutation	SNP	smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T202A	ENST00000358368.4	37	c.604	CCDS32892.1	19	.	.	.	.	.	.	.	.	.	.	T	2.267	-0.367913	0.05069	.	.	ENSG00000076924	ENST00000358368;ENST00000534844	T;T	0.62498	0.02;0.02	4.82	3.8	0.43715	.	0.069101	0.64402	D	0.000017	T	0.30634	0.0771	N	0.03050	-0.425	0.33369	D	0.573286	B	0.02656	0.0	B	0.04013	0.001	T	0.24225	-1.0166	10	0.12766	T	0.61	-45.9179	6.4247	0.21764	0.0:0.1941:0.0:0.8059	.	202	Q9HCS7	SYF1_HUMAN	A	202;199	ENSP00000351137:T202A;ENSP00000438225:T199A	ENSP00000351137:T202A	T	-	1	0	XAB2	7597075	1.000000	0.71417	0.945000	0.38365	0.124000	0.20399	2.187000	0.42602	0.707000	0.31934	0.454000	0.30748	ACC	-	XAB2	-	NULL		0.657	XAB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XAB2	HGNC	protein_coding	OTTHUMT00000461021.1	0	0	0	41	41	35	0.00	0.00	T	NM_020196		7691075	-1	5	2	34	37	tier1	no_errors	ENST00000358368	ensembl	human	known	74_37	missense	12.82	5.13	SNP	0.998	C	5	34
EEF2K	29904	genome.wustl.edu	37	16	22274469	22274469	+	Silent	SNP	G	G	A			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr16:22274469G>A	ENST00000263026.5	+	12	1812	c.1338G>A	c.(1336-1338)gaG>gaA	p.E446E		NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	446					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		ACCCCAGTGAGAAGCGGGGTG	0.557													ENSG00000103319																									NSCLC(195;1411 2157 20319 27471 51856)												0													81.0	66.0	71.0					16																	22274469		2197	4300	6497	SO:0001819	synonymous_variant	0			-	U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.1338G>A	16.37:g.22274469G>A			Q8N588	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.E446	ENST00000263026.5	37	c.1338	CCDS10604.1	16																																																																																			-	EEF2K	-	pirsf_Elongation_factor_2_kinase		0.557	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	HGNC	protein_coding	OTTHUMT00000211580.2	0	0	0	100	100	97	0.00	0.00	G	NM_013302		22274469	+1	6	2	62	54	tier1	no_errors	ENST00000263026	ensembl	human	known	74_37	silent	8.82	3.57	SNP	1.000	A	6	62
AKNA	80709	genome.wustl.edu	37	9	117122049	117122049	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr9:117122049C>G	ENST00000307564.4	-	11	2478	c.2317G>C	c.(2317-2319)Gaa>Caa	p.E773Q	AKNA_ENST00000374075.5_Missense_Mutation_p.E692Q|AKNA_ENST00000223791.3_Missense_Mutation_p.E233Q|AKNA_ENST00000374088.3_Missense_Mutation_p.E773Q|AKNA_ENST00000312033.3_Missense_Mutation_p.E773Q	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	773	PEST.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						CTCATGGCTTCTGGGAGAGAC	0.592													ENSG00000106948																																					0													37.0	35.0	36.0					9																	117122049		2203	4300	6503	SO:0001583	missense	0			-	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2317G>C	9.37:g.117122049C>G	ENSP00000303769:p.Glu773Gln		Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	pfam_TF_AT-hook	p.E773Q	ENST00000307564.4	37	c.2317	CCDS6805.1	9	.	.	.	.	.	.	.	.	.	.	c	12.22	1.871551	0.33069	.	.	ENSG00000106948	ENST00000307564;ENST00000394582;ENST00000374088;ENST00000223791;ENST00000374075;ENST00000312033	T;T;T;T;T	0.38240	2.39;2.39;2.18;2.4;1.15	3.85	2.95	0.34219	.	0.377610	0.22835	N	0.055056	T	0.38799	0.1054	L	0.34521	1.04	0.50171	D	0.999852	D;D	0.61697	0.984;0.99	P;P	0.58266	0.69;0.836	T	0.20009	-1.0288	10	0.62326	D	0.03	-11.416	7.2542	0.26166	0.0:0.8818:0.0:0.1182	.	773;692	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	Q	773;614;773;233;692;773	ENSP00000303769:E773Q;ENSP00000363201:E773Q;ENSP00000223791:E233Q;ENSP00000363188:E692Q;ENSP00000309222:E773Q	ENSP00000223791:E233Q	E	-	1	0	AKNA	116161870	0.914000	0.31030	0.653000	0.29593	0.118000	0.20060	1.705000	0.37867	1.213000	0.43380	0.450000	0.29827	GAA	-	AK	-	NULL		0.592	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AK	HGNC	protein_coding	OTTHUMT00000053767.2	0	0	0	36	36	34	0.00	0.00	C	NM_030767		117122049	-1	4	2	34	23	tier1	no_errors	ENST00000307564	ensembl	human	known	74_37	missense	10.53	8.00	SNP	0.706	G	4	34
TM9SF2	9375	genome.wustl.edu	37	13	100192902	100192902	+	Intron	DEL	T	T	-			TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr13:100192902delT	ENST00000376387.4	+	8	1018					NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2						transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TTGAATGGGATTTTTTTTTGT	0.348													ENSG00000125304																																					0																																										SO:0001627	intron_variant	0				U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.829-66T>-	13.37:g.100192902delT			A8K399|Q2TAY5	R	DEL	-	NULL	ENST00000376387.4	37	NULL	CCDS9493.1	13																																																																																				TM9SF2	-	-		0.348	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF2	HGNC	protein_coding	OTTHUMT00000045602.3	0	0	0	22	22	98	0.00	0.00	T			100192902	+1	2	2	17	142	tier1	no_errors	ENST00000466555	ensembl	human	known	74_37	rna	10.53	1.39	DEL	0.045	-	2	17
MEF2C	4208	genome.wustl.edu	37	5	88178836	88178836	+	5'UTR	DEL	G	G	-	rs200560914		TCGA-X6-A8C5-01A-11D-A36J-09	TCGA-X6-A8C5-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4cf1d985-f27a-4a23-879e-a10eb81baee0	97f61111-eda5-46fb-84f3-9b3f68f9617b	g.chr5:88178836delG	ENST00000437473.2	-	0	214				MEF2C_ENST00000514028.1_5'UTR|MEF2C_ENST00000508569.1_5'UTR|MEF2C_ENST00000514015.1_5'UTR|MEF2C_ENST00000340208.5_Intron|MEF2C-AS1_ENST00000514794.1_RNA|MEF2C_ENST00000504921.2_5'UTR|MEF2C-AS1_ENST00000511100.1_RNA|MEF2C-AS1_ENST00000512585.1_RNA|MEF2C_ENST00000510942.1_5'UTR|MEF2C_ENST00000506554.1_5'UTR|MEF2C_ENST00000424173.2_Intron	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GAGAGAGAGAGAAAAAAAAAA	0.408										HNSCC(66;0.2)			ENSG00000081189																																					0																																										SO:0001623	5_prime_UTR_variant	0				AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.-204C>-	5.37:g.88178836delG			C9JMZ0|D7F7N5|F8W7V7	R	DEL	-	NULL	ENST00000437473.2	37	NULL	CCDS47245.1	5																																																																																				MEF2C	-	-		0.408	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	0	0	0	27	27	71	0.00	0.00	G	NM_002397		88178836	-1	2	3	17	65	tier1	no_errors	ENST00000509349	ensembl	human	known	74_37	rna	10.53	4.41	DEL	0.001	-	2	17
