#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
ACTC1	70	genome.wustl.edu	37	15	35083329	35083329	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr15:35083329T>A	ENST00000290378.4	-	6	1631	c.976A>T	c.(976-978)Acc>Tcc	p.T326S	ACTC1_ENST00000557860.1_5'Flank|RP11-814P5.1_ENST00000503496.1_RNA|RP11-814P5.1_ENST00000558707.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	326					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ATCTTCATGGTGCTAGGAGCC	0.448													ENSG00000159251																																					0													279.0	262.0	268.0					15																	35083329		2201	4298	6499	SO:0001583	missense	0			-	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.976A>T	15.37:g.35083329T>A	ENSP00000290378:p.Thr326Ser		P04270	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.T326S	ENST00000290378.4	37	c.976	CCDS10041.1	15	.	.	.	.	.	.	.	.	.	.	T	15.92	2.975785	0.53720	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	D	0.93953	-3.32	5.48	5.48	0.80851	.	0.000000	0.53938	U	0.000052	D	0.91290	0.7254	N	0.03000	-0.44	0.58432	D	0.99999	B	0.20368	0.044	P	0.49561	0.615	D	0.90002	0.4115	10	0.87932	D	0	.	15.86	0.79014	0.0:0.0:0.0:1.0	.	326	P68032	ACTC_HUMAN	S	326;291	ENSP00000290378:T326S	ENSP00000290378:T326S	T	-	1	0	ACTC1	32870621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.993000	0.88291	2.190000	0.69967	0.533000	0.62120	ACC	-	ACTC1	-	pfam_Actin-related,smart_Actin-related		0.448	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTC1	HGNC	protein_coding	OTTHUMT00000251876.3	1	1		140	140		0.70		T	NM_005159		35083329	-1	7		68		tier1	no_errors	ENST00000290378	ensembl	human	known	74_37	missense	9.33		SNP	1.000	A	7	68
IL12RB2	3595	genome.wustl.edu	37	1	67793870	67793882	+	Splice_Site	DEL	GTTTTGTTTACAG	GTTTTGTTTACAG	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	GTTTTGTTTACAG	GTTTTGTTTACAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:67793870_67793882delGTTTTGTTTACAG	ENST00000262345.1	+	5	1119		c.e5-1		IL12RB2_ENST00000541374.1_Splice_Site|IL12RB2_ENST00000544434.1_Splice_Site|IL12RB2_ENST00000371000.1_Splice_Site	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2						cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						ACGTGGTTGTGTTTTGTTTACAGGCTAAGTGGA	0.333													ENSG00000081985																																					0																																										SO:0001630	splice_region_variant	0				U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.480-1GTTTTGTTTACAG>-	1.37:g.67793870_67793882delGTTTTGTTTACAG			B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Splice_Site	DEL	-	e4-1	ENST00000262345.1	37	c.480-13_480-1	CCDS638.1	1																																																																																				IL12RB2	-	-		0.333	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2									GTTTTGTTTACAG	NM_001559	Intron	67793882	+1					tier1	no_errors	ENST00000262345	ensembl	human	known	74_37	splice_site_del			DEL	0.000:0.011:0.007:0.001:0.000:0.000:0.008:0.023:0.015:0.009:0.017:0.973:0.993	-		
LINC01205	401082	genome.wustl.edu	37	3	109128927	109128927	+	lincRNA	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:109128927G>A	ENST00000497996.1	+	0	91																											CTTTGTACAAGCCATGGTATA	0.567													ENSG00000228980																																					0																																												0			-																													3.37:g.109128927G>A				R	SNP	-	NULL	ENST00000497996.1	37	NULL		3																																																																																			-	RP11-702L6.4	-	-		0.567	RP11-702L6.4-002	KNOWN	basic	lincRNA	ENSG00000228980	Clone_based_vega_gene	lincRNA	OTTHUMT00000353892.1	0	0		110	110		0.00		G			109128927	+1	5		57		tier1	no_errors	ENST00000497996	ensembl	human	known	74_37	rna	8.06		SNP	1.000	A	5	57
UNC13A	23025	genome.wustl.edu	37	19	17743633	17743633	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr19:17743633G>A	ENST00000519716.2	-	28	3385	c.3386C>T	c.(3385-3387)aCg>aTg	p.T1129M	UNC13A_ENST00000550896.1_Missense_Mutation_p.T1127M|UNC13A_ENST00000552293.1_Missense_Mutation_p.T1129M|UNC13A_ENST00000551649.1_Missense_Mutation_p.T1129M|UNC13A_ENST00000252773.7_Missense_Mutation_p.T1129M|UNC13A_ENST00000428389.2_Missense_Mutation_p.T1217M	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	1129	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GGGAAGTTCCGTCACATACTC	0.552													ENSG00000130477																																					0													110.0	115.0	113.0					19																	17743633		2138	4266	6404	SO:0001583	missense	0			-	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.3386C>T	19.37:g.17743633G>A	ENSP00000429562:p.Thr1129Met		E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T1217M	ENST00000519716.2	37	c.3650	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	g	11.89	1.772479	0.31411	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.80566	-1.38;-1.39;-1.38;-1.25;-1.25;-1.38	3.63	3.63	0.41609	Munc13 homology 1 (1);	0.458026	0.22031	U	0.065584	T	0.60996	0.2312	N	0.03608	-0.345	0.21719	N	0.999578	B	0.17465	0.022	B	0.15052	0.012	T	0.57831	-0.7743	10	0.54805	T	0.06	.	12.7958	0.57558	0.0:0.0:1.0:0.0	.	1129	Q9UPW8	UN13A_HUMAN	M	1129;1217;1129;1129;1129;1127	ENSP00000429562:T1129M;ENSP00000400409:T1217M;ENSP00000252773:T1129M;ENSP00000447236:T1129M;ENSP00000447572:T1129M;ENSP00000446831:T1127M	ENSP00000252773:T1129M	T	-	2	0	UNC13A	17604633	1.000000	0.71417	0.983000	0.44433	0.877000	0.50540	4.904000	0.63279	1.585000	0.49928	0.298000	0.19748	ACG	-	UNC13A	-	NULL		0.552	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	0	0		58	58		0.00		G	XM_038604		17743633	-1	5		36		tier1	no_errors	ENST00000428389	ensembl	human	known	74_37	missense	12.20		SNP	0.985	A	5	36
MIR3687-2	103504728	genome.wustl.edu	37	21	9825951	9825951	+	RNA	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr21:9825951G>A	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						TCCCGGCTGCGGTCGGCCGCG	0.821													ENSG00000264462																																					0																																												0			-																													21.37:g.9825951G>A				R	SNP	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			-	MIR3648	-	-		0.821	MIR3687-201	KNOWN	basic	miRNA	MIR3648	HGNC	miRNA		0	0		30	30		0.00		G			9825951	+1	6		8		tier1	no_errors	ENST00000581792	ensembl	human	known	74_37	rna	42.86		SNP	0.032	A	6	8
PITPNM1	9600	genome.wustl.edu	37	11	67261233	67261233	+	Silent	SNP	G	G	A	rs370108604	byFrequency	TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:67261233G>A	ENST00000534749.1	-	20	3272	c.3084C>T	c.(3082-3084)gaC>gaT	p.D1028D	PITPNM1_ENST00000356404.3_Silent_p.D1028D|PITPNM1_ENST00000526450.1_5'UTR|PITPNM1_ENST00000436757.2_Silent_p.D1027D			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	1028					brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TGAAGGAGCCGTCGATGCTGA	0.687													ENSG00000110697	G|||	2	0.000399361	0.0015	0.0	5008	,	,		10784	0.0		0.0	False		,,,				2504	0.0				GBM(28;144 709 4607 5525)												0								G	,	3,4159		0,3,2078	22.0	20.0	21.0		3081,3084	-0.1	1.0	11		21	0,8142		0,0,4071	no	coding-synonymous,coding-synonymous	PITPNM1	NM_001130848.1,NM_004910.2	,	0,3,6149	AA,AG,GG		0.0,0.0721,0.0244	,	1027/1244,1028/1245	67261233	3,12301	2081	4071	6152	SO:0001819	synonymous_variant	0			-	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.3084C>T	11.37:g.67261233G>A			A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.D1028	ENST00000534749.1	37	c.3084	CCDS31620.1	11																																																																																			-	PITPNM1	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2		0.687	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	HGNC	protein_coding	OTTHUMT00000395520.1	0	0		36	36		0.00		G	NM_004910		67261233	-1	7		16		tier1	no_errors	ENST00000356404	ensembl	human	known	74_37	silent	30.43		SNP	0.999	A	7	16
VPS13D	55187	genome.wustl.edu	37	1	12382758	12382758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:12382758G>T	ENST00000358136.3	+	34	8000	c.7870G>T	c.(7870-7872)Gag>Tag	p.E2624*	VPS13D_ENST00000356315.4_Nonsense_Mutation_p.E2624*	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TCGCGTTGGAGAGGAAATCAG	0.478													ENSG00000048707																																					0													93.0	93.0	93.0					1																	12382758		2203	4300	6503	SO:0001587	stop_gained	0			-	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7870G>T	1.37:g.12382758G>T	ENSP00000350854:p.Glu2624*			Nonsense_Mutation	SNP	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E2624*	ENST00000358136.3	37	c.7870	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	16.431406|16.431406	0.99863|0.99863	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|.	.|.	.|.	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	0.572368|0.572368	0.15411|0.15411	N|N	0.263763|0.263763	T|.	0.64800|.	0.2631|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.54629|.	-0.8265|.	5|.	.|0.11794	.|T	.|0.64	.|.	20.1802|20.1802	0.98196|0.98196	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	D|X	1446|2624	.|.	.|ENSP00000348666:E2624X	E|E	+|+	3|1	2|0	VPS13D|VPS13D	12305345|12305345	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.913000|0.913000	0.54294|0.54294	3.717000|3.717000	0.54911|0.54911	2.777000|2.777000	0.95525|0.95525	0.655000|0.655000	0.94253|0.94253	GAG|GAG	-	VPS13D	-	superfamily_UBA-like		0.478	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	0	0		92	92		0.00		G	NM_015378		12382758	+1	4		40		tier1	no_errors	ENST00000358136	ensembl	human	known	74_37	nonsense	9.09		SNP	0.994	T	4	40
RYR2	6262	genome.wustl.edu	37	1	237817712	237817712	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:237817712A>G	ENST00000366574.2	+	52	8280	c.7963A>G	c.(7963-7965)Aag>Gag	p.K2655E	RYR2_ENST00000360064.6_Missense_Mutation_p.K2653E|RYR2_ENST00000542537.1_Missense_Mutation_p.K2639E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2655	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCTGTCTCAAAAGGTAATTTA	0.393													ENSG00000198626																																					0													77.0	75.0	76.0					1																	237817712		1832	4085	5917	SO:0001583	missense	0			-	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7963A>G	1.37:g.237817712A>G	ENSP00000355533:p.Lys2655Glu		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.K2653E	ENST00000366574.2	37	c.7957	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.591359	0.86851	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.94280	-3.39;-3.39;-3.39	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000003	D	0.95921	0.8672	M	0.67953	2.075	0.80722	D	1	D	0.71674	0.998	D	0.68039	0.955	D	0.96197	0.9142	10	0.66056	D	0.02	-20.4917	16.2322	0.82352	1.0:0.0:0.0:0.0	.	2655	Q92736	RYR2_HUMAN	E	2655;2653;2639	ENSP00000355533:K2655E;ENSP00000353174:K2653E;ENSP00000443798:K2639E	ENSP00000353174:K2653E	K	+	1	0	RYR2	235884335	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.273000	0.78527	2.288000	0.76882	0.528000	0.53228	AAG	-	RYR2	-	NULL		0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	0	0		127	127		0.00		A	NM_001035		237817712	+1	12		36		tier1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	25.00		SNP	1.000	G	12	36
FUT5	2527	genome.wustl.edu	37	19	5867290	5867290	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr19:5867290G>T	ENST00000588525.1	-	2	534	c.447C>A	c.(445-447)agC>agA	p.S149R	FUT5_ENST00000252675.5_Missense_Mutation_p.S149R	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	149					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						GGGACTCCATGCTGAACCAGA	0.627													ENSG00000130383																																					0													50.0	44.0	46.0					19																	5867290		2203	4299	6502	SO:0001583	missense	0			-		CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.447C>A	19.37:g.5867290G>T	ENSP00000466880:p.Ser149Arg		A8K4X2	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.S149R	ENST00000588525.1	37	c.447	CCDS12154.1	19	.	.	.	.	.	.	.	.	.	.	G	10.50	1.366413	0.24771	.	.	ENSG00000130383	ENST00000252675	T	0.24908	1.83	2.17	1.11	0.20524	.	0.188472	0.35970	U	0.002861	T	0.40119	0.1104	M	0.92691	3.335	0.09310	N	1	P	0.41546	0.754	P	0.47603	0.551	T	0.35325	-0.9793	10	0.87932	D	0	.	3.6185	0.08086	0.3754:0.0:0.6246:0.0	.	149	Q11128	FUT5_HUMAN	R	149	ENSP00000252675:S149R	ENSP00000252675:S149R	S	-	3	2	FUT5	5818290	0.019000	0.18553	0.007000	0.13788	0.007000	0.05969	1.993000	0.40747	1.211000	0.43351	0.407000	0.27541	AGC	-	FUT5	-	pfam_Glyco_trans_10		0.627	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT5	HGNC	protein_coding	OTTHUMT00000452213.1	0	0		76	76		0.00		G	NM_002034		5867290	-1	4		36		tier1	no_errors	ENST00000252675	ensembl	human	known	74_37	missense	10.00		SNP	0.110	T	4	36
TBC1D1	23216	genome.wustl.edu	37	4	38119814	38119814	+	Splice_Site	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:38119814G>A	ENST00000261439.4	+	17	3317		c.e17+1		TBC1D1_ENST00000508802.1_Intron|TBC1D1_ENST00000407365.1_Splice_Site	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						AGAGTCTTTGGTGAGCATTAG	0.507													ENSG00000065882																																					0													96.0	93.0	94.0					4																	38119814		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.2962+1G>A	4.37:g.38119814G>A			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Splice_Site	SNP	-	e16+1	ENST00000261439.4	37	c.2962+1	CCDS33972.1	4	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142256	0.77775	.	.	ENSG00000065882	ENST00000261439;ENST00000454732;ENST00000510573	.	.	.	5.7	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5961	0.68407	0.0698:0.0:0.9302:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D1	37796209	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.277000	0.95755	1.417000	0.47077	0.655000	0.94253	.	-	TBC1D1	-	-		0.507	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	0	0		88	88		0.00		G	NM_015173	Intron	38119814	+1	6		43		tier1	no_errors	ENST00000261439	ensembl	human	known	74_37	splice_site	12.24		SNP	1.000	A	6	43
ERVFRD-1	405754	genome.wustl.edu	37	6	11105281	11105281	+	Frame_Shift_Del	DEL	G	G	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:11105281delG	ENST00000472091.1	-	2	638	c.263delC	c.(262-264)cctfs	p.P88fs	SMIM13_ENST00000416247.2_Intron|ERVFRD-1_ENST00000542862.1_Frame_Shift_Del_p.P88fs	NM_207582.2	NP_997465.1	P60508	SYCY2_HUMAN	endogenous retrovirus group FRD, member 1	88					syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(4)|stomach(1)	15						ACTATTTGCAGGCCTCATCAG	0.453													ENSG00000244476																																					0													124.0	116.0	119.0					6																	11105281		2203	4300	6503	SO:0001589	frameshift_variant	0				AK075092, AK123938, AY358244	CCDS4519.1	6p24.2	2014-05-02			ENSG00000244476	ENSG00000244476			33823	other	endogenous retrovirus		610524				12970426, 14557543, 15476554, 21542922	Standard	NM_207582		Approved	HERV-W/FRD, HERV-FRD, envFRD, ERVFRDE1, syncytin-2	uc003mzt.3	P60508	OTTHUMG00000159193	ENST00000472091.1:c.263delC	6.37:g.11105281delG	ENSP00000420174:p.Pro88fs			Frame_Shift_Del	DEL	pfam_TLV/ENV_coat_polyprotein	p.P88fs	ENST00000472091.1	37	c.263	CCDS4519.1	6																																																																																				ERVFRD-1	-	NULL		0.453	ERVFRD-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVFRD-1	HGNC	protein_coding	OTTHUMT00000353776.1	0	0		117	117		0.00		G	NM_207582		11105281	-1	16		76		tier1	no_errors	ENST00000472091	ensembl	human	known	74_37	frame_shift_del	17.39		DEL	0.027	-	16	76
FBN1	2200	genome.wustl.edu	37	15	48704928	48704928	+	Silent	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr15:48704928A>G	ENST00000316623.5	-	65	8519	c.8064T>C	c.(8062-8064)tcT>tcC	p.S2688S	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2688					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TGCCCATTCCAGAAACACAGT	0.493													ENSG00000166147																																					0													142.0	139.0	140.0					15																	48704928		2198	4296	6494	SO:0001819	synonymous_variant	0			-	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8064T>C	15.37:g.48704928A>G			B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.S2688	ENST00000316623.5	37	c.8064	CCDS32232.1	15																																																																																			-	FBN1	-	superfamily_Growth_fac_rcpt_N_dom,pirsf_FBN		0.493	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	0	0		44	44		0.00		A			48704928	-1	5		28		tier1	no_errors	ENST00000316623	ensembl	human	known	74_37	silent	15.15		SNP	0.997	G	5	28
TMEM88	92162	genome.wustl.edu	37	17	7758593	7758593	+	Silent	SNP	C	C	T	rs373749404		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr17:7758593C>T	ENST00000301599.6	+	1	211	c.201C>T	c.(199-201)tgC>tgT	p.C67C	CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|CYB5D1_ENST00000570446.1_5'Flank|TMEM88_ENST00000574668.1_Silent_p.C67C|LSMD1_ENST00000570555.1_5'Flank	NM_203411.1	NP_981956.1	Q6PEY1	TMM88_HUMAN	transmembrane protein 88	67					multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(1)	1		all_cancers(10;0.00528)|Prostate(122;0.202)				GCTTCCTCTGCCACTCTCAGG	0.607													ENSG00000167874																																					0								C		0,4404		0,0,2202	49.0	39.0	42.0		201	2.5	1.0	17		42	1,8595		0,1,4297	no	coding-synonymous	TMEM88	NM_203411.1		0,1,6499	TT,TC,CC		0.0116,0.0,0.0077		67/160	7758593	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	0			-	BC057812	CCDS11121.1	17p13.1	2005-12-13				ENSG00000167874			32371	protein-coding gene	gene with protein product							Standard	NM_203411		Approved	MGC71744, FLJ20025	uc002giy.3	Q6PEY1		ENST00000301599.6:c.201C>T	17.37:g.7758593C>T				Silent	SNP	NULL	p.C67	ENST00000301599.6	37	c.201	CCDS11121.1	17																																																																																			-	TMEM88	-	NULL		0.607	TMEM88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM88	HGNC	protein_coding	OTTHUMT00000440252.1	0	0		37	37		0.00		C	NM_203411		7758593	+1	4		24		tier1	no_errors	ENST00000301599	ensembl	human	known	74_37	silent	14.29		SNP	1.000	T	4	24
KRT72	140807	genome.wustl.edu	37	12	52979778	52979779	+	Frame_Shift_Ins	INS	-	-	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr12:52979778_52979779insT	ENST00000537672.2	-	9	1533_1534	c.1523_1524insA	c.(1522-1524)aagfs	p.K508fs	KRT72_ENST00000354310.4_Frame_Shift_Ins_p.K466fs|KRT72_ENST00000293745.2_Frame_Shift_Ins_p.K508fs|KRT72_ENST00000398066.3_Frame_Shift_Ins_p.K320fs	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	508	Tail.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		ATCTGGAGGCCTTTTTGGTGGC	0.564													ENSG00000170486																																					0																																										SO:0001589	frameshift_variant	0				AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.1524dupA	12.37:g.52979783_52979783dupT	ENSP00000441160:p.Lys508fs		B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Frame_Shift_Ins	INS	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.A509fs	ENST00000537672.2	37	c.1524_1523	CCDS8833.1	12																																																																																				KRT72	-	NULL		0.564	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT72	HGNC	protein_coding	OTTHUMT00000405693.1	0	0		58	58		0.00		-	NM_080747		52979779	-1	11		31		tier1	no_errors	ENST00000293745	ensembl	human	known	74_37	frame_shift_ins	26.19		INS	0.980:0.983	T	11	31
AGMAT	79814	genome.wustl.edu	37	1	15905439	15905439	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:15905439C>T	ENST00000375826.3	-	4	777	c.635G>A	c.(634-636)gGt>gAt	p.G212D	DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	212					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		GTCCAGGAGACCCTCATCCAC	0.622													ENSG00000116771																									NSCLC(126;1678 1780 25805 43508 49531)												0													76.0	73.0	74.0					1																	15905439		2203	4300	6503	SO:0001583	missense	0			-	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.635G>A	1.37:g.15905439C>T	ENSP00000364986:p.Gly212Asp		Q5TDH1|Q9H5J3	Missense_Mutation	SNP	pfam_Ureohydrolase,prints_Ureohydrolase,tigrfam_Agmatinase-rel	p.G212D	ENST00000375826.3	37	c.635	CCDS160.1	1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235476	0.79800	.	.	ENSG00000116771	ENST00000375826	T	0.37411	1.2	5.87	4.96	0.65561	Ureohydrolase domain (1);	0.094270	0.64402	D	0.000001	T	0.53948	0.1828	M	0.87827	2.91	0.80722	D	1	B	0.28850	0.225	B	0.41202	0.35	T	0.59231	-0.7493	10	0.62326	D	0.03	-6.7422	13.8011	0.63202	0.0:0.9263:0.0:0.0737	.	212	Q9BSE5	SPEB_HUMAN	D	212	ENSP00000364986:G212D	ENSP00000364986:G212D	G	-	2	0	AGMAT	15778026	1.000000	0.71417	0.958000	0.39756	0.958000	0.62258	5.324000	0.65863	1.497000	0.48584	0.650000	0.86243	GGT	-	AGMAT	-	pfam_Ureohydrolase,tigrfam_Agmatinase-rel		0.622	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGMAT	HGNC	protein_coding	OTTHUMT00000006763.1	0	0		57	57		0.00		C	NM_024758		15905439	-1	4		26		tier1	no_errors	ENST00000375826	ensembl	human	known	74_37	missense	13.33		SNP	1.000	T	4	26
CCDC113	29070	genome.wustl.edu	37	16	58296368	58296368	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr16:58296368T>C	ENST00000219299.4	+	6	786	c.707T>C	c.(706-708)aTt>aCt	p.I236T	CCDC113_ENST00000443128.2_Missense_Mutation_p.I182T	NM_014157.3	NP_054876.2	Q9H0I3	CC113_HUMAN	coiled-coil domain containing 113	236						cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)				large_intestine(4)|lung(6)|ovary(1)|urinary_tract(1)	12						CTTGAGACAATTGAAGCAAGG	0.448													ENSG00000103021																																					0													151.0	135.0	141.0					16																	58296368		2198	4300	6498	SO:0001583	missense	0			-	AL136785	CCDS10795.1, CCDS45497.1	16q21	2008-02-05			ENSG00000103021	ENSG00000103021			25002	protein-coding gene	gene with protein product						11230166, 11042152	Standard	NM_014157		Approved	HSPC065, DKFZp434N1418	uc002ene.3	Q9H0I3	OTTHUMG00000133489	ENST00000219299.4:c.707T>C	16.37:g.58296368T>C	ENSP00000219299:p.Ile236Thr		B2RAQ7|B4DR20|Q9NZX2	Missense_Mutation	SNP	NULL	p.I236T	ENST00000219299.4	37	c.707	CCDS10795.1	16	.	.	.	.	.	.	.	.	.	.	T	20.0	3.931275	0.73327	.	.	ENSG00000103021	ENST00000443128;ENST00000219299	T;T	0.50548	0.86;0.74	5.71	5.71	0.89125	.	0.457372	0.24488	N	0.038098	T	0.67534	0.2903	M	0.91459	3.21	0.49915	D	0.999833	D;D	0.58268	0.982;0.982	P;P	0.52159	0.691;0.691	T	0.76479	-0.2944	10	0.87932	D	0	-5.3034	13.9205	0.63928	0.0:0.0:0.0:1.0	.	182;236	B4DR20;Q9H0I3	.;CC113_HUMAN	T	182;236	ENSP00000402588:I182T;ENSP00000219299:I236T	ENSP00000219299:I236T	I	+	2	0	CCDC113	56853869	1.000000	0.71417	0.969000	0.41365	0.749000	0.42624	5.863000	0.69568	2.185000	0.69588	0.523000	0.50628	ATT	-	CCDC113	-	NULL		0.448	CCDC113-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC113	HGNC	protein_coding	OTTHUMT00000257387.2	0	0		97	97		0.00		T	NM_014157		58296368	+1	9		22		tier1	no_errors	ENST00000219299	ensembl	human	known	74_37	missense	29.03		SNP	1.000	C	9	22
ZNF716	441234	genome.wustl.edu	37	7	57522798	57522798	+	Silent	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr7:57522798A>G	ENST00000420713.1	+	3	298	c.186A>G	c.(184-186)ccA>ccG	p.P62P		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						TCTCTAAGCCAGACTTGATCA	0.373													ENSG00000182111																																					0													103.0	83.0	89.0					7																	57522798		692	1591	2283	SO:0001819	synonymous_variant	0			-	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.186A>G	7.37:g.57522798A>G				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P62	ENST00000420713.1	37	c.186	CCDS55112.1	7																																																																																			-	ZNF716	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.373	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF716	HGNC	protein_coding	OTTHUMT00000345309.1	0	0		212	212		0.00		A	NM_001159279		57522798	+1	16		167		tier1	no_errors	ENST00000420713	ensembl	human	known	74_37	silent	8.74		SNP	0.934	G	16	167
DBX1	120237	genome.wustl.edu	37	11	20180809	20180809	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:20180809G>A	ENST00000524983.2	-	2	685	c.397C>T	c.(397-399)Cct>Tct	p.P133S	DBX1_ENST00000227256.3_Missense_Mutation_p.P133S			A6NMT0	DBX1_HUMAN	developing brain homeobox 1	133					regulation of transcription from RNA polymerase II promoter (GO:0006357)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)	21						GTCTTGGGAGGGACGCTCTGG	0.527													ENSG00000109851																																					0													152.0	140.0	144.0					11																	20180809		2203	4300	6503	SO:0001583	missense	0			-			11p15.1	2011-06-20				ENSG00000109851		"""Homeoboxes / ANTP class : NKL subclass"""	33185	protein-coding gene	gene with protein product						11239429	Standard	NM_001029865		Approved		uc021qey.1	A6NMT0		ENST00000524983.2:c.397C>T	11.37:g.20180809G>A	ENSP00000436881:p.Pro133Ser			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P133S	ENST00000524983.2	37	c.397		11	.	.	.	.	.	.	.	.	.	.	G	12.69	2.012330	0.35511	.	.	ENSG00000109851	ENST00000524983;ENST00000227256	D;T	0.92249	-3.0;0.13	5.43	5.43	0.79202	.	0.183165	0.48286	D	0.000199	D	0.87245	0.6129	L	0.36672	1.1	0.41022	D	0.985084	P	0.42518	0.782	B	0.34652	0.187	D	0.86128	0.1573	10	0.22706	T	0.39	-9.8346	19.2459	0.93902	0.0:0.0:1.0:0.0	.	133	F8W811	.	S	133	ENSP00000436881:P133S;ENSP00000227256:P133S	ENSP00000227256:P133S	P	-	1	0	DBX1	20137385	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	4.325000	0.59234	2.551000	0.86045	0.655000	0.94253	CCT	-	DBX1	-	NULL		0.527	DBX1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	DBX1	HGNC	protein_coding	OTTHUMT00000387585.2	0	0		25	25		0.00		G	NM_001029865		20180809	-1	4		19		tier1	no_errors	ENST00000227256	ensembl	human	known	74_37	missense	17.39		SNP	1.000	A	4	19
RGPD4	285190	genome.wustl.edu	37	2	108487751	108487751	+	Silent	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr2:108487751A>G	ENST00000408999.3	+	20	3368	c.3291A>G	c.(3289-3291)agA>agG	p.R1097R	RGPD4_ENST00000354986.4_Silent_p.R1097R	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1097	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GCAAACCAAGAATGCTGATGC	0.418													ENSG00000196862																																					0													18.0	13.0	15.0					2																	108487751		691	1576	2267	SO:0001819	synonymous_variant	0			-	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3291A>G	2.37:g.108487751A>G			B9A029	Silent	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.R1097	ENST00000408999.3	37	c.3291	CCDS46381.1	2																																																																																			-	RGPD4	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom		0.418	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	0	0		397	397		0.00		A	XM_496581		108487751	+1	36		258		tier1	no_errors	ENST00000354986	ensembl	human	known	74_37	silent	12.24		SNP	0.994	G	36	258
SH3TC1	54436	genome.wustl.edu	37	4	8221200	8221200	+	Missense_Mutation	SNP	C	C	T	rs141671122	byFrequency	TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:8221200C>T	ENST00000245105.3	+	9	1122	c.1055C>T	c.(1054-1056)tCg>tTg	p.S352L	SH3TC1_ENST00000539824.1_Missense_Mutation_p.S276L	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	352	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.									NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						CACGCAGCCTCGGGCCGGGTG	0.692													ENSG00000125089	C|||	3	0.000599042	0.0	0.0	5008	,	,		13848	0.0		0.0	False		,,,				2504	0.0031				NSCLC(145;2298 2623 35616 37297)												0								C	LEU/SER	1,4401		0,1,2200	27.0	32.0	30.0		1055	3.3	0.1	4	dbSNP_134	30	18,8578	11.9+/-42.8	0,18,4280	no	missense	SH3TC1	NM_018986.3	145	0,19,6480	TT,TC,CC		0.2094,0.0227,0.1462	probably-damaging	352/1337	8221200	19,12979	2201	4298	6499	SO:0001583	missense	0			-	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.1055C>T	4.37:g.8221200C>T	ENSP00000245105:p.Ser352Leu		Q4W5G5	Missense_Mutation	SNP	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.S352L	ENST00000245105.3	37	c.1055	CCDS3399.1	4	.	.	.	.	.	.	.	.	.	.	C	15.10	2.732513	0.48939	2.27E-4	0.002094	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.18174	2.23;2.23	4.21	3.34	0.38264	Src homology-3 domain (3);	0.077169	0.50627	D	0.000116	T	0.33352	0.0860	M	0.64404	1.975	0.09310	N	1	D	0.69078	0.997	P	0.62014	0.897	T	0.08391	-1.0724	10	0.87932	D	0	-7.5929	11.1969	0.48717	0.0:0.8138:0.1862:0.0	.	352	Q8TE82	S3TC1_HUMAN	L	90;352;276;181	ENSP00000245105:S352L;ENSP00000441045:S276L	ENSP00000245105:S352L	S	+	2	0	SH3TC1	8272100	0.996000	0.38824	0.113000	0.21522	0.288000	0.27193	5.249000	0.65427	0.716000	0.32124	0.491000	0.48974	TCG	rs141671122	SH3TC1	-	superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.692	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2	0	0		274	274		0.00		C	NM_018986		8221200	+1	19		154		tier1	no_errors	ENST00000245105	ensembl	human	known	74_37	missense	10.92		SNP	0.025	T	19	154
CEPT1	10390	genome.wustl.edu	37	1	111690319	111690320	+	5'UTR	INS	-	-	A	rs577424942|rs560770564|rs529661950	byFrequency	TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:111690319_111690320insA	ENST00000545121.1	+	0	191_192				CEPT1_ENST00000357172.4_5'UTR	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	CTTTAAATATTAAAAAAAAACA	0.361													ENSG00000134255																																					0																																										SO:0001623	5_prime_UTR_variant	0				AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.-17->A	1.37:g.111690328_111690328dupA			Q69YJ9|Q9P0Y8	R	INS	-	NULL	ENST00000545121.1	37	NULL	CCDS830.1	1																																																																																				CEPT1	-	-		0.361	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEPT1	HGNC	protein_coding	OTTHUMT00000034462.2	0	0		44	44		0.00		-	NM_006090		111690320	+1	2		21		tier1	no_errors	ENST00000460443	ensembl	human	known	74_37	rna	8.70		INS	0.002:0.005	A	2	21
LEKR1	389170	genome.wustl.edu	37	3	156645279	156645279	+	5'UTR	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:156645279A>G	ENST00000470811.1	+	0	559				LEKR1_ENST00000356539.4_Missense_Mutation_p.K149E|LEKR1_ENST00000489350.1_Intron			Q6ZMV7	LEKR1_HUMAN	leucine, glutamate and lysine rich 1											breast(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	11			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			TACTTTTACTAAAAGGGAACT	0.259													ENSG00000197980																																					0													26.0	25.0	25.0					3																	156645279		689	1541	2230	SO:0001623	5_prime_UTR_variant	0			-	AK131473	CCDS54660.1	3q25.31	2014-02-12	2008-02-21		ENSG00000197980	ENSG00000197980			33765	protein-coding gene	gene with protein product		613536					Standard	NM_001004316		Approved	FLJ16641	uc021xgh.1	Q6ZMV7	OTTHUMG00000160130	ENST00000470811.1:c.-777A>G	3.37:g.156645279A>G				Missense_Mutation	SNP	superfamily_Ribosomal_L29	p.K149E	ENST00000470811.1	37	c.445		3	.	.	.	.	.	.	.	.	.	.	A	17.92	3.507101	0.64410	.	.	ENSG00000178110	ENST00000356539	T	0.55760	0.5	5.28	5.28	0.74379	.	.	.	.	.	T	0.30417	0.0764	.	.	.	0.21697	N	0.999585	.	.	.	.	.	.	T	0.12967	-1.0527	6	0.06494	T	0.89	.	11.6127	0.51069	1.0:0.0:0.0:0.0	.	.	.	.	E	149	ENSP00000348936:K149E	ENSP00000348936:K149E	K	+	1	0	LEKR1	158127973	1.000000	0.71417	0.995000	0.50966	0.670000	0.39368	4.784000	0.62411	1.977000	0.57605	0.533000	0.62120	AAA	-	LEKR1	-	NULL		0.259	LEKR1-010	KNOWN	upstream_ATG|basic	protein_coding	LEKR1	HGNC	protein_coding	OTTHUMT00000351625.3	0	0		345	345		0.00		A	NM_001004316		156645279	+1	25		172		tier1	no_errors	ENST00000356539	ensembl	human	known	74_37	missense	12.69		SNP	0.993	G	25	172
PCDHA11	56138	genome.wustl.edu	37	5	140250813	140250813	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:140250813C>A	ENST00000398640.2	+	1	2125	c.2125C>A	c.(2125-2127)Ctc>Atc	p.L709I	PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	709					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGTCCAGCCTCCTGGTACT	0.672													ENSG00000249158																																					0													44.0	45.0	45.0					5																	140250813		2203	4299	6502	SO:0001583	missense	0			-	AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.2125C>A	5.37:g.140250813C>A	ENSP00000381636:p.Leu709Ile		B2RN58|O75279	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L709I	ENST00000398640.2	37	c.2125	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	C	8.552	0.875782	0.17395	.	.	ENSG00000249158	ENST00000398640	T	0.24151	1.87	4.75	3.66	0.41972	.	.	.	.	.	T	0.44138	0.1279	M	0.83852	2.665	0.22796	N	0.998723	D;D	0.69078	0.997;0.995	P;P	0.60345	0.873;0.751	T	0.28744	-1.0034	9	0.29301	T	0.29	.	6.5347	0.22346	0.1683:0.6783:0.0:0.1534	.	709;709	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	I	709	ENSP00000381636:L709I	ENSP00000381636:L709I	L	+	1	0	PCDHA11	140230997	0.001000	0.12720	0.995000	0.50966	0.197000	0.23852	0.010000	0.13242	2.176000	0.68965	0.655000	0.94253	CTC	-	PCDHA11	-	NULL		0.672	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	HGNC	protein_coding	OTTHUMT00000372885.2	0	0		87	87		0.00		C	NM_018902		140250813	+1	8		33		tier1	no_errors	ENST00000398640	ensembl	human	known	74_37	missense	19.51		SNP	0.990	A	8	33
CIITA	4261	genome.wustl.edu	37	16	11000787	11000787	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr16:11000787G>A	ENST00000324288.8	+	11	1571	c.1438G>A	c.(1438-1440)Gcc>Acc	p.A480T	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	480	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)			central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						ACTCGTGGCGGCCGATGAGGT	0.592			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								ENSG00000179583																												Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	0													67.0	69.0	68.0					16																	11000787		2195	4293	6488	SO:0001583	missense	0			-	U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.1438G>A	16.37:g.11000787G>A	ENSP00000316328:p.Ala480Thr		A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Missense_Mutation	SNP	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_CHT_NTPase,prints_MHC_II_transact	p.A480T	ENST00000324288.8	37	c.1438	CCDS10544.1	16	.	.	.	.	.	.	.	.	.	.	G	5.199	0.222236	0.09863	.	.	ENSG00000179583	ENST00000324288;ENST00000388910	D	0.81579	-1.51	5.27	4.22	0.49857	NACHT nucleoside triphosphatase (1);	0.455261	0.20291	N	0.095238	T	0.63224	0.2493	N	0.14661	0.345	0.09310	N	0.999993	B;B;B;B	0.28783	0.034;0.076;0.067;0.222	B;B;B;B	0.33960	0.05;0.102;0.03;0.173	T	0.49872	-0.8893	10	0.33141	T	0.24	.	4.1344	0.10164	0.31:0.0:0.69:0.0	.	480;480;432;480	A0N0N9;P33076;F2Z2G8;Q96KL4	.;C2TA_HUMAN;.;.	T	480;432	ENSP00000316328:A480T	ENSP00000316328:A480T	A	+	1	0	CIITA	10908288	0.028000	0.19301	0.068000	0.19968	0.003000	0.03518	2.309000	0.43699	2.442000	0.82660	0.561000	0.74099	GCC	-	CIITA	-	superfamily_P-loop_NTPase,pfscan_CHT_NTPase		0.592	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	0	0		87	87		0.00		G	NM_000246		11000787	+1	4		38		tier1	no_errors	ENST00000324288	ensembl	human	known	74_37	missense	9.52		SNP	0.009	A	4	38
WISP2	8839	genome.wustl.edu	37	20	43343871	43343876	+	Intron	DEL	TGTGTG	TGTGTG	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	TGTGTG	TGTGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr20:43343871_43343876delTGTGTG	ENST00000372868.2	+	1	318				WISP2_ENST00000372865.4_5'UTR|RP11-445H22.4_ENST00000445420.1_RNA|RP11-445H22.4_ENST00000427598.1_RNA|RP11-445H22.4_ENST00000427303.1_RNA|WISP2_ENST00000190983.4_5'Flank			O76076	WISP2_HUMAN	WNT1 inducible signaling pathway protein 2						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				skin(1)	1		Myeloproliferative disorder(115;0.0122)				CTAgtgtgtttgtgtgtgtgtgtgtg	0.573													ENSG00000064205																																					0																																										SO:0001627	intron_variant	0				AF100780	CCDS13336.1	20q13.12	2007-05-14			ENSG00000064205	ENSG00000064205			12770	protein-coding gene	gene with protein product		603399				9843955	Standard	NM_003881		Approved	CT58, CTGF-L, CCN5	uc002xmp.3	O76076	OTTHUMG00000033071	ENST00000372868.2:c.-26+69TGTGTG>-	20.37:g.43343877_43343882delTGTGTG			B2R9N4|E1P612|Q6PEG3	R	DEL	-	NULL	ENST00000372868.2	37	NULL	CCDS13336.1	20																																																																																				WISP2	-	-		0.573	WISP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WISP2	HGNC	protein_coding	OTTHUMT00000127824.1									TGTGTG	NM_003881		43343876	+1					tier1	no_errors	ENST00000497421	ensembl	human	known	74_37	rna			DEL	0.044:0.049:0.052:0.062:0.059:0.007	-		
AMBRA1	55626	genome.wustl.edu	37	11	46456427	46456427	+	Silent	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:46456427C>A	ENST00000458649.2	-	13	3211	c.2793G>T	c.(2791-2793)ctG>ctT	p.L931L	AMBRA1_ENST00000426438.1_Silent_p.L902L|AMBRA1_ENST00000298834.3_Silent_p.L871L|AMBRA1_ENST00000534300.1_Silent_p.L871L|AMBRA1_ENST00000314845.3_Silent_p.L841L|AMBRA1_ENST00000533727.1_Silent_p.L812L|AMBRA1_ENST00000528950.1_Silent_p.L902L			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	931					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		GCATTTCGCCCAGGTTATGGG	0.577													ENSG00000110497																																					0													82.0	69.0	74.0					11																	46456427		2201	4299	6500	SO:0001819	synonymous_variant	0			-	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.2793G>T	11.37:g.46456427C>A			A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L931	ENST00000458649.2	37	c.2793		11																																																																																			-	AMBRA1	-	NULL		0.577	AMBRA1-005	KNOWN	basic	protein_coding	AMBRA1	HGNC	protein_coding	OTTHUMT00000390103.1	0	0		110	110		0.00		C	NM_017749		46456427	-1	18		36		tier1	no_errors	ENST00000458649	ensembl	human	known	74_37	silent	33.33		SNP	1.000	A	18	36
OR8K1	390157	genome.wustl.edu	37	11	56113793	56113793	+	Silent	SNP	G	G	T	rs372174600		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:56113793G>T	ENST00000279783.2	+	1	373	c.279G>T	c.(277-279)gtG>gtT	p.V93V		NM_001002907.1	NP_001002907.1	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(8)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Esophageal squamous(21;0.00448)					ACTTCATAGTGCACAAAAACA	0.393										HNSCC(65;0.19)			ENSG00000150261																																					0													171.0	166.0	167.0					11																	56113793		2201	4296	6497	SO:0001819	synonymous_variant	0			-	AB065835	CCDS31528.1	11q11	2012-08-09			ENSG00000150261	ENSG00000150261		"""GPCR / Class A : Olfactory receptors"""	14831	protein-coding gene	gene with protein product							Standard	NM_001002907		Approved		uc010rjg.2	Q8NGG5	OTTHUMG00000166858	ENST00000279783.2:c.279G>T	11.37:g.56113793G>T			B9EJB1|Q6IFC3|Q96RC1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V93	ENST00000279783.2	37	c.279	CCDS31528.1	11																																																																																			-	OR8K1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.393	OR8K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K1	HGNC	protein_coding	OTTHUMT00000391605.1	0	0		32	32		0.00		G	NM_001002907		56113793	+1	3		22		tier1	no_errors	ENST00000279783	ensembl	human	known	74_37	silent	12.00		SNP	0.000	T	3	22
PGA5	5222	genome.wustl.edu	37	11	61015868	61015868	+	Intron	SNP	T	T	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:61015868T>A	ENST00000312403.5	+	6	841				PGA4_ENST00000422676.2_Intron|CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000451616.2_Missense_Mutation_p.S58T|PGA5_ENST00000541528.1_5'Flank	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)						digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						AAAATTCATGTCTTCTCCCCT	0.517													ENSG00000256713																																					0													331.0	333.0	332.0					11																	61015868		2202	4299	6501	SO:0001627	intron_variant	0			-	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.657-23T>A	11.37:g.61015868T>A			A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.S58T	ENST00000312403.5	37	c.172	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	T	11.11	1.541365	0.27563	.	.	ENSG00000256713	ENST00000451616	T	0.36520	1.25	2.05	-0.779	0.10973	.	.	.	.	.	T	0.31358	0.0794	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34354	-0.9832	6	0.66056	D	0.02	.	4.5325	0.12011	0.1782:0.0:0.3622:0.4596	.	.	.	.	T	58	ENSP00000408739:S58T	ENSP00000408739:S58T	S	+	1	0	PGA5	60772444	0.000000	0.05858	0.001000	0.08648	0.367000	0.29736	-0.120000	0.10660	-0.171000	0.10797	0.344000	0.21773	TCT	-	PGA5	-	NULL		0.517	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	HGNC	protein_coding	OTTHUMT00000397972.1	0	0		296	296		0.00		T	NM_014224		61015868	+1	30		118		tier1	no_errors	ENST00000451616	ensembl	human	putative	74_37	missense	20.27		SNP	0.001	A	30	118
PFN2	5217	genome.wustl.edu	37	3	149688614	149688614	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:149688614G>T	ENST00000239940.7	-	1	282	c.30C>A	c.(28-30)aaC>aaA	p.N10K	PFN2_ENST00000452853.2_Missense_Mutation_p.N10K|AC117395.1_ENST00000593416.1_5'Flank|PFN2_ENST00000489155.1_Intron|PFN2_ENST00000461930.1_Missense_Mutation_p.N10K|PFN2_ENST00000481275.1_5'Flank|PFN2_ENST00000494827.1_Intron|PFN2_ENST00000497148.1_Intron|PFN2_ENST00000475518.1_5'Flank|PFN2_ENST00000461868.1_Missense_Mutation_p.N10K|PFN2_ENST00000481767.1_5'Flank|PFN2_ENST00000490975.1_Missense_Mutation_p.N10K|PFN2_ENST00000498307.1_Intron|PFN2_ENST00000423691.2_Missense_Mutation_p.N10K			P35080	PROF2_HUMAN	profilin 2	10					actin cytoskeleton organization (GO:0030036)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|regulation of synaptic vesicle exocytosis (GO:2000300)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|terminal bouton (GO:0043195)	actin monomer binding (GO:0003785)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CGCACATCAGGTTATCCACGT	0.672													ENSG00000070087																																					0													19.0	17.0	18.0					3																	149688614		1992	3902	5894	SO:0001583	missense	0			-	L10678	CCDS3148.1, CCDS46934.1	3q25.1	2006-10-16			ENSG00000070087	ENSG00000070087			8882	protein-coding gene	gene with protein product		176590				8975700, 8365484	Standard	NM_002628		Approved		uc003ext.1	P35080	OTTHUMG00000159683	ENST00000239940.7:c.30C>A	3.37:g.149688614G>T	ENSP00000239940:p.Asn10Lys		B2R4C8|D3DNI4|Q4VBQ4|Q8WVF9|Q9HBK2	Missense_Mutation	SNP	pfam_Profilin_eukaryotes/bac,superfamily_Profilin_eukaryotes/bac,smart_Profilin_eukaryotes/bac,prints_Profilin_chordates,prints_Profilin_eukaryotes/bac	p.N10K	ENST00000239940.7	37	c.30	CCDS3148.1	3	.	.	.	.	.	.	.	.	.	.	.	20.6	4.020937	0.75275	.	.	ENSG00000070087	ENST00000452853;ENST00000239940;ENST00000423691;ENST00000490975;ENST00000461930;ENST00000461868	D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	3.28	3.28	0.37604	.	0.171785	0.48767	U	0.000172	D	0.90239	0.6948	M	0.66939	2.045	0.50813	D	0.999899	D;D;D	0.76494	0.987;0.999;0.965	P;P;P	0.62560	0.727;0.904;0.52	D	0.89987	0.4105	10	0.56958	D	0.05	.	9.9994	0.41920	0.0:0.2081:0.7919:0.0	.	10;204;10	G5E9Q6;D3DNI2;P35080	.;.;PROF2_HUMAN	K	10	ENSP00000410464:N10K;ENSP00000239940:N10K;ENSP00000408283:N10K;ENSP00000417351:N10K;ENSP00000417912:N10K;ENSP00000420244:N10K	ENSP00000239940:N10K	N	-	3	2	PFN2	151171304	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.416000	0.52707	1.537000	0.49254	0.460000	0.39030	AAC	-	PFN2	-	pfam_Profilin_eukaryotes/bac,superfamily_Profilin_eukaryotes/bac,smart_Profilin_eukaryotes/bac,prints_Profilin_chordates,prints_Profilin_eukaryotes/bac		0.672	PFN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PFN2	HGNC	protein_coding	OTTHUMT00000356873.2	0	0		45	45		0.00		G	NM_002628		149688614	-1	4		25		tier1	no_errors	ENST00000239940	ensembl	human	known	74_37	missense	13.33		SNP	1.000	T	4	25
LAMC1	3915	genome.wustl.edu	37	1	183086705	183086705	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:183086705A>G	ENST00000258341.4	+	10	1981	c.1724A>G	c.(1723-1725)cAg>cGg	p.Q575R		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	575	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AGTTATGGTCAGAACCTCTCC	0.502													ENSG00000135862																																					0													153.0	136.0	142.0					1																	183086705		2203	4300	6503	SO:0001583	missense	0			-	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.1724A>G	1.37:g.183086705A>G	ENSP00000258341:p.Gln575Arg		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.Q575R	ENST00000258341.4	37	c.1724	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.294544	0.81025	.	.	ENSG00000135862	ENST00000258341	T	0.35048	1.33	5.14	5.14	0.70334	Laminin B type IV (2);Laminin B, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.53302	0.1788	M	0.66506	2.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53358	-0.8450	10	0.06494	T	0.89	.	14.9568	0.71120	1.0:0.0:0.0:0.0	.	575	P11047	LAMC1_HUMAN	R	575	ENSP00000258341:Q575R	ENSP00000258341:Q575R	Q	+	2	0	LAMC1	181353328	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.599000	0.90856	1.933000	0.56026	0.533000	0.62120	CAG	-	LAMC1	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV		0.502	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	0	0		70	70		0.00		A	NM_002293		183086705	+1	4		42		tier1	no_errors	ENST00000258341	ensembl	human	known	74_37	missense	8.70		SNP	1.000	G	4	42
TMEM192	201931	genome.wustl.edu	37	4	166000894	166000894	+	Nonsense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:166000894G>T	ENST00000306480.6	-	6	877	c.732C>A	c.(730-732)taC>taA	p.Y244*	TMEM192_ENST00000506087.1_Nonsense_Mutation_p.Y240*	NM_001100389.1	NP_001093859.1	Q8IY95	TM192_HUMAN	transmembrane protein 192	244						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0926)		GTCGCTTCAGGTATTCAATGG	0.443													ENSG00000170088																																					0													121.0	114.0	116.0					4																	166000894		1908	4134	6042	SO:0001587	stop_gained	0			-	BC036301	CCDS43279.1	4q32.3	2008-04-22			ENSG00000170088	ENSG00000170088			26775	protein-coding gene	gene with protein product						12477932	Standard	NM_001100389		Approved	FLJ38482	uc003iqz.4	Q8IY95	OTTHUMG00000161254	ENST00000306480.6:c.732C>A	4.37:g.166000894G>T	ENSP00000305069:p.Tyr244*		Q7Z3A1|Q8N928	Nonsense_Mutation	SNP	NULL	p.Y244*	ENST00000306480.6	37	c.732	CCDS43279.1	4	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286430	0.59867	.	.	ENSG00000170088	ENST00000306480;ENST00000506087	.	.	.	5.97	2.39	0.29439	.	0.056144	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9584	8.5716	0.33572	0.3125:0.0:0.6875:0.0	.	.	.	.	X	244;240	.	ENSP00000305069:Y244X	Y	-	3	2	TMEM192	166220344	1.000000	0.71417	0.725000	0.30721	0.069000	0.16628	0.640000	0.24705	0.446000	0.26666	-0.218000	0.12543	TAC	-	TMEM192	-	NULL		0.443	TMEM192-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM192	HGNC	protein_coding	OTTHUMT00000364310.3	0	0		98	98		0.00		G	NM_152681		166000894	-1	4		46		tier1	no_errors	ENST00000306480	ensembl	human	known	74_37	nonsense	8.00		SNP	0.971	T	4	46
LINC00652	29075	genome.wustl.edu	37	20	18772427	18772427	+	lincRNA	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr20:18772427G>T	ENST00000412553.1	-	0	329				RP5-1068E13.7_ENST00000609087.1_lincRNA	NR_026884.1				long intergenic non-protein coding RNA 652																		AAGATGTGGAGAGCCCATCCA	0.453													ENSG00000179935																																					0																																												0			-	AF161557, BC029555		20p11.23	2012-10-12			ENSG00000179935	ENSG00000179935		"""Long non-coding RNAs"""	25003	non-coding RNA	RNA, long non-coding						11042152	Standard	NR_026883		Approved	HSPC072	uc002wrh.3		OTTHUMG00000031986		20.37:g.18772427G>T				R	SNP	-	NULL	ENST00000412553.1	37	NULL		20																																																																																			-	LINC00652	-	-		0.453	LINC00652-003	KNOWN	basic	lincRNA	LINC00652	HGNC	lincRNA	OTTHUMT00000078198.1	0	0		86	86		0.00		G	NR_026883		18772427	-1	4		44		tier1	no_errors	ENST00000454749	ensembl	human	known	74_37	rna	8.33		SNP	0.000	T	4	44
KCNQ2	3785	genome.wustl.edu	37	20	62038497	62038497	+	Missense_Mutation	SNP	C	C	T	rs543477138		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr20:62038497C>T	ENST00000359125.2	-	17	2293	c.2119G>A	c.(2119-2121)Gcg>Acg	p.A707T	KCNQ2_ENST00000357249.2_Missense_Mutation_p.A689T|KCNQ2_ENST00000360480.3_Missense_Mutation_p.A679T|KCNQ2_ENST00000354587.3_Missense_Mutation_p.A715T|KCNQ2_ENST00000344462.4_Missense_Mutation_p.A676T|KCNQ2_ENST00000370224.1_Missense_Mutation_p.A715T|KCNQ2_ENST00000359689.1_Missense_Mutation_p.A707T	NM_172107.2	NP_742105.1	O43526	KCNQ2_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 2	707					axon guidance (GO:0007411)|nervous system development (GO:0007399)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|liver(1)|lung(30)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	65	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	ACAgggggcgcggccgggggc	0.711													ENSG00000075043																																					0													5.0	6.0	5.0					20																	62038497		2041	4078	6119	SO:0001583	missense	0			-	AF033348	CCDS13518.1, CCDS13519.1, CCDS13520.1, CCDS13521.1, CCDS46629.1	20q13.33	2012-07-05			ENSG00000075043	ENSG00000075043		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6296	protein-coding gene	gene with protein product		602235		EBN, EBN1		9425895, 16382104	Standard	NM_172107		Approved	Kv7.2, ENB1, BFNC, KCNA11, HNSPC	uc002yex.3	O43526	OTTHUMG00000033049	ENST00000359125.2:c.2119G>A	20.37:g.62038497C>T	ENSP00000352035:p.Ala707Thr		O43796|O75580|O95845|Q4VXP4|Q4VXR6|Q5VYT8|Q96J59|Q99454	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.A715T	ENST00000359125.2	37	c.2143	CCDS13520.1	20	.	.	.	.	.	.	.	.	.	.	C	3.761	-0.049564	0.07407	.	.	ENSG00000075043	ENST00000357249;ENST00000359125;ENST00000370226;ENST00000354587;ENST00000359689;ENST00000430658;ENST00000360480;ENST00000344462;ENST00000370224	D;D;D;D;D;D;D;D;D	0.99005	-5.17;-5.32;-5.32;-5.11;-5.32;-5.17;-5.17;-5.26;-5.11	4.5	0.844	0.18943	.	0.510450	0.17649	U	0.166750	D	0.92948	0.7756	N	0.02539	-0.55	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.0	B;B;B;B	0.06405	0.001;0.002;0.001;0.0	D	0.87991	0.2749	10	0.15066	T	0.55	-18.663	8.3989	0.32574	0.0:0.5829:0.0:0.4171	.	679;689;676;707	O43526-3;O43526-2;O43526-4;O43526	.;.;.;KCNQ2_HUMAN	T	689;707;677;715;707;676;679;703;715	ENSP00000349789:A689T;ENSP00000352035:A707T;ENSP00000359246:A677T;ENSP00000346601:A715T;ENSP00000352718:A707T;ENSP00000399612:A676T;ENSP00000353668:A679T;ENSP00000339611:A703T;ENSP00000359244:A715T	ENSP00000339611:A703T	A	-	1	0	KCNQ2	61508941	0.000000	0.05858	0.004000	0.12327	0.148000	0.21650	0.648000	0.24828	0.331000	0.23511	0.491000	0.48974	GCG	-	KCNQ2	-	NULL		0.711	KCNQ2-003	KNOWN	basic|CCDS	protein_coding	KCNQ2	HGNC	protein_coding	OTTHUMT00000080353.1	0	0		35	35		0.00		C	NM_172109		62038497	-1	6		26		tier1	no_errors	ENST00000354587	ensembl	human	known	74_37	missense	18.75		SNP	0.000	T	6	26
PKHD1	5314	genome.wustl.edu	37	6	51776645	51776645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:51776645C>A	ENST00000371117.3	-	39	6717	c.6442G>T	c.(6442-6444)Gag>Tag	p.E2148*	PKHD1_ENST00000340994.4_Nonsense_Mutation_p.E2148*	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2148					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTCTCCCTCTCATTAGTGAGA	0.433													ENSG00000170927																																					0													125.0	120.0	122.0					6																	51776645		2203	4300	6503	SO:0001587	stop_gained	0			-	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.6442G>T	6.37:g.51776645C>A	ENSP00000360158:p.Glu2148*		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Nonsense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.E2148*	ENST00000371117.3	37	c.6442	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	.	48	14.691660	0.99806	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	.	.	.	5.84	5.84	0.93424	.	0.224065	0.39083	N	0.001471	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	17.2906	0.87154	0.0:1.0:0.0:0.0	.	.	.	.	X	2148	.	ENSP00000341097:E2148X	E	-	1	0	PKHD1	51884604	0.996000	0.38824	0.953000	0.39169	0.488000	0.33401	4.334000	0.59291	2.765000	0.95021	0.655000	0.94253	GAG	-	PKHD1	-	NULL		0.433	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	0	0		38	38		0.00		C	NM_138694		51776645	-1	8		23		tier1	no_errors	ENST00000371117	ensembl	human	known	74_37	nonsense	25.81		SNP	0.992	A	8	23
GRIN3A	116443	genome.wustl.edu	37	9	104499623	104499623	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr9:104499623G>C	ENST00000361820.3	-	1	1239	c.639C>G	c.(637-639)agC>agG	p.S213R		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	213					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	GCAGGACTAAGCTGACCAAGT	0.612													ENSG00000198785																																					0													79.0	71.0	74.0					9																	104499623		2203	4300	6503	SO:0001583	missense	0			-		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.639C>G	9.37:g.104499623G>C	ENSP00000355155:p.Ser213Arg		B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.S213R	ENST00000361820.3	37	c.639	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131723	0.56828	.	.	ENSG00000198785	ENST00000361820	D	0.86366	-2.11	5.54	3.65	0.41850	.	0.187696	0.45126	D	0.000394	D	0.88966	0.6581	L	0.56769	1.78	0.45108	D	0.998123	D	0.63046	0.992	P	0.60236	0.871	D	0.88391	0.3008	10	0.87932	D	0	.	7.0094	0.24853	0.2156:0.1342:0.6503:0.0	.	213	Q8TCU5	NMD3A_HUMAN	R	213	ENSP00000355155:S213R	ENSP00000355155:S213R	S	-	3	2	GRIN3A	103539444	0.893000	0.30496	0.995000	0.50966	0.950000	0.60333	0.127000	0.15790	1.297000	0.44761	0.655000	0.94253	AGC	-	GRIN3A	-	superfamily_Peripla_BP_I		0.612	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	0	0		49	49		0.00		G			104499623	-1	6		48		tier1	no_errors	ENST00000361820	ensembl	human	known	74_37	missense	10.91		SNP	0.746	C	6	48
WDR81	124997	genome.wustl.edu	37	17	1630732	1630732	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr17:1630732C>T	ENST00000409644.1	+	1	2479	c.2479C>T	c.(2479-2481)Cag>Tag	p.Q827*	WDR81_ENST00000309182.5_Intron|WDR81_ENST00000437219.2_Intron|WDR81_ENST00000419248.1_Intron|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_Intron	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	827					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CACACTCCTGCAGATGAGTGG	0.647													ENSG00000167716																																					0													25.0	30.0	28.0					17																	1630732		691	1590	2281	SO:0001587	stop_gained	0			-	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.2479C>T	17.37:g.1630732C>T	ENSP00000386609:p.Gln827*		B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q827*	ENST00000409644.1	37	c.2479	CCDS54062.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.483798	0.96307	.	.	ENSG00000167716	ENST00000409644	.	.	.	5.68	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	16.8895	0.86083	0.0:0.8718:0.1282:0.0	.	.	.	.	X	827	.	ENSP00000386609:Q827X	Q	+	1	0	WDR81	1577482	1.000000	0.71417	0.998000	0.56505	0.218000	0.24690	3.202000	0.51067	1.418000	0.47098	-0.233000	0.12211	CAG	-	WDR81	-	NULL		0.647	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	0	0		89	89		0.00		C	NM_152348		1630732	+1	23		71		tier1	no_errors	ENST00000409644	ensembl	human	known	74_37	nonsense	24.47		SNP	1.000	T	23	71
TBCD	6904	genome.wustl.edu	37	17	80828208	80828208	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr17:80828208G>A	ENST00000355528.4	+	14	1557	c.1427G>A	c.(1426-1428)cGt>cAt	p.R476H	TBCD_ENST00000397466.2_Missense_Mutation_p.R90H|TBCD_ENST00000539345.2_Missense_Mutation_p.R476H	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	476					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCCTTCGCGCGTGCCTATGAG	0.652													ENSG00000141556																																					0													34.0	40.0	38.0					17																	80828208		2159	4256	6415	SO:0001583	missense	0			-	BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.1427G>A	17.37:g.80828208G>A	ENSP00000347719:p.Arg476His		O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.R476H	ENST00000355528.4	37	c.1427	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.446612	0.96205	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000397466;ENST00000536182	T;T	0.51071	0.72;0.72	5.53	5.53	0.82687	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77618	0.4157	H	0.94698	3.57	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.997	D	0.83972	0.0327	9	.	.	.	.	16.1871	0.81960	0.0:0.0:1.0:0.0	.	476;476;476	Q9BTW9;Q9BTW9-4;F5H8C7	TBCD_HUMAN;.;.	H	476;227;90;476	ENSP00000347719:R476H;ENSP00000380608:R90H	.	R	+	2	0	TBCD	78421497	1.000000	0.71417	0.852000	0.33557	0.918000	0.54935	8.856000	0.92245	2.591000	0.87537	0.655000	0.94253	CGT	-	TBCD	-	superfamily_ARM-type_fold		0.652	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	0	0		30	30		0.00		G	NM_005993		80828208	+1	12		27		tier1	no_errors	ENST00000355528	ensembl	human	known	74_37	missense	30.00		SNP	0.949	A	12	27
LIMK1	3984	genome.wustl.edu	37	7	73535505	73535505	+	Silent	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr7:73535505C>T	ENST00000336180.2	+	16	1869	c.1818C>T	c.(1816-1818)acC>acT	p.T606T	LIMK1_ENST00000418310.1_Silent_p.T636T|LIMK1_ENST00000538333.3_Silent_p.T572T	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	606					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	GGCTGGAGACCCTCCGCATGC	0.677													ENSG00000106683																																					0													50.0	47.0	48.0					7																	73535505		2203	4300	6503	SO:0001819	synonymous_variant	0			-	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1818C>T	7.37:g.73535505C>T			B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T606	ENST00000336180.2	37	c.1818	CCDS5563.1	7																																																																																			-	LIMK1	-	superfamily_Kinase-like_dom		0.677	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	0	0		110	110		0.00		C	NM_002314		73535505	+1	10		75		tier1	no_errors	ENST00000336180	ensembl	human	known	74_37	silent	11.49		SNP	1.000	T	10	75
CHD7	55636	genome.wustl.edu	37	8	61765390	61765390	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr8:61765390C>T	ENST00000423902.2	+	31	6585	c.6106C>T	c.(6106-6108)Ccg>Tcg	p.P2036S	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2036					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			TGTTACAGAACCGCCCGACCT	0.468													ENSG00000171316																																					0													98.0	100.0	99.0					8																	61765390		1875	4097	5972	SO:0001583	missense	0			-	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6106C>T	8.37:g.61765390C>T	ENSP00000392028:p.Pro2036Ser		D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P2036S	ENST00000423902.2	37	c.6106	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	2.635	-0.285520	0.05605	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.86497	-2.13	5.21	5.21	0.72293	.	0.142264	0.48767	D	0.000164	T	0.75961	0.3921	N	0.17474	0.49	0.37685	D	0.923642	B	0.12630	0.006	B	0.12837	0.008	T	0.71721	-0.4507	10	0.10636	T	0.68	-4.9495	13.71	0.62663	0.1541:0.8459:0.0:0.0	.	2036	Q9P2D1	CHD7_HUMAN	S	2036	ENSP00000392028:P2036S	ENSP00000307304:P2036S	P	+	1	0	CHD7	61927944	0.997000	0.39634	0.725000	0.30721	0.044000	0.14063	3.249000	0.51437	2.433000	0.82419	0.655000	0.94253	CCG	-	CHD7	-	NULL		0.468	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	0	0		137	137		0.00		C	XM_098762		61765390	+1	20		50		tier1	no_errors	ENST00000423902	ensembl	human	known	74_37	missense	28.57		SNP	0.996	T	20	50
CDH12	1010	genome.wustl.edu	37	5	21752318	21752318	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:21752318C>T	ENST00000382254.1	-	15	2999	c.1913G>A	c.(1912-1914)cGa>cAa	p.R638Q	RP11-804N13.1_ENST00000522350.1_RNA|CDH12_ENST00000504376.2_Missense_Mutation_p.R638Q|CDH12_ENST00000522262.1_Missense_Mutation_p.R598Q|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	638					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CTTCTGCCTTCGCAGTGCTAC	0.403										HNSCC(59;0.17)			ENSG00000154162																																					0													80.0	77.0	78.0					5																	21752318		2203	4300	6503	SO:0001583	missense	0			-	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1913G>A	5.37:g.21752318C>T	ENSP00000371689:p.Arg638Gln		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R638Q	ENST00000382254.1	37	c.1913	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283377	0.80803	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	D;D;D	0.86432	-2.12;-2.12;-2.12	5.44	5.44	0.79542	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	D	0.95105	0.8414	M	0.91663	3.23	0.54753	D	0.99998	D;D	0.76494	0.999;0.998	D;D	0.79108	0.988;0.992	D	0.95812	0.8842	10	0.87932	D	0	.	19.2505	0.93923	0.0:1.0:0.0:0.0	.	598;638	B7Z2U6;P55289	.;CAD12_HUMAN	Q	638;638;598	ENSP00000423577:R638Q;ENSP00000371689:R638Q;ENSP00000428786:R598Q	ENSP00000371689:R638Q	R	-	2	0	CDH12	21788075	0.969000	0.33509	0.791000	0.31998	0.589000	0.36550	7.487000	0.81328	2.562000	0.86427	0.591000	0.81541	CGA	-	CDH12	-	pfam_Cadherin_cytoplasmic-dom		0.403	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	0	0		79	79		0.00		C	NM_004061		21752318	-1	8		55		tier1	no_errors	ENST00000382254	ensembl	human	known	74_37	missense	12.70		SNP	0.996	T	8	55
USP13	8975	genome.wustl.edu	37	3	179439296	179439296	+	Missense_Mutation	SNP	C	C	T	rs200851300		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:179439296C>T	ENST00000263966.3	+	8	1478	c.1007C>T	c.(1006-1008)aCg>aTg	p.T336M	USP13_ENST00000496897.1_Missense_Mutation_p.T271M|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	336	USP.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CCTGGCTACACGGGTCTGAAG	0.537													ENSG00000058056																																					0													128.0	109.0	115.0					3																	179439296		2203	4300	6503	SO:0001583	missense	0			-	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1007C>T	3.37:g.179439296C>T	ENSP00000263966:p.Thr336Met		A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.T336M	ENST00000263966.3	37	c.1007	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	C	23.1	4.373022	0.82573	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	T;T	0.75260	-0.92;-0.92	6.06	6.06	0.98353	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.89993	0.6876	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.90759	0.4663	10	0.72032	D	0.01	-19.2794	20.6227	0.99507	0.0:1.0:0.0:0.0	.	336;336	Q92995;A8K2S3	UBP13_HUMAN;.	M	336;271	ENSP00000263966:T336M;ENSP00000417146:T271M	ENSP00000263966:T336M	T	+	2	0	USP13	180921990	1.000000	0.71417	0.999000	0.59377	0.486000	0.33341	7.776000	0.85560	2.885000	0.99019	0.643000	0.83706	ACG	rs200851300	USP13	-	pfam_Peptidase_C19/C67,pirsf_Ubiquitinyl_hydrolase,pfscan_Peptidase_C19/C67		0.537	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	HGNC	protein_coding	OTTHUMT00000349617.1	0	0		115	115		0.00		C			179439296	+1	6		49		tier1	no_errors	ENST00000263966	ensembl	human	known	74_37	missense	10.91		SNP	1.000	T	6	49
KDR	3791	genome.wustl.edu	37	4	55973922	55973922	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:55973922T>C	ENST00000263923.4	-	10	1689	c.1394A>G	c.(1393-1395)gAg>gGg	p.E465G		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	465	Ig-like C2-type 5.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTTGGCGCACTCTTCCTCCAA	0.512			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)			ENSG00000128052																												Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0													185.0	157.0	166.0					4																	55973922		2203	4300	6503	SO:0001583	missense	0			-	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.1394A>G	4.37:g.55973922T>C	ENSP00000263923:p.Glu465Gly		A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.E465G	ENST00000263923.4	37	c.1394	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	T	12.44	1.940070	0.34283	.	.	ENSG00000128052	ENST00000263923	T	0.76839	-1.05	5.19	2.46	0.29980	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.410898	0.26586	N	0.023552	T	0.66458	0.2791	L	0.44542	1.39	0.40364	D	0.979272	P;B	0.38078	0.617;0.149	B;B	0.31101	0.124;0.122	T	0.67142	-0.5745	10	0.45353	T	0.12	.	12.884	0.58032	0.0:0.0:0.2694:0.7306	.	465;465	P35968-2;P35968	.;VGFR2_HUMAN	G	465	ENSP00000263923:E465G	ENSP00000263923:E465G	E	-	2	0	KDR	55668679	1.000000	0.71417	0.167000	0.22817	0.528000	0.34623	3.443000	0.52907	0.768000	0.33290	0.260000	0.18958	GAG	-	KDR	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.512	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	HGNC	protein_coding	OTTHUMT00000250645.1	0	0		63	63		0.00		T			55973922	-1	8		32		tier1	no_errors	ENST00000263923	ensembl	human	known	74_37	missense	20.00		SNP	0.992	C	8	32
LOC105372257	105372257	genome.wustl.edu	37	19	6953174	6953174	+	RNA	SNP	T	T	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr19:6953174T>C	ENST00000593558.1	+	0	0				EMR4P_ENST00000600751.1_RNA																							gagcggtaacttccgggtcat	0.507													ENSG00000268758																																					0																																												0			-																													19.37:g.6953174T>C				R	SNP	-	NULL	ENST00000593558.1	37	NULL		19																																																																																			-	EMR4P	-	-		0.507	RP11-1137G4.3-001	KNOWN	basic	antisense	EMR4P	HGNC	antisense	OTTHUMT00000458493.1	0	0		18	18		0.00		T			6953174	-1	4		16		tier1	no_errors	ENST00000600751	ensembl	human	known	74_37	rna	20.00		SNP	0.038	C	4	16
PGA5	5222	genome.wustl.edu	37	11	61015869	61015869	+	Intron	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:61015869C>A	ENST00000312403.5	+	6	841				PGA4_ENST00000422676.2_Intron|CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000451616.2_Missense_Mutation_p.S58Y|PGA5_ENST00000541528.1_5'Flank	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)						digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						AAATTCATGTCTTCTCCCCTC	0.512													ENSG00000256713																																					0													336.0	338.0	337.0					11																	61015869		2202	4299	6501	SO:0001627	intron_variant	0			-	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.657-22C>A	11.37:g.61015869C>A			A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.S58Y	ENST00000312403.5	37	c.173	CCDS8001.1	11	.	.	.	.	.	.	.	.	.	.	C	11.52	1.662203	0.29515	.	.	ENSG00000256713	ENST00000451616	T	0.37235	1.21	2.05	1.07	0.20283	.	.	.	.	.	T	0.33933	0.0880	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33266	-0.9875	6	0.87932	D	0	.	4.6405	0.12546	0.0:0.6263:0.2333:0.1405	.	.	.	.	Y	58	ENSP00000408739:S58Y	ENSP00000408739:S58Y	S	+	2	0	PGA5	60772445	0.000000	0.05858	0.003000	0.11579	0.411000	0.31082	-0.364000	0.07583	0.414000	0.25790	0.420000	0.28162	TCT	-	PGA5	-	NULL		0.512	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGA5	HGNC	protein_coding	OTTHUMT00000397972.1	0	0		296	296		0.00		C	NM_014224		61015869	+1	30		121		tier1	no_errors	ENST00000451616	ensembl	human	putative	74_37	missense	19.87		SNP	0.005	A	30	121
MED23	9439	genome.wustl.edu	37	6	131917389	131917389	+	Intron	DEL	T	T	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:131917389delT	ENST00000368068.3	-	22	2958				MED23_ENST00000368058.1_Intron|MED23_ENST00000403834.3_Intron|MED23_ENST00000545957.1_Intron|MED23_ENST00000354577.4_Intron|MED23_ENST00000368060.3_Intron|MED23_ENST00000479213.1_5'UTR	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23						gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		ATTGTTTAGATTTTTTTTTGC	0.259													ENSG00000112282																																					0																																										SO:0001627	intron_variant	0				AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.2779-86A>-	6.37:g.131917389delT			B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	R	DEL	-	NULL	ENST00000368068.3	37	NULL	CCDS5147.1	6																																																																																				MED23	-	-		0.259	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED23	HGNC	protein_coding	OTTHUMT00000042215.1	0	0		59	59		0.00		T			131917389	-1	3		23		tier1	no_errors	ENST00000479213	ensembl	human	known	74_37	rna	11.54		DEL	0.000	-	3	23
LIMK1	3984	genome.wustl.edu	37	7	73535474	73535474	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr7:73535474C>T	ENST00000336180.2	+	16	1838	c.1787C>T	c.(1786-1788)tCc>tTc	p.S596F	LIMK1_ENST00000418310.1_Missense_Mutation_p.S626F|LIMK1_ENST00000538333.3_Missense_Mutation_p.S562F	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	596	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CCCAGGCCATCCTTTGTGAAG	0.672													ENSG00000106683																																					0													68.0	65.0	66.0					7																	73535474		2203	4300	6503	SO:0001583	missense	0			-	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1787C>T	7.37:g.73535474C>T	ENSP00000336740:p.Ser596Phe		B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S596F	ENST00000336180.2	37	c.1787	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578165	0.45902	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.66995	-0.24;-0.24;-0.24	4.3	3.4	0.38934	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.537108	0.19276	N	0.118289	T	0.78272	0.4257	M	0.87971	2.92	0.45733	D	0.998638	D;D	0.55172	0.97;0.97	P;P	0.54629	0.757;0.757	T	0.80248	-0.1461	10	0.59425	D	0.04	-23.8437	11.1013	0.48177	0.0:0.6367:0.3633:0.0	.	562;596	B7Z6I8;P53667	.;LIMK1_HUMAN	F	626;596;596;562	ENSP00000409717:S626F;ENSP00000336740:S596F;ENSP00000444452:S562F	ENSP00000336740:S596F	S	+	2	0	LIMK1	73173410	0.997000	0.39634	0.985000	0.45067	0.498000	0.33706	3.427000	0.52785	0.945000	0.37605	0.456000	0.33151	TCC	-	LIMK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.672	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	0	0		102	102		0.00		C	NM_002314		73535474	+1	19		83		tier1	no_errors	ENST00000336180	ensembl	human	known	74_37	missense	18.45		SNP	0.674	T	19	83
PDS5A	23244	genome.wustl.edu	37	4	39900418	39900421	+	Frame_Shift_Del	DEL	CAAA	CAAA	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	CAAA	CAAA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:39900418_39900421delCAAA	ENST00000303538.8	-	15	2145_2148	c.1606_1609delTTTG	c.(1606-1611)tttggafs	p.FG536fs	PDS5A_ENST00000503396.1_Frame_Shift_Del_p.FG536fs	NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						ATCAGTTTTCCAAACATGGCAGAA	0.333													ENSG00000121892																																					0																																										SO:0001589	frameshift_variant	0				AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.1606_1609delTTTG	4.37:g.39900418_39900421delCAAA	ENSP00000303427:p.Phe536fs			Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.F536fs	ENST00000303538.8	37	c.1609_1606	CCDS47045.1	4																																																																																				PDS5A	-	superfamily_ARM-type_fold		0.333	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	0	0		111	111		0.00		CAAA	NM_015200		39900421	-1	18		46		tier1	no_errors	ENST00000303538	ensembl	human	known	74_37	frame_shift_del	28.12		DEL	1.000:1.000:1.000:1.000	-	18	46
FOXM1	2305	genome.wustl.edu	37	12	2974538	2974538	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr12:2974538G>A	ENST00000359843.3	-	6	1071	c.1003C>T	c.(1003-1005)Ccc>Tcc	p.P335S	FOXM1_ENST00000537018.1_5'UTR|FOXM1_ENST00000342628.2_Missense_Mutation_p.P335S|FOXM1_ENST00000361953.3_Intron	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	335					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AAGTGCTCGGGCAATTGTGGA	0.527													ENSG00000111206																																					0													133.0	125.0	128.0					12																	2974538		2203	4300	6503	SO:0001583	missense	0			-	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1003C>T	12.37:g.2974538G>A	ENSP00000352901:p.Pro335Ser		O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P335S	ENST00000359843.3	37	c.1003	CCDS8515.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.85|11.85	1.760544|1.760544	0.31137|0.31137	.|.	.|.	ENSG00000111206|ENSG00000111206	ENST00000535350|ENST00000342628;ENST00000359843	.|D;D	.|0.92752	.|-3.08;-3.1	6.14|6.14	5.08|5.08	0.68730|0.68730	.|.	.|0.314519	.|0.35805	.|N	.|0.002964	D|D	0.84406|0.84406	0.5465|0.5465	N|N	0.04508|0.04508	-0.205|-0.205	0.41272|0.41272	D|D	0.986854|0.986854	.|B;P	.|0.41313	.|0.065;0.745	.|B;P	.|0.44946	.|0.007;0.465	D|D	0.84828|0.84828	0.0800|0.0800	5|10	.|0.41790	.|T	.|0.15	.|.	12.1078|12.1078	0.53821|0.53821	0.1281:0.0:0.8719:0.0|0.1281:0.0:0.8719:0.0	.|.	.|335;335	.|Q08050;Q08050-3	.|FOXM1_HUMAN;.	V|S	59|335	.|ENSP00000342307:P335S;ENSP00000352901:P335S	.|ENSP00000342307:P335S	A|P	-|-	2|1	0|0	FOXM1|FOXM1	2844799|2844799	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.994000|0.994000	0.84299|0.84299	3.322000|3.322000	0.52007|0.52007	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	GCC|CCC	-	FOXM1	-	NULL		0.527	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	1	1		101	101		0.98		G	NM_021953		2974538	-1	4		33		tier1	no_errors	ENST00000342628	ensembl	human	known	74_37	missense	10.81		SNP	0.999	A	4	33
NFRKB	4798	genome.wustl.edu	37	11	129739602	129739602	+	Silent	SNP	G	G	A	rs371098164		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:129739602G>A	ENST00000446488.3	-	23	3421	c.3318C>T	c.(3316-3318)acC>acT	p.T1106T	NFRKB_ENST00000524746.1_Silent_p.T1106T|NFRKB_ENST00000524794.1_Silent_p.T1131T|NFRKB_ENST00000304521.5_Silent_p.T1106T	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	1106					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		GGGTTGCAACGGTGATGGTCT	0.577													ENSG00000170322																																					0								G	,	1,4401	2.1+/-5.4	0,1,2200	139.0	128.0	132.0		3318,3393	-10.5	0.1	11		132	0,8594		0,0,4297	no	coding-synonymous,coding-synonymous	NFRKB	NM_001143835.1,NM_006165.3	,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,	1106/1300,1131/1325	129739602	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	0			-		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.3318C>T	11.37:g.129739602G>A			Q12869|Q15312|Q9H048	Silent	SNP	NULL	p.T1131	ENST00000446488.3	37	c.3393	CCDS44770.1	11																																																																																			-	NFRKB	-	NULL		0.577	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFRKB	HGNC	protein_coding	OTTHUMT00000386063.2	0	0		69	69		0.00		G	NM_006165		129739602	-1	6		31		tier1	no_errors	ENST00000524794	ensembl	human	known	74_37	silent	16.22		SNP	0.002	A	6	31
URB1	9875	genome.wustl.edu	37	21	33709729	33709729	+	Silent	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr21:33709729G>T	ENST00000382751.3	-	27	4720	c.4605C>A	c.(4603-4605)gcC>gcA	p.A1535A	URB1_ENST00000492603.1_5'Flank	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1535						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						CGCTGAGAGTGGCGCCATAGG	0.622													ENSG00000142207																																					0													38.0	41.0	40.0					21																	33709729		692	1591	2283	SO:0001819	synonymous_variant	0			-	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.4605C>A	21.37:g.33709729G>T			D3DSE5|Q96NX1|Q9NYQ1	Silent	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.A1535	ENST00000382751.3	37	c.4605	CCDS46645.1	21																																																																																			-	URB1	-	NULL		0.622	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	0	0		74	74		0.00		G			33709729	-1	4		22		tier1	no_errors	ENST00000382751	ensembl	human	known	74_37	silent	15.38		SNP	0.986	T	4	22
TAS1R2	80834	genome.wustl.edu	37	1	19186142	19186142	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:19186142C>T	ENST00000375371.3	-	1	34	c.13G>A	c.(13-15)Gca>Aca	p.A5T	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	5					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	ATGGTCTTTGCCCTGGGCCCC	0.567													ENSG00000179002																																					0													103.0	97.0	99.0					1																	19186142		2203	4300	6503	SO:0001583	missense	0			-		CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.13G>A	1.37:g.19186142C>T	ENSP00000364520:p.Ala5Thr		Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.A5T	ENST00000375371.3	37	c.13	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	c	10.79	1.450289	0.26074	.	.	ENSG00000179002	ENST00000375371	D	0.88896	-2.44	3.4	0.23	0.15372	.	.	.	.	.	T	0.81931	0.4927	L	0.47716	1.5	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.66048	-0.6020	9	0.30078	T	0.28	.	5.1895	0.15203	0.0:0.4583:0.4183:0.1233	.	5	Q8TE23	TS1R2_HUMAN	T	5	ENSP00000364520:A5T	ENSP00000364520:A5T	A	-	1	0	TAS1R2	19058729	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-0.075000	0.11431	0.061000	0.16311	0.306000	0.20318	GCA	-	TAS1R2	-	NULL		0.567	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	0	0		92	92		0.00		C			19186142	-1	4		41		tier1	no_errors	ENST00000375371	ensembl	human	novel	74_37	missense	8.89		SNP	0.000	T	4	41
SLC7A5	8140	genome.wustl.edu	37	16	87873327	87873327	+	Missense_Mutation	SNP	G	G	A	rs202090522		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr16:87873327G>A	ENST00000261622.4	-	5	985	c.920C>T	c.(919-921)tCg>tTg	p.S307L	SLC7A5_ENST00000565644.1_Missense_Mutation_p.S41L|RP4-536B24.2_ENST00000563687.1_RNA	NM_003486.5	NP_003477.4	Q01650	LAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 5	307					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|neutral amino acid transport (GO:0015804)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(80;0.049)	Dextrothyroxine(DB00509)|L-DOPA(DB01235)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Melphalan(DB01042)	GGCCTCGGACGACAGCATCTG	0.672													ENSG00000103257	G|||	1	0.000199681	0.0	0.0014	5008	,	,		16640	0.0		0.0	False		,,,				2504	0.0																0								G	LEU/SER	0,4396		0,0,2198	120.0	91.0	101.0		920	2.0	0.0	16		101	1,8599	1.2+/-3.3	0,1,4299	no	missense	SLC7A5	NM_003486.5	145	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	benign	307/508	87873327	1,12995	2198	4300	6498	SO:0001583	missense	0			GMAF=0	AF077866	CCDS10964.1	16q24.3	2013-05-22	2011-07-12		ENSG00000103257	ENSG00000103257		"""CD molecules"", ""Solute carriers"""	11063	protein-coding gene	gene with protein product		600182				9751058, 7829099	Standard	XM_006721286		Approved	LAT1, E16, D16S469E, MPE16, CD98	uc002fkm.3	Q01650	OTTHUMG00000137658	ENST00000261622.4:c.920C>T	16.37:g.87873327G>A	ENSP00000261622:p.Ser307Leu		Q8IV97|Q9UBN8|Q9UP15|Q9UQC0	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.S307L	ENST00000261622.4	37	c.920	CCDS10964.1	16	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	7.355	0.623661	0.14193	0.0	1.16E-4	ENSG00000103257	ENST00000261622	D	0.89415	-2.51	5.41	2.05	0.26809	Amino acid permease domain (1);	1.321610	0.04982	N	0.465871	D	0.87466	0.6184	M	0.73430	2.235	0.09310	N	1	B	0.25743	0.133	B	0.15052	0.012	T	0.73350	-0.4010	10	0.66056	D	0.02	.	5.223	0.15379	0.0711:0.2139:0.5115:0.2034	.	307	Q01650	LAT1_HUMAN	L	307	ENSP00000261622:S307L	ENSP00000261622:S307L	S	-	2	0	SLC7A5	86430828	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	0.157000	0.16402	0.718000	0.32166	0.563000	0.77884	TCG	rs202090522	SLC7A5	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter		0.672	SLC7A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A5	HGNC	protein_coding	OTTHUMT00000269110.2	0	0		135	135		0.00		G	NM_003486		87873327	-1	9		52		tier1	no_errors	ENST00000261622	ensembl	human	known	74_37	missense	14.75		SNP	0.000	A	9	52
NBEA	26960	genome.wustl.edu	37	13	36242619	36242619	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr13:36242619G>T	ENST00000400445.3	+	57	9247	c.8713G>T	c.(8713-8715)Gct>Tct	p.A2905S	NBEA_ENST00000540320.1_Missense_Mutation_p.A2905S|NBEA_ENST00000379939.2_Missense_Mutation_p.A2902S|NBEA_ENST00000537702.1_Missense_Mutation_p.A698S|NBEA_ENST00000310336.4_Missense_Mutation_p.A2905S|NBEA_ENST00000379922.3_Missense_Mutation_p.A483S	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2905					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TGGATGTGATGCTGGCATTAG	0.512													ENSG00000172915																																					0													80.0	84.0	83.0					13																	36242619		2052	4194	6246	SO:0001583	missense	0			-	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.8713G>T	13.37:g.36242619G>T	ENSP00000383295:p.Ala2905Ser		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.A2905S	ENST00000400445.3	37	c.8713	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792970	0.50102	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66;1.66	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.23410	0.0566	N	0.17631	0.505	0.80722	D	1	B;B;B	0.22909	0.077;0.074;0.077	B;B;B	0.25759	0.056;0.063;0.056	T	0.08106	-1.0738	10	0.11182	T	0.66	.	20.0858	0.97800	0.0:0.0:1.0:0.0	.	2905;483;2902	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	S	2905;2905;2902;2905;1534;483;698;483	ENSP00000440951:A2905S;ENSP00000383295:A2905S;ENSP00000369271:A2902S;ENSP00000308534:A2905S;ENSP00000440233:A698S;ENSP00000369254:A483S	ENSP00000308534:A2905S	A	+	1	0	NBEA	35140619	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.695000	0.84257	2.753000	0.94483	0.650000	0.86243	GCT	-	NBEA	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.512	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		0	0		91	91		0.00		G	NM_015678		36242619	+1	4		42		tier1	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	8.70		SNP	1.000	T	4	42
ZXDC	79364	genome.wustl.edu	37	3	126194056	126194056	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:126194056G>A	ENST00000389709.3	-	1	706	c.653C>T	c.(652-654)gCc>gTc	p.A218V	ZXDC_ENST00000336332.5_Missense_Mutation_p.A218V	NM_025112.4	NP_079388.3	Q2QGD7	ZXDC_HUMAN	ZXD family zinc finger C	218					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|LRR domain binding (GO:0030275)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(1)	17				GBM - Glioblastoma multiforme(114;0.155)		CGTTGTGAAGGCCCAACCACA	0.652													ENSG00000070476																																					0													19.0	23.0	21.0					3																	126194056		2149	4253	6402	SO:0001583	missense	0			-	AK023923	CCDS43145.1, CCDS43146.1	3q21.3	2014-02-12			ENSG00000070476	ENSG00000070476		"""Zinc fingers, C2H2-type"""	28160	protein-coding gene	gene with protein product		615746				8619474, 9110174	Standard	XM_005247757		Approved	MGC11349, FLJ13861	uc003eiv.3	Q2QGD7	OTTHUMG00000162754	ENST00000389709.3:c.653C>T	3.37:g.126194056G>A	ENSP00000374359:p.Ala218Val		C5J0H9|Q6DKI8|Q7L3L1|Q8NAU2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A218V	ENST00000389709.3	37	c.653	CCDS43145.1	3	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901123	0.92035	.	.	ENSG00000070476	ENST00000389709;ENST00000336332	T;T	0.49432	0.78;0.78	3.81	3.81	0.43845	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.158061	0.42172	U	0.000746	T	0.57315	0.2045	L	0.41961	1.31	0.43218	D	0.995096	D;D	0.69078	0.996;0.997	P;D	0.64321	0.876;0.924	T	0.61987	-0.6949	10	0.72032	D	0.01	-16.5457	13.5851	0.61926	0.0:0.0:1.0:0.0	.	218;218	Q2QGD7-2;Q2QGD7	.;ZXDC_HUMAN	V	218	ENSP00000374359:A218V;ENSP00000337694:A218V	ENSP00000337694:A218V	A	-	2	0	ZXDC	127676746	1.000000	0.71417	1.000000	0.80357	0.715000	0.41141	4.480000	0.60243	1.847000	0.53656	0.485000	0.47835	GCC	-	ZXDC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.652	ZXDC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZXDC	HGNC	protein_coding	OTTHUMT00000370327.2	0	0		50	50		0.00		G	NM_025112		126194056	-1	9		30		tier1	no_errors	ENST00000389709	ensembl	human	known	74_37	missense	23.08		SNP	1.000	A	9	30
ZBBX	79740	genome.wustl.edu	37	3	167031854	167031854	+	Missense_Mutation	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:167031854A>G	ENST00000392766.2	-	16	1665	c.1325T>C	c.(1324-1326)aTc>aCc	p.I442T	ZBBX_ENST00000392764.1_Missense_Mutation_p.I413T|ZBBX_ENST00000455345.2_Missense_Mutation_p.I442T|ZBBX_ENST00000392767.2_Missense_Mutation_p.I442T|ZBBX_ENST00000307529.5_Missense_Mutation_p.I442T|ZBBX_ENST00000469220.1_5'Flank	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	442						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						ATGTTGATGGATGCCATTTTC	0.299													ENSG00000169064																																					0													110.0	103.0	105.0					3																	167031854		1829	4077	5906	SO:0001583	missense	0			-	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1325T>C	3.37:g.167031854A>G	ENSP00000376519:p.Ile442Thr		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.I442T	ENST00000392766.2	37	c.1325	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	A	3.544	-0.093100	0.07053	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11169	2.97;2.97;2.98;2.98;2.8	5.29	1.21	0.21127	.	0.422163	0.22442	N	0.060001	T	0.09818	0.0241	L	0.59436	1.845	0.09310	N	1	B;B	0.27882	0.192;0.121	B;B	0.30105	0.111;0.051	T	0.28332	-1.0047	10	0.87932	D	0	-0.6485	1.8076	0.03084	0.5693:0.1727:0.0917:0.1662	.	442;442	A8MT70-2;A8MT70	.;ZBBX_HUMAN	T	442;442;442;442;413	ENSP00000376519:I442T;ENSP00000376520:I442T;ENSP00000390232:I442T;ENSP00000305065:I442T;ENSP00000376517:I413T	ENSP00000305065:I442T	I	-	2	0	ZBBX	168514548	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.651000	0.24873	0.379000	0.24794	-0.256000	0.11100	ATC	-	ZBBX	-	NULL		0.299	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	0	0		107	107		0.00		A	NM_024687		167031854	-1	14		39		tier1	no_errors	ENST00000307529	ensembl	human	known	74_37	missense	26.42		SNP	0.000	G	14	39
SIM1	6492	genome.wustl.edu	37	6	100868711	100868711	+	Silent	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:100868711C>A	ENST00000369208.3	-	10	1904	c.1122G>T	c.(1120-1122)cgG>cgT	p.R374R	SIM1_ENST00000262901.4_Silent_p.R374R			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	374	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AGCTGGAGAGCCGGGATTTGG	0.502													ENSG00000112246																																					0													109.0	104.0	106.0					6																	100868711		2203	4300	6503	SO:0001819	synonymous_variant	0			-	U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1122G>T	6.37:g.100868711C>A			Q5TDP7	Silent	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_bHLH_dom,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_bHLH_dom	p.R374	ENST00000369208.3	37	c.1122	CCDS5045.1	6																																																																																			-	SIM1	-	pfam_SIM_C		0.502	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	0	0		119	119		0.00		C	NM_005068		100868711	-1	7		80		tier1	no_errors	ENST00000262901	ensembl	human	known	74_37	silent	8.05		SNP	0.953	A	7	80
LOC100128714	100128714	genome.wustl.edu	37	15	26260573	26260573	+	lincRNA	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr15:26260573C>A	ENST00000383019.2	+	0	300					NR_040082.1																						GCCTAGTGAGCCCCTGTTTCC	0.507													ENSG00000206187																																					0																																												0			-																													15.37:g.26260573C>A				R	SNP	-	NULL	ENST00000383019.2	37	NULL		15																																																																																			-	RP11-1084I9.1	-	-		0.507	RP11-1084I9.1-001	KNOWN	basic	lincRNA	LOC100128714	Clone_based_vega_gene	lincRNA	OTTHUMT00000414884.1	0	0		129	129		0.00		C			26260573	+1	12		63		tier1	no_errors	ENST00000383019	ensembl	human	known	74_37	rna	16.00		SNP	0.003	A	12	63
TNFRSF6B	8771	genome.wustl.edu	37	20	62326741	62326741	+	5'Flank	SNP	A	A	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr20:62326741A>G	ENST00000369996.1	+	0	0				RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.Q1187R|RTEL1_ENST00000360203.5_Missense_Mutation_p.Q1187R|RTEL1_ENST00000508582.2_Missense_Mutation_p.Q1211R|RTEL1_ENST00000370003.1_Missense_Mutation_p.Q432R|RTEL1_ENST00000318100.4_Missense_Mutation_p.Q1187R|RTEL1_ENST00000370018.3_Missense_Mutation_p.Q1187R	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy						apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			TTCCTTAGACAGAGGCCAGCA	0.652													ENSG00000258366																																					0													71.0	85.0	80.0					20																	62326741		2198	4287	6485	SO:0001631	upstream_gene_variant	0			-	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724		20.37:g.62326741A>G	Exception_encountered			Missense_Mutation	SNP	pfam_DEAD_2,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_D_helicase_D-repair_Rad3	p.Q1187R	ENST00000369996.1	37	c.3560	CCDS13532.1	20	.	.	.	.	.	.	.	.	.	.	A	11.43	1.635483	0.29068	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203;ENST00000370003	D;D;D;T;T	0.81996	-1.56;-1.51;-1.52;-1.47;0.9	4.15	-0.752	0.11072	.	1.986640	0.02486	N	0.088974	T	0.71871	0.3391	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.15473	0.004;0.013;0.001;0.004	B;B;B;B	0.12156	0.003;0.007;0.001;0.004	T	0.54609	-0.8268	10	0.38643	T	0.18	-0.9481	3.7612	0.08604	0.456:0.2045:0.3395:0.0	.	1211;432;1187;1187	Q9NZ71-7;Q9NZ71-5;Q9NZ71;Q9NZ71-6	.;.;RTEL1_HUMAN;.	R	1187;1187;1211;1187;432	ENSP00000359035:Q1187R;ENSP00000322287:Q1187R;ENSP00000424307:Q1211R;ENSP00000353332:Q1187R;ENSP00000359020:Q432R	ENSP00000353332:Q1187R	Q	+	2	0	AL353715.1	61797185	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.439000	0.06897	-0.055000	0.13244	0.379000	0.24179	CAG	-	RTEL1	-	NULL		0.652	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000080182.1	0	0		286	286		0.00		A			62326741	+1	74		272		tier1	no_errors	ENST00000318100	ensembl	human	known	74_37	missense	21.39		SNP	0.000	G	74	272
BST1	683	genome.wustl.edu	37	4	15733416	15733416	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:15733416C>T	ENST00000265016.4	+	9	1100	c.905C>T	c.(904-906)gCg>gTg	p.A302V	BST1_ENST00000382346.3_Missense_Mutation_p.A317V	NM_004334.2	NP_004325.2	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1	302					humoral immune response (GO:0006959)|multicellular organismal development (GO:0007275)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	NAD(P)+ nucleosidase activity (GO:0050135)|NAD+ nucleosidase activity (GO:0003953)|transferase activity (GO:0016740)			central_nervous_system(1)|large_intestine(1)|lung(2)|stomach(3)|urinary_tract(1)	8						GAACAAAGGGCGGGTCTTATC	0.493													ENSG00000109743																																					0													54.0	55.0	55.0					4																	15733416		2203	4300	6503	SO:0001583	missense	0			-	D21878	CCDS3416.1	4p15	2010-05-04			ENSG00000109743	ENSG00000109743	3.2.2.5	"""CD molecules"""	1118	protein-coding gene	gene with protein product	"""NAD(+) nucleosidase"", ""ADP-ribosyl cyclase 2"""	600387				8202488	Standard	NM_004334		Approved	CD157	uc003goh.4	Q10588	OTTHUMG00000097739	ENST00000265016.4:c.905C>T	4.37:g.15733416C>T	ENSP00000265016:p.Ala302Val		B2R6A2|Q1XII0|Q5U0K0|Q96EN3	Missense_Mutation	SNP	pfam_ADP-ribosyl_cyclase	p.A302V	ENST00000265016.4	37	c.905	CCDS3416.1	4	.	.	.	.	.	.	.	.	.	.	C	11.28	1.591886	0.28357	.	.	ENSG00000109743	ENST00000265016;ENST00000382346	T;T	0.13778	2.57;2.56	4.6	-3.02	0.05446	.	0.946365	0.08638	N	0.916012	T	0.07638	0.0192	N	0.17082	0.46	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.36383	-0.9750	10	0.54805	T	0.06	-1.8413	6.5212	0.22277	0.0:0.3984:0.1234:0.4782	.	302	Q10588	BST1_HUMAN	V	302;317	ENSP00000265016:A302V;ENSP00000371783:A317V	ENSP00000265016:A302V	A	+	2	0	BST1	15342514	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.582000	0.05814	-0.940000	0.03705	-0.916000	0.02749	GCG	-	BST1	-	NULL		0.493	BST1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BST1	HGNC	protein_coding	OTTHUMT00000214968.2	0	0		115	115		0.00		C	NM_004334		15733416	+1	7		72		tier1	no_errors	ENST00000265016	ensembl	human	known	74_37	missense	8.86		SNP	0.000	T	7	72
PCDHA7	56141	genome.wustl.edu	37	5	140214407	140214407	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:140214407C>G	ENST00000525929.1	+	1	439	c.439C>G	c.(439-441)Ccg>Gcg	p.P147A	PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.P147A|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	147	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAATCCAGGCCGCTTGACTC	0.547													ENSG00000204963																									NSCLC(160;258 2013 5070 22440 28951)												0													62.0	59.0	60.0					5																	140214407		2203	4291	6494	SO:0001583	missense	0			-	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.439C>G	5.37:g.140214407C>G	ENSP00000436426:p.Pro147Ala		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P147A	ENST00000525929.1	37	c.439	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.683554	0.00745	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.54071	0.59;0.59	4.17	1.25	0.21368	Cadherin (3);Cadherin-like (1);	0.974525	0.08254	U	0.974219	T	0.27063	0.0663	N	0.16166	0.38	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.17979	0.015;0.02	T	0.28522	-1.0041	10	0.02654	T	1	.	3.0528	0.06174	0.237:0.4954:0.1162:0.1514	.	147;147	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	A	147	ENSP00000436426:P147A;ENSP00000367365:P147A	ENSP00000367365:P147A	P	+	1	0	PCDHA7	140194591	0.000000	0.05858	0.164000	0.22755	0.102000	0.19082	-3.884000	0.00342	0.316000	0.23135	0.455000	0.32223	CCG	-	PCDHA7	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.547	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	0	0		58	58		0.00		C	NM_018910		140214407	+1	7		29		tier1	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	19.44		SNP	0.006	G	7	29
CNTNAP3	79937	genome.wustl.edu	37	9	39165950	39165950	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr9:39165950C>T	ENST00000297668.6	-	9	1530	c.1457G>A	c.(1456-1458)gGt>gAt	p.G486D	CNTNAP3_ENST00000323947.7_Missense_Mutation_p.G486D|CNTNAP3_ENST00000377659.1_Missense_Mutation_p.G486D|CNTNAP3_ENST00000358144.2_Missense_Mutation_p.G398D|CNTNAP3_ENST00000377656.2_Missense_Mutation_p.G486D	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	486	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ATAGGTGTCACCTGAATCAAT	0.463													ENSG00000106714																																					0													2.0	2.0	2.0					9																	39165950		1107	2415	3522	SO:0001583	missense	0			-	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1457G>A	9.37:g.39165950C>T	ENSP00000297668:p.Gly486Asp		B1AMA0|Q9C0E9	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.G486D	ENST00000297668.6	37	c.1457	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	c	13.12	2.140807	0.37825	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000358144;ENST00000323947;ENST00000377659	T;T;T;T;T	0.78126	-1.01;-1.01;-1.01;-1.15;-1.01	3.06	2.15	0.27550	Concanavalin A-like lectin/glucanase (2);Concanavalin A-like lectin/glucanase, subgroup (2);Laminin G domain (4);Laminin G, subdomain 2 (2);	.	.	.	.	D	0.83394	0.5245	M	0.82323	2.585	0.09310	N	1	P;B;P;B;B	0.42357	0.777;0.078;0.469;0.387;0.098	P;B;B;P;B	0.55615	0.78;0.232;0.315;0.518;0.208	T	0.70368	-0.4891	9	0.32370	T	0.25	.	5.2378	0.15456	0.0:0.7234:0.0:0.2766	.	486;486;486;486;486	E2QRH2;Q96NU0;Q9BZ76-2;A6NC89;Q9BZ76	.;CNT3B_HUMAN;.;.;CNTP3_HUMAN	D	486;486;398;486;486	ENSP00000297668:G486D;ENSP00000366884:G486D;ENSP00000350863:G398D;ENSP00000320728:G486D;ENSP00000366887:G486D	ENSP00000297668:G486D	G	-	2	0	CNTNAP3	39155950	0.282000	0.24268	0.035000	0.18076	0.640000	0.38277	0.829000	0.27449	0.600000	0.29862	0.563000	0.77884	GGT	-	CNTP3	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.463	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTP3	HGNC	protein_coding	OTTHUMT00000052511.1	0	0		71	71		0.00		C	NM_033655		39165950	-1	5		26		tier1	no_errors	ENST00000297668	ensembl	human	known	74_37	missense	16.13		SNP	0.093	T	5	26
PDLIM4	8572	genome.wustl.edu	37	5	131607824	131607824	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:131607824C>T	ENST00000253754.3	+	7	959	c.895C>T	c.(895-897)Cgg>Tgg	p.R299W	PDLIM4_ENST00000379018.3_3'UTR|P4HA2_ENST00000471826.1_Intron	NM_001131027.1|NM_003687.3	NP_001124499.1|NP_003678.2	P50479	PDLI4_HUMAN	PDZ and LIM domain 4	299	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.						zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|urinary_tract(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTGGACGAGCGGCTCTACTG	0.612													ENSG00000131435																																					0													97.0	81.0	86.0					5																	131607824		2203	4300	6503	SO:0001583	missense	0			-	AF153882	CCDS4152.1, CCDS47261.1	5q31.1	2008-02-05			ENSG00000131435	ENSG00000131435			16501	protein-coding gene	gene with protein product		603422				9573374	Standard	NM_001131027		Approved	RIL	uc003kwn.3	P50479	OTTHUMG00000059645	ENST00000253754.3:c.895C>T	5.37:g.131607824C>T	ENSP00000253754:p.Arg299Trp		B2R8U1|Q53Y39|Q96AT8|Q9BTW8|Q9Y292	Missense_Mutation	SNP	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.R299W	ENST00000253754.3	37	c.895	CCDS4152.1	5	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734851	0.48939	.	.	ENSG00000131435	ENST00000253754	D	0.88431	-2.38	5.05	2.82	0.32997	Zinc finger, LIM-type (4);	0.369391	0.27659	N	0.018396	D	0.92286	0.7553	M	0.76328	2.33	0.80722	D	1	D	0.76494	0.999	P	0.62885	0.908	D	0.92135	0.5715	10	0.87932	D	0	-13.4067	10.3753	0.44079	0.1363:0.7815:0.0:0.0822	.	299	P50479	PDLI4_HUMAN	W	299	ENSP00000253754:R299W	ENSP00000253754:R299W	R	+	1	2	PDLIM4	131635723	1.000000	0.71417	0.440000	0.26846	0.058000	0.15608	2.179000	0.42528	1.053000	0.40415	0.655000	0.94253	CGG	-	PDLIM4	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.612	PDLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM4	HGNC	protein_coding	OTTHUMT00000132644.2	0	0		50	50		0.00		C	NM_003687		131607824	+1	4		36		tier1	no_errors	ENST00000253754	ensembl	human	known	74_37	missense	10.00		SNP	0.999	T	4	36
HMOX1	3162	genome.wustl.edu	37	22	35785936	35785936	+	Missense_Mutation	SNP	G	G	A	rs201083816		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr22:35785936G>A	ENST00000216117.8	+	4	1055	c.716G>A	c.(715-717)cGg>cAg	p.R239Q		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	239					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	CTTCGCCAGCGGGCCAGCAAC	0.557													ENSG00000100292																																					0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	40.0	41.0	41.0		716	0.8	0.0	22		41	1,8599	1.2+/-3.3	0,1,4299	yes	missense	HMOX1	NM_002133.2	43	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	239/289	35785936	2,13004	2203	4300	6503	SO:0001583	missense	0			-		CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.716G>A	22.37:g.35785936G>A	ENSP00000216117:p.Arg239Gln			Missense_Mutation	SNP	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	p.R239Q	ENST00000216117.8	37	c.716	CCDS13914.1	22	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605917	0.46527	2.27E-4	1.16E-4	ENSG00000100292	ENST00000216117	T	0.22336	1.96	5.38	0.765	0.18470	Haem oxygenase-like, multi-helical (1);	0.248954	0.34460	N	0.003944	T	0.17238	0.0414	M	0.64997	1.995	0.09310	N	1	B	0.22480	0.07	B	0.08055	0.003	T	0.17684	-1.0361	10	0.54805	T	0.06	-30.3888	4.2542	0.10708	0.2666:0.0:0.5762:0.1572	.	239	P09601	HMOX1_HUMAN	Q	239	ENSP00000216117:R239Q	ENSP00000216117:R239Q	R	+	2	0	HMOX1	34115936	0.002000	0.14202	0.000000	0.03702	0.013000	0.08279	1.170000	0.31883	-0.029000	0.13827	0.561000	0.74099	CGG	rs201083816	HMOX1	-	superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase		0.557	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX1	HGNC	protein_coding	OTTHUMT00000320657.1	0	0		42	42		0.00		G			35785936	+1	6		14		tier1	no_errors	ENST00000216117	ensembl	human	known	74_37	missense	30.00		SNP	0.000	A	6	14
HYOU1	10525	genome.wustl.edu	37	11	118919434	118919434	+	Silent	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:118919434C>T	ENST00000404233.3	-	18	2281	c.2157G>A	c.(2155-2157)tcG>tcA	p.S719S	HYOU1_ENST00000543287.1_3'UTR|HYOU1_ENST00000525859.1_Silent_p.S657S|HYOU1_ENST00000529972.1_Silent_p.S657S	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	719					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		ACTTCTGCACCGACTGAGCCA	0.607													ENSG00000149428																																					0													113.0	99.0	104.0					11																	118919434		2200	4295	6495	SO:0001819	synonymous_variant	0			-	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.2157G>A	11.37:g.118919434C>T			A8C1Z0|B7Z909|Q2I204|Q53H25	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.S719	ENST00000404233.3	37	c.2157	CCDS8408.1	11																																																																																			-	HYOU1	-	pfam_Hsp_70_fam		0.607	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HYOU1	HGNC	protein_coding	OTTHUMT00000389353.1	0	0		35	35		0.00		C	NM_006389		118919434	-1	3		16		tier1	no_errors	ENST00000404233	ensembl	human	known	74_37	silent	15.79		SNP	0.001	T	3	16
R3HCC1	203069	genome.wustl.edu	37	8	23146092	23146092	+	Missense_Mutation	SNP	T	T	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr8:23146092T>A	ENST00000411463.1	+	3	176	c.176T>A	c.(175-177)gTc>gAc	p.V59D	R3HCC1_ENST00000522012.1_3'UTR|R3HCC1_ENST00000265806.6_5'UTR|R3HCC1_ENST00000518454.1_5'UTR			Q9Y3T6	R3HC1_HUMAN	R3H domain and coiled-coil containing 1	59	R3H. {ECO:0000255|PROSITE- ProRule:PRU00382}.						nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)			central_nervous_system(1)|skin(2)	3						AATGACTTCGTCCACCGGATC	0.612													ENSG00000104679																																					0																																										SO:0001583	missense	0			-		CCDS47826.1	8p21.3	2012-05-23		2005-11-20	ENSG00000104679	ENSG00000104679			27329	protein-coding gene	gene with protein product						12477932	Standard	XM_005273427		Approved	DKFZp564N123	uc003xdf.3	Q9Y3T6	OTTHUMG00000163786	ENST00000411463.1:c.176T>A	8.37:g.23146092T>A	ENSP00000397555:p.Val59Asp		B7ZLI1	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.V59D	ENST00000411463.1	37	c.176		8	.	.	.	.	.	.	.	.	.	.	T	31	5.086156	0.94100	.	.	ENSG00000104679	ENST00000411463	T	0.28454	1.61	5.77	5.77	0.91146	.	0.150859	0.44097	D	0.000500	T	0.49321	0.1550	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	T	0.52056	-0.8626	7	0.87932	D	0	-25.2302	13.4611	0.61227	0.0:0.0:0.0:1.0	.	.	.	.	D	59	ENSP00000397555:V59D	ENSP00000397555:V59D	V	+	2	0	R3HCC1	23202037	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.873000	0.48475	2.199000	0.70637	0.533000	0.62120	GTC	-	R3HCC1	-	smart_R3H_ss-bd,pfscan_R3H_ss-bd		0.612	R3HCC1-201	KNOWN	basic|appris_principal	protein_coding	R3HCC1	HGNC	protein_coding		0	0		73	73		0.00		T	NM_001136108		23146092	+1	7		45		tier1	no_errors	ENST00000411463	ensembl	human	known	74_37	missense	13.46		SNP	0.998	A	7	45
ZCCHC17	51538	genome.wustl.edu	37	1	31836898	31836899	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	AT	AT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:31836898_31836899delAT	ENST00000373714.1	+	8	845_846	c.584_585delAT	c.(583-585)catfs	p.H195fs	ZCCHC17_ENST00000546109.1_Frame_Shift_Del_p.H187fs|ZCCHC17_ENST00000344147.5_Frame_Shift_Del_p.H195fs|ZCCHC17_ENST00000422613.2_Frame_Shift_Del_p.H197fs|FABP3_ENST00000497275.1_5'Flank	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	195	Lys-rich.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		AAAAAGAAACATAGAGATAGGA	0.391													ENSG00000121766																																					0																																										SO:0001589	frameshift_variant	0				AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.584_585delAT	1.37:g.31836898_31836899delAT	ENSP00000362819:p.His195fs		B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Frame_Shift_Del	DEL	pfam_Rbsml_prot_S1_R-bd_dom,superfamily_-bd_OB-fold,smart_R-binding_domain_S1,pfscan_Rbsml_prot_S1_R-bd_dom	p.H197fs	ENST00000373714.1	37	c.590_591	CCDS341.1	1																																																																																				ZCCHC17	-	NULL		0.391	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC17	HGNC	protein_coding	OTTHUMT00000010665.1	0	0		26	26		0.00		AT	NM_016505		31836899	+1	5		10		tier1	no_errors	ENST00000422613	ensembl	human	known	74_37	frame_shift_del	33.33		DEL	1.000:0.988	-	5	10
CENPJ	55835	genome.wustl.edu	37	13	25486721	25486721	+	Splice_Site	SNP	T	T	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr13:25486721T>C	ENST00000381884.4	-	2	628	c.443A>G	c.(442-444)cAg>cGg	p.Q148R	CENPJ_ENST00000545981.1_Splice_Site_p.Q148R	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	148					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CTATTGTACCTGTTCAAGTTT	0.368													ENSG00000151849																																					0													67.0	69.0	68.0					13																	25486721		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.444+1A>G	13.37:g.25486721T>C			Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Missense_Mutation	SNP	pfam_Tcp10_C_dom	p.Q148R	ENST00000381884.4	37	c.443	CCDS9310.1	13	.	.	.	.	.	.	.	.	.	.	T	21.6	4.167661	0.78339	.	.	ENSG00000151849	ENST00000381884;ENST00000545981;ENST00000445729	T;T	0.36699	2.26;1.24	5.9	5.9	0.94986	.	0.000000	0.64402	D	0.000004	T	0.59932	0.2230	M	0.77616	2.38	0.32225	N	0.574786	D	0.76494	0.999	D	0.80764	0.994	T	0.68784	-0.5317	10	0.36615	T	0.2	.	13.8308	0.63380	0.0:0.0:0.0:1.0	.	148	Q9HC77	CENPJ_HUMAN	R	148	ENSP00000371308:Q148R;ENSP00000441090:Q148R	ENSP00000371308:Q148R	Q	-	2	0	CENPJ	24384721	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	5.098000	0.64548	2.252000	0.74401	0.533000	0.62120	CAG	-	CENPJ	-	NULL		0.368	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPJ	HGNC	protein_coding	OTTHUMT00000044209.1	0	0		92	92		0.00		T	NM_018451	Missense_Mutation	25486721	-1	4		43		tier1	no_errors	ENST00000381884	ensembl	human	known	74_37	missense	8.51		SNP	1.000	C	4	43
CACNG3	10368	genome.wustl.edu	37	16	24372825	24372825	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr16:24372825G>A	ENST00000005284.3	+	4	1791	c.589G>A	c.(589-591)Gtg>Atg	p.V197M		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	197					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		AGTGGTTGCCGTGCACATCTA	0.478													ENSG00000006116																																					0													130.0	127.0	128.0					16																	24372825		2197	4300	6497	SO:0001583	missense	0			-	AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.589G>A	16.37:g.24372825G>A	ENSP00000005284:p.Val197Met			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	p.V197M	ENST00000005284.3	37	c.589	CCDS10620.1	16	.	.	.	.	.	.	.	.	.	.	G	23.3	4.394162	0.83011	.	.	ENSG00000006116	ENST00000005284	D	0.81579	-1.51	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.89399	0.6704	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	D	0.90381	0.4388	10	0.56958	D	0.05	-12.108	17.8423	0.88718	0.0:0.0:1.0:0.0	.	197	O60359	CCG3_HUMAN	M	197	ENSP00000005284:V197M	ENSP00000005284:V197M	V	+	1	0	CACNG3	24280326	1.000000	0.71417	0.989000	0.46669	0.995000	0.86356	9.476000	0.97823	2.274000	0.75844	0.655000	0.94253	GTG	-	CACNG3	-	NULL		0.478	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG3	HGNC	protein_coding	OTTHUMT00000254548.1	0	0		128	128		0.00		G	NM_006539		24372825	+1	10		66		tier1	no_errors	ENST00000005284	ensembl	human	known	74_37	missense	13.16		SNP	1.000	A	10	66
GPR125	166647	genome.wustl.edu	37	4	22389640	22389640	+	Silent	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:22389640C>T	ENST00000334304.5	-	19	3923	c.3654G>A	c.(3652-3654)tcG>tcA	p.S1218S	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	1218					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				TTCGGCTCCTCGAGTGTCCTT	0.522													ENSG00000152990																																					0													93.0	86.0	89.0					4																	22389640		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.3654G>A	4.37:g.22389640C>T			Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.S1218	ENST00000334304.5	37	c.3654	CCDS33964.1	4																																																																																			-	GPR125	-	NULL		0.522	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	HGNC	protein_coding	OTTHUMT00000362960.3	0	0		169	169		0.00		C			22389640	-1	22		90		tier1	no_errors	ENST00000334304	ensembl	human	known	74_37	silent	19.64		SNP	0.000	T	22	90
CRYBB2	1415	genome.wustl.edu	37	22	25620893	25620893	+	Silent	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr22:25620893C>A	ENST00000398215.2	+	3	234	c.63C>A	c.(61-63)atC>atA	p.I21I		NM_000496.2	NP_000487.1	P43320	CRBB2_HUMAN	crystallin, beta B2	21	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|response to stimulus (GO:0050896)|visual perception (GO:0007601)		identical protein binding (GO:0042802)|structural constituent of eye lens (GO:0005212)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)	10						AGATCATCATCTTTGAGCAGG	0.542													ENSG00000244752																																					0													101.0	87.0	92.0					22																	25620893		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS13831.1	22q11.23	2008-06-10			ENSG00000244752	ENSG00000244752			2398	protein-coding gene	gene with protein product		123620		CCA2, CRYB2A, CRYB2		9158139, 8224918	Standard	XM_006724141		Approved		uc003abp.1	P43320	OTTHUMG00000150905	ENST00000398215.2:c.63C>A	22.37:g.25620893C>A			Q9UCM8	Silent	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.I21	ENST00000398215.2	37	c.63	CCDS13831.1	22																																																																																			-	CRYBB2	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin		0.542	CRYBB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBB2	HGNC	protein_coding	OTTHUMT00000320350.1	0	0		91	91		0.00		C	NM_000496		25620893	+1	27		51		tier1	no_errors	ENST00000398215	ensembl	human	known	74_37	silent	34.62		SNP	1.000	A	27	51
DAGLA	747	genome.wustl.edu	37	11	61513968	61513969	+	3'UTR	INS	-	-	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:61513968_61513969insC	ENST00000257215.5	+	0	5252_5253				RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha						arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		TCAGGGACAGACCCCCCACCCC	0.629													ENSG00000124915																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.*2008->C	11.37:g.61513974_61513974dupC			A7E233|Q6WQJ0	R	INS	-	NULL	ENST00000257215.5	37	NULL	CCDS31578.1	11																																																																																				RP11-467L20.10	-	-		0.629	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZP434K028	Clone_based_vega_gene	protein_coding	OTTHUMT00000398516.1	0	0		165	165		0.00		-	NM_006133		61513969	-1	20		97		tier1	no_errors	ENST00000536405	ensembl	human	known	74_37	rna	17.09		INS	0.996:0.997	C	20	97
MEF2C	4208	genome.wustl.edu	37	5	88178836	88178837	+	5'UTR	INS	-	-	A	rs200560914		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:88178836_88178837insA	ENST00000437473.2	-	0	213_214				MEF2C_ENST00000514015.1_5'UTR|MEF2C_ENST00000506554.1_5'UTR|MEF2C-AS1_ENST00000512585.1_RNA|MEF2C_ENST00000424173.2_Intron|MEF2C_ENST00000510942.1_5'UTR|MEF2C_ENST00000504921.2_5'UTR|MEF2C-AS1_ENST00000514794.1_RNA|MEF2C_ENST00000340208.5_Intron|MEF2C_ENST00000514028.1_5'UTR|MEF2C_ENST00000508569.1_5'UTR|MEF2C-AS1_ENST00000511100.1_RNA	NM_001193350.1|NM_002397.4	NP_001180279.1|NP_002388.2	Q06413	MEF2C_HUMAN	myocyte enhancer factor 2C						apoptotic process (GO:0006915)|B cell homeostasis (GO:0001782)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac ventricle formation (GO:0003211)|cartilage morphogenesis (GO:0060536)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to fluid shear stress (GO:0071498)|cellular response to glucose stimulus (GO:0071333)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to trichostatin A (GO:0035984)|chondrocyte differentiation (GO:0002062)|dentate gyrus development (GO:0021542)|embryonic viscerocranium morphogenesis (GO:0048703)|endochondral ossification (GO:0001958)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|germinal center formation (GO:0002467)|glomerulus morphogenesis (GO:0072102)|heart development (GO:0007507)|heart looping (GO:0001947)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|MAPK cascade (GO:0000165)|melanocyte differentiation (GO:0030318)|monocyte differentiation (GO:0030224)|muscle cell differentiation (GO:0042692)|muscle cell fate determination (GO:0007521)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|myotube differentiation (GO:0014902)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of ossification (GO:0030279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nephron tubule epithelial cell differentiation (GO:0072160)|nervous system development (GO:0007399)|neural crest cell differentiation (GO:0014033)|neuron development (GO:0048666)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|platelet formation (GO:0030220)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of skeletal muscle cell differentiation (GO:2001016)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primary heart field specification (GO:0003138)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of dendritic spine development (GO:0060998)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of germinal center formation (GO:0002634)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron apoptotic process (GO:0043523)|regulation of neurotransmitter secretion (GO:0046928)|regulation of sarcomere organization (GO:0060297)|regulation of synapse assembly (GO:0051963)|regulation of synaptic activity (GO:0060025)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|renal tubule morphogenesis (GO:0061333)|response to ischemia (GO:0002931)|response to virus (GO:0009615)|response to vitamin E (GO:0033197)|secondary heart field specification (GO:0003139)|sinoatrial valve morphogenesis (GO:0003185)|skeletal muscle tissue development (GO:0007519)|smooth muscle cell differentiation (GO:0051145)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcomere (GO:0030017)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	40		all_cancers(142;6.67e-05)|all_epithelial(76;7.77e-07)|Lung NSC(167;0.00566)|all_lung(232;0.00732)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;1.04e-33)|Epithelial(54;1.6e-28)|all cancers(79;2.9e-25)		GAGAGAGAGAGAAAAAAAAAAT	0.406										HNSCC(66;0.2)			ENSG00000081189																																					0																																										SO:0001623	5_prime_UTR_variant	0				AL833268	CCDS47244.1, CCDS47245.1, CCDS54877.1, CCDS54878.1	5q14.3	2013-07-03	2007-04-24		ENSG00000081189	ENSG00000081189		"""Myocyte enhancer factors"""	6996	protein-coding gene	gene with protein product		600662				8455629	Standard	NM_002397		Approved		uc003kjl.3	Q06413	OTTHUMG00000162634	ENST00000437473.2:c.-205->T	5.37:g.88178846_88178846dupA			C9JMZ0|D7F7N5|F8W7V7	R	INS	-	NULL	ENST00000437473.2	37	NULL	CCDS47245.1	5																																																																																				MEF2C	-	-		0.406	MEF2C-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	MEF2C	HGNC	protein_coding	OTTHUMT00000369817.1	0	0		41	41		0.00		-	NM_002397		88178837	-1	4		11		tier1	no_errors	ENST00000509349	ensembl	human	known	74_37	rna	26.67		INS	0.001:0.000	A	4	11
PCDHA3	56145	genome.wustl.edu	37	5	140182250	140182250	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:140182250G>A	ENST00000522353.2	+	1	1468	c.1468G>A	c.(1468-1470)Gtg>Atg	p.V490M	PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.V490M|PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	490	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAACGCCCTGGTGTCCTACTC	0.677													ENSG00000255408																																					0													83.0	88.0	86.0					5																	140182250		2203	4299	6502	SO:0001583	missense	0			-	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.1468G>A	5.37:g.140182250G>A	ENSP00000429808:p.Val490Met		O75286	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V490M	ENST00000522353.2	37	c.1468	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	g	15.74	2.921436	0.52653	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.55760	0.5;0.5	4.75	4.75	0.60458	Cadherin (4);Cadherin-like (1);	0.000000	0.37623	U	0.002010	T	0.71710	0.3372	M	0.80746	2.51	0.23994	N	0.996239	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.65043	-0.6264	10	0.87932	D	0	.	11.6726	0.51411	0.0827:0.0:0.9173:0.0	.	490;490	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	M	490	ENSP00000429808:V490M;ENSP00000434086:V490M	ENSP00000429808:V490M	V	+	1	0	PCDHA3	140162434	0.672000	0.27530	0.970000	0.41538	0.790000	0.44656	0.795000	0.26972	2.374000	0.81015	0.461000	0.40582	GTG	-	PCDHA3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.677	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	HGNC	protein_coding	OTTHUMT00000372848.2	0	0		266	266		0.00		G	NM_018906		140182250	+1	14		96		tier1	no_errors	ENST00000522353	ensembl	human	known	74_37	missense	12.73		SNP	0.730	A	14	96
ZMYM3	9203	genome.wustl.edu	37	X	70464192	70464192	+	Silent	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chrX:70464192G>T	ENST00000353904.2	-	20	3427	c.3240C>A	c.(3238-3240)gcC>gcA	p.A1080A	ZMYM3_ENST00000373984.3_Silent_p.A1082A|ZMYM3_ENST00000373988.1_Silent_p.A1082A|ZMYM3_ENST00000314425.5_Silent_p.A1080A|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373998.1_Silent_p.A1068A	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1080					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TTTCTCCATTGGCATATTTTG	0.567													ENSG00000147130																																					0													103.0	75.0	84.0					X																	70464192		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3240C>A	X.37:g.70464192G>T			D3DVV3|O15089|Q96E26	Silent	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.A1082	ENST00000353904.2	37	c.3246	CCDS14409.1	X																																																																																			-	ZMYM3	-	NULL		0.567	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	0	0		53	53		0.00		G	NM_201599		70464192	-1	4		41		tier1	no_errors	ENST00000373988	ensembl	human	known	74_37	silent	8.89		SNP	1.000	T	4	41
PHRF1	57661	genome.wustl.edu	37	11	598385	598385	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr11:598385C>T	ENST00000264555.5	+	9	1035	c.907C>T	c.(907-909)Cgc>Tgc	p.R303C	PHRF1_ENST00000533464.1_Missense_Mutation_p.R299C|PHRF1_ENST00000416188.2_Missense_Mutation_p.R303C|PHRF1_ENST00000413872.2_Missense_Mutation_p.R302C	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	303	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						CACACCAGGGCGCCTCGGGTC	0.672													ENSG00000070047																																					0													31.0	38.0	36.0					11																	598385		2128	4233	6361	SO:0001583	missense	0			-	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.907C>T	11.37:g.598385C>T	ENSP00000264555:p.Arg303Cys		A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R303C	ENST00000264555.5	37	c.907		11	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136605	0.37728	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	4.64	0.772	0.18510	.	0.618637	0.13372	N	0.392802	T	0.21590	0.0520	N	0.08118	0	0.22424	N	0.999117	P;P;P;P	0.45044	0.765;0.849;0.849;0.765	B;B;B;B	0.41723	0.2;0.365;0.365;0.2	T	0.09997	-1.0649	10	0.44086	T	0.13	-7.5723	7.0974	0.25317	0.0:0.2431:0.0:0.7569	.	299;302;303;303	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	C	303;302;303;299	ENSP00000264555:R303C;ENSP00000388589:R302C;ENSP00000410626:R303C;ENSP00000431870:R299C	ENSP00000264555:R303C	R	+	1	0	PHRF1	588385	0.996000	0.38824	0.027000	0.17364	0.001000	0.01503	0.203000	0.17315	-0.105000	0.12132	0.491000	0.48974	CGC	-	PHRF1	-	NULL		0.672	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1	0	0		172	172		0.00		C	NM_020901		598385	+1	19		66		tier1	no_errors	ENST00000264555	ensembl	human	known	74_37	missense	22.09		SNP	0.830	T	19	66
CACNA1A	773	genome.wustl.edu	37	19	13373594	13373594	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr19:13373594C>T	ENST00000360228.5	-	25	4042	c.4043G>A	c.(4042-4044)cGg>cAg	p.R1348Q	CACNA1A_ENST00000573710.2_Missense_Mutation_p.R1349Q	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1349					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TCGTAGCACCCGGAGGACTCG	0.522											OREG0025294	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000141837																																					0													119.0	115.0	116.0					19																	13373594		1910	4129	6039	SO:0001583	missense	0			-	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4043G>A	19.37:g.13373594C>T	ENSP00000353362:p.Arg1348Gln	687	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.R1348Q	ENST00000360228.5	37	c.4043	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487612	0.84854	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.98762	-5.12	5.4	5.4	0.78164	Ion transport (1);	0.000000	0.64402	D	0.000001	D	0.99480	0.9815	H	0.97077	3.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	D	0.98254	1.0495	10	0.87932	D	0	.	17.9649	0.89097	0.0:1.0:0.0:0.0	.	1349;1352;1348	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	Q	1348;1352;1349;1349	ENSP00000353362:R1348Q	ENSP00000317661:R1349Q	R	-	2	0	CACNA1A	13234594	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.712000	0.84684	2.536000	0.85505	0.561000	0.74099	CGG	-	CAC1A	-	pfam_Ion_trans_dom		0.522	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CAC1A	HGNC	protein_coding	OTTHUMT00000104062.2	0	0		128	128		0.00		C	NM_000068		13373594	-1	10		71		tier1	no_errors	ENST00000360228	ensembl	human	known	74_37	missense	12.35		SNP	1.000	T	10	71
NDUFV3	4731	genome.wustl.edu	37	21	44328980	44328980	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr21:44328980C>T	ENST00000340344.4	+	3	242	c.176C>T	c.(175-177)gCc>gTc	p.A59V	NDUFV3_ENST00000460259.1_3'UTR|NDUFV3_ENST00000354250.2_Missense_Mutation_p.A424V	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa	59					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		GCAGAGCCAGCCCCAGTGCCT	0.522													ENSG00000160194																																					0													180.0	149.0	160.0					21																	44328980		2203	4300	6503	SO:0001583	missense	0			-		CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.176C>T	21.37:g.44328980C>T	ENSP00000342895:p.Ala59Val		A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Missense_Mutation	SNP	NULL	p.A424V	ENST00000340344.4	37	c.1271	CCDS33573.1	21	.	.	.	.	.	.	.	.	.	.	C	12.53	1.964355	0.34659	.	.	ENSG00000160194	ENST00000354250;ENST00000340344;ENST00000398198	.	.	.	4.64	1.72	0.24424	.	0.311804	0.23629	N	0.046152	T	0.31358	0.0794	L	0.47716	1.5	0.09310	N	1	B;B	0.25563	0.0;0.129	B;B	0.26202	0.003;0.067	T	0.22906	-1.0203	9	0.52906	T	0.07	-0.5713	4.9408	0.13965	0.0:0.452:0.2907:0.2573	.	59;424	P56181;P56181-2	NDUV3_HUMAN;.	V	424;59;63	.	ENSP00000342895:A59V	A	+	2	0	NDUFV3	43202049	0.097000	0.21791	0.000000	0.03702	0.003000	0.03518	1.720000	0.38022	0.234000	0.21139	0.551000	0.68910	GCC	-	NDUFV3	-	NULL		0.522	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV3	HGNC	protein_coding	OTTHUMT00000195448.2	0	0		129	129		0.00		C			44328980	+1	5		56		tier1	no_errors	ENST00000354250	ensembl	human	known	74_37	missense	8.20		SNP	0.001	T	5	56
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ATP2C1_ENST00000328560.8_Intron|ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000393221.4_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406													ENSG00000034533																																					2	Deletion - Frameshift(2)	ovary(2)																																								SO:0001589	frameshift_variant	0				AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs		B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	pfam_XPG_D_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																				ASTE1	-	NULL		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	HGNC	protein_coding	OTTHUMT00000356659.1	0	0		49	49		0.00		-	NM_014065		130733047	-1	5		27		tier1	no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	15.62		INS	0.003:0.014	T	5	27
ZFP42	132625	genome.wustl.edu	37	4	188924433	188924433	+	Frame_Shift_Del	DEL	C	C	-	rs143445473		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:188924433delC	ENST00000326866.4	+	4	880	c.472delC	c.(472-474)cctfs	p.P158fs	ZFP42_ENST00000509524.1_Frame_Shift_Del_p.P158fs	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	158					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TGGAGGAATACCTGGCATTGA	0.443													ENSG00000179059																																					0													101.0	114.0	110.0					4																	188924433		2203	4300	6503	SO:0001589	frameshift_variant	0				AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.472delC	4.37:g.188924433delC	ENSP00000317686:p.Pro158fs		D3DP65|Q8WXE2	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P158fs	ENST00000326866.4	37	c.472	CCDS3849.1	4																																																																																				ZFP42	-	NULL		0.443	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	HGNC	protein_coding	OTTHUMT00000359794.1	0	0		67	67		0.00		C	NM_174900		188924433	+1	2		18		tier1	no_errors	ENST00000326866	ensembl	human	known	74_37	frame_shift_del	10.00		DEL	0.997	-	2	18
EPHA7	2045	genome.wustl.edu	37	6	93955133	93955133	+	Frame_Shift_Del	DEL	A	A	-			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:93955133delA	ENST00000369303.4	-	16	2949	c.2765delT	c.(2764-2766)ttcfs	p.F922fs		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	922					brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		AAAGGTAGTGAAATCAGGAGT	0.363													ENSG00000135333																																					0													95.0	101.0	99.0					6																	93955133		2203	4300	6503	SO:0001589	frameshift_variant	0				L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2765delT	6.37:g.93955133delA	ENSP00000358309:p.Phe922fs		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Frame_Shift_Del	DEL	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.F922fs	ENST00000369303.4	37	c.2765	CCDS5031.1	6																																																																																				EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM		0.363	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	0	0		89	89		0.00		A			93955133	-1	10		49		tier1	no_errors	ENST00000369303	ensembl	human	known	74_37	frame_shift_del	16.95		DEL	1.000	-	10	49
PCDHGA11	56105	genome.wustl.edu	37	5	140801828	140801828	+	Missense_Mutation	SNP	C	C	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:140801828C>A	ENST00000398587.2	+	1	1067	c.1034C>A	c.(1033-1035)gCt>gAt	p.A345D	PCDHGA11_ENST00000518882.1_Missense_Mutation_p.A345D|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	345	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGATAACGCTCCAGAAATA	0.393													ENSG00000253873																																					0													44.0	45.0	45.0					5																	140801828		1870	4092	5962	SO:0001583	missense	0			-	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1034C>A	5.37:g.140801828C>A	ENSP00000381589:p.Ala345Asp		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A345D	ENST00000398587.2	37	c.1034	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	c	15.66	2.900632	0.52227	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.03301	3.98;3.98	5.82	4.94	0.65067	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.339126	0.15234	U	0.273270	T	0.18045	0.0433	M	0.80616	2.505	0.23791	N	0.996834	P;D;D	0.63880	0.956;0.993;0.974	P;P;P	0.62184	0.729;0.899;0.885	T	0.03993	-1.0986	10	0.66056	D	0.02	.	14.9775	0.71286	0.0:0.9301:0.0:0.0699	.	345;345;345	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	D	345	ENSP00000381589:A345D;ENSP00000428333:A345D	ENSP00000381589:A345D	A	+	2	0	PCDHGA11	140782012	0.000000	0.05858	1.000000	0.80357	0.951000	0.60555	0.718000	0.25866	1.432000	0.47375	0.655000	0.94253	GCT	-	PCDHGA11	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.393	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	0	0		82	82		0.00		C	NM_018914		140801828	+1	4		45		tier1	no_errors	ENST00000398587	ensembl	human	known	74_37	missense	8.16		SNP	0.926	A	4	45
RBM15B	29890	genome.wustl.edu	37	3	51430822	51430824	+	In_Frame_Del	DEL	CCA	CCA	-	rs147738916	byFrequency	TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	CCA	CCA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:51430822_51430824delCCA	ENST00000323686.4	+	1	2092_2094	c.1992_1994delCCA	c.(1990-1995)ggccac>ggc	p.H670del		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	670	His-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGAACGGGGCCACCACCACCAC	0.635													ENSG00000179837																																					0																																										SO:0001651	inframe_deletion	0				AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1992_1994delCCA	3.37:g.51430831_51430833delCCA	ENSP00000313890:p.His670del		A4QPG7|Q6QE19|Q9BV96	In_Frame_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.H668in_frame_del	ENST00000323686.4	37	c.1992_1994	CCDS33764.1	3																																																																																				RBM15B	-	NULL		0.635	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM15B	HGNC	protein_coding	OTTHUMT00000346489.1	0	0		31	31		0.00		CCA	NM_013286		51430824	+1	2		6		tier1	no_errors	ENST00000323686	ensembl	human	known	74_37	in_frame_del	25.00		DEL	1.000:1.000:0.998	-	2	6
NOC4L	79050	genome.wustl.edu	37	12	132632204	132632204	+	Silent	SNP	T	T	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr12:132632204T>A	ENST00000330579.1	+	5	521	c.480T>A	c.(478-480)ccT>ccA	p.P160P	NOC4L_ENST00000535343.1_3'UTR	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	160					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		TGCTGTCTCCTGAGGAGGACC	0.672													ENSG00000184967																																					0													50.0	49.0	50.0					12																	132632204		2203	4299	6502	SO:0001819	synonymous_variant	0			-		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.480T>A	12.37:g.132632204T>A			Q8N2S5|Q96I14	Silent	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.P160	ENST00000330579.1	37	c.480	CCDS9277.1	12																																																																																			-	NOC4L	-	superfamily_ARM-type_fold		0.672	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	HGNC	protein_coding	OTTHUMT00000398999.1	0	0		116	116		0.00		T	NM_024078		132632204	+1	12		64		tier1	no_errors	ENST00000330579	ensembl	human	known	74_37	silent	15.79		SNP	0.000	A	12	64
MYO18B	84700	genome.wustl.edu	37	22	26239728	26239728	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr22:26239728C>T	ENST00000407587.2	+	18	3407	c.3238C>T	c.(3238-3240)Cag>Tag	p.Q1080*	MYO18B_ENST00000335473.7_Nonsense_Mutation_p.Q1079*|MYO18B_ENST00000536101.1_Nonsense_Mutation_p.Q1079*			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1079	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GACCTGTGAGCAGCCCCTCCA	0.602													ENSG00000133454																																					0													103.0	106.0	105.0					22																	26239728		2039	4185	6224	SO:0001587	stop_gained	0			-	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.3238C>T	22.37:g.26239728C>T	ENSP00000386096:p.Gln1080*		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tR-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1079*	ENST00000407587.2	37	c.3235		22	.	.	.	.	.	.	.	.	.	.	C	45	11.468392	0.99565	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	.	.	.	4.71	4.71	0.59529	.	0.137995	0.50627	D	0.000102	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	15.2251	0.73345	0.0:1.0:0.0:0.0	.	.	.	.	X	1079;1079;1080	.	ENSP00000334563:Q1079X	Q	+	1	0	MYO18B	24569728	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	1.721000	0.38032	2.451000	0.82905	0.650000	0.86243	CAG	-	MYO18B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	0	0		42	42		0.00		C	NM_032608		26239728	+1	4		29		tier1	no_errors	ENST00000335473	ensembl	human	known	74_37	nonsense	12.12		SNP	1.000	T	4	29
MT-CO1	4512	genome.wustl.edu	37	M	6287	6287	+	Silent	SNP	C	C	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chrM:6287C>G	ENST00000361624.2	+	1	384	c.384C>G	c.(382-384)gtC>gtG	p.V128V	MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	128					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GGTTGAACAGTCTACCCTCCC	0.542													ENSG00000198804																																					0																																										SO:0001819	synonymous_variant	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.384C>G	M.37:g.6287C>G			Q34770	Silent	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.V128	ENST00000361624.2	37	c.384		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.542	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0		19	19		0.00		C	YP_003024028		6287	+1	2		6		tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	silent	25.00		SNP	NULL	G	2	6
MIR3687-2	103504728	genome.wustl.edu	37	21	9826011	9826011	+	RNA	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr21:9826011G>A	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						CCTTTCTCGCGCCTTCCCCGT	0.796													ENSG00000264462																																					0																																												0			-																													21.37:g.9826011G>A				R	SNP	-	NULL	ENST00000577708.1	37	NULL		21																																																																																			-	MIR3648	-	-		0.796	MIR3687-201	KNOWN	basic	miRNA	MIR3648	HGNC	miRNA		0	0		31	31		0.00		G			9826011	+1	5		9		tier1	no_errors	ENST00000581792	ensembl	human	known	74_37	rna	35.71		SNP	0.084	A	5	9
DIAPH1	1729	genome.wustl.edu	37	5	140966629	140966629	+	Missense_Mutation	SNP	C	C	G			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:140966629C>G	ENST00000398557.4	-	3	420	c.280G>C	c.(280-282)Gtt>Ctt	p.V94L	DIAPH1_ENST00000398562.2_Missense_Mutation_p.V85L|DIAPH1_ENST00000389057.5_Missense_Mutation_p.V85L|DIAPH1_ENST00000253811.6_Missense_Mutation_p.V94L|DIAPH1_ENST00000520569.1_Missense_Mutation_p.V40L|DIAPH1_ENST00000398566.3_Missense_Mutation_p.V85L|DIAPH1_ENST00000389054.3_Missense_Mutation_p.V94L|DIAPH1_ENST00000518047.1_Missense_Mutation_p.V85L	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	94	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCAAAGAGAACCAGCACTTGT	0.428													ENSG00000131504																																					0													168.0	152.0	157.0					5																	140966629		1890	4115	6005	SO:0001583	missense	0			-	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.280G>C	5.37:g.140966629C>G	ENSP00000381565:p.Val94Leu		A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_tR-bd_arm,smart_FH2_Formin	p.V94L	ENST00000398557.4	37	c.280	CCDS43374.1	5	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369425	0.42003	.	.	ENSG00000131504	ENST00000389054;ENST00000520569;ENST00000398562;ENST00000389057;ENST00000398566;ENST00000398557;ENST00000253811;ENST00000518047;ENST00000524301	D;D;D;D;D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47;-2.47	5.01	3.23	0.37069	GTPase-binding/formin homology 3 (1);Diaphanous GTPase-binding (1);	0.304404	0.26875	N	0.022059	T	0.78110	0.4232	N	0.08118	0	0.26957	N	0.965894	B;B	0.34226	0.443;0.443	B;B	0.41374	0.267;0.355	T	0.68307	-0.5443	10	0.32370	T	0.25	.	6.4672	0.21987	0.0:0.6847:0.1492:0.1661	.	85;94	E9PEZ2;O60610	.;DIAP1_HUMAN	L	94;40;85;85;85;94;94;85;40	ENSP00000373706:V94L;ENSP00000429282:V40L;ENSP00000381570:V85L;ENSP00000373709:V85L;ENSP00000381572:V85L;ENSP00000381565:V94L;ENSP00000253811:V94L;ENSP00000428268:V85L;ENSP00000430587:V40L	ENSP00000253811:V94L	V	-	1	0	DIAPH1	140946813	0.997000	0.39634	0.988000	0.46212	0.975000	0.68041	1.824000	0.39072	0.620000	0.30215	0.655000	0.94253	GTT	-	DIAPH1	-	pfam_GTPase-bd		0.428	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		0	0		89	89		0.00		C	NM_005219		140966629	-1	4		36		tier1	no_errors	ENST00000253811	ensembl	human	known	74_37	missense	10.00		SNP	1.000	G	4	36
KMT2E	55904	genome.wustl.edu	37	7	104747869	104747869	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr7:104747869G>A	ENST00000311117.3	+	22	3510	c.2965G>A	c.(2965-2967)Gaa>Aaa	p.E989K	CTB-152G17.6_ENST00000607968.1_RNA|KMT2E_ENST00000257745.4_Missense_Mutation_p.E989K|KMT2E_ENST00000334914.7_Missense_Mutation_p.E44K|KMT2E_ENST00000334877.4_Missense_Mutation_p.E989K	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	989					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TAATTTAACTGAACTGGGTCT	0.368													ENSG00000005483																																					0													71.0	77.0	75.0					7																	104747869		2203	4300	6503	SO:0001583	missense	0			-	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2965G>A	7.37:g.104747869G>A	ENSP00000312379:p.Glu989Lys		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.E989K	ENST00000311117.3	37	c.2965	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	G	22.0	4.225747	0.79576	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.92495	-3.05;-2.62;-3.05;0.55	6.03	6.03	0.97812	.	0.270881	0.37304	N	0.002155	D	0.88078	0.6340	N	0.24115	0.695	0.46131	D	0.99888	B	0.27791	0.189	B	0.27608	0.081	D	0.83611	0.0134	10	0.42905	T	0.14	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	989	Q8IZD2	MLL5_HUMAN	K	989;989;989;909;989;44	ENSP00000312379:E989K;ENSP00000335599:E989K;ENSP00000257745:E989K;ENSP00000333986:E44K	ENSP00000257745:E989K	E	+	1	0	MLL5	104535105	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.378000	0.66190	2.854000	0.98071	0.655000	0.94253	GAA	-	KMT2E	-	NULL		0.368	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	0	0		121	121		0.00		G			104747869	+1	25		72		tier1	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	25.77		SNP	1.000	A	25	72
RBMS2	5939	genome.wustl.edu	37	12	56975275	56975275	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr12:56975275C>T	ENST00000262031.5	+	7	810	c.715C>T	c.(715-717)Cca>Tca	p.P239S	RBMS2_ENST00000552247.2_Missense_Mutation_p.P239S|RBMS2_ENST00000542360.1_Missense_Mutation_p.P94S|RBMS2_ENST00000550726.1_Missense_Mutation_p.P114S	NM_002898.3	NP_002889.1	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting protein 2	239					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(3)|skin(2)|urinary_tract(1)	18						ACGGGCTTGGCCAAGGAATGC	0.483													ENSG00000076067																																					0													56.0	49.0	51.0					12																	56975275		2203	4300	6503	SO:0001583	missense	0			-	D28483	CCDS8923.1	12q13.13	2013-02-12			ENSG00000076067	ENSG00000076067		"""RNA binding motif (RRM) containing"""	9909	protein-coding gene	gene with protein product		602387				8041632	Standard	NM_002898		Approved	SCR3	uc001sln.2	Q15434	OTTHUMG00000170488	ENST00000262031.5:c.715C>T	12.37:g.56975275C>T	ENSP00000262031:p.Pro239Ser			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P239S	ENST00000262031.5	37	c.715	CCDS8923.1	12	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672482	0.29693	.	.	ENSG00000076067	ENST00000262031;ENST00000552247;ENST00000550726;ENST00000542360	T;T;T	0.73681	2.74;-0.77;-0.77	5.21	5.21	0.72293	.	0.398617	0.25919	N	0.027453	T	0.66479	0.2793	L	0.46157	1.445	0.40019	D	0.975385	B;B	0.28082	0.2;0.008	B;B	0.26416	0.069;0.005	T	0.62704	-0.6798	10	0.21540	T	0.41	.	13.6573	0.62346	0.0:0.8447:0.1553:0.0	.	94;239	F5H5C8;Q15434	.;RBMS2_HUMAN	S	239;239;114;94	ENSP00000262031:P239S;ENSP00000447426:P239S;ENSP00000449678:P114S	ENSP00000262031:P239S	P	+	1	0	RBMS2	55261542	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.407000	0.34657	2.605000	0.88082	0.655000	0.94253	CCA	-	RBMS2	-	NULL		0.483	RBMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS2	HGNC	protein_coding	OTTHUMT00000409366.2	0	0		83	83		0.00		C	NM_002898		56975275	+1	5		42		tier1	no_errors	ENST00000262031	ensembl	human	known	74_37	missense	10.64		SNP	1.000	T	5	42
TSTD3	100130890	genome.wustl.edu	37	6	99968898	99968899	+	RNA	INS	-	-	GCGCC			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:99968898_99968899insGCGCC	ENST00000452647.2	+	0	330_331							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GCCGGAGCAGGAGGAGAAGGAG	0.683											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000228439																																					0																																												0						6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968898_99968899insGCGCC		1347		R	INS	-	NULL	ENST00000452647.2	37	NULL		6																																																																																				TSTD3	-	-		0.683	TSTD3-001	KNOWN	basic	antisense	TSTD3	HGNC	antisense	OTTHUMT00000041605.2									-	NM_001195131		99968899	+1					tier1	no_errors	ENST00000452647	ensembl	human	known	74_37	rna			INS	0.000:0.000	GCGCC		
BCAS3	54828	genome.wustl.edu	37	17	59161917	59161917	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr17:59161917C>T	ENST00000390652.5	+	23	2493	c.2462C>T	c.(2461-2463)gCt>gTt	p.A821V	BCAS3_ENST00000585744.1_Missense_Mutation_p.A592V|BCAS3_ENST00000407086.3_Missense_Mutation_p.A806V|BCAS3_ENST00000588874.1_Missense_Mutation_p.A577V|BCAS3_ENST00000408905.3_Missense_Mutation_p.A806V|BCAS3_ENST00000589222.1_Missense_Mutation_p.A806V|BCAS3_ENST00000588462.1_Missense_Mutation_p.A821V	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			GTGATTGATGCTGCCTCAGGT	0.473													ENSG00000141376																																					0													65.0	65.0	65.0					17																	59161917		1931	4158	6089	SO:0001583	missense	0			-	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2462C>T	17.37:g.59161917C>T	ENSP00000375067:p.Ala821Val			Missense_Mutation	SNP	pfam_BCAS3,pfam_WD40_repeat	p.A821V	ENST00000390652.5	37	c.2462	CCDS45749.1	17	.	.	.	.	.	.	.	.	.	.	C	15.94	2.980937	0.53827	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000408905	T;T;T	0.31510	1.51;1.5;1.49	5.92	5.92	0.95590	.	0.055536	0.64402	D	0.000001	T	0.26738	0.0654	N	0.24115	0.695	0.42608	D	0.993308	P;P;P;B;P	0.36909	0.562;0.465;0.573;0.437;0.573	B;B;B;B;B	0.36666	0.202;0.23;0.164;0.079;0.164	T	0.02345	-1.1173	10	0.39692	T	0.17	.	20.3206	0.98668	0.0:1.0:0.0:0.0	.	806;821;806;821;806	Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	V	821;806;806	ENSP00000375067:A821V;ENSP00000385323:A806V;ENSP00000386173:A806V	ENSP00000375067:A821V	A	+	2	0	BCAS3	56516699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.523000	0.67099	2.809000	0.96659	0.655000	0.94253	GCT	-	BCAS3	-	NULL		0.473	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1	0	0		50	50		0.00		C	NM_017679		59161917	+1	3		20		tier1	no_errors	ENST00000390652	ensembl	human	known	74_37	missense	13.04		SNP	1.000	T	3	20
OR11L1	391189	genome.wustl.edu	37	1	248004931	248004931	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:248004931G>T	ENST00000355784.2	-	1	323	c.268C>A	c.(268-270)Caa>Aaa	p.Q90K		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	90						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAGATGGCTTGGCCCCAGGAC	0.567													ENSG00000197591																																					0													68.0	57.0	61.0					1																	248004931		2203	4300	6503	SO:0001583	missense	0			-	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.268C>A	1.37:g.248004931G>T	ENSP00000348033:p.Gln90Lys			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.Q90K	ENST00000355784.2	37	c.268	CCDS31098.1	1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.097489	0.00360	.	.	ENSG00000197591	ENST00000355784	T	0.35421	1.31	4.2	3.28	0.37604	GPCR, rhodopsin-like superfamily (1);	0.945895	0.08537	U	0.931110	T	0.13286	0.0322	N	0.03154	-0.405	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.37267	-0.9713	10	0.02654	T	1	.	5.2718	0.15628	0.1036:0.0:0.5457:0.3507	.	90	Q8NGX0	O11L1_HUMAN	K	90	ENSP00000348033:Q90K	ENSP00000348033:Q90K	Q	-	1	0	OR11L1	246071554	0.000000	0.05858	0.015000	0.15790	0.296000	0.27459	-0.222000	0.09190	2.331000	0.79229	0.543000	0.68304	CAA	-	OR11L1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.567	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11L1	HGNC	protein_coding	OTTHUMT00000096850.1	0	0		106	106		0.00		G	NM_001001959		248004931	-1	4		44		tier1	no_errors	ENST00000355784	ensembl	human	known	74_37	missense	8.16		SNP	0.001	T	4	44
C9orf78	51759	genome.wustl.edu	37	9	132596000	132596001	+	Intron	INS	-	-	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr9:132596000_132596001insA	ENST00000372447.3	-	3	197				USP20_ENST00000358355.1_5'Flank|C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000315480.4_5'Flank|USP20_ENST00000372429.3_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78							cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				TGAGCAAAACCAAAAAAAAAAG	0.48													ENSG00000136819																																					0																																										SO:0001627	intron_variant	0				BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.144-12->T	9.37:g.132596010_132596010dupA			B3KPX8|Q8WVU6|Q9NT39	R	INS	-	NULL	ENST00000372447.3	37	NULL	CCDS6931.1	9																																																																																				C9orf78	-	-		0.480	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1	0	0		47	47		0.00		-	NM_016520		132596001	-1	4		18		tier1	no_errors	ENST00000461762	ensembl	human	known	74_37	rna	18.18		INS	0.062:0.115	A	4	18
APCDD1L	164284	genome.wustl.edu	37	20	57042566	57042566	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr20:57042566G>A	ENST00000371149.3	-	3	567	c.337C>T	c.(337-339)Cgc>Tgc	p.R113C	APCDD1L_ENST00000439429.1_Missense_Mutation_p.R124C	NM_153360.1	NP_699191.1	Q8NCL9	APCDL_HUMAN	adenomatosis polyposis coli down-regulated 1-like	113						integral component of membrane (GO:0016021)				large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(1)	18	Lung NSC(12;0.000856)|all_lung(29;0.0025)		BRCA - Breast invasive adenocarcinoma(13;5.6e-11)|Epithelial(14;1.67e-07)|all cancers(14;1.48e-06)			GAGGCCCGGCGCAGGCGGACT	0.682													ENSG00000198768																																					0													13.0	16.0	15.0					20																	57042566		2199	4295	6494	SO:0001583	missense	0			-	AK074647	CCDS13467.1	20q13.32	2006-07-07			ENSG00000198768	ENSG00000198768			26892	protein-coding gene	gene with protein product							Standard	NM_153360		Approved	FLJ90166	uc002xze.1	Q8NCL9	OTTHUMG00000032845	ENST00000371149.3:c.337C>T	20.37:g.57042566G>A	ENSP00000360191:p.Arg113Cys			Missense_Mutation	SNP	NULL	p.R124C	ENST00000371149.3	37	c.370	CCDS13467.1	20	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778188	0.90195	.	.	ENSG00000198768	ENST00000371149;ENST00000439429	T;T	0.21031	2.03;2.03	5.12	4.18	0.49190	.	0.127043	0.56097	D	0.000034	T	0.48370	0.1496	M	0.83603	2.65	0.46241	D	0.998942	P;D	0.89917	0.933;1.0	B;D	0.72982	0.245;0.979	T	0.55661	-0.8106	10	0.87932	D	0	-36.4835	13.4214	0.61001	0.0759:0.0:0.9241:0.0	.	124;113	F5H6V6;Q8NCL9	.;APCDL_HUMAN	C	113;124	ENSP00000360191:R113C;ENSP00000413261:R124C	ENSP00000360191:R113C	R	-	1	0	APCDD1L	56475972	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.053000	0.64269	1.171000	0.42768	0.555000	0.69702	CGC	-	APCDD1L	-	NULL		0.682	APCDD1L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	APCDD1L	HGNC	protein_coding	OTTHUMT00000079881.2	0	0		33	33		0.00		G	NM_153360		57042566	-1	10		25		tier1	no_errors	ENST00000439429	ensembl	human	known	74_37	missense	28.57		SNP	1.000	A	10	25
GRIA1	2890	genome.wustl.edu	37	5	153078608	153078608	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:153078608G>A	ENST00000285900.5	+	10	1770	c.1427G>A	c.(1426-1428)gGc>gAc	p.G476D	GRIA1_ENST00000518142.1_Missense_Mutation_p.G396D|GRIA1_ENST00000518783.1_Missense_Mutation_p.G486D|GRIA1_ENST00000448073.4_Missense_Mutation_p.G486D|GRIA1_ENST00000521843.2_Missense_Mutation_p.G407D|GRIA1_ENST00000340592.5_Missense_Mutation_p.G476D	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	476					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GCCTGGAATGGCATGGTGGGA	0.552													ENSG00000155511																																					0													55.0	54.0	54.0					5																	153078608		2203	4300	6503	SO:0001583	missense	0			-		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1427G>A	5.37:g.153078608G>A	ENSP00000285900:p.Gly476Asp		B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G486D	ENST00000285900.5	37	c.1457	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	31	5.104986	0.94245	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;D;T;T;T;D	0.95949	1.02;1.02;-3.86;1.02;1.02;1.02;-3.86	5.44	5.44	0.79542	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.98632	0.9542	H	0.96833	3.89	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;0.974	D;D;D;D;D;D	0.97110	0.993;0.993;1.0;0.993;0.988;0.923	D	0.99701	1.1004	10	0.87932	D	0	.	18.2393	0.89961	0.0:0.0:1.0:0.0	.	486;486;396;486;476;476	E7ESV8;B7Z9G9;B7Z3F6;B7Z2W8;P42261-2;P42261	.;.;.;.;.;GRIA1_HUMAN	D	476;476;396;430;476;407;407;486;486	ENSP00000285900:G476D;ENSP00000427920:G396D;ENSP00000339343:G476D;ENSP00000427864:G407D;ENSP00000442108:G407D;ENSP00000428994:G486D;ENSP00000415569:G486D	ENSP00000285900:G476D	G	+	2	0	GRIA1	153058801	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.640000	0.98453	2.548000	0.85928	0.655000	0.94253	GGC	-	GRIA1	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt		0.552	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	0	0		76	76		0.00		G			153078608	+1	4		36		tier1	no_errors	ENST00000448073	ensembl	human	known	74_37	missense	10.00		SNP	1.000	A	4	36
RBP2	5948	genome.wustl.edu	37	3	139173627	139173627	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:139173627C>T	ENST00000232217.2	-	3	354	c.298G>A	c.(298-300)Ggg>Agg	p.G100R	RP11-319G6.1_ENST00000515247.1_RNA|RP11-319G6.1_ENST00000510068.1_RNA	NM_004164.2	NP_004155.2	P50120	RET2_HUMAN	retinol binding protein 2, cellular	100					epidermis development (GO:0008544)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12					Vitamin A(DB00162)	TCCTTCTCCCCCTTTTGCACA	0.517													ENSG00000114113																																					0													238.0	204.0	215.0					3																	139173627		2203	4300	6503	SO:0001583	missense	0			-	U13831	CCDS3109.1	3q23	2013-03-01	2001-11-28		ENSG00000114113	ENSG00000114113		"""Fatty acid binding protein family"""	9920	protein-coding gene	gene with protein product		180280	"""retinol-binding protein 2, cellular"""			7657783, 10072590	Standard	NM_004164		Approved	CRBP2, RBPC2, CRBPII, CRABP-II	uc003eth.3	P50120	OTTHUMG00000159956	ENST00000232217.2:c.298G>A	3.37:g.139173627C>T	ENSP00000232217:p.Gly100Arg		A8K7G3|Q6ISQ9|Q6ISS7	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.G100R	ENST00000232217.2	37	c.298	CCDS3109.1	3	.	.	.	.	.	.	.	.	.	.	C	29.5	5.008463	0.93346	.	.	ENSG00000114113	ENST00000232217;ENST00000511956	T;T	0.08193	3.12;3.12	5.0	5.0	0.66597	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.30823	0.0777	M	0.83603	2.65	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.19031	-1.0318	10	0.13108	T	0.6	.	18.6877	0.91571	0.0:1.0:0.0:0.0	.	100	P50120	RET2_HUMAN	R	100	ENSP00000232217:G100R;ENSP00000424333:G100R	ENSP00000232217:G100R	G	-	1	0	RBP2	140656317	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.689000	0.84165	2.477000	0.83638	0.563000	0.77884	GGG	-	RBP2	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like		0.517	RBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP2	HGNC	protein_coding	OTTHUMT00000358490.1	0	0		102	102		0.00		C	NM_004164		139173627	-1	8		43		tier1	no_errors	ENST00000232217	ensembl	human	known	74_37	missense	15.69		SNP	1.000	T	8	43
HHLA1	10086	genome.wustl.edu	37	8	133113449	133113449	+	Intron	SNP	G	G	A	rs551847132		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr8:133113449G>A	ENST00000414222.1	-	3	139				HHLA1_ENST00000434736.2_Splice_Site_p.L82L	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1							extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						CTGCATTACAGAGTAAGTCAG	0.373													ENSG00000132297																																					0																																										SO:0001627	intron_variant	0			-	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.140-1068C>T	8.37:g.133113449G>A				Silent	SNP	NULL	p.L82	ENST00000414222.1	37	c.246		8																																																																																			-	HHLA1	-	NULL		0.373	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		0	0		104	104		0.00		G	XR_017860		133113449	-1	4		42		tier1	no_errors	ENST00000434736	ensembl	human	novel	74_37	silent	8.70		SNP	0.001	A	4	42
LAMA4	3910	genome.wustl.edu	37	6	112512893	112512893	+	Nonsense_Mutation	SNP	A	A	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr6:112512893A>T	ENST00000230538.7	-	6	1060	c.663T>A	c.(661-663)tgT>tgA	p.C221*	LAMA4_ENST00000424408.2_Nonsense_Mutation_p.C221*|LAMA4_ENST00000389463.4_Nonsense_Mutation_p.C221*|LAMA4_ENST00000522006.1_Nonsense_Mutation_p.C221*|LAMA4_ENST00000524032.1_5'Flank	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	221	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CGCAACGTTCACACTTGAATC	0.502													ENSG00000112769																																					0													95.0	80.0	85.0					6																	112512893		2203	4300	6503	SO:0001587	stop_gained	0			-		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.663T>A	6.37:g.112512893A>T	ENSP00000230538:p.Cys221*		Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_II,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Focal_adhesion_kin_target_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Laminin_G	p.C221*	ENST00000230538.7	37	c.663	CCDS43491.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	40|40|40	8.184917|8.184917|8.184917	0.98696|0.98696|0.98696	.|.|.	.|.|.	ENSG00000112769|ENSG00000112769|ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408;ENST00000454881;ENST00000521398;ENST00000542588|ENST00000368640|ENST00000521732	.|.|.	.|.|.	.|.|.	5.7|5.7|5.7	3.38|3.38|3.38	0.38709|0.38709|0.38709	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	.|T|.	.|0.49609|.	.|0.1567|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|.	.|0.48115|.	.|-0.9063|.	.|4|.	0.02654|.|.	T|.|.	1|.|.	.|.|.	10.478|10.478|10.478	0.44676|0.44676|0.44676	0.8409:0.0:0.1591:0.0|0.8409:0.0:0.1591:0.0|0.8409:0.0:0.1591:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|E|R	221|25|41	.|.|.	ENSP00000230538:C221X|.|.	C|V|X	-|-|-	3|2|1	2|0|0	LAMA4|LAMA4|LAMA4	112619586|112619586|112619586	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.966000|0.966000|0.966000	0.64601|0.64601|0.64601	2.063000|2.063000|2.063000	0.41423|0.41423|0.41423	2.168000|2.168000|2.168000	0.68352|0.68352|0.68352	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TGT|GTG|TGA	-	LAMA4	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin		0.502	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	0	0		77	77		0.00		A	NM_001105206		112512893	-1	7		39		tier1	no_errors	ENST00000230538	ensembl	human	known	74_37	nonsense	15.22		SNP	1.000	T	7	39
EMILIN2	84034	genome.wustl.edu	37	18	2847815	2847815	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr18:2847815G>T	ENST00000254528.3	+	2	302	c.143G>T	c.(142-144)tGc>tTc	p.C48F		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	48	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AGGAACTGGTGCGCCTACATC	0.592													ENSG00000132205																																					0													80.0	72.0	75.0					18																	2847815		2203	4300	6503	SO:0001583	missense	0			-	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.143G>T	18.37:g.2847815G>T	ENSP00000254528:p.Cys48Phe		B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.C48F	ENST00000254528.3	37	c.143	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	G	22.4	4.289487	0.80914	.	.	ENSG00000132205	ENST00000254528	D	0.89617	-2.54	5.5	5.5	0.81552	EMI domain (2);	0.000000	0.64402	D	0.000001	D	0.95762	0.8621	M	0.89601	3.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96257	0.9188	10	0.87932	D	0	-19.3618	19.3849	0.94553	0.0:0.0:1.0:0.0	.	48	Q9BXX0	EMIL2_HUMAN	F	48	ENSP00000254528:C48F	ENSP00000254528:C48F	C	+	2	0	EMILIN2	2837815	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.799000	0.85936	2.584000	0.87258	0.650000	0.86243	TGC	-	EMILIN2	-	pfam_EMI_domain,pfscan_EMI_domain		0.592	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2	0	0		74	74		0.00		G	NM_032048		2847815	+1	4		28		tier1	no_errors	ENST00000254528	ensembl	human	known	74_37	missense	12.50		SNP	1.000	T	4	28
KIR3DL1	3811	genome.wustl.edu	37	19	55284998	55284998	+	Intron	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr19:55284998C>T	ENST00000538269.1	+	2	61				KIR2DL3_ENST00000434419.2_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL1_ENST00000336077.6_Missense_Mutation_p.A95V|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.A95V|CTB-61M7.1_ENST00000400864.3_RNA			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CAAGACCTGGCAGGGACCTAC	0.537													ENSG00000125498																																					0													268.0	238.0	248.0					19																	55284998		2178	4211	6389	SO:0001627	intron_variant	0			-	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-43991C>T	19.37:g.55284998C>T			O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.A95V	ENST00000538269.1	37	c.284		19	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818144	0.32145	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.25085	1.82;1.82	1.24	-2.48	0.06423	.	.	.	.	.	T	0.39064	0.1064	M	0.83603	2.65	0.09310	N	1	D;D	0.71674	0.998;0.993	P;P	0.59825	0.864;0.674	T	0.31668	-0.9935	9	0.87932	D	0	.	0.3152	0.00294	0.2484:0.2941:0.2477:0.2098	.	95;95	Q6IST4;Q6H2H3	.;.	V	95	ENSP00000336769:A95V;ENSP00000291633:A95V	ENSP00000291633:A95V	A	+	2	0	KIR2DL1	59976810	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.593000	0.02096	-1.191000	0.02695	0.398000	0.26397	GCA	-	KIR2DL1	-	pfam_Immunoglobulin,smart_Ig_sub		0.537	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	HGNC	protein_coding		0	0		288	288		0.00		C	NM_013289		55284998	+1	57		131		tier1	no_errors	ENST00000336077	ensembl	human	known	74_37	missense	30.32		SNP	0.000	T	57	131
PRSS38	339501	genome.wustl.edu	37	1	228005164	228005164	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr1:228005164G>T	ENST00000366757.3	+	3	590	c.566G>T	c.(565-567)gGa>gTa	p.G189V		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	189	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						ACGGGATGGGGACTAGTCTCA	0.527													ENSG00000185888																																					0													77.0	71.0	73.0					1																	228005164		2203	4300	6503	SO:0001583	missense	0			-		CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.566G>T	1.37:g.228005164G>T	ENSP00000355719:p.Gly189Val		Q7RTY6	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G189V	ENST00000366757.3	37	c.566	CCDS1563.1	1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207795	0.39003	.	.	ENSG00000185888	ENST00000366757	D	0.94046	-3.34	4.34	4.34	0.51931	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.43260	D	0.000596	D	0.97901	0.9310	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98029	1.0375	10	0.87932	D	0	.	12.6715	0.56870	0.0:0.0:1.0:0.0	.	189	A1L453	PRS38_HUMAN	V	189	ENSP00000355719:G189V	ENSP00000355719:G189V	G	+	2	0	PRSS38	226071787	1.000000	0.71417	0.972000	0.41901	0.026000	0.11368	4.558000	0.60789	2.712000	0.92718	0.655000	0.94253	GGA	-	PRSS38	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.527	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS38	HGNC	protein_coding	OTTHUMT00000091981.1	0	0		69	69		0.00		G	NM_183062		228005164	+1	4		28		tier1	no_errors	ENST00000366757	ensembl	human	known	74_37	missense	12.12		SNP	0.986	T	4	28
ATXN8OS	6315	genome.wustl.edu	37	13	70713512	70713512	+	RNA	SNP	A	A	G	rs2021426|rs143757288		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr13:70713512A>G	ENST00000414504.2	+	0	1099					NR_002717.2				ATXN8 opposite strand (non-protein coding)																		tactactactactactgctgc	0.408													ENSG00000230223																																					0																																												0			-	AF126749		13q21	2012-10-19	2008-08-13	2006-07-18	ENSG00000230223	ENSG00000230223		"""Long non-coding RNAs"", ""-"""	10561	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 3"""	603680	"""spinocerebellar ataxia 8"", ""kelch-like 1 antisense (Drosophila)"""	SCA8, KLHL1AS		10192387, 16804541	Standard	NR_002717		Approved	NCRNA00003	uc010aej.1		OTTHUMG00000017057		13.37:g.70713512A>G				R	SNP	-	NULL	ENST00000414504.2	37	NULL		13																																																																																			rs2021426	ATXN8OS	-	-		0.408	ATXN8OS-002	KNOWN	basic	antisense	ATXN8OS	HGNC	antisense	OTTHUMT00000045233.2	0	0		55	55		0.00		A	NR_002717		70713512	+1	4		23		tier1	no_errors	ENST00000414504	ensembl	human	known	74_37	rna	14.81		SNP	0.000	G	4	23
BNIP3P1	319138	genome.wustl.edu	37	14	28734006	28734006	+	RNA	SNP	G	G	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr14:28734006G>C	ENST00000550043.1	+	0	411									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		TTCTGAAACAGATACCCATAG	0.463													ENSG00000197358																																					0																																												0			-			14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28734006G>C				R	SNP	-	NULL	ENST00000550043.1	37	NULL		14																																																																																			-	BNIP3P1	-	-		0.463	BNIP3P1-002	KNOWN	basic	processed_transcript	BNIP3P1	HGNC	pseudogene	OTTHUMT00000408770.1	0	0		108	108		0.00		G			28734006	+1	14		68		tier1	no_errors	ENST00000550043	ensembl	human	known	74_37	rna	17.07		SNP	0.002	C	14	68
LIMK1	3984	genome.wustl.edu	37	7	73535363	73535363	+	Missense_Mutation	SNP	C	C	G	rs578103189		TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr7:73535363C>G	ENST00000336180.2	+	15	1816	c.1765C>G	c.(1765-1767)Ctg>Gtg	p.L589V	LIMK1_ENST00000418310.1_Missense_Mutation_p.L619V|LIMK1_ENST00000538333.3_Missense_Mutation_p.L555V	NM_002314.3	NP_002305.1	P53667	LIMK1_HUMAN	LIM domain kinase 1	589	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|nervous system development (GO:0007399)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of axon extension (GO:0045773)|positive regulation of stress fiber assembly (GO:0051496)|protein phosphorylation (GO:0006468)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)	ATP binding (GO:0005524)|heat shock protein binding (GO:0031072)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	21		Lung NSC(55;0.137)			Dabrafenib(DB08912)	CTGTTGCGATCTGGACCCCGA	0.662													ENSG00000106683																																					0													87.0	92.0	90.0					7																	73535363		2203	4300	6503	SO:0001583	missense	0			-	D26309	CCDS5563.1, CCDS56491.1	7q11.23	2005-01-21			ENSG00000106683	ENSG00000106683			6613	protein-coding gene	gene with protein product		601329				8673124, 8812460	Standard	NM_002314		Approved	LIMK	uc003uaa.2	P53667	OTTHUMG00000023448	ENST00000336180.2:c.1765C>G	7.37:g.73535363C>G	ENSP00000336740:p.Leu589Val		B7Z6I8|D3DXF4|D3DXF5|O15283|Q15820|Q15821|Q75MU3|Q9Y5Q1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Znf_LIM,pfam_PDZ,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,superfamily_PDZ,smart_Znf_LIM,smart_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_LIM,pfscan_PDZ,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L589V	ENST00000336180.2	37	c.1765	CCDS5563.1	7	.	.	.	.	.	.	.	.	.	.	C	21.3	4.121124	0.77436	.	.	ENSG00000106683	ENST00000418310;ENST00000419043;ENST00000336180;ENST00000538333	T;T;T	0.62232	0.04;0.04;0.04	5.28	3.48	0.39840	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.55000	0.1893	N	0.13098	0.295	0.58432	D	0.999997	P;P	0.45212	0.853;0.853	P;P	0.52909	0.645;0.713	T	0.57883	-0.7734	10	0.72032	D	0.01	-20.1442	9.9725	0.41763	0.0:0.8468:0.0:0.1532	.	555;589	B7Z6I8;P53667	.;LIMK1_HUMAN	V	619;589;589;555	ENSP00000409717:L619V;ENSP00000336740:L589V;ENSP00000444452:L555V	ENSP00000336740:L589V	L	+	1	2	LIMK1	73173299	0.997000	0.39634	0.998000	0.56505	0.985000	0.73830	3.010000	0.49559	0.633000	0.30452	0.558000	0.71614	CTG	-	LIMK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.662	LIMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMK1	HGNC	protein_coding	OTTHUMT00000252335.2	0	0		115	115		0.00		C	NM_002314		73535363	+1	8		77		tier1	no_errors	ENST00000336180	ensembl	human	known	74_37	missense	9.41		SNP	1.000	G	8	77
NCAPG	64151	genome.wustl.edu	37	4	17839401	17839401	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr4:17839401G>T	ENST00000251496.2	+	16	2619	c.2443G>T	c.(2443-2445)Gcc>Tcc	p.A815S		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	815					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		AAATCCTCAGGCCAAGACTTC	0.408													ENSG00000109805																																					0													142.0	139.0	140.0					4																	17839401		2203	4300	6503	SO:0001583	missense	0			-	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2443G>T	4.37:g.17839401G>T	ENSP00000251496:p.Ala815Ser		Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A815S	ENST00000251496.2	37	c.2443	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	G	6.670	0.492226	0.12702	.	.	ENSG00000109805	ENST00000251496	T	0.39056	1.1	5.25	3.31	0.37934	.	0.341985	0.34507	N	0.003913	T	0.29223	0.0727	L	0.46157	1.445	0.29172	N	0.8771	B	0.06786	0.001	B	0.13407	0.009	T	0.33523	-0.9865	10	0.07482	T	0.82	-1.4526	7.2765	0.26288	0.2818:0.0:0.6062:0.112	.	815	Q9BPX3	CND3_HUMAN	S	815	ENSP00000251496:A815S	ENSP00000251496:A815S	A	+	1	0	NCAPG	17448499	0.001000	0.12720	0.998000	0.56505	0.245000	0.25701	0.720000	0.25896	0.221000	0.20879	-1.094000	0.02160	GCC	-	NCAPG	-	NULL		0.408	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	HGNC	protein_coding	OTTHUMT00000250375.1	0	0		66	66		0.00		G	NM_022346		17839401	+1	4		46		tier1	no_errors	ENST00000251496	ensembl	human	known	74_37	missense	8.00		SNP	0.981	T	4	46
CACNA1G	8913	genome.wustl.edu	37	17	48647081	48647081	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr17:48647081C>T	ENST00000359106.5	+	4	503	c.503C>T	c.(502-504)tCg>tTg	p.S168L	CACNA1G_ENST00000360761.4_Missense_Mutation_p.S168L|CACNA1G_ENST00000507896.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000510115.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000352832.5_Missense_Mutation_p.S168L|CACNA1G_ENST00000358244.5_Missense_Mutation_p.S168L|CACNA1G_ENST00000416767.4_Missense_Mutation_p.S168L|CACNA1G_ENST00000510366.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000515411.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000514717.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000514181.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000507336.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000514079.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000512389.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000513964.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000507609.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000513689.2_Missense_Mutation_p.S168L|CACNA1G_ENST00000503485.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000515165.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000429973.2_Missense_Mutation_p.S168L|CACNA1G_ENST00000354983.4_Missense_Mutation_p.S168L|CACNA1G_ENST00000502264.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000515765.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000507510.2_Missense_Mutation_p.S168L|CACNA1G_ENST00000505165.1_Missense_Mutation_p.S168L|CACNA1G_ENST00000442258.2_Missense_Mutation_p.S168L	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	168					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGGAGTACTCGCTGGACCTG	0.602													ENSG00000006283																																					0													23.0	29.0	27.0					17																	48647081		1804	3547	5351	SO:0001583	missense	0			-	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.503C>T	17.37:g.48647081C>T	ENSP00000352011:p.Ser168Leu		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.S168L	ENST00000359106.5	37	c.503	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	c	25.6	4.659823	0.88154	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98221	-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8;-4.8	5.25	5.25	0.73442	Ion transport (1);	0.133904	0.52532	D	0.000065	D	0.98523	0.9507	L	0.53249	1.67	0.80722	D	1	P;D;P;B;P;P;P;P;P;P;P;D;D;P;P;P;P;P;P;D;B;D;P;P;D;P	0.89917	0.486;0.99;0.707;0.389;0.819;0.538;0.538;0.707;0.538;0.46;0.941;0.972;0.978;0.575;0.674;0.553;0.538;0.618;0.819;0.978;0.235;0.994;0.707;0.538;1.0;0.482	B;D;P;B;P;B;B;P;B;B;P;P;P;P;B;B;B;B;P;P;B;P;P;B;D;B	0.85130	0.167;0.933;0.597;0.291;0.597;0.118;0.237;0.597;0.237;0.108;0.653;0.758;0.844;0.498;0.237;0.399;0.118;0.138;0.597;0.844;0.058;0.844;0.529;0.362;0.997;0.072	D	0.99029	1.0820	10	0.40728	T	0.16	.	18.8384	0.92172	0.0:1.0:0.0:0.0	.	168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168;168	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	L	168	ENSP00000353990:S168L;ENSP00000339302:S168L;ENSP00000392390:S168L;ENSP00000347078:S168L;ENSP00000409759:S168L;ENSP00000425522:S168L;ENSP00000426261:S168L;ENSP00000425451:S168L;ENSP00000422407:S168L;ENSP00000426814:S168L;ENSP00000427238:S168L;ENSP00000423112:S168L;ENSP00000420918:S168L;ENSP00000426172:S168L;ENSP00000423045:S168L;ENSP00000427173:S168L;ENSP00000426098:S168L;ENSP00000425698:S168L;ENSP00000426232:S168L;ENSP00000423317:S168L;ENSP00000350979:S168L;ENSP00000352011:S168L;ENSP00000414388:S168L;ENSP00000423155:S168L;ENSP00000422268:S168L;ENSP00000421518:S168L	ENSP00000339302:S168L	S	+	2	0	CACNA1G	46002080	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	6.075000	0.71261	2.457000	0.83068	0.407000	0.27541	TCG	-	CAC1G	-	pfam_Ion_trans_dom		0.602	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CAC1G	HGNC	protein_coding	OTTHUMT00000367895.1	0	0		80	80		0.00		C	NM_018896		48647081	+1	5		42		tier1	no_errors	ENST00000359106	ensembl	human	known	74_37	missense	10.64		SNP	1.000	T	5	42
PEX5L	51555	genome.wustl.edu	37	3	179529607	179529607	+	Missense_Mutation	SNP	G	G	C			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr3:179529607G>C	ENST00000467460.1	-	11	1466	c.1136C>G	c.(1135-1137)gCt>gGt	p.A379G	PEX5L_ENST00000472994.1_Missense_Mutation_p.A320G|PEX5L_ENST00000464614.1_Missense_Mutation_p.A271G|PEX5L_ENST00000465751.1_Missense_Mutation_p.A355G|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000468741.1_Missense_Mutation_p.A187G|PEX5L_ENST00000392649.3_Missense_Mutation_p.A271G|PEX5L_ENST00000476138.1_Missense_Mutation_p.A336G|PEX5L_ENST00000485199.1_Missense_Mutation_p.A344G|PEX5L_ENST00000263962.8_Missense_Mutation_p.A377G	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	379					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			GGCGACAATAGCTGCTTGTTC	0.428													ENSG00000114757																																					0													194.0	183.0	186.0					3																	179529607		2203	4300	6503	SO:0001583	missense	0			-	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1136C>G	3.37:g.179529607G>C	ENSP00000419975:p.Ala379Gly		B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A379G	ENST00000467460.1	37	c.1136	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212334	0.79240	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	D;D;D;D;D;D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48;-3.48	5.41	4.51	0.55191	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.113080	0.64402	D	0.000011	D	0.96617	0.8896	M	0.65975	2.015	0.80722	D	1	P;P;P;D;D;D	0.76494	0.665;0.527;0.948;0.999;0.997;0.999	B;B;P;D;D;D	0.80764	0.328;0.328;0.872;0.99;0.986;0.994	D	0.96850	0.9624	10	0.59425	D	0.04	-12.7572	16.1922	0.82000	0.0:0.1335:0.8665:0.0	.	320;355;271;377;344;379	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	G	379;377;344;377;271;187;336;267;320;271;355	ENSP00000419975:A379G;ENSP00000263962:A377G;ENSP00000418440:A344G;ENSP00000376420:A271G;ENSP00000418665:A187G;ENSP00000420555:A336G;ENSP00000418054:A320G;ENSP00000417270:A271G;ENSP00000419348:A355G	ENSP00000263962:A377G	A	-	2	0	PEX5L	181012301	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	9.813000	0.99286	1.357000	0.45904	0.650000	0.86243	GCT	-	PEX5L	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.428	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	0	0		103	103		0.00		G	NM_016559		179529607	-1	7		67		tier1	no_errors	ENST00000467460	ensembl	human	known	74_37	missense	9.46		SNP	1.000	C	7	67
CTC-305H11.1	0	genome.wustl.edu	37	5	13174909	13174909	+	lincRNA	SNP	T	T	A			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr5:13174909T>A	ENST00000513283.1	+	0	0				AC016553.1_ENST00000410785.1_RNA																							attgtggtttttgccatttct	0.264													ENSG00000222717																																					0																																												0			-																													5.37:g.13174909T>A				R	SNP	-	NULL	ENST00000513283.1	37	NULL		5																																																																																			-	AC016553.1	-	-		0.264	CTC-305H11.1-001	KNOWN	basic	lincRNA	ENSG00000222717	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000367808.1	0	0		300	300		0.00		T			13174909	-1	23		162		tier1	no_errors	ENST00000410785	ensembl	human	novel	74_37	rna	12.43		SNP	0.132	A	23	162
ANKDD1A	348094	genome.wustl.edu	37	15	65239646	65239646	+	Missense_Mutation	SNP	G	G	T			TCGA-X6-A8C6-01A-11D-A36J-09	TCGA-X6-A8C6-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	7d08dfae-c1ce-467f-b80f-2ed6f269c01b	b9a5db61-ec3f-4c18-8702-f4f3f32999e8	g.chr15:65239646G>T	ENST00000380230.3	+	13	1213	c.1184G>T	c.(1183-1185)gGg>gTg	p.G395V	ANKDD1A_ENST00000357698.3_Missense_Mutation_p.G363V|ANKDD1A_ENST00000395723.1_Missense_Mutation_p.G272V|ANKDD1A_ENST00000395720.1_Missense_Mutation_p.G395V	NM_182703.3	NP_874362.3	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A	395					signal transduction (GO:0007165)					NS(1)|endometrium(1)|large_intestine(10)|liver(2)|lung(4)|ovary(1)|prostate(2)	21						GATCCCTCTGGGAAGAGCTTG	0.612													ENSG00000166839																																					0													45.0	44.0	44.0					15																	65239646		2202	4299	6501	SO:0001583	missense	0			-		CCDS10197.2	15q22.31	2013-01-10	2006-02-16		ENSG00000166839	ENSG00000166839		"""Ankyrin repeat domain containing"""	28002	protein-coding gene	gene with protein product						12477932	Standard	NM_182703		Approved	FLJ25870	uc002aoa.3	Q495B1	OTTHUMG00000133051	ENST00000380230.3:c.1184G>T	15.37:g.65239646G>T	ENSP00000369579:p.Gly395Val		Q495B2|Q495B3|Q8N7A0|Q8NBS5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,prints_Ankyrin_rpt	p.G395V	ENST00000380230.3	37	c.1184	CCDS10197.2	15	.	.	.	.	.	.	.	.	.	.	G	9.401	1.078105	0.20227	.	.	ENSG00000166839	ENST00000380230;ENST00000357698;ENST00000395720;ENST00000395723	T;T;T;T	0.38240	1.23;1.2;1.26;1.15	4.41	1.1	0.20463	Ankyrin repeat-containing domain (1);	1.050050	0.07549	N	0.915041	T	0.26448	0.0646	L	0.47190	1.495	0.09310	N	1	B	0.27625	0.183	B	0.25140	0.058	T	0.28713	-1.0035	10	0.15952	T	0.53	-4.2248	3.9457	0.09347	0.0936:0.2673:0.4873:0.1518	.	395	Q495B1	AKD1A_HUMAN	V	395;363;395;272	ENSP00000369579:G395V;ENSP00000350329:G363V;ENSP00000379070:G395V;ENSP00000379073:G272V	ENSP00000350329:G363V	G	+	2	0	ANKDD1A	63026699	0.996000	0.38824	0.068000	0.19968	0.836000	0.47400	2.444000	0.44890	0.477000	0.27464	0.655000	0.94253	GGG	-	ANKDD1A	-	superfamily_Ankyrin_rpt-contain_dom		0.612	ANKDD1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKDD1A	HGNC	protein_coding	OTTHUMT00000256705.2	0	0		55	55		0.00		G	NM_182703		65239646	+1	4		30		tier1	no_errors	ENST00000380230	ensembl	human	known	74_37	missense	11.76		SNP	0.002	T	4	30
