#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
HERC1	8925	genome.wustl.edu	37	15	63928318	63928318	+	Missense_Mutation	SNP	T	T	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr15:63928318T>C	ENST00000443617.2	-	65	12343	c.12256A>G	c.(12256-12258)Act>Gct	p.T4086A		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4086					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CCACAGGAAGTCACCAGCTGG	0.493													ENSG00000103657																																					0													112.0	111.0	112.0					15																	63928318		2022	4178	6200	SO:0001583	missense	0			-	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.12256A>G	15.37:g.63928318T>C	ENSP00000390158:p.Thr4086Ala		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.T4086A	ENST00000443617.2	37	c.12256	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	T	16.64	3.178435	0.57692	.	.	ENSG00000103657	ENST00000443617	T	0.24538	1.85	5.58	4.44	0.53790	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	N	0.12471	0.22	0.58432	D	0.999994	B	0.26363	0.147	B	0.25405	0.06	T	0.05099	-1.0906	10	0.48119	T	0.1	.	12.1782	0.54198	0.1283:0.0:0.0:0.8717	.	4086	Q15751	HERC1_HUMAN	A	4086	ENSP00000390158:T4086A	ENSP00000390158:T4086A	T	-	1	0	HERC1	61715371	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.997000	0.88414	1.024000	0.39682	-0.333000	0.08304	ACT	-	HERC1	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.493	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	0	0	0	67	67	97	0.00	0.00	T	NM_003922		63928318	-1	37	59	34	65	tier1	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	52.11	47.58	SNP	1.000	C	37	34
TRDN	10345	genome.wustl.edu	37	6	123869712	123869712	+	Missense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr6:123869712C>T	ENST00000398178.3	-	3	299	c.278G>A	c.(277-279)cGt>cAt	p.R93H	TRDN_ENST00000546248.1_Missense_Mutation_p.R93H|TRDN_ENST00000542443.1_Missense_Mutation_p.R93H|TRDN_ENST00000334268.4_Missense_Mutation_p.R93H	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	93					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		CATAGCATCACGTACCAGTTT	0.348													ENSG00000186439																																					0													51.0	50.0	51.0					6																	123869712		1838	4088	5926	SO:0001583	missense	0			-	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.278G>A	6.37:g.123869712C>T	ENSP00000381240:p.Arg93His		A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.R93H	ENST00000398178.3	37	c.278	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	3.283	-0.146547	0.06627	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000542443	T;T;T;T	0.62105	1.28;1.28;1.21;0.05	5.29	4.12	0.48240	Aspartyl beta-hydroxylase/Triadin domain (1);	0.526840	0.20624	N	0.088713	T	0.05090	0.0136	N	0.00082	-2.215	0.21220	N	0.999756	B;B;B;B;B	0.17667	0.0;0.023;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.42965	-0.9420	10	0.02654	T	1	-3.3496	9.6367	0.39811	0.0:0.0799:0.0:0.9201	.	93;93;93;93;93	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061	.;.;.;.;TRDN_HUMAN	H	93	ENSP00000381240:R93H;ENSP00000333984:R93H;ENSP00000439281:R93H;ENSP00000437684:R93H	ENSP00000333984:R93H	R	-	2	0	TRDN	123911411	1.000000	0.71417	0.947000	0.38551	0.729000	0.41735	3.264000	0.51553	0.845000	0.35118	-0.238000	0.12139	CGT	-	TRDN	-	pfam_Asp-B-hydro/Triadin_dom		0.348	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		0	0	0	51	51	104	0.00	0.00	C			123869712	-1	10	17	30	63	tier1	no_errors	ENST00000398178	ensembl	human	known	74_37	missense	25.00	20.73	SNP	0.983	T	10	30
ZEB2	9839	genome.wustl.edu	37	2	145277515	145277515	+	5'UTR	SNP	C	C	G			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:145277515C>G	ENST00000558170.2	-	0	1106				ZEB2-AS1_ENST00000610265.1_RNA|ZEB2_ENST00000303660.4_5'UTR|ZEB2_ENST00000539609.3_5'UTR|ZEB2-AS1_ENST00000608361.1_RNA|ZEB2-AS1_ENST00000428623.1_RNA|ZEB2-AS1_ENST00000595109.1_RNA|ZEB2-AS1_ENST00000421083.1_RNA|ZEB2-AS1_ENST00000427278.3_RNA|ZEB2_ENST00000470879.1_5'Flank|ZEB2_ENST00000493689.1_5'Flank|ZEB2-AS1_ENST00000609819.1_RNA|ZEB2-AS1_ENST00000609376.1_RNA|ZEB2_ENST00000465070.1_5'UTR|ZEB2-AS1_ENST00000602006.1_RNA|ZEB2_ENST00000409487.3_5'Flank|ZEB2-AS1_ENST00000595449.1_RNA|ZEB2-AS1_ENST00000609842.1_RNA|ZEB2_ENST00000462355.1_5'Flank	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2						cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCTGCGAAGTCTTGTTTGTAG	0.443											OREG0015003	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000238057																									Melanoma(33;1235 1264 5755 16332)												0																																										SO:0001623	5_prime_UTR_variant	0			-	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.-79G>C	2.37:g.145277515C>G		1693	A0JP09|B7Z2P2|F5H814|Q9UED1	R	SNP	-	NULL	ENST00000558170.2	37	NULL	CCDS2186.1	2																																																																																			-	ZEB2-AS1	-	-		0.443	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZEB2-AS1	HGNC	protein_coding	OTTHUMT00000254778.5	0	0	0	81	81	143	0.00	0.00	C	NM_014795		145277515	+1	21	56	34	56	tier1	no_errors	ENST00000421083	ensembl	human	known	74_37	rna	38.18	50.00	SNP	1.000	G	21	34
POU2F2	5452	genome.wustl.edu	37	19	42626729	42626729	+	Splice_Site	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:42626729C>T	ENST00000526816.2	-	2	44		c.e2-1		POU2F2_ENST00000529067.1_Splice_Site|POU2F2_ENST00000389341.5_Splice_Site|POU2F2_ENST00000560398.1_Splice_Site|POU2F2_ENST00000560558.1_Splice_Site|POU2F2_ENST00000529952.1_Splice_Site|POU2F2_ENST00000342301.4_Splice_Site|POU2F2_ENST00000524801.2_Splice_Site|POU2F2_ENST00000533720.1_Splice_Site			P09086	PO2F2_HUMAN	POU class 2 homeobox 2						cell maturation (GO:0048469)|humoral immune response (GO:0006959)|immunoglobulin secretion involved in immune response (GO:0002380)|mature B cell differentiation (GO:0002335)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Prostate(69;0.059)			Dolutegravir(DB08930)	ATTCTTATTTCTGGGGACAGA	0.612													ENSG00000028277																																					0													44.0	45.0	44.0					19																	42626729		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS33035.1, CCDS56094.1, CCDS56095.1, CCDS58665.1	19q13.2	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9213	protein-coding gene	gene with protein product		164176	"""POU domain class 2, transcription factor 2"""	OTF2			Standard	NM_001207026		Approved	OCT2	uc002osp.3	P09086		ENST00000526816.2:c.29-1G>A	19.37:g.42626729C>T			Q16648|Q7M4M8|Q9BRS4	Splice_Site	SNP	-	e2-1	ENST00000526816.2	37	c.29-1	CCDS56095.1	19	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828167	0.50845	.	.	ENSG00000028277	ENST00000389341;ENST00000342301;ENST00000292077;ENST00000533720;ENST00000526816;ENST00000529067;ENST00000529952	.	.	.	3.69	2.62	0.31277	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2156	0.54404	0.0:0.8259:0.1741:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POU2F2	47318569	1.000000	0.71417	0.950000	0.38849	0.985000	0.73830	5.345000	0.65987	0.871000	0.35750	0.484000	0.47621	.	-	POU2F2	-	-		0.612	POU2F2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POU2F2	HGNC	protein_coding	OTTHUMT00000387329.3	0	0	0	103	103	82	0.00	0.00	C		Intron	42626729	-1	24	19	66	45	tier1	no_errors	ENST00000342301	ensembl	human	known	74_37	splice_site	26.67	29.69	SNP	1.000	T	24	66
TTLL11	158135	genome.wustl.edu	37	9	124801570	124801570	+	Silent	SNP	A	A	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr9:124801570A>T	ENST00000373776.3	-	2	997	c.810T>A	c.(808-810)ggT>ggA	p.G270G	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_Silent_p.G270G	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	270	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						TGTTCACTTGACCGGAGAATA	0.413													ENSG00000175764																																					0													105.0	96.0	99.0					9																	124801570		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.810T>A	9.37:g.124801570A>T				Silent	SNP	pfam_TTL/TTLL_fam	p.G270	ENST00000373776.3	37	c.810	CCDS6834.2	9																																																																																			-	TTLL11	-	pfam_TTL/TTLL_fam		0.413	TTLL11-004	KNOWN	basic|CCDS	protein_coding	TTLL11	HGNC	protein_coding	OTTHUMT00000053907.1	0	0	0	97	97	141	0.00	0.00	A	XM_088486		124801570	-1	8	15	62	96	tier1	no_errors	ENST00000321582	ensembl	human	known	74_37	silent	11.43	13.51	SNP	1.000	T	8	62
ATG16L1	55054	genome.wustl.edu	37	2	234173536	234173536	+	Splice_Site	SNP	A	A	G			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:234173536A>G	ENST00000392017.4	+	5	646		c.e5-1		ATG16L1_ENST00000392018.1_Splice_Site|ATG16L1_ENST00000347464.5_Intron|ATG16L1_ENST00000373525.5_Intron|ATG16L1_ENST00000392020.4_Splice_Site	NM_001190266.1|NM_001190267.1|NM_030803.6	NP_001177195.1|NP_001177196.1|NP_110430.5	Q676U5	A16L1_HUMAN	autophagy related 16-like 1 (S. cerevisiae)						autophagic vacuole assembly (GO:0000045)|negative stranded viral RNA replication (GO:0039689)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)	autophagic vacuole (GO:0005776)|autophagic vacuole membrane (GO:0000421)|axoneme (GO:0005930)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(7)|prostate(3)|skin(1)	25		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0539)		Epithelial(121;1.53e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000379)|LUSC - Lung squamous cell carcinoma(224;0.00619)|Lung(119;0.00732)|GBM - Glioblastoma multiforme(43;0.11)		TCATGCTTCCAGAATTGCAGA	0.512													ENSG00000085978																																					0													95.0	84.0	87.0					2																	234173536		2203	4300	6503	SO:0001630	splice_region_variant	0			-	AK000897	CCDS2502.2, CCDS2503.2, CCDS54438.1	2q37.1	2014-02-12	2012-06-06	2005-09-13	ENSG00000085978	ENSG00000085978		"""WD repeat domain containing"""	21498	protein-coding gene	gene with protein product		610767	"""APG16 autophagy 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like (S. cerevisiae)"", ""ATG16 autophagy related 16-like 1 (S. cerevisiae)"""	APG16L, ATG16L			Standard	NM_017974		Approved	WDR30, FLJ10035, ATG16A	uc002vty.3	Q676U5	OTTHUMG00000133619	ENST00000392017.4:c.390-1A>G	2.37:g.234173536A>G			A3EXK9|A3EXL0|B6ZDH0|Q6IPN1|Q6UXW4|Q6ZVZ5|Q8NCY2|Q96JV5|Q9H619	Splice_Site	SNP	-	e5-2	ENST00000392017.4	37	c.390-2	CCDS2503.2	2	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214960	0.58452	.	.	ENSG00000085978	ENST00000431917;ENST00000392017;ENST00000392020;ENST00000392018	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3245	0.82970	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATG16L1	233838275	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	7.993000	0.88291	2.254000	0.74563	0.460000	0.39030	.	-	ATG16L1	-	-		0.512	ATG16L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG16L1	HGNC	protein_coding	OTTHUMT00000257069.2	0	0	0	54	54	84	0.00	0.00	A	NM_017974	Intron	234173536	+1	14	28	26	29	tier1	no_errors	ENST00000392017	ensembl	human	known	74_37	splice_site	35.00	49.12	SNP	1.000	G	14	26
COPE	11316	genome.wustl.edu	37	19	19021743	19021748	+	Intron	DEL	CCCGCG	CCCGCG	-	rs370096329|rs375855893		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	CCCGCG	CCCGCG	CCCGCG	-	CCCGCG	CCCGCG	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:19021743_19021748delCCCGCG	ENST00000262812.4	-	3	339				AC002985.3_ENST00000596918.1_Intron|COPE_ENST00000600932.1_Intron|COPE_ENST00000349893.4_Intron|COPE_ENST00000598969.1_5'UTR|COPE_ENST00000351079.4_Intron	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon						COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						TGAAGATGGCCCCGCGCCTCAGGCCA	0.66													ENSG00000105669																																					0																																										SO:0001627	intron_variant	0				AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.290+31CGCGGG>-	19.37:g.19021743_19021748delCCCGCG			A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	R	DEL	-	NULL	ENST00000262812.4	37	NULL	CCDS12387.1	19																																																																																				COPE	-	-		0.660	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPE	HGNC	protein_coding	OTTHUMT00000464801.1	0	0	0	100	100	100	0.00	0.00	CCCGCG	NM_007263		19021748	-1	35	35	32	32	tier1	no_errors	ENST00000597646	ensembl	human	known	74_37	rna	52.24	52.24	DEL	0.003:0.001:0.002:0.002:0.015:0.028	-	35	32
DBN1	1627	genome.wustl.edu	37	5	176885489	176885490	+	Frame_Shift_Ins	INS	-	-	C			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-	-	C	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr5:176885489_176885490insC	ENST00000309007.5	-	12	1564_1565	c.1345_1346insG	c.(1345-1347)gcafs	p.A449fs	DBN1_ENST00000393565.1_Frame_Shift_Ins_p.A495fs|DBN1_ENST00000512501.1_Frame_Shift_Ins_p.A181fs|DBN1_ENST00000292385.5_Frame_Shift_Ins_p.A451fs|DBN1_ENST00000393563.4_Frame_Shift_Ins_p.A181fs	NM_004395.3	NP_004386	Q16643	DREB_HUMAN	drebrin 1	449					actin filament organization (GO:0007015)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|maintenance of protein location in cell (GO:0032507)|neural precursor cell proliferation (GO:0061351)|regulation of dendrite development (GO:0050773)|regulation of neuronal synaptic plasticity (GO:0048168)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|gap junction (GO:0005921)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|profilin binding (GO:0005522)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(12)|ovary(1)|skin(2)	25	all_cancers(89;2.17e-05)|Renal(175;0.000269)|Lung NSC(126;0.0014)|all_lung(126;0.0025)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGTGTCAGCTGCATCGTGGATC	0.604													ENSG00000113758																																					0																																										SO:0001589	frameshift_variant	0					CCDS4420.1, CCDS4421.1	5q35.3	2008-02-05			ENSG00000113758	ENSG00000113758			2695	protein-coding gene	gene with protein product		126660		D0S117E		8216329	Standard	NM_004395		Approved		uc003mgy.2	Q16643	OTTHUMG00000130856	ENST00000309007.5:c.1346dupG	5.37:g.176885490_176885490dupC	ENSP00000308532:p.Ala449fs		A8MV58|B2RBG0|Q9UFZ5	Frame_Shift_Ins	INS	pfam_Actin-bd_cofilin/tropomyosin,smart_Actin-bd_cofilin/tropomyosin	p.A451fs	ENST00000309007.5	37	c.1352_1351	CCDS4420.1	5																																																																																				DBN1	-	NULL		0.604	DBN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DBN1	HGNC	protein_coding	OTTHUMT00000253429.2	0	0	0	68	68	88	0.00	0.00	-	NM_080881		176885490	-1	15	31	22	29	tier1	no_errors	ENST00000292385	ensembl	human	known	74_37	frame_shift_ins	40.54	51.67	INS	0.212:0.018	C	15	22
DTX1	1840	genome.wustl.edu	37	12	113532615	113532615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:113532615C>T	ENST00000257600.3	+	6	1752	c.1249C>T	c.(1249-1251)Cga>Tga	p.R417*	DTX1_ENST00000547974.1_3'UTR	NM_004416.2	NP_004407.2	Q86Y01	DTX1_HUMAN	deltex 1, E3 ubiquitin ligase	417					cell surface receptor signaling pathway (GO:0007166)|glial cell differentiation (GO:0010001)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of T cell differentiation (GO:0045581)|Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)|regulation of Notch signaling pathway (GO:0008593)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Notch binding (GO:0005112)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	32						CTGCATGGAGCGACTGGTCAC	0.667													ENSG00000135144																																					0													38.0	35.0	36.0					12																	113532615		2203	4300	6503	SO:0001587	stop_gained	0			-	AF053700	CCDS9164.1	12q24	2014-01-28	2014-01-28			ENSG00000135144			3060	protein-coding gene	gene with protein product		602582	"""deltex homolog 1 (Drosophila)"""			9590294, 12670957	Standard	NM_004416		Approved	hDx-1	uc001tuk.1	Q86Y01	OTTHUMG00000169610	ENST00000257600.3:c.1249C>T	12.37:g.113532615C>T	ENSP00000257600:p.Arg417*		O60630|Q9BS04	Nonsense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.R417*	ENST00000257600.3	37	c.1249	CCDS9164.1	12	.	.	.	.	.	.	.	.	.	.	C	41	8.833927	0.98970	.	.	ENSG00000135144	ENST00000257600	.	.	.	4.14	2.28	0.28536	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.8401	7.5747	0.27928	0.1637:0.7445:0.0:0.0917	.	.	.	.	X	417	.	ENSP00000257600:R417X	R	+	1	2	DTX1	112016998	1.000000	0.71417	0.976000	0.42696	0.813000	0.45954	1.095000	0.30964	0.225000	0.20959	-0.493000	0.04662	CGA	-	DTX1	-	smart_Znf_RING,pfscan_Znf_RING		0.667	DTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX1	HGNC	protein_coding	OTTHUMT00000405045.2	0	0	0	33	33	5	0.00	0.00	C			113532615	+1	4	0	31	8	tier1	no_errors	ENST00000257600	ensembl	human	known	74_37	nonsense	11.43	0.00	SNP	1.000	T	4	31
FAR2P1	440905	genome.wustl.edu	37	2	130807905	130807905	+	RNA	SNP	G	G	T	rs201541587	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr2:130807905G>T	ENST00000325390.3	-	0	799					NR_026758.1																						ATGGAAGAGTGCTCAGTGAGA	0.562													ENSG00000180178	.|||	2719	0.542931	0.4523	0.6671	5008	,	,		21515	0.5208		0.5845	False		,,,				2504	0.5573																0																																												0			-																													2.37:g.130807905G>T				R	SNP	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			rs201541587	AC018865.8	-	-		0.562	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	Clone_based_vega_gene	pseudogene	OTTHUMT00000331630.3	0	0	0	32	32	6	0.00	0.00	G			130807905	-1	4	0	16	9	tier1	no_errors	ENST00000325390	ensembl	human	known	74_37	rna	20.00	0.00	SNP	0.233	T	4	16
RPL13A	23521	genome.wustl.edu	37	19	49993810	49993810	+	Missense_Mutation	SNP	G	G	A			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr19:49993810G>A	ENST00000391857.4	+	4	309	c.233G>A	c.(232-234)cGc>cAc	p.R78H	SNORD35A_ENST00000363389.1_RNA|SNORD32A_ENST00000364805.1_RNA|RPL13A_ENST00000477613.2_3'UTR|SNORD34_ENST00000365633.1_RNA|SNORD33_ENST00000362761.1_RNA|CTD-3148I10.15_ENST00000595815.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	78					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		GCCCCCAGCCGCATCTTCTGG	0.632													ENSG00000142541																																					0													29.0	34.0	33.0					19																	49993810		2200	4298	6498	SO:0001583	missense	0			-	X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.233G>A	19.37:g.49993810G>A	ENSP00000375730:p.Arg78His		A8K505	Missense_Mutation	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	p.R78H	ENST00000391857.4	37	c.233	CCDS12768.1	19	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083625	0.76642	.	.	ENSG00000142541	ENST00000391857;ENST00000396949	.	.	.	5.46	4.41	0.53225	Ribosomal protein L13 domain (2);	0.000000	0.64402	U	0.000001	T	0.60340	0.2261	M	0.69523	2.12	0.58432	D	0.999999	B;B	0.31485	0.325;0.046	B;B	0.26416	0.069;0.01	T	0.64334	-0.6432	9	0.87932	D	0	.	13.508	0.61495	0.0:0.0:0.8431:0.1569	.	78;78	Q5QTS3;P40429	.;RL13A_HUMAN	H	78	.	ENSP00000375730:R78H	R	+	2	0	RPL13A	54685622	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.115000	0.71566	1.272000	0.44329	0.655000	0.94253	CGC	-	RPL13A	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc		0.632	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL13A	HGNC	protein_coding	OTTHUMT00000258989.1	0	0	0	50	50	6	0.00	0.00	G			49993810	+1	4	0	46	2	tier1	no_errors	ENST00000391857	ensembl	human	known	74_37	missense	8.00	0.00	SNP	1.000	A	4	46
STAB1	23166	genome.wustl.edu	37	3	52540712	52540712	+	Missense_Mutation	SNP	G	G	T	rs201076394	byFrequency	TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr3:52540712G>T	ENST00000321725.6	+	18	1911	c.1835G>T	c.(1834-1836)cGc>cTc	p.R612L		NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1	612	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082, ECO:0000305}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)	p.R612L(1)|p.R612H(1)		breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCGCAGGGGCGCATCCTGCTG	0.692													ENSG00000010327																																					2	Substitution - Missense(2)	lung(1)|kidney(1)											22.0	25.0	24.0					3																	52540712		2197	4296	6493	SO:0001583	missense	0			-	AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.1835G>T	3.37:g.52540712G>T	ENSP00000312946:p.Arg612Leu		A7E297|Q8IUH0|Q8IUH1|Q93072	Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,smart_EG-like_dom,smart_EGF_laminin,smart_FAS1_domain,smart_EGF-like_Ca-bd_dom,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.R612L	ENST00000321725.6	37	c.1835	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.147965	0.78001	.	.	ENSG00000010327	ENST00000321725	D	0.91068	-2.78	4.81	4.81	0.61882	FAS1 domain (5);	0.160917	0.41001	D	0.000976	D	0.92407	0.7590	L	0.38175	1.15	0.45427	D	0.998408	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	D	0.92672	0.6151	10	0.51188	T	0.08	.	14.8072	0.69965	0.0:0.0:1.0:0.0	.	612;612	Q9NY15;Q9NY15-2	STAB1_HUMAN;.	L	612	ENSP00000312946:R612L	ENSP00000312946:R612L	R	+	2	0	STAB1	52515752	0.986000	0.35501	1.000000	0.80357	0.835000	0.47333	3.123000	0.50453	2.215000	0.71742	0.462000	0.41574	CGC	-	STAB1	-	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain		0.692	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	0	0	0	30	30	6	0.00	0.00	G	NM_015136		52540712	+1	4	0	8	5	tier1	no_errors	ENST00000321725	ensembl	human	known	74_37	missense	33.33	0.00	SNP	1.000	T	4	8
TAOK3	51347	genome.wustl.edu	37	12	118604652	118604653	+	Intron	INS	-	-	ACAC	rs376430378|rs373259313|rs200569755|rs7487392		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr12:118604652_118604653insACAC	ENST00000392533.3	-	18	2390				TAOK3_ENST00000419821.2_Intron|TAOK3_ENST00000537952.1_Intron|AC026366.1_ENST00000408353.1_RNA	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					cacacacacatacacacacaca	0.421													ENSG00000221280																																					0																																										SO:0001627	intron_variant	0				AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4820->GTGT	12.37:g.118604657_118604660dupACAC			Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	R	INS	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																				AC026366.1	-	-		0.421	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000401456.2	0	0	0	19	19	0	0.00	0.00	-	NM_016281		118604653	+1	3	0	8	0	tier1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	27.27	0.00	INS	0.002:0.000	ACAC	3	8
NUTM2E	283008	genome.wustl.edu	37	10	81606700	81606700	+	Silent	SNP	C	C	T			TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr10:81606700C>T	ENST00000429984.3	+	3	1580	c.1197C>T	c.(1195-1197)taC>taT	p.Y399Y	NUTM2E_ENST00000602967.1_Silent_p.Y399Y			B1AL46	NTM2E_HUMAN	NUT family member 2E	399																	TGATCTTCTACGAGATGGCGG	0.647													ENSG00000228570																																					0																																										SO:0001819	synonymous_variant	0			-			10q22.3	2013-03-14	2013-03-14	2013-03-14	ENSG00000228570	ENSG00000228570			23448	other	unknown			"""family with sequence similarity 22, member E"""	FAM22E			Standard	NG_012781		Approved			B1AL46	OTTHUMG00000018586	ENST00000429984.3:c.1197C>T	10.37:g.81606700C>T			A6NHL0	Silent	SNP	NULL	p.Y399	ENST00000429984.3	37	c.1197		10																																																																																			-	NUTM2E	-	NULL		0.647	NUTM2E-201	KNOWN	basic|appris_principal	protein_coding	NUTM2E	HGNC	protein_coding		0	0	0	17	17	3	0.00	0.00	C	NG_012781		81606700	+1	5	1	3	1	tier1	no_errors	ENST00000429984	ensembl	human	known	74_37	silent	62.50	50.00	SNP	0.069	T	5	3
TBC1D3P3	653017	genome.wustl.edu	37	17	20451293	20451293	+	lincRNA	SNP	A	A	G	rs374159131		TCGA-X6-A8C7-01A-11D-A36J-09	TCGA-X6-A8C7-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	b052af04-ea5e-4acc-8fd1-1b647128a35b	ef4fb3ba-651c-48b8-b2c6-5e957c154b14	g.chr17:20451293A>G	ENST00000591705.1	+	0	2610																											GAAGGAAGGAAAGAAGGAAGG	0.542													ENSG00000267075																																					0																																												0			-																													17.37:g.20451293A>G				R	SNP	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			-	RP11-434D2.3	-	-		0.542	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	Clone_based_vega_gene	lincRNA	OTTHUMT00000441761.2	0	0	0	24	24	2	0.00	0.00	A			20451293	+1	5	2	15	9	tier1	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	25.00	18.18	SNP	0.033	G	5	15
