#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
GRP	2922	genome.wustl.edu	37	18	56892836	56892836	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	T	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr18:56892836G>T	ENST00000256857.2	+	2	350	c.252G>T	c.(250-252)ttG>ttT	p.L84F	GRP_ENST00000529320.2_Missense_Mutation_p.L84F|GRP_ENST00000420468.2_Missense_Mutation_p.L84F	NM_001012512.1|NM_002091.3	NP_001012530.1|NP_002082.2	P07492	GRP_HUMAN	gastrin-releasing peptide	84					neuropeptide signaling pathway (GO:0007218)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	neuropeptide hormone activity (GO:0005184)|receptor binding (GO:0005102)			large_intestine(1)|lung(3)	4		Colorectal(73;0.0946)				CAAGGAATTTGCTGGGTCTCA	0.527													ENSG00000134443																																					0													104.0	100.0	102.0					18																	56892836		2203	4300	6503	SO:0001583	missense	0			-		CCDS11971.1, CCDS45877.1, CCDS45878.1	18q21.1-q21.32	2013-02-26			ENSG00000134443	ENSG00000134443		"""Endogenous ligands"""	4605	protein-coding gene	gene with protein product	"""bombesin"", ""neuromedin C"", ""prepro-GRP"""	137260					Standard	NM_002091		Approved		uc002lhv.3	P07492	OTTHUMG00000132760	ENST00000256857.2:c.252G>T	18.37:g.56892836G>T	ENSP00000256857:p.Leu84Phe		P07491|P81553|Q14454|Q53YA0|Q9BSY7	Missense_Mutation	SNP	pfam_Bombesin	p.L84F	ENST00000256857.2	37	c.252	CCDS11971.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.35|15.35	2.807091|2.807091	0.50421|0.50421	.|.	.|.	ENSG00000134443|ENSG00000134443	ENST00000456142|ENST00000256857;ENST00000529320;ENST00000420468	.|T;T;T	.|0.52754	.|0.65;0.69;0.67	5.03|5.03	2.07|2.07	0.26955|0.26955	.|.	.|0.107610	.|0.38164	.|N	.|0.001789	T|T	0.51873|0.51873	0.1700|0.1700	L|L	0.43152|0.43152	1.355|1.355	0.37966|0.37966	D|D	0.93311|0.93311	.|D;D;B	.|0.89917	.|1.0;0.999;0.356	.|D;D;B	.|0.91635	.|0.999;0.997;0.342	T|T	0.57093|0.57093	-0.7870|-0.7870	5|10	.|0.87932	.|D	.|0	-10.5092|-10.5092	2.6477|2.6477	0.04990|0.04990	0.1771:0.1453:0.5286:0.1491|0.1771:0.1453:0.5286:0.1491	.|.	.|84;84;84	.|P07492-3;P07492;P07492-2	.|.;GRP_HUMAN;.	F|F	40|84	.|ENSP00000256857:L84F;ENSP00000434101:L84F;ENSP00000389696:L84F	.|ENSP00000256857:L84F	C|L	+|+	2|3	0|2	GRP|GRP	55043816|55043816	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.798000|0.798000	0.45092|0.45092	0.838000|0.838000	0.27572|0.27572	1.114000|1.114000	0.41781|0.41781	0.655000|0.655000	0.94253|0.94253	TGC|TTG	-	GRP	-	NULL		0.527	GRP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRP	HGNC	protein_coding	OTTHUMT00000256131.2	0	0	0	82	82	72	0.00	0.00	G	NM_002091		56892836	+1	21	38	39	49	tier1	no_errors	ENST00000256857	ensembl	human	known	74_37	missense	35.00	43.68	SNP	0.994	T	21	39
ETNPPL	64850	genome.wustl.edu	37	4	109683976	109683976	+	Intron	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:109683976C>T	ENST00000296486.3	-	1	211				ETNPPL_ENST00000510706.1_Splice_Site|ETNPPL_ENST00000512646.1_Splice_Site|ETNPPL_ENST00000411864.2_Intron	NM_001146590.1|NM_031279.3	NP_001140062.1|NP_112569.2	Q8TBG4	AT2L1_HUMAN	ethanolamine-phosphate phospho-lyase							mitochondrion (GO:0005739)	ethanolamine-phosphate phospho-lyase activity (GO:0050459)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)										TCTGCACTTACTTCCGGGCCA	0.637													ENSG00000164089																																					0													134.0	124.0	127.0					4																	109683976		2203	4300	6503	SO:0001627	intron_variant	0			-	AJ298293	CCDS3682.1, CCDS54792.1, CCDS54793.1	4q25	2013-06-12	2013-06-12	2013-06-12	ENSG00000164089	ENSG00000164089	4.2.3.2		14404	protein-coding gene	gene with protein product		614682	"""alanine-glyoxylate aminotransferase 2-like 1"""	AGXT2L1		7592550, 22241472	Standard	NM_031279		Approved		uc003hzc.3	Q8TBG4	OTTHUMG00000161036	ENST00000296486.3:c.56+22G>A	4.37:g.109683976C>T			B7Z1Y0|E9PBY0|Q9H174	Splice_Site	SNP	-	e0+1	ENST00000296486.3	37	c.1+1	CCDS3682.1	4	.	.	.	.	.	.	.	.	.	.	C	2.593	-0.294732	0.05568	.	.	ENSG00000164089	ENST00000512646	.	.	.	2.91	-2.67	0.06059	.	.	.	.	.	.	.	.	.	.	.	0.34783	D	0.734913	.	.	.	.	.	.	.	.	.	.	.	.	.	.	1.526	0.02526	0.1372:0.3744:0.136:0.3523	.	.	.	.	.	-1	.	.	.	-	.	.	AGXT2L1	109903425	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.457000	0.06745	-0.391000	0.07763	0.460000	0.39030	.	-	ETNPPL	-	-		0.637	ETNPPL-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETNPPL	HGNC	protein_coding	OTTHUMT00000363508.1	0	0	0	72	72	61	0.00	0.00	C	NM_031279		109683976	-1	6	12	17	78	tier1	no_errors	ENST00000510706	ensembl	human	putative	74_37	splice_site	25.00	13.19	SNP	0.000	T	6	17
ZNF354B	117608	genome.wustl.edu	37	5	178310890	178310890	+	Silent	SNP	C	C	T	rs143278265	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:178310890C>T	ENST00000322434.3	+	5	1663	c.1437C>T	c.(1435-1437)tcC>tcT	p.S479S	ZNF354B_ENST00000522714.1_3'UTR|RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GACAGAGTTCCGCTCTCATTC	0.393													ENSG00000178338																																					0													116.0	115.0	115.0					5																	178310890		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.1437C>T	5.37:g.178310890C>T			A8K0V2|Q5U5Z4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S479	ENST00000322434.3	37	c.1437	CCDS4439.1	5																																																																																			-	ZNF354B	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354B	HGNC	protein_coding	OTTHUMT00000253482.1	0	0	0	64	64	49	0.00	0.00	C	NM_058230		178310890	+1	6	22	19	40	tier1	no_errors	ENST00000322434	ensembl	human	known	74_37	silent	24.00	35.48	SNP	0.127	T	6	19
KCNA1	3736	genome.wustl.edu	37	12	5020795	5020795	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:5020795G>A	ENST00000382545.3	+	2	1358	c.251G>A	c.(250-252)cGc>cAc	p.R84H	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	84					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	TTCTTCGACCGCAACCGGCCC	0.627													ENSG00000111262																																					0													63.0	65.0	65.0					12																	5020795		2203	4298	6501	SO:0001583	missense	0			-	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.251G>A	12.37:g.5020795G>A	ENSP00000371985:p.Arg84His		A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.R84H	ENST00000382545.3	37	c.251	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578422	0.86645	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.90261	-2.64	4.34	4.34	0.51931	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.97390	0.9146	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98994	1.0809	10	0.87932	D	0	.	16.3898	0.83531	0.0:0.0:1.0:0.0	.	84	Q09470	KCNA1_HUMAN	H	84	ENSP00000371985:R84H	ENSP00000228858:R84H	R	+	2	0	KCNA1	4891056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.531000	0.98054	2.410000	0.81850	0.650000	0.86243	CGC	-	KC1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KC1	HGNC	protein_coding	OTTHUMT00000103343.2	0	0	0	212	212	19	0.00	0.00	G	NM_000217		5020795	+1	20	12	97	16	tier1	no_errors	ENST00000382545	ensembl	human	known	74_37	missense	16.95	42.86	SNP	1.000	A	20	97
EDEM1	9695	genome.wustl.edu	37	3	5257568	5257568	+	Missense_Mutation	SNP	A	A	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:5257568A>G	ENST00000256497.4	+	12	2072	c.1939A>G	c.(1939-1941)Atg>Gtg	p.M647V		NM_014674.2	NP_055489.1	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like 1	647					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	calcium ion binding (GO:0005509)|misfolded protein binding (GO:0051787)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		GAGCATCTACATGCGACAGAT	0.448													ENSG00000134109																																					0													227.0	175.0	193.0					3																	5257568		2203	4300	6503	SO:0001583	missense	0			-	D86967	CCDS33686.1	3p26.1	2008-02-05			ENSG00000134109	ENSG00000134109			18967	protein-coding gene	gene with protein product		607673				12610306	Standard	NM_014674		Approved	KIAA0212, EDEM	uc003bqi.3	Q92611	OTTHUMG00000154896	ENST00000256497.4:c.1939A>G	3.37:g.5257568A>G	ENSP00000256497:p.Met647Val		A8K9C8|B4DXP3	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.M647V	ENST00000256497.4	37	c.1939	CCDS33686.1	3	.	.	.	.	.	.	.	.	.	.	A	17.61	3.433290	0.62844	.	.	ENSG00000134109	ENST00000256497	D	0.82433	-1.61	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	M	0.64997	1.995	0.80722	D	1	P	0.35383	0.498	B	0.33454	0.164	T	0.81206	-0.1038	10	0.46703	T	0.11	-33.0056	15.1853	0.72996	1.0:0.0:0.0:0.0	.	647	Q92611	EDEM1_HUMAN	V	647	ENSP00000256497:M647V	ENSP00000256497:M647V	M	+	1	0	EDEM1	5232568	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.772000	0.91757	1.984000	0.57885	0.533000	0.62120	ATG	-	EDEM1	-	NULL		0.448	EDEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM1	HGNC	protein_coding	OTTHUMT00000337566.2	0	0	0	115	115	67	0.00	0.00	A	NM_014674		5257568	+1	11	28	46	63	tier1	no_errors	ENST00000256497	ensembl	human	known	74_37	missense	19.30	30.77	SNP	1.000	G	11	46
HSF2BP	11077	genome.wustl.edu	37	21	44949764	44949764	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr21:44949764G>A	ENST00000291560.2	-	9	1206	c.875C>T	c.(874-876)tCg>tTg	p.S292L	HSF2BP_ENST00000542962.1_Missense_Mutation_p.S217L	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	292					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		CTCAGAGGCCGACTTGGAGAA	0.572													ENSG00000160207																																					0													65.0	66.0	66.0					21																	44949764		2203	4300	6503	SO:0001583	missense	0			-	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.875C>T	21.37:g.44949764G>A	ENSP00000291560:p.Ser292Leu		B4DX36	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S292L	ENST00000291560.2	37	c.875	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	G	5.382	0.255646	0.10185	.	.	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.66099	-0.19;0.86	5.57	-0.0836	0.13693	Armadillo-like helical (1);Armadillo-type fold (1);	0.873444	0.10300	N	0.691241	T	0.34629	0.0904	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18493	-1.0335	10	0.10111	T	0.7	-19.4038	10.8313	0.46663	0.5355:0.0:0.4645:0.0	.	292	O75031	HSF2B_HUMAN	L	292;217	ENSP00000291560:S292L;ENSP00000443367:S217L	ENSP00000291560:S292L	S	-	2	0	HSF2BP	43774192	0.009000	0.17119	0.000000	0.03702	0.890000	0.51754	0.839000	0.27586	0.042000	0.15717	0.563000	0.77884	TCG	-	HSF2BP	-	superfamily_ARM-type_fold		0.572	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	HGNC	protein_coding	OTTHUMT00000195620.1	0	0	0	67	67	87	0.00	0.00	G	NM_007031		44949764	-1	41	40	41	40	tier1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	50.00	50.00	SNP	0.000	A	41	41
SRGAP3	9901	genome.wustl.edu	37	3	9106121	9106121	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:9106121G>A	ENST00000383836.3	-	5	1058	c.631C>T	c.(631-633)Cgc>Tgc	p.R211C	SRGAP3_ENST00000433332.3_5'UTR|SRGAP3_ENST00000360413.3_Missense_Mutation_p.R211C	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	211	F-BAR domain.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		GAGCTGCGGCGCTGGGGCCGG	0.597			T	RAF1	pilocytic astrocytoma								ENSG00000196220																												Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													124.0	113.0	117.0					3																	9106121		2203	4300	6503	SO:0001583	missense	0			-	AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.631C>T	3.37:g.9106121G>A	ENSP00000373347:p.Arg211Cys		Q8IX13|Q8IZV8	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_FCH_dom,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R211C	ENST00000383836.3	37	c.631	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184619	0.78677	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	T;T	0.55413	0.52;0.52	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.82630	2.6	0.80722	D	1	D;D;D;D	0.89917	1.0;0.994;1.0;0.999	D;P;D;D	0.79784	0.993;0.742;0.978;0.952	T	0.77403	-0.2601	10	0.87932	D	0	.	13.1447	0.59454	0.0:0.0:0.8399:0.1601	.	211;80;211;211	C7TPG7;Q9ULR4;O43295-2;O43295	.;.;.;SRGP2_HUMAN	C	211;211;91	ENSP00000373347:R211C;ENSP00000353587:R211C	ENSP00000353587:R211C	R	-	1	0	SRGAP3	9081121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.257000	0.32932	2.452000	0.82932	0.411000	0.27672	CGC	-	SRGAP3	-	NULL		0.597	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	0	0	0	62	62	33	0.00	0.00	G			9106121	-1	14	17	15	22	tier1	no_errors	ENST00000383836	ensembl	human	known	74_37	missense	48.28	43.59	SNP	1.000	A	14	15
TNC	3371	genome.wustl.edu	37	9	117808688	117808688	+	Splice_Site	SNP	C	C	G	rs111797890		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr9:117808688C>G	ENST00000350763.4	-	17	5537		c.e17+1		TNC_ENST00000341037.4_Splice_Site|TNC_ENST00000340094.3_Splice_Site|TNC_ENST00000346706.3_Splice_Site|TNC_ENST00000345230.3_Intron|TNC_ENST00000423613.2_Intron|TNC_ENST00000535648.1_Splice_Site|TNC_ENST00000537320.1_Intron|TNC_ENST00000481475.1_5'Flank|TNC_ENST00000542877.1_Splice_Site	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C						bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						ATTTACAGTACCTGTTGTTGC	0.458													ENSG00000041982																																					0													229.0	217.0	221.0					9																	117808688		2203	4300	6503	SO:0001630	splice_region_variant	0			-		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.5125+1G>C	9.37:g.117808688C>G			C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Splice_Site	SNP	-	e16+1	ENST00000350763.4	37	c.5125+1	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680337	0.88542	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000350763;ENST00000341037;ENST00000542877;ENST00000544972	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0674	0.97707	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TNC	116848509	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.409000	0.80053	2.735000	0.93741	0.563000	0.77884	.	rs111797890	TNC	-	-		0.458	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	0	0	0	100	100	74	0.00	0.00	C	NM_002160	Intron	117808688	-1	6	15	23	33	tier1	no_errors	ENST00000350763	ensembl	human	known	74_37	splice_site	20.69	31.25	SNP	1.000	G	6	23
DCSTAMP	81501	genome.wustl.edu	37	8	105367322	105367322	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:105367322G>A	ENST00000297581.2	+	3	1296	c.1247G>A	c.(1246-1248)cGc>cAc	p.R416H	DCSTAMP_ENST00000517991.1_Intron|DPYS_ENST00000521601.1_Intron|DCSTAMP_ENST00000520080.1_3'UTR	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	416					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											GAGAGGAAGCGCATCCAATAT	0.443													ENSG00000164935																																					0													121.0	120.0	120.0					8																	105367322		2203	4300	6503	SO:0001583	missense	0			-	AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.1247G>A	8.37:g.105367322G>A	ENSP00000297581:p.Arg416His		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	p.R416H	ENST00000297581.2	37	c.1247	CCDS6301.1	8	.	.	.	.	.	.	.	.	.	.	G	18.55	3.649229	0.67358	.	.	ENSG00000164935	ENST00000297581	T	0.78364	-1.17	5.44	5.44	0.79542	Dendritic cell-specific transmembrane protein-like (1);	0.000000	0.85682	D	0.000000	D	0.88808	0.6537	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89834	0.3998	10	0.87932	D	0	-17.4	17.7975	0.88577	0.0:0.0:1.0:0.0	.	416	Q9H295	TM7S4_HUMAN	H	416	ENSP00000297581:R416H	ENSP00000297581:R416H	R	+	2	0	TM7SF4	105436498	0.997000	0.39634	0.132000	0.22025	0.185000	0.23345	7.776000	0.85560	2.700000	0.92200	0.655000	0.94253	CGC	-	DCSTAMP	-	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom		0.443	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	HGNC	protein_coding	OTTHUMT00000380810.1	0	0	0	54	54	49	0.00	0.00	G	NM_030788		105367322	+1	8	9	17	19	tier1	no_errors	ENST00000297581	ensembl	human	known	74_37	missense	32.00	32.14	SNP	0.903	A	8	17
FAM198A	729085	genome.wustl.edu	37	3	43074191	43074191	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:43074191C>T	ENST00000430121.2	+	2	531	c.436C>T	c.(436-438)Cca>Tca	p.P146S	KRBOX1_ENST00000443313.1_Intron	NM_001129908.2	NP_001123380.2	Q9UFP1	F198A_HUMAN	family with sequence similarity 198, member A	146						extracellular region (GO:0005576)				endometrium(1)	1						GGTTGGAGATCCAGGAACCAA	0.572													ENSG00000144649																																					0													83.0	78.0	80.0					3																	43074191		692	1591	2283	SO:0001583	missense	0			-	AL117530	CCDS46808.1	3p22.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000144649	ENSG00000144649			24485	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 41"""	C3orf41			Standard	NM_001129908		Approved	DKFZP434B172	uc003cmp.4	Q9UFP1	OTTHUMG00000156449	ENST00000430121.2:c.436C>T	3.37:g.43074191C>T	ENSP00000407301:p.Pro146Ser		B3KR48	Missense_Mutation	SNP	NULL	p.P146S	ENST00000430121.2	37	c.436	CCDS46808.1	3	.	.	.	.	.	.	.	.	.	.	C	6.996	0.553967	0.13374	.	.	ENSG00000144649	ENST00000430121	T	0.27720	1.65	4.39	2.47	0.30058	.	0.312477	0.23185	N	0.050967	T	0.21062	0.0507	L	0.32530	0.975	0.09310	N	1	B	0.24368	0.102	B	0.21151	0.033	T	0.16867	-1.0388	9	.	.	.	-15.1449	10.7186	0.46028	0.0:0.6057:0.3943:0.0	.	146	Q9UFP1	F198A_HUMAN	S	146	ENSP00000407301:P146S	.	P	+	1	0	FAM198A	43049195	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	-0.325000	0.07976	0.356000	0.24157	-0.282000	0.10007	CCA	-	FAM198A	-	NULL		0.572	FAM198A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM198A	HGNC	protein_coding	OTTHUMT00000344240.3	0	0	0	71	71	106	0.00	0.00	C	NM_001129908		43074191	+1	15	21	30	81	tier1	no_errors	ENST00000273146	ensembl	human	known	74_37	missense	33.33	20.59	SNP	0.000	T	15	30
RAD51AP2	729475	genome.wustl.edu	37	2	17696723	17696723	+	Missense_Mutation	SNP	A	A	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr2:17696723A>T	ENST00000399080.2	-	1	2983	c.2960T>A	c.(2959-2961)cTt>cAt	p.L987H		NM_001099218.2	NP_001092688.1	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	987										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(10)|liver(1)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGTGCTTAGAAGTTCATTTTC	0.318													ENSG00000214842																																					0													98.0	93.0	94.0					2																	17696723		1811	4076	5887	SO:0001583	missense	0			-	AK310498	CCDS42656.1	2p24.2	2009-01-13			ENSG00000214842	ENSG00000214842			34417	protein-coding gene	gene with protein product						16990250	Standard	NM_001099218		Approved	FLJ17540	uc002rcl.1	Q09MP3	OTTHUMG00000151761	ENST00000399080.2:c.2960T>A	2.37:g.17696723A>T	ENSP00000382030:p.Leu987His			Missense_Mutation	SNP	NULL	p.L987H	ENST00000399080.2	37	c.2960	CCDS42656.1	2	.	.	.	.	.	.	.	.	.	.	A	10.49	1.364708	0.24684	.	.	ENSG00000214842	ENST00000399080	T	0.27402	1.67	5.17	-3.37	0.04898	.	.	.	.	.	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.23904	-1.0175	9	0.87932	D	0	-0.4452	1.4532	0.02380	0.2718:0.1036:0.3264:0.2982	.	987	Q09MP3	R51A2_HUMAN	H	987	ENSP00000382030:L987H	ENSP00000382030:L987H	L	-	2	0	RAD51AP2	17560204	0.995000	0.38212	0.459000	0.27081	0.788000	0.44548	0.930000	0.28858	-0.486000	0.06744	-0.290000	0.09829	CTT	-	RAD51AP2	-	NULL		0.318	RAD51AP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD51AP2	HGNC	protein_coding	OTTHUMT00000323801.3	0	0	0	22	22	80	0.00	0.00	A	NM_001099218		17696723	-1	12	26	13	64	tier1	no_errors	ENST00000399080	ensembl	human	known	74_37	missense	48.00	28.89	SNP	0.007	T	12	13
INSC	387755	genome.wustl.edu	37	11	15267818	15267818	+	3'UTR	SNP	G	G	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr11:15267818G>C	ENST00000379554.3	+	0	2018				INSC_ENST00000424273.1_3'UTR|INSC_ENST00000379556.3_3'UTR|INSC_ENST00000528567.1_3'UTR	NM_001031853.3	NP_001027024.3	Q1MX18	INSC_HUMAN	inscuteable homolog (Drosophila)						establishment of mitotic spindle orientation (GO:0000132)|lung epithelial cell differentiation (GO:0060487)|nervous system development (GO:0007399)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(3)|lung(24)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49						TTCAGTTGCAGATGTTGAAAT	0.323													ENSG00000188487																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AB231744	CCDS41621.1, CCDS41622.1, CCDS60735.1, CCDS60736.1	11p15.2	2014-02-05			ENSG00000188487	ENSG00000188487			33116	protein-coding gene	gene with protein product	"""inscuteable spindle orientation adaptor protein"""	610668				16458856	Standard	NM_001031853		Approved		uc001mly.4	Q1MX18	OTTHUMG00000165838	ENST00000379554.3:c.*232G>C	11.37:g.15267818G>C			A0PJX5|Q1MX19|Q3C1V6|Q4AC95|Q4AC96|Q4AC97|Q4AC98	R	SNP	-	NULL	ENST00000379554.3	37	NULL	CCDS41621.1	11																																																																																			-	INSC	-	-		0.323	INSC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSC	HGNC	protein_coding	OTTHUMT00000386590.1	0	0	0	59	59	44	0.00	0.00	G	NM_001031853		15267818	+1	10	27	24	44	tier1	no_errors	ENST00000526102	ensembl	human	known	74_37	rna	29.41	37.50	SNP	0.999	C	10	24
FAM81B	153643	genome.wustl.edu	37	5	94728590	94728590	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:94728590C>G	ENST00000283357.5	+	2	263	c.217C>G	c.(217-219)Caa>Gaa	p.Q73E	FAM81B_ENST00000506418.1_3'UTR	NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	73						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		AGACAATAACCAAGAAAAGAA	0.388													ENSG00000153347																																					0													43.0	42.0	43.0					5																	94728590		1831	4085	5916	SO:0001583	missense	0			-		CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.217C>G	5.37:g.94728590C>G	ENSP00000283357:p.Gln73Glu			Missense_Mutation	SNP	NULL	p.Q73E	ENST00000283357.5	37	c.217	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947883	0.34377	.	.	ENSG00000153347	ENST00000283357	T	0.18960	2.18	5.69	0.617	0.17619	.	0.772034	0.11825	N	0.525818	T	0.17450	0.0419	M	0.62723	1.935	0.21473	N	0.999677	B	0.09022	0.002	B	0.09377	0.004	T	0.25537	-1.0129	10	0.30078	T	0.28	-1.333	3.0158	0.06059	0.2369:0.3903:0.2849:0.0879	.	73	Q96LP2	FA81B_HUMAN	E	73	ENSP00000283357:Q73E	ENSP00000283357:Q73E	Q	+	1	0	FAM81B	94754346	0.995000	0.38212	0.998000	0.56505	0.831000	0.47069	0.390000	0.20768	0.704000	0.31869	0.563000	0.77884	CAA	-	FAM81B	-	NULL		0.388	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	HGNC	protein_coding	OTTHUMT00000370690.1	0	0	0	99	99	79	0.00	0.00	C	NM_152548		94728590	+1	31	21	102	78	tier1	no_errors	ENST00000283357	ensembl	human	known	74_37	missense	23.31	21.21	SNP	0.848	G	31	102
PCDH20	64881	genome.wustl.edu	37	13	61986224	61986224	+	Nonsense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr13:61986224G>A	ENST00000409186.1	-	5	4113	c.2008C>T	c.(2008-2010)Cga>Tga	p.R670*	PCDH20_ENST00000409204.4_Nonsense_Mutation_p.R670*			Q8N6Y1	PCD20_HUMAN	protocadherin 20	670	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CATCCATTTCGTCCAGCGTCA	0.448													ENSG00000197991																																					0													93.0	91.0	91.0					13																	61986224		2203	4300	6503	SO:0001587	stop_gained	0			-	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2008C>T	13.37:g.61986224G>A	ENSP00000386653:p.Arg670*		A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Nonsense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R670*	ENST00000409186.1	37	c.2008	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	G	39	7.657066	0.98415	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	.	.	.	5.94	3.09	0.35607	.	0.527931	0.17356	N	0.177208	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	14.8811	0.70534	0.0:0.0:0.6245:0.3755	.	.	.	.	X	670;670;416	.	ENSP00000351500:R416X	R	-	1	2	PCDH20	60884225	0.035000	0.19736	0.206000	0.23566	0.717000	0.41224	1.392000	0.34486	0.316000	0.23135	0.557000	0.71058	CGA	-	PCDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.448	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	HGNC	protein_coding	OTTHUMT00000333054.2	0	0	0	33	33	81	0.00	0.00	G	NM_022843		61986224	-1	6	13	33	70	tier1	no_errors	ENST00000409186	ensembl	human	known	74_37	nonsense	15.38	15.66	SNP	0.907	A	6	33
CENPC	1060	genome.wustl.edu	37	4	68338334	68338334	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:68338334T>A	ENST00000273853.6	-	19	3071	c.2821A>T	c.(2821-2823)Ata>Tta	p.I941L		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	941	MIF2 homology domain III.				chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										CATCTTTTTATCTGAGTAAAA	0.239													ENSG00000145241																																					0													26.0	24.0	25.0					4																	68338334		1684	3895	5579	SO:0001583	missense	0			-	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2821A>T	4.37:g.68338334T>A	ENSP00000273853:p.Ile941Leu		Q8IW27|Q9P0M5	Missense_Mutation	SNP	pfam_Mif2/CENP-C_cupin,pfam_Cupin_2,superfamily_RmlC_Cupin	p.I941L	ENST00000273853.6	37	c.2821	CCDS47063.1	4	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059418	0.36373	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.45	4.45	0.53987	.	0.116384	0.37715	N	0.001962	T	0.29524	0.0736	N	0.20986	0.625	0.32107	N	0.589801	B	0.26708	0.157	B	0.15870	0.014	T	0.31998	-0.9923	9	0.23891	T	0.37	-19.5767	10.0283	0.42085	0.0:0.0:0.0:1.0	.	941	Q03188	CENPC_HUMAN	L	941	.	ENSP00000273853:I941L	I	-	1	0	CENPC1	68020929	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.559000	0.45888	1.853000	0.53794	0.402000	0.26972	ATA	-	CENPC	-	NULL		0.239	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPC	HGNC	protein_coding	OTTHUMT00000362001.2	0	0	0	184	184	44	0.00	0.00	T			68338334	-1	113	34	60	23	tier1	no_errors	ENST00000273853	ensembl	human	known	74_37	missense	64.94	59.65	SNP	1.000	A	113	60
ZNF536	9745	genome.wustl.edu	37	19	31038939	31038939	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:31038939C>T	ENST00000355537.3	+	4	2560	c.2413C>T	c.(2413-2415)Cgg>Tgg	p.R805W		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	805					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CCATCGGGAGCGGCAGAACGG	0.537													ENSG00000198597																																					0													67.0	73.0	71.0					19																	31038939		2203	4300	6503	SO:0001583	missense	0			-		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2413C>T	19.37:g.31038939C>T	ENSP00000347730:p.Arg805Trp		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R805W	ENST00000355537.3	37	c.2413	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	C	13.31	2.200011	0.38905	.	.	ENSG00000198597	ENST00000355537	T	0.08984	3.03	5.98	2.55	0.30701	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.17789	0.0427	L	0.32530	0.975	0.45172	D	0.998183	D;D	0.89917	1.0;1.0	D;D	0.65987	0.94;0.94	T	0.00617	-1.1642	10	0.87932	D	0	-19.5882	15.7677	0.78141	0.5855:0.4145:0.0:0.0	.	805;805	A7E228;O15090	.;ZN536_HUMAN	W	805	ENSP00000347730:R805W	ENSP00000347730:R805W	R	+	1	2	ZNF536	35730779	1.000000	0.71417	0.993000	0.49108	0.690000	0.40134	2.364000	0.44187	0.364000	0.24374	0.591000	0.81541	CGG	-	ZNF536	-	pfscan_Znf_C2H2		0.537	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	0	0	0	54	54	35	0.00	0.00	C	NM_014717		31038939	+1	6	13	22	46	tier1	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	21.43	22.03	SNP	1.000	T	6	22
CALML6	163688	genome.wustl.edu	37	1	1848446	1848446	+	Silent	SNP	C	C	T	rs375295754		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:1848446C>T	ENST00000307786.3	+	5	886	c.432C>T	c.(430-432)aaC>aaT	p.N144N	CALML6_ENST00000462293.1_3'UTR	NM_138705.2	NP_619650.2	Q8TD86	CALL6_HUMAN	calmodulin-like 6	144	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		AGCCCCTCAACGAGGTGGAGG	0.672													ENSG00000169885																																					0								C		0,4406		0,0,2203	72.0	61.0	65.0		432	-6.0	0.0	1		65	1,8595		0,1,4297	no	coding-synonymous	CALML6	NM_138705.2		0,1,6500	TT,TC,CC		0.0116,0.0,0.0077		144/182	1848446	1,13001	2203	4298	6501	SO:0001819	synonymous_variant	0			-	AF490905	CCDS30566.1	1p36.33	2013-01-10			ENSG00000169885	ENSG00000169885		"""EF-hand domain containing"""	24193	protein-coding gene	gene with protein product		610171					Standard	NM_138705		Approved	CAGLP	uc001aih.1	Q8TD86	OTTHUMG00000000943	ENST00000307786.3:c.432C>T	1.37:g.1848446C>T			A2A2M3|Q6Q2C4	Silent	SNP	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.N144	ENST00000307786.3	37	c.432	CCDS30566.1	1																																																																																			-	CALML6	-	pfscan_EF_hand_dom		0.672	CALML6-004	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	CALML6	HGNC	protein_coding	OTTHUMT00000276929.1	0	0	0	196	196	56	0.00	0.00	C	NM_138705		1848446	+1	29	10	72	47	tier1	no_errors	ENST00000307786	ensembl	human	known	74_37	silent	28.71	17.54	SNP	0.011	T	29	72
TARS2	80222	genome.wustl.edu	37	1	150469344	150469344	+	Missense_Mutation	SNP	G	G	A	rs367984492		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:150469344G>A	ENST00000369064.3	+	9	1014	c.980G>A	c.(979-981)cGa>cAa	p.R327Q	TARS2_ENST00000463555.1_Intron|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Intron|TARS2_ENST00000369054.2_Intron	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	327					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TTCCTGCCACGAGGGACAAGG	0.537													ENSG00000143374																																					0													77.0	68.0	71.0					1																	150469344		2203	4300	6503	SO:0001583	missense	0			-	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.980G>A	1.37:g.150469344G>A	ENSP00000358060:p.Arg327Gln		Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	pfam_aa-tR-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tR_SAD,superfamily_Thr/Ala-tR-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tR_SAD,pfscan_aa-tR-synth_II,prints_Thr-tR-ligase_IIa,tigrfam_Thr-tR-ligase_IIa	p.R327Q	ENST00000369064.3	37	c.980	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013717	0.93404	.	.	ENSG00000143374	ENST00000369064	.	.	.	5.38	5.38	0.77491	.	0.252179	0.33290	N	0.005061	T	0.60508	0.2274	M	0.73319	2.225	0.80722	D	1	D	0.69078	0.997	P	0.53954	0.738	T	0.64918	-0.6294	9	0.62326	D	0.03	-18.1837	13.2495	0.60043	0.0768:0.0:0.9232:0.0	.	327	Q9BW92	SYTM_HUMAN	Q	327	.	ENSP00000358060:R327Q	R	+	2	0	TARS2	148735968	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.867000	0.63013	2.801000	0.96364	0.655000	0.94253	CGA	-	TARS2	-	tigrfam_Thr-tR-ligase_IIa		0.537	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	HGNC	protein_coding	OTTHUMT00000035847.1	0	0	0	88	88	106	0.00	0.00	G	NM_025150		150469344	+1	9	17	39	82	tier1	no_errors	ENST00000369064	ensembl	human	known	74_37	missense	18.75	17.17	SNP	1.000	A	9	39
PCNT	5116	genome.wustl.edu	37	21	47852034	47852034	+	Missense_Mutation	SNP	G	G	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	C	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr21:47852034G>C	ENST00000359568.5	+	38	8763	c.8656G>C	c.(8656-8658)Gaa>Caa	p.E2886Q	PCNT_ENST00000480896.1_Intron	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	2886					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					GAAAGAGCAAGAAGGACGCAA	0.592													ENSG00000160299																																					0													59.0	53.0	55.0					21																	47852034		2203	4300	6503	SO:0001583	missense	0			-	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.8656G>C	21.37:g.47852034G>C	ENSP00000352572:p.Glu2886Gln		O43152|Q7Z7C9	Missense_Mutation	SNP	pfam_PACT_domain	p.E2886Q	ENST00000359568.5	37	c.8656	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	13.78	2.339984	0.41398	.	.	ENSG00000160299	ENST00000359568	T	0.01484	4.84	5.15	4.27	0.50696	.	.	.	.	.	T	0.02418	0.0074	N	0.19112	0.55	0.09310	N	1	D	0.56035	0.974	P	0.49140	0.601	T	0.56147	-0.8027	9	0.27785	T	0.31	.	12.9147	0.58199	0.0786:0.0:0.9214:0.0	.	2886	O95613	PCNT_HUMAN	Q	2886	ENSP00000352572:E2886Q	ENSP00000352572:E2886Q	E	+	1	0	PCNT	46676462	0.777000	0.28628	0.002000	0.10522	0.008000	0.06430	2.254000	0.43214	1.316000	0.45131	0.655000	0.94253	GAA	-	PCNT	-	NULL		0.592	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	HGNC	protein_coding	OTTHUMT00000207336.1	0	0	0	20	20	65	0.00	0.00	G	NM_006031		47852034	+1	7	16	14	25	tier1	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	33.33	39.02	SNP	0.022	C	7	14
UBXN10	127733	genome.wustl.edu	37	1	20517707	20517707	+	Missense_Mutation	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:20517707C>A	ENST00000375099.3	+	2	737	c.653C>A	c.(652-654)aCa>aAa	p.T218K		NM_152376.3	NP_689589.1	Q96LJ8	UBX10_HUMAN	UBX domain protein 10	218	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.									endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|skin(2)	14						TTCCGGCCAACAGATGATTTG	0.498													ENSG00000162543																																					0													102.0	98.0	100.0					1																	20517707		2203	4300	6503	SO:0001583	missense	0			-	AK058158	CCDS205.1	1p36.13	2008-07-25	2008-07-25	2008-07-25	ENSG00000162543	ENSG00000162543		"""UBX domain containing"""	26354	protein-coding gene	gene with protein product			"""UBX domain containing 3"""	UBXD3		12477932	Standard	NM_152376		Approved	FLJ25429	uc001bdb.3	Q96LJ8	OTTHUMG00000002708	ENST00000375099.3:c.653C>A	1.37:g.20517707C>A	ENSP00000364240:p.Thr218Lys		Q5R386	Missense_Mutation	SNP	pfam_UBX,smart_UBX,pfscan_UBX	p.T218K	ENST00000375099.3	37	c.653	CCDS205.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.947595	0.73787	.	.	ENSG00000162543	ENST00000375099	.	.	.	5.03	4.1	0.47936	UBX (3);	0.306644	0.26931	N	0.021767	T	0.69584	0.3127	M	0.62723	1.935	0.38663	D	0.952113	D	0.63880	0.993	P	0.61070	0.883	T	0.75671	-0.3237	9	0.72032	D	0.01	-9.4547	13.914	0.63885	0.0:0.8403:0.1596:0.0	.	218	Q96LJ8	UBX10_HUMAN	K	218	.	ENSP00000364240:T218K	T	+	2	0	UBXN10	20390294	0.977000	0.34250	0.722000	0.30670	0.991000	0.79684	4.088000	0.57678	1.306000	0.44926	0.591000	0.81541	ACA	-	UBXN10	-	pfam_UBX,smart_UBX,pfscan_UBX		0.498	UBXN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN10	HGNC	protein_coding	OTTHUMT00000007693.1	0	0	0	45	45	119	0.00	0.00	C	NM_152376		20517707	+1	5	28	35	100	tier1	no_errors	ENST00000375099	ensembl	human	known	74_37	missense	12.50	21.54	SNP	0.962	A	5	35
PARP2	10038	genome.wustl.edu	37	14	20822373	20822373	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr14:20822373G>A	ENST00000250416.5	+	8	796	c.769G>A	c.(769-771)Gaa>Aaa	p.E257K	PARP2_ENST00000429687.3_Missense_Mutation_p.E244K|PARP2_ENST00000527915.1_Missense_Mutation_p.E257K	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	257	PARP alpha-helical. {ECO:0000255|PROSITE- ProRule:PRU00398}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		AATGATGATGGAAATGAAGTA	0.383								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA					ENSG00000129484																																					0													118.0	114.0	116.0					14																	20822373		1878	4094	5972	SO:0001583	missense	0			-	AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.769G>A	14.37:g.20822373G>A	ENSP00000250416:p.Glu257Lys		Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.E257K	ENST00000250416.5	37	c.769	CCDS41910.1	14	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653401	0.88056	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	T;T;T	0.15487	2.42;2.42;2.42	5.29	4.36	0.52297	Poly(ADP-ribose) polymerase, regulatory domain (4);	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	M	0.89214	3.015	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.78314	0.991;0.925;0.955	T	0.47873	-0.9083	10	0.41790	T	0.15	-23.7972	14.3747	0.66865	0.0:0.0:0.8518:0.1482	.	170;244;257	B4DV82;Q9UGN5-2;Q9UGN5	.;.;PARP2_HUMAN	K	244;257;257	ENSP00000392972:E244K;ENSP00000250416:E257K;ENSP00000432283:E257K	ENSP00000250416:E257K	E	+	1	0	PARP2	19892213	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.115000	0.71566	2.752000	0.94435	0.585000	0.79938	GAA	-	PARP2	-	pfam_Poly(ADP-ribose)pol_reg_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,pfscan_Poly(ADP-ribose)pol_reg_dom		0.383	PARP2-002	KNOWN	basic|CCDS	protein_coding	PARP2	HGNC	protein_coding	OTTHUMT00000387847.2	0	0	0	76	76	136	0.00	0.00	G			20822373	+1	19	24	68	114	tier1	no_errors	ENST00000250416	ensembl	human	known	74_37	missense	21.84	17.39	SNP	1.000	A	19	68
SLC22A14	9389	genome.wustl.edu	37	3	38357847	38357847	+	Missense_Mutation	SNP	C	C	T	rs114208565	byFrequency	TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:38357847C>T	ENST00000273173.4	+	9	1656	c.1565C>T	c.(1564-1566)tCg>tTg	p.S522L	SLC22A14_ENST00000448498.1_Missense_Mutation_p.S522L	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	522					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		TCTCTGGCCTCGGTGGCTGGA	0.627													ENSG00000144671	C|||	2	0.000399361	0.0	0.0	5008	,	,		17943	0.0		0.002	False		,,,				2504	0.0																0								C	LEU/SER	0,4406		0,0,2203	102.0	82.0	89.0		1565	-7.2	0.0	3	dbSNP_132	89	2,8598	2.2+/-6.3	0,2,4298	yes	missense	SLC22A14	NM_004803.3	145	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	possibly-damaging	522/595	38357847	2,13004	2203	4300	6503	SO:0001583	missense	0			GMAF=0.0005	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.1565C>T	3.37:g.38357847C>T	ENSP00000273173:p.Ser522Leu		A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S522L	ENST00000273173.4	37	c.1565	CCDS2677.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	3.036	-0.198501	0.06219	0.0	2.33E-4	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.74737	-0.87;-0.87	4.2	-7.15	0.01521	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.717397	0.12855	N	0.433562	T	0.54398	0.1856	L	0.27053	0.805	0.09310	N	1	B	0.24533	0.105	B	0.26969	0.075	T	0.41538	-0.9503	10	0.51188	T	0.08	.	8.3481	0.32286	0.0:0.2372:0.4199:0.343	.	522	Q9Y267	S22AE_HUMAN	L	522;507;522	ENSP00000396283:S522L;ENSP00000273173:S522L	ENSP00000273173:S522L	S	+	2	0	SLC22A14	38332851	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.241000	0.08940	-1.571000	0.01663	-1.114000	0.02060	TCG	rs114208565	SLC22A14	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.627	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	HGNC	protein_coding	OTTHUMT00000253742.3	0	0	0	112	112	35	0.00	0.00	C	NM_004803		38357847	+1	12	12	25	23	tier1	no_errors	ENST00000273173	ensembl	human	known	74_37	missense	32.43	32.43	SNP	0.000	T	12	25
ADAMTS18	170692	genome.wustl.edu	37	16	77356258	77356258	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:77356258T>A	ENST00000282849.5	-	14	2556	c.2138A>T	c.(2137-2139)gAt>gTt	p.D713V		NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	713	Cys-rich.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						AATACAAACATCATTTTTGTT	0.418													ENSG00000140873																																					0													175.0	158.0	164.0					16																	77356258		2198	4300	6498	SO:0001583	missense	0			-	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.2138A>T	16.37:g.77356258T>A	ENSP00000282849:p.Asp713Val		Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D713V	ENST00000282849.5	37	c.2138	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203963	0.79127	.	.	ENSG00000140873	ENST00000282849	T	0.73681	-0.77	5.93	5.93	0.95920	.	0.107652	0.64402	D	0.000010	D	0.89914	0.6853	H	0.94847	3.59	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.76575	0.988;0.944	D	0.92540	0.6041	10	0.87932	D	0	.	15.5755	0.76380	0.0:0.0:0.0:1.0	.	713;713	Q8TE60-2;Q8TE60	.;ATS18_HUMAN	V	713	ENSP00000282849:D713V	ENSP00000282849:D713V	D	-	2	0	ADAMTS18	75913759	1.000000	0.71417	0.776000	0.31678	0.972000	0.66771	4.813000	0.62620	2.281000	0.76405	0.533000	0.62120	GAT	-	ADAMTS18	-	prints_Peptidase_M12B_ADAM-TS		0.418	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	0	0	0	104	104	95	0.00	0.00	T			77356258	-1	39	66	33	49	tier1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	54.17	57.39	SNP	0.993	A	39	33
NOTCH3	4854	genome.wustl.edu	37	19	15281256	15281256	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:15281256C>G	ENST00000263388.2	-	27	5075	c.5000G>C	c.(4999-5001)cGc>cCc	p.R1667P		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	1667					forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CTCGCGCTTGCGCCGGGCCAC	0.672													ENSG00000074181																																					0													38.0	44.0	42.0					19																	15281256		2203	4298	6501	SO:0001583	missense	0			-	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.5000G>C	19.37:g.15281256C>G	ENSP00000263388:p.Arg1667Pro		Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_3,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1667P	ENST00000263388.2	37	c.5000	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992491	0.93167	.	.	ENSG00000074181	ENST00000263388	D	0.89681	-2.55	3.69	3.69	0.42338	.	.	.	.	.	D	0.94785	0.8316	M	0.88241	2.94	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	D	0.95745	0.8787	9	0.87932	D	0	.	14.3463	0.66665	0.0:1.0:0.0:0.0	.	1667	Q9UM47	NOTC3_HUMAN	P	1667	ENSP00000263388:R1667P	ENSP00000263388:R1667P	R	-	2	0	NOTCH3	15142256	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.571000	0.82399	1.906000	0.55180	0.491000	0.48974	CGC	-	NOTCH3	-	pirsf_Notch		0.672	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	0	0	0	47	47	20	0.00	0.00	C	NM_000435		15281256	-1	9	10	22	12	tier1	no_errors	ENST00000263388	ensembl	human	known	74_37	missense	29.03	45.45	SNP	0.998	G	9	22
FN1	2335	genome.wustl.edu	37	2	216243906	216243906	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr2:216243906T>C	ENST00000359671.1	-	33	5561	c.5296A>G	c.(5296-5298)Aaa>Gaa	p.K1766E	FN1_ENST00000336916.4_Missense_Mutation_p.K1766E|FN1_ENST00000346544.3_Missense_Mutation_p.K1766E|FN1_ENST00000357009.2_Missense_Mutation_p.K1766E|FN1_ENST00000421182.1_Missense_Mutation_p.K1676E|FN1_ENST00000345488.5_Missense_Mutation_p.K1766E|FN1_ENST00000357867.4_Missense_Mutation_p.K1676E|FN1_ENST00000446046.1_Missense_Mutation_p.K1766E|FN1_ENST00000490833.1_5'Flank|FN1_ENST00000443816.1_Missense_Mutation_p.K1676E|FN1_ENST00000356005.4_Missense_Mutation_p.K1676E|FN1_ENST00000354785.4_Missense_Mutation_p.K1857E|FN1_ENST00000323926.6_Missense_Mutation_p.K1857E|FN1_ENST00000432072.2_Missense_Mutation_p.K1767E			P02751	FINC_HUMAN	fibronectin 1	1766	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	TTGATTTCTTTCATTGGTCCG	0.507													ENSG00000115414																																					0													148.0	136.0	140.0					2																	216243906		2203	4300	6503	SO:0001583	missense	0			-		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5296A>G	2.37:g.216243906T>C	ENSP00000352696:p.Lys1766Glu		B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.K1857E	ENST00000359671.1	37	c.5569		2	.	.	.	.	.	.	.	.	.	.	T	26.1	4.703358	0.88924	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.78049	2.395	0.30923	N	0.727807	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.974;0.986;1.0;0.995;0.998;0.998;1.0;0.998;0.986;0.986;0.995;0.991	D;D;D;D;D;D;D;D;D;D;D;D	0.83275	0.964;0.972;0.996;0.992;0.989;0.993;0.996;0.993;0.972;0.972;0.989;0.984	T	0.75964	-0.3132	10	0.28530	T	0.3	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	1766;1767;1857;1676;1676;1766;1766;1767;1676;1676;1857;1766	F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	E	1676;1857;1766;1676;1857;1767;1766;1766;1766;1766;1766;1676;1767;1676;483	ENSP00000394423:K1676E;ENSP00000323534:K1857E;ENSP00000338200:K1766E;ENSP00000350534:K1676E;ENSP00000346839:K1857E;ENSP00000352696:K1766E;ENSP00000265312:K1766E;ENSP00000273049:K1766E;ENSP00000349509:K1766E;ENSP00000410422:K1766E;ENSP00000415018:K1676E;ENSP00000399538:K1767E;ENSP00000348285:K1676E;ENSP00000416139:K483E	ENSP00000265313:K1767E	K	-	1	0	FN1	215952151	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.856000	0.62932	2.371000	0.80710	0.533000	0.62120	AAA	-	FN1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.507	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		0	0	0	80	80	54	0.00	0.00	T	NM_212476		216243906	-1	23	30	25	36	tier1	no_errors	ENST00000354785	ensembl	human	known	74_37	missense	47.92	45.45	SNP	1.000	C	23	25
STEAP2	261729	genome.wustl.edu	37	7	89856742	89856742	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	C	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:89856742T>C	ENST00000287908.3	+	3	1343	c.950T>C	c.(949-951)gTt>gCt	p.V317A	STEAP2_ENST00000394629.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394621.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394622.2_Missense_Mutation_p.V317A|STEAP2_ENST00000402625.2_Missense_Mutation_p.V317A|STEAP2_ENST00000394632.1_Missense_Mutation_p.V317A|STEAP2_ENST00000394626.1_Missense_Mutation_p.V317A	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	317	Ferric oxidoreductase.				copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					ATGGTCCATGTTGCCTACAGC	0.418													ENSG00000157214																																					0													73.0	74.0	74.0					7																	89856742		2202	4298	6500	SO:0001583	missense	0			-	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.950T>C	7.37:g.89856742T>C	ENSP00000287908:p.Val317Ala		A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.V317A	ENST00000287908.3	37	c.950	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	T	7.682	0.689303	0.14973	.	.	ENSG00000157214	ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000394621;ENST00000402625;ENST00000394629	D;D;D;D;D;D;D	0.90788	-2.73;-2.73;-2.73;-2.73;-2.73;-2.73;-2.73	6.04	6.04	0.98038	Flavoprotein transmembrane component (1);	0.057921	0.64402	D	0.000002	T	0.81898	0.4920	N	0.02142	-0.665	0.50632	D	0.99988	B;B;B;B	0.30851	0.137;0.297;0.03;0.03	B;B;B;B	0.41646	0.059;0.362;0.03;0.02	T	0.80301	-0.1440	9	.	.	.	-29.9211	16.5885	0.84745	0.0:0.0:0.0:1.0	.	317;317;317;317	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	A	317	ENSP00000287908:V317A;ENSP00000378123:V317A;ENSP00000378120:V317A;ENSP00000378128:V317A;ENSP00000378119:V317A;ENSP00000384191:V317A;ENSP00000378125:V317A	.	V	+	2	0	STEAP2	89694678	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.192000	0.58378	2.317000	0.78254	0.460000	0.39030	GTT	-	STEAP2	-	pfam_Fe3_Rdtase_TM_dom		0.418	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	HGNC	protein_coding	OTTHUMT00000059662.4	0	0	0	87	87	84	0.00	0.00	T	NM_152999		89856742	+1	10	24	56	58	tier1	no_errors	ENST00000287908	ensembl	human	known	74_37	missense	15.15	29.27	SNP	1.000	C	10	56
HDC	3067	genome.wustl.edu	37	15	50534531	50534531	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr15:50534531C>T	ENST00000267845.3	-	12	2317	c.1915G>A	c.(1915-1917)Gtc>Atc	p.V639I	HDC_ENST00000543581.1_Missense_Mutation_p.V606I|RN7SL494P_ENST00000461517.2_RNA	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)		p.V639F(1)		breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		AAGCTGGGGACGCTGTAGAAT	0.507													ENSG00000140287																									GBM(95;1627 1936 6910 9570)												1	Substitution - Missense(1)	lung(1)											81.0	82.0	82.0					15																	50534531		2196	4295	6491	SO:0001583	missense	0			-		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1915G>A	15.37:g.50534531C>T	ENSP00000267845:p.Val639Ile			Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.V639I	ENST00000267845.3	37	c.1915	CCDS10134.1	15	.	.	.	.	.	.	.	.	.	.	C	24.5	4.533889	0.85812	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.17370	2.67;2.28	5.61	5.61	0.85477	.	0.000000	0.51477	D	0.000088	T	0.32466	0.0830	L	0.27053	0.805	0.50171	D	0.999853	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.988	T	0.06661	-1.0814	10	0.87932	D	0	-40.8107	19.6299	0.95698	0.0:1.0:0.0:0.0	.	606;639	B7ZM01;P19113	.;DCHS_HUMAN	I	639;606	ENSP00000267845:V639I;ENSP00000440252:V606I	ENSP00000267845:V639I	V	-	1	0	HDC	48321823	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.949000	0.75971	2.639000	0.89480	0.655000	0.94253	GTC	-	HDC	-	NULL		0.507	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDC	HGNC	protein_coding	OTTHUMT00000254540.1	0	0	0	117	117	84	0.00	0.00	C			50534531	-1	5	8	38	64	tier1	no_errors	ENST00000267845	ensembl	human	known	74_37	missense	11.63	11.11	SNP	1.000	T	5	38
KIAA1211	57482	genome.wustl.edu	37	4	57193907	57193907	+	Silent	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr4:57193907C>A	ENST00000504228.1	+	9	3744	c.3639C>A	c.(3637-3639)gcC>gcA	p.A1213A	KIAA1211_ENST00000264229.6_Silent_p.A1213A|KIAA1211_ENST00000541073.1_Silent_p.A1206A			Q6ZU35	K1211_HUMAN	KIAA1211	1213										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAGAACCAGCCTGGCTGGCTT	0.547													ENSG00000109265																																					0													101.0	106.0	105.0					4																	57193907		1868	4088	5956	SO:0001819	synonymous_variant	0			-	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3639C>A	4.37:g.57193907C>A			Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NULL	p.A1213	ENST00000504228.1	37	c.3639	CCDS43230.1	4																																																																																			-	KIAA1211	-	NULL		0.547	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	1	1	0	127	127	68	0.78	0.00	C	NM_020722		57193907	+1	30	21	70	61	tier1	no_errors	ENST00000504228	ensembl	human	known	74_37	silent	30.00	25.61	SNP	1.000	A	30	70
MFSD2A	84879	genome.wustl.edu	37	1	40430569	40430569	+	Intron	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:40430569C>T	ENST00000372809.5	+	4	535				MFSD2A_ENST00000420632.2_Intron|MFSD2A_ENST00000372811.5_Intron|MFSD2A_ENST00000480630.1_3'UTR	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A						establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						CTTGCCCAGGCACCTGAGGTC	0.562													ENSG00000168389																																					0																																										SO:0001627	intron_variant	0			-	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.393-314C>T	1.37:g.40430569C>T			A8K675|Q6UWU5|Q96F59|Q9BRC8	R	SNP	-	NULL	ENST00000372809.5	37	NULL	CCDS44118.1	1																																																																																			-	MFSD2A	-	-		0.562	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	MFSD2A	HGNC	protein_coding	OTTHUMT00000025756.1	0	0	0	67	67	59	0.00	0.00	C	NM_032793		40430569	+1	20	28	13	16	tier1	no_errors	ENST00000480630	ensembl	human	known	74_37	rna	60.61	63.64	SNP	0.001	T	20	13
PIP4K2A	5305	genome.wustl.edu	37	10	22825871	22825871	+	3'UTR	SNP	C	C	T	rs561315773		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:22825871C>T	ENST00000376573.4	-	0	1708				PIP4K2A_ENST00000323883.7_3'UTR	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha						megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						AAAATGcacacgcgcgcacac	0.438													ENSG00000150867	C|||	1	0.000199681	0.0	0.0	5008	,	,		15482	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0			-	S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.*259G>A	10.37:g.22825871C>T			B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	R	SNP	-	NULL	ENST00000376573.4	37	NULL	CCDS7141.1	10																																																																																			-	PIP4K2A	-	-		0.438	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2A	HGNC	protein_coding	OTTHUMT00000047193.1	0	0	0	25	25	55	0.00	0.00	C	NM_005028		22825871	-1	11	39	1	15	tier1	no_errors	ENST00000474335	ensembl	human	known	74_37	rna	91.67	72.22	SNP	0.750	T	11	1
MTMR7	9108	genome.wustl.edu	37	8	17230662	17230662	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr8:17230662C>T	ENST00000180173.5	-	2	146	c.112G>A	c.(112-114)Gtg>Atg	p.V38M	MTMR7_ENST00000521857.1_Missense_Mutation_p.V38M	NM_004686.4	NP_004677.3	Q9Y216	MTMR7_HUMAN	myotubularin related protein 7	38					inositol phosphate dephosphorylation (GO:0046855)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(8)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	32				Colorectal(111;0.112)		GAATTTTCCACGAATATGACA	0.403													ENSG00000003987																																					0													86.0	80.0	82.0					8																	17230662		2203	4300	6503	SO:0001583	missense	0			-	AF073482	CCDS34851.1	8p22	2011-06-09			ENSG00000003987	ENSG00000003987		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7454	protein-coding gene	gene with protein product		603562				9736772, 12890864	Standard	NM_004686		Approved		uc003wxm.3	Q9Y216	OTTHUMG00000163771	ENST00000180173.5:c.112G>A	8.37:g.17230662C>T	ENSP00000180173:p.Val38Met		A1L4K9|B4DG87|Q68DX4	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase	p.V38M	ENST00000180173.5	37	c.112	CCDS34851.1	8	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677262	0.88445	.	.	ENSG00000003987	ENST00000180173;ENST00000521857	D;D	0.83250	-1.7;-1.7	5.46	5.46	0.80206	.	0.057935	0.64402	D	0.000002	D	0.86456	0.5937	M	0.84948	2.725	0.80722	D	1	P	0.48407	0.91	B	0.42916	0.402	D	0.87083	0.2167	10	0.39692	T	0.17	.	19.6884	0.95987	0.0:1.0:0.0:0.0	.	38	Q9Y216	MTMR7_HUMAN	M	38	ENSP00000180173:V38M;ENSP00000429733:V38M	ENSP00000180173:V38M	V	-	1	0	MTMR7	17275033	1.000000	0.71417	0.999000	0.59377	0.679000	0.39708	7.159000	0.77483	2.739000	0.93911	0.563000	0.77884	GTG	-	MTMR7	-	NULL		0.403	MTMR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR7	HGNC	protein_coding	OTTHUMT00000375311.1	0	0	0	106	106	84	0.00	0.00	C	NM_004686		17230662	-1	20	24	77	66	tier1	no_errors	ENST00000180173	ensembl	human	known	74_37	missense	20.41	26.67	SNP	1.000	T	20	77
EPHB6	2051	genome.wustl.edu	37	7	142563919	142563919	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr7:142563919G>A	ENST00000392957.2	+	9	2094	c.1307G>A	c.(1306-1308)cGc>cAc	p.R436H	EPHB6_ENST00000442129.1_Missense_Mutation_p.R436H|EPHB6_ENST00000411471.2_Missense_Mutation_p.R159H	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	436	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					TTCGACCCTCGCCAGAGAGGC	0.607													ENSG00000106123																																					0													45.0	40.0	42.0					7																	142563919		2203	4300	6503	SO:0001583	missense	0			-	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1307G>A	7.37:g.142563919G>A	ENSP00000376684:p.Arg436His		A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.R436H	ENST00000392957.2	37	c.1307	CCDS5873.2	7	.	.	.	.	.	.	.	.	.	.	G	35	5.538864	0.96474	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.58060	0.36;0.36;0.36	5.48	5.48	0.80851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.48286	D	0.000190	T	0.72771	0.3502	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.75196	-0.3403	10	0.72032	D	0.01	.	18.344	0.90315	0.0:0.0:1.0:0.0	.	436	O15197	EPHB6_HUMAN	H	436;436;159	ENSP00000376684:R436H;ENSP00000410789:R436H;ENSP00000409061:R159H	ENSP00000376684:R436H	R	+	2	0	EPHB6	142274041	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.808000	0.99193	2.560000	0.86352	0.561000	0.74099	CGC	-	EPHB6	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.607	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	HGNC	protein_coding	OTTHUMT00000341329.1	0	0	0	87	87	25	0.00	0.00	G			142563919	+1	16	4	27	21	tier1	no_errors	ENST00000392957	ensembl	human	known	74_37	missense	37.21	16.00	SNP	1.000	A	16	27
CACNA1D	776	genome.wustl.edu	37	3	53785793	53785793	+	Silent	SNP	C	C	T	rs148248303		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr3:53785793C>T	ENST00000350061.5	+	28	4045	c.3534C>T	c.(3532-3534)taC>taT	p.Y1178Y	CACNA1D_ENST00000288139.4_Silent_p.Y1198Y|CACNA1D_ENST00000422281.2_Silent_p.Y1178Y|CACNA1D_ENST00000540742.1_Silent_p.Y85Y	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1178					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GTGTTGAATACGCCTTGAAAG	0.517													ENSG00000157388																																					0								C	,,	1,4405	2.1+/-5.4	0,1,2202	189.0	167.0	174.0		3594,3534,3534	0.3	1.0	3	dbSNP_134	174	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous	CACNA1D	NM_000720.2,NM_001128839.1,NM_001128840.1	,,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,,	1198/2182,1178/2138,1178/2162	53785793	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			-	AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3534C>T	3.37:g.53785793C>T			B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.Y1198	ENST00000350061.5	37	c.3594	CCDS46848.1	3																																																																																			rs148248303	CAC1D	-	NULL		0.517	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CAC1D	HGNC	protein_coding	OTTHUMT00000350557.1	0	0	0	80	80	95	0.00	0.00	C	NM_000720		53785793	+1	14	13	36	73	tier1	no_errors	ENST00000288139	ensembl	human	known	74_37	silent	28.00	15.12	SNP	1.000	T	14	36
MROH7	374977	genome.wustl.edu	37	1	55139736	55139736	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:55139736C>G	ENST00000421030.2	+	10	2133	c.1848C>G	c.(1846-1848)atC>atG	p.I616M	MROH7-TTC4_ENST00000414150.2_Missense_Mutation_p.I616M|MROH7_ENST00000339553.5_Missense_Mutation_p.I616M|MROH7_ENST00000454855.2_Missense_Mutation_p.I134M|MROH7_ENST00000409996.1_Missense_Mutation_p.I184M|MROH7_ENST00000545244.1_Missense_Mutation_p.I184M|MROH7_ENST00000395690.2_Missense_Mutation_p.I616M	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	616						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GGAGACTCATCCTTCACATTG	0.493													ENSG00000271723																																					0													127.0	134.0	131.0					1																	55139736		1924	4151	6075	SO:0001583	missense	0			-	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.1848C>G	1.37:g.55139736C>G	ENSP00000396622:p.Ile616Met		A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.I616M	ENST00000421030.2	37	c.1848	CCDS41342.2	1	.	.	.	.	.	.	.	.	.	.	C	14.95	2.686974	0.48097	.	.	ENSG00000184313	ENST00000421030;ENST00000545244;ENST00000414867;ENST00000339553;ENST00000409996;ENST00000454855;ENST00000395690	T;T;T;T;T;T	0.05447	3.44;3.44;3.44;3.44;3.44;3.44	4.65	1.79	0.24919	.	0.132353	0.33309	N	0.005046	T	0.08358	0.0208	L	0.54323	1.7	0.24354	N	0.994907	P;P;P	0.44380	0.815;0.834;0.834	B;P;B	0.46208	0.41;0.507;0.118	T	0.12760	-1.0535	10	0.56958	D	0.05	-9.9636	4.6333	0.12513	0.0:0.5167:0.0:0.4833	.	616;616;184	F8W8P2;Q68CQ1;F5H7R4	.;HEAT8_HUMAN;.	M	616;184;645;616;184;134;616	ENSP00000396622:I616M;ENSP00000442333:I184M;ENSP00000343211:I616M;ENSP00000387048:I184M;ENSP00000401130:I134M;ENSP00000379044:I616M	ENSP00000343211:I616M	I	+	3	3	HEATR8	54912324	0.987000	0.35691	0.995000	0.50966	0.980000	0.70556	0.051000	0.14141	0.629000	0.30376	0.558000	0.71614	ATC	-	MROH7-TTC4	-	superfamily_ARM-type_fold		0.493	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH7-TTC4	HGNC	protein_coding	OTTHUMT00000346978.1	0	0	1	98	98	60	0.00	1.64	C	NM_198547		55139736	+1	8	20	27	34	tier1	no_errors	ENST00000414150	ensembl	human	known	74_37	missense	22.86	37.04	SNP	0.993	G	8	27
LRRK2	120892	genome.wustl.edu	37	12	40714914	40714914	+	Frame_Shift_Del	DEL	T	T	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	-	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:40714914delT	ENST00000298910.7	+	35	5152	c.5094delT	c.(5092-5094)cctfs	p.P1698fs		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1698					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATGAAATGCCTTATTTTCCAA	0.378													ENSG00000188906																																					0													168.0	162.0	164.0					12																	40714914		2203	4300	6503	SO:0001589	frameshift_variant	0				AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5094delT	12.37:g.40714914delT	ENSP00000298910:p.Pro1698fs		A6NJU2|Q6ZS50|Q8NCX9	Frame_Shift_Del	DEL	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.Y1699fs	ENST00000298910.7	37	c.5094	CCDS31774.1	12																																																																																				LRRK2	-	NULL		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	0	0	0	113	113	65	0.00	0.00	T	XM_058513		40714914	+1	32	31	33	28	tier1	no_errors	ENST00000298910	ensembl	human	known	74_37	frame_shift_del	49.23	52.54	DEL	0.822	-	32	33
LRRK2	120892	genome.wustl.edu	37	12	40714915	40714915	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:40714915T>A	ENST00000298910.7	+	35	5153	c.5095T>A	c.(5095-5097)Tat>Aat	p.Y1699N		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1699			Y -> C (in PARK8; shows no progressive reduction in neurite length and branching; dbSNP:rs35801418). {ECO:0000269|PubMed:15541308, ECO:0000269|PubMed:15541309, ECO:0000269|PubMed:16172858, ECO:0000269|PubMed:16272164}.		activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TGAAATGCCTTATTTTCCAAT	0.373													ENSG00000188906																																					0													166.0	160.0	162.0					12																	40714915		2203	4300	6503	SO:0001583	missense	0			-	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.5095T>A	12.37:g.40714915T>A	ENSP00000298910:p.Tyr1699Asn		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.Y1699N	ENST00000298910.7	37	c.5095	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	25.8	4.673183	0.88445	.	.	ENSG00000188906	ENST00000298910	T	0.76968	-1.06	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.87470	0.6185	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.983	D	0.88617	0.3160	10	0.72032	D	0.01	.	16.1562	0.81670	0.0:0.0:0.0:1.0	.	1699;1699	Q17RV3;Q5S007	.;LRRK2_HUMAN	N	1699	ENSP00000298910:Y1699N	ENSP00000298910:Y1699N	Y	+	1	0	LRRK2	39001182	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.431000	0.80335	2.210000	0.71456	0.533000	0.62120	TAT	-	LRRK2	-	NULL		0.373	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	0	0	0	114	114	65	0.00	0.00	T	XM_058513		40714915	+1	35	34	30	25	tier1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	53.85	57.63	SNP	1.000	A	35	30
ANAPC2	29882	genome.wustl.edu	37	9	140080911	140080912	+	Intron	DEL	CA	CA	-	rs148147354|rs372896343		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	CA	CA	CA	-	CA	CA	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr9:140080911_140080912delCA	ENST00000323927.2	-	3	745				SSNA1_ENST00000322310.5_5'Flank	NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		GTGCATGCAGcacacacacaca	0.624													ENSG00000176248																																					0																																										SO:0001627	intron_variant	0				AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.741-103TG>-	9.37:g.140080921_140080922delCA			Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	R	DEL	-	NULL	ENST00000323927.2	37	NULL	CCDS7033.1	9																																																																																				APC2	-	-		0.624	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000055315.1	0	0	0	28	28	31	0.00	0.00	CA	NM_013366		140080912	-1	2	2	7	18	tier1	no_errors	ENST00000495611	ensembl	human	known	74_37	rna	22.22	10.00	DEL	0.000:0.000	-	2	7
ANKLE2	23141	genome.wustl.edu	37	12	133313590	133313590	+	Silent	SNP	C	C	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	A	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr12:133313590C>A	ENST00000357997.5	-	8	1571	c.1482G>T	c.(1480-1482)ctG>ctT	p.L494L	ANKLE2_ENST00000337516.5_Silent_p.L494L|ANKLE2_ENST00000539605.1_Silent_p.L432L|ANKLE2_ENST00000542374.1_5'Flank	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	494					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)			NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CTGGGGACCACAGCTCCCCGA	0.652													ENSG00000176915																																					0													56.0	66.0	63.0					12																	133313590		1964	4153	6117	SO:0001819	synonymous_variant	0			-	AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.1482G>T	12.37:g.133313590C>A			A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Silent	SNP	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM_dom	p.L494	ENST00000357997.5	37	c.1482	CCDS41869.1	12																																																																																			-	ANKLE2	-	NULL		0.652	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	0	0	0	43	43	25	0.00	0.00	C			133313590	-1	14	16	12	7	tier1	no_errors	ENST00000357997	ensembl	human	known	74_37	silent	53.85	69.57	SNP	0.999	A	14	12
ANXA8L1	728113	genome.wustl.edu	37	10	47754779	47754779	+	Missense_Mutation	SNP	G	G	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr10:47754779G>A	ENST00000374277.5	+	5	508	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	AL603965.1_ENST00000335083.5_Intron|ANXA8L2_ENST00000340243.6_Intron|ANXA8L2_ENST00000538825.1_Missense_Mutation_p.R67Q|ANXA8L2_ENST00000449464.2_Missense_Mutation_p.R129Q	NM_001630.2	NP_001621.2														endometrium(1)|pancreas(1)	2						AACCAGCTGCGGGAGATAATG	0.567													ENSG00000186807																																					0													6.0	6.0	6.0					10																	47754779		1932	4036	5968	SO:0001583	missense	0			-																												ENST00000374277.5:c.386G>A	10.37:g.47754779G>A	ENSP00000363395:p.Arg129Gln			Missense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVIII,prints_AnnexinIII	p.R129Q	ENST00000374277.5	37	c.386	CCDS7216.1	10	.	.	.	.	.	.	.	.	.	.	.	6.665	0.491230	0.12702	.	.	ENSG00000186807	ENST00000374277;ENST00000449464;ENST00000538825	T;T;T	0.03124	4.04;4.04;4.04	2.12	-1.4	0.08968	Annexin repeat, conserved site (1);	1.266630	0.05483	N	0.555198	T	0.02767	0.0083	N	0.13299	0.325	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.47736	-0.9094	10	0.39692	T	0.17	.	7.4882	0.27445	0.3637:0.0:0.6363:0.0	.	129	Q5VT79	AXA82_HUMAN	Q	129;129;67	ENSP00000363395:R129Q;ENSP00000407079:R129Q;ENSP00000440742:R67Q	ENSP00000363395:R129Q	R	+	2	0	ANXA8L2	47224785	0.000000	0.05858	0.683000	0.30040	0.553000	0.35397	-0.650000	0.05378	-0.760000	0.04677	-0.974000	0.02594	CGG	-	ANXA8L2	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinIII		0.567	ANXA8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA8L2	HGNC	protein_coding	OTTHUMT00000047866.1	0	0	0	82	82	16	0.00	0.00	G			47754779	+1	11	4	8	4	tier1	no_errors	ENST00000374277	ensembl	human	known	74_37	missense	57.89	50.00	SNP	0.524	A	11	8
SYCP2	10388	genome.wustl.edu	37	20	58476847	58476847	+	Missense_Mutation	SNP	A	A	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A	A	G	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:58476847A>G	ENST00000357552.3	-	16	1277	c.1052T>C	c.(1051-1053)cTa>cCa	p.L351P	SYCP2_ENST00000371001.2_Missense_Mutation_p.L351P			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	351					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TATTGTCAGTAGCTTCTTTGA	0.308													ENSG00000196074																																					0													67.0	65.0	66.0					20																	58476847		2199	4281	6480	SO:0001583	missense	0			-	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1052T>C	20.37:g.58476847A>G	ENSP00000350162:p.Leu351Pro		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.L351P	ENST00000357552.3	37	c.1052	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471882	0.63737	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.22336	2.2;2.2;1.96	5.78	5.78	0.91487	.	0.121018	0.37393	N	0.002118	T	0.44117	0.1278	M	0.65975	2.015	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.71870	0.944;0.975	T	0.39396	-0.9616	10	0.87932	D	0	-2.9631	13.6269	0.62170	1.0:0.0:0.0:0.0	.	351;351	A2A341;Q9BX26	.;SYCP2_HUMAN	P	351	ENSP00000360040:L351P;ENSP00000350162:L351P;ENSP00000402456:L351P	ENSP00000350162:L351P	L	-	2	0	SYCP2	57910242	1.000000	0.71417	0.942000	0.38095	0.816000	0.46133	6.124000	0.71620	2.191000	0.70037	0.528000	0.53228	CTA	-	SYCP2	-	NULL		0.308	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	0	0	0	86	86	46	0.00	0.00	A	NM_014258		58476847	-1	27	30	4	6	tier1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	87.10	81.08	SNP	0.996	G	27	4
SYCP2	10388	genome.wustl.edu	37	20	58496452	58496452	+	Missense_Mutation	SNP	T	T	A			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T	T	A	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:58496452T>A	ENST00000357552.3	-	4	306	c.81A>T	c.(79-81)aaA>aaT	p.K27N	SYCP2_ENST00000476314.1_5'UTR|SYCP2_ENST00000371001.2_Missense_Mutation_p.K27N			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	27					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GCAAAAGTGTTTTCAAAGGTT	0.303													ENSG00000196074																																					0													52.0	49.0	50.0					20																	58496452		2198	4291	6489	SO:0001583	missense	0			-	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.81A>T	20.37:g.58496452T>A	ENSP00000350162:p.Lys27Asn		A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	NULL	p.K27N	ENST00000357552.3	37	c.81	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	T	11.34	1.608603	0.28623	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834;ENST00000425931	T;T;T;T	0.46451	2.45;2.45;2.19;0.87	5.04	2.7	0.31948	.	0.685143	0.14295	N	0.328675	T	0.33469	0.0864	L	0.47716	1.5	0.09310	N	1	P	0.36909	0.573	B	0.36186	0.219	T	0.12372	-1.0550	10	0.40728	T	0.16	-1.0514	7.2584	0.26189	0.0:0.0778:0.1462:0.776	.	27	Q9BX26	SYCP2_HUMAN	N	27;27;27;26	ENSP00000360040:K27N;ENSP00000350162:K27N;ENSP00000402456:K27N;ENSP00000399300:K26N	ENSP00000350162:K27N	K	-	3	2	SYCP2	57929847	0.399000	0.25287	0.204000	0.23530	0.738000	0.42128	0.872000	0.28037	0.335000	0.23614	0.383000	0.25322	AAA	-	SYCP2	-	NULL		0.303	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	0	0	0	75	75	67	0.00	0.00	T	NM_014258		58496452	-1	51	58	12	7	tier1	no_errors	ENST00000357552	ensembl	human	known	74_37	missense	79.69	89.23	SNP	0.064	A	51	12
ZSWIM5	57643	genome.wustl.edu	37	1	45671800	45671800	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:45671800C>T	ENST00000359600.5	-	1	428	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	ZSWIM5_ENST00000464588.1_Intron	NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	75						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCCCACTTTTCCGCCACCGTC	0.701													ENSG00000162415																																					0													14.0	16.0	15.0					1																	45671800		1925	4110	6035	SO:0001583	missense	0			-	AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.223G>A	1.37:g.45671800C>T	ENSP00000352614:p.Glu75Lys		Q5SXQ9	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.E75K	ENST00000359600.5	37	c.223	CCDS41319.1	1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662097	0.67700	.	.	ENSG00000162415	ENST00000359600	T	0.33654	1.4	2.68	1.72	0.24424	.	0.000000	0.64402	U	0.000004	T	0.26738	0.0654	L	0.45352	1.415	0.45250	D	0.998258	B	0.26445	0.149	B	0.25405	0.06	T	0.05178	-1.0901	10	0.25751	T	0.34	-3.5717	9.4427	0.38679	0.0:0.8809:0.0:0.1191	.	75	Q9P217	ZSWM5_HUMAN	K	75	ENSP00000352614:E75K	ENSP00000352614:E75K	E	-	1	0	ZSWIM5	45444387	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.583000	0.60964	0.426000	0.26116	0.442000	0.29010	GAA	-	ZSWIM5	-	NULL		0.701	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	HGNC	protein_coding	OTTHUMT00000024823.2	0	0	0	59	59	13	0.00	0.00	C	XM_046581		45671800	-1	19	4	32	6	tier1	no_errors	ENST00000359600	ensembl	human	known	74_37	missense	37.25	40.00	SNP	1.000	T	19	32
MYH11	4629	genome.wustl.edu	37	16	15850274	15850274	+	Missense_Mutation	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:15850274C>T	ENST00000300036.5	-	14	1782	c.1673G>A	c.(1672-1674)gGc>gAc	p.G558D	MYH11_ENST00000396324.3_Missense_Mutation_p.G565D|MYH11_ENST00000452625.2_Missense_Mutation_p.G565D|MYH11_ENST00000576790.2_Missense_Mutation_p.G558D	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	558	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)	p.G558D(1)|p.Q557_S559delQGS(1)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GGGGTGGCTGCCCTGCTCCGT	0.587			T	CBFB	AML						OREG0023636	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	ENSG00000133392																												Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	2	Substitution - Missense(1)|Deletion - In frame(1)	prostate(2)											123.0	97.0	106.0					16																	15850274		2197	4300	6497	SO:0001583	missense	0			-	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.1673G>A	16.37:g.15850274C>T	ENSP00000300036:p.Gly558Asp	705	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SRE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.G565D	ENST00000300036.5	37	c.1694	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	C	22.3	4.272246	0.80580	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23	5.37	4.35	0.52113	Myosin head, motor domain (2);	0.286130	0.32655	N	0.005818	D	0.91503	0.7317	L	0.59436	1.845	0.80722	D	1	P;P;P;B;D;B	0.57899	0.892;0.756;0.756;0.348;0.981;0.348	P;P;P;P;D;D	0.74023	0.758;0.768;0.768;0.768;0.947;0.982	D	0.92193	0.5761	10	0.87932	D	0	.	14.6177	0.68560	0.0:0.8537:0.1463:0.0	.	565;558;558;565;558;565	B1PS43;D2JYH7;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;.;MYH11_HUMAN;.;.;.	D	558;558;565;565;565	ENSP00000300036:G558D;ENSP00000345136:G558D;ENSP00000379616:G565D;ENSP00000407821:G565D	ENSP00000300036:G558D	G	-	2	0	MYH11	15757775	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.754000	0.62191	2.518000	0.84900	0.555000	0.69702	GGC	-	MYH11	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.587	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	0	0	0	141	141	59	0.00	0.00	C	NM_001040113		15850274	-1	10	8	72	73	tier1	no_errors	ENST00000396324	ensembl	human	known	74_37	missense	12.05	9.88	SNP	1.000	T	10	72
CFDP1	10428	genome.wustl.edu	37	16	75327731	75327732	+	3'UTR	INS	-	-	A	rs149574560		TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	-	-	-	A	-	-	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr16:75327731_75327732insA	ENST00000283882.3	-	0	1150_1151					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CTTCAATGTAGAAAAAAAAAAG	0.307													ENSG00000153774																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*119->T	16.37:g.75327741_75327741dupA			O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	R	INS	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																				CFDP1	-	-		0.307	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	HGNC	protein_coding	OTTHUMT00000269031.2	0	0	1	48	48	98	0.00	1.01	-	NM_006324		75327732	-1	6	6	61	114	tier1	no_errors	ENST00000570103	ensembl	human	known	74_37	rna	8.96	5.00	INS	0.904:0.940	A	6	61
GPR25	2848	genome.wustl.edu	37	1	200842925	200842925	+	Missense_Mutation	SNP	G	G	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr1:200842925G>T	ENST00000304244.2	+	1	843	c.760G>T	c.(760-762)Gtg>Ttg	p.V254L		NM_005298.2	NP_005289.2	O00155	GPR25_HUMAN	G protein-coupled receptor 25	254					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(1)|lung(2)|ovary(1)|skin(1)	5						GAGCACGTTTGTGGGCTCCTG	0.731													ENSG00000170128																																					0													27.0	30.0	29.0					1																	200842925		2202	4297	6499	SO:0001583	missense	0			-	U91939	CCDS1405.1	1q32.1	2012-08-21			ENSG00000170128	ENSG00000170128		"""GPCR / Class A : Orphans"""	4480	protein-coding gene	gene with protein product		602174				9020062	Standard	NM_005298		Approved		uc001gvn.2	O00155	OTTHUMG00000035788	ENST00000304244.2:c.760G>T	1.37:g.200842925G>T	ENSP00000301917:p.Val254Leu		A0AVJ5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V254L	ENST00000304244.2	37	c.760	CCDS1405.1	1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947945	0.34377	.	.	ENSG00000170128	ENST00000304244	T	0.73152	-0.72	4.66	2.37	0.29283	GPCR, rhodopsin-like superfamily (1);	0.000000	0.30101	U	0.010409	T	0.49355	0.1552	N	0.17764	0.52	0.29651	N	0.843993	B	0.25048	0.117	B	0.32393	0.145	T	0.43669	-0.9377	10	0.02654	T	1	-15.2964	8.6926	0.34275	0.2933:0.0:0.7067:0.0	.	254	O00155	GPR25_HUMAN	L	254	ENSP00000301917:V254L	ENSP00000301917:V254L	V	+	1	0	GPR25	199109548	0.018000	0.18449	1.000000	0.80357	0.919000	0.55068	0.758000	0.26447	0.949000	0.37715	0.462000	0.41574	GTG	-	GPR25	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.731	GPR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR25	HGNC	protein_coding	OTTHUMT00000087056.1	0	0	0	117	117	13	0.00	0.00	G	NM_005298		200842925	+1	4	0	39	5	tier1	no_errors	ENST00000304244	ensembl	human	known	74_37	missense	9.30	0.00	SNP	0.998	T	4	39
LAMA5	3911	genome.wustl.edu	37	20	60905970	60905970	+	Frame_Shift_Del	DEL	C	C	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:60905970delC	ENST00000252999.3	-	30	3747	c.3681delG	c.(3679-3681)aagfs	p.K1227fs	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1227	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTGGGGCGGCTTTGGGAAGC	0.726													ENSG00000130702																																					0													15.0	20.0	18.0					20																	60905970		2092	4099	6191	SO:0001589	frameshift_variant	0				AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3681delG	20.37:g.60905970delC	ENSP00000252999:p.Lys1227fs		Q8TDF8|Q8WZA7|Q9H1P1	Frame_Shift_Del	DEL	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.K1227fs	ENST00000252999.3	37	c.3681	CCDS33502.1	20																																																																																				LAMA5	-	NULL		0.726	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	0	0	0	79	79	6	0.00	0.00	C	NM_005560		60905970	-1	2	0	16	3	tier1	no_errors	ENST00000252999	ensembl	human	known	74_37	frame_shift_del	11.11	0.00	DEL	1.000	-	2	16
SLC35A4	113829	genome.wustl.edu	37	5	139947189	139947191	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:139947189_139947191delGCT	ENST00000514199.1	+	2	2121_2123	c.435_437delGCT	c.(433-438)gcgctg>gcg	p.L149del	APBB3_ENST00000357560.4_5'Flank|APBB3_ENST00000507279.1_Intron|SLC35A4_ENST00000323146.3_In_Frame_Del_p.L149del			Q96G79	S35A4_HUMAN	solute carrier family 35, member A4	149	Leu-rich.					Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGGGTTAGCGCTGCTGCTGCTG	0.635													ENSG00000176087																																					0																																										SO:0001651	inframe_deletion	0				AJ420598	CCDS4231.1	5q31.3	2013-05-22			ENSG00000176087	ENSG00000176087		"""Solute carriers"""	20753	protein-coding gene	gene with protein product							Standard	NM_080670		Approved		uc003lgg.1	Q96G79	OTTHUMG00000129495	ENST00000514199.1:c.435_437delGCT	5.37:g.139947198_139947200delGCT	ENSP00000424566:p.Leu149del		A8K013	In_Frame_Del	DEL	pfam_Nuc_sug_transpt,pfam_DMT,pirsf_UDP/CMP-sugar_transptr	p.L149in_frame_del	ENST00000514199.1	37	c.435_437	CCDS4231.1	5																																																																																				SLC35A4	-	pfam_Nuc_sug_transpt,pfam_DMT,pirsf_UDP/CMP-sugar_transptr		0.635	SLC35A4-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35A4	HGNC	protein_coding	OTTHUMT00000372815.1	0	0	0	47	47	13	0.00	0.00	GCT	NM_080670		139947191	+1	2	0	7	3	tier1	no_errors	ENST00000323146	ensembl	human	known	74_37	in_frame_del	22.22	0.00	DEL	0.375:0.638:0.998	-	2	7
UCKL1	54963	genome.wustl.edu	37	20	62587648	62587648	+	Silent	SNP	C	C	T			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr20:62587648C>T	ENST00000354216.6	-	1	120	c.78G>A	c.(76-78)cgG>cgA	p.R26R	UCKL1_ENST00000369892.3_Silent_p.R26R|UCKL1_ENST00000358711.3_Silent_p.R26R	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	26					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCTCAGCCTGCCGGCCTGGTG	0.726													ENSG00000198276																																					0													23.0	23.0	23.0					20																	62587648		2193	4284	6477	SO:0001819	synonymous_variant	0			-	AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.78G>A	20.37:g.62587648C>T			B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Silent	SNP	pfam_PRK/URK,pfam_CPT,superfamily_P-loop_NTPase,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.R26	ENST00000354216.6	37	c.78	CCDS13547.1	20																																																																																			-	UCKL1	-	NULL		0.726	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	HGNC	protein_coding	OTTHUMT00000080236.1	0	0	0	104	104	13	0.00	0.00	C	NM_017859		62587648	-1	4	0	34	5	tier1	no_errors	ENST00000354216	ensembl	human	known	74_37	silent	10.53	0.00	SNP	0.005	T	4	34
FAM230A	653203	genome.wustl.edu	37	22	20709420	20709420	+	Missense_Mutation	SNP	C	C	G			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr22:20709420C>G	ENST00000434783.3	+	8	1336	c.1152C>G	c.(1150-1152)aaC>aaG	p.N384K	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		GCATCGCTAACGAGGACGCCG	0.706													ENSG00000188280																																					0																																										SO:0001583	missense	0			-	JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.1152C>G	22.37:g.20709420C>G	ENSP00000463576:p.Asn384Lys			Missense_Mutation	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.N384K	ENST00000434783.3	37	c.1152		22																																																																																			-	FAM230A	-	superfamily_Kinase-like_dom		0.706	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	1	1	0	111	111	1	0.89	0.00	C			20709420	+1	7	0	79	0	tier1	no_errors	ENST00000434783	ensembl	human	known	74_37	missense	8.14	0.00	SNP	0.000	G	7	79
KDM4B	23030	genome.wustl.edu	37	19	5077423	5077423	+	Missense_Mutation	SNP	A	A	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr19:5077423A>C	ENST00000159111.4	+	8	940	c.722A>C	c.(721-723)cAt>cCt	p.H241P	KDM4B_ENST00000536461.1_Missense_Mutation_p.H241P|KDM4B_ENST00000592175.1_3'UTR|KDM4B_ENST00000381759.4_Missense_Mutation_p.H241P	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	241	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TTCCTGCGGCATAAGATGACC	0.652													ENSG00000127663																																					0													135.0	137.0	137.0					19																	5077423		2203	4300	6503	SO:0001583	missense	0			-	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.722A>C	19.37:g.5077423A>C	ENSP00000159111:p.His241Pro		B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.H241P	ENST00000159111.4	37	c.722	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	A	23.9	4.475045	0.84640	.	.	ENSG00000127663	ENST00000159111;ENST00000381759;ENST00000536461	T;T;T	0.70986	-0.53;-0.53;-0.53	4.52	4.52	0.55395	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.89245	0.6660	H	0.97340	3.985	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.92759	0.6222	10	0.87932	D	0	-45.6696	13.8579	0.63540	1.0:0.0:0.0:0.0	.	241;241;241	F5GX28;O94953-2;O94953	.;.;KDM4B_HUMAN	P	241	ENSP00000159111:H241P;ENSP00000371178:H241P;ENSP00000440495:H241P	ENSP00000159111:H241P	H	+	2	0	KDM4B	5028423	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.172000	0.94808	1.679000	0.50963	0.379000	0.24179	CAT	-	KDM4B	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom		0.652	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	0	0	0	116	116	36	0.00	0.00	A	NM_015015		5077423	+1	14	2	116	49	tier1	no_errors	ENST00000159111	ensembl	human	known	74_37	missense	10.77	3.92	SNP	1.000	C	14	116
SLC25A2	83884	genome.wustl.edu	37	5	140683011	140683011	+	Missense_Mutation	SNP	T	T	C			TCGA-X9-A971-01A-11D-A387-09	TCGA-X9-A971-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	40187452-3e55-49e2-a541-e272da5ea58f	fc27b823-1add-40bb-9e0b-49f2e340b162	g.chr5:140683011T>C	ENST00000239451.4	-	1	601	c.422A>G	c.(421-423)gAg>gGg	p.E141G		NM_031947.2	NP_114153.1	Q9BXI2	ORNT2_HUMAN	solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 2	141					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|urea cycle (GO:0000050)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(500;0.000249)|Lung NSC(810;0.0011)|Ovarian(839;0.00556)|Breast(839;0.0173)|all_hematologic(541;0.152)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.00204)	L-Ornithine(DB00129)	CCCTGACATCTCCATTTCATA	0.522													ENSG00000120329																																					0													99.0	107.0	104.0					5																	140683011		2203	4300	6503	SO:0001583	missense	0			-	AF332005	CCDS4258.1	5q31.3	2013-05-22			ENSG00000120329	ENSG00000120329		"""Solute carriers"""	22921	protein-coding gene	gene with protein product		608157				11004451	Standard	NM_031947		Approved	ORNT2	uc003ljf.3	Q9BXI2	OTTHUMG00000129604	ENST00000239451.4:c.422A>G	5.37:g.140683011T>C	ENSP00000239451:p.Glu141Gly		Q496C1|Q6XUI0|Q8NFZ2	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.E141G	ENST00000239451.4	37	c.422	CCDS4258.1	5	.	.	.	.	.	.	.	.	.	.	T	11.11	1.542055	0.27563	.	.	ENSG00000120329	ENST00000239451	T	0.79749	-1.3	3.78	2.57	0.30868	Mitochondrial carrier domain (2);	0.415220	0.23904	U	0.043404	T	0.66086	0.2754	L	0.37800	1.135	0.31099	N	0.710615	B	0.09022	0.002	B	0.10450	0.005	T	0.56444	-0.7978	10	0.24483	T	0.36	-11.8776	4.2678	0.10771	0.0:0.1088:0.2036:0.6875	.	141	Q9BXI2	ORNT2_HUMAN	G	141	ENSP00000239451:E141G	ENSP00000239451:E141G	E	-	2	0	SLC25A2	140663195	0.999000	0.42202	0.525000	0.27900	0.823000	0.46562	2.662000	0.46766	0.777000	0.33496	0.528000	0.53228	GAG	-	SLC25A2	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.522	SLC25A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A2	HGNC	protein_coding	OTTHUMT00000251799.2	0	0	0	76	76	67	0.00	0.00	T	NM_031947		140683011	-1	7	2	33	46	tier1	no_errors	ENST00000239451	ensembl	human	known	74_37	missense	17.50	4.17	SNP	0.891	C	7	33
