#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
MAP4K1	11184	genome.wustl.edu	37	19	39088139	39088139	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr19:39088139G>A	ENST00000591517.1	-	23	1793	c.1765C>T	c.(1765-1767)Cgc>Tgc	p.R589C	MAP4K1_ENST00000589130.1_Missense_Mutation_p.R585C|MAP4K1_ENST00000396857.2_Missense_Mutation_p.R589C|MAP4K1_ENST00000586296.1_Intron|CTB-186G2.1_ENST00000589557.1_RNA|MAP4K1_ENST00000423454.2_Silent_p.T230T	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	589	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCCAGTAGGCGGTGGGGGCTA	0.572													ENSG00000104814																																					0													81.0	84.0	83.0					19																	39088139		2016	4163	6179	SO:0001583	missense	0			-	U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1765C>T	19.37:g.39088139G>A	ENSP00000465039:p.Arg589Cys			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R589C	ENST00000591517.1	37	c.1765	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	.	19.12	3.764938	0.69878	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	T	0.75477	-0.94	5.25	4.23	0.50019	Citron-like (3);	0.258863	0.30101	N	0.010406	T	0.82263	0.4999	M	0.70595	2.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.984;0.991	T	0.82661	-0.0347	10	0.87932	D	0	.	6.6828	0.23129	0.0884:0.0:0.736:0.1756	.	589;589	Q92918-2;Q92918	.;M4K1_HUMAN	C	589	ENSP00000380066:R589C	ENSP00000221409:R589C	R	-	1	0	MAP4K1	43779979	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.314000	0.43743	1.472000	0.48140	0.555000	0.69702	CGC	-	MAP4K1	-	pfam_Citron,smart_Citron		0.572	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	0	0	0	40	40	52	0.00	0.00	G	NM_001042600		39088139	-1	10	13	38	47	tier1	no_errors	ENST00000591517	ensembl	human	known	74_37	missense	20.83	21.67	SNP	1.000	A	10	38
ZNF671	79891	genome.wustl.edu	37	19	58232323	58232323	+	Missense_Mutation	SNP	A	A	T			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	A	A	A	T	A	A	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr19:58232323A>T	ENST00000317398.6	-	4	1226	c.1131T>A	c.(1129-1131)ttT>ttA	p.F377L	ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|ZNF671_ENST00000335820.3_Missense_Mutation_p.F279L|AC003006.7_ENST00000594684.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	377					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TACTGCTAAAAAATTTCCCAC	0.463													ENSG00000083814																																					0													71.0	62.0	65.0					19																	58232323		2203	4300	6503	SO:0001583	missense	0			-		CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.1131T>A	19.37:g.58232323A>T	ENSP00000321848:p.Phe377Leu		A6NF07|Q9H5E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F377L	ENST00000317398.6	37	c.1131	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	A	8.024	0.760290	0.15914	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.17691	2.26;2.26	1.88	-3.76	0.04359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05777	0.0151	N	0.02708	-0.52	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.33292	-0.9874	9	0.56958	D	0.05	.	4.4482	0.11607	0.5594:0.1881:0.2525:0.0	.	377	Q8TAW3	ZN671_HUMAN	L	377;279	ENSP00000321848:F377L;ENSP00000338670:F279L	ENSP00000321848:F377L	F	-	3	2	ZNF671	62924135	0.000000	0.05858	0.021000	0.16686	0.945000	0.59286	-3.451000	0.00466	-0.927000	0.03766	-0.375000	0.07067	TTT	-	ZNF671	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.463	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	0	0	0	35	35	69	0.00	0.00	A	NM_024833		58232323	-1	8	20	16	60	tier1	no_errors	ENST00000317398	ensembl	human	known	74_37	missense	33.33	25.00	SNP	0.026	T	8	16
CCDC132	55610	genome.wustl.edu	37	7	92938151	92938151	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	C	C	C	T	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr7:92938151C>T	ENST00000305866.5	+	19	1773	c.1645C>T	c.(1645-1647)Caa>Taa	p.Q549*	CCDC132_ENST00000317751.6_Nonsense_Mutation_p.Q280*|CCDC132_ENST00000535481.1_Nonsense_Mutation_p.Q269*|CCDC132_ENST00000541136.1_Nonsense_Mutation_p.Q360*|CCDC132_ENST00000544910.1_Nonsense_Mutation_p.Q519*	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	549						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			ATCTGATGAACAAGAAAAGAG	0.408													ENSG00000004766																																					0													113.0	105.0	107.0					7																	92938151		1880	4113	5993	SO:0001587	stop_gained	0			-	AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.1645C>T	7.37:g.92938151C>T	ENSP00000307666:p.Gln549*		B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Nonsense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.Q549*	ENST00000305866.5	37	c.1645	CCDS43617.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.418281	0.96092	.	.	ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000541136;ENST00000535481;ENST00000317751	.	.	.	5.31	5.31	0.75309	.	0.075582	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	2.6215	19.3667	0.94466	0.0:1.0:0.0:0.0	.	.	.	.	X	549;519;360;269;280	.	ENSP00000307666:Q549X	Q	+	1	0	CCDC132	92776087	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.797000	0.62503	2.655000	0.90218	0.650000	0.86243	CAA	-	CCDC132	-	NULL		0.408	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	0	0	0	49	49	82	0.00	0.00	C	NM_017667		92938151	+1	7	15	19	52	tier1	no_errors	ENST00000305866	ensembl	human	known	74_37	nonsense	26.92	22.39	SNP	1.000	T	7	19
OR7D2	162998	genome.wustl.edu	37	19	9297316	9297316	+	Missense_Mutation	SNP	C	C	G			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	C	C	C	G	C	C	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr19:9297316C>G	ENST00000344248.2	+	1	1038	c.859C>G	c.(859-861)Ccc>Gcc	p.P287A		NM_175883.2	NP_787079.1	Q96RA2	OR7D2_HUMAN	olfactory receptor, family 7, subfamily D, member 2	287					regulation of transcription, DNA-templated (GO:0006355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	20						CATGTTGAACCCCTTCATCTA	0.567													ENSG00000188000																																					0													71.0	70.0	70.0					19																	9297316		2203	4300	6503	SO:0001583	missense	0			-	AK095468	CCDS32900.1	19p13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8378	protein-coding gene	gene with protein product							Standard	NM_175883		Approved	OR19-4, HTPCRH03, FLJ38149	uc002mkz.1	Q96RA2		ENST00000344248.2:c.859C>G	19.37:g.9297316C>G	ENSP00000345563:p.Pro287Ala		Q6IFJ7|Q8N133	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P287A	ENST00000344248.2	37	c.859	CCDS32900.1	19	.	.	.	.	.	.	.	.	.	.	C	15.59	2.877532	0.51801	.	.	ENSG00000188000	ENST00000344248	T	0.63255	-0.03	2.2	2.2	0.27929	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	U	0.001304	D	0.83156	0.5193	H	0.99325	4.515	0.26975	N	0.965482	P	0.50943	0.94	P	0.54759	0.76	T	0.78753	-0.2081	10	0.87932	D	0	.	11.9676	0.53044	0.0:1.0:0.0:0.0	.	287	Q96RA2	OR7D2_HUMAN	A	287	ENSP00000345563:P287A	ENSP00000345563:P287A	P	+	1	0	OR7D2	9158316	0.993000	0.37304	1.000000	0.80357	0.771000	0.43674	3.260000	0.51523	1.578000	0.49821	0.505000	0.49811	CCC	-	OR7D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.567	OR7D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7D2	HGNC	protein_coding	OTTHUMT00000449002.1	0	0	0	48	48	27	0.00	0.00	C			9297316	+1	5	12	27	28	tier1	no_errors	ENST00000344248	ensembl	human	known	74_37	missense	15.62	30.00	SNP	1.000	G	5	27
LRRC7	57554	genome.wustl.edu	37	1	70477507	70477507	+	Missense_Mutation	SNP	T	T	G			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	T	T	T	G	T	T	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr1:70477507T>G	ENST00000035383.5	+	10	948	c.918T>G	c.(916-918)tgT>tgG	p.C306W	LRRC7_ENST00000310961.5_Missense_Mutation_p.C311W|LRRC7_ENST00000415775.2_5'UTR|RP11-181B18.1_ENST00000414132.1_RNA	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	306						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AATTTGACTGTAGCTGTAATG	0.333													ENSG00000033122																																					0													50.0	49.0	49.0					1																	70477507		2201	4299	6500	SO:0001583	missense	0			-		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.918T>G	1.37:g.70477507T>G	ENSP00000035383:p.Cys306Trp		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.C306W	ENST00000035383.5	37	c.918	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	T	16.16	3.045281	0.55110	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.24723	1.97;1.84	5.14	-2.72	0.05968	.	0.000000	0.85682	D	0.000000	T	0.27629	0.0679	L	0.49778	1.585	0.80722	D	1	D	0.69078	0.997	D	0.70935	0.971	T	0.23368	-1.0190	10	0.87932	D	0	.	13.5734	0.61860	0.0:0.6408:0.0:0.3592	.	306	Q96NW7	LRRC7_HUMAN	W	311;306;129	ENSP00000309245:C311W;ENSP00000035383:C306W	ENSP00000035383:C306W	C	+	3	2	LRRC7	70250095	0.989000	0.36119	0.991000	0.47740	0.979000	0.70002	0.231000	0.17872	-0.425000	0.07371	-0.911000	0.02809	TGT	-	LRRC7	-	NULL		0.333	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	0	0	0	61	61	76	0.00	0.00	T	NM_020794		70477507	+1	11	12	31	51	tier1	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	26.19	19.05	SNP	0.956	G	11	31
ZDHHC6	64429	genome.wustl.edu	37	10	114194138	114194138	+	Nonsense_Mutation	SNP	G	G	A			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr10:114194138G>A	ENST00000369405.3	-	7	1243	c.820C>T	c.(820-822)Cag>Tag	p.Q274*	ZDHHC6_ENST00000369404.3_Nonsense_Mutation_p.Q270*|ZDHHC6_ENST00000482410.1_5'Flank	NM_022494.1	NP_071939.1	Q9H6R6	ZDHC6_HUMAN	zinc finger, DHHC-type containing 6	274					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Colorectal(252;0.198)		Epithelial(162;0.0291)|all cancers(201;0.117)		GTAAATACCTGTTTAAAGTTC	0.403													ENSG00000023041																																					0													113.0	104.0	107.0					10																	114194138		2203	4300	6503	SO:0001587	stop_gained	0			-	AK025605	CCDS7574.1	10q26.11	2008-05-02			ENSG00000023041	ENSG00000023041		"""Zinc fingers, DHHC-type"""	19160	protein-coding gene	gene with protein product							Standard	NM_022494		Approved	ZNF376, FLJ21952	uc001kzv.3	Q9H6R6	OTTHUMG00000019062	ENST00000369405.3:c.820C>T	10.37:g.114194138G>A	ENSP00000358413:p.Gln274*		D3DRB6|Q53G45|Q96IV7|Q9H605	Nonsense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfam_SH3_2,superfamily_SH3_domain,pfscan_Znf_DHHC_palmitoyltrfase	p.Q274*	ENST00000369405.3	37	c.820	CCDS7574.1	10	.	.	.	.	.	.	.	.	.	.	G	41	9.140292	0.99078	.	.	ENSG00000023041	ENST00000369405;ENST00000369404	.	.	.	5.69	4.78	0.61160	.	0.112422	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-31.2711	16.3159	0.82928	0.0:0.0:0.8665:0.1335	.	.	.	.	X	274;270	.	ENSP00000358412:Q270X	Q	-	1	0	ZDHHC6	114184128	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.696000	0.98695	1.519000	0.48950	0.650000	0.86243	CAG	-	ZDHHC6	-	NULL		0.403	ZDHHC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC6	HGNC	protein_coding	OTTHUMT00000050393.1	0	0	0	60	60	123	0.00	0.00	G	NM_022494		114194138	-1	5	13	32	88	tier1	no_errors	ENST00000369405	ensembl	human	known	74_37	nonsense	13.51	12.87	SNP	1.000	A	5	32
CD3EAP	10849	genome.wustl.edu	37	19	45912297	45912297	+	Silent	SNP	G	G	A			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	G	G	G	A	G	G	Unknown	Valid	Somatic	Phase_IV	WXS	Hybrid_Capture_Illumina_Seq			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr19:45912297G>A	ENST00000309424.3	+	3	1559	c.1071G>A	c.(1069-1071)ctG>ctA	p.L357L	ERCC1_ENST00000300853.3_3'UTR|CD3EAP_ENST00000589804.1_Silent_p.L359L|ERCC1_ENST00000588738.1_5'Flank|ERCC1_ENST00000423698.2_3'UTR|PPP1R13L_ENST00000418234.2_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	357					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		TGAAGCCTCTGGAGTCCCCAG	0.582													ENSG00000117877																																					0													40.0	48.0	45.0					19																	45912297		2202	4299	6501	SO:0001819	synonymous_variant	0			-	U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1071G>A	19.37:g.45912297G>A			Q32N11|Q7Z5U2|Q9UPF6	Silent	SNP	pfam_D-dir_R_pol1_su_RPA34	p.L359	ENST00000309424.3	37	c.1077	CCDS12661.1	19																																																																																			-	CD3EAP	-	NULL		0.582	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	HGNC	protein_coding	OTTHUMT00000459538.1	0	0	0	92	92	57	0.00	0.00	G	NM_012099		45912297	+1	7	4	65	45	tier1	no_errors	ENST00000589804	ensembl	human	known	74_37	silent	9.72	8.16	SNP	0.006	A	7	65
FAM120A	23196	genome.wustl.edu	37	9	96259883	96259884	+	Splice_Site	INS	-	-	A	rs35062269|rs554262666|rs397936267	byFrequency	TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr9:96259883_96259884insA	ENST00000277165.6	+	4	1127		c.e4+2		FAM120A_ENST00000340893.4_Splice_Site|FAM120A_ENST00000375389.3_Splice_Site|FAM120A_ENST00000333936.5_Splice_Site	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A							cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						CATTCACAGGTAAAAAAAAAAA	0.436													ENSG00000048828	|||unknown(HR)	1255	0.250599	0.4834	0.245	5008	,	,		26167	0.1835		0.1571	False		,,,				2504	0.1053																0																																										SO:0001630	splice_region_variant	0				AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.933+2->A	9.37:g.96259894_96259894dupA			A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Splice_Site	INS	-	e4+2	ENST00000277165.6	37	c.933+2_933+1	CCDS6706.1	9																																																																																				FAM120A	-	-		0.436	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	0	0	0	38	38	12	0.00	0.00	-	NM_014612	Intron	96259884	+1	4	0	26	4	tier1	no_errors	ENST00000333936	ensembl	human	known	74_37	splice_site_ins	13.33	0.00	INS	1.000:0.997	A	4	26
SPPL2B	56928	genome.wustl.edu	37	19	2341094	2341101	+	RNA	DEL	CTCCCTGG	CTCCCTGG	-	rs77642174|rs76166147|rs386805838|rs547300749	byFrequency	TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	CTCCCTGG	CTCCCTGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr19:2341094_2341101delCTCCCTGG	ENST00000452401.2	+	0	1033							Q8TCT7	SPP2B_HUMAN	signal peptide peptidase like 2B						membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	endosome membrane (GO:0010008)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCC	0.702													ENSG00000005206		1248	0.249201	0.0469	0.3718	5008	,	,		14617	0.25		0.4294	False		,,,				2504	0.2495																0																																												0					CCDS74252.1, CCDS74253.1	19p13.3	2012-02-21			ENSG00000005206	ENSG00000005206			30627	protein-coding gene	gene with protein product	"""intramembrane protease 4"""	608239				10819331	Standard	NM_001077238		Approved	IMP4, PSL1, KIAA1532	uc002lvs.3	Q8TCT7			19.37:g.2341094_2341101delCTCCCTGG			D6W609|O60365|Q567S3|Q8IUH9|Q9BUY6|Q9H3M4|Q9NPN2|Q9P1Z6	R	DEL	-	NULL	ENST00000452401.2	37	NULL		19																																																																																				SPPL2B	-	-		0.702	SPPL2B-202	KNOWN	basic	processed_transcript	SPPL2B	HGNC	processed_transcript		0	0	0	1	1	1	0.00	0.00	CTCCCTGG	NM_020172		2341101	+1	0	0	1	1	tier1	no_errors	ENST00000592738	ensembl	human	known	74_37	rna	0.00	0.00	DEL	0.000:0.000:0.010:0.001:0.000:0.000:0.001:0.000	-	0	1
TRAPPC12	51112	genome.wustl.edu	37	2	3391677	3391677	+	Nonsense_Mutation	SNP	G	G	T			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr2:3391677G>T	ENST00000324266.5	+	2	478	c.283G>T	c.(283-285)Gga>Tga	p.G95*	TRAPPC12_ENST00000382110.2_Nonsense_Mutation_p.G95*	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	95					vesicle-mediated transport (GO:0016192)												AGCTGAGCCCGGAGGGGAAGG	0.726													ENSG00000171853																																					0													13.0	12.0	12.0					2																	3391677		2170	4257	6427	SO:0001587	stop_gained	0			-	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.283G>T	2.37:g.3391677G>T	ENSP00000324318:p.Gly95*		B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G95*	ENST00000324266.5	37	c.283	CCDS1652.1	2	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713202	0.48517	.	.	ENSG00000171853	ENST00000382110;ENST00000304601;ENST00000324266	.	.	.	5.21	-7.75	0.01236	.	1.644710	0.03054	N	0.154999	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	9.4897	0.38951	0.3822:0.4566:0.1612:0.0	.	.	.	.	X	95;78;95	.	ENSP00000303612:G78X	G	+	1	0	TTC15	3370684	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.026000	0.12392	-1.694000	0.01425	-1.129000	0.01985	GGA	-	TRAPPC12	-	NULL		0.726	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRAPPC12	HGNC	protein_coding	OTTHUMT00000206693.2	0	0	0	20	20	0	0.00	0.00	G	NM_016030		3391677	+1	3	0	7	0	tier1	no_errors	ENST00000324266	ensembl	human	known	74_37	nonsense	30.00	0.00	SNP	0.000	T	3	7
CDON	50937	genome.wustl.edu	37	11	125831880	125831880	+	Frame_Shift_Del	DEL	T	T	-			TCGA-Z4-A8JB-01A-23D-A37C-09	TCGA-Z4-A8JB-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	693ee45f-0cc9-45e1-8b05-bfb08253990a	ef7ae782-355b-4982-8713-82dfdb7e1fab	g.chr11:125831880delT	ENST00000392693.3	-	19	3497	c.3370delA	c.(3370-3372)accfs	p.T1124fs	CDON_ENST00000531738.1_Frame_Shift_Del_p.T501fs|CDON_ENST00000263577.7_Frame_Shift_Del_p.T1124fs	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1124					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		GTGCTGTTGGTTTTGGTGAAA	0.433													ENSG00000064309																																					0													56.0	57.0	57.0					11																	125831880		2201	4299	6500	SO:0001589	frameshift_variant	0				AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3370delA	11.37:g.125831880delT	ENSP00000376458:p.Thr1124fs		O14631	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T1124fs	ENST00000392693.3	37	c.3370	CCDS58192.1	11																																																																																				CDON	-	NULL		0.433	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	HGNC	protein_coding	OTTHUMT00000386749.2	0	0	0	34	34	120	0.00	0.00	T	NM_016952		125831880	-1	2	2	21	175	tier1	no_errors	ENST00000392693	ensembl	human	known	74_37	frame_shift_del	8.70	1.13	DEL	1.000	-	2	21
