#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_ ensembl_gene_id	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNP	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_n_alt_count	i_n_alt_count_full	i_n_alt_count_val	i_n_ref_count	i_n_ref_count_full	i_n_ref_count_val	i_normal_vaf	i_normal_vaf_val	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_t_alt_count_full	i_t_alt_count_val	i_t_ref_count_full	i_t_ref_count_val	i_tier	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_vaf	i_tumor_vaf_val	i_type	i_ucsc_cons	i_variant	t_alt_count	t_ref_count
EVL	51466	genome.wustl.edu	37	14	100576061	100576061	+	Intron	SNP	G	G	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr14:100576061G>C	ENST00000402714.2	+	3	956				MIR151B_ENST00000584249.1_RNA|EVL_ENST00000392920.3_Intron|EVL_ENST00000544450.2_Intron|MIR342_ENST00000362212.1_RNA			Q9UI08	EVL_HUMAN	Enah/Vasp-like						actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				gtctcacacagaaatcgcacc	0.547													ENSG00000199082																																					0													76.0	76.0	76.0					14																	100576061		1568	3582	5150	SO:0001627	intron_variant	0			-	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.352+12066G>C	14.37:g.100576061G>C			A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	R	SNP	-	NULL	ENST00000402714.2	37	NULL		14																																																																																			-	MIR342	-	-		0.547	EVL-006	KNOWN	basic|appris_candidate	protein_coding	MIR342	HGNC	protein_coding	OTTHUMT00000413958.1	0	0		31	31		0.00		G			100576061	+1	4		40		tier1	no_errors	ENST00000362212	ensembl	human	known	74_37	rna	9.09		SNP	1.000	C	4	40
DOCK10	55619	genome.wustl.edu	37	2	225659678	225659678	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:225659678G>A	ENST00000258390.7	-	45	5139	c.5072C>T	c.(5071-5073)tCc>tTc	p.S1691F	DOCK10_ENST00000409592.3_Missense_Mutation_p.S1685F	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1691	DHR-2.				regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCTTGCGTAGGAGTTTGCCAG	0.512													ENSG00000135905																																					0													150.0	156.0	154.0					2																	225659678		2073	4224	6297	SO:0001583	missense	0			-	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.5072C>T	2.37:g.225659678G>A	ENSP00000258390:p.Ser1691Phe		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S1691F	ENST00000258390.7	37	c.5072	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807312	0.90623	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.68025	4.5;-0.3	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.86497	0.5947	M	0.91300	3.195	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;1.0;1.0	D;D;D;D	0.91635	0.992;0.991;0.999;0.983	D	0.88833	0.3307	10	0.87932	D	0	.	19.7791	0.96410	0.0:0.0:1.0:0.0	.	1691;545;1685;353	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	F	1685;1691;229	ENSP00000386694:S1685F;ENSP00000258390:S1691F	ENSP00000258390:S1691F	S	-	2	0	DOCK10	225367922	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	9.476000	0.97823	2.683000	0.91414	0.557000	0.71058	TCC	-	DOCK10	-	superfamily_ARM-type_fold		0.512	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	0	0		67	67		0.00		G			225659678	-1	15		39		tier1	no_errors	ENST00000258390	ensembl	human	known	74_37	missense	27.78		SNP	1.000	A	15	39
MUC12	10071	genome.wustl.edu	37	7	100643080	100643080	+	Missense_Mutation	SNP	C	C	T	rs139875131		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr7:100643080C>T	ENST00000379442.3	+	5	9665	c.9665C>T	c.(9664-9666)aCg>aTg	p.T3222M	MUC12_ENST00000536621.1_Missense_Mutation_p.T3079M			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3222	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GAACCTACAACGTCACCCATC	0.527													ENSG00000205277																																					0													1.0	1.0	1.0					7																	100643080		233	590	823	SO:0001583	missense	0			-	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9665C>T	7.37:g.100643080C>T	ENSP00000368755:p.Thr3222Met		A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA_dom	p.T3079M	ENST00000379442.3	37	c.9236		7	.	.	.	.	.	.	.	.	.	.	C	3.555	-0.090832	0.07053	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12255	2.7;2.7	0.869	-1.74	0.08056	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34004	-0.9846	7	0.45353	T	0.12	.	2.356	0.04295	0.0:0.3962:0.3269:0.2769	.	.	.	.	M	3222;3079	ENSP00000368755:T3222M;ENSP00000441929:T3079M	ENSP00000368755:T3222M	T	+	2	0	MUC12	100429800	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.110000	0.15437	-0.783000	0.04534	0.194000	0.17425	ACG	rs139875131	MUC12	-	NULL		0.527	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	0	0		11	11		0.00		C	XM_379904		100643080	+1	3		7		tier1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	30.00		SNP	0.000	T	3	7
FPGT-TNNI3K	100526835	genome.wustl.edu	37	1	74929214	74929214	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:74929214G>T	ENST00000370899.3	+	23	2441	c.2404G>T	c.(2404-2406)Ggg>Tgg	p.G802W	TNNI3K_ENST00000326637.3_Missense_Mutation_p.G701W|TNNI3K_ENST00000370891.2_Missense_Mutation_p.G802W|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.G815W	NM_001199327.1	NP_001186256			FPGT-TNNI3K readthrough																		GCTGATACGAGGGTGGAACGC	0.438													ENSG00000259030																																					0													147.0	132.0	137.0					1																	74929214		2203	4300	6503	SO:0001583	missense	0			-			1p31.3	2014-03-14			ENSG00000259030	ENSG00000259030			42952	other	readthrough							Standard	NM_001112808		Approved		uc001dge.2		OTTHUMG00000166281	ENST00000370899.3:c.2404G>T	1.37:g.74929214G>T	ENSP00000359936:p.Gly802Trp			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G815W	ENST00000370899.3	37	c.2443		1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.488701	0.84962	.	.	ENSG00000259030;ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000370899;ENST00000557284;ENST00000370891;ENST00000326637	D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85750	0.5769	L	0.37697	1.125	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73380	0.98;0.977;0.965	D	0.87035	0.2137	10	0.72032	D	0.01	.	19.2533	0.93933	0.0:0.0:1.0:0.0	.	701;802;802	Q59H18;Q59H18-1;Q59H18-4	TNI3K_HUMAN;.;.	W	802;802;802;701	ENSP00000359936:G802W;ENSP00000450895:G802W;ENSP00000359928:G802W;ENSP00000322251:G701W	ENSP00000322251:G701W	G	+	1	0	RP11-653A5.2;AC093158.1	74701802	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.281000	0.78621	2.634000	0.89283	0.655000	0.94253	GGG	-	FPGT-TNNI3K	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.438	FPGT-TNNI3K-003	NOVEL	basic|appris_candidate|readthrough_transcript|exp_conf	protein_coding	FPGT-TNNI3K	HGNC	protein_coding	OTTHUMT00000026438.3	0	0		43	43		0.00		G			74929214	+1	4		35		tier1	no_errors	ENST00000557284	ensembl	human	known	74_37	missense	10.26		SNP	1.000	T	4	35
C6orf89	221477	genome.wustl.edu	37	6	36891153	36891153	+	Missense_Mutation	SNP	A	A	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:36891153A>G	ENST00000480824.2	+	9	1274	c.980A>G	c.(979-981)tAc>tGc	p.Y327C	C6orf89_ENST00000359359.2_Missense_Mutation_p.Y221C|C6orf89_ENST00000373685.1_Missense_Mutation_p.Y327C|C6orf89_ENST00000510325.2_Missense_Mutation_p.Y221C|C6orf89_ENST00000355190.3_Missense_Mutation_p.Y334C			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	327				Y -> C (in Ref. 4; CAD98021). {ECO:0000305}.	epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						TGGAAGGTCTACGTTATAGCC	0.532													ENSG00000198663																																					0													91.0	74.0	80.0					6																	36891153		2203	4300	6503	SO:0001583	missense	0			-	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.980A>G	6.37:g.36891153A>G	ENSP00000475947:p.Tyr327Cys		B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	NULL	p.Y334C	ENST00000480824.2	37	c.1001		6	.	.	.	.	.	.	.	.	.	.	A	14.68	2.606560	0.46527	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685	.	.	.	5.56	3.24	0.37175	.	0.388937	0.30492	N	0.009510	T	0.37320	0.0999	L	0.57536	1.79	0.30520	N	0.768473	D;D	0.71674	0.998;0.998	P;P	0.61592	0.891;0.891	T	0.10636	-1.0621	9	0.36615	T	0.2	7.515	6.7696	0.23587	0.8424:0.0:0.1576:0.0	.	327;334	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	C	221;221;334;327	.	ENSP00000347322:Y334C	Y	+	2	0	C6orf89	36999131	0.995000	0.38212	0.989000	0.46669	0.560000	0.35617	2.163000	0.42377	2.128000	0.65567	0.459000	0.35465	TAC	-	C6orf89	-	NULL		0.532	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	C6orf89	HGNC	protein_coding	OTTHUMT00000040387.2	0	0		42	42		0.00		A	NM_152734		36891153	+1	24		7		tier1	no_errors	ENST00000355190	ensembl	human	known	74_37	missense	77.42		SNP	0.860	G	24	7
LONRF2	164832	genome.wustl.edu	37	2	100900776	100900776	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:100900776C>T	ENST00000393437.3	-	12	2888	c.2249G>A	c.(2248-2250)aGg>aAg	p.R750K	LONRF2_ENST00000409647.1_Missense_Mutation_p.R507K	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	750							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ATTTCTCTCCCTGGCATTAGC	0.478													ENSG00000170500																																					0													26.0	22.0	23.0					2																	100900776		2197	4297	6494	SO:0001583	missense	0			-	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.2249G>A	2.37:g.100900776C>T	ENSP00000377086:p.Arg750Lys		B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.R750K	ENST00000393437.3	37	c.2249	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	C	6.472	0.455277	0.12283	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	D;D	0.84660	-1.72;-1.88	5.24	1.29	0.21616	.	0.984141	0.08265	N	0.972358	T	0.66177	0.2763	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.50259	-0.8849	10	0.20046	T	0.44	-2.7776	2.7117	0.05176	0.1336:0.4353:0.2751:0.156	.	750	Q1L5Z9	LONF2_HUMAN	K	750;507	ENSP00000377086:R750K;ENSP00000386823:R507K	ENSP00000377086:R750K	R	-	2	0	LONRF2	100267208	0.000000	0.05858	0.000000	0.03702	0.440000	0.31957	-0.024000	0.12435	-0.043000	0.13513	0.655000	0.94253	AGG	-	LONRF2	-	NULL		0.478	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	0	0		49	49		0.00		C	NM_198461		100900776	-1	41		18		tier1	no_errors	ENST00000393437	ensembl	human	known	74_37	missense	69.49		SNP	0.000	T	41	18
ZNF330	27309	genome.wustl.edu	37	4	142153779	142153779	+	Missense_Mutation	SNP	A	A	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr4:142153779A>G	ENST00000262990.4	+	9	899	c.671A>G	c.(670-672)aAg>aGg	p.K224R	ZNF330_ENST00000421169.2_Missense_Mutation_p.K164R	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	224						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					CAGGAGACTAAGGACCTTAGC	0.358													ENSG00000109445																																					0													83.0	78.0	79.0					4																	142153779		2203	4300	6503	SO:0001583	missense	0			-	AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.671A>G	4.37:g.142153779A>G	ENSP00000262990:p.Lys224Arg		B2RDA3	Missense_Mutation	SNP	pfam_NOA36	p.K224R	ENST00000262990.4	37	c.671	CCDS3754.1	4	.	.	.	.	.	.	.	.	.	.	A	25.0	4.596708	0.86953	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000421169	T;T;T	0.39406	1.08;1.08;1.08	5.42	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	M	0.69248	2.105	0.58432	D	0.999999	B;B	0.09022	0.001;0.002	B;B	0.12837	0.003;0.008	T	0.33650	-0.9860	10	0.62326	D	0.03	-16.1433	10.9631	0.47397	0.9273:0.0:0.0727:0.0	.	164;224	E9PDK6;Q9Y3S2	.;ZN330_HUMAN	R	224;224;164	ENSP00000262990:K224R;ENSP00000422599:K224R;ENSP00000397397:K164R	ENSP00000262990:K224R	K	+	2	0	ZNF330	142373229	1.000000	0.71417	0.989000	0.46669	0.980000	0.70556	9.324000	0.96373	0.909000	0.36697	0.528000	0.53228	AAG	-	ZNF330	-	pfam_NOA36		0.358	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF330	HGNC	protein_coding	OTTHUMT00000257271.2	0	0		77	77		0.00		A	NM_014487		142153779	+1	49		53		tier1	no_errors	ENST00000262990	ensembl	human	known	74_37	missense	48.04		SNP	1.000	G	49	53
EIF2AK4	440275	genome.wustl.edu	37	15	40284991	40284991	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr15:40284991G>T	ENST00000263791.5	+	18	2751	c.2708G>T	c.(2707-2709)gGc>gTc	p.G903V	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.G875V	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	903	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		GGGATGGTTGGCACTGCTCTC	0.418													ENSG00000128829																																					0													124.0	114.0	117.0					15																	40284991		1905	4126	6031	SO:0001583	missense	0			-	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.2708G>T	15.37:g.40284991G>T	ENSP00000263791:p.Gly903Val		C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RWD-domain,superfamily_Kinase-like_dom,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Anticodon-bd,smart_RWD-domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_RWD-domain,pfscan_Prot_kinase_dom	p.G903V	ENST00000263791.5	37	c.2708	CCDS42016.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.175532	0.94807	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.39229	1.09;1.09	6.07	6.07	0.98685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.71384	0.3333	M	0.86178	2.8	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73711	-0.3897	10	0.87932	D	0	-23.287	20.6593	0.99626	0.0:0.0:1.0:0.0	.	903	Q9P2K8	E2AK4_HUMAN	V	903;875	ENSP00000263791:G903V;ENSP00000372174:G875V	ENSP00000263791:G903V	G	+	2	0	EIF2AK4	38072283	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.562000	0.98145	2.885000	0.99019	0.655000	0.94253	GGC	-	EIF2AK4	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_GCN2,pfscan_Prot_kinase_dom		0.418	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2AK4	HGNC	protein_coding	OTTHUMT00000418395.1	0	0		58	58		0.00		G			40284991	+1	4		40		tier1	no_errors	ENST00000263791	ensembl	human	known	74_37	missense	9.09		SNP	1.000	T	4	40
CCNDBP1	23582	genome.wustl.edu	37	15	43482568	43482568	+	Silent	SNP	G	G	C	rs565148907		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr15:43482568G>C	ENST00000300213.4	+	6	716	c.474G>C	c.(472-474)gcG>gcC	p.A158A	EPB42_ENST00000563128.1_Intron|CCNDBP1_ENST00000356633.5_5'UTR	NM_012142.4	NP_036274.3	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1	158	Interaction with RPLP0.|Interaction with TCF3.|Required for interaction with CCND1.				cell cycle (GO:0007049)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)	13		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		TCTGGGTTGCGTGCCAGCAGA	0.473													ENSG00000166946																																					0													75.0	70.0	72.0					15																	43482568		2203	4299	6502	SO:0001819	synonymous_variant	0			-	AF082569	CCDS10092.1	15q14-q15	2008-07-18			ENSG00000166946	ENSG00000166946			1587	protein-coding gene	gene with protein product	"""D-type cyclin-interacting protein 1"", ""MAID protein"", ""HHM Protein"", ""grap2 cyclin interacting protein"""	607089				10801854	Standard	NM_012142		Approved	DIP1, GCIP	uc001zqv.3	O95273	OTTHUMG00000130703	ENST00000300213.4:c.474G>C	15.37:g.43482568G>C			A8K3Q0|A8K3U2|Q6ZQN9|Q7Z519|Q8NBS7|Q8NBY2|Q9NS19|Q9NYH3|Q9UHX9	Missense_Mutation	SNP	NULL	p.R126P	ENST00000300213.4	37	c.377	CCDS10092.1	15																																																																																			-	CCNDBP1	-	NULL		0.473	CCNDBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNDBP1	HGNC	protein_coding	OTTHUMT00000253203.1	0	0		63	63		0.00		G	NM_012142		43482568	+1	35		8		tier1	no_errors	ENST00000568507	ensembl	human	known	74_37	missense	81.40		SNP	0.000	C	35	8
MEI4	101928601	genome.wustl.edu	37	6	78400413	78400413	+	Missense_Mutation	SNP	A	A	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:78400413A>G	ENST00000602452.2	+	1	39	c.25A>G	c.(25-27)Aga>Gga	p.R9G		NM_001282136.1	NP_001269065.1	A8MW99	MEI4L_HUMAN	meiosis-specific 4 homolog (S. cerevisiae)	9					DNA recombination (GO:0006310)|meiotic DNA double-strand break formation (GO:0042138)|oogenesis (GO:0048477)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	lateral element (GO:0000800)											ATGGTATTTGAGAACTTCAAA	0.383													ENSG00000269964																																					0																																										SO:0001583	missense	0			-		CCDS64463.1	6q14.1	2014-08-13			ENSG00000269964	ENSG00000269964			43638	protein-coding gene	gene with protein product						20551173	Standard	XM_005248773		Approved			A8MW99	OTTHUMG00000153472	ENST00000602452.2:c.25A>G	6.37:g.78400413A>G	ENSP00000473370:p.Arg9Gly		R4GMV8	Missense_Mutation	SNP	NULL	p.R9G	ENST00000602452.2	37	c.25		6																																																																																			-	MEI4	-	NULL		0.383	MEI4-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	MEI4	HGNC	protein_coding	OTTHUMT00000331298.2	0	0		58	58		0.00		A			78400413	+1	36		16		tier1	no_errors	ENST00000602452	ensembl	human	novel	74_37	missense	69.23		SNP	1.000	G	36	16
STEAP2-AS1	100874100	genome.wustl.edu	37	7	89754242	89754242	+	RNA	DEL	T	T	-	rs138820427	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr7:89754242delT	ENST00000478318.2	-	0	424				RP5-1121E10.2_ENST00000471553.1_lincRNA|DPY19L2P4_ENST00000497063.1_RNA					STEAP2 antisense RNA 1																		AAATAATCTATTTTTAAGCCC	0.353													ENSG00000235436		639	0.127596	0.2141	0.1066	5008	,	,		16053	0.0774		0.0557	False		,,,				2504	0.1513																0																																												0						7q21.13	2012-10-12	2012-08-15		ENSG00000227646	ENSG00000227646		"""Long non-coding RNAs"""	40820	non-coding RNA	RNA, long non-coding			"""STEAP2 antisense RNA 1 (non-protein coding)"""				Standard	NR_110029		Approved				OTTHUMG00000065036		7.37:g.89754242delT				R	DEL	-	NULL	ENST00000478318.2	37	NULL		7																																																																																				DPY19L2P4	-	-		0.353	STEAP2-AS1-002	KNOWN	basic	antisense	DPY19L2P4	HGNC	processed_transcript	OTTHUMT00000350909.2	0	0		9	9		0.00		T			89754242	+1	18		4		tier1	no_errors	ENST00000497063	ensembl	human	known	74_37	rna	81.82		DEL	0.004	-	18	4
TAF1L	138474	genome.wustl.edu	37	9	32632679	32632679	+	Missense_Mutation	SNP	G	G	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:32632679G>C	ENST00000242310.4	-	1	2988	c.2899C>G	c.(2899-2901)Cta>Gta	p.L967V	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	967					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GTCACCTCTAGGAGACACTTG	0.478													ENSG00000122728																																					0													151.0	141.0	144.0					9																	32632679		2203	4300	6503	SO:0001583	missense	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2899C>G	9.37:g.32632679G>C	ENSP00000418379:p.Leu967Val		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L967V	ENST00000242310.4	37	c.2899	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	11.39	1.624622	0.28889	.	.	ENSG00000122728	ENST00000242310	T	0.23147	1.92	1.04	-0.377	0.12501	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.071833	0.56097	D	0.000027	T	0.45776	0.1359	M	0.85710	2.77	0.49213	D	0.999766	D	0.89917	1.0	D	0.91635	0.999	T	0.33214	-0.9877	10	0.87932	D	0	.	4.1421	0.10198	0.5197:0.0:0.4803:0.0	.	967	Q8IZX4	TAF1L_HUMAN	V	967	ENSP00000418379:L967V	ENSP00000418379:L967V	L	-	1	2	TAF1L	32622679	1.000000	0.71417	0.969000	0.41365	0.842000	0.47809	1.905000	0.39878	-0.347000	0.08299	0.195000	0.17529	CTA	-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.478	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0		78	78		0.00		G			32632679	-1	25		37		tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	40.32		SNP	0.999	C	25	37
VSIG10L	147645	genome.wustl.edu	37	19	51840497	51840497	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr19:51840497C>A	ENST00000335624.4	-	7	2299	c.2300G>T	c.(2299-2301)cGg>cTg	p.R767L		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	767						integral component of membrane (GO:0016021)		p.R767L(2)		breast(1)|endometrium(2)|kidney(1)	4						CTCACCGGCCCGGTAGACCCG	0.617													ENSG00000186806																																					2	Substitution - Missense(2)	endometrium(2)											61.0	75.0	71.0					19																	51840497		692	1591	2283	SO:0001583	missense	0			-		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2300G>T	19.37:g.51840497C>A	ENSP00000335623:p.Arg767Leu			Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R767L	ENST00000335624.4	37	c.2300	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	c	7.376	0.627812	0.14257	.	.	ENSG00000186806	ENST00000335624	T	0.21361	2.01	4.76	-2.02	0.07388	.	0.604093	0.13862	N	0.357565	T	0.17365	0.0417	L	0.55990	1.75	0.09310	N	1	B	0.18166	0.026	B	0.15052	0.012	T	0.26710	-1.0095	10	0.26408	T	0.33	0.0411	10.1637	0.42866	0.0:0.5099:0.0:0.4901	.	767	Q86VR7	VS10L_HUMAN	L	767	ENSP00000335623:R767L	ENSP00000335623:R767L	R	-	2	0	VSIG10L	56532309	0.001000	0.12720	0.087000	0.20705	0.036000	0.12997	-0.906000	0.04071	-0.397000	0.07691	-1.934000	0.00508	CGG	-	VSIG10L	-	NULL		0.617	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	0	0		52	52		0.00		C	NM_001163922		51840497	-1	4		37		tier1	no_errors	ENST00000335624	ensembl	human	novel	74_37	missense	9.76		SNP	0.139	A	4	37
RP11-289H16.1	0	genome.wustl.edu	37	1	144090814	144090814	+	lincRNA	SNP	T	T	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:144090814T>C	ENST00000441760.1	-	0	574				SRGAP2B_ENST00000467933.1_RNA																							ACATCTCTATTCTAAATTTAG	0.363													ENSG00000224363																																					0																																												0			-																													1.37:g.144090814T>C				R	SNP	-	NULL	ENST00000441760.1	37	NULL		1																																																																																			-	RP11-289H16.1	-	-		0.363	RP11-289H16.1-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000224363	Clone_based_vega_gene	lincRNA	OTTHUMT00000099257.1	1	1		181	181		0.55		T			144090814	-1	9		99		tier1	no_errors	ENST00000441760	ensembl	human	known	74_37	rna	8.33		SNP	0.859	C	9	99
PPP2R2B	5521	genome.wustl.edu	37	5	146080608	146080608	+	Splice_Site	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr5:146080608C>T	ENST00000394413.3	-	2	738	c.168G>A	c.(166-168)gaG>gaA	p.E56E	PPP2R2B_ENST00000394410.2_Splice_Site_p.E45E|PPP2R2B_ENST00000394414.1_Splice_Site_p.E122E|PPP2R2B_ENST00000394409.3_Splice_Site_p.E114E|PPP2R2B_ENST00000336640.6_Splice_Site_p.E59E|PPP2R2B_ENST00000356826.3_Splice_Site_p.E56E|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000508545.2_Splice_Site_p.E45E|PPP2R2B_ENST00000394411.4_Splice_Site_p.E56E|PPP2R2B_ENST00000453001.1_Splice_Site_p.E56E|PPP2R2B_ENST00000504198.1_Splice_Site_p.E62E			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta	56					apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACCACTTACCTCCTGCTCTC	0.463													ENSG00000156475																																					0													290.0	298.0	296.0					5																	146080608		2203	4300	6503	SO:0001630	splice_region_variant	0			-	M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381	ENST00000394413.3:c.168+1G>A	5.37:g.146080608C>T			A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.E122	ENST00000394413.3	37	c.366	CCDS4284.1	5																																																																																			-	PPP2R2B	-	superfamily_WD40_repeat_dom,pirsf_PP2A_PR55		0.463	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	HGNC	protein_coding	OTTHUMT00000251893.2	0	0		59	59		0.00		C	NM_181678	Silent	146080608	-1	14		44		tier1	no_errors	ENST00000394414	ensembl	human	known	74_37	silent	24.14		SNP	1.000	T	14	44
KLHL22	84861	genome.wustl.edu	37	22	20819155	20819155	+	Silent	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr22:20819155G>T	ENST00000328879.4	-	4	1258	c.1102C>A	c.(1102-1104)Cga>Aga	p.R368R	KLHL22_ENST00000440659.2_Silent_p.R225R	NM_032775.3	NP_116164.2	Q53GT1	KLH22_HUMAN	kelch-like family member 22	368					cell division (GO:0051301)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein monoubiquitination (GO:0006513)	centrosome (GO:0005813)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|polar microtubule (GO:0005827)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	20	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CTCCAGCATCGGGACTCTGCT	0.572													ENSG00000099910																																					0													88.0	79.0	82.0					22																	20819155		2202	4300	6502	SO:0001819	synonymous_variant	0			-		CCDS13780.1	22q11.21	2013-01-30	2013-01-30		ENSG00000099910	ENSG00000099910		"""Kelch-like"", ""BTB/POZ domain containing"""	25888	protein-coding gene	gene with protein product			"""kelch-like 22 (Drosophila)"""			12477932	Standard	NM_032775		Approved	FLJ14360, KELCHL	uc002zsl.2	Q53GT1	OTTHUMG00000150778	ENST00000328879.4:c.1102C>A	22.37:g.20819155G>T			A8K3Q4|A8MTV3|B7Z2G1|D3DX30|Q96B68|Q96KC6	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_Kelch_2,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R368	ENST00000328879.4	37	c.1102	CCDS13780.1	22																																																																																			-	KLHL22	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.572	KLHL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL22	HGNC	protein_coding	OTTHUMT00000320045.2	0	0		33	33		0.00		G	NM_032775		20819155	-1	3		18		tier1	no_errors	ENST00000328879	ensembl	human	known	74_37	silent	14.29		SNP	1.000	T	3	18
HERC2P3	283755	genome.wustl.edu	37	15	20649520	20649520	+	RNA	SNP	T	T	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr15:20649520T>C	ENST00000428453.1	-	0	2678							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CTGAGGGCTGTGCAGGGGCTG	0.562													ENSG00000180229																																					0													101.0	88.0	92.0					15																	20649520		2191	4272	6463			0			-	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20649520T>C				R	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			-	HERC2P3	-	-		0.562	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	0	0		247	247		0.00		T	NG_008269		20649520	-1	54		81		tier1	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	40.00		SNP	0.925	C	54	81
TACC2	10579	genome.wustl.edu	37	10	123954634	123954634	+	Frame_Shift_Del	DEL	C	C	-			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr10:123954634delC	ENST00000369005.1	+	8	6254	c.5914delC	c.(5914-5916)cccfs	p.P1973fs	TACC2_ENST00000368999.1_Frame_Shift_Del_p.P51fs|TACC2_ENST00000515603.1_Frame_Shift_Del_p.P1928fs|TACC2_ENST00000369000.1_5'UTR|TACC2_ENST00000513429.1_Frame_Shift_Del_p.P119fs|TACC2_ENST00000515273.1_Frame_Shift_Del_p.P1977fs|TACC2_ENST00000334433.3_Frame_Shift_Del_p.P1973fs|TACC2_ENST00000360561.3_Frame_Shift_Del_p.P51fs|TACC2_ENST00000369004.3_Frame_Shift_Del_p.P51fs|TACC2_ENST00000453444.2_Frame_Shift_Del_p.P1977fs|TACC2_ENST00000369001.1_5'UTR|TACC2_ENST00000358010.1_Frame_Shift_Del_p.P119fs|TACC2_ENST00000493951.1_3'UTR|TACC2_ENST00000260733.3_Frame_Shift_Del_p.P51fs	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	1973	Pro-rich.				astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ACCCCCACCACCCCCCGAAGT	0.612													ENSG00000138162																																					0													61.0	66.0	64.0					10																	123954634		2203	4300	6503	SO:0001589	frameshift_variant	0				AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.5914delC	10.37:g.123954634delC	ENSP00000358001:p.Pro1973fs		Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Frame_Shift_Del	DEL	pfam_TACC	p.E1974fs	ENST00000369005.1	37	c.5914	CCDS7626.1	10																																																																																				TACC2	-	NULL		0.612	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	0	0		42	42		0.00		C			123954634	+1	2		23		tier1	no_errors	ENST00000334433	ensembl	human	known	74_37	frame_shift_del	8.00		DEL	0.994	-	2	23
CORO1C	23603	genome.wustl.edu	37	12	109095036	109095036	+	Missense_Mutation	SNP	T	T	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:109095036T>C	ENST00000261401.3	-	2	231	c.59A>G	c.(58-60)aAt>aGt	p.N20S	CORO1C_ENST00000541050.1_Missense_Mutation_p.N20S|CORO1C_ENST00000420959.2_Missense_Mutation_p.N73S|CORO1C_ENST00000549384.1_Intron|CORO1C_ENST00000549772.1_Missense_Mutation_p.N26S	NM_001105237.2|NM_001276471.1|NM_014325.2	NP_001098707.1|NP_001263400.1|NP_055140.1	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C	20					actin cytoskeleton organization (GO:0030036)|phagocytosis (GO:0006909)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|skin(4)	24						GCACTGGTCATTTTTCACCGC	0.453													ENSG00000110880																																					0													169.0	137.0	148.0					12																	109095036		2203	4300	6503	SO:0001583	missense	0			-	BC002342	CCDS9120.1, CCDS61236.1	12q24.1	2013-01-10	2001-11-28			ENSG00000110880		"""Coronins"", ""WD repeat domain containing"""	2254	protein-coding gene	gene with protein product		605269	"""coronin, actin-binding protein, 1C"""			9778037, 10461187	Standard	NM_014325		Approved	coronin-3, HCRNN4	uc009zva.4	Q9ULV4		ENST00000261401.3:c.59A>G	12.37:g.109095036T>C	ENSP00000261401:p.Asn20Ser		A7MAP0|A7MAP1|B3KU12|Q9NSK5	Missense_Mutation	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N73S	ENST00000261401.3	37	c.218	CCDS9120.1	12	.	.	.	.	.	.	.	.	.	.	T	18.81	3.703313	0.68501	.	.	ENSG00000110880	ENST00000261401;ENST00000541050;ENST00000549772;ENST00000420959;ENST00000547294;ENST00000550032;ENST00000551550;ENST00000546571;ENST00000551044	T;T;T;T;T;T;T;T;T	0.75938	0.06;0.06;0.12;-0.0;-0.29;0.09;-0.49;-0.64;-0.98	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);Domain of unknown function DUF1899 (1);	0.000000	0.85682	D	0.000000	T	0.63651	0.2529	N	0.20986	0.625	0.80722	D	1	B;B;B	0.26635	0.051;0.155;0.011	B;B;B	0.28305	0.088;0.038;0.038	T	0.61501	-0.7050	10	0.38643	T	0.18	-6.1773	15.2847	0.73819	0.0:0.0:0.0:1.0	.	20;73;20	B4DMH3;A7MAP1;Q9ULV4	.;.;COR1C_HUMAN	S	20;20;26;73;20;20;20;20;20	ENSP00000261401:N20S;ENSP00000438341:N20S;ENSP00000447534:N26S;ENSP00000394496:N73S;ENSP00000449330:N20S;ENSP00000447989:N20S;ENSP00000448527:N20S;ENSP00000448195:N20S;ENSP00000447049:N20S	ENSP00000261401:N20S	N	-	2	0	CORO1C	107619165	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.652000	0.83633	2.003000	0.58678	0.397000	0.26171	AAT	-	CORO1C	-	pfam_DUF1899		0.453	CORO1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1C	HGNC	protein_coding	OTTHUMT00000403802.1	0	0		46	46		0.00		T	NM_014325		109095036	-1	27		17		tier1	no_errors	ENST00000420959	ensembl	human	known	74_37	missense	61.36		SNP	1.000	C	27	17
ZBTB20	26137	genome.wustl.edu	37	3	114057869	114057869	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr3:114057869G>A	ENST00000474710.1	-	5	2387	c.2209C>T	c.(2209-2211)Cat>Tat	p.H737Y	ZBTB20_ENST00000471418.1_Missense_Mutation_p.H664Y|ZBTB20_ENST00000393785.2_Missense_Mutation_p.H664Y|ZBTB20_ENST00000464560.1_Missense_Mutation_p.H664Y|ZBTB20_ENST00000481632.1_Missense_Mutation_p.H664Y|ZBTB20_ENST00000357258.3_Missense_Mutation_p.H664Y|ZBTB20_ENST00000462705.1_Missense_Mutation_p.H664Y	NM_001164342.1	NP_001157814.1	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20	737						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		TCAGACACATGCATCCTCATG	0.448													ENSG00000181722																									NSCLC(69;748 1344 9802 11203 30933)												0													80.0	79.0	79.0					3																	114057869		2203	4299	6502	SO:0001583	missense	0			-	AF139460	CCDS2981.1, CCDS54626.1	3q13.2	2013-01-08	2004-07-16	2004-07-16	ENSG00000181722	ENSG00000181722		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13503	protein-coding gene	gene with protein product		606025	"""zinc finger protein 288"""	ZNF288		10965110, 11352661	Standard	XM_005247339		Approved	ODA-8S, DKFZp566F123, DPZF	uc003ebi.3	Q9HC78	OTTHUMG00000159366	ENST00000474710.1:c.2209C>T	3.37:g.114057869G>A	ENSP00000419153:p.His737Tyr		Q63HP6|Q8N6R5|Q9Y410	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H737Y	ENST00000474710.1	37	c.2209	CCDS54626.1	3	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620690	0.66787	.	.	ENSG00000181722	ENST00000462705;ENST00000393785;ENST00000481632;ENST00000471418;ENST00000474710;ENST00000357258;ENST00000464560	T;T;T;T;T;T;T	0.26067	1.86;1.86;1.86;1.86;1.76;1.86;1.86	5.87	5.87	0.94306	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.104565	0.64402	D	0.000003	T	0.65565	0.2703	H	0.95004	3.61	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	T	0.73871	-0.3846	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	737	Q9HC78	ZBT20_HUMAN	Y	664;664;664;664;737;664;664	ENSP00000420324:H664Y;ENSP00000377375:H664Y;ENSP00000418092:H664Y;ENSP00000419902:H664Y;ENSP00000419153:H737Y;ENSP00000349803:H664Y;ENSP00000417307:H664Y	ENSP00000349803:H664Y	H	-	1	0	ZBTB20	115540559	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.549000	0.98106	2.941000	0.99782	0.655000	0.94253	CAT	-	ZBTB20	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.448	ZBTB20-003	KNOWN	basic|CCDS	protein_coding	ZBTB20	HGNC	protein_coding	OTTHUMT00000354951.1	0	0		48	48		0.00		G	NM_015642		114057869	-1	4		38		tier1	no_errors	ENST00000474710	ensembl	human	known	74_37	missense	9.52		SNP	1.000	A	4	38
WASH3P	374666	genome.wustl.edu	37	15	102514186	102514186	+	RNA	SNP	C	C	T	rs76042271	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr15:102514186C>T	ENST00000557932.1	+	0	779				DDX11L9_ENST00000562189.1_RNA			C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)			central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GCCTGACCTGCCCGGCATTAC	0.577													ENSG00000185596																																					0																																												0			-			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102514186C>T				R	SNP	-	NULL	ENST00000557932.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	c	6.652	0.488870	0.12641	.	.	ENSG00000185596	ENST00000338304;ENST00000398121;ENST00000378819	.	.	.	0.906	0.906	0.19314	.	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	.	.	.	0.44719	D	0.997711	.	.	.	.	.	.	T	0.50039	-0.8874	4	.	.	.	-17.5294	7.6988	0.28611	0.0:1.0:0.0:0.0	.	.	.	.	S	263;252;251	.	.	P	+	1	0	WASH3P	100331709	1.000000	0.71417	0.849000	0.33467	0.486000	0.33341	6.429000	0.73387	0.793000	0.33875	0.184000	0.17185	CCC	rs76042271	WASH3P	-	-		0.577	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	HGNC	pseudogene	OTTHUMT00000417608.1	0	0		61	61		0.00		C	NM_199163		102514186	+1	2		12		tier1	no_errors	ENST00000557932	ensembl	human	known	74_37	rna	14.29		SNP	1.000	T	2	12
GSX1	219409	genome.wustl.edu	37	13	28367862	28367862	+	Missense_Mutation	SNP	T	T	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr13:28367862T>A	ENST00000302945.2	+	2	620	c.572T>A	c.(571-573)gTg>gAg	p.V191E		NM_145657.1	NP_663632.1	Q9H4S2	GSX1_HUMAN	GS homeobox 1	191					adenohypophysis development (GO:0021984)|hypothalamus development (GO:0021854)|neuron fate commitment (GO:0048663)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spinal cord association neuron differentiation (GO:0021527)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4		Lung SC(185;0.0161)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0402)|all cancers(112;0.0404)|OV - Ovarian serous cystadenocarcinoma(117;0.197)		GAGAAGCAGGTGAAGATCTGG	0.617													ENSG00000169840																																					0													82.0	79.0	80.0					13																	28367862		2203	4300	6503	SO:0001583	missense	0			-	AB044157	CCDS9326.1	13q12.2	2012-03-09		2007-07-26	ENSG00000169840	ENSG00000169840		"""Homeoboxes / ANTP class : HOXL subclass"""	20374	protein-coding gene	gene with protein product				GSH1			Standard	NM_145657		Approved	Gsh-1	uc001urr.1	Q9H4S2	OTTHUMG00000016637	ENST00000302945.2:c.572T>A	13.37:g.28367862T>A	ENSP00000304331:p.Val191Glu		Q9UD62	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.V191E	ENST00000302945.2	37	c.572	CCDS9326.1	13	.	.	.	.	.	.	.	.	.	.	T	20.4	3.981667	0.74474	.	.	ENSG00000169840	ENST00000302945	D	0.99032	-5.35	4.86	3.65	0.41850	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.99565	4.63	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97787	1.0236	10	0.87932	D	0	.	11.5574	0.50757	0.0:0.0:0.1502:0.8498	.	191	Q9H4S2	GSX1_HUMAN	E	191	ENSP00000304331:V191E	ENSP00000304331:V191E	V	+	2	0	GSX1	27265862	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.961000	0.87903	0.676000	0.31285	0.459000	0.35465	GTG	-	GSX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa		0.617	GSX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSX1	HGNC	protein_coding	OTTHUMT00000044309.2	0	0		36	36		0.00		T	NM_145657		28367862	+1	12		30		tier1	no_errors	ENST00000302945	ensembl	human	known	74_37	missense	28.57		SNP	1.000	A	12	30
RAB1B	81876	genome.wustl.edu	37	11	66039142	66039143	+	Intron	INS	-	-	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr11:66039142_66039143insA	ENST00000311481.6	+	2	161				RAB1B_ENST00000527397.1_Intron|RP11-867G23.3_ENST00000501708.1_lincRNA	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family						ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						accttattgctaaaaaaaaaat	0.5													ENSG00000245156																																					0																																										SO:0001627	intron_variant	0				AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.15-125->A	11.37:g.66039152_66039152dupA			A8K7S1	R	INS	-	NULL	ENST00000311481.6	37	NULL	CCDS31613.1	11																																																																																				RP11-867G23.3	-	-		0.500	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245156	Clone_based_vega_gene	protein_coding	OTTHUMT00000391886.2	0	0		25	25		0.00		-	NM_030981		66039143	-1	4		13		tier1	no_errors	ENST00000501708	ensembl	human	known	74_37	rna	23.53		INS	0.001:0.020	A	4	13
IDE	3416	genome.wustl.edu	37	10	94228696	94228696	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr10:94228696G>T	ENST00000265986.6	-	19	2316	c.2260C>A	c.(2260-2262)Cat>Aat	p.H754N	IDE_ENST00000371581.5_Missense_Mutation_p.H199N|IDE_ENST00000496903.1_5'UTR	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	754					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	GGTTTGGTATGAGCATGTTCA	0.398													ENSG00000119912																																					0													123.0	112.0	115.0					10																	94228696		2203	4300	6503	SO:0001583	missense	0			-	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2260C>A	10.37:g.94228696G>T	ENSP00000265986:p.His754Asn		B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.H754N	ENST00000265986.6	37	c.2260	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	G	5.180	0.218772	0.09810	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.07800	3.16;3.16	5.6	4.7	0.59300	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.03520	0.0101	N	0.01789	-0.72	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.17433	0.001;0.018	T	0.42982	-0.9419	10	0.12103	T	0.63	-9.5745	14.1886	0.65623	0.0725:0.0:0.9275:0.0	.	754;199	P14735;B3KSB8	IDE_HUMAN;.	N	754;199	ENSP00000265986:H754N;ENSP00000360637:H199N	ENSP00000265986:H754N	H	-	1	0	IDE	94218676	1.000000	0.71417	0.998000	0.56505	0.862000	0.49288	9.134000	0.94467	1.373000	0.46208	-0.140000	0.14226	CAT	-	IDE	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16		0.398	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	0	0		75	75		0.00		G	NM_004969		94228696	-1	41		6		tier1	no_errors	ENST00000265986	ensembl	human	known	74_37	missense	87.23		SNP	1.000	T	41	6
FUBP1	8880	genome.wustl.edu	37	1	78426184	78426185	+	Intron	INS	-	-	A	rs545766306		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:78426184_78426185insA	ENST00000370768.2	-	15	1426				FUBP1_ENST00000370767.1_Intron|FUBP1_ENST00000436586.2_Intron	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1						positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CTGGGCCCTACAAAAAAAAGGA	0.475			"""F, N"""		oligodendroglioma								ENSG00000162613																												Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	0																																										SO:0001627	intron_variant	0				U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.1345-4->T	1.37:g.78426192_78426192dupA			Q12828	R	INS	-	NULL	ENST00000370768.2	37	NULL	CCDS683.1	1																																																																																				FUBP1	-	-		0.475	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUBP1	HGNC	protein_coding	OTTHUMT00000098030.3	0	0		27	27		0.00		-	NM_003902		78426185	-1	3		30		tier1	no_errors	ENST00000470287	ensembl	human	known	74_37	rna	9.09		INS	0.209:0.567	A	3	30
PAPD5	64282	genome.wustl.edu	37	16	50263703	50263703	+	3'UTR	SNP	A	A	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr16:50263703A>T	ENST00000561678.1	+	0	2305				PAPD5_ENST00000436909.3_3'UTR|PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TTTTTTTTTTAAATATTTTTG	0.299													ENSG00000121274																																					0																																										SO:0001624	3_prime_UTR_variant	0			-	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*464A>T	16.37:g.50263703A>T			B4DV38|Q9NW67|Q9Y6C0	R	SNP	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			-	PAPD5	-	-		0.299	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	HGNC	protein_coding	OTTHUMT00000423150.1	0	0		53	53		0.00		A	NM_022447		50263703	+1	4		44		tier1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	8.33		SNP	0.127	T	4	44
FAM182A	284800	genome.wustl.edu	37	20	26061831	26061831	+	RNA	DEL	G	G	-	rs78032466		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr20:26061831delG	ENST00000376398.2	+	0	851					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A									p.R62fs*49(1)		breast(1)|endometrium(2)|kidney(1)	4						TAGAAATGGTGAGAGAACTTT	0.473													ENSG00000125804																																					1	Deletion - Frameshift(1)	breast(1)											18.0	14.0	15.0					20																	26061831		692	1585	2277			0				AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061831delG			A2RRD0|Q8N947	R	DEL	-	NULL	ENST00000376398.2	37	NULL		20																																																																																				FAM182A	-	-		0.473	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	HGNC	processed_transcript	OTTHUMT00000078473.2	0	0		39	39		0.00		G			26061831	+1	9		29		tier1	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	23.68		DEL	0.232	-	9	29
DRP2	1821	genome.wustl.edu	37	X	100509889	100509889	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chrX:100509889C>T	ENST00000395209.3	+	19	2683	c.2156C>T	c.(2155-2157)tCc>tTc	p.S719F	DRP2_ENST00000402866.1_Missense_Mutation_p.S719F|DRP2_ENST00000538510.1_Missense_Mutation_p.S719F|DRP2_ENST00000541709.1_Missense_Mutation_p.S641F	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	719					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.S716F(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GACACACACTCCCGAATTGAG	0.577													ENSG00000102385																																					1	Substitution - Missense(1)	lung(1)											121.0	97.0	105.0					X																	100509889		2203	4300	6503	SO:0001583	missense	0			-	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2156C>T	X.37:g.100509889C>T	ENSP00000378635:p.Ser719Phe		A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.S719F	ENST00000395209.3	37	c.2156	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199533	0.79015	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	4.73	4.73	0.59995	.	0.157584	0.64402	D	0.000019	D	0.93831	0.8027	M	0.86178	2.8	0.58432	D	0.999999	D	0.65815	0.995	D	0.72982	0.979	D	0.94936	0.8087	10	0.87932	D	0	-12.0203	16.5016	0.84259	0.0:1.0:0.0:0.0	.	719	Q13474	DRP2_HUMAN	F	719;719;641;719	ENSP00000385038:S719F;ENSP00000378635:S719F;ENSP00000444752:S641F;ENSP00000441051:S719F	ENSP00000378635:S719F	S	+	2	0	DRP2	100396545	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.041000	0.49807	2.174000	0.68829	0.544000	0.68410	TCC	-	DRP2	-	pirsf_Dystrophin-related_2		0.577	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	HGNC	protein_coding	OTTHUMT00000057522.3	0	0		20	20		0.00		C	NM_001939		100509889	+1	5		13		tier1	no_errors	ENST00000395209	ensembl	human	known	74_37	missense	27.78		SNP	1.000	T	5	13
KCNC2	3747	genome.wustl.edu	37	12	75435998	75435999	+	3'UTR	DEL	TA	TA	-	rs201871666|rs551771602|rs7969026	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:75435998_75435999delTA	ENST00000549446.1	-	0	3483_3484				KCNC2_ENST00000341669.3_Intron|KCNC2_ENST00000550433.1_Intron|KCNC2_ENST00000298972.1_Intron|KCNC2_ENST00000548513.1_Intron|KCNC2_ENST00000350228.2_Intron|RP11-81K13.1_ENST00000547040.1_RNA|RP11-81K13.1_ENST00000550049.1_RNA|RP11-81K13.1_ENST00000549762.1_RNA	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2						action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	TTTTTTTTTTTAAAGAGTCTAG	0.386													ENSG00000257434																																					0																																										SO:0001624	3_prime_UTR_variant	0				AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.*887TA>-	12.37:g.75435998_75435999delTA			B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	R	DEL	-	NULL	ENST00000549446.1	37	NULL	CCDS9007.1	12																																																																																				RP11-81K13.1	-	-		0.386	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257434	Clone_based_vega_gene	protein_coding	OTTHUMT00000405581.2	0	0		27	27		0.00		TA	NM_153748		75435999	+1	3		22		tier1	no_errors	ENST00000547040	ensembl	human	known	74_37	rna	12.00		DEL	0.000:0.000	-	3	22
TAF1L	138474	genome.wustl.edu	37	9	32633008	32633008	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:32633008G>A	ENST00000242310.4	-	1	2659	c.2570C>T	c.(2569-2571)tCa>tTa	p.S857L	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	857					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GCTGCTTTCTGAATGGGAAGG	0.443													ENSG00000122728																																					0													115.0	121.0	119.0					9																	32633008		2203	4297	6500	SO:0001583	missense	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2570C>T	9.37:g.32633008G>A	ENSP00000418379:p.Ser857Leu		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.S857L	ENST00000242310.4	37	c.2570	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170518	0.57584	.	.	ENSG00000122728	ENST00000242310	T	0.14766	2.48	1.19	1.19	0.21007	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.38054	0.1026	M	0.90252	3.1	0.53688	D	0.999978	D	0.89917	1.0	D	0.81914	0.995	T	0.29549	-1.0008	10	0.87932	D	0	.	7.8312	0.29344	0.0:0.0:1.0:0.0	.	857	Q8IZX4	TAF1L_HUMAN	L	857	ENSP00000418379:S857L	ENSP00000418379:S857L	S	-	2	0	TAF1L	32623008	1.000000	0.71417	0.993000	0.49108	0.899000	0.52679	6.137000	0.71710	0.632000	0.30432	0.195000	0.17529	TCA	-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0		68	68		0.00		G			32633008	-1	31		72		tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	30.10		SNP	1.000	A	31	72
PTHLH	5744	genome.wustl.edu	37	12	28114897	28114898	+	Intron	INS	-	-	T	rs377014358		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:28114897_28114898insT	ENST00000545234.1	-	5	1065				RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000538310.1_Frame_Shift_Ins_p.K186fs|PTHLH_ENST00000395872.1_Intron|PTHLH_ENST00000539239.1_Intron|PTHLH_ENST00000354417.3_Frame_Shift_Ins_p.K186fs			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					TGTTGTTTTCCTTTTTTTTTTT	0.337													ENSG00000087494																																					0																																										SO:0001627	intron_variant	0					CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382->A	12.37:g.28114908_28114908dupT			Q15251|Q6FH74	Frame_Shift_Ins	INS	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.E187fs	ENST00000545234.1	37	c.558_557	CCDS44853.1	12																																																																																				PTHLH	-	NULL		0.337	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	HGNC	protein_coding	OTTHUMT00000402913.1	0	0		31	31		0.00		-	NM_198965		28114898	-1	9		38		tier1	no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_ins	19.15		INS	0.126:0.135	T	9	38
DNAH7	56171	genome.wustl.edu	37	2	196619234	196619234	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:196619234C>A	ENST00000312428.6	-	63	11691	c.11591G>T	c.(11590-11592)tGg>tTg	p.W3864L	DNAH7_ENST00000409063.1_Missense_Mutation_p.W347L	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3864					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AACCTCATACCATTGCTAGGG	0.488													ENSG00000118997																																					0													78.0	80.0	80.0					2																	196619234		1904	4119	6023	SO:0001583	missense	0			-	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11591G>T	2.37:g.196619234C>A	ENSP00000311273:p.Trp3864Leu		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.W3864L	ENST00000312428.6	37	c.11591	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480531	0.63849	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.09445	2.98;2.98	5.55	5.55	0.83447	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	H	0.99104	4.43	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75167	-0.3413	10	0.87932	D	0	.	19.2868	0.94082	0.0:1.0:0.0:0.0	.	3864	Q8WXX0	DYH7_HUMAN	L	3864;347	ENSP00000311273:W3864L;ENSP00000386912:W347L	ENSP00000311273:W3864L	W	-	2	0	DNAH7	196327479	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.332000	0.79203	2.885000	0.99019	0.655000	0.94253	TGG	-	DH7	-	pfam_Dynein_heavy_dom		0.488	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DH7	HGNC	protein_coding	OTTHUMT00000335202.3	0	0		67	67		0.00		C	NM_018897		196619234	-1	24		62		tier1	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	27.91		SNP	1.000	A	24	62
SH3BP5	9467	genome.wustl.edu	37	3	15297083	15297083	+	3'UTR	DEL	T	T	-			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr3:15297083delT	ENST00000383791.3	-	0	2098				SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)						intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						TGTTCTTGGATTTTTTTTTTT	0.363													ENSG00000224660																																					0																																										SO:0001624	3_prime_UTR_variant	0				AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.*510A>-	3.37:g.15297083delT			B3KQW6|Q5JWV9	R	DEL	-	NULL	ENST00000383791.3	37	NULL	CCDS2625.2	3																																																																																				SH3BP5-AS1	-	-		0.363	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5-AS1	HGNC	protein_coding	OTTHUMT00000340740.2	0	0		28	28		0.00		T	NM_004844		15297083	+1	3		16		tier1	no_errors	ENST00000420195	ensembl	human	known	74_37	rna	15.79		DEL	0.010	-	3	16
PRIM2	5558	genome.wustl.edu	37	6	57512787	57512788	+	3'UTR	INS	-	-	CACCAAGGC	rs373452397|rs376103961|rs386701662|rs79832250		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:57512787_57512788insCACCAAGGC	ENST00000389488.2	+	0	1702_1703				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttgcactctgttgtgtaattgt	0.431													ENSG00000146143																																					0																																										SO:0001624	3_prime_UTR_variant	0					CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1700->CACCAAGGC	6.37:g.57512787_57512788insCACCAAGGC			Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	R	INS	-	NULL	ENST00000389488.2	37	NULL		6																																																																																				PRIM2	-	-		0.431	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3									-	NM_000947		57512788	+1					tier1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna			INS	0.057:0.034	CACCAAGGC		
T	6862	genome.wustl.edu	37	6	166571913	166571913	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:166571913G>T	ENST00000296946.2	-	9	1666	c.1198C>A	c.(1198-1200)Ctg>Atg	p.L400M	T_ENST00000366871.3_Missense_Mutation_p.L342M	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	400					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		CCTTCGTACAGTGGGGATCCC	0.692									Chordoma, Familial Clustering of				ENSG00000164458																																					0													58.0	67.0	64.0					6																	166571913		2203	4298	6501	SO:0001583	missense	0	Familial Cancer Database		-	AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1198C>A	6.37:g.166571913G>T	ENSP00000296946:p.Leu400Met		E7ERD6|Q4KMP4	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_D-bd,smart_TF_T-box,prints_TF_Brachyury,prints_TF_T-box,pfscan_TF_T-box	p.L400M	ENST00000296946.2	37	c.1198	CCDS5290.1	6	.	.	.	.	.	.	.	.	.	.	G	4.894	0.166192	0.09339	.	.	ENSG00000164458	ENST00000366876;ENST00000296946;ENST00000366871	D;D	0.83250	-1.7;-1.68	4.92	3.06	0.35304	.	0.476235	0.17838	N	0.160310	T	0.53286	0.1787	L	0.41027	1.25	0.21604	N	0.999626	B;B;B	0.19817	0.039;0.005;0.002	B;B;B	0.19148	0.024;0.006;0.008	T	0.40496	-0.9560	10	0.23302	T	0.38	.	5.357	0.16067	0.1686:0.0:0.6629:0.1685	.	342;400;342	E7ERD6;O15178;Q4KMP4	.;BRAC_HUMAN;.	M	400;400;342	ENSP00000296946:L400M;ENSP00000355836:L342M	ENSP00000296946:L400M	L	-	1	2	T	166491903	0.477000	0.25909	0.579000	0.28588	0.104000	0.19210	0.729000	0.26028	0.521000	0.28445	0.655000	0.94253	CTG	-	T	-	NULL		0.692	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	T	HGNC	protein_coding	OTTHUMT00000043037.2	0	0		72	72		0.00		G	NM_003181		166571913	-1	44		16		tier1	no_errors	ENST00000296946	ensembl	human	known	74_37	missense	73.33		SNP	0.030	T	44	16
ZNF704	619279	genome.wustl.edu	37	8	81571895	81571895	+	Silent	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr8:81571895C>T	ENST00000327835.3	-	7	1188	c.957G>A	c.(955-957)tcG>tcA	p.S319S		NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	319							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			TGAACTTGGCCGATCCTGGAA	0.463													ENSG00000164684																																					0													147.0	157.0	154.0					8																	81571895		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.957G>A	8.37:g.81571895C>T			B2RNE6|B9EGW6	Silent	SNP	pfscan_Znf_C2H2	p.S319	ENST00000327835.3	37	c.957	CCDS34913.1	8																																																																																			-	ZNF704	-	NULL		0.463	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF704	HGNC	protein_coding	OTTHUMT00000379964.2	0	0		109	109		0.00		C	NM_001033723		81571895	-1	21		70		tier1	no_errors	ENST00000327835	ensembl	human	known	74_37	silent	23.08		SNP	0.000	T	21	70
HP	3240	genome.wustl.edu	37	16	72093094	72093095	+	Intron	INS	-	-	CTGAGCA	rs573073579	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr16:72093094_72093095insCTGAGCA	ENST00000355906.5	+	6	500				HP_ENST00000357763.4_Intron|HP_ENST00000562526.1_Intron|HP_ENST00000569639.1_Frame_Shift_Ins_p.-92fs|HPR_ENST00000356967.5_Intron|HP_ENST00000398131.2_Intron|HP_ENST00000565574.1_Intron|HP_ENST00000570083.1_Intron	NM_005143.3	NP_005134.1	P00738	HPT_HUMAN	haptoglobin						acute-phase response (GO:0006953)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|immune system process (GO:0002376)|negative regulation of hydrogen peroxide catabolic process (GO:2000296)|negative regulation of oxidoreductase activity (GO:0051354)|positive regulation of cell death (GO:0010942)|response to hydrogen peroxide (GO:0042542)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)	antioxidant activity (GO:0016209)|hemoglobin binding (GO:0030492)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7		Renal(780;9.67e-05)|Ovarian(137;0.00327)|Hepatocellular(780;0.114)		BRCA - Breast invasive adenocarcinoma(221;0.00015)|Kidney(780;0.000529)		GCAGGTGGGTGCTGAGCACTTA	0.52													ENSG00000257017		169	0.033746	0.0908	0.0159	5008	,	,		18348	0.003		0.0338	False		,,,				2504	0.001																0									,	115,3291		54,7,1642					,	1.1	0.0		dbSNP_130	111	55,7727		21,13,3857	no	intron,intron	HP	NM_005143.3,NM_001126102.1	,	75,20,5499	A1A1,A1R,RR		0.7068,3.3764,1.5195	,	,		170,11018				SO:0001627	intron_variant	0					CCDS45524.1, CCDS45525.1	16q22.2	2012-10-02			ENSG00000257017	ENSG00000257017			5141	protein-coding gene	gene with protein product		140100				11109501, 9352226	Standard	NM_005143		Approved		uc002fbr.4	P00738		ENST00000355906.5:c.442+7->CTGAGCA	16.37:g.72093095_72093101dupCTGAGCA			B0AZL5|P00737|Q0VAC4|Q0VAC5|Q2PP15|Q3B7J0|Q6LBY9|Q9UC67	Frame_Shift_Ins	INS	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.*93fs	ENST00000355906.5	37	c.272_273	CCDS45524.1	16																																																																																				HP	-	NULL		0.520	HP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HP	HGNC	protein_coding	OTTHUMT00000421680.1									-	NM_005143		72093095	+1					tier1	no_errors	ENST00000569639	ensembl	human	putative	74_37	frame_shift_ins			INS	0.001:0.000	CTGAGCA		
SIX5	147912	genome.wustl.edu	37	19	46265047	46265048	+	IGR	INS	-	-	TCCAGC	rs139434566|rs59054027		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr19:46265047_46265048insTCCAGC	ENST00000317578.6	-	0	3318				AC074212.5_ENST00000559756.1_RNA|AC074212.3_ENST00000457052.2_In_Frame_Ins_p.453_453S>SSS	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GCAAGGCGCCAtccagctccag	0.658													ENSG00000237452																																					0																																										SO:0001628	intergenic_variant	0				L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196			19.37:g.46265048_46265053dupTCCAGC				In_Frame_Ins	INS	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.456in_frame_insSS	ENST00000317578.6	37	c.1356_1357	CCDS12673.1	19																																																																																				AC074212.3	-	NULL		0.658	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237452	Clone_based_vega_gene	protein_coding	OTTHUMT00000417341.3									-	NM_175875		46265048	+1					tier1	no_errors	ENST00000457052	ensembl	human	putative	74_37	in_frame_ins			INS	0.000:0.004	TCCAGC		
TBX5	6910	genome.wustl.edu	37	12	114793374	114793374	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:114793374C>A	ENST00000310346.4	-	9	2186	c.1520G>T	c.(1519-1521)gGa>gTa	p.G507V	TBX5_ENST00000405440.2_Missense_Mutation_p.G507V|TBX5_ENST00000349716.5_Missense_Mutation_p.G457V	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	507				PRTLSPHQYHSVHGVGMVPEWSDNS -> QGLYPLISTTLC TELAWCRVERQ (in Ref. 1; CAA70592). {ECO:0000305}.	apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CATGCCAACTCCGTGCACAGA	0.542													ENSG00000089225																									NSCLC(152;1358 1980 4050 23898 40356)												0													52.0	50.0	51.0					12																	114793374		2203	4300	6503	SO:0001583	missense	0			-	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.1520G>T	12.37:g.114793374C>A	ENSP00000309913:p.Gly507Val		A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_D-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.G507V	ENST00000310346.4	37	c.1520	CCDS9173.1	12	.	.	.	.	.	.	.	.	.	.	C	16.53	3.150000	0.57151	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000405440	D;D;D	0.88664	-2.36;-2.41;-2.41	5.42	5.42	0.78866	.	0.205916	0.50627	D	0.000111	D	0.88833	0.6544	L	0.46157	1.445	0.80722	D	1	P	0.48162	0.906	P	0.46585	0.521	D	0.88798	0.3283	10	0.46703	T	0.11	.	19.2304	0.93836	0.0:1.0:0.0:0.0	.	507	Q99593	TBX5_HUMAN	V	457;507;507	ENSP00000337723:G457V;ENSP00000309913:G507V;ENSP00000384152:G507V	ENSP00000309913:G507V	G	-	2	0	TBX5	113277757	1.000000	0.71417	0.155000	0.22561	0.925000	0.55904	7.487000	0.81328	2.540000	0.85666	0.655000	0.94253	GGA	-	TBX5	-	NULL		0.542	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	HGNC	protein_coding	OTTHUMT00000388297.1	0	0		34	34		0.00		C	NM_080717		114793374	-1	9		28		tier1	no_errors	ENST00000310346	ensembl	human	known	74_37	missense	24.32		SNP	0.996	A	9	28
RABGGTB	5876	genome.wustl.edu	37	1	76259678	76259714	+	Intron	DEL	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	-	rs372421559|rs377221880|rs75986168|rs141490560|rs377745023	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	ENST00000319942.3	+	8	776				RABGGTB_ENST00000535300.1_Intron|RABGGTB_ENST00000496055.1_Intron|MSH4_ENST00000263187.3_5'Flank	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						CATCAGATTACCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCTCAAAATTAGG	0.376													ENSG00000137955		911	0.181909	0.1604	0.2781	5008	,	,		24903	0.0169		0.2843	False		,,,				2504	0.2076																0																																										SO:0001627	intron_variant	0				U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.706-55CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT>-	1.37:g.76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT			Q92697	R	DEL	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																				RABGGTB	-	-		0.376	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1									CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	NM_004582		76259714	+1					tier1	no_errors	ENST00000459697	ensembl	human	known	74_37	rna			DEL	0.002:0.001:0.001:0.000:0.002:0.005:0.008:0.009:0.007:0.005:0.003:0.003:0.001:0.001:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000	-		
PINLYP	390940	genome.wustl.edu	37	19	44085493	44085493	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr19:44085493G>T	ENST00000599207.1	+	3	317	c.317G>T	c.(316-318)gGc>gTc	p.G106V	L34079.2_ENST00000594374.1_Intron|PINLYP_ENST00000569031.2_Missense_Mutation_p.G18V|PINLYP_ENST00000562365.2_Missense_Mutation_p.G18V|PINLYP_ENST00000562255.1_Missense_Mutation_p.G18V	NM_001193621.1	NP_001180550.1	A6NC86	PINLY_HUMAN	phospholipase A2 inhibitor and LY6/PLAUR domain containing	106	UPAR/Ly6.					extracellular region (GO:0005576)	phospholipase inhibitor activity (GO:0004859)										CAGAGCGACGGCTGCAACAGT	0.592													ENSG00000234465																																					0																																										SO:0001583	missense	0			-		CCDS58667.1, CCDS74385.1	19q13.31	2012-07-20			ENSG00000234465	ENSG00000234465			44206	protein-coding gene	gene with protein product							Standard	NM_001193621		Approved		uc021uvg.1	A6NC86	OTTHUMG00000175560	ENST00000599207.1:c.317G>T	19.37:g.44085493G>T	ENSP00000469886:p.Gly106Val		B7Z457|O95053	Missense_Mutation	SNP	pfam_LY6_UPAR	p.G18V	ENST00000599207.1	37	c.53		19																																																																																			-	PINLYP	-	NULL		0.592	PINLYP-005	NOVEL	basic|appris_principal	protein_coding	PINLYP	HGNC	protein_coding	OTTHUMT00000463346.2	0	0		40	40		0.00		G	NM_001193621		44085493	+1	4		33		tier1	no_errors	ENST00000562255	ensembl	human	known	74_37	missense	10.81		SNP	0.950	T	4	33
MIR3156-3	100423018	genome.wustl.edu	37	21	14778707	14778707	+	RNA	SNP	C	C	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr21:14778707C>G	ENST00000580304.1	-	0	74					NR_036164.1				microRNA 3156-3																		ACTATATATACAGAGAGAAAG	0.398													ENSG00000266211																																					0																																												0			-			21	2011-09-12				ENSG00000266211		"""ncRNAs / Micro RNAs"""	38229	non-coding RNA	RNA, micro							Standard	NR_036164		Approved	hsa-mir-3156-3	uc021whb.1				21.37:g.14778707C>G				R	SNP	-	NULL	ENST00000580304.1	37	NULL		21																																																																																			-	MIR3156-3	-	-		0.398	MIR3156-3-201	KNOWN	basic	miRNA	MIR3156-3	HGNC	miRNA		0	0		79	79		0.00		C	NR_036164		14778707	-1	46		13		tier1	no_errors	ENST00000580304	ensembl	human	known	74_37	rna	77.97		SNP	0.000	G	46	13
KIAA1875	340390	genome.wustl.edu	37	8	145162757	145162757	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr8:145162757delA	ENST00000323662.8	+	1	129	c.104delA	c.(103-105)gaafs	p.E35fs				A6NE52	K1875_HUMAN	KIAA1875	35										large_intestine(1)	1						CTGCTCACCGAAAAGAATGGT	0.607													ENSG00000179698																																					0																																										SO:0001589	frameshift_variant	0				AB058778		8q24.3	2013-01-10			ENSG00000179698	ENSG00000179698		"""WD repeat domain containing"""	26959	protein-coding gene	gene with protein product						11347906	Standard	NR_024207		Approved		uc011lky.1	A6NE52	OTTHUMG00000165245	ENST00000323662.8:c.104delA	8.37:g.145162757delA	ENSP00000320648:p.Glu35fs		Q96JF2	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K36fs	ENST00000323662.8	37	c.104		8																																																																																				KIAA1875	-	NULL		0.607	KIAA1875-007	PUTATIVE	basic|appris_principal	protein_coding	KIAA1875	HGNC	protein_coding	OTTHUMT00000382917.1	0	0		26	26		0.00		A	NM_032529		145162757	+1	2		23		tier1	no_errors	ENST00000534167	ensembl	human	known	74_37	frame_shift_del	8.00		DEL	0.010	-	2	23
KANSL3	55683	genome.wustl.edu	37	2	97276511	97276511	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:97276511C>T	ENST00000431828.1	-	11	1347	c.1271G>A	c.(1270-1272)cGa>cAa	p.R424Q	KANSL3_ENST00000440133.1_Missense_Mutation_p.R218Q|KANSL3_ENST00000599854.1_Missense_Mutation_p.R337Q|KANSL3_ENST00000487070.1_5'UTR|KANSL3_ENST00000441706.2_Missense_Mutation_p.R337Q			Q9P2N6	KANL3_HUMAN	KAT8 regulatory NSL complex subunit 3	424					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GTTCTCAGCTCGAATCTTCTC	0.507													ENSG00000114982																																					0													124.0	122.0	123.0					2																	97276511		1915	4135	6050	SO:0001583	missense	0			-	BC063792	CCDS46361.1	2q11.2	2011-10-31	2011-10-31	2011-10-31	ENSG00000114982	ENSG00000114982			25473	protein-coding gene	gene with protein product			"""KIAA1310"""	KIAA1310			Standard	NM_001115016		Approved	FLJ10081, Rcd1, NSL3	uc002swn.5	Q9P2N6	OTTHUMG00000155249	ENST00000431828.1:c.1271G>A	2.37:g.97276511C>T	ENSP00000396749:p.Arg424Gln		A1L184|D3DXH3|D3DXH4|Q05BU4|Q6P3X2|Q6PJH6|Q86T19|Q96L64|Q9H0C9|Q9H8C9|Q9HAP8|Q9NWE5	Missense_Mutation	SNP	NULL	p.R424Q	ENST00000431828.1	37	c.1271	CCDS46361.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.163128	0.94727	.	.	ENSG00000114982	ENST00000354204;ENST00000447759;ENST00000431828;ENST00000441706;ENST00000440133;ENST00000444759;ENST00000452268	T;T;T	0.22743	1.94;1.94;1.94	5.92	5.92	0.95590	.	0.052599	0.85682	D	0.000000	T	0.26666	0.0652	N	0.14661	0.345	0.80722	D	1	P;D;P;D	0.71674	0.836;0.997;0.803;0.998	B;P;B;P	0.58780	0.167;0.663;0.147;0.845	T	0.02444	-1.1158	10	0.37606	T	0.19	.	17.8105	0.88614	0.0:1.0:0.0:0.0	.	218;424;337;312	B4E1W4;Q9P2N6-3;Q9P2N6-5;Q9P2N6-6	.;.;.;.	Q	337;312;424;337;218;218;337	ENSP00000396749:R424Q;ENSP00000400678:R337Q;ENSP00000406207:R218Q	ENSP00000346144:R337Q	R	-	2	0	KIAA1310	96640238	1.000000	0.71417	0.848000	0.33437	0.989000	0.77384	5.811000	0.69187	2.809000	0.96659	0.557000	0.71058	CGA	-	KANSL3	-	NULL		0.507	KANSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	KANSL3	HGNC	protein_coding	OTTHUMT00000339040.2	0	0		49	49		0.00		C	NM_017991		97276511	-1	21		20		tier1	no_errors	ENST00000431828	ensembl	human	known	74_37	missense	51.22		SNP	0.995	T	21	20
MAN1B1	11253	genome.wustl.edu	37	9	139998211	139998212	+	Intron	DEL	GT	GT	-	rs527754315	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:139998211_139998212delGT	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Intron	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		CAGGTCGGTGGTGTTACATTCA	0.54													ENSG00000177239		13	0.00259585	0.0	0.0	5008	,	,		29423	0.0		0.0	False		,,,				2504	0.0133																0																																										SO:0001627	intron_variant	0				AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2087GT>-	9.37:g.139998213_139998214delGT			Q5VSG3|Q9BRS9|Q9Y5K7	R	DEL	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																				MAN1B1	-	-		0.540	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	0	0		24	24		0.00		GT	NM_016219		139998212	+1	20		24		tier1	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	45.45		DEL	0.513:0.732	-	20	24
GALK1	2584	genome.wustl.edu	37	17	73754413	73754413	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:73754413C>T	ENST00000588479.1	-	7	1559	c.985G>A	c.(985-987)Gtg>Atg	p.V329M	GALK1_ENST00000437911.1_Missense_Mutation_p.V359M|GALK1_ENST00000225614.2_Missense_Mutation_p.V329M			P51570	GALK1_HUMAN	galactokinase 1	329					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCAGCCTCCACCAGCTGGTCC	0.677													ENSG00000108479																																					0													15.0	17.0	16.0					17																	73754413		2183	4287	6470	SO:0001583	missense	0			-		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.985G>A	17.37:g.73754413C>T	ENSP00000465930:p.Val329Met		B2RC07|B4E1G6	Missense_Mutation	SNP	pfam_GalKase_gal-bd,pfam_GHMP_kinase_C_dom,pfam_GHMP_kinase_N_dom,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Galactokinase,prints_Mevalonate/galactokinase,prints_Galactokinase,prints_Galkinase,tigrfam_Galactokinase	p.V359M	ENST00000588479.1	37	c.1075	CCDS11728.1	17	.	.	.	.	.	.	.	.	.	.	C	22.5	4.304142	0.81136	.	.	ENSG00000108479	ENST00000225614;ENST00000437911	D;D	0.91686	-2.89;-2.89	4.46	4.46	0.54185	GHMP kinase, C-terminal (1);	.	.	.	.	D	0.97504	0.9183	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99129	1.0852	9	0.87932	D	0	-30.0445	17.3028	0.87187	0.0:1.0:0.0:0.0	.	329	P51570	GALK1_HUMAN	M	329;359	ENSP00000225614:V329M;ENSP00000406305:V359M	ENSP00000225614:V329M	V	-	1	0	GALK1	71266008	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	7.141000	0.77330	2.317000	0.78254	0.563000	0.77884	GTG	-	GALK1	-	pfam_GHMP_kinase_C_dom,pirsf_Galactokinase,tigrfam_Galactokinase		0.677	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	GALK1	HGNC	protein_coding	OTTHUMT00000448430.1	0	0		21	21		0.00		C			73754413	-1	3		12		tier1	no_errors	ENST00000437911	ensembl	human	known	74_37	missense	20.00		SNP	1.000	T	3	12
RTKN2	219790	genome.wustl.edu	37	10	64022582	64022583	+	Splice_Site	INS	-	-	A	rs149410563		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr10:64022582_64022583insA	ENST00000373789.3	-	2	157		c.e2-2		RTKN2_ENST00000395260.3_Splice_Site|RTKN2_ENST00000395265.1_Splice_Site	NM_145307.2	NP_660350.2	Q8IZC4	RTKN2_HUMAN	rhotekin 2						hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(12;0.0297)|all_hematologic(501;0.215)					GTTGCAGTCCTAAAAAAAAAAT	0.302													ENSG00000182010																																					0																																										SO:0001630	splice_region_variant	0				BC025765	CCDS7263.1, CCDS73140.1	10q21.3	2013-01-10	2007-12-14	2007-12-14	ENSG00000182010	ENSG00000182010		"""Pleckstrin homology (PH) domain containing"""	19364	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family K member 1"""	PLEKHK1		15504364	Standard	NM_001282941		Approved	Em:AC024597.2, bA531F24.1, FLJ39352	uc001jlw.3	Q8IZC4	OTTHUMG00000018299	ENST00000373789.3:c.61-2->T	10.37:g.64022592_64022592dupA			Q3ZCR1|Q68DZ6|Q8N8K1|Q8TAV2	Splice_Site	INS	-	e2-2	ENST00000373789.3	37	c.61-3_61-2	CCDS7263.1	10																																																																																				RTKN2	-	-		0.302	RTKN2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RTKN2	HGNC	protein_coding	OTTHUMT00000091618.1	0	0		30	30		0.00		-	NM_145307	Intron	64022583	-1	5		22		tier1	no_errors	ENST00000373789	ensembl	human	known	74_37	splice_site_ins	18.52		INS	1.000:0.881	A	5	22
DYTN	391475	genome.wustl.edu	37	2	207530749	207530749	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:207530749G>A	ENST00000452335.2	-	10	1101	c.985C>T	c.(985-987)Ctt>Ttt	p.L329F		NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	329						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		TGTTTTTTAAGGAGCCTGAAA	0.403													ENSG00000232125																																					0													137.0	122.0	127.0					2																	207530749		1834	4080	5914	SO:0001583	missense	0			-	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.985C>T	2.37:g.207530749G>A	ENSP00000396593:p.Leu329Phe			Missense_Mutation	SNP	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.L329F	ENST00000452335.2	37	c.985	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274445	0.40194	.	.	ENSG00000232125	ENST00000452335	T	0.15603	2.41	4.33	2.46	0.29980	.	.	.	.	.	T	0.20536	0.0494	L	0.29908	0.895	0.22050	N	0.999392	D	0.69078	0.997	D	0.63597	0.916	T	0.12811	-1.0533	9	0.13853	T	0.58	-5.7163	6.4251	0.21766	0.2317:0.0:0.7683:0.0	.	329	A2CJ06	DYTN_HUMAN	F	329	ENSP00000396593:L329F	ENSP00000396593:L329F	L	-	1	0	DYTN	207238994	0.984000	0.35163	0.660000	0.29694	0.512000	0.34134	0.996000	0.29719	0.717000	0.32145	0.561000	0.74099	CTT	-	DYTN	-	NULL		0.403	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	HGNC	protein_coding	OTTHUMT00000336799.1	0	0		77	77		0.00		G			207530749	-1	38		31		tier1	no_errors	ENST00000452335	ensembl	human	known	74_37	missense	55.07		SNP	0.930	A	38	31
GMPPA	29926	genome.wustl.edu	37	2	220371491	220371491	+	Nonsense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:220371491C>T	ENST00000358215.3	+	13	1603	c.1234C>T	c.(1234-1236)Cga>Tga	p.R412*	GMPPA_ENST00000313597.5_Nonsense_Mutation_p.R412*|GMPPA_ENST00000373917.3_Nonsense_Mutation_p.R465*|GMPPA_ENST00000341142.3_Nonsense_Mutation_p.R412*|GMPPA_ENST00000373908.1_Nonsense_Mutation_p.R412*|AC053503.11_ENST00000429882.1_RNA	NM_205847.2	NP_995319.1	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	412					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotidyltransferase activity (GO:0016779)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		GGAGCTGAGCCGAAGCTTCAC	0.622													ENSG00000144591																																					0													100.0	80.0	87.0					2																	220371491		2203	4300	6503	SO:0001587	stop_gained	0			-	AF135422	CCDS2441.1	2q36.1	2008-02-05			ENSG00000144591	ENSG00000144591			22923	protein-coding gene	gene with protein product		615495					Standard	NM_205847		Approved		uc002vlr.3	Q96IJ6	OTTHUMG00000058922	ENST00000358215.3:c.1234C>T	2.37:g.220371491C>T	ENSP00000350949:p.Arg412*		A6NJ74|A8K3Q6|B3KMT4|Q53GI0|Q9NWC3|Q9Y5P5	Nonsense_Mutation	SNP	pfam_NTP_transferase	p.R412*	ENST00000358215.3	37	c.1234	CCDS2441.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.332760	0.95733	.	.	ENSG00000144591	ENST00000313597;ENST00000373917;ENST00000358215;ENST00000373908;ENST00000341142	.	.	.	4.08	4.08	0.47627	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2929	11.528	0.50591	0.1794:0.8206:0.0:0.0	.	.	.	.	X	412;465;412;412;412	.	ENSP00000315925:R412X	R	+	1	2	GMPPA	220079735	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.736000	0.38187	1.977000	0.57605	0.467000	0.42956	CGA	-	GMPPA	-	NULL		0.622	GMPPA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GMPPA	HGNC	protein_coding	OTTHUMT00000130230.1	0	0		67	67		0.00		C	NM_013335		220371491	+1	22		40		tier1	no_errors	ENST00000313597	ensembl	human	known	74_37	nonsense	35.48		SNP	1.000	T	22	40
TAF1L	138474	genome.wustl.edu	37	9	32632655	32632655	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:32632655G>A	ENST00000242310.4	-	1	3012	c.2923C>T	c.(2923-2925)Ccc>Tcc	p.P975S	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	975					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CACCCTGTGGGATCTGCCACC	0.498													ENSG00000122728																																					0													174.0	161.0	165.0					9																	32632655		2203	4300	6503	SO:0001583	missense	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2923C>T	9.37:g.32632655G>A	ENSP00000418379:p.Pro975Ser		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.P975S	ENST00000242310.4	37	c.2923	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863129	0.51482	.	.	ENSG00000122728	ENST00000242310	T	0.47177	0.85	1.04	1.04	0.20106	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72846	-0.4169	10	0.87932	D	0	.	7.4859	0.27432	0.0:0.0:1.0:0.0	.	975	Q8IZX4	TAF1L_HUMAN	S	975	ENSP00000418379:P975S	ENSP00000418379:P975S	P	-	1	0	TAF1L	32622655	1.000000	0.71417	0.998000	0.56505	0.886000	0.51366	6.195000	0.72088	0.507000	0.28148	0.195000	0.17529	CCC	-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.498	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0		75	75		0.00		G			32632655	-1	27		43		tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	38.57		SNP	1.000	A	27	43
LPAL2	80350	genome.wustl.edu	37	6	160899631	160899631	+	RNA	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:160899631C>T	ENST00000335388.5	-	0	1253					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		TGTCAGGTTGCAGTACTCCCA	0.493													ENSG00000213071																																					0																																												0			-	U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160899631C>T			E1P5B4	R	SNP	-	NULL	ENST00000335388.5	37	NULL		6																																																																																			-	LPAL2	-	-		0.493	LPAL2-003	KNOWN	basic	processed_transcript	LPAL2	HGNC	pseudogene	OTTHUMT00000042950.1	0	0		53	53		0.00		C	NM_024492		160899631	-1	4		30		tier1	no_errors	ENST00000335388	ensembl	human	known	74_37	rna	11.76		SNP	0.996	T	4	30
MIER3	166968	genome.wustl.edu	37	5	56219632	56219632	+	Missense_Mutation	SNP	T	T	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr5:56219632T>A	ENST00000381199.3	-	12	1091	c.1081A>T	c.(1081-1083)Aca>Tca	p.T361S	MIER3_ENST00000381213.3_Missense_Mutation_p.T360S|MIER3_ENST00000409421.1_Missense_Mutation_p.T298S|SETD9_ENST00000541720.1_Intron|MIER3_ENST00000381226.3_Missense_Mutation_p.T366S			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	361					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		AAAGCTTCTGTTTCATCTACT	0.413													ENSG00000155545																																					0													151.0	147.0	149.0					5																	56219632		2203	4300	6503	SO:0001583	missense	0			-	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.1081A>T	5.37:g.56219632T>A	ENSP00000370596:p.Thr361Ser		B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.T361S	ENST00000381199.3	37	c.1081		5	.	.	.	.	.	.	.	.	.	.	T	9.413	1.080928	0.20309	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.98	4.83	0.62350	.	0.158788	0.56097	D	0.000035	T	0.13372	0.0324	N	0.17474	0.49	0.36221	D	0.852029	B;B;B	0.21606	0.043;0.016;0.058	B;B;B	0.20577	0.025;0.022;0.03	T	0.20538	-1.0272	10	0.02654	T	1	-19.0449	4.8589	0.13573	0.0:0.2519:0.0:0.7481	.	361;366;360	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	S	366;360;361;298	ENSP00000370624:T366S;ENSP00000370611:T360S;ENSP00000370596:T361S;ENSP00000386584:T298S	ENSP00000370596:T361S	T	-	1	0	MIER3	56255389	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.658000	0.54482	2.289000	0.77006	0.460000	0.39030	ACA	-	MIER3	-	NULL		0.413	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2	0	0		71	71		0.00		T	NM_152622		56219632	-1	32		52		tier1	no_errors	ENST00000381199	ensembl	human	known	74_37	missense	38.10		SNP	1.000	A	32	52
SMARCA5	8467	genome.wustl.edu	37	4	144449085	144449085	+	Missense_Mutation	SNP	T	T	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr4:144449085T>C	ENST00000283131.3	+	7	1328	c.866T>C	c.(865-867)aTg>aCg	p.M289T		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	289	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					TCTTATGAAATGCTTATTAAA	0.318													ENSG00000153147																																					0													106.0	107.0	107.0					4																	144449085		2203	4299	6502	SO:0001583	missense	0			-	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.866T>C	4.37:g.144449085T>C	ENSP00000283131:p.Met289Thr			Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M289T	ENST00000283131.3	37	c.866	CCDS3761.1	4	.	.	.	.	.	.	.	.	.	.	T	23.2	4.393303	0.83011	.	.	ENSG00000153147	ENST00000283131;ENST00000536484;ENST00000535006	D	0.92397	-3.03	5.85	5.85	0.93711	DEAD-like helicase (2);SNF2-related (1);	0.045751	0.85682	D	0.000000	D	0.86806	0.6021	N	0.13371	0.34	0.80722	D	1	B	0.18968	0.032	B	0.26310	0.068	D	0.83456	0.0051	10	0.87932	D	0	2.0E-4	16.2473	0.82450	0.0:0.0:0.0:1.0	.	289	O60264	SMCA5_HUMAN	T	289;232;232	ENSP00000283131:M289T	ENSP00000283131:M289T	M	+	2	0	SMARCA5	144668535	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.945000	0.87732	2.238000	0.73509	0.533000	0.62120	ATG	-	SMARCA5	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,pfam_D/R_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.318	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCA5	HGNC	protein_coding	OTTHUMT00000365077.3	0	0		88	88		0.00		T			144449085	+1	62		71		tier1	no_errors	ENST00000283131	ensembl	human	known	74_37	missense	46.62		SNP	1.000	C	62	71
HLA-DPB2	3116	genome.wustl.edu	37	6	33084812	33084812	+	RNA	SNP	A	A	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr6:33084812A>G	ENST00000435074.1	+	0	244									major histocompatibility complex, class II, DP beta 2 (pseudogene)																		CTCATCTACAACCGGGAGGAA	0.557													ENSG00000224557																																					0																																												0			-	M23911		6p21.3	2012-10-02			ENSG00000224557	ENSG00000224557		"""Histocompatibility complex"""	4941	pseudogene	pseudogene				HLA-DP2B		3036829	Standard	NR_001435		Approved	DP2B, DPB2	uc003ocv.1		OTTHUMG00000031080		6.37:g.33084812A>G				R	SNP	-	NULL	ENST00000435074.1	37	NULL		6																																																																																			-	HLA-DPB2	-	-		0.557	HLA-DPB2-002	KNOWN	basic	processed_transcript	HLA-DPB2	HGNC	pseudogene	OTTHUMT00000276666.1	0	0		58	58		0.00		A	NR_001435		33084812	+1	6		42		tier1	no_errors	ENST00000435074	ensembl	human	known	74_37	rna	12.50		SNP	0.995	G	6	42
DRICH1	51233	genome.wustl.edu	37	22	23964283	23964285	+	In_Frame_Del	DEL	CAT	CAT	-	rs66974032|rs142649853|rs10564183|rs200087148	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	CAT	CAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr22:23964283_23964285delCAT	ENST00000317749.5	-	4	674_676	c.377_379delATG	c.(376-381)gatgcc>gcc	p.D126del		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		126	Asp-rich.							p.D126delD(1)		endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						CTTACCTGGGcatcatcatcatc	0.429													ENSG00000189269		621	0.124002	0.1036	0.0937	5008	,	,		21629	0.1895		0.1133	False		,,,				2504	0.1166																1	Deletion - In frame(1)	pancreas(1)																																								SO:0001651	inframe_deletion	0																															ENST00000317749.5:c.377_379delATG	22.37:g.23964292_23964294delCAT	ENSP00000316137:p.Asp126del		Q6ICJ8|Q6P4I3|Q9NU31	In_Frame_Del	DEL	NULL	p.D126in_frame_del	ENST00000317749.5	37	c.379_377	CCDS42985.1	22																																																																																				C22orf43	-	NULL		0.429	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf43	HGNC	protein_coding	OTTHUMT00000319708.2	0	0		31	31		0.00		CAT			23964285	-1	8		13		tier1	no_errors	ENST00000317749	ensembl	human	known	74_37	in_frame_del	38.10		DEL	0.003:0.003:0.004	-	8	13
MTA3	57504	genome.wustl.edu	37	2	42808937	42808937	+	Intron	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr2:42808937G>T	ENST00000405094.1	+	3	190				MTA3_ENST00000406652.1_Intron|MTA3_ENST00000406911.1_Intron|MTA3_ENST00000407270.3_Intron|MTA3_ENST00000405592.1_Intron			Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3							intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(9)|ovary(2)|stomach(1)	15						acggagtttcgctcttgttgc	0.398													ENSG00000057935																																					0																																										SO:0001627	intron_variant	0			-	AB033092	CCDS46267.1, CCDS62900.1	2p22.1	2013-01-25	2004-12-15		ENSG00000057935	ENSG00000057935		"""GATA zinc finger domain containing"""	23784	protein-coding gene	gene with protein product		609050	"""metastasis associated gene family, member 3"""			12705869, 14613024	Standard	NM_001282755		Approved	KIAA1266	uc002rsq.3	Q9BTC8	OTTHUMG00000150452	ENST00000405094.1:c.190+2597G>T	2.37:g.42808937G>T			Q9NSP2|Q9ULF4	Missense_Mutation	SNP	pfam_BAH_dom,pfscan_BAH_dom	p.R68L	ENST00000405094.1	37	c.203		2																																																																																			-	MTA3	-	pfscan_BAH_dom		0.398	MTA3-017	KNOWN	basic	protein_coding	MTA3	HGNC	protein_coding	OTTHUMT00000318159.1	0	0		43	43		0.00		G	NM_020744		42808937	+1	4		40		tier1	no_errors	ENST00000430763	ensembl	human	known	74_37	missense	9.09		SNP	0.002	T	4	40
TAF1L	138474	genome.wustl.edu	37	9	32632965	32632965	+	Silent	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:32632965G>A	ENST00000242310.4	-	1	2702	c.2613C>T	c.(2611-2613)ttC>ttT	p.F871F	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	871					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CTGTGCGTTTGAAGTCAGCGC	0.473													ENSG00000122728																																					0													143.0	144.0	144.0					9																	32632965		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2613C>T	9.37:g.32632965G>A			Q0VG57	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.F871	ENST00000242310.4	37	c.2613	CCDS35003.1	9																																																																																			-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.473	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0		61	61		0.00		G			32632965	-1	25		61		tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	silent	29.07		SNP	1.000	A	25	61
KPNA3	3839	genome.wustl.edu	37	13	50275994	50275994	+	Missense_Mutation	SNP	C	C	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr13:50275994C>G	ENST00000261667.3	-	17	1922	c.1508G>C	c.(1507-1509)gGa>gCa	p.G503A		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	503					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GTAGGTACCTCCTTGTGTTGC	0.333													ENSG00000102753																																					0													161.0	176.0	171.0					13																	50275994		2203	4300	6503	SO:0001583	missense	0			-	D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.1508G>C	13.37:g.50275994C>G	ENSP00000261667:p.Gly503Ala		O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.G503A	ENST00000261667.3	37	c.1508	CCDS9421.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.00|15.00	2.702694|2.702694	0.48307|0.48307	.|.	.|.	ENSG00000102753|ENSG00000102753	ENST00000436760|ENST00000261667	.|T	.|0.63913	.|-0.07	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.52256|0.52256	0.1723|0.1723	N|N	0.20483|0.20483	0.58|0.58	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.13407	.|0.009	T|T	0.37454|0.37454	-0.9705|-0.9705	5|10	.|0.34782	.|T	.|0.22	-14.5765|-14.5765	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|503	.|O00505	.|IMA3_HUMAN	Q|A	90|503	.|ENSP00000261667:G503A	.|ENSP00000261667:G503A	E|G	-|-	1|2	0|0	KPNA3|KPNA3	49173995|49173995	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	3.844000|3.844000	0.55873|0.55873	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAG|GGA	-	KP3	-	NULL		0.333	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KP3	HGNC	protein_coding	OTTHUMT00000044939.2	0	0		50	50		0.00		C	NM_002267		50275994	-1	15		38		tier1	no_errors	ENST00000261667	ensembl	human	known	74_37	missense	28.30		SNP	1.000	G	15	38
NUDT12	83594	genome.wustl.edu	37	5	102891772	102891772	+	Missense_Mutation	SNP	A	A	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr5:102891772A>C	ENST00000230792.2	-	4	920	c.824T>G	c.(823-825)cTt>cGt	p.L275R	NUDT12_ENST00000507423.1_Missense_Mutation_p.L257R|NUDT12_ENST00000515407.1_5'UTR	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	275					NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		GTGCCAGGCAAGAACAGATCT	0.328													ENSG00000112874																																					0													92.0	87.0	89.0					5																	102891772		2202	4300	6502	SO:0001583	missense	0			-	AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.824T>G	5.37:g.102891772A>C	ENSP00000230792:p.Leu275Arg		B3KUW2|Q8TAL7	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,pfam_Ankyrin_rpt,pfam_Znr_DH_PPase,pfam_DH_PPase-like_N,superfamily_NUDIX_hydrolase_dom-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L275R	ENST00000230792.2	37	c.824	CCDS4096.1	5	.	.	.	.	.	.	.	.	.	.	A	24.1	4.497870	0.85069	.	.	ENSG00000112874	ENST00000230792;ENST00000507423	T;T	0.39406	1.08;1.08	5.25	5.25	0.73442	NUDIX hydrolase domain (1);NADH pyrophosphatase-like, N-terminal (1);NUDIX hydrolase domain-like (1);	0.186293	0.48286	D	0.000197	T	0.57519	0.2059	L	0.59436	1.845	0.53688	D	0.999972	P;P	0.51147	0.942;0.872	P;P	0.59171	0.798;0.853	T	0.60622	-0.7227	10	0.66056	D	0.02	-17.2548	15.4155	0.74962	1.0:0.0:0.0:0.0	.	257;275	E7EM93;Q9BQG2	.;NUD12_HUMAN	R	275;257	ENSP00000230792:L275R;ENSP00000424521:L257R	ENSP00000230792:L275R	L	-	2	0	NUDT12	102919671	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.753000	0.91637	2.095000	0.63458	0.528000	0.53228	CTT	-	NUDT12	-	pfam_DH_PPase-like_N,superfamily_NUDIX_hydrolase_dom-like		0.328	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT12	HGNC	protein_coding	OTTHUMT00000250650.1	0	0		33	33		0.00		A	NM_031438		102891772	-1	21		15		tier1	no_errors	ENST00000230792	ensembl	human	known	74_37	missense	58.33		SNP	1.000	C	21	15
MALRD1	340895	genome.wustl.edu	37	10	19778020	19778020	+	Silent	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr10:19778020G>A	ENST00000454679.2	+	15	3045	c.3045G>A	c.(3043-3045)gaG>gaA	p.E1015E	C10orf112_ENST00000455457.2_5'Flank|C10orf112_ENST00000492202.1_Intron			Q5VYJ5	MALR1_HUMAN		1015					cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						CCTTTCCGGAGCCAGAATGCC	0.647													ENSG00000204740																																					0																																										SO:0001819	synonymous_variant	0			-																												ENST00000454679.2:c.3045G>A	10.37:g.19778020G>A			B7ZBP2	Silent	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.E1015	ENST00000454679.2	37	c.3045		10																																																																																			-	C10orf112	-	NULL		0.647	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		0	0		66	66		0.00		G			19778020	+1	6		40		tier1	no_errors	ENST00000454679	ensembl	human	known	74_37	silent	13.04		SNP	0.001	A	6	40
C1orf101	257044	genome.wustl.edu	37	1	244640895	244640895	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:244640895C>A	ENST00000366534.4	+	3	221	c.167C>A	c.(166-168)aCt>aAt	p.T56N	C1orf101_ENST00000366531.3_De_novo_Start_InFrame|C1orf101_ENST00000366533.4_Missense_Mutation_p.T56N|C1orf101_ENST00000473875.1_3'UTR	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	56			T -> S (in dbSNP:rs58602830).			CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			GTGCCAGAAACTTGTTTTGTG	0.274													ENSG00000179397																																					0													181.0	200.0	193.0					1																	244640895		2203	4299	6502	SO:0001583	missense	0			-	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.167C>A	1.37:g.244640895C>A	ENSP00000355492:p.Thr56Asn		B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.T56N	ENST00000366534.4	37	c.167	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	C	4.891	0.165659	0.09339	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042	T;T;T	0.33654	1.41;1.41;1.4	4.16	-0.068	0.13758	.	1.779410	0.03075	N	0.157748	T	0.31420	0.0796	L	0.40543	1.245	0.09310	N	0.999999	P;P;P	0.36837	0.571;0.571;0.571	B;B;B	0.36464	0.225;0.225;0.225	T	0.26121	-1.0112	10	0.51188	T	0.08	.	6.6306	0.22855	0.0:0.5398:0.2809:0.1793	.	46;56;56	B1AQM6;Q5SY80;Q5SY80-2	.;CA101_HUMAN;.	N	56;56;56;46	ENSP00000355492:T56N;ENSP00000355491:T56N;ENSP00000395796:T46N	ENSP00000355491:T56N	T	+	2	0	C1orf101	242707518	0.001000	0.12720	0.004000	0.12327	0.179000	0.23085	-0.910000	0.04054	-0.191000	0.10448	-0.797000	0.03246	ACT	-	C1orf101	-	NULL		0.274	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	0	0		87	87		0.00		C	NM_173807		244640895	+1	11		67		tier1	no_errors	ENST00000366534	ensembl	human	novel	74_37	missense	14.10		SNP	0.007	A	11	67
MANSC1	54682	genome.wustl.edu	37	12	12483640	12483640	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:12483640C>A	ENST00000535902.1	-	4	1180	c.617G>T	c.(616-618)aGt>aTt	p.S206I	MANSC1_ENST00000396349.3_Missense_Mutation_p.S172I|MANSC1_ENST00000545735.1_Missense_Mutation_p.S125I			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	206						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		AAATTGTGAACTCTGAGAATG	0.458													ENSG00000111261																																					0													88.0	92.0	90.0					12																	12483640		2203	4300	6503	SO:0001583	missense	0			-	AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.617G>T	12.37:g.12483640C>A	ENSP00000438205:p.Ser206Ile		Q8NEC1|Q9NW60	Missense_Mutation	SNP	pfam_MANSC_N,smart_MANSC_N,pfscan_MANSC	p.S206I	ENST00000535902.1	37	c.617	CCDS8648.1	12	.	.	.	.	.	.	.	.	.	.	C	14.88	2.666200	0.47677	.	.	ENSG00000111261	ENST00000535902;ENST00000396349;ENST00000355566;ENST00000545735	T;T;T	0.33865	1.75;1.73;1.39	4.81	-3.12	0.05282	.	0.902423	0.09310	N	0.819708	T	0.24586	0.0596	L	0.27053	0.805	0.09310	N	1	P;P;P	0.46512	0.718;0.718;0.879	B;B;P	0.44394	0.216;0.216;0.448	T	0.15549	-1.0433	10	0.72032	D	0.01	-4.1678	5.0812	0.14656	0.0:0.2994:0.2725:0.4282	.	140;172;206	B4DQ82;Q9NW60;Q9H8J5	.;.;MANS1_HUMAN	I	206;172;125;125	ENSP00000438205:S206I;ENSP00000379638:S172I;ENSP00000445303:S125I	ENSP00000347765:S125I	S	-	2	0	MANSC1	12374907	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-0.419000	0.07071	-1.194000	0.02684	0.491000	0.48974	AGT	-	MANSC1	-	NULL		0.458	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANSC1	HGNC	protein_coding	OTTHUMT00000400144.1	0	0		69	69		0.00		C	NM_018050		12483640	-1	18		79		tier1	no_errors	ENST00000535902	ensembl	human	known	74_37	missense	18.56		SNP	0.000	A	18	79
SNORA70	26778	genome.wustl.edu	37	18	3025549	3025549	+	RNA	SNP	T	T	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr18:3025549T>A	ENST00000516449.1	-	0	15									small nucleolar RNA, H/ACA box 70																		AAAAtctttttatttaagaga	0.468													ENSG00000252258																																					0																																												0			-	Y11164		Xq28	2013-09-05	2006-04-05	2006-04-05	ENSG00000207165	ENSG00000207165		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	10231	non-coding RNA	RNA, small nucleolar			"""RNA, U70 small nucleolar"""	RNU70		9106664, 15199136	Standard	NR_000011		Approved	U70, DXS648E	uc021raw.1				18.37:g.3025549T>A				R	SNP	-	NULL	ENST00000516449.1	37	NULL		18																																																																																			-	SNORA70	-	-		0.468	SNORA70.21-201	NOVEL	basic	snoRNA	ENSG00000252258	RFAM	snoRNA		0	0		9	9		0.00		T	NR_000011		3025549	-1	7		7		tier1	no_errors	ENST00000516449	ensembl	human	novel	74_37	rna	50.00		SNP	0.004	A	7	7
PATZ1	23598	genome.wustl.edu	37	22	31740562	31740562	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr22:31740562C>T	ENST00000266269.5	-	1	1656	c.1027G>A	c.(1027-1029)Gac>Aac	p.D343N	AC005003.1_ENST00000504184.2_5'Flank|PATZ1_ENST00000405309.3_Missense_Mutation_p.D343N|PATZ1_ENST00000351933.4_Missense_Mutation_p.D343N|PATZ1_ENST00000215919.3_Missense_Mutation_p.D343N	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	343					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						CGGGGGCCGTCGGGGTCTTCA	0.607													ENSG00000100105																																					0													49.0	51.0	50.0					22																	31740562		2203	4300	6503	SO:0001583	missense	0			-	AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1027G>A	22.37:g.31740562C>T	ENSP00000266269:p.Asp343Asn		Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.D343N	ENST00000266269.5	37	c.1027	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	C	18.76	3.693092	0.68271	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.10382	2.91;2.88;2.94;3.13	4.78	4.78	0.61160	.	0.054823	0.64402	D	0.000001	T	0.09113	0.0225	N	0.08118	0	0.58432	D	0.999992	D;P;D;P	0.61080	0.989;0.745;0.967;0.855	P;B;B;B	0.50192	0.634;0.161;0.288;0.161	T	0.44711	-0.9310	10	0.13470	T	0.59	-15.5765	16.8089	0.85713	0.0:1.0:0.0:0.0	.	343;343;343;343	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	N	343	ENSP00000266269:D343N;ENSP00000384173:D343N;ENSP00000337520:D343N;ENSP00000215919:D343N	ENSP00000215919:D343N	D	-	1	0	PATZ1	30070562	0.998000	0.40836	0.861000	0.33841	0.982000	0.71751	5.359000	0.66074	2.211000	0.71520	0.561000	0.74099	GAC	-	PATZ1	-	NULL		0.607	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	HGNC	protein_coding	OTTHUMT00000321932.1	0	0		73	73		0.00		C	NM_032052		31740562	-1	28		13		tier1	no_errors	ENST00000266269	ensembl	human	known	74_37	missense	68.29		SNP	0.998	T	28	13
XYLT1	64131	genome.wustl.edu	37	16	17451890	17451890	+	Silent	SNP	C	C	T	rs530940051	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr16:17451890C>T	ENST00000261381.6	-	2	465	c.381G>A	c.(379-381)ccG>ccA	p.P127P	XYLT1_ENST00000568226.1_5'UTR	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	127					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GGGTGATGAGCGGACTTGGGT	0.463													ENSG00000103489	C|||	2	0.000399361	0.0	0.0	5008	,	,		21336	0.002		0.0	False		,,,				2504	0.0																0													130.0	107.0	115.0					16																	17451890		2197	4300	6497	SO:0001819	synonymous_variant	0			-	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.381G>A	16.37:g.17451890C>T			Q9H1B6	Silent	SNP	pfam_XylT,pfam_Glyco_trans_14	p.P127	ENST00000261381.6	37	c.381	CCDS10569.1	16																																																																																			-	XYLT1	-	NULL		0.463	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	0	0		120	120		0.00		C	NM_022166		17451890	-1	55		19		tier1	no_errors	ENST00000261381	ensembl	human	known	74_37	silent	73.33		SNP	0.190	T	55	19
TP53	7157	genome.wustl.edu	37	17	7579296	7579331	+	Splice_Site	DEL	CCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG	CCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG	-	rs587781495|rs55863639|rs587780067|rs121912658		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	CCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG	CCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:7579296_7579331delCCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG	ENST00000269305.4	-	4	545_565	c.356_376delCCAAGTCTGTGACTTGCACGGTCAGTTGCCCTGAGG	c.(355-378)gccaagtctgtgacttgcacggtc>gtc	p.AKSVTCT119del	TP53_ENST00000455263.2_Splice_Site_p.AKSVTCT119del|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Splice_Site_p.AKSVTCT119del|TP53_ENST00000420246.2_Splice_Site_p.AKSVTCT119del|TP53_ENST00000445888.2_Splice_Site_p.AKSVTCT119del|TP53_ENST00000359597.4_Splice_Site_p.AKSVTCT119del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	119	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in a sporadic cancer; somatic mutation).|A -> T (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.T125T(51)|p.?(38)|p.T125M(16)|p.0?(8)|p.T125K(6)|p.V122fs*26(5)|p.K120M(5)|p.A119A(5)|p.C124G(4)|p.C124R(4)|p.T125P(4)|p.C124*(3)|p.K120E(3)|p.G59fs*23(3)|p.T125R(3)|p.K120*(2)|p.K120fs*3(2)|p.K120R(2)|p.C124fs*46(2)|p.C124fs*1(1)|p.V122fs*46(1)|p.T118fs*27(1)|p.V122L(1)|p.K120Q(1)|p.T125_Y126insX(1)|p.S121F(1)|p.V73fs*9(1)|p.Y126fs*11(1)|p.Y107fs*44(1)|p.C124fs*48(1)|p.S33fs*23(1)|p.S121fs*27(1)|p.C124S(1)|p.P13fs*18(1)|p.C124Y(1)|p.C124fs*25(1)|p.T123I(1)|p.T123fs*24(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.H115fs*27(1)|p.K120N(1)|p.S121fs*2(1)|p.T125fs*45(1)|p.T125fs*24(1)|p.T125A(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAGCCAGCCCCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGGCTGTCCCAGA	0.559		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			ENSG00000141510																									Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	193	Substitution - coding silent(56)|Substitution - Missense(55)|Unknown(38)|Deletion - Frameshift(25)|Whole gene deletion(8)|Substitution - Nonsense(5)|Insertion - Frameshift(3)|Deletion - In frame(2)|Insertion - In frame(1)	lung(46)|haematopoietic_and_lymphoid_tissue(25)|large_intestine(23)|upper_aerodigestive_tract(21)|ovary(20)|breast(16)|urinary_tract(12)|central_nervous_system(7)|bone(5)|liver(3)|biliary_tract(3)|oesophagus(3)|pancreas(3)|prostate(2)|stomach(1)|soft_tissue(1)|kidney(1)|skin(1)	GRCh37	CI073782|CM065494|CM921039|CS004351|CS011573|CS951538|CS971913	TP53	I|M|S	rs121912658|rs55863639																																			SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.375+1CCAAGTCTGTGACTTGCACGGTCAGTTGCCCTGAGG>-	17.37:g.7579296_7579331delCCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG			Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	DEL	-	e4-1	ENST00000269305.4	37	c.375+21_375+1	CCDS11118.1	17																																																																																				TP53	-	-		0.559	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1									CCTCAGGGCAACTGACCGTGCAAGTCACAGACTTGG	NM_000546	In_Frame_Del	7579331	-1					tier1	no_errors	ENST00000269305	ensembl	human	known	74_37	splice_site_del			DEL	0.000:0.000:0.000:0.098:0.375:0.705:0.810:0.818:0.907:0.921:0.997:1.000:1.000:0.991:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.960:0.999:0.998:0.949:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-		
GAPVD1	26130	genome.wustl.edu	37	9	128025963	128025989	+	Intron	DEL	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT	-	rs551743640|rs71374244|rs143312600	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	CAGCACTCCATCTGTAGGTATGTCTGT	CAGCACTCCATCTGTAGGTATGTCTGT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT	ENST00000495955.1	+	1	92				GAPVD1_ENST00000297933.6_Intron|GAPVD1_ENST00000470056.1_Intron|GAPVD1_ENST00000394105.2_Intron|GAPVD1_ENST00000394084.1_Intron|GAPVD1_ENST00000469528.1_3'UTR|GAPVD1_ENST00000394104.2_Intron|GAPVD1_ENST00000265956.4_Intron|GAPVD1_ENST00000394083.2_Intron			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1						endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						CTAAGTGGCACAGCACTCCATCTGTAGGTATGTCTGTCAGCACTCCA	0.564													ENSG00000165219		2105	0.420327	0.4516	0.3818	5008	,	,		19587	0.4454		0.3777	False		,,,				2504	0.4233																0																																										SO:0001627	intron_variant	0					CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.-199+1725CAGCACTCCATCTGTAGGTATGTCTGT>-	9.37:g.128025963_128025989delCAGCACTCCATCTGTAGGTATGTCTGT			A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Splice_Site	DEL	-	NULL	ENST00000495955.1	37	c.NULL		9																																																																																				GAPVD1	-	-		0.564	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1									CAGCACTCCATCTGTAGGTATGTCTGT			128025989	+1					tier1	no_errors	ENST00000469528	ensembl	human	known	74_37	splice_site_del			DEL	1.000:1.000:1.000:1.000:1.000:0.999:0.996:0.980:0.970:0.963:0.961:0.959:0.952:0.948:0.947:0.950:0.961:0.966:0.966:0.969:0.974:0.982:0.984:0.985:0.984:0.985:0.993	-		
ANO5	203859	genome.wustl.edu	37	11	22242681	22242681	+	Silent	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr11:22242681C>T	ENST00000324559.8	+	5	536	c.219C>T	c.(217-219)ttC>ttT	p.F73F		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	73					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTATCTTCTTCCGAGATGGGA	0.358													ENSG00000171714																																					0													94.0	92.0	93.0					11																	22242681		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.219C>T	11.37:g.22242681C>T				Silent	SNP	pfam_Anoctamin	p.F73	ENST00000324559.8	37	c.219	CCDS31444.1	11																																																																																			-	ANO5	-	NULL		0.358	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	HGNC	protein_coding	OTTHUMT00000387615.1	0	0		60	60		0.00		C	NM_213599		22242681	+1	22		8		tier1	no_errors	ENST00000324559	ensembl	human	known	74_37	silent	73.33		SNP	0.994	T	22	8
UBBP4	23666	genome.wustl.edu	37	17	21730946	21730946	+	Missense_Mutation	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:21730946C>T	ENST00000578713.1	+	1	252	c.248C>T	c.(247-249)aCc>aTc	p.T83I	UBBP4_ENST00000583708.1_Intron|UBBP4_ENST00000584398.1_Intron|UBBP4_ENST00000584755.1_Missense_Mutation_p.T83I					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						TTCGTGAAGACCCTGACCGGC	0.552													ENSG00000263563																																					0																																										SO:0001583	missense	0			-	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.248C>T	17.37:g.21730946C>T	ENSP00000464265:p.Thr83Ile			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.T83I	ENST00000578713.1	37	c.248		17																																																																																			-	UBBP4	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup		0.552	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444589.2	0	0		73	73		0.00		C			21730946	+1	38		45		tier1	no_errors	ENST00000578713	ensembl	human	putative	74_37	missense	45.78		SNP	1.000	T	38	45
POM121L7	728418	genome.wustl.edu	37	22	21475923	21475923	+	IGR	SNP	G	G	A	rs563610118	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr22:21475923G>A	ENST00000419447.1	-	0	1689				KB-1592A4.15_ENST00000420508.1_lincRNA|BCRP2_ENST00000461808.1_RNA					POM121 transmembrane nucleoporin-like 7																		GTACCTATCTGGGCCCGGTGG	0.557													ENSG00000169668	.|||	323	0.0644968	0.0847	0.049	5008	,	,		25408	0.0169		0.0895	False		,,,				2504	0.0716																0																																										SO:0001628	intergenic_variant	0			-			22q11.21	2013-03-28	2012-03-13		ENSG00000239511	ENSG00000239511			35444	other	unknown			"""POM121 membrane glycoprotein-like 7"""				Standard	NG_009026		Approved		uc010gsw.2		OTTHUMG00000150783		22.37:g.21475923G>A				R	SNP	-	NULL	ENST00000419447.1	37	NULL		22																																																																																			-	BCRP2	-	-		0.557	POM121L7-201	KNOWN	basic|appris_principal	protein_coding	BCRP2	HGNC	protein_coding		0	0		26	26		0.00		G	NG_009026		21475923	+1	5		11		tier1	no_errors	ENST00000461808	ensembl	human	known	74_37	rna	31.25		SNP	0.017	A	5	11
CA5BP1	340591	genome.wustl.edu	37	X	15721279	15721279	+	RNA	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chrX:15721279C>T	ENST00000380334.2	+	0	696							Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB pseudogene 1							mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)										GGCTTTGGACCGCCCGCCACC	0.652													ENSG00000186312																																					0																																												0			-	BC021816		Xp22.2	2012-11-02	2011-02-07	2011-02-07	ENSG00000186312	ENSG00000186312			29544	pseudogene	pseudogene	"""similar to carbonic anhydrase VB, mitochondrial precursor"", ""carbonic dehydratase"""		"""carbonic anhydrase VB-like"", ""carbonic anhydrase VB pseudogene"""	CA5BL, CA5BP		12477932	Standard	NR_026551		Approved	PRO2325	uc011mir.1	Q8WTZ4	OTTHUMG00000021182		X.37:g.15721279C>T			A6NEZ4	R	SNP	-	NULL	ENST00000380334.2	37	NULL		X																																																																																			-	CA5BP1	-	-		0.652	CA5BP1-005	KNOWN	basic	processed_transcript	CA5BP1	HGNC	pseudogene	OTTHUMT00000055884.3	0	0		41	41		0.00		C	NR_026551		15721279	+1	18		19		tier1	no_errors	ENST00000380333	ensembl	human	known	74_37	rna	48.65		SNP	0.000	T	18	19
BFAR	51283	genome.wustl.edu	37	16	14738206	14738206	+	Start_Codon_SNP	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr16:14738206G>A	ENST00000261658.2	+	2	280	c.3G>A	c.(1-3)atG>atA	p.M1I	BFAR_ENST00000426842.2_5'UTR|RNU7-125P_ENST00000458760.1_RNA|BFAR_ENST00000563971.1_Start_Codon_SNP_p.M1I	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	1					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						GCTAAGAGATGGAGGAACCTC	0.383													ENSG00000103429																																					0													88.0	94.0	92.0					16																	14738206		2197	4300	6497	SO:0001582	initiator_codon_variant	0			-	AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.3G>A	16.37:g.14738206G>A	ENSP00000261658:p.Met1Ile		A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.M1I	ENST00000261658.2	37	c.3	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793778	0.70452	.	.	ENSG00000103429	ENST00000261658	T	0.06528	3.29	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	.	.	.	0.80722	D	1	D;D;D	0.69078	0.969;0.969;0.997	D;D;D	0.73380	0.914;0.914;0.98	T	0.00223	-1.1903	9	0.72032	D	0.01	.	19.2684	0.93998	0.0:0.0:1.0:0.0	.	1;1;1	B2R9R6;Q9NZS9;B4DLM6	.;BFAR_HUMAN;.	I	1	ENSP00000261658:M1I	ENSP00000261658:M1I	M	+	3	0	BFAR	14645707	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	7.326000	0.79133	2.797000	0.96272	0.655000	0.94253	ATG	-	BFAR	-	NULL		0.383	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	0	0		66	66		0.00		G	NM_016561	Missense_Mutation	14738206	+1	20		6		tier1	no_errors	ENST00000261658	ensembl	human	known	74_37	missense	76.92		SNP	1.000	A	20	6
MVB12B	89853	genome.wustl.edu	37	9	129243626	129243627	+	Intron	INS	-	-	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:129243626_129243627insT	ENST00000361171.3	+	8	838				MVB12B_ENST00000436593.3_Intron|MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										TTAATGCCATCTTTTTTTTTCT	0.396													ENSG00000196814																																					0										3,4261		0,3,2129						-1.5	0.0			197	1,8253		0,1,4126	no	intron	FAM125B	NM_033446.2		0,4,6255	A1A1,A1R,RR		0.0121,0.0704,0.032				4,12514				SO:0001627	intron_variant	0				AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.758-21->T	9.37:g.129243635_129243635dupT			Q8N6S7	R	INS	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																				MVB12B	-	-		0.396	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	HGNC	protein_coding	OTTHUMT00000054110.1	0	0		20	20		0.00		-	XM_088525		129243627	+1	4		31		tier1	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	11.43		INS	0.001:0.000	T	4	31
VEZF1	7716	genome.wustl.edu	37	17	56056605	56056607	+	In_Frame_Del	DEL	TGC	TGC	-	rs61731354|rs73995411|rs57786397|rs369163670	byFrequency	TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:56056605_56056607delTGC	ENST00000581208.1	-	5	1084_1086	c.1044_1046delGCA	c.(1042-1047)cagcaa>caa	p.348_349QQ>Q	VEZF1_ENST00000584396.1_In_Frame_Del_p.339_340QQ>Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	348	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						ttgttgttgttgctgctgctgct	0.463													ENSG00000136451																																					0																																										SO:0001651	inframe_deletion	0				D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1044_1046delGCA	17.37:g.56056614_56056616delTGC	ENSP00000462337:p.Gln354del			In_Frame_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q352in_frame_del	ENST00000581208.1	37	c.1046_1044	CCDS32687.1	17																																																																																				VEZF1	-	NULL		0.463	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VEZF1	HGNC	protein_coding	OTTHUMT00000443321.1	0	0		44	44		0.00		TGC			56056607	-1	4		29		tier1	no_errors	ENST00000581208	ensembl	human	known	74_37	in_frame_del	12.12		DEL	0.940:0.945:0.948	-	4	29
PITPNM3	83394	genome.wustl.edu	37	17	6380417	6380417	+	Silent	SNP	C	C	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:6380417C>T	ENST00000262483.8	-	9	1104	c.1017G>A	c.(1015-1017)ccG>ccA	p.P339P	PITPNM3_ENST00000421306.3_Silent_p.P303P	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	339					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		TCTGTTTCCGCGGCAACGGCC	0.582													ENSG00000091622																																					0													126.0	97.0	107.0					17																	6380417		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1017G>A	17.37:g.6380417C>T			A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.P339	ENST00000262483.8	37	c.1017	CCDS11076.1	17																																																																																			-	PITPNM3	-	NULL		0.582	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	HGNC	protein_coding	OTTHUMT00000219824.2	0	0		23	23		0.00		C	NM_031220		6380417	-1	19		20		tier1	no_errors	ENST00000262483	ensembl	human	known	74_37	silent	48.72		SNP	0.007	T	19	20
MT-ND5	4540	genome.wustl.edu	37	M	12418	12418	+	Frame_Shift_Del	DEL	A	A	-			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chrM:12418delA	ENST00000361567.2	+	1	82	c.82delA	c.(82-84)aaafs	p.K29fs	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	29					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTAACCCTAACAAAAAAAACT	0.413													ENSG00000198786																																					0																																										SO:0001589	frameshift_variant	0						mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.82delA	M.37:g.12418delA	ENSP00000354813:p.Lys29fs		Q34773|Q8WCY3	Frame_Shift_Del	DEL	pfam_DH_UbQ/plastoQ_OxRdtase,pfam_DH_DH_su5_C,pfam_DH_UbQ_OxRdtase_chain5/L_N,tigrfam_DHpl_OxRdtase_5	p.N30fs	ENST00000361567.2	37	c.82		MT																																																																																				MT-ND5	-	tigrfam_DHpl_OxRdtase_5		0.413	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		0	0		40	40		0.00		A	YP_003024036		12418	+1	8		7		tier1	no_errors	ENST00000361567	ensembl	human	known	74_37	frame_shift_del	53.33		DEL	NULL	-	8	7
ZNF800	168850	genome.wustl.edu	37	7	127013660	127013660	+	Missense_Mutation	SNP	G	G	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr7:127013660G>A	ENST00000393313.1	-	5	2321	c.1730C>T	c.(1729-1731)cCt>cTt	p.P577L	ZNF800_ENST00000393312.1_Missense_Mutation_p.P577L|ZNF800_ENST00000485577.1_5'Flank|ZNF800_ENST00000265827.3_Missense_Mutation_p.P577L			Q2TB10	ZN800_HUMAN	zinc finger protein 800	577					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(8)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	32						ATCCCTCGAAGGGCCTCTTTT	0.363													ENSG00000048405																																					0													110.0	111.0	111.0					7																	127013660		2203	4299	6502	SO:0001583	missense	0			-	AF218032	CCDS5795.1	7q31.33	2008-05-02			ENSG00000048405	ENSG00000048405		"""Zinc fingers, C2H2-type"""	27267	protein-coding gene	gene with protein product						12477932	Standard	NM_176814		Approved		uc003vly.1	Q2TB10	OTTHUMG00000023456	ENST00000393313.1:c.1730C>T	7.37:g.127013660G>A	ENSP00000376989:p.Pro577Leu		Q9HBN0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P577L	ENST00000393313.1	37	c.1730	CCDS5795.1	7	.	.	.	.	.	.	.	.	.	.	G	8.890	0.953836	0.18431	.	.	ENSG00000048405	ENST00000393313;ENST00000265827;ENST00000393312	T;T;T	0.14640	2.49;2.49;2.49	5.7	5.7	0.88788	.	0.488362	0.22117	N	0.064387	T	0.08714	0.0216	N	0.08118	0	0.38954	D	0.958406	B;B	0.14805	0.011;0.011	B;B	0.08055	0.003;0.003	T	0.32188	-0.9916	8	.	.	.	-7.7463	18.8226	0.92103	0.0:0.0:1.0:0.0	.	480;577	B7Z4V7;Q2TB10	.;ZN800_HUMAN	L	577	ENSP00000376989:P577L;ENSP00000265827:P577L;ENSP00000376988:P577L	.	P	-	2	0	ZNF800	126800896	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.917000	0.63369	2.692000	0.91855	0.655000	0.94253	CCT	-	ZNF800	-	NULL		0.363	ZNF800-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF800	HGNC	protein_coding	OTTHUMT00000141823.1	0	0		67	67		0.00		G	NM_176814		127013660	-1	46		6		tier1	no_errors	ENST00000265827	ensembl	human	known	74_37	missense	88.46		SNP	1.000	A	46	6
VWF	7450	genome.wustl.edu	37	12	6078426	6078426	+	Silent	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:6078426G>T	ENST00000261405.5	-	45	7934	c.7680C>A	c.(7678-7680)ggC>ggA	p.G2560G		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2560					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TCAGCTGAAAGCCCGAGGGGC	0.597													ENSG00000110799																																					0													37.0	36.0	36.0					12																	6078426		2203	4300	6503	SO:0001819	synonymous_variant	0			-		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7680C>A	12.37:g.6078426G>T			Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.G2560	ENST00000261405.5	37	c.7680	CCDS8539.1	12																																																																																			-	VWF	-	pirsf_VWF		0.597	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	0	0		47	47		0.00		G	NM_000552		6078426	-1	42		28		tier1	no_errors	ENST00000261405	ensembl	human	known	74_37	silent	60.00		SNP	1.000	T	42	28
DENND2C	163259	genome.wustl.edu	37	1	115130449	115130449	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr1:115130449G>T	ENST00000393274.1	-	19	3181	c.2556C>A	c.(2554-2556)ttC>ttA	p.F852L	DENND2C_ENST00000393277.1_Missense_Mutation_p.F740L|DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393276.3_Missense_Mutation_p.F795L	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	852	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGGACTTACGGAATGGTTCCC	0.483													ENSG00000175984																																					0													109.0	92.0	98.0					1																	115130449		2203	4300	6503	SO:0001583	missense	0			-		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2556C>A	1.37:g.115130449G>T	ENSP00000376955:p.Phe852Leu		B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F852L	ENST00000393274.1	37	c.2556	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.641375	0.87859	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	D;D;D	0.82433	-1.61;-1.61;-1.61	5.9	3.06	0.35304	dDENN (3);	0.046236	0.85682	D	0.000000	D	0.88127	0.6353	M	0.89287	3.02	0.28585	N	0.909922	D;D	0.71674	0.997;0.998	D;D	0.75484	0.958;0.986	D	0.83708	0.0186	10	0.87932	D	0	.	11.2588	0.49069	0.1899:0.0:0.8101:0.0	.	852;795	Q68D51;Q68D51-3	DEN2C_HUMAN;.	L	795;852;852;740	ENSP00000376957:F795L;ENSP00000376955:F852L;ENSP00000376958:F740L	ENSP00000358553:F852L	F	-	3	2	DENND2C	114931972	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.269000	0.51592	0.427000	0.26145	0.551000	0.68910	TTC	-	DENND2C	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom		0.483	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	0	0		58	58		0.00		G	NM_198459		115130449	-1	4		44		tier1	no_errors	ENST00000393274	ensembl	human	known	74_37	missense	8.33		SNP	1.000	T	4	44
TAF1L	138474	genome.wustl.edu	37	9	32632977	32632977	+	Silent	SNP	G	G	C			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr9:32632977G>C	ENST00000242310.4	-	1	2690	c.2601C>G	c.(2599-2601)ctC>ctG	p.L867L	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	867					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AGTCAGCGCAGAGCTTTAGCC	0.463													ENSG00000122728																																					0													133.0	136.0	135.0					9																	32632977		2203	4300	6503	SO:0001819	synonymous_variant	0			-	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2601C>G	9.37:g.32632977G>C			Q0VG57	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.L867	ENST00000242310.4	37	c.2601	CCDS35003.1	9																																																																																			-	TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591		0.463	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	0	0		59	59		0.00		G			32632977	-1	28		57		tier1	no_errors	ENST00000242310	ensembl	human	known	74_37	silent	32.94		SNP	1.000	C	28	57
CCDC63	160762	genome.wustl.edu	37	12	111311658	111311659	+	Frame_Shift_Ins	INS	-	-	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr12:111311658_111311659insA	ENST00000308208.5	+	5	624_625	c.382_383insA	c.(382-384)gaafs	p.E128fs	CCDC63_ENST00000545036.1_Frame_Shift_Ins_p.E88fs|CCDC63_ENST00000550317.1_3'UTR|CCDC63_ENST00000552694.1_Frame_Shift_Ins_p.E49fs	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	128										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						TCTTCAGATGGAAAAAAAAATC	0.416													ENSG00000173093																																					0																																										SO:0001589	frameshift_variant	0				AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.391dupA	12.37:g.111311667_111311667dupA	ENSP00000312399:p.Glu128fs		B4DY03|Q0P603|Q6P2E1	Frame_Shift_Ins	INS	NULL	p.I131fs	ENST00000308208.5	37	c.382_383	CCDS9151.1	12																																																																																				CCDC63	-	NULL		0.416	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC63	HGNC	protein_coding	OTTHUMT00000404673.2	0	0		55	55		0.00		-	NM_152591		111311659	+1	5		50		tier1	no_errors	ENST00000308208	ensembl	human	known	74_37	frame_shift_ins	9.09		INS	0.975:0.872	A	5	50
EFEMP2	30008	genome.wustl.edu	37	11	65637630	65637630	+	Missense_Mutation	SNP	G	G	C	rs562466098		TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr11:65637630G>C	ENST00000307998.6	-	6	799	c.569C>G	c.(568-570)cCg>cGg	p.P190R	EFEMP2_ENST00000528176.1_Missense_Mutation_p.P190R|EFEMP2_ENST00000532648.1_5'Flank	NM_016938.4	NP_058634.4	O95967	FBLN4_HUMAN	EGF containing fibulin-like extracellular matrix protein 2	190	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21				READ - Rectum adenocarcinoma(159;0.169)		CTGGAAGCCCGGCTCGCACTG	0.667													ENSG00000172638																																					0													38.0	42.0	41.0					11																	65637630		2201	4294	6495	SO:0001583	missense	0			-	AF109121	CCDS8116.1	11q13	2011-06-17	2011-01-25		ENSG00000172638	ENSG00000172638		"""Fibulins"""	3219	protein-coding gene	gene with protein product	"""fibulin 4"""	604633	"""EGF-containing fibulin-like extracellular matrix protein 2"""			10601734, 10982184	Standard	NR_037718		Approved	FBLN4, UPH1	uc001ofy.4	O95967	OTTHUMG00000166664	ENST00000307998.6:c.569C>G	11.37:g.65637630G>C	ENSP00000309953:p.Pro190Arg		A8K7R4|B3KM31|B3KQT1|O75967	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,superfamily_TIL_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.P190R	ENST00000307998.6	37	c.569	CCDS8116.1	11	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388166	0.82902	.	.	ENSG00000172638	ENST00000528176;ENST00000307998;ENST00000526624	D;D;D	0.95307	-3.67;-3.67;-2.94	5.14	5.14	0.70334	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.50627	D	0.000116	D	0.95815	0.8638	L	0.50919	1.6	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.83275	0.933;0.996	D	0.94012	0.7285	10	0.22109	T	0.4	.	16.4548	0.84008	0.0:0.0:1.0:0.0	.	190;190	E9PRU1;O95967	.;FBLN4_HUMAN	R	190	ENSP00000434151:P190R;ENSP00000309953:P190R;ENSP00000435419:P190R	ENSP00000309953:P190R	P	-	2	0	EFEMP2	65394206	1.000000	0.71417	0.952000	0.39060	0.995000	0.86356	6.321000	0.72881	2.556000	0.86216	0.561000	0.74099	CCG	-	EFEMP2	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.667	EFEMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP2	HGNC	protein_coding	OTTHUMT00000391047.4	0	0		55	55		0.00		G	NM_016938		65637630	-1	29		12		tier1	no_errors	ENST00000307998	ensembl	human	known	74_37	missense	70.73		SNP	0.997	C	29	12
MT-CO1	4512	genome.wustl.edu	37	M	6656	6656	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chrM:6656C>A	ENST00000361624.2	+	1	753	c.753C>A	c.(751-753)ttC>ttA	p.F251L	MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	251					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CTACCAGGCTTCGGAATAATC	0.433													ENSG00000198804																																					0																																										SO:0001583	missense	0			-			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.753C>A	M.37:g.6656C>A	ENSP00000354499:p.Phe251Leu		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.F251L	ENST00000361624.2	37	c.753		MT																																																																																			-	MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.433	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		0	0		36	36		0.00		C	YP_003024028		6656	+1	2		10		tier1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	16.67		SNP	NULL	A	2	10
SLC35G1	159371	genome.wustl.edu	37	10	95660526	95660526	+	Missense_Mutation	SNP	C	C	A			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr10:95660526C>A	ENST00000427197.1	+	3	438	c.377C>A	c.(376-378)cCa>cAa	p.P126Q	SLC35G1_ENST00000371408.3_Missense_Mutation_p.P125Q	NM_001134658.1|NM_153226.2	NP_001128130.1|NP_694958.1	Q2M3R5	S35G1_HUMAN	solute carrier family 35, member G1	126	EamA 1.				calcium ion export from cell (GO:1990034)|cytosolic calcium ion homeostasis (GO:0051480)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											TTTATAGGCCCAAAAGGTCAA	0.328													ENSG00000176273																																					0													86.0	84.0	85.0					10																	95660526		2203	4299	6502	SO:0001583	missense	0			-	AK091309	CCDS7432.1, CCDS44459.1	10q23.33	2013-05-22	2011-08-03	2011-08-03	ENSG00000176273	ENSG00000176273		"""Solute carriers"""	26607	protein-coding gene	gene with protein product			"""transmembrane protein 20"""	TMEM20		21569384	Standard	NM_153226		Approved	FLJ33990, C10orf60	uc001kjg.2	Q2M3R5	OTTHUMG00000018779	ENST00000427197.1:c.377C>A	10.37:g.95660526C>A	ENSP00000400932:p.Pro126Gln		Q86YG5|Q8NBA5	Missense_Mutation	SNP	pfam_DMT	p.P126Q	ENST00000427197.1	37	c.377	CCDS44459.1	10	.	.	.	.	.	.	.	.	.	.	C	19.49	3.837761	0.71373	.	.	ENSG00000176273	ENST00000371408;ENST00000427197	T;T	0.53423	0.62;0.62	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.69895	0.3162	M	0.85373	2.75	0.80722	D	1	D;P;B	0.58970	0.984;0.883;0.39	P;P;B	0.57244	0.816;0.625;0.176	T	0.69960	-0.5003	10	0.42905	T	0.14	.	20.3812	0.98933	0.0:1.0:0.0:0.0	.	109;126;125	B7ZKP0;Q2M3R5;Q2M3R5-2	.;S35G1_HUMAN;.	Q	125;126	ENSP00000360462:P125Q;ENSP00000400932:P126Q	ENSP00000360462:P125Q	P	+	2	0	SLC35G1	95650516	1.000000	0.71417	0.977000	0.42913	0.628000	0.37860	7.457000	0.80775	2.821000	0.97095	0.650000	0.86243	CCA	-	SLC35G1	-	pfam_DMT		0.328	SLC35G1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35G1	HGNC	protein_coding		0	0		36	36		0.00		C	NM_153226		95660526	+1	4		20		tier1	no_errors	ENST00000427197	ensembl	human	known	74_37	missense	16.67		SNP	1.000	A	4	20
DNAH11	8701	genome.wustl.edu	37	7	21603913	21603913	+	Silent	SNP	A	A	G			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr7:21603913A>G	ENST00000409508.3	+	6	1123	c.1092A>G	c.(1090-1092)ttA>ttG	p.L364L	DNAH11_ENST00000328843.6_Silent_p.L364L	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	364	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TCGCTCCATTATTTCATACCA	0.428									Kartagener syndrome				ENSG00000105877																																					0													120.0	110.0	114.0					7																	21603913		1833	4078	5911	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.1092A>G	7.37:g.21603913A>G			Q9UJ82	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L364	ENST00000409508.3	37	c.1092		7																																																																																			-	DH11	-	pfam_Dynein_heavy_dom-1		0.428	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DH11	HGNC	protein_coding	OTTHUMT00000326582.6	0	0		55	55		0.00		A	NM_003777		21603913	+1	14		76		tier1	no_errors	ENST00000328843	ensembl	human	known	74_37	silent	15.56		SNP	0.925	G	14	76
SP6	80320	genome.wustl.edu	37	17	45924895	45924895	+	Missense_Mutation	SNP	G	G	T			TCGA-Z4-AAPG-01A-11D-A38Z-09	TCGA-Z4-AAPG-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq 2500	a5c60f83-e78d-427a-a555-336d753b9798	0a67fd48-b06f-407d-a340-b59e67c4b9c4	g.chr17:45924895G>T	ENST00000536300.1	-	2	1232	c.901C>A	c.(901-903)Ctg>Atg	p.L301M	SP6_ENST00000342234.2_Missense_Mutation_p.L301M	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	301					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						TGGCGCTGCAGCTCGTCCGAG	0.657													ENSG00000189120																																					0													45.0	39.0	41.0					17																	45924895		2203	4300	6503	SO:0001583	missense	0			-		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.901C>A	17.37:g.45924895G>T	ENSP00000438209:p.Leu301Met		B3KXS4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L301M	ENST00000536300.1	37	c.901	CCDS11520.1	17	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768909	0.49680	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.53640	0.61;0.61	4.4	3.43	0.39272	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34853	N	0.003631	T	0.68851	0.3046	M	0.86420	2.815	0.40538	D	0.980992	D	0.89917	1.0	D	0.97110	1.0	T	0.70644	-0.4815	10	0.87932	D	0	.	8.6494	0.34025	0.2631:0.0:0.7369:0.0	.	301	Q3SY56	SP6_HUMAN	M	301	ENSP00000340799:L301M;ENSP00000438209:L301M	ENSP00000340799:L301M	L	-	1	2	SP6	43279894	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	5.633000	0.67825	0.489000	0.27749	-1.598000	0.00824	CTG	-	SP6	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.657	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SP6	HGNC	protein_coding	OTTHUMT00000441395.1	0	0		51	51		0.00		G	NM_199262		45924895	-1	7		35		tier1	no_errors	ENST00000342234	ensembl	human	known	74_37	missense	16.67		SNP	1.000	T	7	35
