#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
AIM1L	55057	bcgsc.ca	37	1	26669776	26669776	+	5'UTR	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:26669776G>T	ENST00000308182.5	-	0	216				AIM1L_ENST00000527815.1_Silent_p.A100A			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GGGTCTTTAAGGCTGGGCTCT	0.612																																					p.A974A													.	AIM1L	98		0			c.C2922A																																									SO:0001623	5_prime_UTR_variant	55057	exon3			CTTTAAGGCTGGG			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490	ENST00000308182.5:c.-214C>A	1.37:g.26669776G>T			54	0	0		107	0.00	0	NM_001039775	0		0	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	37																																																																																						0.612	AIM1L-201	KNOWN	basic	protein_coding	protein_coding				NM_001039775.2	
COL8A2	1296	broad.mit.edu	37	1	36564613	36564613	+	Silent	SNP	A	A	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:36564613A>C	ENST00000397799.1	-	4	893	c.669T>G	c.(667-669)ggT>ggG	p.G223G	COL8A2_ENST00000481785.1_Silent_p.G158G|COL8A2_ENST00000303143.4_Silent_p.G223G			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	223	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGCCGGGGGCACCCCCCTGCC	0.726																																					p.G223G													.	COL8A2	41		0			c.T669G												7.0	9.0	8.0					1																	36564613		1911	3830	5741	SO:0001819	synonymous_variant	1296	exon2			GGGGGCACCCCCC	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.669T>G	1.37:g.36564613A>C			84	0.0119047619	1		135	0.11	15	NM_005202	15	0.00	0	Q5JV31|Q8TEJ5	Silent	SNP	ENST00000397799.1	37	CCDS403.1																																																																																					0.726	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313674.1		NM_005202	
LPHN2	23266	broad.mit.edu;bcgsc.ca	37	1	82436031	82436031	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:82436031T>A	ENST00000370728.1	+	18	3400	c.2755T>A	c.(2755-2757)Ttt>Att	p.F919I	LPHN2_ENST00000370730.1_Missense_Mutation_p.F919I|LPHN2_ENST00000370713.1_Missense_Mutation_p.F906I|LPHN2_ENST00000370717.2_Missense_Mutation_p.F919I|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000335786.5_Missense_Mutation_p.F919I|LPHN2_ENST00000370727.1_Missense_Mutation_p.F919I|LPHN2_ENST00000370715.1_Missense_Mutation_p.F906I|LPHN2_ENST00000359929.3_Missense_Mutation_p.F906I|LPHN2_ENST00000370721.1_Missense_Mutation_p.F844I|LPHN2_ENST00000370725.1_Missense_Mutation_p.F919I|LPHN2_ENST00000271029.4_Missense_Mutation_p.F919I|LPHN2_ENST00000319517.6_Missense_Mutation_p.F906I|LPHN2_ENST00000370723.1_Missense_Mutation_p.F906I|LPHN2_ENST00000394879.1_Missense_Mutation_p.F906I			O95490	LPHN2_HUMAN	latrophilin 2	919					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		ACTTCTACACTTTTTCTTTTT	0.353																																					p.F906I													.	LPHN2	464		0			c.T2716A												146.0	146.0	146.0					1																	82436031		2203	4300	6503	SO:0001583	missense	23266	exon14			CTACACTTTTTCT	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2755T>A	1.37:g.82436031T>A	ENSP00000359763:p.Phe919Ile		110	0	0		153	0.03	5	NM_012302	1	0.00	0	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	ENST00000370728.1	37		.	.	.	.	.	.	.	.	.	.	T	24.0	4.479622	0.84747	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.65893	0.2735	M	0.89478	3.035	0.58432	D	0.999999	D;D;D	0.65815	0.986;0.992;0.995	P;P;P	0.61201	0.885;0.853;0.885	T	0.74589	-0.3615	10	0.87932	D	0	.	15.9852	0.80147	0.0:0.0:0.0:1.0	.	906;906;906	O95490-3;O95490-4;O95490-2	.;.;.	I	844;919;919;919;919;906;906;906;906;906;919;906;919;919	ENSP00000359756:F844I;ENSP00000359763:F919I;ENSP00000359765:F919I;ENSP00000359762:F919I;ENSP00000359760:F919I;ENSP00000359758:F906I;ENSP00000353006:F906I;ENSP00000359750:F906I;ENSP00000359748:F906I;ENSP00000322270:F906I;ENSP00000359752:F919I;ENSP00000378344:F906I;ENSP00000271029:F919I;ENSP00000337306:F919I	ENSP00000271029:F919I	F	+	1	0	LPHN2	82208619	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.036000	0.88901	2.172000	0.68678	0.482000	0.46254	TTT			0.353	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000027188.1		NM_012302	
NBPF14	25832	broad.mit.edu	37	1	145293269	145293269	+	Splice_Site	SNP	G	G	A	rs61350760		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:145293269G>A	ENST00000468030.1	+	5	1125		c.e5+1		NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Splice_Site|NBPF10_ENST00000342960.5_5'Flank																							TTTCACAACAGTAAGTTAAGA	0.423																																					.													.	NBPF10	221		0			.																																									SO:0001630	splice_region_variant	100132406	.			ACAACAGTAAGTT																												ENST00000468030.1:c.714+1G>A	1.37:g.145293269G>A			26	0	0		58	0.12	7	.	4	0.00	0		Splice_Site	SNP	ENST00000468030.1	37																																																																																						0.423	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000038553.9			Intron
MTX1	4580	mdanderson.org	37	1	155178986	155178986	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:155178986A>G	ENST00000368376.3	+	1	497	c.391A>G	c.(391-393)Agg>Ggg	p.R131G	MTX1_ENST00000316721.4_Missense_Mutation_p.R131G|THBS3_ENST00000541990.1_5'Flank|MTX1_ENST00000609421.1_5'Flank|RP11-263K19.6_ENST00000455788.1_RNA|THBS3_ENST00000457183.2_5'Flank|THBS3_ENST00000368378.3_5'Flank|THBS3_ENST00000486260.1_5'Flank	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1	131					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGCGGGCCCAGGCAGGGGAG	0.701																																					p.R131G													.	.			0			c.A391G												3.0	2.0	2.0					1																	155178986		1526	3067	4593	SO:0001583	missense	4580	exon1			GGGCCCAGGCAGG		CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708	ENST00000368376.3:c.391A>G	1.37:g.155178986A>G	ENSP00000357360:p.Arg131Gly		30	0	0		40	0.08	3	NM_198883	0		0	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	Missense_Mutation	SNP	ENST00000368376.3	37	CCDS1100.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710900	0.30322	.	.	ENSG00000173171	ENST00000368376;ENST00000316721	T;T	0.32753	1.44;1.44	5.12	-0.994	0.10225	.	27.190700	0.00622	N	0.000453	T	0.03608	0.0103	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.18178	-1.0345	10	0.19147	T	0.46	4.7638	0.5663	0.00687	0.2741:0.1721:0.3614:0.1925	.	131;131	Q13505-2;Q13505	.;MTX1_HUMAN	G	131	ENSP00000357360:R131G;ENSP00000317106:R131G	ENSP00000317106:R131G	R	+	1	2	MTX1	153445610	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.143000	0.03200	-0.384000	0.07845	-0.146000	0.13790	AGG			0.701	MTX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000086844.1		NM_198883	
SH2D2A	9047	mdanderson.org	37	1	156777073	156777073	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:156777073T>G	ENST00000368199.3	-	8	1220	c.1067A>C	c.(1066-1068)cAc>cCc	p.H356P	SH2D2A_ENST00000368198.3_Missense_Mutation_p.H338P|SH2D2A_ENST00000392306.2_Missense_Mutation_p.H366P	NM_001161443.1|NM_001161444.1|NM_003975.3	NP_001154915.1|NP_001154916.1|NP_003966.2	Q9NP31	SH22A_HUMAN	SH2 domain containing 2A	356	Pro-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|large_intestine(2)|lung(15)	18	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGGGGGCTGGTGGGGCAGGGG	0.597																																					p.H366P													SH2D2A_ENST00000392306,right_upper_lobe,carcinoma,0,2	SH2D2A_ENST00000392306	0	2	0			c.A1097C												16.0	18.0	17.0					1																	156777073		2201	4299	6500	SO:0001583	missense	9047	exon8			GGCTGGTGGGGCA	AJ000553	CCDS1159.1, CCDS53380.1, CCDS53381.1	1q21	2013-02-14	2010-04-21		ENSG00000027869	ENSG00000027869		"""SH2 domain containing"""	10821	protein-coding gene	gene with protein product	"""T lymphocyte specific adaptor protein"", ""T cell specific adapter protein TSAd"", ""T cell specific adpater protein TSAd"""	604514	"""SH2 domain protein 2A"""			9468509	Standard	NM_003975		Approved	TSAd, F2771	uc009wsh.2	Q9NP31	OTTHUMG00000041305	ENST00000368199.3:c.1067A>C	1.37:g.156777073T>G	ENSP00000357182:p.His356Pro		10	0.5	5		24	0.54	13	NM_001161441	26	0.00	0	O43817|Q5UBZ1|Q5VZS4|Q5VZS5|Q9UPA7	Missense_Mutation	SNP	ENST00000368199.3	37	CCDS1159.1	.	.	.	.	.	.	.	.	.	.	T	7.673	0.687372	0.14973	.	.	ENSG00000027869	ENST00000368199;ENST00000368198;ENST00000392306	T;T;T	0.57107	0.45;0.42;0.87	4.24	1.63	0.23807	.	2.261830	0.01799	N	0.032797	T	0.21761	0.0524	L	0.27053	0.805	0.09310	N	1	P;B;B	0.35982	0.531;0.396;0.396	B;B;B	0.37833	0.259;0.133;0.094	T	0.18650	-1.0330	10	0.49607	T	0.09	-4.3545	4.3832	0.11304	0.2016:0.0:0.2094:0.5889	.	366;338;356	Q9NP31-2;Q5VZS4;Q9NP31	.;.;SH22A_HUMAN	P	356;338;366	ENSP00000357182:H356P;ENSP00000357181:H338P;ENSP00000376123:H366P	ENSP00000357181:H338P	H	-	2	0	SH2D2A	155043697	0.049000	0.20398	0.024000	0.17045	0.664000	0.39144	0.065000	0.14466	0.745000	0.32763	0.374000	0.22700	CAC			0.597	SH2D2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000098982.1		NM_003975	
OR10J1	26476	bcgsc.ca	37	1	159410279	159410279	+	Missense_Mutation	SNP	G	G	A	rs368823977		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:159410279G>A	ENST00000423932.3	+	1	768	c.731G>A	c.(730-732)cGg>cAg	p.R244Q	RP11-550P17.5_ENST00000431862.1_RNA	NM_012351.2	NP_036483.2	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J, member 1	244					G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of chemical stimulus (GO:0007606)|single fertilization (GO:0007338)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|stomach(1)	25	all_hematologic(112;0.0429)					GTTGAGGGCCGGAAGAAGGCT	0.478																																					p.R244Q													OR10J1,NS,carcinoma,+1,1	OR10J1	118	1	0			c.G731A							G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	189.0	175.0	180.0		731	1.8	0.1	1		180	0,8600		0,0,4300	no	missense	OR10J1	NM_012351.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	244/321	159410279	1,13005	2203	4300	6503	SO:0001583	missense	26476	exon1			AGGGCCGGAAGAA	X64995	CCDS1185.1	1q23.2	2012-08-09			ENSG00000196184	ENSG00000196184		"""GPCR / Class A : Olfactory receptors"""	8175	protein-coding gene	gene with protein product						1370859	Standard	NM_012351		Approved	HGMP07J, HSHGMP07J	uc010piv.2	P30954	OTTHUMG00000022737	ENST00000423932.3:c.731G>A	1.37:g.159410279G>A	ENSP00000399078:p.Arg244Gln		108	0.0092592593	1		151	0.00	0	NM_012351	0		0	Q2M1M8|Q5VSV1|Q6IET5|Q96R56	Missense_Mutation	SNP	ENST00000423932.3	37	CCDS1185.1	.	.	.	.	.	.	.	.	.	.	G	10.09	1.255584	0.22965	2.27E-4	0.0	ENSG00000196184	ENST00000423932	T	0.00311	8.15	3.73	1.79	0.24919	GPCR, rhodopsin-like superfamily (1);	0.202066	0.24202	N	0.040602	T	0.00073	0.0002	L	0.55990	1.75	0.18873	N	0.999984	B	0.29253	0.239	B	0.26864	0.074	T	0.27640	-1.0068	10	0.54805	T	0.06	.	8.2618	0.31790	0.1974:0.0:0.8026:0.0	.	244	P30954	O10J1_HUMAN	Q	244	ENSP00000399078:R244Q	ENSP00000399078:R244Q	R	+	2	0	OR10J1	157676903	0.000000	0.05858	0.076000	0.20297	0.709000	0.40893	0.048000	0.14078	0.334000	0.23590	0.650000	0.86243	CGG			0.478	OR10J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059020.1		NM_012351	
PPOX	5498	broad.mit.edu	37	1	161138882	161138882	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:161138882C>A	ENST00000367999.4	+	7	982	c.716C>A	c.(715-717)gCc>gAc	p.A239D	B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_3'UTR|PPOX_ENST00000352210.5_Missense_Mutation_p.A239D	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase	239					heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TTGCCTCAGGCCCTTGAAACC	0.627																																					p.A239D													.	PPOX	34		0			c.C716A												73.0	74.0	73.0					1																	161138882		2203	4300	6503	SO:0001583	missense	5498	exon7			CTCAGGCCCTTGA	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.716C>A	1.37:g.161138882C>A	ENSP00000356978:p.Ala239Asp		46	0.0217391304	1		81	0.06	5	NM_001122764	37	0.00	0	D3DVG0|Q5VTW8	Missense_Mutation	SNP	ENST00000367999.4	37	CCDS1221.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.01|19.01	3.743360|3.743360	0.69418|0.69418	.|.	.|.	ENSG00000143224|ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000435935|ENST00000537523	D;D|.	0.97114|.	-4.25;-4.25|.	5.57|5.57	5.57|5.57	0.84162|0.84162	Amine oxidase (1);|.	0.243583|.	0.40554|.	N|.	0.001066|.	D|D	0.82623|0.82623	0.5077|0.5077	M|M	0.89534|0.89534	3.04|3.04	0.80722|0.80722	D|D	1|1	D;D;D|.	0.63046|.	0.958;0.992;0.966|.	P;P;P|.	0.61201|.	0.885;0.664;0.46|.	D|D	0.85261|0.85261	0.1050|0.1050	10|5	0.54805|.	T|.	0.06|.	-15.7416|-15.7416	18.3212|18.3212	0.90239|0.90239	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	206;77;239|.	B4DY76;B3KT30;P50336|.	.;.;PPOX_HUMAN|.	D|T	239;239;206|52	ENSP00000343943:A239D;ENSP00000356978:A239D|.	ENSP00000343943:A239D|.	A|P	+|+	2|1	0|0	PPOX|PPOX	159405506|159405506	1.000000|1.000000	0.71417|0.71417	0.802000|0.802000	0.32245|0.32245	0.429000|0.429000	0.31625|0.31625	4.722000|4.722000	0.61958|0.61958	2.602000|2.602000	0.87976|0.87976	0.655000|0.655000	0.94253|0.94253	GCC|CCC			0.627	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082993.1		NM_000309	
EPRS	2058	mdanderson.org	37	1	220178702	220178702	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:220178702G>T	ENST00000366923.3	-	16	2220	c.1951C>A	c.(1951-1953)Cat>Aat	p.H651N		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	651	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	AGCTCTTCATGCTGTAAAGAT	0.338																																					p.H651N													.	.			0			c.C1951A												83.0	83.0	83.0					1																	220178702		2202	4298	6500	SO:0001630	splice_region_variant	2058	exon16			CTTCATGCTGTAA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.1951-1C>A	1.37:g.220178702G>T			21	0	0		49	0.06	3	NM_004446	79	0.00	0	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	37	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	G	6.826	0.521512	0.13005	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.06294	3.32	5.36	5.36	0.76844	Ribosomal protein L25/Gln-tRNA synthetase, anti-codon-binding domain (1);Ribosomal protein L25/Gln-tRNA synthetase, beta-barrel domain (1);Glutamyl/glutaminyl-tRNA synthetase, class Ib, anti-codon binding domain (1);	0.552403	0.20424	N	0.092613	T	0.06645	0.0170	L	0.27053	0.805	0.41038	D	0.985207	B;B;B;B	0.26147	0.143;0.0;0.01;0.028	B;B;B;B	0.27380	0.079;0.009;0.009;0.05	T	0.42682	-0.9437	10	0.12103	T	0.63	-6.7653	19.4637	0.94929	0.0:0.0:1.0:0.0	.	675;658;658;651	E7EMN0;F5H7I7;Q3KQZ8;P07814	.;.;.;SYEP_HUMAN	N	651;658;675	ENSP00000355890:H651N	ENSP00000355890:H651N	H	-	1	0	EPRS	218245325	1.000000	0.71417	0.998000	0.56505	0.684000	0.39900	3.945000	0.56637	2.675000	0.91044	0.655000	0.94253	CAT			0.338	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091133.2		NM_004446	Missense_Mutation
HLX	3142	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	221054636	221054636	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:221054636C>G	ENST00000366903.6	+	2	2194	c.693C>G	c.(691-693)aaC>aaG	p.N231K	HLX_ENST00000549319.1_5'UTR|HLA-AS1_ENST00000552026.1_RNA	NM_021958.3	NP_068777.1	Q14774	HLX_HUMAN	H2.0-like homeobox	231					cell differentiation (GO:0030154)|embryonic digestive tract morphogenesis (GO:0048557)|enteric nervous system development (GO:0048484)|liver development (GO:0001889)|multicellular organismal development (GO:0007275)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|positive regulation of cell proliferation (GO:0008284)|positive regulation of organ growth (GO:0046622)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(9)|lung(11)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(131;0.00914)		ATCCCATTAACGAGGCTTCTG	0.552																																					p.N231K													.	.			0			c.C693G												94.0	96.0	96.0					1																	221054636		2203	4300	6503	SO:0001583	missense	3142	exon2			CATTAACGAGGCT	BC033808	CCDS1527.1	1q41	2011-06-20	2007-07-26	2007-07-26	ENSG00000136630	ENSG00000136630		"""Homeoboxes / ANTP class : NKL subclass"""	4978	protein-coding gene	gene with protein product		142995	"""H2.0 (Drosophila)-like homeo box 1"", ""H2.0-like homeobox 1 (Drosophila)"", ""H2.0-like homeobox 1"""	HLX1		1676597, 7806220	Standard	NM_021958		Approved	HB24	uc001hmv.4	Q14774	OTTHUMG00000037352	ENST00000366903.6:c.693C>G	1.37:g.221054636C>G	ENSP00000355870:p.Asn231Lys		147	0	0		206	0.12	24	NM_021958	13	0.00	0	B2R8A8|Q15988|Q59HE7|Q9NZ75	Missense_Mutation	SNP	ENST00000366903.6	37	CCDS1527.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077926	0.55753	.	.	ENSG00000136630	ENST00000366903	D	0.89681	-2.55	5.82	0.873	0.19118	.	0.357028	0.26855	N	0.022143	T	0.78648	0.4316	N	0.24115	0.695	0.80722	D	1	B	0.23650	0.089	B	0.19391	0.025	T	0.64761	-0.6331	10	0.29301	T	0.29	-36.3448	9.9892	0.41860	0.0:0.6695:0.0:0.3305	.	231	Q14774	HLX_HUMAN	K	231	ENSP00000355870:N231K	ENSP00000355870:N231K	N	+	3	2	HLX	219121259	0.961000	0.32948	0.991000	0.47740	0.967000	0.64934	0.160000	0.16462	-0.076000	0.12775	-0.254000	0.11334	AAC			0.552	HLX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000090902.3		NM_021958	
OBSCN	84033	mdanderson.org	37	1	228462511	228462511	+	Silent	SNP	C	C	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:228462511C>T	ENST00000422127.1	+	20	5966	c.5922C>T	c.(5920-5922)ggC>ggT	p.G1974G	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Silent_p.G1974G|OBSCN_ENST00000359599.6_Silent_p.G821G|RP5-1139B12.3_ENST00000602947.1_RNA|RP5-1139B12.3_ENST00000602529.1_RNA|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000570156.2_Silent_p.G2349G|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1974	Ig-like 19.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				AGGCTGAGGGCGCCTCATCCT	0.657																																					p.G2349G													.	.			0			c.C7047T												26.0	31.0	29.0					1																	228462511		2130	4242	6372	SO:0001819	synonymous_variant	84033	exon24			TGAGGGCGCCTCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5922C>T	1.37:g.228462511C>T			28	0	0		36	0.08	3	NM_001271223	0		0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	37	CCDS58065.1																																																																																					0.657	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
ARID4B	51742	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	235345007	235345007	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr1:235345007C>G	ENST00000264183.3	-	20	3724	c.3227G>C	c.(3226-3228)gGg>gCg	p.G1076A	ARID4B_ENST00000494543.1_5'UTR|ARID4B_ENST00000349213.3_Missense_Mutation_p.G990A|ARID4B_ENST00000366603.2_Missense_Mutation_p.G1076A	NM_016374.5	NP_057458.4	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B (RBP1-like)	1076					histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|large_intestine(2)|lung(1)|ovary(2)	8	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			TTGGAGCTCCCCAGCAACACT	0.478																																					p.G1076A													.	ARID4B	142		0			c.G3227C												111.0	94.0	100.0					1																	235345007		2203	4300	6503	SO:0001583	missense	51742	exon20			AGCTCCCCAGCAA	AF214114	CCDS31060.1, CCDS31061.1	1q42.1-q43	2013-02-07	2006-11-08	2004-01-30	ENSG00000054267	ENSG00000054267		"""-"""	15550	protein-coding gene	gene with protein product		609696	"""retinoblastoma binding protein 1-like 1"", ""AT rich interactive domain 4B (RBP1- like)"""	RBP1L1		11481388	Standard	NM_016374		Approved	BCAA, BRCAA1, SAP180	uc001hwq.3	Q4LE39	OTTHUMG00000039621	ENST00000264183.3:c.3227G>C	1.37:g.235345007C>G	ENSP00000264183:p.Gly1076Ala		86	0.011627907	1		99	0.17	17	NM_016374	26	0.19	5	A1L465|Q3MHV4|Q5HY99|Q5T2C2|Q5T2C3|Q5T2C4|Q5T2C5|Q5T2C6|Q6P600|Q86UX1|Q86WR4|Q9H915|Q9NYU3|Q9NZB6|Q9NZG4|Q9P2W4|Q9UF62|Q9Y6E1	Missense_Mutation	SNP	ENST00000264183.3	37	CCDS31061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.57|16.57	3.161176|3.161176	0.57368|0.57368	.|.	.|.	ENSG00000054267|ENSG00000054267	ENST00000391856;ENST00000349213;ENST00000366603;ENST00000264183|ENST00000444620	T;T;T|.	0.27890|.	1.7;1.64;1.64|.	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.71298|0.71298	0.3323|0.3323	L|L	0.50333|0.50333	1.59|1.59	0.58432|0.58432	D|D	0.999999|0.999999	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999|.	D;D;D;D|.	0.87578|.	0.998;0.996;0.996;0.991|.	T|T	0.71941|0.71941	-0.4440|-0.4440	10|7	0.02654|0.51188	T|T	1|0.08	-12.6422|-12.6422	18.6926|18.6926	0.91589|0.91589	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	757;1076;990;1076|.	Q4LE39-4;Q4LE39-3;Q4LE39-2;Q4LE39|.	.;.;.;ARI4B_HUMAN|.	A|R	1076;990;1076;1076|476	ENSP00000264184:G990A;ENSP00000355562:G1076A;ENSP00000264183:G1076A|.	ENSP00000264183:G1076A|ENSP00000416063:G476R	G|G	-|-	2|1	0|0	ARID4B|ARID4B	233411630|233411630	1.000000|1.000000	0.71417|0.71417	0.914000|0.914000	0.36105|0.36105	0.979000|0.979000	0.70002|0.70002	5.535000|5.535000	0.67173|0.67173	2.418000|2.418000	0.82041|0.82041	0.585000|0.585000	0.79938|0.79938	GGG|GGG			0.478	ARID4B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095566.3		NM_016374	
AKR1C7P	648947	broad.mit.edu	37	10	5325578	5325578	+	RNA	DEL	C	C	-	rs144291885|rs571534992	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr10:5325578delC	ENST00000432689.2	-	0	276									aldo-keto reductase family 1, member C7, pseudogene																		tgaggtcaaacaactgctgga	0.498											OREG0019985	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	.			0			.																																											0	.			GTCAAACAACTGC			10p15.1	2012-12-04			ENSG00000215267	ENSG00000215267			44681	pseudogene	pseudogene							Standard	NG_023403		Approved				OTTHUMG00000017588		10.37:g.5325578delC			4	0	0	625	10	0.50	5	.	0		0		RNA	DEL	ENST00000432689.2	37																																																																																						0.498	AKR1C7P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331591.2		NG_023403	
TET1	80312	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	70412305	70412305	+	Missense_Mutation	SNP	C	C	G	rs376648844		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr10:70412305C>G	ENST00000373644.4	+	6	4624	c.4415C>G	c.(4414-4416)aCc>aGc	p.T1472S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1472					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GTAGTGTACACCGGTAAAGAA	0.353																																					p.T1472S													.	.			0			c.C4415G												122.0	123.0	123.0					10																	70412305		2203	4300	6503	SO:0001583	missense	80312	exon6			TGTACACCGGTAA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4415C>G	10.37:g.70412305C>G	ENSP00000362748:p.Thr1472Ser		72	0	0		112	0.12	13	NM_030625	22	0.23	5	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.411869	0.83340	.	.	ENSG00000138336	ENST00000373644	T	0.36340	1.26	5.84	5.84	0.93424	TET cysteine-rich domain (1);	0.055233	0.64402	D	0.000001	T	0.61135	0.2323	M	0.64170	1.965	0.49582	D	0.999808	D	0.89917	1.0	D	0.85130	0.997	T	0.61013	-0.7148	10	0.87932	D	0	.	20.1579	0.98126	0.0:1.0:0.0:0.0	.	1472	Q8NFU7	TET1_HUMAN	S	1472	ENSP00000362748:T1472S	ENSP00000362748:T1472S	T	+	2	0	TET1	70082311	1.000000	0.71417	0.115000	0.21578	0.684000	0.39900	5.571000	0.67404	2.767000	0.95098	0.555000	0.69702	ACC			0.353	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
PTDSS2	81490	mdanderson.org	37	11	489457	489457	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:489457G>T	ENST00000308020.5	+	9	1088	c.912G>T	c.(910-912)gaG>gaT	p.E304D		NM_030783.1	NP_110410.1	Q9BVG9	PTSS2_HUMAN	phosphatidylserine synthase 2	304					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CDP-diacylglycerol-serine O-phosphatidyltransferase activity (GO:0003882)			autonomic_ganglia(1)|breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(1)	9		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;2.76e-26)|Epithelial(43;2.56e-25)|OV - Ovarian serous cystadenocarcinoma(40;7.54e-20)|BRCA - Breast invasive adenocarcinoma(625;8.76e-05)|Lung(200;0.0407)|LUSC - Lung squamous cell carcinoma(625;0.0735)	Phosphatidylserine(DB00144)	TTCGCTTCGAGTGGAAGCCGG	0.701																																					p.E304D													.	.			0			c.G912T												54.0	51.0	52.0					11																	489457		2202	4300	6502	SO:0001583	missense	81490	exon9			CTTCGAGTGGAAG	BC001210	CCDS7696.1	11p15	2008-05-02			ENSG00000174915	ENSG00000174915			15463	protein-coding gene	gene with protein product		612793				14984733	Standard	NM_030783		Approved	PSS2	uc001lpj.3	Q9BVG9	OTTHUMG00000119087	ENST00000308020.5:c.912G>T	11.37:g.489457G>T	ENSP00000308258:p.Glu304Asp		37	0	0		42	0.07	3	NM_030783	81	0.00	0		Missense_Mutation	SNP	ENST00000308020.5	37	CCDS7696.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895288	0.52121	.	.	ENSG00000174915	ENST00000308020	.	.	.	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.25419	0.0618	N	0.03967	-0.31	0.52501	D	0.999955	B	0.26147	0.143	B	0.27262	0.078	T	0.12243	-1.0555	9	0.10377	T	0.69	-26.1837	10.5793	0.45246	0.0911:0.0:0.9089:0.0	.	304	Q9BVG9	PTSS2_HUMAN	D	304	.	ENSP00000308258:E304D	E	+	3	2	PTDSS2	479457	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.804000	0.55568	2.403000	0.81681	0.561000	0.74099	GAG			0.701	PTDSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239301.2			
ABCC8	6833	hgsc.bcm.edu	37	11	17464362	17464362	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:17464362T>C	ENST00000389817.3	-	10	1603	c.1535A>G	c.(1534-1536)tAc>tGc	p.Y512C	ABCC8_ENST00000528202.1_5'Flank|ABCC8_ENST00000302539.4_Missense_Mutation_p.Y512C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	512	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTCCCAGGCGTACAGCTTCAG	0.602																																					p.Y512C													.	.			0			c.A1535G												100.0	91.0	94.0					11																	17464362		2200	4293	6493	SO:0001583	missense	6833	exon10			CAGGCGTACAGCT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.1535A>G	11.37:g.17464362T>C	ENSP00000374467:p.Tyr512Cys		56	0	0		68	0.06	4	NM_000352	0		0	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	37	CCDS31437.1	.	.	.	.	.	.	.	.	.	.	T	26.6	4.754032	0.89843	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.92099	-2.97;-2.97	6.02	6.02	0.97574	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;0.993	D;D	0.91635	0.999;0.947	D	0.98264	1.0500	10	0.87932	D	0	.	16.5446	0.84426	0.0:0.0:0.0:1.0	.	511;512	B7Z4N0;Q09428	.;ABCC8_HUMAN	C	512;512;526	ENSP00000374467:Y512C;ENSP00000303960:Y512C	ENSP00000303960:Y512C	Y	-	2	0	ABCC8	17420938	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.029000	0.88807	2.311000	0.77944	0.533000	0.62120	TAC			0.602	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000389093.1		NM_000352	
RPLP0P2	113157	broad.mit.edu	37	11	61405030	61405030	+	RNA	SNP	T	T	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:61405030T>A	ENST00000496593.1	+	0	1634					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		ctgctgctgctgcAGCCCCAG	0.552																																					.													.	.			0			.																																											0	.			TGCTGCTGCAGCC	BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61405030T>A			102	0.0098039216	1		131	0.03	4	.	11	0.00	0		RNA	SNP	ENST00000496593.1	37																																																																																						0.552	RPLP0P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000350911.1		NR_002775	
ADRBK1	156	mdanderson.org	37	11	67034243	67034243	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:67034243G>T	ENST00000308595.5	+	1	363	c.73G>T	c.(73-75)Gcc>Tcc	p.A25S	ADRBK1_ENST00000526285.1_Missense_Mutation_p.A25S	NM_001619.3	NP_001610.2	P25098	ARBK1_HUMAN	adrenergic, beta, receptor kinase 1	25	N-terminal.				activation of phospholipase C activity (GO:0007202)|cardiac muscle contraction (GO:0060048)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of striated muscle contraction (GO:0045988)|negative regulation of the force of heart contraction by chemical signal (GO:0003108)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of catecholamine secretion (GO:0033605)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)	22			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)		Adenosine triphosphate(DB00171)	GGCCACGCCGGCCGCGCGCGC	0.766																																					p.A25S													.	.			0			c.G73T												8.0	9.0	8.0					11																	67034243		2110	4154	6264	SO:0001583	missense	156	exon1			ACGCCGGCCGCGC	X61157	CCDS8156.1	11q13	2013-01-10			ENSG00000173020	ENSG00000173020		"""Pleckstrin homology (PH) domain containing"""	289	protein-coding gene	gene with protein product		109635				2037065	Standard	NM_001619		Approved	GRK2, BARK1	uc009yrn.1	P25098	OTTHUMG00000167104	ENST00000308595.5:c.73G>T	11.37:g.67034243G>T	ENSP00000312262:p.Ala25Ser		13	0	0		15	0.20	3	NM_001619	46	0.00	0	B0ZBE1|Q13837|Q6GTT3	Missense_Mutation	SNP	ENST00000308595.5	37	CCDS8156.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449571	0.43531	.	.	ENSG00000173020	ENST00000308595;ENST00000526285	T;T	0.60920	0.36;0.15	2.94	2.94	0.34122	.	0.000000	0.31531	U	0.007488	T	0.45337	0.1337	L	0.38953	1.18	0.45594	D	0.998536	B;B	0.24576	0.106;0.038	B;B	0.24701	0.055;0.025	T	0.33420	-0.9869	10	0.22706	T	0.39	.	12.7913	0.57534	0.0:0.0:1.0:0.0	.	25;25	P25098;E9PRV7	ARBK1_HUMAN;.	S	25	ENSP00000312262:A25S;ENSP00000434126:A25S	ENSP00000312262:A25S	A	+	1	0	ADRBK1	66790819	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.033000	0.76504	1.195000	0.43115	0.186000	0.17326	GCC			0.766	ADRBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393153.1		NM_001619	
ADAMTS8	11095	mdanderson.org	37	11	130297477	130297477	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr11:130297477G>T	ENST00000257359.6	-	1	1411	c.705C>A	c.(703-705)taC>taA	p.Y235*		NM_007037.4	NP_008968.4	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 8	235	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				negative regulation of cell proliferation (GO:0008285)|phosphate ion transmembrane transport (GO:0035435)	proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)|low-affinity phosphate transmembrane transporter activity (GO:0009673)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	10	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GGTCGGCCCCGTAGAAGGCAG	0.672																																					p.Y235X													.	.			0			c.C705A												13.0	17.0	16.0					11																	130297477		2023	4064	6087	SO:0001587	stop_gained	11095	exon1			GGCCCCGTAGAAG	AF060153	CCDS41732.1	11q25	2008-07-18	2005-08-19		ENSG00000134917	ENSG00000134917		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	224	protein-coding gene	gene with protein product		605175	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 8"""			10438512	Standard	NM_007037		Approved	METH2, FLJ41712, ADAM-TS8	uc001qgg.4	Q9UP79	OTTHUMG00000165656	ENST00000257359.6:c.705C>A	11.37:g.130297477G>T	ENSP00000257359:p.Tyr235*		12	0	0		19	0.11	2	NM_007037	0		0	Q9NZS0	Nonsense_Mutation	SNP	ENST00000257359.6	37	CCDS41732.1	.	.	.	.	.	.	.	.	.	.	G	43	10.438497	0.99405	.	.	ENSG00000134917	ENST00000257359;ENST00000414575	.	.	.	4.89	-7.08	0.01558	.	0.205357	0.43579	D	0.000556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	9.1868	0.37176	0.514:0.0:0.3941:0.0918	.	.	.	.	X	235;264	.	ENSP00000257359:Y235X	Y	-	3	2	ADAMTS8	129802687	0.018000	0.18449	0.070000	0.20053	0.957000	0.61999	-0.598000	0.05706	-1.372000	0.02137	-0.379000	0.06801	TAC			0.672	ADAMTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385636.1		NM_007037	
KRT8	3856	bcgsc.ca	37	12	53298699	53298699	+	Missense_Mutation	SNP	G	G	A	rs201807576	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:53298699G>A	ENST00000552551.1	-	2	499	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C	KRT8_ENST00000293308.6_Missense_Mutation_p.R23C|KRT8_ENST00000546897.1_Missense_Mutation_p.R23C|KRT8_ENST00000552150.1_Missense_Mutation_p.R51C			P05787	K2C8_HUMAN	keratin 8	23	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	GTGTAGGAGCGGCTGCTGAAG	0.667																																					p.R51C													KRT8,colon,carcinoma,0,2	KRT8	41	2	0			c.C151T												11.0	13.0	13.0					12																	53298699		1953	3904	5857	SO:0001583	missense	3856	exon2			AGGAGCGGCTGCT	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.67C>T	12.37:g.53298699G>A	ENSP00000447566:p.Arg23Cys		30	0	0		44	0.00	0	NM_001256282	22	0.00	0	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	ENST00000552551.1	37	CCDS8841.1	.	.	.	.	.	.	.	.	.	.	-	13.69	2.312705	0.40895	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	D;D;D;D;D;D;D;T	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-0.98	4.71	4.71	0.59529	.	0.431059	0.26883	N	0.022003	T	0.75824	0.3902	L	0.33293	1	0.41950	D	0.99065	B;B;B	0.12630	0.006;0.003;0.003	B;B;B	0.15484	0.013;0.005;0.002	T	0.69450	-0.5142	10	0.27082	T	0.32	.	9.653	0.39908	0.0974:0.0:0.9026:0.0	.	51;23;23	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	C	23;23;23;23;51;23;63;23;101	ENSP00000447566:R23C;ENSP00000293308:R23C;ENSP00000447402:R23C;ENSP00000449404:R51C;ENSP00000447881:R23C;ENSP00000447040:R63C;ENSP00000448681:R23C;ENSP00000450228:R101C	ENSP00000293308:R23C	R	-	1	0	KRT8	51584966	0.070000	0.21116	1.000000	0.80357	0.819000	0.46315	0.097000	0.15168	2.582000	0.87167	0.531000	0.56144	CGC			0.667	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406385.1		NM_002273	
MARCH9	92979	mdanderson.org	37	12	58152628	58152628	+	Missense_Mutation	SNP	G	G	T	rs146323526		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:58152628G>T	ENST00000266643.5	+	4	1420	c.989G>T	c.(988-990)cGt>cTt	p.R330L	MARCH9_ENST00000548358.1_Missense_Mutation_p.R217L	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	330					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			CCAGATGCCCGTTCCAGCTCC	0.597																																					p.R330L													.	.			0			c.G989T												27.0	27.0	27.0					12																	58152628		2187	4288	6475	SO:0001583	missense	92979	exon4			ATGCCCGTTCCAG	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.989G>T	12.37:g.58152628G>T	ENSP00000266643:p.Arg330Leu		56	0	0		97	0.04	4	NM_138396	70	0.00	0	B2R9U9|Q86VN5|Q96GG2	Missense_Mutation	SNP	ENST00000266643.5	37	CCDS31847.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217516	0.58560	.	.	ENSG00000139266	ENST00000266643;ENST00000548358	T;T	0.35605	2.2;1.3	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.55625	0.1932	M	0.63843	1.955	0.58432	D	0.999991	D;D	0.76494	0.999;0.995	D;P	0.74023	0.982;0.796	T	0.39840	-0.9594	10	0.13108	T	0.6	.	18.4399	0.90662	0.0:0.0:1.0:0.0	.	217;330	Q86YJ5-2;Q86YJ5	.;MARH9_HUMAN	L	330;217	ENSP00000266643:R330L;ENSP00000446758:R217L	ENSP00000266643:R330L	R	+	2	0	MARCH9	56438895	0.918000	0.31147	1.000000	0.80357	0.985000	0.73830	1.699000	0.37804	2.890000	0.99128	0.655000	0.94253	CGT			0.597	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000409244.1		NM_138396	
NCOR2	9612	mdanderson.org	37	12	124827604	124827604	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr12:124827604A>G	ENST00000405201.1	-	33	4883	c.4883T>C	c.(4882-4884)aTc>aCc	p.I1628T	NCOR2_ENST00000356219.3_Missense_Mutation_p.I1635T|NCOR2_ENST00000404621.1_Missense_Mutation_p.I1618T|NCOR2_ENST00000404121.2_Missense_Mutation_p.I1189T|NCOR2_ENST00000397355.1_Missense_Mutation_p.I1619T|NCOR2_ENST00000429285.2_Missense_Mutation_p.I1618T			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1636					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGCCAGGGGGATGTGGCTGCG	0.672																																					p.I1628T													.	.			0			c.T4883C												37.0	45.0	42.0					12																	124827604		2135	4223	6358	SO:0001583	missense	9612	exon35			AGGGGGATGTGGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.4883T>C	12.37:g.124827604A>G	ENSP00000384018:p.Ile1628Thr		53	0	0		56	0.05	3	NM_006312	42	0.00	0	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	A	17.00	3.275581	0.59649	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	T;T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91;0.91	5.27	5.27	0.74061	.	0.055791	0.64402	D	0.000001	T	0.62962	0.2471	M	0.65975	2.015	0.49213	D	0.999765	D;D;D	0.76494	0.999;0.993;0.996	D;D;D	0.80764	0.994;0.977;0.99	T	0.67122	-0.5750	10	0.87932	D	0	-25.2372	15.1879	0.73020	1.0:0.0:0.0:0.0	.	1618;1619;1628	C9J0Q5;C9J239;C9JFD3	.;.;.	T	1628;1618;1635;1619;1627;1189;1618	ENSP00000384018:I1628T;ENSP00000384202:I1618T;ENSP00000348551:I1635T;ENSP00000380513:I1619T;ENSP00000385618:I1189T;ENSP00000400281:I1618T	ENSP00000348551:I1635T	I	-	2	0	NCOR2	123393557	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	8.415000	0.90241	1.975000	0.57531	0.533000	0.62120	ATC			0.672	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
TRIM13	10206	hgsc.bcm.edu	37	13	50588490	50588490	+	3'UTR	SNP	T	T	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:50588490T>C	ENST00000378182.3	+	0	3152				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank|KCNRG_ENST00000312942.1_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		aatatatatatatatatacac	0.308																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	10206	.			TATATATATATAT	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1190T>C	13.37:g.50588490T>C			22	0	0		32	0.19	6	.	0		0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																					0.308	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354875.1		NM_001007278	
TRIM13	10206	hgsc.bcm.edu	37	13	50588492	50588492	+	3'UTR	SNP	T	T	C	rs200626518		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:50588492T>C	ENST00000378182.3	+	0	3154				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank|KCNRG_ENST00000312942.1_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		tatatatatatatatacacac	0.303																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	10206	.			TATATATATATAC	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1192T>C	13.37:g.50588492T>C			22	0	0		31	0.23	7	.	0		0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																					0.303	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354875.1		NM_001007278	
TRIM13	10206	hgsc.bcm.edu	37	13	50588494	50588494	+	3'UTR	SNP	T	T	C	rs201280640		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:50588494T>C	ENST00000378182.3	+	0	3156				TRIM13_ENST00000478111.1_Intron|KCNRG_ENST00000360473.4_5'Flank|KCNRG_ENST00000312942.1_5'Flank	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		tatatatatatatacacacac	0.294																																					.													.	.			0			.																																									SO:0001624	3_prime_UTR_variant	10206	.			TATATATATACAC	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1194T>C	13.37:g.50588494T>C			26	0	0		31	0.26	8	.	0		0	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	SNP	ENST00000378182.3	37	CCDS9423.1																																																																																					0.294	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000354875.1		NM_001007278	
ATP11AUN	400165	bcgsc.ca	37	13	113333688	113333688	+	5'UTR	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:113333688G>T	ENST00000356049.1	+	0	753					NM_207440.1	NP_997323.1	Q6ZP68	ATPUN_HUMAN												breast(1)|lung(2)|ovary(1)|prostate(1)	5	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)		all cancers(43;0.201)			CTGGGACCTTGTTAGGATGAA	0.562																																					.													.	C13orf35	13		0			.												57.0	52.0	54.0					13																	113333688		2203	4300	6503	SO:0001623	5_prime_UTR_variant	400165	.			GACCTTGTTAGGA																												ENST00000356049.1:c.-6G>T	13.37:g.113333688G>T			45	0	0		51	0.00	0	.	2	0.00	0		Missense_Mutation	SNP	ENST00000356049.1	37	CCDS9526.1																																																																																					0.562	C13orf35-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000126522.2			
CUL4A	8451	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	13	113898807	113898807	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr13:113898807A>T	ENST00000375440.4	+	12	1396	c.1312A>T	c.(1312-1314)Atc>Ttc	p.I438F	CUL4A_ENST00000451881.1_Missense_Mutation_p.I338F|CUL4A_ENST00000326335.4_Missense_Mutation_p.I338F|CUL4A_ENST00000375441.3_Missense_Mutation_p.I338F	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	438					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			CAAGATCATGATCCTGTTCAG	0.478																																					p.I438F													.	.			0			c.A1312T												81.0	65.0	70.0					13																	113898807		2203	4300	6503	SO:0001583	missense	8451	exon12			ATCATGATCCTGT	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1312A>T	13.37:g.113898807A>T	ENSP00000364589:p.Ile438Phe		213	0	0		265	0.09	25	NM_001008895	52	0.21	11	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	37	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515694	0.85389	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	4.77	4.77	0.60923	Cullin, N-terminal (1);Cullin homology (3);	0.000000	0.85682	D	0.000000	D	0.82843	0.5125	M	0.79805	2.47	0.80722	D	1	P;P	0.44090	0.826;0.826	P;P	0.52646	0.705;0.705	D	0.85704	0.1315	10	0.72032	D	0.01	-36.4424	14.5824	0.68300	1.0:0.0:0.0:0.0	.	438;438	Q13619;A8MSH7	CUL4A_HUMAN;.	F	338;338;338;438	ENSP00000364590:I338F;ENSP00000389118:I338F;ENSP00000322132:I338F;ENSP00000364589:I438F	ENSP00000322132:I338F	I	+	1	0	CUL4A	112946808	1.000000	0.71417	0.995000	0.50966	0.825000	0.46686	9.119000	0.94362	1.918000	0.55548	0.397000	0.26171	ATC			0.478	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045888.3		NM_003589	
GALC	2581	mdanderson.org	37	14	88459491	88459491	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr14:88459491G>T	ENST00000261304.2	-	1	124	c.18C>A	c.(16-18)ctC>ctA	p.L6L	GALC_ENST00000393569.2_Intron|GALC_ENST00000544807.2_5'Flank|GALC_ENST00000393568.4_Silent_p.L6L	NM_000153.3|NM_001201401.1	NP_000144.2|NP_001188330.1	P54803	GALC_HUMAN	galactosylceramidase	6					carbohydrate metabolic process (GO:0005975)|galactosylceramide catabolic process (GO:0006683)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	galactosylceramidase activity (GO:0004336)			endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AGGAAGCCGAGAGTAGCCACT	0.701																																					p.L6L													.	.			0			c.C18A																																									SO:0001819	synonymous_variant	2581	exon1			AGCCGAGAGTAGC	L23116	CCDS9878.2, CCDS55936.1, CCDS55937.1	14q31	2009-01-06	2005-11-29		ENSG00000054983	ENSG00000054983	3.2.1.46		4115	protein-coding gene	gene with protein product	"""Krabbe disease"""	606890	"""galactosylceramidase (Krabbe disease)"""				Standard	NM_000153		Approved		uc001xvt.3	P54803	OTTHUMG00000028646	ENST00000261304.2:c.18C>A	14.37:g.88459491G>T			30	0.0333333333	1		52	0.06	3	NM_000153	0		0	B4DKE8|B4DYN1|B4DZJ8|B7Z7Z2|J3KN25|J3KPP8|Q8J030	Silent	SNP	ENST00000261304.2	37	CCDS9878.2																																																																																					0.701	GALC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071559.2			
IGHV3-21	28444	broad.mit.edu	37	14	106691798	106691800	+	RNA	DEL	AAC	AAC	-	rs553767931	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr14:106691798_106691800delAAC	ENST00000390607.2	-	0	302_304									immunoglobulin heavy variable 3-21																		TAGTATATGTAACTACTACTACT	0.517																																					.													.	.			0			.																																											0	.			ATATGTAACTACT	Z14073		14q32.33	2012-02-08			ENSG00000211947	ENSG00000211947		"""Immunoglobulins / IGH locus"""	5586	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152279		14.37:g.106691798_106691800delAAC			157	0	0		237	0.10	23	.	219	0.00	0		RNA	DEL	ENST00000390607.2	37																																																																																						0.517	IGHV3-21-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000325667.1		NG_001019	
Unknown	0	bcgsc.ca	37	15	22692049	22692049	+	IGR	SNP	G	G	A	rs201007455		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr15:22692049G>A								MIR4509-2 (16808 upstream) : GOLGA8DP (12671 downstream)																							AAAGAAGCCAGCCTGAGCGAA	0.502																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	56476	.			AAGCCAGCCTGAG																													15.37:g.22692049G>A			48	0.0833333333	4		73	0.26	19	.	0		0		RNA	SNP		37																																																																																					0	0.502										
TPSB2	64499	mdanderson.org	37	16	1278707	1278707	+	RNA	SNP	G	G	T	rs369177468		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:1278707G>T	ENST00000339687.6	-	0	794				TPSB2_ENST00000430512.2_RNA|TPSB2_ENST00000445910.1_RNA			P20231	TRYB2_HUMAN	tryptase beta 2 (gene/pseudogene)							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|upper_aerodigestive_tract(1)	2		Hepatocellular(780;0.00369)				TGACACGGGTGTAGATGCCAG	0.657																																					p.Y257X													.	.			0			c.C771A												50.0	51.0	50.0					16																	1278707		2184	4296	6480			64499	exon7			ACGGGTGTAGATG	AF099143		16p13.3	2009-11-20	2009-11-18		ENSG00000197253	ENSG00000197253			14120	protein-coding gene	gene with protein product	"""tryptase beta II"", ""tryptase beta III"""	191081	"""tryptase beta 2"""			19748655	Standard	NM_024164		Approved		uc002cky.3	P20231	OTTHUMG00000155926		16.37:g.1278707G>T			145	0	0		174	0.03	5	NM_024164	10	0.00	0	D2E6S0|D2E6S2|O95827|Q15664|Q9UQI6|Q9UQI7	Nonsense_Mutation	SNP	ENST00000339687.6	37		.	.	.	.	.	.	.	.	.	.	G	13.35	2.209885	0.39003	.	.	ENSG00000197253	ENST00000430512	.	.	.	3.8	1.8	0.24995	.	0.000000	0.39544	N	0.001330	.	.	.	.	.	.	0.40531	D	0.980931	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.191	0.20524	0.3397:0.0:0.6602:0.0	.	.	.	.	X	256	.	ENSP00000412409:Y256X	Y	-	3	2	TPSB2	1218708	0.909000	0.30893	0.941000	0.38009	0.012000	0.07955	1.224000	0.32539	0.238000	0.21222	0.561000	0.74099	TAC			0.657	TPSB2-002	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000342364.1		NM_024164	
PKMYT1	9088	broad.mit.edu	37	16	3026798	3026798	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:3026798A>C	ENST00000262300.8	-	3	753	c.245T>G	c.(244-246)gTg>gGg	p.V82G	PKMYT1_ENST00000440027.2_Missense_Mutation_p.V82G|PKMYT1_ENST00000574730.1_Missense_Mutation_p.V13G|PKMYT1_ENST00000431515.2_Missense_Mutation_p.V82G|PKMYT1_ENST00000573944.1_Missense_Mutation_p.V73G|PKMYT1_ENST00000574385.1_Missense_Mutation_p.V73G	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	82					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						CCGGAATGACACCCGCCGGGG	0.687																																					p.V82G													.	PKMYT1	23		0			c.T245G												8.0	9.0	9.0					16																	3026798		2174	4274	6448	SO:0001583	missense	9088	exon3			AATGACACCCGCC	AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.245T>G	16.37:g.3026798A>C	ENSP00000262300:p.Val82Gly		79	0.1012658228	8		83	0.23	19	NM_182687	75	0.05	4	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	ENST00000262300.8	37	CCDS10486.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.175810	0.57692	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.62364	0.03;0.09;0.12;0.16	5.78	5.78	0.91487	.	0.000000	0.56097	D	0.000026	T	0.75642	0.3877	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.999	T	0.77424	-0.2593	10	0.62326	D	0.03	-24.4059	14.0579	0.64781	1.0:0.0:0.0:0.0	.	73;13;82;82	A6NHV6;B4DXD4;Q99640;F8W164	.;.;PMYT1_HUMAN;.	G	82;82;82;82;73	ENSP00000392855:V82G;ENSP00000262300:V82G;ENSP00000397739:V82G;ENSP00000371675:V73G	ENSP00000262300:V82G	V	-	2	0	PKMYT1	2966799	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	5.761000	0.68801	2.190000	0.69967	0.533000	0.62120	GTG			0.687	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000250963.2		NM_004203	
MAZ	4150	mdanderson.org	37	16	29820974	29820974	+	Intron	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr16:29820974G>T	ENST00000322945.6	+	5	1444				MAZ_ENST00000219782.6_Missense_Mutation_p.A465S|MAZ_ENST00000545521.1_Intron|MAZ_ENST00000568282.1_Missense_Mutation_p.A66S|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000566906.2_Intron|PRRT2_ENST00000300797.6_5'Flank|PRRT2_ENST00000358758.7_5'Flank|AC009133.15_ENST00000566537.1_RNA|PRRT2_ENST00000567659.1_5'Flank|MAZ_ENST00000568544.1_Intron|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000562337.1_Intron|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000563402.1_Intron	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						CAAGACCCCTGCCCAGCTGGC	0.726																																					p.A465S	Colon(72;875 1167 15364 30899 37091)												.	.			0			c.G1393T												10.0	12.0	11.0					16																	29820974		1962	4128	6090	SO:0001627	intron_variant	4150	exon5			ACCCCTGCCCAGC	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.1280-424G>T	16.37:g.29820974G>T			39	0	0		29	0.10	3	NM_001042539	159	0.00	0	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	ENST00000322945.6	37	CCDS42143.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896347	0.52121	.	.	ENSG00000103495	ENST00000219782	T	0.08193	3.12	4.64	3.66	0.41972	.	0.628800	0.13309	U	0.397667	T	0.03695	0.0105	N	0.05330	-0.07	0.28367	N	0.920199	B	0.33171	0.4	B	0.31101	0.124	T	0.13602	-1.0503	10	0.02654	T	1	-1.521	11.414	0.49941	0.0971:0.0:0.9029:0.0	.	465	G5E927	.	S	465	ENSP00000219782:A465S	ENSP00000219782:A465S	A	+	1	0	MAZ	29728475	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.562000	0.45914	2.313000	0.78055	0.561000	0.74099	GCC			0.726	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000435536.1		NM_002383	
ATP2A3	489	mdanderson.org	37	17	3851124	3851124	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:3851124G>A	ENST00000352011.3	-	8	710	c.656C>T	c.(655-657)gCg>gTg	p.A219V	ATP2A3_ENST00000309890.7_Missense_Mutation_p.A219V|ATP2A3_ENST00000397035.3_Missense_Mutation_p.A219V|ATP2A3_ENST00000397041.3_Missense_Mutation_p.A219V|ATP2A3_ENST00000397043.3_Missense_Mutation_p.A219V|ATP2A3_ENST00000359983.3_Missense_Mutation_p.A219V|ATP2A3_ENST00000397039.1_5'UTR			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	219					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CACACCCACCGCTTTGCCCGA	0.677																																					p.A219V	GBM(32;29 774 15719 37967)												.	.			0			c.C656T												20.0	23.0	22.0					17																	3851124		2106	4148	6254	SO:0001583	missense	489	exon8			CCCACCGCTTTGC		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.656C>T	17.37:g.3851124G>A	ENSP00000301387:p.Ala219Val		13	0	0		12	0.17	2	NM_174958	46	0.00	0	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Missense_Mutation	SNP	ENST00000352011.3	37	CCDS11041.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.236124	0.79800	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	3.4	3.4	0.38934	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.96062	0.8717	M	0.92412	3.305	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.988;0.991;0.996;0.988;0.996	D;B;P;P;P;P	0.81914	0.995;0.364;0.53;0.616;0.498;0.48	D	0.97029	0.9749	10	0.87932	D	0	.	15.035	0.71738	0.0:0.0:1.0:0.0	.	219;219;219;219;219;219	Q93084-4;Q93084-2;Q93084;Q93084-6;G3XAE1;Q93084-3	.;.;AT2A3_HUMAN;.;.;.	V	219	ENSP00000380236:A219V;ENSP00000301387:A219V;ENSP00000353072:A219V;ENSP00000380234:A219V;ENSP00000312577:A219V;ENSP00000380229:A219V	ENSP00000312577:A219V	A	-	2	0	ATP2A3	3797873	1.000000	0.71417	0.904000	0.35570	0.750000	0.42670	9.652000	0.98499	2.191000	0.70037	0.491000	0.48974	GCG			0.677	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000438401.1		NM_174953	
C1QBP	708	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	5336638	5336638	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:5336638G>A	ENST00000225698.4	-	5	755	c.674C>T	c.(673-675)aCa>aTa	p.T225I	CTC-524C5.2_ENST00000575890.1_RNA|C1QBP_ENST00000574444.1_Missense_Mutation_p.T121I	NM_001212.3	NP_001203.1	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding protein	225					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|mature ribosome assembly (GO:0042256)|mRNA processing (GO:0006397)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of mitochondrial translation (GO:0070131)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of trophoblast cell migration (GO:1901165)|regulation of complement activation (GO:0030449)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adrenergic receptor binding (GO:0031690)|complement component C1q binding (GO:0001849)|hyaluronic acid binding (GO:0005540)|kininogen binding (GO:0030984)|mitochondrial ribosome binding (GO:0097177)|mRNA binding (GO:0003729)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			lung(2)|ovary(1)	3					Hyaluronan(DB08818)	TGTGTTGAGTGTATAATTAGT	0.478																																					p.T225I													.	C1QBP	12		0			c.C674T												98.0	95.0	96.0					17																	5336638		2203	4300	6503	SO:0001583	missense	708	exon5			TTGAGTGTATAAT	X75913	CCDS11071.1	17p13.3	2009-05-07				ENSG00000108561			1243	protein-coding gene	gene with protein product	"""C1q globular domain-binding protein"", ""hyaluronan-binding protein 1"", ""splicing factor SF2-associated protein"""	601269		HABP1		8567680, 8195709	Standard	NM_001212		Approved	gC1Q-R, gC1qR, p32, SF2p32	uc002gby.1	Q07021		ENST00000225698.4:c.674C>T	17.37:g.5336638G>A	ENSP00000225698:p.Thr225Ile		136	0	0		210	0.03	7	NM_001212	1426	0.03	42	Q2HXR8|Q9NNY8	Missense_Mutation	SNP	ENST00000225698.4	37	CCDS11071.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.466255	0.84425	.	.	ENSG00000108561	ENST00000225698	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.69124	0.3076	M	0.72118	2.19	0.80722	D	1	P	0.41978	0.767	P	0.46144	0.505	T	0.71027	-0.4711	9	0.46703	T	0.11	-9.1601	17.2517	0.87044	0.0:0.0:1.0:0.0	.	225	Q07021	C1QBP_HUMAN	I	225	.	ENSP00000225698:T225I	T	-	2	0	C1QBP	5277362	1.000000	0.71417	0.971000	0.41717	0.933000	0.57130	7.545000	0.82128	2.655000	0.90218	0.655000	0.94253	ACA			0.478	C1QBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439388.1		NM_001212	
AIPL1	23746	mdanderson.org	37	17	6329080	6329080	+	Silent	SNP	C	C	T	rs371635123		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:6329080C>T	ENST00000381129.3	-	6	935	c.855G>A	c.(853-855)gcG>gcA	p.A285A	AIPL1_ENST00000576307.1_Silent_p.A225A|AIPL1_ENST00000576776.1_Silent_p.A261A|AIPL1_ENST00000570466.1_Silent_p.A263A|AIPL1_ENST00000575265.1_3'UTR|AIPL1_ENST00000250087.5_Silent_p.A222A|AIPL1_ENST00000574506.1_Silent_p.A273A	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	285					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		TCTGGAGGTCCGCCTTGGCCT	0.652																																					p.A285A													.	.			0			c.G855A												33.0	32.0	33.0					17																	6329080		2203	4300	6503	SO:0001819	synonymous_variant	23746	exon6			GAGGTCCGCCTTG	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.855G>A	17.37:g.6329080C>T			38	0	0		35	0.09	3	NM_014336	6	0.00	0	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Silent	SNP	ENST00000381129.3	37	CCDS11075.1																																																																																					0.652	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219828.3		NM_014336	
FXR2	9513	broad.mit.edu	37	17	7496130	7496130	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:7496130T>G	ENST00000250113.7	-	14	1945	c.1611A>C	c.(1609-1611)gaA>gaC	p.E537D	SOX15_ENST00000538513.2_5'Flank|SOX15_ENST00000250055.2_5'Flank|SOX15_ENST00000570788.1_5'Flank|FXR2_ENST00000573057.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	537						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CTGGGGGGGGTTCCCCAGGTT	0.607																																					p.E537D													.	FXR2	44		0			c.A1611C												22.0	25.0	24.0					17																	7496130		1821	4074	5895	SO:0001583	missense	9513	exon14			GGGGGGTTCCCCA	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1611A>C	17.37:g.7496130T>G	ENSP00000250113:p.Glu537Asp		111	0.0810810811	9		110	0.10	11	NM_004860	56	0.00	0	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	ENST00000250113.7	37	CCDS45604.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.118146	0.56505	.	.	ENSG00000129245	ENST00000250113	T	0.39592	1.07	5.56	-1.68	0.08212	.	0.055536	0.64402	D	0.000001	T	0.32793	0.0841	L	0.49126	1.545	0.38147	D	0.938615	B	0.17852	0.024	B	0.15052	0.012	T	0.19386	-1.0307	10	0.40728	T	0.16	-1.7059	11.5721	0.50839	0.0:0.6665:0.0:0.3335	.	537	P51116	FXR2_HUMAN	D	537	ENSP00000250113:E537D	ENSP00000250113:E537D	E	-	3	2	FXR2	7436855	0.765000	0.28485	0.985000	0.45067	0.938000	0.57974	-0.009000	0.12765	-0.138000	0.11434	0.528000	0.53228	GAA			0.607	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441084.1			
DNAH9	1770	mdanderson.org	37	17	11797775	11797775	+	Missense_Mutation	SNP	G	G	A	rs139641473	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:11797775G>A	ENST00000262442.4	+	59	11436	c.11368G>A	c.(11368-11370)Gtg>Atg	p.V3790M	DNAH9_ENST00000396001.2_3'UTR|DNAH9_ENST00000454412.2_Missense_Mutation_p.V3790M|DNAH9_ENST00000608377.1_Missense_Mutation_p.V102M	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3790					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CGCCAGCCCCGTGGAGTTCCT	0.522																																					p.V3790M													.	.			0			c.G11368A							G	MET/VAL,MET/VAL	2,4404	4.2+/-10.8	0,2,2201	84.0	85.0	84.0		11368,304	4.1	0.9	17	dbSNP_134	84	0,8600		0,0,4300	no	missense,missense	DNAH9	NM_001372.3,NM_004662.2	21,21	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign,benign	3790/4487,102/799	11797775	2,13004	2203	4300	6503	SO:0001583	missense	1770	exon59			AGCCCCGTGGAGT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11368G>A	17.37:g.11797775G>A	ENSP00000262442:p.Val3790Met		57	0	0		57	0.05	3	NM_001372	0		0	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	37	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137300	0.77775	4.54E-4	0.0	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001;ENST00000361801	T;T;T	0.09073	3.02;3.02;3.02	5.03	4.05	0.47172	Dynein heavy chain (1);	0.125811	0.53938	N	0.000058	T	0.27278	0.0669	H	0.94620	3.56	0.53688	D	0.999972	P;P	0.48089	0.798;0.905	P;P	0.52598	0.618;0.703	T	0.05484	-1.0882	10	0.54805	T	0.06	.	7.7363	0.28817	0.0835:0.0:0.755:0.1614	.	143;3790	B7Z7H0;Q9NYC9	.;DYH9_HUMAN	M	3790;3790;2372;102;143	ENSP00000262442:V3790M;ENSP00000414874:V3790M;ENSP00000379323:V102M	ENSP00000262442:V3790M	V	+	1	0	DNAH9	11738500	1.000000	0.71417	0.866000	0.34008	0.922000	0.55478	5.583000	0.67484	1.082000	0.41137	0.655000	0.94253	GTG	0		0.522	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252756.2		NM_001372	
KIAA0100	9703	broad.mit.edu;mdanderson.org	37	17	26970628	26970628	+	Splice_Site	SNP	G	G	T	rs150640676		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:26970628G>T	ENST00000528896.2	-	3	322	c.248C>A	c.(247-249)cCa>cAa	p.P83Q	KIAA0100_ENST00000389003.3_5'UTR|KIAA0100_ENST00000544884.1_5'UTR	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	83						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					GGGTACTCACGGAAGATCATG	0.458																																					p.P83Q													.	KIAA0100	175		0			c.C248A												129.0	128.0	129.0					17																	26970628		2203	4300	6503	SO:0001630	splice_region_variant	9703	exon3			ACTCACGGAAGAT	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.248+1C>A	17.37:g.26970628G>T			58	0	0		102	0.04	4	NM_014680	24	0.00	0	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Splice_Site	SNP	ENST00000528896.2	37	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774875	0.90108	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896	T	0.22743	1.94	5.6	5.6	0.85130	FMP27, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.02698	-1.1122	9	.	.	.	.	19.6224	0.95663	0.0:0.0:1.0:0.0	.	83;83	F6XS94;Q14667	.;K0100_HUMAN	Q	83	ENSP00000436773:P83Q	.	P	-	2	0	KIAA0100	23994755	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.242000	0.89818	2.630000	0.89119	0.655000	0.94253	CCA			0.458	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390571.3		NM_014680	Missense_Mutation
RHOT1	55288	bcgsc.ca	37	17	30536465	30536465	+	Intron	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:30536465G>T	ENST00000333942.6	+	18	1978				RHOT1_ENST00000581094.1_3'UTR|RHOT1_ENST00000358365.3_Splice_Site|RHOT1_ENST00000394692.2_Splice_Site|RHOT1_ENST00000583994.1_Splice_Site|RHOT1_ENST00000545287.2_Intron|RHOT1_ENST00000354266.3_Intron	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AAACTGCTTTGTAAGTTACTT	0.343																																					.													.	RHOT1	69		0			c.1835+1G>T												66.0	67.0	67.0					17																	30536465		2203	4300	6503	SO:0001627	intron_variant	55288	exon19			TGCTTTGTAAGTT	AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1739+1137G>T	17.37:g.30536465G>T			31	0	0		52	0.00	0	NM_001033568	1	0.00	0	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Splice_Site	SNP	ENST00000333942.6	37	CCDS32612.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230557	0.39399	.	.	ENSG00000126858	ENST00000358365;ENST00000394692	.	.	.	5.95	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.6344	0.51196	0.0:0.0:0.8231:0.1769	.	.	.	.	.	-1	.	.	.	+	.	.	RHOT1	27560578	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.918000	0.48829	2.824000	0.97209	0.655000	0.94253	.			0.343	RHOT1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000447097.1		NM_018307	
FMNL1	752	mdanderson.org	37	17	43318982	43318982	+	Silent	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:43318982G>A	ENST00000331495.3	+	14	1902	c.1566G>A	c.(1564-1566)ccG>ccA	p.P522P	CTD-2020K17.3_ENST00000587534.1_RNA|FMNL1_ENST00000587489.1_Silent_p.P100P|CTD-2020K17.3_ENST00000393507.2_RNA|FMNL1_ENST00000328118.3_Silent_p.P522P	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	522	Pro-rich.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						CGGGGGTGCCGACCGGCTCCC	0.711																																					p.P522P	GBM(164;1247 1997 8702 11086 51972)												.	.			0			c.G1566A												4.0	4.0	4.0					17																	43318982		1681	3418	5099	SO:0001819	synonymous_variant	752	exon14			GGTGCCGACCGGC	AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.1566G>A	17.37:g.43318982G>A			18	0	0		44	0.07	3	NM_005892	70	0.00	0	D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Silent	SNP	ENST00000331495.3	37	CCDS11497.1																																																																																					0.711	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450198.1		NM_005892	
LUC7L3	51747	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	48821082	48821082	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr17:48821082T>A	ENST00000505658.1	+	6	631	c.442T>A	c.(442-444)Tct>Act	p.S148T	LUC7L3_ENST00000544170.1_Missense_Mutation_p.S72T|LUC7L3_ENST00000240304.1_Missense_Mutation_p.S148T|LUC7L3_ENST00000393227.2_Missense_Mutation_p.S148T			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	148					mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						AGAATTAGGGTCTGAAGGAAA	0.388																																					p.S148T													.	.			0			c.T442A												74.0	75.0	75.0					17																	48821082		2203	4300	6503	SO:0001583	missense	51747	exon6			TTAGGGTCTGAAG		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.442T>A	17.37:g.48821082T>A	ENSP00000425092:p.Ser148Thr		139	0	0		209	0.11	24	NM_006107	277	0.27	76	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	ENST00000505658.1	37	CCDS11573.1	.	.	.	.	.	.	.	.	.	.	T	11.87	1.768843	0.31320	.	.	ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000542316;ENST00000544170	T;T;T;T	0.43688	1.24;1.24;1.24;0.94	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.34279	0.0892	L	0.27053	0.805	0.80722	D	1	B;B;B	0.25904	0.137;0.0;0.0	B;B;B	0.37304	0.246;0.001;0.002	T	0.16394	-1.0404	10	0.17369	T	0.5	-7.0678	11.6095	0.51052	0.1332:0.0:0.0:0.8668	.	72;148;148	B4DJ96;O95232;A8K3C5	.;LC7L3_HUMAN;.	T	148;148;148;148;72	ENSP00000425092:S148T;ENSP00000376919:S148T;ENSP00000240304:S148T;ENSP00000444253:S72T	ENSP00000240304:S148T	S	+	1	0	LUC7L3	46176081	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	6.162000	0.71874	2.201000	0.70794	0.460000	0.39030	TCT			0.388	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368205.2		NM_016424	
DSC1	1823	broad.mit.edu	37	18	28710564	28710564	+	Silent	SNP	G	G	A	rs140362700		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr18:28710564G>A	ENST00000257198.5	-	16	2859	c.2598C>T	c.(2596-2598)agC>agT	p.S866S	DSC1_ENST00000257197.3_3'UTR|RP11-408H20.2_ENST00000581836.1_RNA|RP11-408H20.3_ENST00000582307.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	866					homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			CCTGCCGATCGCTGCAGCAAC	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16925	0.0		0.0	False		,,,				2504	0.0				p.S866S													.	DSC1	240		0			c.C2598T							G	,	8,4398	14.3+/-33.2	0,8,2195	157.0	155.0	156.0		,2598	-4.1	0.7	18	dbSNP_134	156	0,8600		0,0,4300	no	utr-3,coding-synonymous	DSC1	NM_004948.3,NM_024421.2	,	0,8,6495	AA,AG,GG		0.0,0.1816,0.0615	,	,866/895	28710564	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	1823	exon16			CCGATCGCTGCAG	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.2598C>T	18.37:g.28710564G>A			149	0	0		209	0.02	5	NM_024421	0		0	Q9HB01	Silent	SNP	ENST00000257198.5	37	CCDS11894.1																																																																																					0.438	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254946.1		NM_004948, NM_024421	
SAFB	6294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	5667118	5667118	+	Missense_Mutation	SNP	G	G	T	rs201604799		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:5667118G>T	ENST00000292123.5	+	18	2503	c.2396G>T	c.(2395-2397)gGg>gTg	p.G799V	SAFB_ENST00000538656.1_Missense_Mutation_p.G641V|SAFB_ENST00000454510.1_Missense_Mutation_p.G730V|SAFB_ENST00000433404.1_Missense_Mutation_p.G629V|SAFB_ENST00000592224.1_Missense_Mutation_p.G798V|SAFB_ENST00000588852.1_Missense_Mutation_p.G799V	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	799	Arg-rich.|Gly-rich.|Interaction with SAFB2.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GATGGCTGGGGGGGCTATGGC	0.652																																					p.G799V	Colon(88;338 1345 6184 8214 20897)												.	.			0			c.G2396T												32.0	37.0	35.0					19																	5667118		2200	4288	6488	SO:0001583	missense	6294	exon18			GCTGGGGGGGCTA	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.2396G>T	19.37:g.5667118G>T	ENSP00000292123:p.Gly799Val		124	0	0		178	0.15	27	NM_002967	459	0.28	130	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	37	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114538	0.56505	.	.	ENSG00000160633	ENST00000454510;ENST00000540206;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.11169	2.81;2.97;2.82;2.8	3.89	3.89	0.44902	.	0.114998	0.39687	N	0.001295	T	0.23806	0.0576	M	0.67397	2.05	0.54753	D	0.999986	D;D;D;D;D;D;D	0.57257	0.964;0.964;0.979;0.964;0.964;0.964;0.964	P;P;P;P;P;P;P	0.54270	0.562;0.562;0.747;0.562;0.562;0.562;0.562	T	0.03240	-1.1057	10	0.72032	D	0.01	-21.7955	14.4178	0.67163	0.0:0.0:1.0:0.0	.	598;641;730;798;799;799;798	B7Z1C7;B7Z2F6;F5H0H3;B7ZLP5;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	V	730;694;629;799;641	ENSP00000415895:G730V;ENSP00000404545:G629V;ENSP00000292123:G799V;ENSP00000438880:G641V	ENSP00000292123:G799V	G	+	2	0	SAFB	5618118	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.797000	0.62503	1.883000	0.54544	0.555000	0.69702	GGG			0.652	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000451641.2			
MAST3	23031	broad.mit.edu	37	19	18260116	18260116	+	Silent	SNP	A	A	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:18260116A>C	ENST00000262811.6	+	27	3510	c.3510A>C	c.(3508-3510)ccA>ccC	p.P1170P	AC007192.6_ENST00000600364.2_RNA	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	1170							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						AGCTTGGGCCACCCCGCCCCA	0.766																																					p.P1170P													.	MAST3	83		0			c.A3510C																																									SO:0001819	synonymous_variant	23031	exon27			TGGGCCACCCCGC	AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.3510A>C	19.37:g.18260116A>C			47	0.1276595745	6		70	0.20	14	NM_015016	11	0.09	1	Q7LDZ8|Q9UPI0	Silent	SNP	ENST00000262811.6	37	CCDS46014.1																																																																																					0.766	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466526.2		XM_038150	
SIX5	147912	bcgsc.ca	37	19	46268979	46268979	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:46268979G>A	ENST00000317578.6	-	3	2381	c.2000C>T	c.(1999-2001)gCa>gTa	p.A667V	AC074212.5_ENST00000592217.2_RNA|SIX5_ENST00000560168.1_3'UTR|AC074212.5_ENST00000559756.1_RNA|AC074212.6_ENST00000590076.1_RNA	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5	667					lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		TTCCAGCCCTGCTGACCAGAC	0.687																																					p.A667V													.	SIX5	35		0			c.C2000T												31.0	37.0	35.0					19																	46268979		2199	4299	6498	SO:0001583	missense	147912	exon3			AGCCCTGCTGACC	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196		ENST00000317578.6:c.2000C>T	19.37:g.46268979G>A	ENSP00000316842:p.Ala667Val		32	0	0		68	0.00	0	NM_175875	56	0.00	0		Missense_Mutation	SNP	ENST00000317578.6	37	CCDS12673.1	.	.	.	.	.	.	.	.	.	.	g	12.12	1.843477	0.32606	.	.	ENSG00000177045	ENST00000317578	D	0.91295	-2.82	3.34	2.3	0.28687	.	0.597834	0.15653	N	0.251302	T	0.77246	0.4102	N	0.08118	0	0.09310	N	1	P	0.35107	0.484	B	0.37015	0.239	T	0.66689	-0.5860	10	0.13470	T	0.59	-0.4254	6.5347	0.22346	0.1339:0.0:0.8661:0.0	.	667	Q8N196	SIX5_HUMAN	V	667	ENSP00000316842:A667V	ENSP00000316842:A667V	A	-	2	0	SIX5	50960819	0.001000	0.12720	0.137000	0.22149	0.815000	0.46073	0.855000	0.27805	0.984000	0.38629	0.555000	0.69702	GCA			0.687	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417341.3		NM_175875	
ZNF765	91661	mdanderson.org	37	19	53905414	53905414	+	Missense_Mutation	SNP	C	C	A	rs375081702		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr19:53905414C>A	ENST00000396408.3	+	3	229	c.112C>A	c.(112-114)Ctg>Atg	p.L38M	ZNF765_ENST00000594030.1_Missense_Mutation_p.L38M	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		GGACGTGATGCTGGAGAATTA	0.478																																					p.L38M													.	.			0			c.C112A												107.0	110.0	109.0					19																	53905414		1510	2704	4214	SO:0001583	missense	91661	exon3			GTGATGCTGGAGA	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.112C>A	19.37:g.53905414C>A	ENSP00000379689:p.Leu38Met		47	0	0		60	0.05	3	NM_001040185	2	0.00	0	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Missense_Mutation	SNP	ENST00000396408.3	37	CCDS46171.1	.	.	.	.	.	.	.	.	.	.	C	7.619	0.676434	0.14841	.	.	ENSG00000196417	ENST00000396408	T	0.03152	4.03	1.64	-3.27	0.05048	Krueppel-associated box (4);	.	.	.	.	T	0.17152	0.0412	H	0.94620	3.56	0.19775	N	0.99995	D	0.89917	1.0	D	0.79108	0.992	T	0.11036	-1.0604	9	0.87932	D	0	.	0.6059	0.00752	0.2061:0.3751:0.2054:0.2134	.	38	Q7L2R6	ZN765_HUMAN	M	38	ENSP00000379689:L38M	ENSP00000379689:L38M	L	+	1	2	ZNF765	58597226	0.007000	0.16637	0.719000	0.30619	0.101000	0.19017	-3.723000	0.00383	-1.219000	0.02597	-1.188000	0.01700	CTG			0.478	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371603.1		NM_138372	
RPLP0P6	220717	broad.mit.edu	37	2	38709548	38709548	+	lincRNA	DEL	G	G	-			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:38709548delG	ENST00000417039.1	-	0	696																											CTTCTCCTTTGGGCTGGTCAT	0.512																																					.													.	.			0			.																																											0	.			TCCTTTGGGCTGG																													2.37:g.38709548delG			148	0	0		196	0.10	20	.	3247	0.00	0		RNA	DEL	ENST00000417039.1	37																																																																																						0.512	AC016995.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000331173.1			
EPAS1	2034	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	2	46583327	46583327	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:46583327G>T	ENST00000263734.3	+	3	765	c.255G>T	c.(253-255)caG>caT	p.Q85H		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	85	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			AAGCTGACCAGCAGATGGACA	0.512																																					p.Q85H													.	.			0			c.G255T												106.0	91.0	96.0					2																	46583327		2203	4300	6503	SO:0001583	missense	2034	exon3			TGACCAGCAGATG	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.255G>T	2.37:g.46583327G>T	ENSP00000263734:p.Gln85His		76	0	0		115	0.04	5	NM_001430	22	0.00	0	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	17.41	3.382951	0.61845	.	.	ENSG00000116016	ENST00000449347;ENST00000263734	T;T	0.22539	1.95;1.95	4.98	3.13	0.36017	Helix-loop-helix DNA-binding (1);	0.247838	0.41097	D	0.000955	T	0.30854	0.0778	L	0.52126	1.63	0.44345	D	0.997239	P	0.51653	0.947	P	0.57776	0.827	T	0.01484	-1.1343	10	0.46703	T	0.11	.	8.2971	0.31993	0.2496:0.0:0.7504:0.0	.	85	Q99814	EPAS1_HUMAN	H	85	ENSP00000406137:Q85H;ENSP00000263734:Q85H	ENSP00000263734:Q85H	Q	+	3	2	EPAS1	46436831	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	0.842000	0.27627	0.640000	0.30582	-0.258000	0.10820	CAG			0.512	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250752.2		NM_001430	
GPAT2	150763	hgsc.bcm.edu	37	2	96685052	96685052	+	IGR	SNP	T	T	G	rs372044509	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:96685052T>G	ENST00000434632.1	-	0	3061				FAHD2CP_ENST00000607780.1_RNA			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial						CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						TGCAGCAGAGTCCCCAGCTCC	0.572													G|||	9	0.00179712	0.0	0.0	5008	,	,		22500	0.003		0.002	False		,,,				2504	0.0041				.													.	.			0			.																																									SO:0001628	intergenic_variant	729234	.			GCAGAGTCCCCAG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208		2.37:g.96685052T>G			46	0	0		56	0.14	8	.	23	0.13	3	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	RNA	SNP	ENST00000434632.1	37	CCDS42714.1																																																																																					0.572	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338786.1		NM_207328	
LRP2	4036	broad.mit.edu	37	2	169993970	169993970	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:169993970G>T	ENST00000263816.3	-	76	13837	c.13552C>A	c.(13552-13554)Ccc>Acc	p.P4518T		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4518					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	AATATTATGGGCTGCTTCCCC	0.433																																					p.P4518T													.	LRP2	751		0			c.C13552A												164.0	156.0	159.0					2																	169993970		2203	4300	6503	SO:0001583	missense	4036	exon76			TTATGGGCTGCTT		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13552C>A	2.37:g.169993970G>T	ENSP00000263816:p.Pro4518Thr		81	0.012345679	1		135	0.04	6	NM_004525	0		0	O00711|Q16215	Missense_Mutation	SNP	ENST00000263816.3	37	CCDS2232.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700144	0.88924	.	.	ENSG00000081479	ENST00000263816	D	0.89617	-2.54	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.91119	0.7204	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90932	0.4791	10	0.41790	T	0.15	.	19.259	0.93959	0.0:0.0:1.0:0.0	.	4518	P98164	LRP2_HUMAN	T	4518	ENSP00000263816:P4518T	ENSP00000263816:P4518T	P	-	1	0	LRP2	169702216	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.726000	0.84824	2.549000	0.85964	0.551000	0.68910	CCC			0.433	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255231.2		NM_004525	
PTPRN	5798	broad.mit.edu	37	2	220162683	220162683	+	Missense_Mutation	SNP	G	G	T	rs375078153		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr2:220162683G>T	ENST00000295718.2	-	13	2051	c.1811C>A	c.(1810-1812)gCg>gAg	p.A604E	PTPRN_ENST00000423636.2_Missense_Mutation_p.A514E|PTPRN_ENST00000409251.3_Missense_Mutation_p.A575E|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000497977.1_5'Flank	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	604					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TTGCTGCCGCGCATGCTGCCG	0.652																																					p.A604E													.	PTPRN	138		0			c.C1811A												33.0	33.0	33.0					2																	220162683		2203	4299	6502	SO:0001583	missense	5798	exon13			TGCCGCGCATGCT		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1811C>A	2.37:g.220162683G>T	ENSP00000295718:p.Ala604Glu		129	0	0		162	0.02	4	NM_002846	1	0.00	0	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	ENST00000295718.2	37	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.531994	0.45073	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.03635	3.96;3.87;3.86	4.76	2.87	0.33458	.	0.359079	0.24018	N	0.042311	T	0.05318	0.0141	L	0.50333	1.59	0.24627	N	0.993648	B;B	0.31752	0.242;0.338	B;B	0.33568	0.065;0.166	T	0.21759	-1.0236	10	0.62326	D	0.03	.	11.5325	0.50618	0.0787:0.1355:0.7858:0.0	.	575;604	Q6NSL1;Q16849	.;PTPRN_HUMAN	E	575;604;575;514	ENSP00000386638:A575E;ENSP00000295718:A604E;ENSP00000444244:A514E	ENSP00000295718:A604E	A	-	2	0	PTPRN	219870927	0.832000	0.29368	0.014000	0.15608	0.872000	0.50106	4.433000	0.59929	1.225000	0.43566	0.655000	0.94253	GCG			0.652	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256819.2			
MAVS	57506	mdanderson.org	37	20	3846444	3846444	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:3846444G>A	ENST00000428216.2	+	7	1401	c.1273G>A	c.(1273-1275)Gca>Aca	p.A425T	MAVS_ENST00000416600.2_Missense_Mutation_p.A284T|MAVS_ENST00000358134.6_3'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	425					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						TGGCGTGCTGGCATCCCAGGT	0.642																																					p.A425T													.	.			0			c.G1273A												37.0	38.0	38.0					20																	3846444		2203	4300	6503	SO:0001583	missense	57506	exon7			GTGCTGGCATCCC	DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.1273G>A	20.37:g.3846444G>A	ENSP00000401980:p.Ala425Thr		59	0	0		95	0.04	4	NM_020746	8	0.00	0	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	ENST00000428216.2	37	CCDS33437.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780984	0.31502	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.30714	1.52;2.53	4.41	-3.0	0.05480	.	1.648960	0.03993	N	0.295206	T	0.17195	0.0413	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.19391	0.025	T	0.16424	-1.0403	10	0.27082	T	0.32	0.4099	2.9611	0.05893	0.0838:0.2634:0.2498:0.403	.	425	Q7Z434	MAVS_HUMAN	T	284;425	ENSP00000413749:A284T;ENSP00000401980:A425T	ENSP00000413749:A284T	A	+	1	0	MAVS	3794444	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-1.132000	0.03235	-0.458000	0.07023	0.655000	0.94253	GCA			0.642	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077784.3		NM_020746	
FRG1B	284802	bcgsc.ca	37	20	29623214	29623214	+	Missense_Mutation	SNP	C	C	T	rs367590609		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr20:29623214C>T	ENST00000278882.3	+	3	406	c.26C>T	c.(25-27)tCg>tTg	p.S9L	FRG1B_ENST00000439954.2_Silent_p.L10L|FRG1B_ENST00000358464.4_Missense_Mutation_p.S9L			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	9										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TACATGCACTCGACAATGGTC	0.393																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	284802	.			TGCACTCGACAAT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.26C>T	20.37:g.29623214C>T	ENSP00000278882:p.Ser9Leu		325	0.0276923077	9		511	0.04	21	.	124	0.02	2	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	6.225	0.409655	0.11812	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.93	-0.799	0.10901	.	0.226615	0.39020	N	0.001481	T	0.26268	0.0641	.	.	.	0.21064	N	0.999793	.	.	.	.	.	.	T	0.21827	-1.0234	6	0.72032	D	0.01	.	0.1722	0.00114	0.2331:0.1666:0.2366:0.3637	.	.	.	.	L	9	.	ENSP00000278882:S9L	S	+	2	0	FRG1B	28236875	0.975000	0.34042	0.996000	0.52242	0.067000	0.16453	-0.074000	0.11450	-0.180000	0.10637	-0.465000	0.05216	TCG			0.393	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
GADL1	339896	broad.mit.edu	37	3	30875385	30875385	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:30875385G>T	ENST00000282538.5	-	11	1160	c.1010C>A	c.(1009-1011)gCt>gAt	p.A337D	GADL1_ENST00000454381.3_Missense_Mutation_p.A337D	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	337					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						CTGGATCCCAGCCATCAGCAT	0.483																																					p.A337D													.	GADL1	91		0			c.C1010A												85.0	83.0	84.0					3																	30875385		2203	4300	6503	SO:0001583	missense	339896	exon11			ATCCCAGCCATCA	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1010C>A	3.37:g.30875385G>T	ENSP00000282538:p.Ala337Asp		158	0	0		215	0.02	4	NM_207359	0		0		Missense_Mutation	SNP	ENST00000282538.5	37	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	G	22.9	4.351263	0.82132	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	T;T	0.46451	0.87;0.87	5.87	5.87	0.94306	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.73273	0.3566	M	0.91354	3.2	0.44995	D	0.998018	D	0.65815	0.995	D	0.69479	0.964	T	0.78224	-0.2287	10	0.72032	D	0.01	.	20.2181	0.98305	0.0:0.0:1.0:0.0	.	337	Q6ZQY3	GADL1_HUMAN	D	337	ENSP00000282538:A337D;ENSP00000427059:A337D	ENSP00000282538:A337D	A	-	2	0	GADL1	30850389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.007000	0.63984	2.785000	0.95823	0.655000	0.94253	GCT			0.483	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253106.2		NM_207359	
SLC22A14	9389	mdanderson.org	37	3	38354566	38354566	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:38354566G>A	ENST00000273173.4	+	5	1112	c.1021G>A	c.(1021-1023)Gca>Aca	p.A341T	SLC22A14_ENST00000448498.1_Missense_Mutation_p.A341T	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	341					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GTGCTACGCCGCAAGTGTGAA	0.602																																					p.A341T													SLC22A14,rectum,carcinoma,0,1	SLC22A14	0	1	0			c.G1021A												67.0	63.0	64.0					3																	38354566		2203	4300	6503	SO:0001583	missense	9389	exon5			TACGCCGCAAGTG	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.1021G>A	3.37:g.38354566G>A	ENSP00000273173:p.Ala341Thr		89	0.0112359551	1		102	0.05	5	NM_004803	0		0	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	ENST00000273173.4	37	CCDS2677.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.391129	0.82902	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.59364	0.27;0.27	4.14	4.14	0.48551	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.113352	0.64402	D	0.000016	T	0.78691	0.4323	M	0.89353	3.025	0.49798	D	0.999821	D	0.89917	1.0	D	0.87578	0.998	D	0.83462	0.0054	10	0.87932	D	0	.	13.9454	0.64082	0.0:0.0:1.0:0.0	.	341	Q9Y267	S22AE_HUMAN	T	341	ENSP00000396283:A341T;ENSP00000273173:A341T	ENSP00000273173:A341T	A	+	1	0	SLC22A14	38329570	1.000000	0.71417	0.040000	0.18447	0.001000	0.01503	5.784000	0.68990	2.211000	0.71520	0.591000	0.81541	GCA			0.602	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253742.3		NM_004803	
ACVR2B	93	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	38518867	38518867	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:38518867C>T	ENST00000352511.4	+	2	614	c.142C>T	c.(142-144)Cgc>Tgc	p.R48C		NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB	48					activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		CGGCCTGGAGCGCTGCGAAGG	0.647																																					p.R48C													.	.			0			c.C142T												65.0	59.0	61.0					3																	38518867		2203	4300	6503	SO:0001583	missense	93	exon2			CTGGAGCGCTGCG	X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291	ENST00000352511.4:c.142C>T	3.37:g.38518867C>T	ENSP00000340361:p.Arg48Cys		80	0	0		87	0.13	11	NM_001106	3	0.33	1	Q4VAV0	Missense_Mutation	SNP	ENST00000352511.4	37	CCDS2679.1	.	.	.	.	.	.	.	.	.	.	C	19.35	3.809914	0.70797	.	.	ENSG00000114739	ENST00000352511	D	0.98512	-4.97	4.17	4.17	0.49024	TGF-beta receptor/activin receptor, type I/II (1);	0.053892	0.85682	D	0.000000	D	0.97835	0.9289	L	0.53249	1.67	0.80722	D	1	D	0.62365	0.991	P	0.58970	0.849	D	0.97038	0.9755	10	0.42905	T	0.14	.	12.1902	0.54266	0.1706:0.8294:0.0:0.0	.	48	Q13705	AVR2B_HUMAN	C	48	ENSP00000340361:R48C	ENSP00000340361:R48C	R	+	1	0	ACVR2B	38493871	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	5.685000	0.68204	2.318000	0.78349	0.655000	0.94253	CGC			0.647	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254059.3		NM_001106	
ARIH2	10425	broad.mit.edu;mdanderson.org	37	3	49020649	49020649	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:49020649G>T	ENST00000356401.4	+	16	1767	c.1428G>T	c.(1426-1428)atG>atT	p.M476I	RP13-131K19.7_ENST00000609473.1_lincRNA|ARIH2_ENST00000449376.1_Missense_Mutation_p.M476I|RP13-131K19.1_ENST00000429681.1_RNA|RP13-131K19.2_ENST00000452042.1_RNA|RP13-131K19.1_ENST00000415982.1_RNA	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	476					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		AGAACCAGATGCATATAGCGG	0.547																																					p.M476I													.	ARIH2	32		0			c.G1428T												155.0	162.0	160.0					3																	49020649		2203	4300	6503	SO:0001583	missense	10425	exon16			CCAGATGCATATA	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.1428G>T	3.37:g.49020649G>T	ENSP00000348769:p.Met476Ile		56	0	0		51	0.08	4	NM_006321	241	0.00	0	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	37	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.899883	0.91962	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	D;D	0.81908	-1.55;-1.55	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.85461	0.5702	L	0.39020	1.185	0.80722	D	1	P;P;D	0.55172	0.525;0.525;0.97	P;P;P	0.55615	0.48;0.48;0.78	D	0.83771	0.0220	10	0.41790	T	0.15	.	20.563	0.99327	0.0:0.0:1.0:0.0	.	401;476;476	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	I	476;476;393;300	ENSP00000348769:M476I;ENSP00000403222:M476I	ENSP00000348769:M476I	M	+	3	0	ARIH2	48995653	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.167000	0.94773	2.937000	0.99478	0.650000	0.86243	ATG			0.547	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257525.1		NM_006321	
MED12L	116931	broad.mit.edu;mdanderson.org	37	3	151093929	151093929	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:151093929G>A	ENST00000474524.1	+	26	3913	c.3875G>A	c.(3874-3876)tGt>tAt	p.C1292Y	MED12L_ENST00000273432.4_Missense_Mutation_p.C1152Y|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1292						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CAGCTTATCTGTTATCCTCAT	0.388																																					p.C1292Y													.	MED12L	271		0			c.G3875A												82.0	81.0	82.0					3																	151093929		2203	4300	6503	SO:0001583	missense	116931	exon26			TTATCTGTTATCC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.3875G>A	3.37:g.151093929G>A	ENSP00000417235:p.Cys1292Tyr		66	0.0151515152	1		112	0.09	10	NM_053002	4	0.00	0	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	37	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.766029	0.90020	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.65549	0.02;-0.16	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.80665	0.4666	M	0.75085	2.285	0.80722	D	1	D;D;D	0.89917	1.0;0.997;0.995	D;D;D	0.85130	0.997;0.994;0.986	T	0.81376	-0.0961	10	0.87932	D	0	-16.3698	19.874	0.96863	0.0:0.0:1.0:0.0	.	1152;1291;1292	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	Y	1292;1152	ENSP00000417235:C1292Y;ENSP00000273432:C1152Y	ENSP00000273432:C1152Y	C	+	2	0	MED12L	152576619	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.293000	0.96082	2.788000	0.95919	0.650000	0.86243	TGT			0.388	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357707.2		NM_053002	
MUC4	4585	broad.mit.edu	37	3	195517978	195517978	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr3:195517978C>G	ENST00000463781.3	-	2	932	c.473G>C	c.(472-474)gGa>gCa	p.G158A	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.G158A|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	163					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACTTTCAGTTCCTGCTGTTGA	0.463																																					p.G158A													MUC4_ENST00000463781,NS,carcinoma,0,2	MUC4	1505	2	0			c.G473C												200.0	175.0	183.0					3																	195517978		1996	4190	6186	SO:0001583	missense	4585	exon2			TCAGTTCCTGCTG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.473G>C	3.37:g.195517978C>G	ENSP00000417498:p.Gly158Ala		109	0.0091743119	1		136	0.02	3	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	2.616	-0.289597	0.05605	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.34859	1.34;1.35	3.56	-7.13	0.01532	.	3.653860	0.01043	N	0.004338	T	0.21062	0.0507	L	0.39898	1.24	0.09310	N	1	B;B	0.22346	0.058;0.068	B;B	0.15484	0.013;0.008	T	0.33394	-0.9870	10	0.08381	T	0.77	10.0015	2.5125	0.04660	0.2584:0.3436:0.299:0.0991	.	158;163	E7ESK3;Q99102	.;MUC4_HUMAN	A	158;158;132	ENSP00000417498:G158A;ENSP00000420243:G158A	ENSP00000376209:G132A	G	-	2	0	MUC4	197002373	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.687000	0.00833	-2.888000	0.00316	-0.365000	0.07479	GGA			0.463	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
STK32B	55351	mdanderson.org	37	4	5418660	5418660	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr4:5418660G>T	ENST00000282908.5	+	6	983	c.561G>T	c.(559-561)atG>atT	p.M187I	STK32B_ENST00000510398.1_Splice_Site_p.M140I|STK32B_ENST00000512636.1_Intron	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						AGCCCTACATGGGTGAGTGTT	0.517																																					p.M187I													.	.			0			c.G561T												66.0	56.0	59.0					4																	5418660		2203	4300	6503	SO:0001630	splice_region_variant	55351	exon6			CTACATGGGTGAG	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.562+1G>T	4.37:g.5418660G>T			28	0	0		35	0.09	3	NM_018401	0		0		Missense_Mutation	SNP	ENST00000282908.5	37	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	G	19.35	3.810143	0.70797	.	.	ENSG00000152953	ENST00000282908;ENST00000510398	T;T	0.27256	1.68;1.68	4.58	4.58	0.56647	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45867	U	0.000329	T	0.32041	0.0816	L	0.58969	1.84	0.80722	D	1	B	0.24920	0.114	B	0.34093	0.175	T	0.17899	-1.0354	10	0.54805	T	0.06	.	15.1935	0.73067	0.0:0.0:1.0:0.0	.	187	Q9NY57	ST32B_HUMAN	I	187;140	ENSP00000282908:M187I;ENSP00000420984:M140I	ENSP00000282908:M187I	M	+	3	0	STK32B	5469561	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.819000	0.75262	2.244000	0.73946	0.655000	0.94253	ATG			0.517	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206854.4		NM_018401	Missense_Mutation
SEPT11	55752	mdanderson.org	37	4	77926924	77926924	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr4:77926924G>T	ENST00000264893.6	+	3	514	c.313G>T	c.(313-315)Gga>Tga	p.G105*	SEPT11_ENST00000541121.1_Nonsense_Mutation_p.G115*|SEPT11_ENST00000505788.1_Nonsense_Mutation_p.G105*|SEPT11_ENST00000512575.1_Intron|SEPT11_ENST00000510515.1_Nonsense_Mutation_p.G115*|SEPT11_ENST00000502584.1_Nonsense_Mutation_p.G105*	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	105	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						CGTGGGATTTGGAGACCAGAT	0.438																																					p.G105X													.	.			0			c.G313T												127.0	124.0	125.0					4																	77926924		2203	4300	6503	SO:0001587	stop_gained	55752	exon3			GGATTTGGAGACC	AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.313G>T	4.37:g.77926924G>T	ENSP00000264893:p.Gly105*		89	0	0		91	0.05	5	NM_018243	24	0.00	0	B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Nonsense_Mutation	SNP	ENST00000264893.6	37	CCDS34018.1	.	.	.	.	.	.	.	.	.	.	G	38	6.902722	0.97924	.	.	ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000504637;ENST00000512778;ENST00000541121	.	.	.	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.1464	0.93471	0.0:0.0:1.0:0.0	.	.	.	.	X	105;105;97;105;115;115;115;115	.	ENSP00000264893:G105X	G	+	1	0	SEPT11	78145948	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.471000	0.97696	2.494000	0.84150	0.557000	0.71058	GGA			0.438	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000362676.1		NM_018243	
SEMA5A	9037	mdanderson.org	37	5	9054225	9054225	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:9054225G>T	ENST00000382496.5	-	19	3328	c.2663C>A	c.(2662-2664)gCa>gAa	p.A888E	MIR4636_ENST00000582271.1_RNA	NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	888	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						GTTGCAGAGTGCCTCTTCTGT	0.557																																					p.A888E													.	.			0			c.C2663A												76.0	72.0	73.0					5																	9054225		2203	4300	6503	SO:0001583	missense	9037	exon19			CAGAGTGCCTCTT	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2663C>A	5.37:g.9054225G>T	ENSP00000371936:p.Ala888Glu		26	0	0		40	0.08	3	NM_003966	0		0	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	G	18.32	3.598606	0.66332	.	.	ENSG00000112902	ENST00000382496	T	0.44083	0.93	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.33177	0.0854	N	0.02865	-0.47	0.80722	D	1	D	0.60575	0.988	P	0.61722	0.893	T	0.16247	-1.0409	10	0.02654	T	1	.	17.1979	0.86898	0.0:0.0:1.0:0.0	.	888	Q13591	SEM5A_HUMAN	E	888	ENSP00000371936:A888E	ENSP00000371936:A888E	A	-	2	0	SEMA5A	9107225	1.000000	0.71417	0.962000	0.40283	0.730000	0.41778	9.348000	0.97062	2.722000	0.93159	0.561000	0.74099	GCA			0.557	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206989.2			
KATNBL1P4	100128982	bcgsc.ca	37	5	51227580	51227580	+	IGR	SNP	C	C	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:51227580C>T								RNA5SP182 (44977 upstream) : CTD-2203A3.1 (76284 downstream)																							CAGTAGTTTACAGGGAGAAAA	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGTTTACAGGGAG																													5.37:g.51227580C>T			30	0	0		38	0.03	1	.	0		0		RNA	SNP		37																																																																																					0	0.393										
MAP1B	4131	broad.mit.edu	37	5	71495566	71495566	+	Silent	SNP	A	A	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:71495566A>G	ENST00000296755.7	+	5	6682	c.6384A>G	c.(6382-6384)ggA>ggG	p.G2128G		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2128					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AATCAGGGGGAGCCCCACCGC	0.552																																					p.G2128G	Melanoma(17;367 822 11631 31730 47712)												.	MAP1B	243		0			c.A6384G												68.0	73.0	71.0					5																	71495566		2203	4300	6503	SO:0001819	synonymous_variant	4131	exon5			AGGGGGAGCCCCA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.6384A>G	5.37:g.71495566A>G			146	0	0		148	0.02	3	NM_005909	8	0.00	0	A2BDK5	Silent	SNP	ENST00000296755.7	37	CCDS4012.1																																																																																					0.552	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000218561.6		NM_005909	
MCC	4163	mdanderson.org	37	5	112824069	112824069	+	Missense_Mutation	SNP	T	T	C	rs201571604	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:112824069T>C	ENST00000408903.3	-	1	458	c.43A>G	c.(43-45)Agc>Ggc	p.S15G		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		ccgccgccgctgctggagctc	0.746													T|||	12	0.00239617	0.0008	0.0043	5008	,	,		9112	0.001		0.004	False		,,,				2504	0.0031				p.S15G													.	.			0			c.A43G												4.0	5.0	5.0					5																	112824069		1013	2431	3444	SO:0001583	missense	4163	exon1			CGCCGCTGCTGGA		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.43A>G	5.37:g.112824069T>C	ENSP00000386227:p.Ser15Gly		11	0	0		8	0.38	3	NM_001085377	0		0	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000408903.3	37	CCDS43351.1	.	.	.	.	.	.	.	.	.	.	T	3.719	-0.057973	0.07317	.	.	ENSG00000171444	ENST00000408903	T	0.35421	1.31	3.18	-1.11	0.09840	.	.	.	.	.	T	0.25044	0.0608	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25984	-1.0116	8	0.59425	D	0.04	.	7.8573	0.29489	0.0:0.3799:0.0:0.6201	.	15	P23508-2	.	G	15	ENSP00000386227:S15G	ENSP00000386227:S15G	S	-	1	0	MCC	112851968	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.915000	0.04033	-0.158000	0.11040	0.260000	0.18958	AGC			0.746	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370839.1		NM_001085377	
PROB1	389333	mdanderson.org	37	5	138728419	138728419	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:138728419G>T	ENST00000434752.2	-	1	2466	c.2352C>A	c.(2350-2352)agC>agA	p.S784R	MZB1_ENST00000457570.2_5'Flank|MZB1_ENST00000412103.2_5'Flank|MZB1_ENST00000302125.8_5'Flank	NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	784	Pro-rich.																GCTGGGATGAGCTGCGGGCGC	0.726																																					p.S784R													.	.			0			c.C2352A												8.0	9.0	9.0					5																	138728419		690	1587	2277	SO:0001583	missense	389333	exon1			GGATGAGCTGCGG	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.2352C>A	5.37:g.138728419G>T	ENSP00000416033:p.Ser784Arg		46	0	0		28	0.11	3	NM_001161546	2	0.00	0	B4E007	Missense_Mutation	SNP	ENST00000434752.2	37	CCDS54909.1	.	.	.	.	.	.	.	.	.	.	G	0.404	-0.916702	0.02415	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.0	1.13	0.20643	.	.	.	.	.	T	0.15565	0.0375	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19679	-1.0298	8	0.54805	T	0.06	-0.9953	5.9217	0.19086	0.1879:0.166:0.6461:0.0	.	784	E7EW31	CE065_HUMAN	R	784	.	ENSP00000416033:S784R	S	-	3	2	AC135457.1	138756318	0.491000	0.26019	0.021000	0.16686	0.257000	0.26127	1.147000	0.31602	0.437000	0.26423	0.561000	0.74099	AGC			0.726	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000470735.1		NM_001161546	
ARAP3	64411	bcgsc.ca	37	5	141059566	141059566	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:141059566A>G	ENST00000239440.4	-	2	553	c.488T>C	c.(487-489)cTg>cCg	p.L163P	ARAP3_ENST00000508305.1_Missense_Mutation_p.L85P	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	163					cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						TCTTGAGTCCAGGCCGAAGTA	0.587																																					p.L163P													.	ARAP3	139		0			c.T488C												99.0	111.0	107.0					5																	141059566		2203	4300	6503	SO:0001583	missense	64411	exon2			GAGTCCAGGCCGA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.488T>C	5.37:g.141059566A>G	ENSP00000239440:p.Leu163Pro		76	0	0		81	0.00	0	NM_022481	2	0.00	0	B4DIT1|D3DQE3	Missense_Mutation	SNP	ENST00000239440.4	37	CCDS4266.1	.	.	.	.	.	.	.	.	.	.	A	15.24	2.775307	0.49786	.	.	ENSG00000120318	ENST00000522690;ENST00000508305;ENST00000239440;ENST00000504448	T;T;T	0.21031	2.3;2.96;2.03	4.3	4.3	0.51218	.	0.317851	0.20618	N	0.088823	T	0.28699	0.0711	N	0.24115	0.695	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.71656	0.974;0.946	T	0.03503	-1.1030	10	0.56958	D	0.05	.	9.7471	0.40453	1.0:0.0:0.0:0.0	.	85;163	G5E9Y3;Q8WWN8	.;ARAP3_HUMAN	P	85;85;163;163	ENSP00000421826:L85P;ENSP00000239440:L163P;ENSP00000421148:L163P	ENSP00000239440:L163P	L	-	2	0	ARAP3	141039750	0.984000	0.35163	0.997000	0.53966	0.528000	0.34623	1.824000	0.39072	1.809000	0.52856	0.379000	0.24179	CTG			0.587	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251805.1		NM_022481	
SLC34A1	6569	mdanderson.org	37	5	176824902	176824902	+	Missense_Mutation	SNP	G	G	A	rs141898673		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr5:176824902G>A	ENST00000324417.5	+	13	1626	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H	SLC34A1_ENST00000513614.1_3'UTR	NM_003052.4	NP_003043.3	Q06495	NPT2A_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 1	512					arsenate ion transmembrane transport (GO:1901684)|bone remodeling (GO:0046849)|cellular response to metal ion (GO:0071248)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to staurosporine (GO:0072734)|dentinogenesis (GO:0097187)|gentamycin metabolic process (GO:1901128)|glycoprotein metabolic process (GO:0009100)|indole metabolic process (GO:0042431)|ion transport (GO:0006811)|kidney development (GO:0001822)|ossification (GO:0001503)|phosphate ion homeostasis (GO:0055062)|phosphate ion transport (GO:0006817)|positive regulation of membrane potential (GO:0045838)|positive regulation of phosphate transmembrane transport (GO:2000187)|positive regulation of sodium-dependent phosphate transport (GO:2000120)|protein homooligomerization (GO:0051260)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to lead ion (GO:0010288)|response to magnesium ion (GO:0032026)|response to mercury ion (GO:0046689)|response to potassium ion (GO:0035864)|response to thyroid hormone (GO:0097066)|response to vitamin A (GO:0033189)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|tricarboxylic acid metabolic process (GO:0072350)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|membrane-bounded vesicle (GO:0031988)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|symporter activity (GO:0015293)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCAAGTACCGCTGGTTTGCC	0.607																																					p.R512H													SLC34A1,middle_lobe,carcinoma,+1,1	SLC34A1	1	1	0			c.G1535A							G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	142.0	117.0	126.0		1535	5.2	1.0	5	dbSNP_134	126	0,8600		0,0,4300	no	missense	SLC34A1	NM_003052.4	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	512/640	176824902	1,13005	2203	4300	6503	SO:0001583	missense	6569	exon13			AGTACCGCTGGTT	L13258	CCDS4418.1, CCDS54953.1	5q35.3	2013-07-17	2013-07-17		ENSG00000131183	ENSG00000131183		"""Solute carriers"""	11019	protein-coding gene	gene with protein product	"""sodium/phosphate co-transporter"", ""solute carrier family 17 (sodium phosphate), member 2"", ""Na+-phosphate cotransporter type II"""	182309	"""solute carrier family 34 (sodium phosphate), member 1"""	NPT2, SLC17A2		8327470, 8693007	Standard	NM_003052		Approved	NAPI-3, NPTIIa, SLC11	uc003mgk.4	Q06495	OTTHUMG00000130857	ENST00000324417.5:c.1535G>A	5.37:g.176824902G>A	ENSP00000321424:p.Arg512His		62	0	0		53	0.06	3	NM_003052	0		0	B4DPE3	Missense_Mutation	SNP	ENST00000324417.5	37	CCDS4418.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027331	0.75390	2.27E-4	0.0	ENSG00000131183	ENST00000324417	T	0.37411	1.2	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.66406	0.2786	M	0.84948	2.725	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.72721	-0.4208	10	0.87932	D	0	-25.3129	18.7764	0.91912	0.0:0.0:1.0:0.0	.	512	Q06495	NPT2A_HUMAN	H	512	ENSP00000321424:R512H	ENSP00000321424:R512H	R	+	2	0	SLC34A1	176757508	1.000000	0.71417	1.000000	0.80357	0.191000	0.23601	9.748000	0.98867	2.426000	0.82243	0.305000	0.20034	CGC	0		0.607	SLC34A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253431.1		NM_003052	
DEK	7913	hgsc.bcm.edu;mdanderson.org	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001				p.E41D				Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	.			0			c.G123C							-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	exon2			CTCCTCCTCGTCG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	6.37:g.18264096C>G	ENSP00000380414:p.Glu41Asp		113	0	0		145	0.06	8	NM_003472	58	0.02	1	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	DEK	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG	0.001		0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039962.4			
HIST1H2AI	8329	broad.mit.edu	37	6	27776148	27776148	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:27776148C>T	ENST00000358739.3	+	1	250	c.161C>T	c.(160-162)gCg>gTg	p.A54V	HIST1H2BL_ENST00000377401.2_5'Flank|HIST1H3H_ENST00000369163.2_5'Flank	NM_003509.2	NP_003500.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ai	54						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			lung(3)	3						TACCTGGCGGCGGTGCTGGAG	0.677																																					p.A54V													.	HIST1H2AI	9		0			c.C161T												12.0	15.0	14.0					6																	27776148		2094	4157	6251	SO:0001583	missense	8329	exon1			TGGCGGCGGTGCT	Z83742	CCDS4626.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000196747	ENSG00000196747		"""Histones / Replication-dependent"""	4725	protein-coding gene	gene with protein product		602787	"""H2A histone family, member C"", ""histone 1, H2ai"""	H2AFC		9439656, 12408966	Standard	NM_003509		Approved	H2A/c		P0C0S8	OTTHUMG00000014484	ENST00000358739.3:c.161C>T	6.37:g.27776148C>T	ENSP00000351589:p.Ala54Val		131	0	0		186	0.05	10	NM_003509	84	0.13	11	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000358739.3	37	CCDS4626.1	.	.	.	.	.	.	.	.	.	.	.	18.67	3.673528	0.67928	.	.	ENSG00000196747	ENST00000358739	T	0.71103	-0.54	4.53	3.64	0.41730	.	0.000000	0.39909	N	0.001233	T	0.74152	0.3679	.	.	.	0.39437	D	0.96718	.	.	.	.	.	.	T	0.79095	-0.1944	7	0.72032	D	0.01	.	14.2543	0.66040	0.0:0.8492:0.1508:0.0	.	.	.	.	V	54	ENSP00000351589:A54V	ENSP00000351589:A54V	A	+	2	0	HIST1H2AI	27884127	1.000000	0.71417	0.993000	0.49108	0.572000	0.35998	7.066000	0.76734	1.183000	0.42943	0.556000	0.70494	GCG			0.677	HIST1H2AI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040152.1		NM_003509	
GPX5	2880	bcgsc.ca	37	6	28500116	28500116	+	Silent	SNP	A	A	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:28500116A>G	ENST00000412168.2	+	4	467	c.378A>G	c.(376-378)ggA>ggG	p.G126G	GPX5_ENST00000469384.1_Missense_Mutation_p.E87G|GPX5_ENST00000442674.2_3'UTR	NM_001509.2	NP_001500.1	O75715	GPX5_HUMAN	glutathione peroxidase 5 (epididymal androgen-related protein)	126					lipid metabolic process (GO:0006629)|response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)	glutathione peroxidase activity (GO:0004602)			endometrium(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16					Glutathione(DB00143)	GTCCAGGGGGAGGATTTGTAC	0.423																																					p.E87G													GPX5,NS,carcinoma,0,1	GPX5	42	1	0			c.A260G												156.0	143.0	147.0					6																	28500116		2203	4300	6503	SO:0001819	synonymous_variant	2880	exon3			AGGGGGAGGATTT	AJ005277	CCDS4652.1, CCDS4653.1	6p22.1	2008-02-05			ENSG00000224586	ENSG00000224586	1.11.1.9		4557	protein-coding gene	gene with protein product		603435				9639555	Standard	NM_001509		Approved		uc003nll.2	O75715	OTTHUMG00000016307	ENST00000412168.2:c.378A>G	6.37:g.28500116A>G			85	0.0117647059	1		166	0.04	6	NM_003996	0		0	A1A4Y0	Missense_Mutation	SNP	ENST00000412168.2	37	CCDS4652.1	.	.	.	.	.	.	.	.	.	.	A	16.39	3.110080	0.56398	.	.	ENSG00000224586	ENST00000469384	T	0.12879	2.64	4.16	2.98	0.34508	.	.	.	.	.	T	0.17789	0.0427	.	.	.	0.34937	D	0.74995	D	0.71674	0.998	D	0.66847	0.947	T	0.02437	-1.1159	7	.	.	.	-14.3104	8.139	0.31071	0.7835:0.0:0.0:0.2165	.	87	A1A4Y0	.	G	87	ENSP00000419935:E87G	.	E	+	2	0	GPX5	28608095	0.504000	0.26123	0.581000	0.28614	0.999000	0.98932	-0.149000	0.10204	0.903000	0.36546	0.533000	0.62120	GAG			0.423	GPX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043672.2			
B3GALT4	8705	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	33245604	33245604	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:33245604G>T	ENST00000451237.1	+	1	688	c.408G>T	c.(406-408)ggG>ggT	p.G136G		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	136					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						CAGCCCAGGGGGATATCTTGC	0.627																																					p.G136G													.	.			0			c.G408T												55.0	62.0	59.0					6																	33245604		2203	4299	6502	SO:0001819	synonymous_variant	8705	exon1			CCAGGGGGATATC	Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.408G>T	6.37:g.33245604G>T			44	0	0		85	0.12	10	NM_003782	13	0.00	0		Silent	SNP	ENST00000451237.1	37	CCDS34425.1																																																																																					0.627	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076162.2			
ITPR3	3710	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	33652420	33652420	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:33652420C>G	ENST00000374316.5	+	39	6152	c.5092C>G	c.(5092-5094)Cgg>Ggg	p.R1698G	ITPR3_ENST00000605930.1_Missense_Mutation_p.R1698G			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1698					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	CCTCCAGAACCGGAAGTCCAC	0.637																																					p.R1698G													.	.			0			c.C5092G												77.0	81.0	80.0					6																	33652420		2203	4300	6503	SO:0001583	missense	3710	exon38			CAGAACCGGAAGT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.5092C>G	6.37:g.33652420C>G	ENSP00000363435:p.Arg1698Gly		121	0	0		158	0.15	24	NM_002224	42	0.26	11	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163419	0.38217	.	.	ENSG00000096433	ENST00000374316	D	0.92965	-3.14	5.05	5.05	0.67936	.	0.409731	0.25222	N	0.032237	T	0.80116	0.4564	L	0.33485	1.01	0.37828	D	0.928617	B	0.15473	0.013	B	0.14578	0.011	T	0.74728	-0.3567	10	0.23302	T	0.38	-34.9464	11.7843	0.52032	0.2224:0.7776:0.0:0.0	.	1698	Q14573	ITPR3_HUMAN	G	1698	ENSP00000363435:R1698G	ENSP00000363435:R1698G	R	+	1	2	ITPR3	33760398	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	3.709000	0.54853	2.505000	0.84491	0.655000	0.94253	CGG			0.637	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
RUNX2	860	hgsc.bcm.edu	37	6	45390482	45390482	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr6:45390482C>G	ENST00000371438.1	+	2	569	c.211C>G	c.(211-213)Cag>Gag	p.Q71E	RUNX2_ENST00000576263.1_Missense_Mutation_p.Q71E|RUNX2_ENST00000371432.3_Missense_Mutation_p.Q57E|RUNX2_ENST00000465038.2_Missense_Mutation_p.Q71E|RUNX2_ENST00000359524.5_Missense_Mutation_p.Q57E|RUNX2_ENST00000371436.6_Missense_Mutation_p.Q71E|RUNX2_ENST00000541979.1_Missense_Mutation_p.Q139E|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000352853.5_Missense_Mutation_p.Q139E	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	71	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						gcagcagcagcaggaggcggc	0.716																																					p.Q71E													RUNX2_ENST00000352853,NS,carcinoma,0,2	RUNX2_ENST00000352853	0	2	0			c.C211G												6.0	10.0	9.0					6																	45390482		1279	2789	4068	SO:0001583	missense	860	exon3			CAGCAGCAGGAGG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.211C>G	6.37:g.45390482C>G	ENSP00000360493:p.Gln71Glu		21	0.0476190476	1		23	0.09	2	NM_001024630	1	0.00	0	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	37	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	C	12.60	1.985548	0.35036	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08	3.45	3.45	0.39498	.	1.972660	0.03402	N	0.203449	T	0.19248	0.0462	N	0.14661	0.345	0.27094	N	0.962779	B;B;B	0.23806	0.033;0.055;0.091	B;B;B	0.20384	0.029;0.013;0.029	T	0.13818	-1.0495	10	0.02654	T	1	.	14.8379	0.70197	0.0:1.0:0.0:0.0	.	139;71;57	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	E	71;139;139;71;71;57;57	ENSP00000420707:Q71E;ENSP00000319087:Q139E;ENSP00000446290:Q139E;ENSP00000360493:Q71E;ENSP00000360491:Q71E;ENSP00000352514:Q57E;ENSP00000360486:Q57E	ENSP00000319087:Q139E	Q	+	1	0	RUNX2	45498460	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.268000	0.33062	1.622000	0.50330	0.407000	0.27541	CAG			0.716	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040755.2		NM_004348	
PMS2CL	441194	broad.mit.edu	37	7	6786128	6786128	+	RNA	DEL	A	A	-	rs77886001|rs200309339		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:6786128delA	ENST00000486256.1	+	0	1963					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene																		actctgtctcaaaaaaaaaaa	0.393																																					.													.	.			0			.																																											0	.			TGTCTCAAAAAAA	BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6786128delA			7	0	0		8	0.38	3	.	1	0.00	0	B4DK88|Q764P1	RNA	DEL	ENST00000486256.1	37																																																																																						0.393	PMS2CL-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000324193.1		NR_002217	
GLI3	2737	mdanderson.org	37	7	42005903	42005903	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:42005903G>T	ENST00000395925.3	-	15	2852	c.2768C>A	c.(2767-2769)cCc>cAc	p.P923H	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	923					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						CTGCTGGGCGGGCGTGAGGCT	0.711									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.P923H													GLI3,NS,carcinoma,+1,1	GLI3	1	1	0			c.C2768A												19.0	24.0	22.0					7																	42005903		2187	4291	6478	SO:0001583	missense	2737	exon15	Familial Cancer Database	;	TGGGCGGGCGTGA		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.2768C>A	7.37:g.42005903G>T	ENSP00000379258:p.Pro923His		27	0	0		51	0.06	3	NM_000168	0		0	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	37	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680644	0.88542	.	.	ENSG00000106571	ENST00000395925	D	0.95656	-3.77	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.97971	0.9332	M	0.86420	2.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99143	1.0856	10	0.87932	D	0	.	17.9834	0.89148	0.0:0.0:1.0:0.0	.	923	P10071	GLI3_HUMAN	H	923	ENSP00000379258:P923H	ENSP00000379258:P923H	P	-	2	0	GLI3	41972428	1.000000	0.71417	0.953000	0.39169	0.961000	0.63080	9.781000	0.99029	2.214000	0.71695	0.462000	0.41574	CCC			0.711	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250806.3		NM_000168	
INTS4L2	644619	broad.mit.edu	37	7	65139108	65139109	+	RNA	INS	-	-	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:65139108_65139109insA	ENST00000430126.2	+	0	305							Q2T9F4	IN4L2_HUMAN	integrator complex subunit 4-like 2																		atctcaggaagaaaaaaaaaaa	0.436																																					.													.	.			0			.																																											0	.			CAGGAAGAAAAAA	BC111554		7q11.21	2013-03-26			ENSG00000232270	ENSG00000273024			22351	other	unknown							Standard	NR_027392		Approved	MGC133166	uc003tue.2	Q2T9F4	OTTHUMG00000156558		7.37:g.65139119_65139119dupA			4	0	0		9	0.33	3	.	0		0		RNA	INS	ENST00000430126.2	37																																																																																						0.436	INTS4L2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345545.2		NR_027392	
RAB19	401409	broad.mit.edu	37	7	140125883	140125883	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr7:140125883T>C	ENST00000356407.3	+	3	655	c.587T>C	c.(586-588)cTc>cCc	p.L196P	RAB19_ENST00000537763.1_Missense_Mutation_p.L196P|RAB19_ENST00000275874.5_Missense_Mutation_p.L243P			A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family	196					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(3)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	9	Melanoma(164;0.0142)					CTGAACGGCCTCCCCCTGGAC	0.547																																					p.L196P													.	RAB19	21		0			c.T587C												73.0	68.0	70.0					7																	140125883		2203	4300	6503	SO:0001583	missense	401409	exon4			ACGGCCTCCCCCT		CCDS34762.1, CCDS34762.2	7q34	2014-05-09			ENSG00000146955	ENSG00000146955		"""RAB, member RAS oncogene"""	19982	protein-coding gene	gene with protein product							Standard	NM_001008749		Approved	RAB19B	uc010lni.2	A4D1S5	OTTHUMG00000157410	ENST00000356407.3:c.587T>C	7.37:g.140125883T>C	ENSP00000348778:p.Leu196Pro		99	0.0101010101	1		180	0.02	4	NM_001008749	5	0.00	0	A4D1S6|B2RTS6|B5MDR2|Q9UL27	Missense_Mutation	SNP	ENST00000356407.3	37	CCDS34762.2	.	.	.	.	.	.	.	.	.	.	T	12.59	1.982431	0.34942	.	.	ENSG00000146955	ENST00000275874;ENST00000537763;ENST00000356407	T;T;T	0.65732	-0.17;-0.06;-0.06	5.69	2.03	0.26663	.	0.667620	0.14900	N	0.291872	T	0.37293	0.0998	N	0.08118	0	0.21878	N	0.999492	B	0.02656	0.0	B	0.04013	0.001	T	0.18493	-1.0335	9	.	.	.	.	9.4656	0.38811	0.0:0.2012:0.0:0.7988	.	196	A4D1S5	RAB19_HUMAN	P	243;196;196	ENSP00000275874:L243P;ENSP00000440167:L196P;ENSP00000348778:L196P	.	L	+	2	0	RAB19	139772352	0.258000	0.24033	0.000000	0.03702	0.094000	0.18550	2.148000	0.42235	0.111000	0.17947	0.459000	0.35465	CTC			0.547	RAB19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348740.1			
UBR5	51366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	103277378	103277378	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr8:103277378C>A	ENST00000520539.1	-	53	8157	c.7551G>T	c.(7549-7551)agG>agT	p.R2517S	UBR5_ENST00000521922.1_Missense_Mutation_p.R2510S|UBR5_ENST00000518205.1_Missense_Mutation_p.R245S|UBR5_ENST00000220959.4_Missense_Mutation_p.R2516S	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2517	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TCTTGCCAGGCCTTGGAGTAT	0.358																																					p.R2517S	Ovarian(131;96 1741 5634 7352 27489)												.	.			0			c.G7551T												118.0	116.0	117.0					8																	103277378		2203	4300	6503	SO:0001583	missense	51366	exon53			GCCAGGCCTTGGA	AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.7551G>T	8.37:g.103277378C>A	ENSP00000429084:p.Arg2517Ser		115	0	0		176	0.09	16	NM_015902	96	0.28	27	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	ENST00000520539.1	37	CCDS34933.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752675	0.69533	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.26	-1.61	0.08399	HECT (4);	0.058419	0.64402	N	0.000003	T	0.56645	0.1999	L	0.55743	1.74	0.42024	D	0.990997	D;D	0.53462	0.96;0.96	P;P	0.61477	0.889;0.889	T	0.56092	-0.8036	10	0.87932	D	0	.	6.569	0.22529	0.0:0.419:0.2143:0.3667	.	2510;2517	E7EMW7;O95071	.;UBR5_HUMAN	S	2517;2516;245;2510	ENSP00000429084:R2517S;ENSP00000220959:R2516S;ENSP00000428693:R245S;ENSP00000427819:R2510S	ENSP00000220959:R2516S	R	-	3	2	UBR5	103346554	0.724000	0.28038	0.992000	0.48379	0.994000	0.84299	-0.118000	0.10692	-0.275000	0.09219	-0.140000	0.14226	AGG			0.358	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000380075.2		NM_015902	
RP11-383M4.6	0	broad.mit.edu	37	9	84545116	84545116	+	lincRNA	DEL	C	C	-	rs375617018		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:84545116delC	ENST00000585776.1	-	0	4416				SPATA31D4_ENST00000341875.4_RNA|RP11-383M4.2_ENST00000427387.1_lincRNA																							CCACCGCCttctttttttttt	0.393																																					.													.	.			0			.												2.0	3.0	3.0					9																	84545116		165	692	857			0	.			CGCCTTCTTTTTT																													9.37:g.84545116delC			68	0	0		104	0.06	6	.	0		0		RNA	DEL	ENST00000585776.1	37																																																																																						0.393	RP11-383M4.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000453562.1			
ZNF782	158431	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	99581871	99581871	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:99581871C>A	ENST00000481138.1	-	6	1095	c.434G>T	c.(433-435)tGc>tTc	p.C145F	ZNF782_ENST00000535338.1_Missense_Mutation_p.C13F|ZNF782_ENST00000466833.1_5'UTR	NM_001001662.1	NP_001001662.1	Q6ZMW2	ZN782_HUMAN	zinc finger protein 782	145					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(8)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)	33		Acute lymphoblastic leukemia(62;0.0527)				GAGCCCCTGGCAAGCAGACCC	0.438																																					p.C145F													.	.			0			c.G434T												98.0	101.0	100.0					9																	99581871		2203	4300	6503	SO:0001583	missense	158431	exon6			CCCTGGCAAGCAG	AK131468	CCDS35075.1	9q22.33	2013-01-08			ENSG00000196597	ENSG00000196597		"""Zinc fingers, C2H2-type"", ""-"""	33110	protein-coding gene	gene with protein product							Standard	NM_001001662		Approved	FLJ16636	uc004awp.1	Q6ZMW2	OTTHUMG00000020310	ENST00000481138.1:c.434G>T	9.37:g.99581871C>A	ENSP00000419397:p.Cys145Phe		64	0	0		108	0.07	8	NM_001001662	3	0.33	1	B2RNR0	Missense_Mutation	SNP	ENST00000481138.1	37	CCDS35075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.326|1.326	-0.598082|-0.598082	0.03744|0.03744	.|.	.|.	ENSG00000196597|ENSG00000196597	ENST00000481138;ENST00000535338;ENST00000478850|ENST00000289032	T;T;T|.	0.04654|.	3.66;3.58;6.19|.	3.53|3.53	-1.82|-1.82	0.07857|0.07857	.|.	0.950157|.	0.08533|.	N|.	0.931676|.	T|T	0.06781|0.06781	0.0173|0.0173	N|N	0.00677|0.00677	-1.265|-1.265	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.34976|0.34976	-0.9807|-0.9807	9|5	.|.	.|.	.|.	.|.	2.8884|2.8884	0.05668|0.05668	0.3397:0.3154:0.0:0.3449|0.3397:0.3154:0.0:0.3449	.|.	145|.	Q6ZMW2|.	ZN782_HUMAN|.	F|F	145;13;145|133	ENSP00000419397:C145F;ENSP00000440624:C13F;ENSP00000417577:C145F|.	.|.	C|L	-|-	2|3	0|2	ZNF782|ZNF782	98621692|98621692	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.033000|0.033000	0.12548|0.12548	-1.123000|-1.123000	0.03263|0.03263	-0.325000|-0.325000	0.08577|0.08577	-0.250000|-0.250000	0.11733|0.11733	TGC|TTG			0.438	ZNF782-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356810.1		NM_001001662	
TTF1	7270	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	135275424	135275424	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:135275424T>C	ENST00000334270.2	-	3	1628	c.1589A>G	c.(1588-1590)cAa>cGa	p.Q530R		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	530					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		AAGCTCACCTTGTGCTTTAAA	0.448																																					p.Q530R													.	.			0			c.A1589G												135.0	126.0	129.0					9																	135275424		2203	4300	6503	SO:0001583	missense	7270	exon3			TCACCTTGTGCTT	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1589A>G	9.37:g.135275424T>C	ENSP00000333920:p.Gln530Arg		149	0	0		243	0.09	21	NM_007344	21	0.33	7	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	ENST00000334270.2	37	CCDS6948.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.032803	0.75504	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.14893	2.47	5.14	3.96	0.45880	.	0.000000	0.64402	D	0.000006	T	0.29882	0.0747	M	0.63843	1.955	0.35413	D	0.792571	D	0.63880	0.993	P	0.58391	0.838	T	0.38222	-0.9671	10	0.59425	D	0.04	.	8.3523	0.32310	0.1737:0.0:0.0:0.8263	.	530	Q15361	TTF1_HUMAN	R	530	ENSP00000333920:Q530R	ENSP00000245588:Q530R	Q	-	2	0	TTF1	134265245	1.000000	0.71417	0.960000	0.40013	0.916000	0.54674	2.329000	0.43876	1.951000	0.56629	0.460000	0.39030	CAA			0.448	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054784.2		NM_007344	
NDOR1	27158	mdanderson.org	37	9	140110832	140110832	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chr9:140110832G>T	ENST00000344894.5	+	14	1841	c.1758G>T	c.(1756-1758)caG>caT	p.Q586H	NDOR1_ENST00000458322.2_Missense_Mutation_p.Q579H|NDOR1_ENST00000427047.2_3'UTR|NDOR1_ENST00000371521.4_Missense_Mutation_p.Q595H	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CCAGGCTCCAGCAGACACGGC	0.672																																					p.Q595H													.	.			0			c.G1785T												36.0	40.0	39.0					9																	140110832		2203	4299	6502	SO:0001583	missense	27158	exon14			GCTCCAGCAGACA	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1758G>T	9.37:g.140110832G>T	ENSP00000343344:p.Gln586His		27	0	0		33	0.09	3	NM_001144026	48	0.00	0		Missense_Mutation	SNP	ENST00000344894.5	37	CCDS7036.1	.	.	.	.	.	.	.	.	.	.	G	11.59	1.685019	0.29872	.	.	ENSG00000188566	ENST00000458322;ENST00000371521;ENST00000344894	T;T;T	0.78595	-1.19;-1.19;-1.19	4.06	4.06	0.47325	.	0.116272	0.56097	D	0.000026	D	0.83663	0.5303	M	0.79926	2.475	0.80722	D	1	P;P;B	0.51147	0.904;0.942;0.071	P;P;B	0.52217	0.497;0.693;0.04	D	0.86567	0.1845	10	0.66056	D	0.02	-11.267	13.7542	0.62926	0.0:0.0:1.0:0.0	.	579;595;586	D3YTG6;Q9UHB4-2;Q9UHB4	.;.;NDOR1_HUMAN	H	579;595;586	ENSP00000389905:Q579H;ENSP00000360576:Q595H;ENSP00000343344:Q586H	ENSP00000343344:Q586H	Q	+	3	2	NDOR1	139230653	1.000000	0.71417	0.967000	0.41034	0.112000	0.19704	1.789000	0.38724	2.109000	0.64355	0.561000	0.74099	CAG			0.672	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254704.1		NM_014434	
MAP7D2	256714	mdanderson.org	37	X	20074871	20074871	+	Silent	SNP	G	G	T			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:20074871G>T	ENST00000379651.3	-	4	429	c.411C>A	c.(409-411)cgC>cgA	p.R137R	MAP7D2_ENST00000543767.1_Silent_p.R8R|MAP7D2_ENST00000379643.5_Silent_p.R137R|MAP7D2_ENST00000452324.3_Silent_p.R93R|MAP7D2_ENST00000443379.3_Silent_p.R137R	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	137					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						GCTGCTGTGTGCGCTCCAGGG	0.552																																					p.R137R													.	.			0			c.C411A												104.0	72.0	83.0					X																	20074871		2203	4300	6503	SO:0001819	synonymous_variant	256714	exon4			CTGTGTGCGCTCC	BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.411C>A	X.37:g.20074871G>T			30	0	0		46	0.07	3	NM_001168466	34	0.00	0	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Silent	SNP	ENST00000379651.3	37	CCDS14195.1																																																																																					0.552	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056001.1		NM_152780	
NAP1L3	4675	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	92927246	92927246	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:92927246G>C	ENST00000373079.3	-	1	1321	c.1058C>G	c.(1057-1059)cCt>cGt	p.P353R	NAP1L3_ENST00000475430.2_Missense_Mutation_p.P346R|FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000538690.1_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	353					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						GTAACTTACAGGCTGGCCAGG	0.408																																					p.P353R													.	NAP1L3	81		0			c.C1058G												47.0	44.0	45.0					X																	92927246		2203	4300	6503	SO:0001583	missense	4675	exon1			CTTACAGGCTGGC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.1058C>G	X.37:g.92927246G>C	ENSP00000362171:p.Pro353Arg		98	0.0102040816	1		149	0.23	34	NM_004538	21	0.43	9	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245928	0.39697	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.26067	1.76	3.68	2.81	0.32909	.	0.054104	0.85682	D	0.000000	T	0.39200	0.1069	L	0.48218	1.51	0.35695	D	0.815181	D	0.89917	1.0	D	0.87578	0.998	T	0.48281	-0.9049	10	0.72032	D	0.01	.	8.34	0.32239	0.1234:0.0:0.8766:0.0	.	353	Q99457	NP1L3_HUMAN	R	353;346	ENSP00000362171:P353R	ENSP00000362171:P353R	P	-	2	0	NAP1L3	92813902	1.000000	0.71417	0.434000	0.26772	0.734000	0.41952	3.096000	0.50243	0.931000	0.37242	0.529000	0.55759	CCT			0.408	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057449.1		NM_004538	
ABCD1	215	bcgsc.ca	37	X	152991228	152991228	+	Missense_Mutation	SNP	C	C	A	rs398123112		TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:152991228C>A	ENST00000218104.3	+	1	906	c.507C>A	c.(505-507)caC>caA	p.H169Q	BCAP31_ENST00000458587.2_5'Flank|ABCD1_ENST00000370129.4_5'Flank|BCAP31_ENST00000441714.1_5'Flank|BCAP31_ENST00000345046.6_5'Flank	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	169	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.|Interaction with PEX19.				alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGGCCCACGCCTACCGCC	0.637																																					p.H169Q													.	ABCD1	59		0			c.C507A												54.0	47.0	49.0					X																	152991228		2203	4299	6502	SO:0001583	missense	215	exon1			GGCCCACGCCTAC	Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.507C>A	X.37:g.152991228C>A	ENSP00000218104:p.His169Gln		58	0	0		72	0.04	3	NM_000033	10	0.00	0	Q6GTZ2	Missense_Mutation	SNP	ENST00000218104.3	37	CCDS14728.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042981	0.55003	.	.	ENSG00000101986	ENST00000218104	D	0.99701	-6.45	5.37	-9.33	0.00639	ABC transporter, N-terminal (1);ABC transporter, integral membrane type 1 (1);	0.000000	0.85682	D	0.000000	D	0.99661	0.9874	M	0.92555	3.32	0.58432	D	0.999997	D	0.69078	0.997	D	0.74348	0.983	D	0.99865	1.1088	10	0.66056	D	0.02	-28.4494	21.1647	0.99947	0.0:0.1486:0.0:0.8514	.	169	P33897	ABCD1_HUMAN	Q	169	ENSP00000218104:H169Q	ENSP00000218104:H169Q	H	+	3	2	ABCD1	152644422	0.000000	0.05858	0.307000	0.25127	0.973000	0.67179	-1.768000	0.01794	-2.757000	0.00371	-0.395000	0.06472	CAC			0.637	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061041.1		NM_000033	
PLXNB3	5365	mdanderson.org	37	X	153039024	153039024	+	Silent	SNP	G	G	A			TCGA-2G-AAFG-05A-11D-A42Y-10	TCGA-2G-AAFG-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	207b80ef-28bf-4aa9-9a50-448ae72536f2	b3717c8e-343c-48c0-8d20-5035da43230c	g.chrX:153039024G>A	ENST00000361971.5	+	19	3249	c.3135G>A	c.(3133-3135)cgG>cgA	p.R1045R	PLXNB3_ENST00000538282.1_Silent_p.R655R|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538966.1_Silent_p.R1068R|PLXNB3_ENST00000538776.1_Silent_p.R698R	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1045	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGCAGCGGCCCCTACTGT	0.687																																					p.R1068R													.	.			0			c.G3204A												21.0	22.0	21.0					X																	153039024		2181	4259	6440	SO:0001819	synonymous_variant	5365	exon20			GCAGCGGCCCCTA	AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3135G>A	X.37:g.153039024G>A			44	0	0		54	0.06	3	NM_001163257	0		0	B7Z3E6|F5H773|Q9HDA4	Silent	SNP	ENST00000361971.5	37	CCDS14729.1																																																																																					0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000061063.1			
