#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
KIF17	57576	broad.mit.edu	37	1	21011461	21011461	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr1:21011461G>T	ENST00000247986.2	-	10	2382	c.2072C>A	c.(2071-2073)cCt>cAt	p.P691H	KIF17_ENST00000400463.3_Missense_Mutation_p.P691H|KIF17_ENST00000375044.1_Missense_Mutation_p.P591H|KIF17_ENST00000490034.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	691					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CCACACGCCAGGCTCTGCTGT	0.662																																					p.P691H													.	KIF17	130		0			c.C2072A												38.0	34.0	35.0					1																	21011461		2203	4299	6502	SO:0001583	missense	57576	exon10			ACGCCAGGCTCTG	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2072C>A	1.37:g.21011461G>T	ENSP00000247986:p.Pro691His		222	0	0		201	0.02	5	NM_020816	6	0.00	0	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	37	CCDS213.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.417730	0.42918	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.71103	-0.54;-0.43;-0.43	3.86	1.92	0.25849	.	0.896381	0.09043	U	0.857061	T	0.71169	0.3308	L	0.46157	1.445	0.09310	N	1	D;D;P	0.63046	0.986;0.992;0.838	P;P;B	0.55999	0.62;0.789;0.358	T	0.57148	-0.7861	10	0.49607	T	0.09	.	4.3236	0.11029	0.1172:0.0:0.6574:0.2255	.	691;691;691	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	H	591;691;691;72	ENSP00000364184:P591H;ENSP00000383311:P691H;ENSP00000247986:P691H	ENSP00000247986:P691H	P	-	2	0	KIF17	20884048	0.253000	0.23982	0.066000	0.19879	0.033000	0.12548	0.966000	0.29331	0.557000	0.29117	0.655000	0.94253	CCT			0.662	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000276995.1		NM_020816	
PEF1	553115	hgsc.bcm.edu	37	1	32096374	32096374	+	Missense_Mutation	SNP	C	C	T	rs371830019		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr1:32096374C>T	ENST00000373703.4	-	5	717	c.695G>A	c.(694-696)cGc>cAc	p.R232H	HCRTR1_ENST00000373705.1_Intron|PEF1_ENST00000492061.1_5'Flank	NM_012392.3	NP_036524.1	Q9UBV8	PEF1_HUMAN	penta-EF-hand domain containing 1	232	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Required for interaction with PDCD6.				proteolysis (GO:0006508)|response to calcium ion (GO:0051592)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|poly(A) RNA binding (GO:0044822)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)	7		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)|all_neural(195;0.186)		STAD - Stomach adenocarcinoma(196;0.0546)		ATTGGCAGAGCGTGGGCAGTA	0.597																																					p.R232H													PEF1,NS,carcinoma,+1,1	PEF1	1	1	0			c.G695A							C	HIS/ARG	0,4406		0,0,2203	58.0	54.0	55.0		695	4.0	1.0	1		55	1,8599	1.2+/-3.3	0,1,4299	no	missense	PEF1	NM_012392.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	232/285	32096374	1,13005	2203	4300	6503	SO:0001583	missense	553115	exon5			GCAGAGCGTGGGC		CCDS345.1	1p34	2013-01-10			ENSG00000162517	ENSG00000162517		"""EF-hand domain containing"""	30009	protein-coding gene	gene with protein product	"""peflin"""	610033				10486255, 11883899	Standard	NM_012392		Approved	PEF1A	uc001bth.2	Q9UBV8	OTTHUMG00000003877	ENST00000373703.4:c.695G>A	1.37:g.32096374C>T	ENSP00000362807:p.Arg232His		69	0.0144927536	1		42	0.05	2	NM_012392	195	0.00	0		Missense_Mutation	SNP	ENST00000373703.4	37	CCDS345.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.278857	0.80692	0.0	1.16E-4	ENSG00000162517	ENST00000373703	D	0.84660	-1.88	4.92	4.0	0.46444	EF-hand-like domain (1);	0.098325	0.64402	N	0.000002	D	0.89746	0.6804	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	D	0.89845	0.4005	10	0.72032	D	0.01	.	9.8427	0.41008	0.0:0.8279:0.0:0.1721	.	232	Q9UBV8	PEF1_HUMAN	H	232	ENSP00000362807:R232H	ENSP00000362807:R232H	R	-	2	0	PEF1	31868961	0.855000	0.29742	1.000000	0.80357	0.994000	0.84299	2.787000	0.47798	1.390000	0.46547	0.650000	0.86243	CGC			0.597	PEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011046.1		NM_012392	
ZNF362	149076	mdanderson.org	37	1	33742069	33742069	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr1:33742069C>A	ENST00000539719.1	+	4	393	c.223C>A	c.(223-225)Ccc>Acc	p.P75T	ZNF362_ENST00000373428.5_Missense_Mutation_p.P75T	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	75					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCCGCCGGCACCCGCCGAGAG	0.697																																					p.P75T	Pancreas(162;1431 2676 35353 38425)												.	.			0			c.C223A												7.0	7.0	7.0					1																	33742069		1964	3889	5853	SO:0001583	missense	149076	exon4			CCGGCACCCGCCG		CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.223C>A	1.37:g.33742069C>A	ENSP00000446335:p.Pro75Thr		28	0	0		24	0.13	3	NM_152493	11	0.00	0	Q8WYU4	Missense_Mutation	SNP	ENST00000539719.1	37	CCDS377.1	.	.	.	.	.	.	.	.	.	.	C	8.709	0.911565	0.17833	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.08008	3.14;3.14	4.24	4.24	0.50183	.	0.653044	0.12596	N	0.455200	T	0.07458	0.0188	L	0.29908	0.895	0.38291	D	0.942691	B	0.06786	0.001	B	0.04013	0.001	T	0.23691	-1.0181	10	0.14252	T	0.57	-8.5671	14.1749	0.65534	0.0:1.0:0.0:0.0	.	75	Q5T0B9	ZN362_HUMAN	T	62;75;75	ENSP00000446335:P75T;ENSP00000362527:P75T	ENSP00000362527:P75T	P	+	1	0	ZNF362	33514656	0.714000	0.27936	0.999000	0.59377	0.891000	0.51852	0.776000	0.26704	2.185000	0.69588	0.650000	0.86243	CCC			0.697	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011857.2		NM_152493	
RSBN1	54665	broad.mit.edu	37	1	114354926	114354926	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr1:114354926delC	ENST00000261441.5	-	1	172	c.109delG	c.(109-111)gcgfs	p.A37fs	RP5-1073O3.2_ENST00000418238.1_RNA|RP5-1073O3.2_ENST00000429398.1_RNA	NM_018364.3	NP_060834.2	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	37						nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(3)|urinary_tract(2)	29	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCCCGACCGCCCCCCCGTCC	0.682																																					p.A37fs													.	RSBN1	71		0			c.109delG												28.0	39.0	35.0					1																	114354926		2202	4297	6499	SO:0001589	frameshift_variant	54665	exon1			CGACCGCCCCCCC	AK002082	CCDS862.1	1p13.1	2008-02-05			ENSG00000081019	ENSG00000081019			25642	protein-coding gene	gene with protein product		615858				12477932	Standard	NM_018364		Approved	FLJ11220, ROSBIN	uc001edq.3	Q5VWQ0	OTTHUMG00000011938	ENST00000261441.5:c.109delG	1.37:g.114354926delC	ENSP00000261441:p.Ala37fs		19	0	0		11	0.27	3	NM_018364	1	0.00	0	A8K937|Q6AI21|Q8TC33|Q9HA80|Q9NUP6	Frame_Shift_Del	DEL	ENST00000261441.5	37	CCDS862.1																																																																																					0.682	RSBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033022.2		NM_018364	
FCRL2	79368	mdanderson.org	37	1	157745582	157745582	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr1:157745582G>A	ENST00000361516.3	-	2	83	c.35C>T	c.(34-36)gCa>gTa	p.A12V	FCRL2_ENST00000392274.3_Missense_Mutation_p.A12V|FCRL2_ENST00000368181.4_Missense_Mutation_p.A12V	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	12					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TTCAGTGACTGCATCTGTGAG	0.428																																					p.A12V													.	.			0			c.C35T												115.0	96.0	102.0					1																	157745582		2203	4300	6503	SO:0001583	missense	79368	exon2			GTGACTGCATCTG	AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.35C>T	1.37:g.157745582G>A	ENSP00000355157:p.Ala12Val		35	0	0		43	0.07	3	NM_030764	0		0	A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Missense_Mutation	SNP	ENST00000361516.3	37	CCDS1168.1	.	.	.	.	.	.	.	.	.	.	G	6.186	0.402551	0.11696	.	.	ENSG00000132704	ENST00000361516;ENST00000368181;ENST00000392274	T;T;T	0.24350	1.95;3.5;1.86	4.51	-2.29	0.06805	.	1.645400	0.04265	U	0.341049	T	0.05364	0.0142	N	0.14661	0.345	0.09310	N	1	B;B;B;B	0.24426	0.0;0.001;0.103;0.002	B;B;B;B	0.22386	0.0;0.001;0.039;0.007	T	0.40384	-0.9566	10	0.48119	T	0.1	.	8.7613	0.34676	0.5312:0.0:0.4688:0.0	.	12;12;12;12	B4E0W2;B4DVJ9;Q96LA5-5;Q96LA5	.;.;.;FCRL2_HUMAN	V	12	ENSP00000355157:A12V;ENSP00000357163:A12V;ENSP00000376100:A12V	ENSP00000355157:A12V	A	-	2	0	FCRL2	156012206	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.296000	0.19083	-0.318000	0.08665	-0.136000	0.14681	GCA			0.428	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051408.2		NM_030764	
SHOC2	8036	mdanderson.org	37	10	112724386	112724386	+	Silent	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr10:112724386G>T	ENST00000369452.4	+	2	615	c.270G>T	c.(268-270)gtG>gtT	p.V90V	SHOC2_ENST00000489390.1_Intron|SHOC2_ENST00000265277.5_Silent_p.V90V	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	90					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		ATGCAGAGGTGATTAAAGAGC	0.448																																					p.V90V													.	.			0			c.G270T												79.0	77.0	77.0					10																	112724386		2203	4299	6502	SO:0001819	synonymous_variant	8036	exon1			AGAGGTGATTAAA	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.270G>T	10.37:g.112724386G>T			159	0	0		118	0.04	5	NM_001269039	30	0.00	0	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Silent	SNP	ENST00000369452.4	37	CCDS7568.1																																																																																					0.448	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050355.1		NM_007373	
MUC2	4583	mdanderson.org	37	11	1093324	1093324	+	Missense_Mutation	SNP	G	G	A	rs201143282		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:1093324G>A	ENST00000441003.2	+	30	5170	c.5143G>A	c.(5143-5145)Ggc>Agc	p.G1715S	MUC2_ENST00000333592.6_Missense_Mutation_p.G3S|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.G1682S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aacacccaccggcacacagac	0.637																																					p.G1715S													MUC2_ENST00000441003,uveal_tract,malignant_melanoma,0,2	MUC2_ENST00000441003	0	2	0			c.G5143A												178.0	224.0	208.0					11																	1093324		1930	3651	5581	SO:0001583	missense	4583	exon30			CCCACCGGCACAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5143G>A	11.37:g.1093324G>A	ENSP00000415183:p.Gly1715Ser		36	0.0277777778	1		32	0.09	3	NM_002457	2	0.00	0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	G	7.149	0.583420	0.13749	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.16743	3.11;3.17;2.32	1.64	0.221	0.15283	.	155.122000	0.02480	U	0.088379	T	0.09686	0.0238	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22556	-1.0213	9	0.19147	T	0.46	.	3.4701	0.07563	0.7575:0.0:0.2425:0.0	.	1715	E7EUV1	.	S	1715;1682;3	ENSP00000415183:G1715S;ENSP00000351956:G1682S;ENSP00000331373:G3S	ENSP00000331373:G3S	G	+	1	0	MUC2	1083324	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.131000	0.10482	-0.042000	0.13535	-1.076000	0.02234	GGC			0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MUC2	4583	mdanderson.org	37	11	1093346	1093346	+	Missense_Mutation	SNP	C	C	T	rs371050870		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:1093346C>T	ENST00000441003.2	+	30	5192	c.5165C>T	c.(5164-5166)aCa>aTa	p.T1722I	MUC2_ENST00000333592.6_Missense_Mutation_p.T10I|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1689I	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccgacacccatctcc	0.642																																					p.T1722I													.	.			0			c.C5165T							C	ILE/THR	18,3940		0,18,1961	232.0	270.0	257.0		5162	1.4	0.0	11		257	110,7416		0,110,3653	no	missense	MUC2	NM_002457.2	89	0,128,5614	TT,TC,CC		1.4616,0.4548,1.1146	possibly-damaging	1721/2813	1093346	128,11356	1979	3763	5742	SO:0001583	missense	4583	exon30			CCCCGACACCCAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5165C>T	11.37:g.1093346C>T	ENSP00000415183:p.Thr1722Ile		48	0.0208333333	1		36	0.14	5	NM_002457	6	0.33	2	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	7.653	0.683278	0.14907	0.004548	0.014616	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.11063	2.91;2.81;2.82	1.4	1.4	0.22301	.	0.000000	0.34959	U	0.003560	T	0.04497	0.0123	.	.	.	0.09310	N	1	P	0.34699	0.464	B	0.24269	0.052	T	0.30794	-0.9966	9	0.72032	D	0.01	.	8.2676	0.31824	0.0:1.0:0.0:0.0	.	1722	E7EUV1	.	I	1722;1689;10	ENSP00000415183:T1722I;ENSP00000351956:T1689I;ENSP00000331373:T10I	ENSP00000331373:T10I	T	+	2	0	MUC2	1083346	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.331000	0.19733	0.729000	0.32403	0.195000	0.17529	ACA			0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
AHNAK	79026	hgsc.bcm.edu	37	11	62294188	62294188	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:62294188T>G	ENST00000378024.4	-	5	7975	c.7701A>C	c.(7699-7701)ttA>ttC	p.L2567F	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2567					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTGGCATCTTTAACTTAGGCC	0.478																																					p.L2567F													AHNAK,mucosal,malignant_melanoma,0,2	AHNAK	0	2	0			c.A7701C												185.0	187.0	186.0					11																	62294188		2202	4299	6501	SO:0001583	missense	79026	exon5			CATCTTTAACTTA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7701A>C	11.37:g.62294188T>G	ENSP00000367263:p.Leu2567Phe		214	0	0		154	0.05	8	NM_001620	94	0.00	0	A1A586	Missense_Mutation	SNP	ENST00000378024.4	37	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	t	0.043	-1.275286	0.01410	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.02763	4.17	4.42	-0.957	0.10350	.	.	.	.	.	T	0.00552	0.0018	N	0.00067	-2.295	0.23232	N	0.998077	B	0.02656	0.0	B	0.01281	0.0	T	0.44483	-0.9325	9	0.02654	T	1	-7.7106	5.4338	0.16469	0.4598:0.0:0.4101:0.1302	.	2567	Q09666	AHNK_HUMAN	F	656;2567	ENSP00000367263:L2567F	ENSP00000244934:L656F	L	-	3	2	AHNAK	62050764	0.000000	0.05858	0.777000	0.31699	0.757000	0.42996	-4.448000	0.00232	-0.565000	0.06061	-0.361000	0.07541	TTA			0.478	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395572.1		NM_024060	
FAM86C2P	645332	bcgsc.ca	37	11	67560715	67560715	+	RNA	SNP	C	C	T	rs184691350		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:67560715C>T	ENST00000528089.1	-	0	1035							A6NEL3	F86C2_HUMAN	family with sequence similarity 86, member C2, pseudogene																		CGTAGGGAAACAGTTTCTGGT	0.512																																					.													.	.			0			.																																											645332	.			GGGAAACAGTTTC			11q13.2	2011-07-07			ENSG00000160172	ENSG00000160172			42392	pseudogene	pseudogene							Standard	NR_024249		Approved		uc001omt.4	A6NEL3	OTTHUMG00000167222		11.37:g.67560715C>T			279	0.0394265233	11		269	0.08	22	.	9	0.00	0		RNA	SNP	ENST00000528089.1	37																																																																																						0.512	FAM86C2P-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000393796.1			
HTR3B	9177	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	113775694	113775694	+	Silent	SNP	C	C	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:113775694C>A	ENST00000260191.2	+	1	296	c.39C>A	c.(37-39)atC>atA	p.I13I		NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	13					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	GGGCCTGCATCCTGGTGGCTG	0.438																																					p.I13I													.	HTR3B	50		0			c.C39A												103.0	94.0	97.0					11																	113775694		2201	4296	6497	SO:0001819	synonymous_variant	9177	exon1			CTGCATCCTGGTG	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.39C>A	11.37:g.113775694C>A			122	0.0081967213	1		77	0.43	33	NM_006028	0		0	B0YJ23|Q0VJC3	Silent	SNP	ENST00000260191.2	37	CCDS8364.1																																																																																					0.438	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398842.1		NM_006028	
OR10G9	219870	mdanderson.org	37	11	123894601	123894601	+	Silent	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr11:123894601G>T	ENST00000375024.1	+	1	882	c.882G>T	c.(880-882)gtG>gtT	p.V294V		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		ACAAGGAGGTGAAGAAAGCTG	0.428																																					p.V294V													.	.			0			c.G882T												103.0	98.0	100.0					11																	123894601		2201	4299	6500	SO:0001819	synonymous_variant	219870	exon1			GGAGGTGAAGAAA	AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.882G>T	11.37:g.123894601G>T			98	0	0		30	0.10	3	NM_001001953	0		0		Silent	SNP	ENST00000375024.1	37	CCDS31703.1																																																																																					0.428	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387269.1		NM_001001953	
WBP11	51729	broad.mit.edu	37	12	14947586	14947586	+	Silent	SNP	A	A	G			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:14947586A>G	ENST00000261167.2	-	7	839	c.606T>C	c.(604-606)ccT>ccC	p.P202P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	202	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GACCAGGGGGAGGGCCAGGAG	0.512																																					p.P202P													WBP11,right_lower_lobe,carcinoma,0,2	WBP11	66	2	0			c.T606C												100.0	107.0	105.0					12																	14947586		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon7			AGGGGGAGGGCCA	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.606T>C	12.37:g.14947586A>G			220	0.0090909091	2		588	0.02	9	NM_016312	566	0.00	1	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.512	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
SPRYD3	84926	broad.mit.edu	37	12	53471008	53471009	+	Missense_Mutation	DNP	GC	GC	AG			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:53471008_53471009GC>AG	ENST00000301463.4	-	2	146_147	c.60_61GC>CT	c.(58-63)ctGCac>ctCTac	p.H21Y	SPRYD3_ENST00000547837.1_Missense_Mutation_p.H58Y	NM_032840.2	NP_116229.1	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	21	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						AACCGGTAGTGCAGGTTGAGGT	0.525																																					p.H58Y													.	SPRYD3	29		0			c.G60C																																									SO:0001583	missense	84926	exon2			GGTAGTGCAGGTT	AK074694	CCDS8845.1	12q13.13	2006-11-29		2006-02-02		ENSG00000167778			25920	protein-coding gene	gene with protein product						14702039	Standard	NM_032840		Approved	FLJ14800	uc001sbt.2	Q8NCJ5	OTTHUMG00000170101	ENST00000301463.4:c.60_61delinsAG	12.37:g.53471008_53471009delinsAG	ENSP00000301463:p.His21Tyr		106	0	0		110	0.04	4	NM_032840	64	0.00	0	B9EG99|Q96SK5	Missense_Mutation	DNP	ENST00000301463.4	37	CCDS8845.1																																																																																					0.525	SPRYD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000407264.1		NM_032840	
PPFIA2	8499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	81760903	81760903	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:81760903T>A	ENST00000549396.1	-	14	1689	c.1529A>T	c.(1528-1530)gAa>gTa	p.E510V	PPFIA2_ENST00000541570.2_Missense_Mutation_p.E77V|PPFIA2_ENST00000443686.3_Missense_Mutation_p.E411V|PPFIA2_ENST00000552948.1_Missense_Mutation_p.E510V|PPFIA2_ENST00000549325.1_Missense_Mutation_p.E492V|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000407050.4_Missense_Mutation_p.E436V|PPFIA2_ENST00000550584.2_Missense_Mutation_p.E510V|PPFIA2_ENST00000548586.1_Missense_Mutation_p.E510V|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000333447.7_Missense_Mutation_p.E492V|PPFIA2_ENST00000550359.2_Missense_Mutation_p.E357V	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	510	Glu-rich.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						ATGTAAAGATTCTTCAAGATT	0.224																																					p.E510V													PPFIA2,NS,carcinoma,-1,1	PPFIA2	-1	1	0			c.A1529T												25.0	24.0	24.0					12																	81760903		1457	3310	4767	SO:0001583	missense	8499	exon13			AAAGATTCTTCAA	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1529A>T	12.37:g.81760903T>A	ENSP00000450337:p.Glu510Val		495	0	0		501	0.21	107	NM_001220476	0		0	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	37	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.603018	0.66445	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058;ENST00000548670	T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.41	5.41	0.78517	.	0.119241	0.56097	D	0.000030	T	0.44705	0.1306	M	0.69523	2.12	0.80722	D	1	B	0.30482	0.281	B	0.24848	0.056	T	0.49133	-0.8971	10	0.87932	D	0	-19.9813	15.742	0.77905	0.0:0.0:0.0:1.0	.	510	O75334	LIPA2_HUMAN	V	510;492;77;436;521;492;510;411;510;91;77	ENSP00000450337:E510V;ENSP00000450298:E492V;ENSP00000438337:E77V;ENSP00000385093:E436V;ENSP00000327416:E492V;ENSP00000449338:E510V;ENSP00000388373:E411V;ENSP00000447868:E510V;ENSP00000448941:E91V	ENSP00000327416:E492V	E	-	2	0	PPFIA2	80285034	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.401000	0.79962	2.185000	0.69588	0.519000	0.50382	GAA			0.224	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000408030.1			
RP11-478C19.2	0	broad.mit.edu	37	12	110868215	110868216	+	RNA	DEL	GT	GT	-	rs113592903		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:110868215_110868216delGT	ENST00000550231.1	-	0	97																											CAgtgtgtgcgtgtgtgtgtgt	0.49																																					.													.	.			0			.																																											0	.			GTGTGCGTGTGTG																													12.37:g.110868225_110868226delGT			8	0	0		12	0.42	5	.	0		0		RNA	DEL	ENST00000550231.1	37																																																																																						0.490	RP11-478C19.2-001	KNOWN	basic|readthrough_transcript	retained_intron	processed_transcript		OTTHUMT00000404601.1			
CIT	11113	mdanderson.org	37	12	120128070	120128070	+	Silent	SNP	G	G	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:120128070G>C	ENST00000261833.7	-	46	5998	c.5946C>G	c.(5944-5946)ccC>ccG	p.P1982P	CIT_ENST00000392521.2_Silent_p.P2024P|CIT_ENST00000537607.1_5'UTR	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1982					cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCATCCGGCCGGGGGACTTCT	0.721																																					p.P2024P													CIT_ENST00000392521,axilla,malignant_melanoma,-2,6	CIT_ENST00000392521	-2	6	0			c.C6072G												11.0	13.0	12.0					12																	120128070		2162	4257	6419	SO:0001819	synonymous_variant	11113	exon47			CCGGCCGGGGGAC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.5946C>G	12.37:g.120128070G>C			12	0	0		17	0.12	2	NM_001206999	40	0.00	0	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Silent	SNP	ENST00000261833.7	37	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	C	8.921	0.961024	0.18583	.	.	ENSG00000122966	ENST00000392520	T	0.21932	1.98	5.4	-10.8	0.00216	.	0.000000	0.85682	D	0.000000	T	0.19525	0.0469	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62637	-0.6812	7	0.87932	D	0	.	3.9034	0.09172	0.1348:0.1179:0.349:0.3982	.	.	.	.	R	1595	ENSP00000376305:P1595R	ENSP00000376305:P1595R	P	-	2	0	CIT	118612453	0.000000	0.05858	0.029000	0.17559	0.995000	0.86356	-3.110000	0.00600	-3.595000	0.00135	-0.120000	0.15030	CCG			0.721	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000259410.4		NM_007174	
TCTN2	79867	mdanderson.org	37	12	124156143	124156143	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr12:124156143G>T	ENST00000303372.5	+	2	300	c.172G>T	c.(172-174)Gtg>Ttg	p.V58L	TCTN2_ENST00000426174.2_Missense_Mutation_p.V58L	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	58					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GTCCCTGGCAGTGCTGCAGGA	0.632																																					p.V58L													.	.			0			c.G172T												54.0	53.0	53.0					12																	124156143		2203	4300	6503	SO:0001583	missense	79867	exon2			CTGGCAGTGCTGC	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.172G>T	12.37:g.124156143G>T	ENSP00000304941:p.Val58Leu		46	0	0		68	0.06	4	NM_001143850	47	0.00	0	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	ENST00000303372.5	37	CCDS9253.1	.	.	.	.	.	.	.	.	.	.	G	8.295	0.818700	0.16607	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.82619	-1.63;-1.63	4.5	-6.42	0.01932	.	1.258880	0.05935	N	0.635985	T	0.60894	0.2304	N	0.03268	-0.37	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.55179	-0.8181	10	0.10377	T	0.69	-16.4776	14.4384	0.67298	0.0:0.1474:0.7038:0.1488	.	58;58	A8K7Y8;Q96GX1	.;TECT2_HUMAN	L	58	ENSP00000395171:V58L;ENSP00000304941:V58L	ENSP00000304941:V58L	V	+	1	0	TCTN2	122722096	0.001000	0.12720	0.000000	0.03702	0.536000	0.34869	-0.034000	0.12225	-1.068000	0.03156	-0.181000	0.13052	GTG			0.632	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000400652.1		NM_024809	
RB1	5925	broad.mit.edu	37	13	48947559	48947559	+	Silent	SNP	C	C	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr13:48947559C>A	ENST00000267163.4	+	12	1284	c.1146C>A	c.(1144-1146)atC>atA	p.I382I		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	382	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TGAACACTATCCAACAATTAA	0.299		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.I382I			yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068		23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.C1146A												103.0	111.0	108.0					13																	48947559		2202	4288	6490	SO:0001819	synonymous_variant	5925	exon12	Familial Cancer Database		CACTATCCAACAA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1146C>A	13.37:g.48947559C>A			450	0.0022222222	1		334	0.02	6	NM_000321	29	0.03	1	A8K5E3|P78499|Q5VW46|Q8IZL4	Silent	SNP	ENST00000267163.4	37	CCDS31973.1																																																																																					0.299	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000044884.1			
CLDN10	9071	broad.mit.edu	37	13	96085990	96085990	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr13:96085990G>A	ENST00000376873.3	+	0	133					NM_001160100.1|NM_182848.3	NP_001153572.1|NP_878268.1	P78369	CLD10_HUMAN	claudin 10						calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			ACCCACATCCGCTGGCTGTGA	0.512																																					.													.	CLDN10	70		0			.																																											9071	.			ACATCCGCTGGCT	U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000376873.3:c.-98G>A	13.37:g.96085990G>A			51	0.0196078431	1		40	0.08	3	.	0		0	Q6IBF9|Q96N78	Translation_Start_Site	SNP	ENST00000376873.3	37	CCDS9475.1																																																																																					0.512	CLDN10-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000045483.3		NM_006984	
TM9SF2	9375	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	100192991	100192991	+	Silent	SNP	G	G	T	rs149415928		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr13:100192991G>T	ENST00000376387.4	+	8	1042	c.852G>T	c.(850-852)gcG>gcT	p.A284A		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	284					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TCAGATGGGCGTCTAGATGGG	0.373																																					p.A284A													.	.			0			c.G852T												185.0	172.0	177.0					13																	100192991		2203	4300	6503	SO:0001819	synonymous_variant	9375	exon8			ATGGGCGTCTAGA	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.852G>T	13.37:g.100192991G>T			211	0	0		160	0.46	74	NM_004800	226	0.46	105	A8K399|Q2TAY5	Silent	SNP	ENST00000376387.4	37	CCDS9493.1																																																																																					0.373	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045602.3			
ING1	3621	mdanderson.org	37	13	111366533	111366533	+	5'Flank	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr13:111366533G>T	ENST00000375774.3	+	0	0				ING1_ENST00000375775.3_Intron|ING1_ENST00000333219.7_Missense_Mutation_p.V13L|ING1_ENST00000338450.7_Intron|CARS2_ENST00000535398.1_5'Flank	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1						cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GCTCCACCTGGTGAACTATGT	0.627																																					p.V13L													.	.			0			c.G37T												74.0	58.0	64.0					13																	111366533		2202	4300	6502	SO:0001631	upstream_gene_variant	3621	exon1			CACCTGGTGAACT		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346		13.37:g.111366533G>T	Exception_encountered		55	0	0		34	0.09	3	NM_198219	21	0.00	0	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	37	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479385	0.26511	.	.	ENSG00000153487	ENST00000333219	.	.	.	3.16	3.16	0.36331	.	.	.	.	.	T	0.42877	0.1222	L	0.38531	1.155	0.80722	D	1	B	0.13594	0.008	B	0.09377	0.004	T	0.21518	-1.0243	8	0.12766	T	0.61	.	11.2279	0.48895	0.0:0.0:0.8163:0.1836	.	13	Q5T9H0	.	L	13	.	ENSP00000328436:V13L	V	+	1	0	ING1	110164534	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	8.233000	0.89799	1.301000	0.44836	0.462000	0.41574	GTG			0.627	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000045770.2		NM_005537	
ADAM21	8747	bcgsc.ca	37	14	70924643	70924643	+	Missense_Mutation	SNP	T	T	C	rs78114303		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr14:70924643T>C	ENST00000603540.1	+	2	685	c.427T>C	c.(427-429)Tat>Cat	p.Y143H	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.Y143H	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	143					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGGCCTCACTTATGAAATTGA	0.433																																					p.Y143H													.	ADAM21	181		0			c.T427C												55.0	63.0	60.0					14																	70924643		2203	4300	6503	SO:0001583	missense	8747	exon2			CTCACTTATGAAA	AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.427T>C	14.37:g.70924643T>C	ENSP00000474385:p.Tyr143His		144	0.0208333333	3		174	0.07	13	NM_003813	0		0	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	ENST00000603540.1	37	CCDS9804.1	.	.	.	.	.	.	.	.	.	.	T	8.985	0.976280	0.18736	.	.	ENSG00000139985	ENST00000267499	T	0.15952	2.38	3.76	2.59	0.31030	Peptidase M12B, propeptide (1);	0.000000	0.39146	U	0.001443	T	0.48857	0.1523	H	0.94542	3.55	0.30013	N	0.815021	D	0.76494	0.999	D	0.85130	0.997	T	0.55774	-0.8088	10	0.87932	D	0	.	9.3062	0.37876	0.0:0.088:0.0:0.912	.	143	Q9UKJ8	ADA21_HUMAN	H	143	ENSP00000267499:Y143H	ENSP00000267499:Y143H	Y	+	1	0	ADAM21	69994396	0.998000	0.40836	0.563000	0.28383	0.010000	0.07245	3.395000	0.52558	0.610000	0.30035	-0.385000	0.06624	TAT			0.433	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413008.3			
HEATR4	399671	broad.mit.edu	37	14	73989219	73989219	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr14:73989219C>T	ENST00000553558.1	-	3	959	c.638G>A	c.(637-639)cGc>cAc	p.R213H	RP3-414A15.11_ENST00000553394.1_RNA|HEATR4_ENST00000334988.2_Missense_Mutation_p.R213H|RP3-414A15.2_ENST00000555972.2_RNA|HEATR4_ENST00000560393.1_Missense_Mutation_p.R166H	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	213								p.R166H(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCGGGCTGTGCGCTCGTTCAG	0.592																																					p.R213H													HEATR4,colon,carcinoma,0,1	HEATR4	126	1	1	Substitution - Missense(1)	large_intestine(1)	c.G638A												51.0	48.0	49.0					14																	73989219		2203	4300	6503	SO:0001583	missense	399671	exon2			GCTGTGCGCTCGT	BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.638G>A	14.37:g.73989219C>T	ENSP00000450444:p.Arg213His		114	0	0		156	0.03	5	NM_203309	1	0.00	0	B7Z7V9|E9KL41	Missense_Mutation	SNP	ENST00000553558.1	37	CCDS9815.2	.	.	.	.	.	.	.	.	.	.	C	16.74	3.205528	0.58234	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.45276	0.9	6.07	5.18	0.71444	.	0.000000	0.64402	D	0.000004	T	0.28896	0.0717	L	0.36672	1.1	0.35388	D	0.790534	P	0.38788	0.647	B	0.26517	0.07	T	0.46721	-0.9171	10	0.59425	D	0.04	-9.178	11.525	0.50573	0.0:0.918:0.0:0.082	.	213	Q86WZ0	HEAT4_HUMAN	H	213;166	ENSP00000450444:R213H	ENSP00000335447:R166H	R	-	2	0	HEATR4	73058972	1.000000	0.71417	1.000000	0.80357	0.093000	0.18481	2.541000	0.45735	1.577000	0.49804	0.655000	0.94253	CGC			0.592	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414422.2		NM_203309	
MIR380	494329	mdanderson.org	37	14	101490191	101490191	+	RNA	SNP	C	C	G			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr14:101490191C>G	ENST00000362112.2	-	0	111				MIR758_ENST00000390227.1_RNA|MIR329-1_ENST00000385028.1_RNA|MIR1197_ENST00000408818.1_RNA|MIR379_ENST00000362218.3_RNA|MIR323A_ENST00000362199.1_RNA|MIR299_ENST00000385016.2_RNA|MIR411_ENST00000362239.2_RNA	NR_029872.1				microRNA 380																		TAAACCGCTTCTTGGTATCCA	0.532																																					.													.	.			0			.												67.0	64.0	65.0					14																	101490191		1568	3582	5150			407023	.			CCGCTTCTTGGTA			14q32.31	2013-02-12		2008-12-18		ENSG00000198982		"""ncRNAs / Micro RNAs"""	31873	non-coding RNA	RNA, micro		613654		MIRN380			Standard	NR_029872		Approved	hsa-mir-380	uc010awb.1				14.37:g.101490191C>G			269	0	0		325	0.03	9	.	0		0		RNA	SNP	ENST00000362112.2	37																																																																																						0.532	MIR380-201	KNOWN	basic	miRNA	miRNA				NR_029872	
PLA2G4F	255189	broad.mit.edu	37	15	42436300	42436300	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr15:42436300C>T	ENST00000382396.4	-	18	2104	c.2018G>A	c.(2017-2019)cGg>cAg	p.R673Q	PLA2G4F_ENST00000397272.3_Missense_Mutation_p.R675Q			Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	673	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid secretion (GO:0050482)|cellular response to antibiotic (GO:0071236)|cellular response to organic cyclic compound (GO:0071407)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	calcium-dependent phospholipase A2 activity (GO:0047498)|lysophospholipase activity (GO:0004622)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		CAGGCAGTCCCGCATGGGGGT	0.587																																					p.R673Q													PLA2G4F,NS,carcinoma,-1,2	PLA2G4F	75	2	0			c.G2018A												91.0	78.0	83.0					15																	42436300		2203	4299	6502	SO:0001583	missense	255189	exon18			CAGTCCCGCATGG		CCDS32204.1	15q15.1	2008-09-19				ENSG00000168907	3.1.1.4		27396	protein-coding gene	gene with protein product						14702039, 15866882	Standard	NM_213600		Approved	PLA2G4F/Z	uc001zoz.3	Q68DD2		ENST00000382396.4:c.2018G>A	15.37:g.42436300C>T	ENSP00000371833:p.Arg673Gln		77	0	0		74	0.04	3	NM_213600	1	0.00	0	Q6ZMC8	Missense_Mutation	SNP	ENST00000382396.4	37	CCDS32204.1	.	.	.	.	.	.	.	.	.	.	c	9.457	1.092215	0.20471	.	.	ENSG00000168907	ENST00000290497;ENST00000397272;ENST00000382396;ENST00000443825	T;T	0.12361	2.69;2.69	5.58	-2.48	0.06423	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.887861	0.09621	N	0.777554	T	0.05044	0.0135	L	0.31578	0.945	0.09310	N	1	P;P	0.44006	0.824;0.824	B;B	0.25405	0.06;0.042	T	0.41016	-0.9532	10	0.14252	T	0.57	-1.747	4.4587	0.11656	0.1091:0.2131:0.1074:0.5704	.	460;673	A2RRC4;Q68DD2	.;PA24F_HUMAN	Q	669;675;673;673	ENSP00000380442:R675Q;ENSP00000371833:R673Q	ENSP00000290497:R669Q	R	-	2	0	PLA2G4F	40223592	0.000000	0.05858	0.022000	0.16811	0.802000	0.45316	-0.295000	0.08298	-0.137000	0.11455	-0.854000	0.03029	CGG			0.587	PLA2G4F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000420463.1		NM_213600	
ZNF609	23060	mdanderson.org	37	15	64970351	64970351	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr15:64970351G>T	ENST00000326648.3	+	5	3567	c.3439G>T	c.(3439-3441)Gcc>Tcc	p.A1147S		NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	1147						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGTTTATCCTGCCAAGTACTC	0.498																																					p.A1147S													.	.			0			c.G3439T												57.0	51.0	53.0					15																	64970351		2203	4299	6502	SO:0001583	missense	23060	exon5			TATCCTGCCAAGT	BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.3439G>T	15.37:g.64970351G>T	ENSP00000316527:p.Ala1147Ser		65	0	0		46	0.07	3	NM_015042	28	0.00	0	Q0D2I2	Missense_Mutation	SNP	ENST00000326648.3	37	CCDS32270.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612472	0.28712	.	.	ENSG00000180357	ENST00000326648	T	0.40476	1.03	5.14	5.14	0.70334	.	0.231578	0.43416	D	0.000578	T	0.23649	0.0572	N	0.13098	0.295	0.41921	D	0.990519	B	0.28998	0.23	B	0.22386	0.039	T	0.10590	-1.0623	10	0.02654	T	1	-14.7412	17.1468	0.86768	0.0:0.0:1.0:0.0	.	1147	O15014	ZN609_HUMAN	S	1147	ENSP00000316527:A1147S	ENSP00000316527:A1147S	A	+	1	0	ZNF609	62757404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.190000	0.58365	2.537000	0.85549	0.650000	0.86243	GCC			0.498	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418130.1		XM_042833	
AXIN1	8312	mdanderson.org	37	16	347728	347728	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:347728G>T	ENST00000262320.3	-	6	2149	c.1778C>A	c.(1777-1779)gCc>gAc	p.A593D	AXIN1_ENST00000354866.3_Missense_Mutation_p.A593D|AXIN1_ENST00000481769.1_5'Flank	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	593	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TCACCTGTGGGCGAGGCCATC	0.637																																					p.A593D													.	.			0			c.C1778A												19.0	20.0	20.0					16																	347728		2201	4297	6498	SO:0001583	missense	8312	exon6			CTGTGGGCGAGGC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1778C>A	16.37:g.347728G>T	ENSP00000262320:p.Ala593Asp		29	0	0		33	0.09	3	NM_003502	62	0.00	0	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	9.509	1.105290	0.20632	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.61040	0.17;0.14	4.95	2.97	0.34412	.	0.430085	0.28630	N	0.014665	T	0.55832	0.1945	L	0.47716	1.5	0.80722	D	1	B;B	0.28400	0.21;0.041	B;B	0.35607	0.206;0.046	T	0.54669	-0.8259	10	0.41790	T	0.15	0.0084	16.7101	0.85383	0.0:0.3861:0.6139:0.0	.	593;593	O15169-2;O15169	.;AXIN1_HUMAN	D	593	ENSP00000262320:A593D;ENSP00000346935:A593D	ENSP00000262320:A593D	A	-	2	0	AXIN1	287729	0.944000	0.32072	0.887000	0.34795	0.149000	0.21700	0.848000	0.27710	0.588000	0.29660	-0.503000	0.04515	GCC			0.637	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000139441.3			
CRAMP1L	57585	mdanderson.org	37	16	1717336	1717336	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:1717336G>T	ENST00000397412.3	+	17	3136	c.3037G>T	c.(3037-3039)Ggc>Tgc	p.G1013C	CRAMP1L_ENST00000436138.3_Splice_Site_p.G1010C|CRAMP1L_ENST00000293925.5_Splice_Site_p.G1013C|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000262317.4_Splice_Site_p.G391C			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1013						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CTTCCTGCAGGGCTCCGACCC	0.607																																					p.G1013C													.	.			0			c.G3037T												45.0	50.0	48.0					16																	1717336		2047	4197	6244	SO:0001630	splice_region_variant	57585	exon16			CTGCAGGGCTCCG	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3037-1G>T	16.37:g.1717336G>T			62	0.0161290323	1		46	0.07	3	NM_020825	12	0.00	0	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	37	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.123795	0.77436	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317	.	.	.	4.87	4.87	0.63330	.	0.503195	0.22573	N	0.058318	T	0.58264	0.2110	L	0.27053	0.805	0.80722	D	1	D	0.53885	0.963	P	0.55999	0.789	T	0.54180	-0.8332	8	.	.	.	-12.061	15.5894	0.76512	0.0:0.0:1.0:0.0	.	1013	Q96RY5	CRML_HUMAN	C	1013;1013;1010;391	.	.	G	+	1	0	CRAMP1L	1657337	0.988000	0.35896	0.891000	0.34965	0.073000	0.16967	1.613000	0.36900	2.627000	0.88993	0.650000	0.86243	GGC			0.607	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000157297.4			Missense_Mutation
IGFALS	3483	broad.mit.edu;mdanderson.org	37	16	1841105	1841105	+	Silent	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:1841105C>T	ENST00000215539.3	-	2	1424	c.1314G>A	c.(1312-1314)gaG>gaA	p.E438E	IGFALS_ENST00000415638.3_Silent_p.E476E			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	438					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						TCAGGTCGAGCTCCAGCAGCT	0.682																																					p.E476E													.	IGFALS	29		0			c.G1428A												16.0	19.0	18.0					16																	1841105		2178	4289	6467	SO:0001819	synonymous_variant	3483	exon2			GTCGAGCTCCAGC	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1314G>A	16.37:g.1841105C>T			27	0	0		13	0.23	3	NM_001146006	10	0.10	1	B4DZY8|E9PGU3	Silent	SNP	ENST00000215539.3	37	CCDS10446.1																																																																																					0.682	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250509.2			
THAP11	57215	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	67876460	67876460	+	Start_Codon_SNP	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:67876460G>T	ENST00000303596.1	+	1	248	c.3G>T	c.(1-3)atG>atT	p.M1I	CENPT_ENST00000562787.1_Intron	NM_020457.2	NP_065190.2	Q96EK4	THA11_HUMAN	THAP domain containing 11	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	8		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		gcgcAGCCATGCCTGGCTTTA	0.726																																					p.M1I													.	THAP11	27		0			c.G3T												19.0	12.0	14.0					16																	67876460		1864	3585	5449	SO:0001582	initiator_codon_variant	57215	exon1			AGCCATGCCTGGC	AB015338	CCDS10847.1	16q22.1	2013-01-25			ENSG00000168286	ENSG00000168286		"""THAP (C2CH-type zinc finger) domain containing"""	23194	protein-coding gene	gene with protein product		609119				12575992, 8325628	Standard	NM_020457		Approved	HRIHFB2206, CTG-B45d, CTG-B43a	uc002euo.3	Q96EK4	OTTHUMG00000137546	ENST00000303596.1:c.3G>T	16.37:g.67876460G>T	ENSP00000304689:p.Met1Ile		49	0	0		24	0.42	10	NM_020457	22	0.55	12	A4UCT5|A8K002|O94795	Translation_Start_Site	SNP	ENST00000303596.1	37	CCDS10847.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209687	0.39003	.	.	ENSG00000168286	ENST00000303596	.	.	.	5.19	5.19	0.71726	Zinc finger, C2CH-type (1);	0.000000	0.85682	D	0.000000	T	0.78916	0.4359	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.81453	-0.0926	8	0.87932	D	0	-5.7871	18.6587	0.91463	0.0:0.0:1.0:0.0	.	1	Q96EK4	THA11_HUMAN	I	1	.	ENSP00000304689:M1I	M	+	3	0	THAP11	66433961	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	8.854000	0.92228	2.573000	0.86826	0.561000	0.74099	ATG			0.726	THAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268879.1		NM_020457	Missense_Mutation
NFATC3	4775	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	68119617	68119617	+	Silent	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:68119617G>A	ENST00000346183.3	+	1	57	c.33G>A	c.(31-33)gaG>gaA	p.E11E	RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000575270.1_Silent_p.E11E|NFATC3_ENST00000329524.4_Silent_p.E11E|NFATC3_ENST00000349223.5_Silent_p.E11E	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	11					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		CCCACGACGAGCTCGACTTCA	0.746																																					p.E11E													.	.			0			c.G33A												16.0	14.0	14.0					16																	68119617		1821	3578	5399	SO:0001819	synonymous_variant	4775	exon1			CGACGAGCTCGAC	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.33G>A	16.37:g.68119617G>A			40	0	0		22	0.36	8	NM_173163	3	0.33	1	O75211|Q14516|Q99840|Q99841|Q99842	Silent	SNP	ENST00000346183.3	37	CCDS10860.1																																																																																					0.746	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268890.2		NM_004555	
AP1G1	164	broad.mit.edu;mdanderson.org	37	16	71805154	71805154	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr16:71805154G>T	ENST00000299980.4	-	5	911	c.470C>A	c.(469-471)gCa>gAa	p.A157E	AP1G1_ENST00000423132.2_Splice_Site_p.A157E|AP1G1_ENST00000569748.1_Splice_Site_p.A157E|AP1G1_ENST00000393512.3_Splice_Site_p.A157E|AP1G1_ENST00000433195.2_Splice_Site_p.A180E	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	157					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				ACACAGTGCTGCCTATGAAAA	0.333																																					p.A157E													.	AP1G1	83		0			c.C470A												46.0	44.0	45.0					16																	71805154		2198	4298	6496	SO:0001630	splice_region_variant	164	exon5			AGTGCTGCCTATG	Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.469-1C>A	16.37:g.71805154G>T			96	0	0		68	0.07	5	NM_001030007	22	0.00	0	O75709|O75842|Q9UG09|Q9Y3U4	Splice_Site	SNP	ENST00000299980.4	37	CCDS32480.1	.	.	.	.	.	.	.	.	.	.	G	33	5.218806	0.95104	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000538574;ENST00000425422	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.48	5.48	0.80851	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.87390	0.6165	H	0.97491	4.015	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;1.0	D	0.91682	0.5359	10	0.87932	D	0	-11.8132	19.3636	0.94453	0.0:0.0:1.0:0.0	.	239;157;180;157	B4DS96;O43747;B3KXW5;O43747-2	.;AP1G1_HUMAN;.;.	E	157;157;157;180;28;239	ENSP00000299980:A157E;ENSP00000377148:A157E;ENSP00000409153:A157E;ENSP00000403259:A180E	ENSP00000299980:A157E	A	-	2	0	AP1G1	70362655	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.476000	0.97823	2.573000	0.86826	0.655000	0.94253	GCA			0.333	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000434147.1			Missense_Mutation
ALOX12	239	mdanderson.org	37	17	6905930	6905930	+	Intron	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr17:6905930G>T	ENST00000251535.6	+	8	1214				AC027763.2_ENST00000399540.2_Missense_Mutation_p.T36N|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Missense_Mutation_p.T36N|AC027763.2_ENST00000573939.1_Missense_Mutation_p.L5I|AC027763.2_ENST00000574377.1_Missense_Mutation_p.T48N|RP11-589P10.7_ENST00000572547.1_RNA	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase						aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						aacacagcaagtcccggtctc	0.428																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			CAGCAAGTCCCGG	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1161+800G>T	17.37:g.6905930G>T			22	0	0		19	0.11	2	.	12	0.00	0	O95569|Q6ISF8|Q9UQM4	RNA	SNP	ENST00000251535.6	37	CCDS11084.1	.	.	.	.	.	.	.	.	.	.	G	4.573	0.106507	0.08780	.	.	ENSG00000215067	ENST00000399540	T	0.01347	4.99	0.545	0.545	0.17190	.	.	.	.	.	T	0.01835	0.0058	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.49341	-0.8950	5	0.40728	T	0.16	.	.	.	.	.	.	.	.	N	36	ENSP00000382455:T36N	ENSP00000382455:T36N	T	-	2	0	AC027763.2	6846654	0.013000	0.17824	0.027000	0.17364	0.037000	0.13140	0.240000	0.18042	0.533000	0.28675	0.305000	0.20034	ACT			0.428	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219922.2			
TMEM102	284114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	7339839	7339839	+	Missense_Mutation	SNP	G	G	C	rs556911261		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr17:7339839G>C	ENST00000323206.1	+	3	814	c.541G>C	c.(541-543)Gaa>Caa	p.E181Q	RP11-104H15.8_ENST00000576615.1_RNA|RP11-104H15.7_ENST00000575310.1_RNA|TMEM102_ENST00000396568.1_Missense_Mutation_p.E181Q|RP11-104H15.9_ENST00000570444.1_RNA|RP11-104H15.10_ENST00000575331.1_RNA|FGF11_ENST00000293829.4_5'Flank|FGF11_ENST00000575235.1_5'Flank	NM_178518.2	NP_848613.1	Q8N9M5	TM102_HUMAN	transmembrane protein 102	181					apoptotic process (GO:0006915)|positive regulation of cell adhesion (GO:0045785)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell migration (GO:2000406)|regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901028)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to cytokine (GO:0034097)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|protein complex (GO:0043234)				kidney(1)|lung(3)|skin(1)	5		Prostate(122;0.173)				GGAGAGCGAAGAAAGTTCCAA	0.572													G|||	1	0.000199681	0.0	0.0	5008	,	,		17124	0.0		0.0	False		,,,				2504	0.001				p.E181Q													.	.			0			c.G541C												86.0	83.0	84.0					17																	7339839		2203	4300	6503	SO:0001583	missense	284114	exon3			AGCGAAGAAAGTT	AK094197	CCDS11104.1	17p13.1	2008-04-21			ENSG00000181284	ENSG00000181284			26722	protein-coding gene	gene with protein product		613936				12477932	Standard	NM_178518		Approved	FLJ36878	uc002ggx.1	Q8N9M5	OTTHUMG00000132901	ENST00000323206.1:c.541G>C	17.37:g.7339839G>C	ENSP00000315387:p.Glu181Gln		145	0	0		119	0.41	49	NM_178518	29	0.45	13	D3DTP8	Missense_Mutation	SNP	ENST00000323206.1	37	CCDS11104.1	.	.	.	.	.	.	.	.	.	.	G	7.941	0.742812	0.15642	.	.	ENSG00000181284	ENST00000323206;ENST00000396568	T;T	0.45276	0.9;0.9	5.36	3.3	0.37823	.	1.268860	0.05337	N	0.529433	T	0.38825	0.1055	L	0.44542	1.39	0.09310	N	1	B	0.17465	0.022	B	0.11329	0.006	T	0.31223	-0.9951	10	0.48119	T	0.1	-24.485	8.9781	0.35948	0.0:0.1621:0.6695:0.1683	.	181	Q8N9M5	TM102_HUMAN	Q	181	ENSP00000315387:E181Q;ENSP00000379815:E181Q	ENSP00000315387:E181Q	E	+	1	0	TMEM102	7280563	0.030000	0.19436	0.005000	0.12908	0.093000	0.18481	1.601000	0.36773	0.689000	0.31550	0.655000	0.94253	GAA			0.572	TMEM102-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256405.1		NM_178518	
MRPL45P2	653479	broad.mit.edu	37	17	45567245	45567246	+	RNA	INS	-	-	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr17:45567245_45567246insA	ENST00000575291.1	-	0	385									mitochondrial ribosomal protein L45 pseudogene 2																		aactccatctcaaaaaaaaaaa	0.401																																					.													.	.			0			.																																											0	.			CCATCTCAAAAAA			17q21.32	2010-09-29				ENSG00000228782			29716	pseudogene	pseudogene						12706105	Standard	NR_033934		Approved		uc002ilq.3				17.37:g.45567256_45567256dupA			8	0	0		6	0.50	3	.	0		0		RNA	INS	ENST00000575291.1	37																																																																																						0.401	MRPL45P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000441112.1		NR_033934	
R3HDM4	91300	broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	900917	900917	+	Silent	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr19:900917C>T	ENST00000361574.5	-	4	460	c.387G>A	c.(385-387)gaG>gaA	p.E129E	R3HDM4_ENST00000587975.1_Silent_p.E108E	NM_138774.3	NP_620129.2	Q96D70	R3HD4_HUMAN	R3H domain containing 4	129						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)										CCCGCTCCTGCTCCTCCCCGG	0.672																																					p.E129E													.	.			0			c.G387A												22.0	23.0	23.0					19																	900917		2198	4300	6498	SO:0001819	synonymous_variant	91300	exon4			CTCCTGCTCCTCC	BC012775	CCDS12048.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000198858	ENSG00000198858			28270	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 22"""	C19orf22		12477932	Standard	NM_138774		Approved	MGC16353	uc002lqg.2	Q96D70		ENST00000361574.5:c.387G>A	19.37:g.900917C>T			156	0	0		110	0.05	6	NM_138774	151	0.11	16		Silent	SNP	ENST00000361574.5	37	CCDS12048.1																																																																																					0.672	R3HDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458209.1		NM_138774	
CHAF1A	10036	mdanderson.org	37	19	4428887	4428887	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr19:4428887G>T	ENST00000301280.5	+	8	1705	c.1604G>T	c.(1603-1605)aGt>aTt	p.S535I	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	535					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		ATTTTTAACAGGTCAGAGCCT	0.602								Chromatin Structure																													p.S535I													.	.			0			c.G1604T												22.0	26.0	24.0					19																	4428887		2196	4293	6489	SO:0001630	splice_region_variant	10036	exon8			TTAACAGGTCAGA	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1604+1G>T	19.37:g.4428887G>T			69	0	0		57	0.05	3	NM_005483	67	0.00	0	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	37	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	G	15.21	2.766979	0.49574	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.16457	2.34	5.14	5.14	0.70334	.	.	.	.	.	T	0.26048	0.0635	L	0.56769	1.78	0.53005	D	0.99996	D	0.54047	0.964	P	0.47044	0.535	T	0.02220	-1.1193	9	0.87932	D	0	-7.885	15.7407	0.77894	0.0:0.0:1.0:0.0	.	535	Q13111	CAF1A_HUMAN	I	535	ENSP00000301280:S535I	ENSP00000301280:S535I	S	+	2	0	CHAF1A	4379887	1.000000	0.71417	0.966000	0.40874	0.238000	0.25445	4.875000	0.63072	2.386000	0.81285	0.555000	0.69702	AGT			0.602	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458310.2		NM_005483	Missense_Mutation
RHPN2	85415	hgsc.bcm.edu	37	19	33517507	33517507	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr19:33517507C>T	ENST00000254260.3	-	3	252	c.217G>A	c.(217-219)Gtg>Atg	p.V73M	RHPN2_ENST00000400226.4_De_novo_Start_OutOfFrame	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	73					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.V73M(2)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TCCAGCCGCACTTGCTCCCGC	0.552																																					p.V73M													RHPN2,face,carcinoma,0,2	RHPN2	0	2	2	Substitution - Missense(2)	NS(1)|skin(1)	c.G217A												84.0	83.0	83.0					19																	33517507		2203	4300	6503	SO:0001583	missense	85415	exon3			GCCGCACTTGCTC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.217G>A	19.37:g.33517507C>T	ENSP00000254260:p.Val73Met		21	0.0476190476	1		22	0.14	3	NM_033103	61	0.00	0	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	37	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	18.08	3.542997	0.65198	.	.	ENSG00000131941	ENST00000254260	T	0.39787	1.06	3.88	3.88	0.44766	.	0.000000	0.85682	D	0.000000	T	0.64853	0.2636	M	0.79475	2.455	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.71984	-0.4427	10	0.87932	D	0	11.9954	16.025	0.80536	0.0:1.0:0.0:0.0	.	73	Q8IUC4	RHPN2_HUMAN	M	73	ENSP00000254260:V73M	ENSP00000254260:V73M	V	-	1	0	RHPN2	38209347	1.000000	0.71417	1.000000	0.80357	0.343000	0.28985	7.267000	0.78462	2.167000	0.68274	0.557000	0.71058	GTG			0.552	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450828.2		NM_033103	
LRP3	4037	mdanderson.org	37	19	33696583	33696583	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr19:33696583G>T	ENST00000253193.7	+	5	1109	c.907G>T	c.(907-909)Ggc>Tgc	p.G303C	CTD-2540B15.13_ENST00000609744.1_RNA	NM_002333.3	NP_002324.2	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein 3	303	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|pancreas(2)	15	Esophageal squamous(110;0.137)					ACTGCGGCTGGGCTATGACGA	0.692																																					p.G303C													.	.			0			c.G907T												16.0	23.0	21.0					19																	33696583		2190	4281	6471	SO:0001583	missense	4037	exon5			CGGCTGGGCTATG	AB009462	CCDS12430.1	19q13.11	2013-05-30			ENSG00000130881	ENSG00000130881		"""Low density lipoprotein receptors"""	6695	protein-coding gene	gene with protein product		603159				9693042, 7959795	Standard	NM_002333		Approved	LRP-3, hLRp105	uc010edh.3	O75074	OTTHUMG00000180343	ENST00000253193.7:c.907G>T	19.37:g.33696583G>T	ENSP00000253193:p.Gly303Cys		33	0	0		20	0.10	2	NM_002333	58	0.00	0	B3KQD6|B4DKF2	Missense_Mutation	SNP	ENST00000253193.7	37	CCDS12430.1	.	.	.	.	.	.	.	.	.	.	G	15.45	2.836578	0.50951	.	.	ENSG00000130881	ENST00000431491;ENST00000253193	T	0.35048	1.33	5.02	3.98	0.46160	CUB (5);	0.000000	0.85682	D	0.000000	T	0.49881	0.1583	L	0.42245	1.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.43686	-0.9376	10	0.41790	T	0.15	-22.2954	12.8081	0.57626	0.0801:0.0:0.9199:0.0	.	177;303;221	C9J8W0;O75074;B7ZAJ9	.;LRP3_HUMAN;.	C	177;303	ENSP00000253193:G303C	ENSP00000253193:G303C	G	+	1	0	LRP3	38388423	1.000000	0.71417	0.958000	0.39756	0.432000	0.31715	7.995000	0.88328	1.116000	0.41820	0.313000	0.20887	GGC			0.692	LRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450842.4			
SIGLEC9	27180	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	51628989	51628989	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr19:51628989C>T	ENST00000250360.3	+	2	624	c.557C>T	c.(556-558)tCc>tTc	p.S186F	SIGLEC9_ENST00000440804.3_Missense_Mutation_p.S186F	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	186	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		ACCTCCGTGTCCCCCCTGGAC	0.667																																					p.S186F													.	.			0			c.C557T												75.0	76.0	76.0					19																	51628989		2203	4300	6503	SO:0001583	missense	27180	exon2			CCGTGTCCCCCCT	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.557C>T	19.37:g.51628989C>T	ENSP00000250360:p.Ser186Phe		65	0	0		50	0.36	18	NM_001198558	2	0.00	0	Q6GTU4|Q9BYI9	Missense_Mutation	SNP	ENST00000250360.3	37	CCDS12825.1	.	.	.	.	.	.	.	.	.	.	.	8.403	0.842481	0.16963	.	.	ENSG00000129450	ENST00000440804;ENST00000250360	T;T	0.03272	3.99;3.99	2.88	1.79	0.24919	Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	1.109960	0.07038	N	0.829625	T	0.07863	0.0197	M	0.78456	2.415	0.09310	N	1	B	0.20671	0.047	B	0.23852	0.049	T	0.36114	-0.9761	10	0.62326	D	0.03	.	7.3941	0.26926	0.0:0.7274:0.2726:0.0	.	186	Q9Y336	SIGL9_HUMAN	F	186	ENSP00000413861:S186F;ENSP00000250360:S186F	ENSP00000250360:S186F	S	+	2	0	SIGLEC9	56320801	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.210000	0.09345	0.372000	0.24591	0.514000	0.50259	TCC			0.667	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464224.1		NM_014441	
MFSD2B	388931	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	24246462	24246462	+	Silent	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:24246462G>A	ENST00000406420.3	+	12	1195	c.1179G>A	c.(1177-1179)ctG>ctA	p.L393L	MFSD2B_ENST00000338315.4_Silent_p.L393L	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	393					transport (GO:0006810)	integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						GGTCCATGCTGCCAGACGTGG	0.607																																					p.L393L													.	.			0			c.G1179A												57.0	63.0	61.0					2																	24246462		2130	4230	6360	SO:0001819	synonymous_variant	388931	exon12			CATGCTGCCAGAC		CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.1179G>A	2.37:g.24246462G>A			105	0	0		212	0.08	18	NM_001080473	0		0	B5MC32	Silent	SNP	ENST00000406420.3	37	CCDS46228.1																																																																																					0.607	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000324307.1		NM_001080473	
EGR4	1961	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	73519001	73519001	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:73519001T>A	ENST00000545030.1	-	2	1428	c.1354A>T	c.(1354-1356)Acc>Tcc	p.T452S	EGR4_ENST00000436467.2_Missense_Mutation_p.T349S	NM_001965.3	NP_001956.3	Q05215	EGR4_HUMAN	early growth response 4	452	Pro-rich.				cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGGAAAGGGGTGGGCGGCGGC	0.736																																					p.T452S													.	.			0			c.A1354T												4.0	5.0	4.0					2																	73519001		1837	3805	5642	SO:0001583	missense	1961	exon2			AAGGGGTGGGCGG		CCDS1925.2	2p13	2013-01-08			ENSG00000135625	ENSG00000135625		"""Zinc fingers, C2H2-type"""	3241	protein-coding gene	gene with protein product		128992				1584812	Standard	NM_001965		Approved	NGFI-C, PAT133	uc010yrj.2	Q05215	OTTHUMG00000129774	ENST00000545030.1:c.1354A>T	2.37:g.73519001T>A	ENSP00000445626:p.Thr452Ser		23	0	0		14	0.57	8	NM_001965	0		0	B2RAE3|G3V1T5|Q2Z1P5	Missense_Mutation	SNP	ENST00000545030.1	37	CCDS1925.2	.	.	.	.	.	.	.	.	.	.	T	1.493	-0.554192	0.03996	.	.	ENSG00000135625	ENST00000545030;ENST00000436467	T;T	0.13307	2.6;2.94	4.56	0.284	0.15701	.	1.344230	0.05033	N	0.474979	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.33189	-0.9878	10	0.06236	T	0.91	-0.3501	0.8988	0.01269	0.3136:0.3463:0.1532:0.1869	.	349;452	Q05215;G3V1T5	EGR4_HUMAN;.	S	452;349	ENSP00000445626:T452S;ENSP00000419687:T349S	ENSP00000419687:T349S	T	-	1	0	EGR4	73372509	0.000000	0.05858	0.001000	0.08648	0.164000	0.22412	-1.384000	0.02542	0.138000	0.18790	-0.242000	0.12053	ACC			0.736	EGR4-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_001965	
GPAT2	150763	broad.mit.edu	37	2	96687429	96687429	+	IGR	DEL	C	C	-	rs199741104|rs386648371|rs59812668		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:96687429delC	ENST00000434632.1	-	0	3061				FAHD2CP_ENST00000607780.1_RNA			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial						CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						ACAGGCCCTGCACATAGGATG	0.582																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GCCCTGCACATAG	BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208		2.37:g.96687429delC			37	0.0540540541	2		19	0.53	10	.	1	0.00	0	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	RNA	DEL	ENST00000434632.1	37	CCDS42714.1																																																																																					0.582	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338786.1		NM_207328	
TMEM131	23505	mdanderson.org	37	2	98418952	98418952	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:98418952G>T	ENST00000186436.5	-	24	2818	c.2590C>A	c.(2590-2592)Cag>Aag	p.Q864K		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	864						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GGAATAAACTGAACATAGACA	0.318																																					p.Q864K													.	.			0			c.C2590A												111.0	107.0	108.0					2																	98418952		1823	4080	5903	SO:0001583	missense	23505	exon24			TAAACTGAACATA	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.2590C>A	2.37:g.98418952G>T	ENSP00000186436:p.Gln864Lys		177	0	0		119	0.04	5	NM_015348	41	0.00	0		Missense_Mutation	SNP	ENST00000186436.5	37	CCDS46368.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789073	0.90367	.	.	ENSG00000075568	ENST00000186436	T	0.38560	1.13	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.63271	0.2497	M	0.63843	1.955	0.80722	D	1	D	0.63880	0.993	D	0.67548	0.952	T	0.59451	-0.7452	10	0.45353	T	0.12	-11.4698	20.0566	0.97653	0.0:0.0:1.0:0.0	.	864	Q92545	TM131_HUMAN	K	864	ENSP00000186436:Q864K	ENSP00000186436:Q864K	Q	-	1	0	TMEM131	97785384	1.000000	0.71417	0.981000	0.43875	0.877000	0.50540	9.476000	0.97823	2.750000	0.94351	0.467000	0.42956	CAG			0.318	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000329285.2		XM_371542	
TANC1	85461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	159992709	159992709	+	Silent	SNP	C	C	G	rs375201296	byFrequency	TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:159992709C>G	ENST00000263635.6	+	5	501	c.264C>G	c.(262-264)ccC>ccG	p.P88P	TANC1_ENST00000454300.1_Silent_p.P88P	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	88					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.P88P(2)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CTACAGGTCCCGTCAGGAAGC	0.483																																					p.P88P													TANC1,NS,carcinoma,0,2	TANC1	0	2	2	Substitution - coding silent(2)	lung(2)	c.C264G												140.0	144.0	143.0					2																	159992709		1921	4127	6048	SO:0001819	synonymous_variant	85461	exon5			AGGTCCCGTCAGG	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.264C>G	2.37:g.159992709C>G			62	0	0		44	0.20	9	NM_033394	12	0.50	6	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	37	CCDS42766.1																																																																																					0.483	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333135.1			
IFIH1	64135	broad.mit.edu;mdanderson.org	37	2	163174366	163174366	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:163174366C>T	ENST00000263642.2	-	1	847	c.452G>A	c.(451-453)cGg>cAg	p.R151Q	GCA_ENST00000429691.2_5'Flank|IFIH1_ENST00000421365.2_Splice_Site_p.R151Q	NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	151	CARD 2.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GACACCTACCCGGTTTCTGTC	0.488																																					p.R151Q													.	IFIH1	102		0			c.G452A												270.0	301.0	290.0					2																	163174366		2203	4300	6503	SO:0001630	splice_region_variant	64135	exon1			CCTACCCGGTTTC	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.453+1G>A	2.37:g.163174366C>T			82	0	0		58	0.05	3	NM_022168	43	0.09	4	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Splice_Site	SNP	ENST00000263642.2	37	CCDS2217.1	.	.	.	.	.	.	.	.	.	.	C	12.90	2.076715	0.36662	.	.	ENSG00000115267	ENST00000263642;ENST00000543192;ENST00000421365	T;T	0.20881	2.04;2.04	5.26	3.43	0.39272	DEATH-like (2);Caspase Recruitment (1);	0.513127	0.19895	N	0.103648	T	0.34745	0.0908	L	0.57536	1.79	0.31081	N	0.71191	D;D	0.89917	1.0;0.996	D;P	0.74674	0.984;0.853	T	0.20538	-1.0272	10	0.19590	T	0.45	-11.0202	7.9507	0.30012	0.2867:0.6399:0.0:0.0734	.	151;151	Q9BYX4-2;Q9BYX4	.;IFIH1_HUMAN	Q	151	ENSP00000263642:R151Q;ENSP00000408450:R151Q	ENSP00000263642:R151Q	R	-	2	0	IFIH1	162882612	0.979000	0.34478	0.987000	0.45799	0.025000	0.11179	2.260000	0.43267	1.325000	0.45301	-0.169000	0.13324	CGG			0.488	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255078.2		NM_022168	Missense_Mutation
RAPH1	65059	broad.mit.edu	37	2	204312708	204312708	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:204312708G>T	ENST00000319170.5	-	12	1906	c.1607C>A	c.(1606-1608)tCg>tAg	p.S536*	RAPH1_ENST00000419464.1_Nonsense_Mutation_p.S536*|RAPH1_ENST00000308091.4_Nonsense_Mutation_p.S588*|RAPH1_ENST00000439222.1_Nonsense_Mutation_p.S561*|RAPH1_ENST00000423104.1_Nonsense_Mutation_p.S563*|RAPH1_ENST00000374493.3_Nonsense_Mutation_p.S588*|RAPH1_ENST00000453034.1_Nonsense_Mutation_p.S588*|RAPH1_ENST00000374488.2_Nonsense_Mutation_p.S561*|RAPH1_ENST00000418114.1_Nonsense_Mutation_p.S536*|RAPH1_ENST00000374489.2_Nonsense_Mutation_p.S563*|RAPH1_ENST00000457812.1_Nonsense_Mutation_p.S536*	NM_213589.1	NP_998754.1	Q70E73	RAPH1_HUMAN	Ras association (RalGDS/AF-6) and pleckstrin homology domains 1	536					axon extension (GO:0048675)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(5)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						ACTGGATCCCGATTTAATGCT	0.433																																					p.S588X													.	RAPH1	118		0			c.C1763A												109.0	98.0	102.0					2																	204312708		2203	4300	6503	SO:0001587	stop_gained	65059	exon14			GATCCCGATTTAA	AJ584699	CCDS2359.1, CCDS2360.1	2q33	2013-01-10	2003-11-25	2003-11-26	ENSG00000173166	ENSG00000173166		"""Pleckstrin homology (PH) domain containing"""	14436	protein-coding gene	gene with protein product	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 18"""	609035	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 9"""	ALS2CR9, ALS2CR18			Standard	NM_203365		Approved	KIAA1681	uc002vad.3	Q70E73	OTTHUMG00000132876	ENST00000319170.5:c.1607C>A	2.37:g.204312708G>T	ENSP00000316543:p.Ser536*		132	0	0		127	0.02	3	NM_203365	15	0.00	0	Q96Q37|Q9C0I2	Nonsense_Mutation	SNP	ENST00000319170.5	37	CCDS2359.1	.	.	.	.	.	.	.	.	.	.	G	36	5.930609	0.97116	.	.	ENSG00000173166	ENST00000457812;ENST00000319170;ENST00000374493;ENST00000374489;ENST00000374488;ENST00000308091;ENST00000439222;ENST00000419464;ENST00000423104;ENST00000453034;ENST00000432342;ENST00000418114;ENST00000413201	.	.	.	5.57	5.57	0.84162	.	0.000000	0.45606	D	0.000345	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.9901	19.542	0.95278	0.0:0.0:1.0:0.0	.	.	.	.	X	536;536;588;563;561;588;561;536;563;588;561;536;563	.	ENSP00000311293:S588X	S	-	2	0	RAPH1	204020953	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.807000	0.99171	2.628000	0.89032	0.650000	0.86243	TCG			0.433	RAPH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256363.2		NM_025252	
TRIP12	9320	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	230650472	230650472	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr2:230650472C>T	ENST00000283943.5	-	33	5048		c.e33+1		TRIP12_ENST00000389045.3_Splice_Site|TRIP12_ENST00000389044.4_Splice_Site	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TCCAAGCTCACCTCATTTTCA	0.453																																					.													.	.			0			c.4869+1G>A												116.0	116.0	116.0					2																	230650472		2203	4300	6503	SO:0001630	splice_region_variant	9320	exon34			AGCTCACCTCATT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4869+1G>A	2.37:g.230650472C>T			79	0	0		78	0.55	43	NM_004238	15	1.00	15	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	SNP	ENST00000283943.5	37	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367901	0.82463	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	.	.	.	5.66	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0404	0.80679	0.1346:0.8654:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRIP12	230358716	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.405000	0.80007	2.661000	0.90470	0.585000	0.79938	.			0.453	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000331861.3		NM_004238	Intron
FRG1B	284802	bcgsc.ca;mdanderson.org	37	20	29633902	29633902	+	Missense_Mutation	SNP	C	C	A	rs145072022		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr20:29633902C>A	ENST00000278882.3	+	9	921	c.541C>A	c.(541-543)Cca>Aca	p.P181T	FRG1B_ENST00000358464.4_Missense_Mutation_p.P181T			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	181								p.P181T(2)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						AACAAGAGAACCAAATTGAAA	0.274																																					.													.	FRG1B	181		2	Substitution - Missense(2)	endometrium(2)	.																																									SO:0001583	missense	284802	.			AGAGAACCAAATT			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.541C>A	20.37:g.29633902C>A	ENSP00000278882:p.Pro181Thr		265	0.0113207547	3		256	0.05	12	.	28	0.00	0	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	4.973	0.180670	0.09443	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	T	0.42063	0.1186	.	.	.	0.20074	N	0.999938	.	.	.	.	.	.	T	0.34527	-0.9825	5	0.52906	T	0.07	.	9.2539	0.37571	0.0:1.0:0.0:0.0	.	.	.	.	T	181	.	ENSP00000278882:P181T	P	+	1	0	FRG1B	28247563	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	3.567000	0.53813	1.206000	0.43276	0.502000	0.49764	CCA			0.274	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
RBM39	9584	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	20	34300982	34300982	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr20:34300982G>A	ENST00000253363.6	-	12	1156	c.1133C>T	c.(1132-1134)gCt>gTt	p.A378V	RBM39_ENST00000407261.4_Missense_Mutation_p.A221V|RBM39_ENST00000528062.3_Missense_Mutation_p.A356V|RBM39_ENST00000361162.6_Missense_Mutation_p.A378V			Q14498	RBM39_HUMAN	RNA binding motif protein 39	378	Interaction with ESR1 and ESR2. {ECO:0000250}.|Interaction with JUN. {ECO:0000250}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					CATCTGTAGAGCTTGCTGTGC	0.403																																					p.A378V													.	.			0			c.C1133T												63.0	60.0	61.0					20																	34300982		2203	4300	6503	SO:0001583	missense	9584	exon12			TGTAGAGCTTGCT	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1133C>T	20.37:g.34300982G>A	ENSP00000253363:p.Ala378Val		88	0	0		90	0.42	38	NM_184234	429	0.32	139	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Missense_Mutation	SNP	ENST00000253363.6	37	CCDS13266.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019919	0.75275	.	.	ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.71	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.50565	0.1623	L	0.56124	1.755	0.80722	D	1	P;P;P;P;P	0.51933	0.609;0.609;0.729;0.609;0.949	B;B;B;B;P	0.52189	0.235;0.235;0.413;0.298;0.692	T	0.51926	-0.8643	10	0.59425	D	0.04	.	15.0982	0.72253	0.0691:0.0:0.9309:0.0	.	356;356;378;378;354	B4DRA0;A2RRD3;Q14498-2;Q14498;B3KWX7	.;.;.;RBM39_HUMAN;.	V	378;378;356;221	ENSP00000253363:A378V;ENSP00000354437:A378V;ENSP00000436747:A356V;ENSP00000384541:A221V	ENSP00000253363:A378V	A	-	2	0	RBM39	33764396	1.000000	0.71417	0.997000	0.53966	0.909000	0.53808	9.756000	0.98918	2.706000	0.92434	0.650000	0.86243	GCT			0.403	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000078931.2		NM_184237	
TCFL5	10732	bcgsc.ca	37	20	61488884	61488884	+	Silent	SNP	T	T	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr20:61488884T>C	ENST00000335351.3	-	4	1193	c.1101A>G	c.(1099-1101)gaA>gaG	p.E367E	TCFL5_ENST00000217162.5_Silent_p.E319E	NM_006602.2	NP_006593.2	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 (basic helix-loop-helix)	367					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|urinary_tract(1)	9	Breast(26;5.68e-08)					CGGTGGCACCTTCGCCCACAT	0.577																																					p.E367E													.	TCFL5	43		0			c.A1101G												118.0	110.0	113.0					20																	61488884		2203	4300	6503	SO:0001819	synonymous_variant	10732	exon4			GGCACCTTCGCCC	AB012124	CCDS13506.1	20q13.33	2013-09-19			ENSG00000101190	ENSG00000101190		"""Basic helix-loop-helix proteins"""	11646	protein-coding gene	gene with protein product	"""HPV-16 E2 binding protein 1"""	604745				9763657	Standard	XM_005260185		Approved	Figlb, E2BP-1, CHA, bHLHe82	uc002ydp.3	Q9UL49	OTTHUMG00000032939	ENST00000335351.3:c.1101A>G	20.37:g.61488884T>C			174	0	0		169	0.04	6	NM_006602	72	0.00	0	O94771|Q9BYW0	Silent	SNP	ENST00000335351.3	37	CCDS13506.1																																																																																					0.577	TCFL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080079.2		NM_006602	
ZGPAT	84619	mdanderson.org	37	20	62364705	62364705	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr20:62364705G>T	ENST00000328969.5	+	3	845		c.e3+1		ZGPAT_ENST00000357119.4_Splice_Site|ZGPAT_ENST00000369967.3_Splice_Site|ZGPAT_ENST00000448100.2_Splice_Site|RP4-583P15.15_ENST00000490623.2_Splice_Site|ZGPAT_ENST00000478385.1_Splice_Site|ZGPAT_ENST00000355969.6_Splice_Site	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain						negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CGCATCACCGGTGAGGCTGGC	0.677																																					.													ZGPAT,NS,carcinoma,+1,1	ZGPAT	1	1	0			c.718+1G>T												19.0	21.0	20.0					20																	62364705		2203	4299	6502	SO:0001630	splice_region_variant	84619	exon3			TCACCGGTGAGGC	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.718+1G>T	20.37:g.62364705G>T			34	0	0		48	0.06	3	NM_001083113	3	0.00	0	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Splice_Site	SNP	ENST00000328969.5	37	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.158911	0.38119	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000369967;ENST00000328969	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6358	0.88122	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZGPAT	61835149	1.000000	0.71417	1.000000	0.80357	0.094000	0.18550	9.082000	0.94059	2.599000	0.87857	0.591000	0.81541	.			0.677	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000080214.1		NM_181484	Intron
ANKRD30BP2	149992	hgsc.bcm.edu	37	21	14417695	14417695	+	RNA	SNP	T	T	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr21:14417695T>C	ENST00000507941.1	+	0	307				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		attattaGATTATACAGAAAA	0.249																																					.													.	.			0			.																																											149992	.			TTAGATTATACAG	AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14417695T>C			101	0	0		131	0.19	25	.	0		0		RNA	SNP	ENST00000507941.1	37																																																																																						0.249	ANKRD30BP2-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000372094.1		NR_026916	
SAMSN1	64092	broad.mit.edu	37	21	15955849	15955850	+	5'Flank	INS	-	-	A	rs202144398		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr21:15955849_15955850insA	ENST00000285670.2	-	0	0				SAMSN1-AS1_ENST00000449214.1_RNA	NM_001256370.1	NP_001243299.1	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1						negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		AACTTGGCAATAAAAAAAAATC	0.391																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCAATAAAAAA	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317		21.37:g.15955858_15955858dupA	Exception_encountered		31	0	0		55	0.13	7	.	0		0	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	RNA	INS	ENST00000285670.2	37	CCDS58786.1																																																																																					0.391	SAMSN1-001	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000157913.1			
TMPRSS15	5651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	19666630	19666630	+	Missense_Mutation	SNP	C	C	T	rs202100185		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr21:19666630C>T	ENST00000284885.3	-	21	2476	c.2443G>A	c.(2443-2445)Gtc>Atc	p.V815I		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	815	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCACTGCTGACGAGAGATGCG	0.577													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12733	0.0		0.0	False		,,,				2504	0.0				p.V815I													.	.			0			c.G2443A												72.0	73.0	73.0					21																	19666630		2203	4300	6503	SO:0001583	missense	5651	exon21			TGCTGACGAGAGA		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2443G>A	21.37:g.19666630C>T	ENSP00000284885:p.Val815Ile		155	0	0		203	0.05	11	NM_002772	0		0	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	37	CCDS13571.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	2.326	-0.354521	0.05173	.	.	ENSG00000154646	ENST00000284885	D	0.87966	-2.32	5.79	1.46	0.22682	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.547259	0.18801	N	0.130786	T	0.62780	0.2456	N	0.01742	-0.745	0.22446	N	0.999094	P	0.36959	0.575	B	0.29598	0.104	T	0.58222	-0.7674	9	.	.	.	.	10.1431	0.42747	0.0:0.6753:0.0:0.3247	.	815	P98073	ENTK_HUMAN	I	815	ENSP00000284885:V815I	.	V	-	1	0	TMPRSS15	18588501	0.010000	0.17322	0.198000	0.23420	0.684000	0.39900	0.087000	0.14958	0.378000	0.24764	0.643000	0.83706	GTC	0.001		0.577	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000158231.2		NM_002772	
B3GALT5	10317	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	41032933	41032933	+	Silent	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr21:41032933G>A	ENST00000380620.4	+	5	1039	c.447G>A	c.(445-447)gcG>gcA	p.A149A	B3GALT5_ENST00000343118.4_Silent_p.A149A|B3GALT5_ENST00000380618.1_Silent_p.A149A|AF064860.5_ENST00000416555.1_RNA|B3GALT5_ENST00000398714.2_Silent_p.A149A			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5	149					protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				GTCCTCAGGCGGCGTTTGTGA	0.443																																					p.A149A													.	B3GALT5	40		0			c.G447A												101.0	96.0	98.0					21																	41032933		2203	4300	6503	SO:0001819	synonymous_variant	10317	exon3			TCAGGCGGCGTTT	AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.447G>A	21.37:g.41032933G>A			158	0	0		205	0.04	8	NM_033170	7	0.29	2	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	Silent	SNP	ENST00000380620.4	37	CCDS13667.1																																																																																					0.443	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195008.2	rescued with RNA-seq	NM_033170	
MN1	4330	hgsc.bcm.edu	37	22	28193690	28193690	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr22:28193690T>C	ENST00000302326.4	-	1	3796	c.2842A>G	c.(2842-2844)Agg>Ggg	p.R948G		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	948					intramembranous ossification (GO:0001957)					NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						CCACTGTCCCTTTTTCTGCGA	0.687			T	ETV6	"""AML, meningioma"""																																p.R948G				Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	.	.			0			c.A2842G												10.0	13.0	12.0					22																	28193690		1962	4119	6081	SO:0001583	missense	4330	exon1			TGTCCCTTTTTCT	X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.2842A>G	22.37:g.28193690T>C	ENSP00000304956:p.Arg948Gly		101	0	0		73	0.05	4	NM_002430	16	0.00	0	A9Z1V9	Missense_Mutation	SNP	ENST00000302326.4	37	CCDS42998.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.840050	0.51057	.	.	ENSG00000169184	ENST00000302326	T	0.62105	0.05	4.1	1.86	0.25419	.	0.000000	0.85682	D	0.000000	T	0.62048	0.2396	L	0.29908	0.895	0.40102	D	0.976383	D	0.76494	0.999	D	0.80764	0.994	T	0.55623	-0.8112	10	0.10636	T	0.68	-14.1178	10.6799	0.45809	0.0:0.0:0.4935:0.5065	.	948	Q10571	MN1_HUMAN	G	948	ENSP00000304956:R948G	ENSP00000304956:R948G	R	-	1	2	MN1	26523690	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.826000	0.39092	0.135000	0.18707	0.379000	0.24179	AGG			0.687	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320737.1		NM_002430	
TTC28	23331	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	22	28559107	28559108	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	CA	CA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr22:28559107_28559108CA>TG	ENST00000397906.2	-	6	1554_1555	c.1413_1414TG>CA	c.(1411-1416)gcTGca>gcCAca	p.A472T		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	472					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CGCCCCTCTGCAGCCCGGTCCT	0.53																																					p.A472T													.	.			0			c.T1413C																																									SO:0001583	missense	23331	exon6			CCTCTGCAGCCCG	AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.1413_1414delinsTG	22.37:g.28559107_28559108delinsTG	ENSP00000381003:p.Ala472Thr		81	0	0		58	0.48	28	NM_001145418	3	0.00	0	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	DNP	ENST00000397906.2	37	CCDS46678.1																																																																																					0.530	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000320930.2		XM_929318	
CELSR1	9620	mdanderson.org	37	22	46832126	46832126	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr22:46832126G>T	ENST00000262738.3	-	4	4466	c.4467C>A	c.(4465-4467)caC>caA	p.H1489Q		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1489	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGATGAAGTCGTGCTTCTCAT	0.577																																					p.H1489Q													.	.			0			c.C4467A												107.0	86.0	93.0					22																	46832126		2203	4300	6503	SO:0001583	missense	9620	exon4			GAAGTCGTGCTTC	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.4467C>A	22.37:g.46832126G>T	ENSP00000262738:p.His1489Gln		65	0	0		51	0.06	3	NM_014246	28	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459841	0.63401	.	.	ENSG00000075275	ENST00000262738	T	0.78816	-1.21	4.73	0.196	0.15159	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.074272	0.52532	U	0.000066	T	0.80747	0.4682	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.78267	-0.2270	10	0.72032	D	0.01	.	8.7315	0.34503	0.4171:0.0:0.5829:0.0	.	1489	Q9NYQ6	CELR1_HUMAN	Q	1489	ENSP00000262738:H1489Q	ENSP00000262738:H1489Q	H	-	3	2	CELSR1	45210790	0.052000	0.20516	1.000000	0.80357	0.958000	0.62258	-0.604000	0.05667	0.162000	0.19483	0.555000	0.69702	CAC			0.577	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
EFHB	151651	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	19975292	19975292	+	Silent	SNP	T	T	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr3:19975292T>A	ENST00000295824.9	-	1	380	c.219A>T	c.(217-219)ggA>ggT	p.G73G	EFHB_ENST00000344838.4_Intron|EFHB_ENST00000498089.1_5'UTR	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	73							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						GTCTTTCTAATCCCATTTCAA	0.473																																					p.G73G													.	.			0			c.A219T												120.0	117.0	118.0					3																	19975292		1922	4138	6060	SO:0001819	synonymous_variant	151651	exon1			TTCTAATCCCATT	AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.219A>T	3.37:g.19975292T>A			314	0	0		373	0.08	29	NM_144715	4	0.00	0	A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Silent	SNP	ENST00000295824.9	37	CCDS33715.2																																																																																					0.473	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318673.2		NM_144715	
WNT5A	7474	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	55504144	55504144	+	Silent	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr3:55504144G>A	ENST00000474267.1	-	6	1640	c.1119C>T	c.(1117-1119)atC>atT	p.I373I	WNT5A_ENST00000497027.1_Silent_p.I358I|WNT5A_ENST00000493406.1_5'UTR|WNT5A_ENST00000264634.4_Silent_p.I373I			P41221	WNT5A_HUMAN	wingless-type MMTV integration site family, member 5A	373					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|ameboidal cell migration (GO:0001667)|anterior/posterior axis specification, embryo (GO:0008595)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular protein localization (GO:0034613)|cellular response to calcium ion (GO:0071277)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cervix development (GO:0060067)|cochlea morphogenesis (GO:0090103)|convergent extension involved in organogenesis (GO:0060029)|dopaminergic neuron differentiation (GO:0071542)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system development (GO:0048706)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity (GO:0001736)|face development (GO:0060324)|genitalia development (GO:0048806)|heart looping (GO:0001947)|hematopoietic stem cell proliferation (GO:0071425)|hindgut morphogenesis (GO:0007442)|hypophysis morphogenesis (GO:0048850)|keratinocyte differentiation (GO:0030216)|lateral sprouting involved in mammary gland duct morphogenesis (GO:0060599)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|male gonad development (GO:0008584)|mammary gland branching involved in thelarche (GO:0060744)|mesenchymal-epithelial cell signaling (GO:0060638)|midgut development (GO:0007494)|negative chemotaxis (GO:0050919)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of mesenchymal cell proliferation (GO:0072201)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of synapse assembly (GO:0051964)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|olfactory bulb interneuron development (GO:0021891)|optic cup formation involved in camera-type eye development (GO:0003408)|palate development (GO:0060021)|planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:0061350)|planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:0061349)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar cell polarity pathway involved in outflow tract morphogenesis (GO:0061347)|planar cell polarity pathway involved in pericardium morphogenesis (GO:0061354)|planar cell polarity pathway involved in ventricular septum morphogenesis (GO:0061348)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cartilage development (GO:0061036)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of cytokine secretion involved in immune response (GO:0002741)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of meiosis (GO:0045836)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of ossification (GO:0045778)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of response to cytokine stimulus (GO:0060760)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|protein phosphorylation (GO:0006468)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|response to organic substance (GO:0010033)|somitogenesis (GO:0001756)|type B pancreatic cell development (GO:0003323)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vagina development (GO:0060068)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|wound healing (GO:0042060)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|receptor tyrosine kinase-like orphan receptor binding (GO:0005115)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(1)|large_intestine(4)|lung(3)|prostate(2)|urinary_tract(1)	13				KIRC - Kidney renal clear cell carcinoma(284;0.00377)|Kidney(284;0.00408)|OV - Ovarian serous cystadenocarcinoma(275;0.204)		ACTGGTCCACGATCTCCGTGC	0.562																																					p.I373I													WNT5A,NS,carcinoma,0,1	WNT5A	0	1	0			c.C1119T												77.0	79.0	78.0					3																	55504144		2203	4300	6503	SO:0001819	synonymous_variant	7474	exon5			GTCCACGATCTCC	L20861	CCDS46850.1, CCDS58835.1	3p21-p14	2013-02-28			ENSG00000114251	ENSG00000114251		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12784	protein-coding gene	gene with protein product	"""WNT-5A protein"""	164975				8288227	Standard	NM_001256105		Approved	hWNT5A	uc010hmw.4	P41221	OTTHUMG00000158361	ENST00000474267.1:c.1119C>T	3.37:g.55504144G>A			135	0	0		150	0.13	19	NM_003392	22	0.18	4	A8K4A4|Q6P278	Silent	SNP	ENST00000474267.1	37	CCDS46850.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.275958	0.23307	.	.	ENSG00000114251	ENST00000442038	.	.	.	5.68	-2.05	0.07321	.	.	.	.	.	T	0.59142	0.2172	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60276	-0.7295	5	0.87932	D	0	.	6.8217	0.23861	0.4519:0.0:0.4389:0.1092	.	.	.	.	C	106	.	ENSP00000395272:R106C	R	-	1	0	WNT5A	55479184	0.813000	0.29090	0.984000	0.44739	0.989000	0.77384	-0.124000	0.10595	-0.385000	0.07833	0.561000	0.74099	CGT			0.562	WNT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350793.3		NM_003392	
FLNB	2317	broad.mit.edu	37	3	58098020	58098020	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr3:58098020C>T	ENST00000295956.4	+	18	2885	c.2720C>T	c.(2719-2721)aCg>aTg	p.T907M	FLNB_ENST00000419752.2_Missense_Mutation_p.T738M|FLNB_ENST00000429972.2_Missense_Mutation_p.T907M|FLNB_ENST00000490882.1_Missense_Mutation_p.T907M|FLNB_ENST00000493452.1_Missense_Mutation_p.T738M|FLNB_ENST00000358537.3_Missense_Mutation_p.T907M|FLNB_ENST00000348383.5_Missense_Mutation_p.T907M|FLNB_ENST00000357272.4_Missense_Mutation_p.T907M	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	907					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TACTCTCACACGGTTAAATAT	0.557																																					p.T907M													.	FLNB	430		0			c.C2720T												97.0	94.0	95.0					3																	58098020		2203	4300	6503	SO:0001583	missense	2317	exon18			CTCACACGGTTAA	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.2720C>T	3.37:g.58098020C>T	ENSP00000295956:p.Thr907Met		144	0	0		168	0.02	4	NM_001457	84	0.04	3	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	37	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.925015	0.92319	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06;-2.06	5.54	5.54	0.83059	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94118	0.8114	M	0.90082	3.085	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;1.0;0.993;1.0;1.0	D	0.94828	0.7993	10	0.87932	D	0	.	19.4806	0.95008	0.0:1.0:0.0:0.0	.	907;907;738;738;907;907	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	M	907;907;907;907;907;907;738;738	ENSP00000295956:T907M;ENSP00000420213:T907M;ENSP00000351339:T907M;ENSP00000415599:T907M;ENSP00000232447:T907M;ENSP00000349819:T907M;ENSP00000418510:T738M;ENSP00000414532:T738M	ENSP00000295956:T907M	T	+	2	0	FLNB	58073060	1.000000	0.71417	0.971000	0.41717	0.946000	0.59487	7.815000	0.86186	2.622000	0.88805	0.650000	0.86243	ACG			0.557	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000353569.1		NM_001457	
EPHA3	2042	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	89480495	89480495	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr3:89480495G>C	ENST00000336596.2	+	13	2557	c.2332G>C	c.(2332-2334)Gct>Cct	p.A778P	EPHA3_ENST00000494014.1_Missense_Mutation_p.A778P	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	778	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CCCAGAAGCTGCTTATACAAC	0.403										TSP Lung(6;0.00050)																											p.A778P													.	.			0			c.G2332C												102.0	97.0	99.0					3																	89480495		2203	4300	6503	SO:0001583	missense	2042	exon13			GAAGCTGCTTATA	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2332G>C	3.37:g.89480495G>C	ENSP00000337451:p.Ala778Pro		163	0	0		116	0.47	54	NM_005233	51	0.53	27	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	37	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552970	0.86127	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.73575	-0.75;-0.76	5.33	5.33	0.75918	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.81380	0.4810	L	0.37850	1.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79092	-0.1945	9	.	.	.	.	19.3726	0.94495	0.0:0.0:1.0:0.0	.	778	P29320	EPHA3_HUMAN	P	778	ENSP00000337451:A778P;ENSP00000419190:A778P	.	A	+	1	0	EPHA3	89563185	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	9.813000	0.99286	2.648000	0.89879	0.585000	0.79938	GCT			0.403	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352995.1		NM_005233	
ABTB1	80325	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	127395400	127395400	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr3:127395400G>A	ENST00000232744.8	+	6	588	c.502G>A	c.(502-504)Gcc>Acc	p.A168T	ABTB1_ENST00000453791.2_Missense_Mutation_p.A26T|ABTB1_ENST00000393363.3_Missense_Mutation_p.A26T|ABTB1_ENST00000468137.1_Missense_Mutation_p.A26T					ankyrin repeat and BTB (POZ) domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	10						GGCCTTTGGGGCCCTGCTGCA	0.597																																					p.A168T													.	.			0			c.G502A												126.0	118.0	121.0					3																	127395400		2203	4300	6503	SO:0001583	missense	80325	exon6			TTTGGGGCCCTGC	AB053324	CCDS3045.1, CCDS46901.1	3q21	2013-01-10			ENSG00000114626	ENSG00000114626		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	18275	protein-coding gene	gene with protein product		608308				10891360, 11494141	Standard	NM_172027		Approved	BPOZ, EF1ABP, Btb3, BTBD21	uc003ejt.3	Q969K4	OTTHUMG00000159636	ENST00000232744.8:c.502G>A	3.37:g.127395400G>A	ENSP00000232744:p.Ala168Thr		118	0	0		144	0.06	9	NM_172027	40	0.05	2		Missense_Mutation	SNP	ENST00000232744.8	37	CCDS3045.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632410	0.67015	.	.	ENSG00000114626	ENST00000393363;ENST00000232744;ENST00000453791;ENST00000468137	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	4.49	3.51	0.40186	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.181735	0.49305	D	0.000151	T	0.64114	0.2569	M	0.61703	1.905	0.44337	D	0.997221	P;P	0.50443	0.935;0.887	P;P	0.48368	0.575;0.544	T	0.61623	-0.7025	10	0.10111	T	0.7	-11.0735	11.2686	0.49124	0.0:0.0:0.6667:0.3332	.	168;143	Q969K4;Q969K4-3	ABTB1_HUMAN;.	T	26;168;26;26	ENSP00000377030:A26T;ENSP00000232744:A168T;ENSP00000412684:A26T;ENSP00000417366:A26T	ENSP00000232744:A168T	A	+	1	0	ABTB1	128878090	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.332000	0.59279	2.050000	0.60909	0.491000	0.48974	GCC			0.597	ABTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356595.1		NM_172027	
SLC30A9	10463	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	41992712	41992712	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr4:41992712G>C	ENST00000264451.7	+	1	224	c.44G>C	c.(43-45)tGg>tCg	p.W15S	RP11-814H16.2_ENST00000608029.1_lincRNA	NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	15					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGATGTAGCTGGTCCTCCCTG	0.716																																					p.W15S													.	.			0			c.G44C												21.0	21.0	21.0					4																	41992712		2191	4289	6480	SO:0001583	missense	10463	exon1			GTAGCTGGTCCTC	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.44G>C	4.37:g.41992712G>C	ENSP00000264451:p.Trp15Ser		80	0	0		67	0.49	33	NM_006345	40	0.63	25	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	ENST00000264451.7	37	CCDS3465.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571384	0.28003	.	.	ENSG00000014824	ENST00000264451	T	0.29917	1.55	4.67	4.67	0.58626	.	0.063086	0.64402	D	0.000002	T	0.28034	0.0691	L	0.46157	1.445	0.58432	D	0.999997	B	0.30482	0.281	B	0.27170	0.077	T	0.13282	-1.0515	10	0.87932	D	0	-0.0274	12.9446	0.58365	0.0:0.0:1.0:0.0	.	15	Q6PML9	ZNT9_HUMAN	S	15	ENSP00000264451:W15S	ENSP00000264451:W15S	W	+	2	0	SLC30A9	41687469	1.000000	0.71417	0.995000	0.50966	0.018000	0.09664	3.866000	0.56040	2.428000	0.82296	0.561000	0.74099	TGG			0.716	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216842.3			
LIN54	132660	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	83867529	83867529	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr4:83867529C>A	ENST00000340417.3	-	5	1427	c.1050G>T	c.(1048-1050)caG>caT	p.Q350H	LIN54_ENST00000395282.2_3'UTR|snoR442_ENST00000517025.1_RNA|Y_RNA_ENST00000362660.1_RNA|LIN54_ENST00000510557.1_Missense_Mutation_p.Q129H|LIN54_ENST00000442461.2_Missense_Mutation_p.Q129H|LIN54_ENST00000505397.1_Missense_Mutation_p.Q350H|LIN54_ENST00000506560.1_Missense_Mutation_p.Q261H|LIN54_ENST00000395283.2_Missense_Mutation_p.Q261H|LIN54_ENST00000446851.2_Missense_Mutation_p.Q129H	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	350					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				GCACTTGAATCTGCTGGACAT	0.468																																					p.Q350H													.	LIN54	50		0			c.G1050T												198.0	178.0	185.0					4																	83867529		2203	4300	6503	SO:0001583	missense	132660	exon5			TTGAATCTGCTGG	BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.1050G>T	4.37:g.83867529C>A	ENSP00000341947:p.Gln350His		197	0	0		170	0.05	8	NM_194282	15	0.00	0	Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	ENST00000340417.3	37	CCDS3599.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362299	0.82353	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000442461;ENST00000446851;ENST00000510557;ENST00000506560;ENST00000505397	.	.	.	6.01	5.17	0.71159	.	0.057598	0.64402	D	0.000001	T	0.67011	0.2848	L	0.29908	0.895	0.80722	D	1	D;D;D	0.71674	0.998;0.99;0.995	D;D;D	0.72982	0.935;0.979;0.936	T	0.71474	-0.4582	9	0.72032	D	0.01	-2.4211	17.5339	0.87822	0.0:0.8764:0.1236:0.0	.	261;222;350	Q6MZP7-2;Q7Z3G2;Q6MZP7	.;.;LIN54_HUMAN	H	350;261;129;129;129;261;350	.	ENSP00000341947:Q350H	Q	-	3	2	LIN54	84086553	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.361000	0.44160	1.531000	0.49152	0.655000	0.94253	CAG			0.468	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252626.2		NM_194282	
TENM3	55714	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	183600887	183600887	+	Silent	SNP	G	G	A	rs553919743		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr4:183600887G>A	ENST00000511685.1	+	8	1518	c.1395G>A	c.(1393-1395)acG>acA	p.T465T	TENM3_ENST00000406950.2_Silent_p.T465T			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	465					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGCTTGAGACGGAGAGAGCCG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		14860	0.0		0.001	False		,,,				2504	0.0				p.T465T													.	.			0			c.G1395A												52.0	57.0	56.0					4																	183600887		1896	4103	5999	SO:0001819	synonymous_variant	55714	exon7			TGAGACGGAGAGA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.1395G>A	4.37:g.183600887G>A			151	0.0066225166	1		113	0.11	12	NM_001080477	12	0.00	0	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	37	CCDS47165.1																																																																																					0.547	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361734.1			
ADAMTS2	9509	mdanderson.org	37	5	178564853	178564853	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr5:178564853C>T	ENST00000251582.7	-	12	1969	c.1868G>A	c.(1867-1869)cGc>cAc	p.R623H		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	623	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CTGCTCCTCGCGGAAGTCAGC	0.701																																					p.R623H													.	.			0			c.G1868A												16.0	17.0	17.0					5																	178564853		2174	4283	6457	SO:0001583	missense	9509	exon12			TCCTCGCGGAAGT	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1868G>A	5.37:g.178564853C>T	ENSP00000251582:p.Arg623His		40	0	0		40	0.08	3	NM_014244	17	0.00	0		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	C	35	5.541267	0.96474	.	.	ENSG00000087116	ENST00000251582	T	0.68181	-0.31	5.62	5.62	0.85841	.	0.000000	0.49916	D	0.000133	D	0.89619	0.6767	H	0.98446	4.235	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93099	0.6507	10	0.87932	D	0	.	19.0118	0.92875	0.0:1.0:0.0:0.0	.	623	O95450	ATS2_HUMAN	H	623	ENSP00000251582:R623H	ENSP00000251582:R623H	R	-	2	0	ADAMTS2	178497459	1.000000	0.71417	0.972000	0.41901	0.946000	0.59487	7.338000	0.79269	2.813000	0.96785	0.561000	0.74099	CGC			0.701	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253507.1		NM_014244	
HIVEP1	3096	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	12125357	12125357	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr6:12125357G>A	ENST00000379388.2	+	4	5661	c.5329G>A	c.(5329-5331)Gtg>Atg	p.V1777M	HIVEP1_ENST00000541134.1_5'Flank	NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	1777					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TGCAACAGACGTGAGACCTTT	0.448																																					p.V1777M													.	.			0			c.G5329A												117.0	115.0	115.0					6																	12125357		1877	4108	5985	SO:0001583	missense	3096	exon4			ACAGACGTGAGAC	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.5329G>A	6.37:g.12125357G>A	ENSP00000368698:p.Val1777Met		160	0	0		155	0.10	16	NM_002114	17	0.12	2	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	4.801	0.149000	0.09185	.	.	ENSG00000095951	ENST00000379388	T	0.10005	2.92	5.62	-1.74	0.08056	.	1.406770	0.05631	N	0.581813	T	0.02688	0.0081	L	0.39898	1.24	0.09310	N	1	P	0.48998	0.918	B	0.39738	0.308	T	0.38265	-0.9669	9	.	.	.	0.246	5.0391	0.14449	0.4278:0.0:0.3509:0.2213	.	1777	P15822	ZEP1_HUMAN	M	1777	ENSP00000368698:V1777M	.	V	+	1	0	HIVEP1	12233343	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	0.308000	0.19314	-0.318000	0.08665	-0.150000	0.13652	GTG			0.448	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039870.2		NM_002114	
LY6G5B	58496	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	31639021	31639021	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr6:31639021C>G	ENST00000375864.4	+	2	931	c.147C>G	c.(145-147)atC>atG	p.I49M	LY6G5B_ENST00000409525.1_5'UTR|CSNK2B-LY6G5B-1181_ENST00000375880.2_Missense_Mutation_p.Q216E	NM_021221.2	NP_067044.2	Q8NDX9	LY65B_HUMAN	lymphocyte antigen 6 complex, locus G5B	49	UPAR/Ly6.					extracellular region (GO:0005576)				lung(4)	4						AGTGTACCATCAGCAGCTCAT	0.547																																					p.I49M													.	.			0			c.C147G												242.0	236.0	238.0					6																	31639021		1510	2709	4219	SO:0001583	missense	58496	exon2			TACCATCAGCAGC	AF129756	CCDS34400.1	6p21.3	2008-08-01	2002-07-29	2002-08-01	ENSG00000240053	ENSG00000240053			13931	protein-coding gene	gene with protein product		610433	"""chromosome 6 open reading frame 19"""	C6orf19		8812450, 12079290, 17008713	Standard	NM_021221		Approved	G5b		Q8NDX9	OTTHUMG00000031227	ENST00000375864.4:c.147C>G	6.37:g.31639021C>G	ENSP00000365024:p.Ile49Met		215	0	0		182	0.05	9	NM_021221	11	0.09	1	B0UXB2|B0UZ65|B0UZP8|B7ZCA3|Q5SQ62|Q5SST3|Q9UKT0|Q9UMQ0	Missense_Mutation	SNP	ENST00000375864.4	37	CCDS34400.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.26|15.26	2.779485|2.779485	0.49891|0.49891	.|.	.|.	ENSG00000240053|ENSG00000204435	ENST00000409691;ENST00000375864|ENST00000375880	T|.	0.26373|.	1.74|.	4.44|4.44	-2.25|-2.25	0.06888|0.06888	.|.	.|.	.|.	.|.	.|.	T|T	0.09555|0.09555	0.0235|0.0235	L|L	0.29908|0.29908	0.895|0.895	.|.	.|.	.|.	D|B	0.71674|0.13145	0.998|0.007	D|B	0.70935|0.12156	0.971|0.007	T|T	0.25293|0.25293	-1.0136|-1.0136	8|7	0.62326|0.36615	D|T	0.03|0.2	-4.4321|-4.4321	3.1402|3.1402	0.06453|0.06453	0.3027:0.3267:0.0:0.3705|0.3027:0.3267:0.0:0.3705	.|.	49|216	Q8NDX9|Q5SRQ3	LY65B_HUMAN|.	M|E	46;49|216	ENSP00000365024:I49M|.	ENSP00000365024:I49M|ENSP00000365040:Q216E	I|Q	+|+	3|1	3|0	LY6G5B|CSNK2B	31747000|31747000	0.000000|0.000000	0.05858|0.05858	0.037000|0.037000	0.18230|0.18230	0.972000|0.972000	0.66771|0.66771	-0.320000|-0.320000	0.08028|0.08028	-0.251000|-0.251000	0.09542|0.09542	-0.291000|-0.291000	0.09656|0.09656	ATC|CAG			0.547	LY6G5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000124389.4			
FRS3	10817	mdanderson.org	37	6	41739127	41739127	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr6:41739127G>T	ENST00000373018.3	-	7	960	c.709C>A	c.(709-711)Cca>Aca	p.P237T	FRS3_ENST00000259748.2_Missense_Mutation_p.P237T	NM_006653.3	NP_006644.1	O43559	FRS3_HUMAN	fibroblast growth factor receptor substrate 3	237					fibroblast growth factor receptor signaling pathway (GO:0008543)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			ACCTGGCCTGGCTGCAAGAAC	0.682																																					p.P237T													.	.			0			c.C709A												47.0	52.0	50.0					6																	41739127		2203	4300	6503	SO:0001583	missense	10817	exon7			GGCCTGGCTGCAA	AF036718	CCDS4860.1	6p21.1	2010-08-05			ENSG00000137218	ENSG00000137218			16970	protein-coding gene	gene with protein product		607744				8761293, 9660748	Standard	NM_006653		Approved	SNT-2, FRS2beta, FRS2B	uc003orc.1	O43559	OTTHUMG00000014686	ENST00000373018.3:c.709C>A	6.37:g.41739127G>T	ENSP00000362109:p.Pro237Thr		54	0	0		47	0.06	3	NM_006653	9	0.00	0	Q5T3D5	Missense_Mutation	SNP	ENST00000373018.3	37	CCDS4860.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862399	0.51482	.	.	ENSG00000137218	ENST00000373018;ENST00000259748	T;T	0.31510	1.49;1.49	5.58	5.58	0.84498	.	0.105917	0.64402	D	0.000003	T	0.28732	0.0712	M	0.68593	2.085	0.58432	D	0.999995	P	0.48503	0.911	B	0.42282	0.382	T	0.20874	-1.0262	10	0.72032	D	0.01	-27.5126	19.175	0.93600	0.0:0.0:1.0:0.0	.	237	O43559	FRS3_HUMAN	T	237	ENSP00000362109:P237T;ENSP00000259748:P237T	ENSP00000259748:P237T	P	-	1	0	FRS3	41847105	1.000000	0.71417	0.999000	0.59377	0.510000	0.34073	7.611000	0.82962	2.642000	0.89623	0.655000	0.94253	CCA			0.682	FRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040532.2		NM_006653	
TDRD6	221400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	46659709	46659709	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr6:46659709G>A	ENST00000316081.6	+	1	3844	c.3844G>A	c.(3844-3846)Gga>Aga	p.G1282R	TDRD6_ENST00000544460.1_Missense_Mutation_p.G1282R	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1282					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			GAGAAAAATAGGAGATTCATG	0.343																																					p.G1282R													.	.			0			c.G3844A												41.0	47.0	45.0					6																	46659709		2201	4297	6498	SO:0001583	missense	221400	exon1			AAAATAGGAGATT	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.3844G>A	6.37:g.46659709G>A	ENSP00000346065:p.Gly1282Arg		227	0	0		172	0.19	32	NM_001168359	0		0	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	37	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	G	6.103	0.387186	0.11581	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.14640	2.49;2.49	4.57	3.7	0.42460	.	0.748754	0.12975	N	0.423745	T	0.02610	0.0079	N	0.16478	0.41	0.27191	N	0.960416	B;B	0.18461	0.028;0.008	B;B	0.14023	0.01;0.003	T	0.41034	-0.9531	10	0.13853	T	0.58	-1.6654	12.0314	0.53399	0.0817:0.0:0.9183:0.0	.	1282;1282	F5H5M3;O60522	.;TDRD6_HUMAN	R	1282	ENSP00000443299:G1282R;ENSP00000346065:G1282R	ENSP00000346065:G1282R	G	+	1	0	TDRD6	46767668	0.091000	0.21658	0.521000	0.27850	0.873000	0.50193	1.520000	0.35899	1.530000	0.49136	0.655000	0.94253	GGA			0.343	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000040800.1		XM_166443	
AP5Z1	9907	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	4830438	4830438	+	Silent	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:4830438C>T	ENST00000348624.4	+	16	2167	c.2073C>T	c.(2071-2073)ccC>ccT	p.P691P	AP5Z1_ENST00000490487.1_Intron|MIR4656_ENST00000579503.1_RNA	NM_014855.2	NP_055670.1	O43299	AP5Z1_HUMAN	adaptor-related protein complex 5, zeta 1 subunit	691					cell death (GO:0008219)|double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-5 adaptor complex (GO:0044599)|AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|nucleus (GO:0005634)											CTGCCCTGCCCAGGTGTCCCC	0.642																																					p.P691P													.	.			0			c.C2073T												30.0	35.0	33.0					7																	4830438		2031	4176	6207	SO:0001819	synonymous_variant	9907	exon16			CCTGCCCAGGTGT	AB007875	CCDS47528.1	7p22.1	2012-03-20	2012-03-20	2012-03-20	ENSG00000242802	ENSG00000242802			22197	protein-coding gene	gene with protein product		613653	"""KIAA0415"""	KIAA0415		20613862, 22022230	Standard	NM_014855		Approved	SPG48, zeta	uc003sne.3	O43299	OTTHUMG00000151754	ENST00000348624.4:c.2073C>T	7.37:g.4830438C>T			36	0	0		56	0.21	12	NM_014855	117	0.21	25	Q8N3X2|Q96H80	Silent	SNP	ENST00000348624.4	37	CCDS47528.1																																																																																					0.642	AP5Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323771.1			
NUDCD3	23386	mdanderson.org	37	7	44530025	44530025	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:44530025G>T	ENST00000355451.7	-	1	454	c.175C>A	c.(175-177)Cag>Aag	p.Q59K		NM_015332.3	NP_056147.2	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3	59										endometrium(2)|large_intestine(1)|lung(3)|skin(1)	7						ACCAAGGCCTGCGCGGCCCCG	0.706																																					p.Q59K													.	.			0			c.C175A												10.0	14.0	13.0					7																	44530025		1852	4080	5932	SO:0001583	missense	23386	exon1			AGGCCTGCGCGGC	BC003691	CCDS5490.2	7p13-p12	2005-03-18			ENSG00000015676	ENSG00000015676			22208	protein-coding gene	gene with protein product		610296					Standard	NM_015332		Approved	KIAA1068	uc003tkz.3	Q8IVD9	OTTHUMG00000129174	ENST00000355451.7:c.175C>A	7.37:g.44530025G>T	ENSP00000347626:p.Gln59Lys		19	0	0		28	0.11	3	NM_015332	149	0.00	0	Q9BTI3|Q9H7W9|Q9UPT4	Missense_Mutation	SNP	ENST00000355451.7	37	CCDS5490.2	.	.	.	.	.	.	.	.	.	.	g	15.31	2.796196	0.50208	.	.	ENSG00000015676	ENST00000355451	T	0.52754	0.65	4.16	4.16	0.48862	.	0.065673	0.64402	D	0.000010	T	0.27454	0.0674	N	0.03194	-0.395	0.39829	D	0.972943	P	0.42757	0.789	B	0.44224	0.444	T	0.12066	-1.0562	10	0.16420	T	0.52	-5.0596	13.6244	0.62155	0.0:0.0:1.0:0.0	.	59	Q8IVD9	NUDC3_HUMAN	K	59	ENSP00000347626:Q59K	ENSP00000347626:Q59K	Q	-	1	0	NUDCD3	44496550	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	4.685000	0.61693	2.287000	0.76781	0.558000	0.71614	CAG			0.706	NUDCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251248.3		NM_015332	
SPDYE18	100505767	broad.mit.edu	37	7	76684443	76684447	+	RNA	DEL	AGAGT	AGAGT	-	rs373144187		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	AGAGT	AGAGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:76684443_76684447delAGAGT	ENST00000459742.1	+	0	58																											TTTTGTACACAGAGTAAAGAGGACA	0.449																																					.													.	.			0			.																																											0	.			GTACACAGAGTAA																													7.37:g.76684443_76684447delAGAGT			37	0.0810810811	3		74	0.16	12	.	0		0		RNA	DEL	ENST00000459742.1	37																																																																																						0.449	RP11-467H10.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000473089.1			
VGF	7425	mdanderson.org	37	7	100807777	100807777	+	Silent	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:100807777G>T	ENST00000249330.2	-	2	587	c.348C>A	c.(346-348)acC>acA	p.T116T	VGF_ENST00000445482.2_Silent_p.T116T	NM_003378.3	NP_003369.2	O15240	VGF_HUMAN	VGF nerve growth factor inducible	116					defense response to bacterium (GO:0042742)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|ovarian follicle development (GO:0001541)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)|response to insulin (GO:0032868)|sexual reproduction (GO:0019953)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				cervix(1)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	9	Lung NSC(181;0.168)|all_lung(186;0.215)					GCACGGTCTCGGTCAGCAGAG	0.736																																					p.T116T													.	.			0			c.C348A												8.0	10.0	9.0					7																	100807777		2101	4115	6216	SO:0001819	synonymous_variant	7425	exon2			GGTCTCGGTCAGC	Y12661	CCDS5712.1	7q22	2008-07-18			ENSG00000128564	ENSG00000128564			12684	protein-coding gene	gene with protein product	"""neuro-endocrine specific protein VGF"""	602186				9344675	Standard	NM_003378		Approved		uc003uxx.4	O15240	OTTHUMG00000157109	ENST00000249330.2:c.348C>A	7.37:g.100807777G>T			15	0	0		25	0.12	3	NM_003378	10	0.00	0	Q9UDW8	Silent	SNP	ENST00000249330.2	37	CCDS5712.1																																																																																					0.736	VGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347462.1		NM_003378	
CALU	813	bcgsc.ca;mdanderson.org	37	7	128409204	128409204	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:128409204C>T	ENST00000249364.4	+	7	1033	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	CALU_ENST00000535011.2_3'UTR|CALU_ENST00000538546.1_Missense_Mutation_p.R160W|CALU_ENST00000535623.1_3'UTR|CALU_ENST00000479257.1_Missense_Mutation_p.R319W|CALU_ENST00000449187.2_Missense_Mutation_p.R311W|CALU_ENST00000542996.2_Missense_Mutation_p.R319W	NM_001219.4	NP_001210.1	O43852	CALU_HUMAN	calumenin	311					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)			kidney(2)|large_intestine(3)|lung(5)	10						GGCCTTAGTACGGCATGATGA	0.438																																					p.R319W													.	CALU	42		0			c.C955T												110.0	94.0	100.0					7																	128409204		2203	4300	6503	SO:0001583	missense	813	exon8			TTAGTACGGCATG	AF013759	CCDS5805.1, CCDS47703.1, CCDS56506.1, CCDS56507.1, CCDS56508.1	7q32	2013-01-10			ENSG00000128595	ENSG00000128595		"""EF-hand domain containing"""	1458	protein-coding gene	gene with protein product		603420				9598325	Standard	NM_001219		Approved		uc003vnq.3	O43852	OTTHUMG00000158274	ENST00000249364.4:c.931C>T	7.37:g.128409204C>T	ENSP00000249364:p.Arg311Trp		85	0	0		107	0.05	5	NM_001199671	509	0.00	0	B3KPG9|D6QS48|D6QS49|D6QS50|D6QS51|D6QS52|D6QS53|D6QS54|D6QS55|D6QS56|D6QS57|D6QS58|D6QS59|F5H1Q9|F5H879|O60456|Q6FHB9|Q96RL3|Q9NR43	Missense_Mutation	SNP	ENST00000249364.4	37	CCDS5805.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.48|19.48	3.834949|3.834949	0.71373|0.71373	.|.	.|.	ENSG00000128595|ENSG00000128595	ENST00000542996;ENST00000538394;ENST00000537667;ENST00000538546;ENST00000249364;ENST00000449187;ENST00000342367;ENST00000479257|ENST00000493278	T;T;T;T;T|.	0.32023|.	2.61;1.47;2.61;2.62;2.6|.	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	0.065682|.	0.64402|.	D|.	0.000008|.	T|T	0.80969|0.80969	0.4726|0.4726	M|M	0.92317|0.92317	3.295|3.295	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.74674|.	0.984;0.983|.	D|D	0.84984|0.84984	0.0890|0.0890	10|5	0.59425|.	D|.	0.04|.	-2.2772|-2.2772	11.2273|11.2273	0.48890|0.48890	0.1831:0.8169:0.0:0.0|0.1831:0.8169:0.0:0.0	.|.	319;311|.	D6QS48;O43852|.	.;CALU_HUMAN|.	W|M	319;261;197;160;311;311;150;319|142	ENSP00000438248:R319W;ENSP00000438994:R160W;ENSP00000249364:R311W;ENSP00000408838:R311W;ENSP00000420381:R319W|.	ENSP00000249364:R311W|.	R|T	+|+	1|2	2|0	CALU|CALU	128196440|128196440	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	1.763000|1.763000	0.38461|0.38461	2.387000|2.387000	0.81309|0.81309	0.563000|0.563000	0.77884|0.77884	CGG|ACG			0.438	CALU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350533.1		NM_001219	
PRSS3P2	154754	hgsc.bcm.edu	37	7	142478944	142478944	+	RNA	SNP	G	G	A	rs377675720		TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr7:142478944G>A	ENST00000603901.1	+	0	40					NR_001296.3		Q8NHM4	TRY6_HUMAN	protease, serine, 3 pseudogene 2						endothelial cell migration (GO:0043542)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)										ATGCCCTGCCGTTCTTGCCAC	0.532																																					.													.	.			0			.																																											154754	.			CCTGCCGTTCTTG			7q34	2012-03-06			ENSG00000250606	ENSG00000275896			43788	pseudogene	pseudogene	"""trypsinogen C"""						Standard	NR_001296		Approved	TRY6	uc011ksq.2	Q8NHM4	OTTHUMG00000158904		7.37:g.142478944G>A			18	0	0		49	0.10	5	.	0		0		RNA	SNP	ENST00000603901.1	37																																																																																						0.532	PRSS3P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000470000.1		NR_001296	
GSDMD	79792	mdanderson.org	37	8	144644256	144644256	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr8:144644256G>T	ENST00000526406.1	+	11	1834	c.951G>T	c.(949-951)gaG>gaT	p.E317D	GSDMD_ENST00000533063.1_Missense_Mutation_p.E365D|GSDMD_ENST00000262580.4_Missense_Mutation_p.E317D	NM_001166237.1	NP_001159709.1	P57764	GSDMD_HUMAN	gasdermin D	317					cellular response to extracellular stimulus (GO:0031668)					breast(1)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	12						AGGGCCTGGAGGGGGTGCTGC	0.672																																					p.E317D													.	.			0			c.G951T												33.0	38.0	36.0					8																	144644256		2201	4299	6500	SO:0001583	missense	79792	exon11			CCTGGAGGGGGTG	AK096216	CCDS34956.1	8q24.3	2008-07-31	2008-07-31	2008-07-31		ENSG00000104518			25697	protein-coding gene	gene with protein product			"""gasdermin domain containing 1"""	GSDMDC1		15289881, 17350798	Standard	NM_024736		Approved	FLJ12150, DF5L	uc003yyg.3	P57764		ENST00000526406.1:c.951G>T	8.37:g.144644256G>T	ENSP00000433209:p.Glu317Asp		13	0.0769230769	1		29	0.10	3	NM_001166237	33	0.00	0	D3DWJ9|Q96Q98	Missense_Mutation	SNP	ENST00000526406.1	37	CCDS34956.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.090|5.090	0.202211|0.202211	0.09652|0.09652	.|.	.|.	ENSG00000104518|ENSG00000104518	ENST00000526406;ENST00000533063;ENST00000262580|ENST00000525208	T;T;T|.	0.22945|.	1.93;1.93;1.93|.	4.39|4.39	-7.74|-7.74	0.01241|0.01241	.|.	1.598880|.	0.03149|.	N|.	0.167759|.	T|T	0.30665|0.30665	0.0772|0.0772	L|L	0.47716|0.47716	1.5|1.5	0.09310|0.09310	N|N	1|1	B;P;P|.	0.43287|.	0.002;0.802;0.764|.	B;B;B|.	0.36418|.	0.005;0.222;0.224|.	T|T	0.29274|0.29274	-1.0017|-1.0017	10|5	0.13470|.	T|.	0.59|.	-10.522|-10.522	4.6573|4.6573	0.12624|0.12624	0.1469:0.4989:0.1525:0.2017|0.1469:0.4989:0.1525:0.2017	.|.	317;317;365|.	A8K702;P57764;G3V1A6|.	.;GSDMD_HUMAN;.|.	D|W	317;365;317|13	ENSP00000433209:E317D;ENSP00000433958:E365D;ENSP00000262580:E317D|.	ENSP00000262580:E317D|.	E|G	+|+	3|1	2|0	GSDMD|GSDMD	144715399|144715399	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.420000|-0.420000	0.07062|0.07062	-1.839000|-1.839000	0.01186|0.01186	-1.127000|-1.127000	0.01993|0.01993	GAG|GGG			0.672	GSDMD-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382046.3		NM_024736	
OPLAH	26873	mdanderson.org	37	8	145113441	145113441	+	Silent	SNP	G	G	T			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr8:145113441G>T	ENST00000426825.1	-	6	822	c.741C>A	c.(739-741)cgC>cgA	p.R247R	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	247					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CCTGCACGTAGCGCTGGATGG	0.697																																					p.R247R													.	.			0			c.C741A												31.0	37.0	35.0					8																	145113441		2137	4229	6366	SO:0001819	synonymous_variant	26873	exon6			CACGTAGCGCTGG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.741C>A	8.37:g.145113441G>T			22	0	0		18	0.17	3	NM_017570	12	0.00	0	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	37																																																																																						0.697	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_017570	
ARHGAP39	80728	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	145806589	145806590	+	Frame_Shift_Ins	INS	-	-	CACTCACC			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chr8:145806589_145806590insCACTCACC	ENST00000276826.5	-	2	353_354	c.152_153insGGTGAGTG	c.(151-153)tgcfs	p.C51fs	CTD-2517M22.9_ENST00000529377.1_RNA|ARHGAP39_ENST00000540274.1_Frame_Shift_Ins_p.C51fs|ARHGAP39_ENST00000377307.2_Frame_Shift_Ins_p.C51fs			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	51	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GGTCCCACACGCACTCACCGGT	0.644																																					p.C51fs													.	ARHGAP39	80		0			c.153_154insGGTGAGTG																																									SO:0001589	frameshift_variant	80728	exon4			CCACACGCACTCA		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.145_152dupGGTGAGTG	8.37:g.145806590_145806597dupCACTCACC	ENSP00000276826:p.Cys51fs		160	0	0		210	0.09	18	NM_025251	18	0.00	0	B4E1I1	Frame_Shift_Ins	INS	ENST00000276826.5	37																																																																																						0.644	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382509.1			
ZMYM3	9203	broad.mit.edu	37	X	70472909	70472909	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAFZ-01A-11D-A42Y-10	TCGA-2G-AAFZ-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6e4ca9a5-5e0a-43cb-9415-8379c4ef3a09	2499651e-d997-4ae7-bad7-8945ce31b25c	g.chrX:70472909A>G	ENST00000353904.2	-	2	384	c.197T>C	c.(196-198)cTg>cCg	p.L66P	ZMYM3_ENST00000373998.1_Missense_Mutation_p.L66P|ZMYM3_ENST00000314425.5_Missense_Mutation_p.L66P|ZMYM3_ENST00000373978.1_Missense_Mutation_p.L66P|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Missense_Mutation_p.L66P|ZMYM3_ENST00000373981.1_Missense_Mutation_p.L66P|ZMYM3_ENST00000373984.3_Missense_Mutation_p.L66P|ZMYM3_ENST00000373982.1_Missense_Mutation_p.L66P	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	66					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					GTCTTTTTCCAGGCCAGCAGG	0.642											OREG0019858	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L66P													.	ZMYM3	137		0			c.T197C												14.0	15.0	15.0					X																	70472909		2196	4282	6478	SO:0001583	missense	9203	exon2			TTTTCCAGGCCAG	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.197T>C	X.37:g.70472909A>G	ENSP00000343909:p.Leu66Pro		208	0	0	1122	410	0.02	9	NM_005096	66	0.00	0	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	ENST00000353904.2	37	CCDS14409.1	.	.	.	.	.	.	.	.	.	.	a	16.84	3.233341	0.58886	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981;ENST00000373978	T;T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.21;1.21;1.21;1.21	5.28	5.28	0.74379	.	0.000000	0.40818	N	0.001001	T	0.43233	0.1238	N	0.19112	0.55	0.80722	D	1	D;D;D	0.69078	0.995;0.997;0.995	D;D;D	0.78314	0.986;0.991;0.979	T	0.34775	-0.9815	10	0.36615	T	0.2	-5.7551	12.9179	0.58216	1.0:0.0:0.0:0.0	.	66;66;66	Q96E26;Q14202-2;Q14202	.;.;ZMYM3_HUMAN	P	66	ENSP00000322845:L66P;ENSP00000363110:L66P;ENSP00000343909:L66P;ENSP00000363096:L66P;ENSP00000363100:L66P;ENSP00000363094:L66P;ENSP00000363093:L66P;ENSP00000363090:L66P	ENSP00000322845:L66P	L	-	2	0	ZMYM3	70389634	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.684000	0.46951	1.765000	0.52091	0.237000	0.17872	CTG			0.642	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000057154.1		NM_201599	
