#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
PANK4	55229	hgsc.bcm.edu;bcgsc.ca	37	1	2453203	2453203	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:2453203A>G	ENST00000378466.3	-	2	173	c.161T>C	c.(160-162)gTa>gCa	p.V54A	PANK4_ENST00000435556.3_Missense_Mutation_p.V54A|PANK4_ENST00000491212.1_5'UTR	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4	54					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TTTGTGCTGTACCGTTGAATA	0.622																																					p.V54A													.	.			0			c.T161C												168.0	160.0	163.0					1																	2453203		2203	4300	6503	SO:0001583	missense	55229	exon2			TGCTGTACCGTTG	AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.161T>C	1.37:g.2453203A>G	ENSP00000367727:p.Val54Ala		66	0	0		69	0.06	4	NM_018216	25	0.00	0	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Missense_Mutation	SNP	ENST00000378466.3	37	CCDS42.1	.	.	.	.	.	.	.	.	.	.	A	16.53	3.150163	0.57151	.	.	ENSG00000157881	ENST00000378466;ENST00000435556	D;D	0.99494	-6.01;-3.82	4.85	4.85	0.62838	.	0.000000	0.64402	D	0.000001	D	0.98836	0.9607	L	0.53249	1.67	0.80722	D	1	D;D	0.60160	0.973;0.987	P;P	0.58130	0.833;0.833	D	0.99965	1.1835	10	0.07813	T	0.8	-31.6293	13.6019	0.62024	1.0:0.0:0.0:0.0	.	54;54	E9PHT6;Q9NVE7	.;PANK4_HUMAN	A	54	ENSP00000367727:V54A;ENSP00000421433:V54A	ENSP00000367727:V54A	V	-	2	0	PANK4	2443063	1.000000	0.71417	0.737000	0.30932	0.107000	0.19398	8.347000	0.90062	1.817000	0.53016	0.460000	0.39030	GTA			0.622	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000002082.1			
CLCN6	1185	mdanderson.org	37	1	11884555	11884555	+	Missense_Mutation	SNP	A	A	T	rs198400		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:11884555A>T	ENST00000346436.6	+	8	645	c.593A>T	c.(592-594)gAg>gTg	p.E198V	CLCN6_ENST00000376492.3_3'UTR|CLCN6_ENST00000376487.3_Missense_Mutation_p.E176V|CLCN6_ENST00000376496.3_Missense_Mutation_p.E198V|CLCN6_ENST00000312413.6_Missense_Mutation_p.E198V	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	198			E -> G (in dbSNP:rs198400). {ECO:0000269|PubMed:10500249, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:7584044, ECO:0000269|PubMed:8543009, ECO:0000269|PubMed:9224655, ECO:0000269|Ref.8}.		cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CTCTTCGTGGAGAAGGAAGGC	0.592																																					p.E198V													.	.			0			c.A593T												70.0	66.0	67.0					1																	11884555		2203	4300	6503	SO:0001583	missense	1185	exon8			TCGTGGAGAAGGA	X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.593A>T	1.37:g.11884555A>T	ENSP00000234488:p.Glu198Val		54	0	0		66	0.05	3	NM_001286	7	0.00	0	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Missense_Mutation	SNP	ENST00000346436.6	37	CCDS138.1	.	.	.	.	.	.	.	.	.	.	G	15.67	2.900806	0.52227	.	.	ENSG00000011021	ENST00000312413;ENST00000346436;ENST00000376487;ENST00000376496;ENST00000376490;ENST00000376491;ENST00000376492	D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09	5.79	5.79	0.91817	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.82282	0.5003	N	0.08118	0	0.30059	N	0.811059	B;B;P;P;B	0.40250	0.003;0.413;0.709;0.528;0.004	B;B;B;B;B	0.31751	0.001;0.131;0.118;0.135;0.001	T	0.81747	-0.0791	10	0.87932	D	0	-21.8217	14.207	0.65741	0.0714:0.0:0.9286:0.0	.	176;198;198;198;198	F8W9R3;P51797-3;P51797-4;P51797-2;P51797	.;.;.;.;CLCN6_HUMAN	V	198;198;176;198;198;198;198	ENSP00000308367:E198V;ENSP00000234488:E198V;ENSP00000365670:E176V;ENSP00000365679:E198V	ENSP00000308367:E198V	E	+	2	0	CLCN6	11807142	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	7.663000	0.83820	1.462000	0.47948	-0.215000	0.12644	GAG			0.592	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006639.2		NM_001286	
SPEN	23013	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	16254718	16254718	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:16254718G>A	ENST00000375759.3	+	11	2187	c.1983G>A	c.(1981-1983)tgG>tgA	p.W661*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	661	Arg-rich.|Tyr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATTCAGAATGGGAAACTTACC	0.428																																					p.W661X													.	.			0			c.G1983A												126.0	123.0	124.0					1																	16254718		2203	4300	6503	SO:0001587	stop_gained	23013	exon11			AGAATGGGAAACT		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1983G>A	1.37:g.16254718G>A	ENSP00000364912:p.Trp661*		140	0	0		126	0.29	36	NM_015001	8	0.38	3	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	37	CCDS164.1	.	.	.	.	.	.	.	.	.	.	G	39	7.823853	0.98510	.	.	ENSG00000065526	ENST00000375759	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-4.24	18.1431	0.89647	0.0:0.0:1.0:0.0	.	.	.	.	X	661	.	ENSP00000364912:W661X	W	+	3	0	SPEN	16127305	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.063000	0.71162	2.514000	0.84764	0.563000	0.77884	TGG			0.428	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025993.1		NM_015001	
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																					.													.	.			0			.																																									SO:0001630	splice_region_variant	55672	.			AACTTACTGTTGT	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			35	0	0		34	0.15	5	.	1	0.00	0	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																						0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000106436.3		NM_017940	Intron
CAMK2N1	55450	mdanderson.org	37	1	20811816	20811816	+	Silent	SNP	G	G	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:20811816G>A	ENST00000375078.3	-	1	897	c.57C>T	c.(55-57)ggC>ggT	p.G19G	CAMK2N1_ENST00000489020.1_5'Flank	NM_018584.5	NP_061054.2	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 1	19						cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	calcium-dependent protein kinase inhibitor activity (GO:0008427)			lung(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		GGCCCACGTCGCCGCCGTCGC	0.721																																					p.G19G													.	.			0			c.C57T												13.0	16.0	15.0					1																	20811816		2186	4278	6464	SO:0001819	synonymous_variant	55450	exon1			CACGTCGCCGCCG	AY204901	CCDS207.1	1p36.12	2008-02-05			ENSG00000162545	ENSG00000162545			24190	protein-coding gene	gene with protein product		614986				12477932	Standard	NM_018584		Approved	CaMKIINalpha	uc001bdh.3	Q7Z7J9	OTTHUMG00000002837	ENST00000375078.3:c.57C>T	1.37:g.20811816G>A			44	0	0		38	0.08	3	NM_018584	4	0.00	0		Silent	SNP	ENST00000375078.3	37	CCDS207.1																																																																																					0.721	CAMK2N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007949.1		NM_018584	
UBXN11	91544	mdanderson.org	37	1	26624522	26624522	+	Silent	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:26624522G>T	ENST00000374222.1	-	6	695	c.231C>A	c.(229-231)gcC>gcA	p.A77A	UBXN11_ENST00000374221.3_Silent_p.A77A|UBXN11_ENST00000374217.2_Silent_p.A44A|UBXN11_ENST00000374223.1_5'UTR|UBXN11_ENST00000535108.1_Intron|UBXN11_ENST00000314675.7_Intron|UBXN11_ENST00000436301.2_Silent_p.A2A|UBXN11_ENST00000357089.4_Silent_p.A44A			Q5T124	UBX11_HUMAN	UBX domain protein 11	77						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(3)	23						TCGTCATGAAGGCCATCAGCT	0.607																																					p.A77A													.	.			0			c.C231A												62.0	62.0	62.0					1																	26624522		2047	4218	6265	SO:0001819	synonymous_variant	91544	exon6			CATGAAGGCCATC	AF521017	CCDS41286.1, CCDS41287.1, CCDS41288.1	1p36.11	2008-07-25	2008-07-25	2008-07-25	ENSG00000158062	ENSG00000158062		"""UBX domain containing"""	30600	protein-coding gene	gene with protein product	"""socius"""	609151	"""UBX domain containing 5"""	UBXD5		11940653	Standard	NM_183008		Approved	SOC, SOCI	uc001blw.3	Q5T124	OTTHUMG00000003382	ENST00000374222.1:c.231C>A	1.37:g.26624522G>T			61	0	0		46	0.07	3	NM_183008	22	0.00	0	D3DPK6|Q5T117|Q5T120|Q5T125|Q5T126|Q5T129|Q5T131|Q5T133|Q63HM6|Q71RB3|Q8IY27|Q8N1L6|Q8N9M4|Q8NA18|Q8NFE3|Q8NFE4|Q8NFE6	Silent	SNP	ENST00000374222.1	37	CCDS41288.1																																																																																					0.607	UBXN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000009500.1		NM_145345	
TCHHL1	126637	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	152057679	152057679	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:152057679C>G	ENST00000368806.1	-	3	2543	c.2479G>C	c.(2479-2481)Gcc>Ccc	p.A827P		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	827							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			GATGCCTGGGCTATCTGAACT	0.463																																					p.A827P													.	.			0			c.G2479C												288.0	254.0	266.0					1																	152057679		2203	4300	6503	SO:0001583	missense	126637	exon3			CCTGGGCTATCTG		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.2479G>C	1.37:g.152057679C>G	ENSP00000357796:p.Ala827Pro		209	0	0		182	0.05	9	NM_001008536	0		0	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	37	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	14.59	2.579750	0.46006	.	.	ENSG00000182898	ENST00000368806	T	0.26373	1.74	4.56	0.0971	0.14493	.	1.781760	0.03794	N	0.263353	T	0.07052	0.0179	N	0.24115	0.695	0.09310	N	1	P	0.44090	0.826	P	0.45037	0.467	T	0.09818	-1.0657	10	0.32370	T	0.25	5.6919	0.8459	0.01161	0.1895:0.4059:0.184:0.2205	.	827	Q5QJ38	TCHL1_HUMAN	P	827	ENSP00000357796:A827P	ENSP00000357796:A827P	A	-	1	0	TCHHL1	150324303	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-0.242000	0.08928	0.922000	0.37019	0.591000	0.81541	GCC			0.463	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036638.2		XM_060104	
LCE3C	353144	mdanderson.org	37	1	152573341	152573341	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:152573341G>T	ENST00000333881.3	+	1	204	c.134G>T	c.(133-135)gGc>gTc	p.G45V		NM_178434.2	NP_848521.1	Q5T5A8	LCE3C_HUMAN	late cornified envelope 3C	45					keratinization (GO:0031424)					lung(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0313)|Kidney(5;0.0367)		GGGGGCTGTGGCCCCAGTTCT	0.622																																					p.G45V													.	.			0			c.G134T												66.0	60.0	63.0					1																	152573341		1822	2738	4560	SO:0001583	missense	353144	exon1			GCTGTGGCCCCAG	BI670516	CCDS1015.1	1q21.3	2008-02-05		2004-10-15	ENSG00000244057	ENSG00000244057		"""Late cornified envelopes"""	16612	protein-coding gene	gene with protein product		612615	"""small proline rich-like (epidermal differentiation complex) 3A"""	SPRL3A		11698679	Standard	NM_178434		Approved	LEP15	uc001fac.2	Q5T5A8	OTTHUMG00000014403	ENST00000333881.3:c.134G>T	1.37:g.152573341G>T	ENSP00000334644:p.Gly45Val		67	0	0		42	0.07	3	NM_178434	0		0	A1L420	Missense_Mutation	SNP	ENST00000333881.3	37	CCDS1015.1	.	.	.	.	.	.	.	.	.	.	G	0.916	-0.717433	0.03182	.	.	ENSG00000244057	ENST00000333881	T	0.03801	3.8	3.25	1.21	0.21127	.	.	.	.	.	T	0.01254	0.0041	.	.	.	0.09310	N	0.999997	B	0.16603	0.018	B	0.17433	0.018	T	0.47433	-0.9118	8	0.87932	D	0	.	3.4264	0.07412	0.1467:0.0:0.5899:0.2634	.	45	Q5T5A8	LCE3C_HUMAN	V	45	ENSP00000334644:G45V	ENSP00000334644:G45V	G	+	2	0	LCE3C	150839965	0.025000	0.19082	0.025000	0.17156	0.425000	0.31504	0.126000	0.15769	0.063000	0.16370	0.313000	0.20887	GGC			0.622	LCE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040061.2		NM_178434	
ARHGAP30	257106	mdanderson.org	37	1	161026274	161026274	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr1:161026274G>T	ENST00000368013.3	-	3	569	c.249C>A	c.(247-249)taC>taA	p.Y83*	ARHGAP30_ENST00000368016.3_Nonsense_Mutation_p.Y83*|ARHGAP30_ENST00000368015.1_Intron	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	83	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)			breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			TGTCTTGGAGGTAAACATCCC	0.572																																					p.Y83X													.	.			0			c.C249A												84.0	75.0	78.0					1																	161026274		2203	4300	6503	SO:0001587	stop_gained	257106	exon3			TTGGAGGTAAACA	AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.249C>A	1.37:g.161026274G>T	ENSP00000356992:p.Tyr83*		67	0	0		73	0.05	4	NM_181720	2	0.00	0	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Nonsense_Mutation	SNP	ENST00000368013.3	37	CCDS30918.1	.	.	.	.	.	.	.	.	.	.	G	37	6.558943	0.97663	.	.	ENSG00000186517	ENST00000368016;ENST00000368013	.	.	.	5.34	2.41	0.29592	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5066	0.39051	0.2383:0.0:0.7617:0.0	.	.	.	.	X	83	.	ENSP00000356992:Y83X	Y	-	3	2	ARHGAP30	159292898	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	2.125000	0.42016	0.236000	0.21180	-0.145000	0.13849	TAC			0.572	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077090.2		NM_181720	
ADARB2	105	hgsc.bcm.edu	37	10	1578004	1578005	+	Intron	DNP	TC	TC	CT			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	TC	TC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:1578004_1578005TC>CT	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GGCCCTGAGTTCCCTTGCCCCG	0.624																																					.													.	.			0			.																																									SO:0001627	intron_variant	642394	.			CTGAGTTCCCTTG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101_101delinsCT	10.37:g.1578004_1578005delinsCT			124	0	0		69	0.09	6	.	0		0	B2RPJ5|Q5VUT6|Q5VW42	RNA	DNP	ENST00000381312.1	37	CCDS7058.1																																																																																					0.624	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
FBXO18	84893	mdanderson.org	37	10	5951128	5951128	+	Silent	SNP	A	A	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:5951128A>G	ENST00000362091.4	+	5	1006	c.891A>G	c.(889-891)acA>acG	p.T297T	FBXO18_ENST00000397269.3_5'UTR|FBXO18_ENST00000379999.5_Silent_p.T348T|FBXO18_ENST00000470089.1_3'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	297					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						ACAGATACACAGCCACCACTA	0.562																																					p.T348T													.	.			0			c.A1044G												100.0	92.0	94.0					10																	5951128		2203	4300	6503	SO:0001819	synonymous_variant	84893	exon6			ATACACAGCCACC	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.891A>G	10.37:g.5951128A>G			36	0	0		21	0.14	3	NM_032807	21	0.00	0	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	ENST00000362091.4	37	CCDS7072.1																																																																																					0.562	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046596.1		NM_032807	
TYSND1	219743	bcgsc.ca;mdanderson.org	37	10	71905784	71905784	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:71905784G>T	ENST00000287078.6	-	1	558	c.559C>A	c.(559-561)Ctg>Atg	p.L187M	TYSND1_ENST00000494143.1_5'Flank|TYSND1_ENST00000335494.5_Missense_Mutation_p.L187M	NM_173555.2	NP_775826.2	Q2T9J0	TYSD1_HUMAN	trypsin domain containing 1	187					protein homooligomerization (GO:0051260)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of fatty acid beta-oxidation (GO:0031998)	membrane (GO:0016020)|peroxisome (GO:0005777)	identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|liver(1)|lung(3)|prostate(1)	9						ACGCCCAGCAGCGCAAACCAG	0.701																																					p.L187M													.	TYSND1	20		0			c.C559A												24.0	25.0	25.0					10																	71905784		2198	4292	6490	SO:0001583	missense	219743	exon1			CCAGCAGCGCAAA	BC016840	CCDS31213.1, CCDS31214.1	10q22.1	2009-11-06		2006-09-21	ENSG00000156521	ENSG00000156521			28531	protein-coding gene	gene with protein product		611017				17255948	Standard	NM_173555		Approved	MGC34695, NET41	uc001jqr.4	Q2T9J0	OTTHUMG00000018397	ENST00000287078.6:c.559C>A	10.37:g.71905784G>T	ENSP00000287078:p.Leu187Met		75	0	0		58	0.09	5	NM_001040273	18	0.00	0	Q5SQT4|Q5SQU1|Q8N6H2|Q96AR5	Missense_Mutation	SNP	ENST00000287078.6	37	CCDS31213.1	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077398	0.36662	.	.	ENSG00000156521	ENST00000287078;ENST00000335494	T;T	0.70399	-0.48;-0.48	3.93	2.01	0.26516	.	0.300837	0.26832	N	0.022272	T	0.78220	0.4249	M	0.64997	1.995	0.31900	N	0.616036	D;D	0.76494	0.999;0.999	D;D	0.72075	0.976;0.946	T	0.78443	-0.2202	10	0.72032	D	0.01	-19.8477	8.308	0.32053	0.2057:0.0:0.7943:0.0	.	187;187	Q2T9J0-2;Q2T9J0	.;TYSD1_HUMAN	M	187	ENSP00000287078:L187M;ENSP00000335673:L187M	ENSP00000287078:L187M	L	-	1	2	TYSND1	71575790	0.406000	0.25344	0.855000	0.33649	0.282000	0.26991	0.557000	0.23454	0.404000	0.25506	0.313000	0.20887	CTG			0.701	TYSND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048483.1		NM_173555	
FFAR4	338557	mdanderson.org	37	10	95326496	95326496	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:95326496C>T	ENST00000371483.4	+	1	75	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W	FFAR4_ENST00000604414.1_Missense_Mutation_p.R7W|FFAR4_ENST00000371481.4_Missense_Mutation_p.R7W	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	7					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										TGAATGCGCGCGGGCAGCGGG	0.697																																					p.R7W													.	.			0			c.C19T												10.0	10.0	10.0					10																	95326496		2182	4267	6449	SO:0001583	missense	338557	exon1			TGCGCGCGGGCAG		CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.19C>T	10.37:g.95326496C>T	ENSP00000360538:p.Arg7Trp		39	0	0		33	0.09	3	NM_001195755	0		0	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Missense_Mutation	SNP	ENST00000371483.4	37	CCDS31248.1	.	.	.	.	.	.	.	.	.	.	C	10.33	1.321462	0.23994	.	.	ENSG00000186188	ENST00000371481;ENST00000371483	T;T	0.67171	-0.25;-0.11	5.22	3.32	0.38043	.	0.970419	0.08494	N	0.937479	T	0.48484	0.1502	N	0.12182	0.205	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.04013	0.001;0.0	T	0.40403	-0.9565	10	0.66056	D	0.02	-3.4582	7.7367	0.28819	0.0:0.7235:0.1359:0.1406	.	7;7	Q5NUL3-2;Q5NUL3	.;O3FA1_HUMAN	W	7	ENSP00000360536:R7W;ENSP00000360538:R7W	ENSP00000360536:R7W	R	+	1	2	O3FAR1	95316486	0.001000	0.12720	0.163000	0.22734	0.073000	0.16967	0.603000	0.24149	1.421000	0.47157	0.561000	0.74099	CGG			0.697	FFAR4-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000083179.1		NM_181745	
BLNK	29760	ucsc.edu	37	10	97987208	97987208	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:97987208G>T	ENST00000224337.5	-	5	460	c.319C>A	c.(319-321)Ccg>Acg	p.P107T	BLNK_ENST00000427367.2_Missense_Mutation_p.P107T|BLNK_ENST00000371176.2_Missense_Mutation_p.P107T|BLNK_ENST00000413476.2_Missense_Mutation_p.P107T	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	107	Pro-rich.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		GGGTGAACCGGCCTGGTTTCC	0.627																																					p.P107T													.	BLNK	46		0			c.C319A												105.0	92.0	96.0					10																	97987208		2203	4300	6503	SO:0001583	missense	29760	exon5			GAACCGGCCTGGT	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.319C>A	10.37:g.97987208G>T	ENSP00000224337:p.Pro107Thr		68	0	0		42	0.10	4	NM_001114094	0		0	O75498|O75499|Q2MD49	Missense_Mutation	SNP	ENST00000224337.5	37	CCDS7446.1	.	.	.	.	.	.	.	.	.	.	G	0.203	-1.043071	0.01997	.	.	ENSG00000095585	ENST00000224337;ENST00000371176;ENST00000427367;ENST00000413476;ENST00000537049;ENST00000393894;ENST00000393889;ENST00000428924	.	.	.	5.83	2.21	0.28008	.	0.716979	0.14861	N	0.294115	T	0.22551	0.0544	N	0.01874	-0.695	0.09310	N	1	B;B;B;D;B;B	0.89917	0.0;0.0;0.0;1.0;0.0;0.0	B;B;B;D;B;B	0.83275	0.0;0.0;0.001;0.996;0.0;0.0	T	0.19128	-1.0315	9	0.16420	T	0.52	-1.3894	7.235	0.26064	0.0:0.0825:0.4685:0.449	.	107;107;107;107;107;107	Q2MD54;Q2MD49;Q8WV28-2;Q2MD59;Q2MD52;Q8WV28	.;.;.;.;.;BLNK_HUMAN	T	107	.	ENSP00000224337:P107T	P	-	1	0	BLNK	97977198	0.588000	0.26799	0.142000	0.22268	0.858000	0.48976	0.794000	0.26958	0.134000	0.18681	-0.410000	0.06199	CCG			0.627	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049593.1		NM_013314	
GPAM	57678	mdanderson.org	37	10	113924339	113924339	+	Silent	SNP	C	C	T	rs140253495	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:113924339C>T	ENST00000348367.4	-	13	1448	c.1251G>A	c.(1249-1251)ccG>ccA	p.P417P	GPAM_ENST00000423155.1_Silent_p.P417P|GPAM_ENST00000369425.1_Silent_p.P417P			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	417					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		GAGCAGACACCGGTTTCTGAC	0.363													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17325	0.0		0.0	False		,,,				2504	0.0				p.P417P	Ovarian(161;1017 2606 18293 52943)												GPAM,NS,carcinoma,-1,1	GPAM	-1	1	0			c.G1251A												69.0	72.0	71.0					10																	113924339		2203	4300	6503	SO:0001819	synonymous_variant	57678	exon13			AGACACCGGTTTC	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1251G>A	10.37:g.113924339C>T			96	0	0		51	0.06	3	NM_020918	8	0.00	0	Q5VW51|Q86TA3	Silent	SNP	ENST00000348367.4	37	CCDS7570.1																																																																																					0.363	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050377.1		NM_020918	
TCERG1L	256536	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	133106529	133106529	+	Silent	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr10:133106529C>T	ENST00000368642.4	-	3	700	c.615G>A	c.(613-615)ccG>ccA	p.P205P		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	205								p.P164P(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		AGGCAGGAGCCGGCCTGGACA	0.522																																					p.P205P													TCERG1L,colon,carcinoma,-2,4	TCERG1L	-2	4	1	Substitution - coding silent(1)	ovary(1)	c.G615A												57.0	55.0	56.0					10																	133106529		2203	4300	6503	SO:0001819	synonymous_variant	256536	exon3			AGGAGCCGGCCTG	AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.615G>A	10.37:g.133106529C>T			171	0	0		112	0.43	48	NM_174937	9	0.78	7	Q5VWI2|Q86XM8	Silent	SNP	ENST00000368642.4	37	CCDS7662.2																																																																																					0.522	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091619.2		NM_174937	
NLRP6	171389	bcgsc.ca	37	11	279526	279526	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:279526G>T	ENST00000312165.5	+	2	229	c.229G>T	c.(229-231)Gcc>Tcc	p.A77S	NLRP6_ENST00000534750.1_Missense_Mutation_p.A77S	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	77	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCCGGAGCCTGCCCTGGAGGT	0.761																																					p.A77S													.	NLRP6	4		0			c.G229T												3.0	4.0	3.0					11																	279526		1750	3461	5211	SO:0001583	missense	171389	exon2			GAGCCTGCCCTGG	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.229G>T	11.37:g.279526G>T	ENSP00000309767:p.Ala77Ser		25	0	0		16	0.25	4	NM_138329	0		0	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	37	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356661	0.61293	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.68025	-0.3;-0.3	3.71	3.71	0.42584	Pyrin (2);DEATH-like (2);	.	.	.	.	T	0.79759	0.4501	M	0.72576	2.205	0.37680	D	0.923463	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.994	D	0.84626	0.0687	9	0.87932	D	0	.	13.785	0.63104	0.0:0.0:1.0:0.0	.	77;77	E9PJZ8;P59044	.;NALP6_HUMAN	S	77	ENSP00000433617:A77S;ENSP00000309767:A77S	ENSP00000309767:A77S	A	+	1	0	NLRP6	269526	0.904000	0.30761	0.053000	0.19242	0.017000	0.09413	2.335000	0.43929	2.009000	0.58944	0.491000	0.48974	GCC			0.761	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239283.1		NM_138329	
ATHL1	80162	mdanderson.org	37	11	292550	292550	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:292550C>T	ENST00000409548.2	+	6	1146	c.1031C>T	c.(1030-1032)gCc>gTc	p.A344V	ATHL1_ENST00000409479.1_Missense_Mutation_p.A344V|ATHL1_ENST00000409655.1_Missense_Mutation_p.A167V	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	344					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTCAGGGAGCCAAGTTTGCC	0.662																																					p.A344V													.	.			0			c.C1031T												46.0	41.0	43.0					11																	292550		2203	4300	6503	SO:0001583	missense	80162	exon6			AGGGAGCCAAGTT	AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1031C>T	11.37:g.292550C>T	ENSP00000387185:p.Ala344Val		67	0	0		35	0.09	3	NM_025092	17	0.00	0	Q658X8|Q8TEG9|Q9H635	Missense_Mutation	SNP	ENST00000409548.2	37	CCDS31322.2	.	.	.	.	.	.	.	.	.	.	c	22.0	4.232708	0.79688	.	.	ENSG00000142102	ENST00000409548;ENST00000409655;ENST00000409479	.	.	.	4.14	4.14	0.48551	Glycoside hydrolase, family 65, central catalytic (1);Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.145234	0.46758	D	0.000273	T	0.78578	0.4305	M	0.83953	2.67	0.40138	D	0.976806	D;D;D	0.67145	0.988;0.967;0.996	D;P;P	0.65323	0.934;0.897;0.824	T	0.82267	-0.0542	9	0.49607	T	0.09	.	15.5652	0.76287	0.0:1.0:0.0:0.0	.	344;344;167	Q32M88;E7EMA9;B8ZZ60	ATHL1_HUMAN;.;.	V	344;167;344	.	ENSP00000387099:A344V	A	+	2	0	ATHL1	282550	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.031000	0.57267	2.154000	0.67381	0.550000	0.68814	GCC			0.662	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330164.3		NM_025092	
MICAL2	9645	mdanderson.org	37	11	12244987	12244987	+	Silent	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:12244987G>T	ENST00000256194.4	+	12	1767	c.1479G>T	c.(1477-1479)ctG>ctT	p.L493L	MICAL2_ENST00000537344.1_Silent_p.L493L|MICAL2_ENST00000527546.1_Silent_p.L493L|MICAL2_ENST00000342902.5_Silent_p.L493L|MICAL2_ENST00000379612.3_Silent_p.L493L	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	493	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		CTAAGGAGCTGGAGCACTACC	0.557																																					p.L493L													.	.			0			c.G1479T												111.0	104.0	106.0					11																	12244987		2201	4294	6495	SO:0001819	synonymous_variant	9645	exon12			GGAGCTGGAGCAC	AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.1479G>T	11.37:g.12244987G>T			73	0	0		50	0.06	3	NM_014632	1	0.00	0	B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Silent	SNP	ENST00000256194.4	37	CCDS7809.1																																																																																					0.557	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385993.1		NM_014632	
RAB3IL1	5866	mdanderson.org	37	11	61674072	61674072	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:61674072G>T	ENST00000394836.2	-	5	680	c.523C>A	c.(523-525)Ccc>Acc	p.P175T	RAB3IL1_ENST00000301773.5_Intron	NM_013401.2	NP_037533.2	Q8TBN0	R3GEF_HUMAN	RAB3A interacting protein (rabin3)-like 1	175					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|liver(1)|lung(4)|skin(3)|urinary_tract(1)	14						AGCAGCTGGGGGTGAAGCTCG	0.662																																					p.P175T													.	.			0			c.C523A												49.0	44.0	46.0					11																	61674072		2202	4299	6501	SO:0001583	missense	5866	exon5			GCTGGGGGTGAAG	AF084557	CCDS8014.1, CCDS60809.1	11q12.2	2008-02-01			ENSG00000167994	ENSG00000167994			9780	protein-coding gene	gene with protein product							Standard	NM_013401		Approved		uc001nso.4	Q8TBN0	OTTHUMG00000167524	ENST00000394836.2:c.523C>A	11.37:g.61674072G>T	ENSP00000378313:p.Pro175Thr		38	0	0		31	0.10	3	NM_013401	8	0.00	0	Q86V32|Q9P1Q8	Missense_Mutation	SNP	ENST00000394836.2	37	CCDS8014.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253005	0.80135	.	.	ENSG00000167994	ENST00000394836;ENST00000531922	T;T	0.54479	1.27;0.57	4.59	3.65	0.41850	.	0.064436	0.64402	D	0.000006	T	0.70011	0.3175	M	0.79258	2.445	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.72871	-0.4161	10	0.52906	T	0.07	0.3964	12.736	0.57225	0.0827:0.0:0.9173:0.0	.	175	Q8TBN0	R3GEF_HUMAN	T	175;222	ENSP00000378313:P175T;ENSP00000435444:P222T	ENSP00000378313:P175T	P	-	1	0	RAB3IL1	61430648	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.571000	0.82399	2.368000	0.80403	0.561000	0.74099	CCC			0.662	RAB3IL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394917.1		NM_013401	
SYT12	91683	mdanderson.org	37	11	66802170	66802170	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:66802170C>A	ENST00000393946.2	+	6	1251	c.89C>A	c.(88-90)gCc>gAc	p.A30D	SYT12_ENST00000527043.1_Missense_Mutation_p.A30D|SYT12_ENST00000525457.1_Missense_Mutation_p.A30D|SYT12_ENST00000526281.1_Intron			Q8IV01	SYT12_HUMAN	synaptotagmin XII	30						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|synapse (GO:0045202)				NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	20						GGGGCCCTGGCCCTGCTGGGA	0.612																																					p.A30D	Ovarian(65;2862 3307)												.	.			0			c.C89A												59.0	66.0	63.0					11																	66802170		2200	4295	6495	SO:0001583	missense	91683	exon3			CCCTGGCCCTGCT	AK024280	CCDS8154.1	11q13.2	2014-07-02			ENSG00000173227	ENSG00000173227		"""Synaptotagmins"""	18381	protein-coding gene	gene with protein product		606436				8987811	Standard	NM_177963		Approved	SRG1	uc001oju.3	Q8IV01	OTTHUMG00000167101	ENST00000393946.2:c.89C>A	11.37:g.66802170C>A	ENSP00000377520:p.Ala30Asp		47	0	0		40	0.08	3	NM_177963	2	0.00	0		Missense_Mutation	SNP	ENST00000393946.2	37	CCDS8154.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.403012	0.62288	.	.	ENSG00000173227	ENST00000393946;ENST00000525457;ENST00000527043;ENST00000533427	T;T;T	0.13089	2.62;2.62;2.62	4.94	4.02	0.46733	.	0.139238	0.48767	D	0.000165	T	0.08179	0.0204	N	0.19112	0.55	0.39727	D	0.971556	P	0.44578	0.838	B	0.36134	0.218	T	0.12656	-1.0539	10	0.87932	D	0	.	10.3093	0.43699	0.0:0.9038:0.0:0.0962	.	30	Q8IV01	SYT12_HUMAN	D	30	ENSP00000377520:A30D;ENSP00000431400:A30D;ENSP00000435316:A30D	ENSP00000377520:A30D	A	+	2	0	SYT12	66558746	0.922000	0.31269	0.937000	0.37676	0.960000	0.62799	1.783000	0.38664	2.276000	0.75962	0.563000	0.77884	GCC			0.612	SYT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393129.1		NM_177963	
DLG2	1740	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	83180284	83180284	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:83180284T>C	ENST00000532653.1	-	20	2512	c.2210A>G	c.(2209-2211)tAt>tGt	p.Y737C	DLG2_ENST00000280241.8_Missense_Mutation_p.Y794C|DLG2_ENST00000398309.2_Missense_Mutation_p.Y755C|DLG2_ENST00000426717.2_Missense_Mutation_p.Y219C|DLG2_ENST00000537455.1_Missense_Mutation_p.Y505C|DLG2_ENST00000543673.1_Missense_Mutation_p.Y860C|DLG2_ENST00000524982.1_Missense_Mutation_p.Y751C|DLG2_ENST00000376106.3_Missense_Mutation_p.Y219C|DLG2_ENST00000376104.2_Missense_Mutation_p.Y860C|DLG2_ENST00000330014.6_Missense_Mutation_p.Y676C|DLG2_ENST00000418306.2_Missense_Mutation_p.Y634C|DLG2_ENST00000404783.3_Missense_Mutation_p.Y233C|DLG2_ENST00000531015.1_Missense_Mutation_p.Y722C			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	451					nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ACTGGTTCCATATAAATTGTC	0.413																																					p.Y860C													.	.			0			c.A2579G												259.0	238.0	245.0					11																	83180284		1877	4113	5990	SO:0001583	missense	1740	exon25			GTTCCATATAAAT	U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.2210A>G	11.37:g.83180284T>C	ENSP00000435849:p.Tyr737Cys		173	0	0		134	0.36	48	NM_001142699	5	0.40	2	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	ENST00000532653.1	37		.	.	.	.	.	.	.	.	.	.	T	22.9	4.353959	0.82243	.	.	ENSG00000150672	ENST00000398309;ENST00000426717;ENST00000376104;ENST00000418306;ENST00000543673;ENST00000280241;ENST00000404783;ENST00000330014;ENST00000537455;ENST00000376106;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000531015;ENST00000457267	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	5.72	5.72	0.89469	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.64402	D	0.000007	D	0.85613	0.5737	H	0.98370	4.215	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;0.999;1.0;1.0	D	0.91311	0.5074	9	.	.	.	.	16.0037	0.80327	0.0:0.0:0.0:1.0	.	722;737;751;676;233;860;755;634	E9PIW2;B7Z2T4;E9PN83;B7Z264;B5MCC5;Q15700-2;Q15700;Q15700-3	.;.;.;.;.;.;DLG2_HUMAN;.	C	755;219;860;634;860;794;233;676;505;219;751;737;860;722;107	ENSP00000381355:Y755C;ENSP00000393049:Y219C;ENSP00000365272:Y860C;ENSP00000402275:Y634C;ENSP00000441994:Y860C;ENSP00000280241:Y794C;ENSP00000385113:Y233C;ENSP00000381353:Y676C;ENSP00000443248:Y505C;ENSP00000365274:Y219C;ENSP00000432894:Y751C;ENSP00000435849:Y737C;ENSP00000433848:Y722C;ENSP00000409133:Y107C	.	Y	-	2	0	DLG2	82857932	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.638000	0.83328	2.184000	0.69523	0.533000	0.62120	TAT			0.413	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000259253.2		NM_001364	
SIK3	23387	mdanderson.org	37	11	116746687	116746687	+	Silent	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr11:116746687G>T	ENST00000292055.4	-	9	995	c.960C>A	c.(958-960)atC>atA	p.I320I	SIK3_ENST00000434315.2_Silent_p.I219I|SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Silent_p.I378I|SIK3_ENST00000542607.1_Intron|SIK3_ENST00000446921.2_Intron	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	320	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						GCAGGCTGTAGATTGCACTAT	0.468																																					p.I320I													.	.			0			c.C960A												108.0	99.0	102.0					11																	116746687		2201	4296	6497	SO:0001819	synonymous_variant	23387	exon9			GCTGTAGATTGCA	AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.960C>A	11.37:g.116746687G>T			47	0	0		17	0.12	2	NM_025164	8	0.00	0	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Silent	SNP	ENST00000292055.4	37	CCDS8379.1	.	.	.	.	.	.	.	.	.	.	G	9.301	1.053215	0.19907	.	.	ENSG00000160584	ENST00000445177;ENST00000413553	.	.	.	5.45	4.54	0.55810	.	.	.	.	.	T	0.69700	0.3140	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68754	-0.5325	4	.	.	.	.	13.9355	0.64023	0.0732:0.0:0.9268:0.0	.	.	.	.	I	372;281	.	.	L	-	1	2	SIK3	116251897	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.138000	0.77305	1.297000	0.44761	0.555000	0.69702	CTA			0.468	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_025164	
NCKAP5L	57701	mdanderson.org	37	12	50190598	50190598	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr12:50190598G>T	ENST00000335999.6	-	8	1246	c.1045C>A	c.(1045-1047)Cca>Aca	p.P349T		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	345	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						CCATTGAGTGGGCCTGCAGCC	0.652																																					p.P349T													.	.			0			c.C1045A												21.0	24.0	23.0					12																	50190598		1926	4126	6052	SO:0001583	missense	57701	exon8			TGAGTGGGCCTGC	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1045C>A	12.37:g.50190598G>T	ENSP00000337998:p.Pro349Thr		42	0	0		33	0.09	3	NM_001037806	10	0.00	0	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Missense_Mutation	SNP	ENST00000335999.6	37	CCDS41781.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.965299|3.965299	0.74131|0.74131	.|.	.|.	ENSG00000167566|ENSG00000167566	ENST00000433948|ENST00000335999;ENST00000354423	.|T	.|0.48201	.|0.82	4.12|4.12	4.12|4.12	0.48240|0.48240	.|.	0.000000|0.000000	0.41605|0.41605	D|D	0.000858|0.000858	T|T	0.33527|0.33527	0.0866|0.0866	N|N	0.08118|0.08118	0|0	0.19300|0.19300	N|N	0.999971|0.999971	.|D	.|0.56968	.|0.978	.|P	.|0.50659	.|0.647	T|T	0.12192|0.12192	-1.0557|-1.0557	6|10	.|0.24483	.|T	.|0.36	-6.6864|-6.6864	10.9043|10.9043	0.47071|0.47071	0.0:0.0:0.8118:0.1882|0.0:0.0:0.8118:0.1882	.|.	.|345	.|E2QRB5	.|.	H|T	63|349;345	.|ENSP00000337998:P349T	.|ENSP00000337998:P349T	P|P	-|-	2|1	0|0	NCKAP5L|NCKAP5L	48476865|48476865	0.155000|0.155000	0.22806|0.22806	0.995000|0.995000	0.50966|0.50966	0.832000|0.832000	0.47134|0.47134	2.269000|2.269000	0.43346|0.43346	2.032000|2.032000	0.59987|0.59987	0.462000|0.462000	0.41574|0.41574	CCC|CCA			0.652	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346884.2		XM_035497	
FOXN4	121643	broad.mit.edu	37	12	109719430	109719430	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr12:109719430A>G	ENST00000299162.5	-	9	1180	c.1076T>C	c.(1075-1077)gTc>gCc	p.V359A	FOXN4_ENST00000355216.1_Missense_Mutation_p.V179A	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	359					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						GTGCAGGGGGACTGACTGCAG	0.692																																					p.V359A													.	FOXN4	74		0			c.T1076C												40.0	24.0	29.0					12																	109719430		2202	4299	6501	SO:0001583	missense	121643	exon9			AGGGGGACTGACT	AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.1076T>C	12.37:g.109719430A>G	ENSP00000299162:p.Val359Ala		118	0.0084745763	1		117	0.05	6	NM_213596	0		0	Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	ENST00000299162.5	37	CCDS9126.2	.	.	.	.	.	.	.	.	.	.	A	10.35	1.326225	0.24080	.	.	ENSG00000139445	ENST00000355216;ENST00000299162	D;D	0.94537	-3.45;-3.06	4.55	2.14	0.27477	.	0.765740	0.11893	N	0.519378	D	0.90335	0.6976	L	0.51422	1.61	0.09310	N	1	B;B	0.26002	0.081;0.139	B;B	0.26614	0.071;0.055	T	0.77975	-0.2385	10	0.20519	T	0.43	-15.1402	6.8394	0.23955	0.7679:0.1518:0.0803:0.0	.	359;359	A6H901;Q96NZ1	.;FOXN4_HUMAN	A	179;359	ENSP00000347354:V179A;ENSP00000299162:V359A	ENSP00000299162:V359A	V	-	2	0	FOXN4	108203813	0.202000	0.23423	0.202000	0.23494	0.899000	0.52679	4.419000	0.59835	0.343000	0.23821	0.454000	0.30748	GTC			0.692	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000328306.1		XM_062735	
NOC4L	79050	mdanderson.org	37	12	132632512	132632512	+	Missense_Mutation	SNP	G	G	T	rs149306359	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr12:132632512G>T	ENST00000330579.1	+	6	732	c.691G>T	c.(691-693)Gtg>Ttg	p.V231L	NOC4L_ENST00000535343.1_3'UTR|NOC4L_ENST00000538784.1_5'Flank	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	231					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		CAGCTTCTATGTGAAGCGGGC	0.667																																					p.V231L													.	.			0			c.G691T												30.0	29.0	29.0					12																	132632512		2194	4298	6492	SO:0001583	missense	79050	exon6			TTCTATGTGAAGC		CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.691G>T	12.37:g.132632512G>T	ENSP00000328854:p.Val231Leu		56	0.0178571429	1		48	0.06	3	NM_024078	89	0.00	0	Q8N2S5|Q96I14	Missense_Mutation	SNP	ENST00000330579.1	37	CCDS9277.1	.	.	.	.	.	.	.	.	.	.	g	9.542	1.113576	0.20795	.	.	ENSG00000184967	ENST00000330579;ENST00000541954	T;T	0.32515	1.45;1.45	5.17	5.17	0.71159	.	0.126174	0.52532	D	0.000080	T	0.31979	0.0814	L	0.55481	1.735	0.80722	D	1	B	0.26902	0.163	B	0.31245	0.126	T	0.06409	-1.0828	10	0.27785	T	0.31	-28.5576	14.1942	0.65659	0.0:0.0:1.0:0.0	.	231	Q9BVI4	NOC4L_HUMAN	L	231;198	ENSP00000328854:V231L;ENSP00000438255:V198L	ENSP00000328854:V231L	V	+	1	0	NOC4L	131198465	0.996000	0.38824	0.309000	0.25155	0.007000	0.05969	3.412000	0.52679	2.409000	0.81822	0.558000	0.71614	GTG			0.667	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398999.1		NM_024078	
TPTE2	93492	broad.mit.edu;mdanderson.org	37	13	20025336	20025336	+	Silent	SNP	A	A	G	rs545861513	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr13:20025336A>G	ENST00000400230.2	-	11	815	c.771T>C	c.(769-771)caT>caC	p.H257H	TPTE2_ENST00000457266.2_Silent_p.H146H|TPTE2_ENST00000382975.4_Silent_p.H217H|TPTE2_ENST00000382977.4_Silent_p.H257H|TPTE2_ENST00000382978.1_Silent_p.H217H|TPTE2_ENST00000390680.2_Silent_p.H180H|TPTE2_ENST00000255310.6_Silent_p.H180H|TPTE2_ENST00000400103.2_Silent_p.H146H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	257	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGTGGTTTCGATGTTTCTTAT	0.358													a|||	6	0.00119808	0.003	0.0014	5008	,	,		20859	0.0		0.001	False		,,,				2504	0.0				p.H257H													.	TPTE2	225		0			c.T771C												132.0	116.0	122.0					13																	20025336		2203	4299	6502	SO:0001819	synonymous_variant	93492	exon12			GTTTCGATGTTTC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.771T>C	13.37:g.20025336A>G			55	0	0		51	0.16	8	NM_199254	0		0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	37	CCDS45014.1																																																																																					0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	
HMGB1	3146	broad.mit.edu	37	13	31035512	31035512	+	Missense_Mutation	SNP	T	T	A	rs200836895	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr13:31035512T>A	ENST00000405805.1	-	5	1570	c.630A>T	c.(628-630)gaA>gaT	p.E210D	HMGB1_ENST00000341423.5_Missense_Mutation_p.E210D|HMGB1_ENST00000399494.1_Missense_Mutation_p.E210D|HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000339872.4_Missense_Mutation_p.E210D			P09429	HMGB1_HUMAN	high mobility group box 1	210	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		CATCAtcatcttcttcttcat	0.378													T|||	6	0.00119808	0.003	0.0	5008	,	,		18295	0.0		0.0	False		,,,				2504	0.002				p.E210D													.	HMGB1	21		0			c.A630T												20.0	25.0	23.0					13																	31035512		1894	4135	6029	SO:0001583	missense	3146	exon5			ATCATCTTCTTCT	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.630A>T	13.37:g.31035512T>A	ENSP00000384678:p.Glu210Asp		58	0	0		40	0.08	3	NM_002128	752	0.00	3	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	37	CCDS9335.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.336740	0.41398	.	.	ENSG00000189403	ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.68	-1.58	0.08479	Armadillo-like helical (1);	0.305542	0.22770	N	0.055856	T	0.33440	0.0863	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.02901	-1.1096	10	0.87932	D	0	.	4.5078	0.11896	0.474:0.2443:0.0:0.2817	.	171;210	B3KQ05;P09429	.;HMGB1_HUMAN	D	210	ENSP00000384678:E210D;ENSP00000343040:E210D;ENSP00000345347:E210D;ENSP00000382417:E210D	ENSP00000343040:E210D	E	-	3	2	HMGB1	29933512	0.999000	0.42202	0.997000	0.53966	0.995000	0.86356	0.152000	0.16302	-0.149000	0.11215	-0.276000	0.10085	GAA			0.378	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000303998.2		NM_002128	
TECPR2	9895	mdanderson.org	37	14	102963955	102963955	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr14:102963955G>T	ENST00000359520.7	+	19	4206	c.3980G>T	c.(3979-3981)cGc>cTc	p.R1327L		NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1327					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GTGTGGGCCCGCTGTCCAAAC	0.667																																					p.R1327L													.	.			0			c.G3980T												15.0	17.0	16.0					14																	102963955		2198	4294	6492	SO:0001583	missense	9895	exon19			GGGCCCGCTGTCC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.3980G>T	14.37:g.102963955G>T	ENSP00000352510:p.Arg1327Leu		46	0	0		47	0.06	3	NM_014844	14	0.00	0	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Missense_Mutation	SNP	ENST00000359520.7	37	CCDS32162.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.101914	0.37048	.	.	ENSG00000196663	ENST00000359520	T	0.12039	2.72	5.54	4.46	0.54185	.	0.000000	0.85682	D	0.000000	T	0.11324	0.0276	N	0.02916	-0.46	0.80722	D	1	D;D	0.64830	0.987;0.994	P;D	0.62955	0.83;0.909	T	0.10730	-1.0617	10	0.02654	T	1	.	14.9996	0.71462	0.0818:0.0:0.9182:0.0	.	510;1327	B4DSD3;O15040	.;TCPR2_HUMAN	L	1327	ENSP00000352510:R1327L	ENSP00000352510:R1327L	R	+	2	0	TECPR2	102033708	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.516000	0.81772	2.619000	0.88677	0.455000	0.32223	CGC			0.667	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415056.2		NM_014844	
LOC101927079	101927079	broad.mit.edu	37	15	22332492	22332492	+	RNA	SNP	A	A	C	rs540968052		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr15:22332492A>C	ENST00000558896.1	+	0	299																											TATTTCTCTTATTACTATTTT	0.383																																					.													.	.			0			.																																											0	.			TCTCTTATTACTA																													15.37:g.22332492A>C			47	0	0		55	0.05	3	.	0		0		RNA	SNP	ENST00000558896.1	37																																																																																						0.383	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000417625.1			
MIR7162	102466227	broad.mit.edu	37	15	62538522	62538523	+	RNA	INS	-	-	GA	rs3055695|rs540111016|rs370506651	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr15:62538522_62538523insGA	ENST00000570077.1	-	0	693_694				AC126323.1_ENST00000408214.1_RNA																							GGGGGCTCCGGGTAGGGGTTCA	0.609																																					.													.	.			0			.																																											0	.			GCTCCGGGTAGGG																													15.37:g.62538522_62538523insGA			3	0	0		7	0.29	2	.	0		0		RNA	INS	ENST00000570077.1	37																																																																																						0.609	hsa-mir-7162.1-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000422143.1			
TICRR	90381	mdanderson.org	37	15	90168927	90168927	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr15:90168927G>T	ENST00000268138.7	+	20	5491	c.5386G>T	c.(5386-5388)Gat>Tat	p.D1796Y	KIF7_ENST00000558928.1_Intron|TICRR_ENST00000560985.1_Missense_Mutation_p.D1795Y			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	1796					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CCTGAGAGAAGATTCAGAAGT	0.517																																					p.D1796Y													.	.			0			c.G5386T												49.0	53.0	51.0					15																	90168927		2200	4299	6499	SO:0001583	missense	90381	exon20			AGAGAAGATTCAG	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.5386G>T	15.37:g.90168927G>T	ENSP00000268138:p.Asp1796Tyr		56	0	0		58	0.07	4	NM_152259	50	0.00	0	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	ENST00000268138.7	37	CCDS10352.2	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595761	0.46318	.	.	ENSG00000140534	ENST00000268138	T	0.10005	2.92	5.2	3.29	0.37713	.	0.159575	0.37178	N	0.002212	T	0.21186	0.0510	M	0.66939	2.045	0.09310	N	0.999999	D	0.60160	0.987	P	0.55303	0.773	T	0.02728	-1.1118	10	0.72032	D	0.01	-7.3083	9.2387	0.37481	0.2384:0.0:0.7615:0.0	.	1796	Q7Z2Z1	TICRR_HUMAN	Y	1796	ENSP00000268138:D1796Y	ENSP00000268138:D1796Y	D	+	1	0	C15orf42	87969931	0.876000	0.30132	0.029000	0.17559	0.092000	0.18411	3.618000	0.54188	1.322000	0.45245	-0.136000	0.14681	GAT			0.517	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000312856.1		NM_152259	
ZNF646	9726	mdanderson.org	37	16	31087950	31087950	+	Missense_Mutation	SNP	G	G	T	rs143373931	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr16:31087950G>T	ENST00000394979.2	+	1	728	c.305G>T	c.(304-306)cGc>cTc	p.R102L	ZNF668_ENST00000300849.4_5'Flank|ZNF646_ENST00000300850.5_Missense_Mutation_p.R102L|ZNF668_ENST00000564456.1_5'Flank			O15015	ZN646_HUMAN	zinc finger protein 646	102					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCTGAGGGCCGCCGCAGGCAC	0.612																																					p.R102L													ZNF646,right_lower_lobe,carcinoma,0,1	ZNF646	0	1	0			c.G305T												39.0	37.0	38.0					16																	31087950		2197	4300	6497	SO:0001583	missense	9726	exon2			AGGGCCGCCGCAG	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.305G>T	16.37:g.31087950G>T	ENSP00000378429:p.Arg102Leu		22	0	0		31	0.10	3	NM_014699	11	0.00	0	Q8IVD8	Missense_Mutation	SNP	ENST00000394979.2	37		.	.	.	.	.	.	.	.	.	.	G	14.19	2.460122	0.43736	.	.	ENSG00000167395	ENST00000428260;ENST00000300850;ENST00000394979	T;T;T	0.08370	3.37;3.1;3.11	5.65	2.64	0.31445	.	.	.	.	.	T	0.11495	0.0280	L	0.27053	0.805	0.27042	N	0.963987	D	0.56746	0.977	P	0.55303	0.773	T	0.18241	-1.0343	9	0.38643	T	0.18	-6.6766	9.7986	0.40751	0.2185:0.0:0.7815:0.0	.	102	O15015-2	.	L	102	ENSP00000391271:R102L;ENSP00000300850:R102L;ENSP00000378429:R102L	ENSP00000300850:R102L	R	+	2	0	ZNF646	30995451	0.662000	0.27439	0.940000	0.37924	0.966000	0.64601	1.239000	0.32719	0.318000	0.23185	-0.251000	0.11542	CGC			0.612	ZNF646-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000108510.2		NM_014699	
COG8	84342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	69368744	69368744	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr16:69368744C>A	ENST00000306875.4	-	3	1207	c.1093G>T	c.(1093-1095)Ggt>Tgt	p.G365C	COG8_ENST00000562081.1_Missense_Mutation_p.G365C|RP11-343C2.12_ENST00000562949.1_Missense_Mutation_p.G11C	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	365					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						GCCAACTGACCCCGGAAATCA	0.552																																					p.G365C													.	.			0			c.G1093T												64.0	69.0	67.0					16																	69368744		2198	4300	6498	SO:0001583	missense	84342	exon3			ACTGACCCCGGAA	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1093G>T	16.37:g.69368744C>A	ENSP00000305459:p.Gly365Cys		77	0	0		76	0.21	16	NM_032382	42	0.17	7	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	ENST00000306875.4	37	CCDS10876.1	.	.	.	.	.	.	.	.	.	.	C	18.87	3.714723	0.68730	.	.	ENSG00000213380	ENST00000306875	T	0.50001	0.76	6.04	5.1	0.69264	Cullin repeat-like-containing domain (1);	0.044107	0.85682	D	0.000000	T	0.69904	0.3163	M	0.81341	2.54	0.54753	D	0.999985	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.984	T	0.74556	-0.3626	10	0.59425	D	0.04	-0.7164	15.5066	0.75745	0.0:0.9339:0.0:0.0661	.	392;365	B4DYU2;Q96MW5	.;COG8_HUMAN	C	365	ENSP00000305459:G365C	ENSP00000305459:G365C	G	-	1	0	COG8	67926245	1.000000	0.71417	0.998000	0.56505	0.524000	0.34500	4.633000	0.61318	1.567000	0.49668	0.563000	0.77884	GGT			0.552	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268948.2		NM_032382	
DBNDD1	79007	mdanderson.org	37	16	90075739	90075739	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr16:90075739C>T	ENST00000002501.6	-	2	262	c.131G>A	c.(130-132)gGc>gAc	p.G44D	DBNDD1_ENST00000304733.3_Missense_Mutation_p.G64D|DBNDD1_ENST00000568838.1_Missense_Mutation_p.G164D|DBNDD1_ENST00000392973.3_Missense_Mutation_p.G50D	NM_001042610.1	NP_001036075.1	Q9H9R9	DBND1_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 1	44						cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)|lung(1)	3		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0275)		TACTGGGATGCCCCCGACCTC	0.687																																					p.G64D													.	.			0			c.G191A												58.0	72.0	67.0					16																	90075739		2079	4188	6267	SO:0001583	missense	79007	exon2			GGGATGCCCCCGA	AK090696	CCDS10991.2, CCDS42223.1, CCDS73931.1	16q24.3	2008-02-05			ENSG00000003249	ENSG00000003249			28455	protein-coding gene	gene with protein product						12477932	Standard	NM_001288708		Approved	MGC3101, FLJ12582	uc002fqe.1	Q9H9R9	OTTHUMG00000138984	ENST00000002501.6:c.131G>A	16.37:g.90075739C>T	ENSP00000002501:p.Gly44Asp		41	0	0		40	0.08	3	NM_024043	22	0.00	0	B4DQS3|Q69YT2|Q9BW25	Missense_Mutation	SNP	ENST00000002501.6	37	CCDS42223.1	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972126	0.53614	.	.	ENSG00000003249	ENST00000304733;ENST00000002501;ENST00000392973	T;T	0.33865	1.39;1.39	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.62048	0.2396	M	0.78637	2.42	0.25987	N	0.982296	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.985	T	0.58864	-0.7561	9	.	.	.	-47.947	17.452	0.87594	0.0:1.0:0.0:0.0	.	44;64	Q9H9R9;Q9H9R9-2	DBND1_HUMAN;.	D	64;44;164	ENSP00000306407:G64D;ENSP00000002501:G44D	.	G	-	2	0	DBNDD1	88603240	0.974000	0.33945	0.658000	0.29665	0.586000	0.36452	4.066000	0.57520	2.216000	0.71823	0.467000	0.42956	GGC			0.687	DBNDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272872.1		NM_024043	
LRRC37BP1	147172	broad.mit.edu	37	17	28961033	28961033	+	RNA	SNP	T	T	G	rs397833613		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:28961033T>G	ENST00000417404.1	+	0	1291									leucine rich repeat containing 37B pseudogene 1																		AGTTCCAGGATATGACTATAA	0.264																																					.													.	.			0			.																																											0	.			CCAGGATATGACT	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28961033T>G			86	0	0		100	0.04	4	.	21	0.00	0		RNA	SNP	ENST00000417404.1	37																																																																																						0.264	LRRC37BP1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000256203.1		NR_015341	
STAC2	342667	bcgsc.ca	37	17	37381749	37381749	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:37381749C>T	ENST00000333461.5	-	1	376	c.7G>A	c.(7-9)Gag>Aag	p.E3K		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	3					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						TCGCTCATCTCGGTCATGGTT	0.692																																					p.E3K													.	STAC2	47		0			c.G7A												76.0	58.0	64.0					17																	37381749		2203	4300	6503	SO:0001583	missense	342667	exon1			TCATCTCGGTCAT	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.7G>A	17.37:g.37381749C>T	ENSP00000327509:p.Glu3Lys		32	0	0		39	0.10	4	NM_198993	1	0.00	0	Q32MA3	Missense_Mutation	SNP	ENST00000333461.5	37	CCDS11335.1	.	.	.	.	.	.	.	.	.	.	c	35	5.537964	0.96460	.	.	ENSG00000141750	ENST00000333461	D	0.81579	-1.51	5.27	5.27	0.74061	.	0.314323	0.23317	N	0.049483	T	0.79329	0.4427	N	0.22421	0.69	0.36809	D	0.885785	D	0.71674	0.998	P	0.55222	0.771	D	0.84536	0.0636	10	0.87932	D	0	-4.3934	14.3984	0.67027	0.0:1.0:0.0:0.0	.	3	Q6ZMT1	STAC2_HUMAN	K	3	ENSP00000327509:E3K	ENSP00000327509:E3K	E	-	1	0	STAC2	34635275	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.859000	0.62954	2.469000	0.83416	0.455000	0.32223	GAG			0.692	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444533.2		NM_198993	
LOC100505782	100505782	ucsc.edu	37	17	39566191	39566191	+	RNA	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:39566191C>A	ENST00000432258.1	+	0	1605				AC003958.2_ENST00000430006.1_RNA																							TGCACAGAATCTGGGGTAAGA	0.468																																					.													.	.			0			.																																											100505782	.			CAGAATCTGGGGT																													17.37:g.39566191C>A			12	0	0		13	0.31	4	.	0		0		Splice_Site	SNP	ENST00000432258.1	37																																																																																						0.468	AC003958.2-002	KNOWN	basic	antisense	antisense		OTTHUMT00000257900.2			
CDC27	996	hgsc.bcm.edu	37	17	45216115	45216115	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:45216115T>A	ENST00000066544.3	-	13	1787	c.1694A>T	c.(1693-1695)aAt>aTt	p.N565I	CDC27_ENST00000446365.2_Missense_Mutation_p.N504I|CDC27_ENST00000531206.1_Missense_Mutation_p.N571I|CDC27_ENST00000527547.1_Missense_Mutation_p.N564I	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	565					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)	p.N565I(1)|p.N571I(1)		NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						CTCTGGCGAATTTTTATCCAT	0.353																																					p.N571I													CDC27_ENST00000531206,NS,carcinoma,0,2	CDC27_ENST00000531206	0	2	2	Substitution - Missense(2)	ovary(2)	c.A1712T												50.0	55.0	54.0					17																	45216115		2201	4299	6500	SO:0001583	missense	996	exon13			GGCGAATTTTTAT	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.1694A>T	17.37:g.45216115T>A	ENSP00000066544:p.Asn565Ile		60	0	0		33	0.09	3	NM_001114091	53	0.00	0	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.271461	0.80469	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.62	5.62	0.85841	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.041764	0.85682	D	0.000000	T	0.53997	0.1831	L	0.58810	1.83	0.58432	D	0.999999	D;P;D;P	0.57257	0.979;0.952;0.978;0.914	P;P;P;B	0.56788	0.806;0.546;0.645;0.36	T	0.52019	-0.8631	10	0.37606	T	0.19	-4.6177	13.77	0.63019	0.0:0.0:0.0:1.0	.	504;564;571;565	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	I	565;571;504;564	ENSP00000066544:N565I;ENSP00000434614:N571I;ENSP00000392802:N504I;ENSP00000437339:N564I	ENSP00000066544:N565I	N	-	2	0	CDC27	42571114	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.893000	0.56243	2.141000	0.66446	0.528000	0.53228	AAT			0.353	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000389742.2			
USP32	84669	mdanderson.org	37	17	58303401	58303401	+	Splice_Site	SNP	G	G	A	rs76017156	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:58303401G>A	ENST00000300896.4	-	13	1625	c.1431C>T	c.(1429-1431)agC>agT	p.S477S	USP32_ENST00000592339.1_Splice_Site_p.S147S	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	477	DUSP. {ECO:0000255|PROSITE- ProRule:PRU00613}.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CATATTTACCGCTGCCAGCAG	0.373													G|||	3	0.000599042	0.0023	0.0	5008	,	,		17518	0.0		0.0	False		,,,				2504	0.0				p.S477S													.	.			0			c.C1431T							G		30,4376	36.8+/-68.6	0,30,2173	99.0	100.0	100.0		1431	-1.8	0.2	17	dbSNP_131	100	1,8599		0,1,4299	yes	coding-synonymous-near-splice	USP32	NM_032582.3		0,31,6472	AA,AG,GG		0.0116,0.6809,0.2384		477/1605	58303401	31,12975	2203	4300	6503	SO:0001630	splice_region_variant	84669	exon13			TTTACCGCTGCCA	AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.1432+1C>T	17.37:g.58303401G>A			61	0	0		56	0.05	3	NM_032582	54	0.00	0	Q7Z5T3|Q9BX85|Q9Y591	Silent	SNP	ENST00000300896.4	37	CCDS32697.1																																																																																			0.002		0.373	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449235.2		NM_032582	Silent
BPTF	2186	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	65890193	65890193	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr17:65890193G>T	ENST00000321892.4	+	9	2894	c.2833G>T	c.(2833-2835)Gaa>Taa	p.E945*	BPTF_ENST00000335221.5_Nonsense_Mutation_p.E945*|BPTF_ENST00000424123.3_Nonsense_Mutation_p.E806*|BPTF_ENST00000306378.6_Nonsense_Mutation_p.E819*			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	945					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.E945*(1)|p.E819*(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CAAACCCAGAGAATTTGCATT	0.378																																					p.E945X													BPTF_ENST00000335221,caecum,carcinoma,0,4	BPTF_ENST00000335221	0	4	2	Substitution - Nonsense(2)	large_intestine(2)	c.G2833T												144.0	136.0	139.0					17																	65890193		2203	4300	6503	SO:0001587	stop_gained	2186	exon9			CCCAGAGAATTTG	AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.2833G>T	17.37:g.65890193G>T	ENSP00000315454:p.Glu945*		59	0	0		82	0.28	23	NM_004459	21	0.14	3	Q6NX67|Q7Z7D6|Q9UIG2	Nonsense_Mutation	SNP	ENST00000321892.4	37		.	.	.	.	.	.	.	.	.	.	G	39	7.493260	0.98319	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000544778	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-18.1014	19.5998	0.95557	0.0:0.0:1.0:0.0	.	.	.	.	X	819;945;945;743	.	ENSP00000307208:E819X	E	+	1	0	BPTF	63320655	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.734000	0.98822	2.717000	0.92951	0.655000	0.94253	GAA			0.378	BPTF-201	KNOWN	basic	protein_coding	protein_coding				NM_182641, NM_004459	
PARD6G	84552	hgsc.bcm.edu	37	18	77920329	77920329	+	Intron	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr18:77920329G>T	ENST00000353265.3	-	3	493				AC139100.2_ENST00000586421.1_Intron|AC139100.2_ENST00000589574.1_Intron|AC139100.2_ENST00000587254.1_Intron|AC139100.2_ENST00000585422.1_Intron	NM_032510.3	NP_115899.1	Q9BYG4	PAR6G_HUMAN	par-6 family cell polarity regulator gamma						cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	8		all_cancers(4;5.63e-22)|all_epithelial(4;5.86e-15)|all_lung(4;1.32e-05)|Ovarian(4;1.33e-05)|Lung NSC(4;2.77e-05)|Esophageal squamous(42;0.0157)|all_hematologic(56;0.13)|Melanoma(33;0.144)		Epithelial(2;1.48e-13)|all cancers(1;5.77e-13)|OV - Ovarian serous cystadenocarcinoma(15;2.74e-10)|BRCA - Breast invasive adenocarcinoma(31;0.00166)|STAD - Stomach adenocarcinoma(84;0.18)|Lung(128;0.23)		GGGGCTGGGTGTGCATGTCTG	0.423																																					.													.	.			0			.																																									SO:0001627	intron_variant	100130522	.			CTGGGTGTGCATG		CCDS12022.1	18q23	2013-08-28	2013-08-28		ENSG00000178184	ENSG00000178184			16076	protein-coding gene	gene with protein product		608976	"""par-6 (partitioning defective 6, C.elegans) homolog gamma"", ""par-6 partitioning defective 6 homolog gamma (C. elegans)"""			11260256	Standard	NM_032510		Approved	PAR-6G, PAR6gamma	uc002lny.3	Q9BYG4	OTTHUMG00000132922	ENST00000353265.3:c.296-1840C>A	18.37:g.77920329G>T			85	0	0		79	0.06	5	.	0		0	A8QM57	RNA	SNP	ENST00000353265.3	37	CCDS12022.1																																																																																					0.423	PARD6G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256435.2		NM_032510	
ARRDC5	645432	ucsc.edu;bcgsc.ca;mdanderson.org	37	19	4891239	4891239	+	Missense_Mutation	SNP	G	G	T	rs2297506		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:4891239G>T	ENST00000381781.2	-	3	847	c.848C>A	c.(847-849)aCg>aAg	p.T283K	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	283										endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		ACCGTCCTGCGTGCTGCTGCT	0.607																																					p.T283K													.	ARRDC5	19		0			c.C848A												115.0	127.0	123.0					19																	4891239		2139	4235	6374	SO:0001583	missense	645432	exon3			TCCTGCGTGCTGC		CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.848C>A	19.37:g.4891239G>T	ENSP00000371200:p.Thr283Lys		56	0	0		42	0.10	4	NM_001080523	0		0		Missense_Mutation	SNP	ENST00000381781.2	37	CCDS45929.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099038	0.37048	.	.	ENSG00000205784	ENST00000381781	T	0.17213	2.29	4.91	-9.45	0.00600	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	40.696800	0.00166	N	0.000004	T	0.08133	0.0203	N	0.19112	0.55	0.09310	N	1	B	0.24426	0.103	B	0.27076	0.076	T	0.20505	-1.0273	10	0.25106	T	0.35	1.7516	1.567	0.02606	0.2366:0.3687:0.1833:0.2114	.	283	A6NEK1	ARRD5_HUMAN	K	283	ENSP00000371200:T283K	ENSP00000371200:T283K	T	-	2	0	ARRDC5	4842239	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.714000	0.01881	-1.563000	0.01680	-0.133000	0.14855	ACG			0.607	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450443.1		XM_292803	
ZNF823	55552	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11833770	11833770	+	Silent	SNP	T	T	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:11833770T>C	ENST00000341191.6	-	4	732	c.579A>G	c.(577-579)aaA>aaG	p.K193K	ZNF823_ENST00000545749.1_Silent_p.K11K	NM_001080493.2	NP_001073962.1	P16415	ZN823_HUMAN	zinc finger protein 823	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)	26						ACAACTTACATTTATAAGGTC	0.418										HNSCC(68;0.2)																											p.K193K													ZNF823_ENST00000341191,colon,carcinoma,-1,2	ZNF823_ENST00000341191	-1	2	0			c.A579G												90.0	96.0	94.0					19																	11833770		2199	4299	6498	SO:0001819	synonymous_variant	55552	exon4			CTTACATTTATAA	X51760	CCDS45981.1	19p13.2	2013-01-08			ENSG00000197933	ENSG00000197933		"""Zinc fingers, C2H2-type"", ""-"""	30936	protein-coding gene	gene with protein product	"""ZFP 36 for a zinc finger protein"""						Standard	XM_006722789		Approved	HSZFP36	uc002msm.2	P16415	OTTHUMG00000156528	ENST00000341191.6:c.579A>G	19.37:g.11833770T>C			108	0	0		106	0.31	33	NM_001080493	6	0.67	4	A0PJL4|B7Z8D4|Q6P4A9	Silent	SNP	ENST00000341191.6	37	CCDS45981.1																																																																																					0.418	ZNF823-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344516.2		NM_001080493	
SUGP2	10147	hgsc.bcm.edu	37	19	19135472	19135472	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:19135472G>T	ENST00000601879.1	-	3	1982	c.1685C>A	c.(1684-1686)aCg>aAg	p.T562K	SUGP2_ENST00000456085.2_Missense_Mutation_p.T331K|SUGP2_ENST00000598202.1_5'Flank|SUGP2_ENST00000600377.1_Missense_Mutation_p.T576K|SUGP2_ENST00000337018.6_Missense_Mutation_p.T562K|SUGP2_ENST00000452918.2_Missense_Mutation_p.T562K			Q8IX01	SUGP2_HUMAN	SURP and G patch domain containing 2	562					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						TTCAGGTTTCGTAGGAGGAAT	0.478																																					p.T562K													SUGP2,NS,carcinoma,0,1	SUGP2	0	1	0			c.C1685A												96.0	92.0	93.0					19																	19135472		2203	4300	6503	SO:0001583	missense	10147	exon3			GGTTTCGTAGGAG	AB002363	CCDS12392.1	19p13	2013-01-28	2010-08-10	2010-08-10	ENSG00000064607	ENSG00000064607		"""G patch domain containing"""	18641	protein-coding gene	gene with protein product		607993	"""splicing factor, arginine/serine-rich 14"""	SFRS14		12594045	Standard	NM_014884		Approved	KIAA0365	uc002nkx.2	Q8IX01		ENST00000601879.1:c.1685C>A	19.37:g.19135472G>T	ENSP00000472286:p.Thr562Lys		74	0	0		46	0.04	2	NM_014884	55	0.00	0	C9JI71|O15071|O60369|Q5JPH7|Q8WUF7	Missense_Mutation	SNP	ENST00000601879.1	37	CCDS12392.1	.	.	.	.	.	.	.	.	.	.	g	11.33	1.607626	0.28623	.	.	ENSG00000064607	ENST00000337018;ENST00000330854;ENST00000452918;ENST00000456085	T;T;T;T	0.12039	2.93;2.93;2.93;2.72	4.97	-1.27	0.09347	.	0.837534	0.10478	N	0.669922	T	0.06325	0.0163	N	0.14661	0.345	0.09310	N	1	P;B;B	0.34724	0.465;0.029;0.307	B;B;B	0.26310	0.061;0.013;0.068	T	0.37686	-0.9695	10	0.25106	T	0.35	0.1306	9.6419	0.39844	0.3688:0.0:0.6312:0.0	.	331;562;562	E7ETX7;A8K5G0;Q8IX01	.;.;SUGP2_HUMAN	K	562;562;562;331	ENSP00000337926:T562K;ENSP00000332373:T562K;ENSP00000389380:T562K;ENSP00000409603:T331K	ENSP00000332373:T562K	T	-	2	0	SUGP2	18996472	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.907000	0.04067	-0.374000	0.07967	-1.380000	0.01176	ACG			0.478	SUGP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464627.1		NM_001017392	
CEBPA	1050	broad.mit.edu;mdanderson.org	37	19	33792544	33792544	+	Silent	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:33792544C>A	ENST00000498907.2	-	1	926	c.777G>T	c.(775-777)gcG>gcT	p.A259A	CTD-2540B15.7_ENST00000587312.1_RNA|CEBPA-AS1_ENST00000592982.2_RNA|CTD-2540B15.11_ENST00000589932.1_RNA	NM_004364.3	NP_004355.2	P49715	CEBPA_HUMAN	CCAAT/enhancer binding protein (C/EBP), alpha	259					acute-phase response (GO:0006953)|brown fat cell differentiation (GO:0050873)|cell maturation (GO:0048469)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|cholesterol metabolic process (GO:0008203)|cytokine-mediated signaling pathway (GO:0019221)|embryonic placenta development (GO:0001892)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|liver development (GO:0001889)|lung development (GO:0030324)|macrophage differentiation (GO:0030225)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to glucocorticoid (GO:0051384)|response to vitamin B2 (GO:0033274)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|urea cycle (GO:0000050)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.H219fs*53(1)|p.H200_K352>Q(1)|p.P247fs*54(1)|p.?(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(912)|lung(5)|prostate(1)|stomach(1)	920	Esophageal squamous(110;0.137)					GGTCGGGGTGCGCGGCGCCCA	0.786			"""Mis, N, F"""		"""AML, MDS"""				Acute Myeloid Leukemia, Familial, associated with CEBPA germline mutation																												p.A259A				Dom	yes		19	19q13.1	1050	"""CCAAT/enhancer binding protein (C/EBP), alpha"""		L	.	CEBPA	986		4	Deletion - Frameshift(2)|Unknown(1)|Complex - deletion inframe(1)	haematopoietic_and_lymphoid_tissue(4)	c.G777T												4.0	5.0	5.0					19																	33792544		1672	3674	5346	SO:0001819	synonymous_variant	1050	exon1	Familial Cancer Database	Familial AML	GGGGTGCGCGGCG	M37197	CCDS54243.1	19q13.1	2014-09-17				ENSG00000245848		"""basic leucine zipper proteins"""	1833	protein-coding gene	gene with protein product		116897		CEBP		1535333, 1840554	Standard	NM_004364		Approved	C/EBP-alpha	uc002nun.3	P49715		ENST00000498907.2:c.777G>T	19.37:g.33792544C>A			15	0	0		11	0.73	8	NM_004364	1	0.00	0	A7LNP2|P78319|Q05CA4	Silent	SNP	ENST00000498907.2	37	CCDS54243.1																																																																																					0.786	CEBPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365012.1		NM_004364	
ZNF30	90075	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	35434283	35434283	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:35434283A>G	ENST00000601142.1	+	5	650	c.413A>G	c.(412-414)cAt>cGt	p.H138R	ZNF30_ENST00000303586.7_Missense_Mutation_p.H139R|ZNF30_ENST00000595818.1_3'UTR|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000439785.1_Missense_Mutation_p.H139R|ZNF30_ENST00000426813.2_Missense_Mutation_p.H57R			P17039	ZNF30_HUMAN	zinc finger protein 30	138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		CCTGTTCAACATGAAAGAATA	0.373																																					p.H139R													.	.			0			c.A416G												100.0	97.0	98.0					19																	35434283		1904	4134	6038	SO:0001583	missense	90075	exon5			TTCAACATGAAAG	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.413A>G	19.37:g.35434283A>G	ENSP00000469954:p.His138Arg		157	0	0		136	0.28	38	NM_001099438	2	0.50	1	A5PLP1|A8K320|B4DIC0|Q6N068	Missense_Mutation	SNP	ENST00000601142.1	37	CCDS46045.1	.	.	.	.	.	.	.	.	.	.	A	18.24	3.580002	0.65992	.	.	ENSG00000168661	ENST00000439785;ENST00000303586;ENST00000426813	T;T	0.52526	0.66;0.66	1.91	1.91	0.25777	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71247	0.3317	M	0.93375	3.41	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.965;0.99	T	0.57642	-0.7776	9	0.72032	D	0.01	.	5.7491	0.18136	1.0:0.0:0.0:0.0	.	139;138	P17039-2;P17039	.;ZNF30_HUMAN	R	139;138;57	ENSP00000403441:H139R;ENSP00000416457:H57R	ENSP00000303889:H138R	H	+	2	0	ZNF30	40126123	0.387000	0.25188	0.751000	0.31187	0.836000	0.47400	2.624000	0.46444	0.873000	0.35799	0.416000	0.27883	CAT			0.373	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000464432.1		NM_194325	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	39057585	39057585	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:39057585C>T	ENST00000359596.3	+	92	13472	c.13472C>T	c.(13471-13473)cCa>cTa	p.P4491L	RYR1_ENST00000360985.3_Missense_Mutation_p.P4486L|RYR1_ENST00000355481.4_Missense_Mutation_p.P4486L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4491	Pro-rich.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCGCCAGAGCCAGAGCCCGAG	0.647																																					p.P4491L													RYR1,caecum,carcinoma,+1,1	RYR1	1	1	0			c.C13472T												40.0	39.0	40.0					19																	39057585		2202	4298	6500	SO:0001583	missense	6261	exon92			CAGAGCCAGAGCC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.13472C>T	19.37:g.39057585C>T	ENSP00000352608:p.Pro4491Leu		35	0	0		42	0.29	12	NM_000540	38	0.16	6	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	1.491	-0.554667	0.03996	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.93076	-3.16;-3.16;-3.16	3.93	1.71	0.24356	Ryanodine Receptor TM 4-6 (1);	0.606936	0.13185	U	0.407200	D	0.84009	0.5378	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.71417	-0.4599	10	0.37606	T	0.19	.	2.3396	0.04256	0.3006:0.4376:0.1609:0.101	.	4486;4491	P21817-2;P21817	.;RYR1_HUMAN	L	4491;4486;4486	ENSP00000352608:P4491L;ENSP00000347667:P4486L;ENSP00000354254:P4486L	ENSP00000347667:P4486L	P	+	2	0	RYR1	43749425	0.457000	0.25752	0.095000	0.20976	0.009000	0.06853	2.127000	0.42035	0.591000	0.29711	0.313000	0.20887	CCA			0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
EGLN2	112398	mdanderson.org	37	19	41306600	41306600	+	Silent	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:41306600C>A	ENST00000593726.1	+	1	1151	c.123C>A	c.(121-123)ccC>ccA	p.P41P	CTC-490E21.12_ENST00000601627.1_5'Flank|EGLN2_ENST00000594140.1_5'Flank|RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000303961.4_Silent_p.P41P|EGLN2_ENST00000406058.2_Silent_p.P41P			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	41					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	GTTACCTGCCCTGTCCCCTGC	0.652																																					p.P41P													.	.			0			c.C123A												55.0	47.0	50.0					19																	41306600		2203	4300	6503	SO:0001819	synonymous_variant	112398	exon2			CCTGCCCTGTCCC	AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.123C>A	19.37:g.41306600C>A			45	0	0		37	0.08	3	NM_080732	79	0.00	0	A8K5S0|Q8WWY4|Q9BV14	Silent	SNP	ENST00000593726.1	37	CCDS12567.1																																																																																					0.652	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463218.1			
FLT3LG	2323	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	49979435	49979435	+	Missense_Mutation	SNP	G	G	C	rs367551792		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:49979435G>C	ENST00000594009.1	+	3	257	c.178G>C	c.(178-180)Gtg>Ctg	p.V60L	FLT3LG_ENST00000344019.3_Missense_Mutation_p.V60L|FLT3LG_ENST00000204637.2_5'UTR|CTD-3148I10.9_ENST00000599536.1_Intron|FLT3LG_ENST00000600429.1_Missense_Mutation_p.V60L|FLT3LG_ENST00000597551.1_Missense_Mutation_p.V60L|FLT3LG_ENST00000595510.1_5'UTR|CTD-3148I10.15_ENST00000595815.1_RNA|FLT3LG_ENST00000596435.1_Missense_Mutation_p.V60L	NM_001204503.1	NP_001191432.1	P49771	FLT3L_HUMAN	fms-related tyrosine kinase 3 ligand	60					embryonic hemopoiesis (GO:0035162)|lymphocyte differentiation (GO:0030098)|positive regulation of cell proliferation (GO:0008284)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein phosphorylation (GO:0001934)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)|membrane (GO:0016020)	receptor binding (GO:0005102)			large_intestine(2)|lung(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	10		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CCCAGTCACCGTGGCCTCCAA	0.567											OREG0025623	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V60L													.	.			0			c.G178C												165.0	165.0	165.0					19																	49979435		2203	4300	6503	SO:0001583	missense	2323	exon3			GTCACCGTGGCCT	U04806	CCDS12767.1, CCDS62753.1	19q13.3	2014-01-30				ENSG00000090554		"""Endogenous ligands"""	3766	protein-coding gene	gene with protein product		600007				8145851, 7824267	Standard	NM_001204502		Approved		uc010yau.2	P49771		ENST00000594009.1:c.178G>C	19.37:g.49979435G>C	ENSP00000469613:p.Val60Leu		45	0	0	966	49	0.27	13	NM_001204503	4	0.00	0	A0AVC2|B9EGH2|Q05C96	Missense_Mutation	SNP	ENST00000594009.1	37	CCDS12767.1	.	.	.	.	.	.	.	.	.	.	G	8.591	0.884629	0.17467	.	.	ENSG00000090554	ENST00000204637;ENST00000344019	.	.	.	4.04	2.95	0.34219	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.227351	0.35436	U	0.003217	T	0.33235	0.0856	L	0.34521	1.04	0.09310	N	1	B	0.28783	0.222	B	0.34093	0.175	T	0.32693	-0.9897	9	0.72032	D	0.01	-12.4909	9.7282	0.40344	0.0:0.2126:0.7873:0.0	.	60	P49771	FLT3L_HUMAN	L	60	.	ENSP00000204637:V60L	V	+	1	0	FLT3LG	54671247	0.833000	0.29383	0.201000	0.23476	0.130000	0.20726	1.303000	0.33470	0.761000	0.33130	0.542000	0.68232	GTG			0.567	FLT3LG-007	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465305.1			
FAM71E2	284418	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	55870578	55870578	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr19:55870578G>A	ENST00000424985.3	-	9	1851	c.1658C>T	c.(1657-1659)cCg>cTg	p.P553L	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.R103C	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	553	Pro-rich.									NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TGAGGCAGGCGGGCTCAGCGC	0.592																																					p.P553L													.	.			0			c.C1658T												7.0	9.0	9.0					19																	55870578		690	1585	2275	SO:0001583	missense	284418	exon9			GCAGGCGGGCTCA	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.1658C>T	19.37:g.55870578G>A	ENSP00000398617:p.Pro553Leu		97	0	0		60	0.30	18	NM_001145402	0		0	Q8ND99	Missense_Mutation	SNP	ENST00000424985.3	37		.	.	.	.	.	.	.	.	.	.	N	8.117	0.780143	0.16120	.	.	ENSG00000180043	ENST00000424985	T	0.12361	2.69	2.12	-0.236	0.13067	.	.	.	.	.	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.35968	-0.9767	9	0.45353	T	0.12	.	5.0665	0.14585	0.1409:0.215:0.6441:0.0	.	553	Q8N5Q1	F71E2_HUMAN	L	553	ENSP00000398617:P553L	ENSP00000398617:P553L	P	-	2	0	FAM71E2	60562390	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.247000	0.18179	0.018000	0.15052	-0.308000	0.09152	CCG			0.592	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000409063.4		NM_001145402	
MSH2	4436	mdanderson.org	37	2	47643474	47643474	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr2:47643474G>T	ENST00000233146.2	+	6	1205	c.982G>T	c.(982-984)Gcc>Tcc	p.A328S	MSH2_ENST00000543555.1_Missense_Mutation_p.A262S|MSH2_ENST00000406134.1_Missense_Mutation_p.A328S	NM_000251.2	NP_000242.1	P43246	MSH2_HUMAN	mutS homolog 2	328			A -> P (shows significantly decreased repair efficiency when associated with variant Ser-127; presumed to enhance cancer risk considerably when associated with variant Ser-127).		ATP catabolic process (GO:0006200)|B cell differentiation (GO:0030183)|B cell mediated immunity (GO:0019724)|cell cycle arrest (GO:0007050)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|germ cell development (GO:0007281)|in utero embryonic development (GO:0001701)|intra-S DNA damage checkpoint (GO:0031573)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|isotype switching (GO:0045190)|maintenance of DNA repeat elements (GO:0043570)|male gonad development (GO:0008584)|meiotic gene conversion (GO:0006311)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reciprocal meiotic recombination (GO:0045128)|oxidative phosphorylation (GO:0006119)|positive regulation of helicase activity (GO:0051096)|postreplication repair (GO:0006301)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSalpha complex (GO:0032301)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|guanine/thymine mispair binding (GO:0032137)|heteroduplex DNA loop binding (GO:0000404)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|Y-form DNA binding (GO:0000403)	p.0?(2)|p.?(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(5)|large_intestine(50)|lung(18)|ovary(5)|prostate(2)|skin(3)|small_intestine(1)|stomach(2)|urinary_tract(1)	112		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTCTCTGGCTGCCTTGCTGAA	0.408			"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian"""	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.A328S			yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p22-p21	4436	mutS homolog 2 (E. coli)		E	MSH2,caecum,carcinoma,-2,2	MSH2	-2	2	3	Whole gene deletion(2)|Unknown(1)	haematopoietic_and_lymphoid_tissue(3)	c.G982T												148.0	150.0	149.0					2																	47643474		2203	4300	6503	SO:0001583	missense	4436	exon6	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CTGGCTGCCTTGC	U03911	CCDS1834.1, CCDS58709.1	2p21	2014-09-17	2013-09-12		ENSG00000095002	ENSG00000095002			7325	protein-coding gene	gene with protein product		609309	"""mutS (E. coli) homolog 2 (colon cancer, nonpolyposis type 1)"", ""mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)"""	COCA1		8484120, 9843200	Standard	NM_000251		Approved	HNPCC, HNPCC1	uc002rvy.2	P43246	OTTHUMG00000128861	ENST00000233146.2:c.982G>T	2.37:g.47643474G>T	ENSP00000233146:p.Ala328Ser		66	0	0		44	0.07	3	NM_000251	301	0.01	2	B4E2Z2|O75488	Missense_Mutation	SNP	ENST00000233146.2	37	CCDS1834.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084253	0.76642	.	.	ENSG00000095002	ENST00000233146;ENST00000543555;ENST00000406134;ENST00000419559;ENST00000432737;ENST00000453755;ENST00000448533;ENST00000394792;ENST00000413880	D;D;D	0.90900	-2.75;-2.75;-2.75	5.62	5.62	0.85841	DNA mismatch repair protein MutS, core (3);	0.202214	0.51477	D	0.000085	T	0.82148	0.4974	N	0.03983	-0.305	0.50632	D	0.999885	B;B;B	0.19331	0.004;0.035;0.006	B;B;B	0.19666	0.007;0.026;0.014	T	0.77696	-0.2491	10	0.72032	D	0.01	-6.2078	19.6637	0.95885	0.0:0.0:1.0:0.0	.	262;328;328	B4E2Z2;E9PHA6;P43246	.;.;MSH2_HUMAN	S	328;262;328;328;328;328;328;328;114	ENSP00000233146:A328S;ENSP00000442697:A262S;ENSP00000384199:A328S	ENSP00000233146:A328S	A	+	1	0	MSH2	47496978	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	9.716000	0.98752	2.646000	0.89796	0.467000	0.42956	GCC			0.408	MSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250805.3			
DCTN1	1639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	74592776	74592776	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr2:74592776C>G	ENST00000361874.3	-	25	3212	c.2895G>C	c.(2893-2895)gaG>gaC	p.E965D	DCTN1_ENST00000394003.3_Missense_Mutation_p.E958D|DCTN1_ENST00000495643.1_5'Flank|DCTN1_ENST00000407639.2_Missense_Mutation_p.E831D|DCTN1_ENST00000409438.1_Missense_Mutation_p.E831D|DCTN1_ENST00000409567.3_Missense_Mutation_p.E945D|DCTN1_ENST00000409868.1_Missense_Mutation_p.E948D|DCTN1_ENST00000409240.1_Missense_Mutation_p.E928D|RP11-287D1.3_ENST00000451608.2_5'Flank	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	965					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CCTCACTTAGCTCCTCTCCCT	0.562																																					p.E965D													.	.			0			c.G2895C												93.0	83.0	86.0					2																	74592776		2203	4300	6503	SO:0001583	missense	1639	exon25			ACTTAGCTCCTCT		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2895G>C	2.37:g.74592776C>G	ENSP00000354791:p.Glu965Asp		79	0	0		90	0.21	19	NM_004082	377	0.21	81	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	37	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	C	17.75	3.466114	0.63625	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000393999;ENST00000407639;ENST00000409438;ENST00000409240;ENST00000409868;ENST00000409567	D;D;D;D;D;D;D	0.82344	-1.6;-1.6;-1.6;-1.6;-1.6;-1.6;-1.6	4.83	0.0692	0.14373	.	0.000000	0.43747	D	0.000537	D	0.87216	0.6122	M	0.66939	2.045	0.58432	D	0.999999	P;D;D;P;P;D	0.89917	0.849;1.0;0.984;0.791;0.886;0.99	P;D;D;P;P;D	0.91635	0.461;0.999;0.935;0.51;0.787;0.971	T	0.83158	-0.0100	10	0.32370	T	0.25	-12.8781	10.466	0.44607	0.0:0.7027:0.0:0.2973	.	945;928;965;958;831;831	E9PGE1;E9PFS5;Q14203;A8MY36;Q14203-2;G5E9H4	.;.;DCTN1_HUMAN;.;.;.	D	965;958;948;831;831;928;948;945	ENSP00000354791:E965D;ENSP00000377571:E958D;ENSP00000384844:E831D;ENSP00000387270:E831D;ENSP00000386406:E928D;ENSP00000387327:E948D;ENSP00000386843:E945D	ENSP00000354791:E965D	E	-	3	2	DCTN1	74446284	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	1.681000	0.37618	-0.031000	0.13781	-0.258000	0.10820	GAG			0.562	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252227.3		NM_004082	
KDM3A	55818	mdanderson.org	37	2	86711213	86711213	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr2:86711213G>T	ENST00000409556.1	+	20	3391	c.3026G>T	c.(3025-3027)tGt>tTt	p.C1009F	KDM3A_ENST00000542128.1_Missense_Mutation_p.C957F|KDM3A_ENST00000312912.5_Missense_Mutation_p.C1009F|KDM3A_ENST00000409064.1_Missense_Mutation_p.C1009F			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	1009					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						CTAGTTAATTGTAGGACCAAT	0.423																																					p.C1009F	NSCLC(96;1150 1523 6936 46253 49736)												.	.			0			c.G3026T												116.0	116.0	116.0					2																	86711213		2203	4300	6503	SO:0001583	missense	55818	exon19			TTAATTGTAGGAC	AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.3026G>T	2.37:g.86711213G>T	ENSP00000386660:p.Cys1009Phe		86	0	0		106	0.05	5	NM_001146688	56	0.00	0	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Missense_Mutation	SNP	ENST00000409556.1	37	CCDS1990.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.687731	0.88639	.	.	ENSG00000115548	ENST00000409556;ENST00000540058;ENST00000312912;ENST00000409064;ENST00000542128	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.86070	0.5845	M	0.84156	2.68	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	1.0;0.999	D	0.86907	0.2058	10	0.66056	D	0.02	.	19.0872	0.93209	0.0:0.0:1.0:0.0	.	957;1009	F5H070;Q9Y4C1	.;KDM3A_HUMAN	F	1009;1009;1009;1009;957	ENSP00000386660:C1009F;ENSP00000323659:C1009F;ENSP00000386516:C1009F;ENSP00000438324:C957F	ENSP00000323659:C1009F	C	+	2	0	KDM3A	86564724	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.752000	0.94435	0.655000	0.94253	TGT			0.423	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252522.2		NM_018433	
STAU1	6780	mdanderson.org	37	20	47734337	47734337	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr20:47734337G>T	ENST00000371856.2	-	11	1896	c.1486C>A	c.(1486-1488)Ctt>Att	p.L496I	STAU1_ENST00000340954.7_Missense_Mutation_p.L415I|STAU1_ENST00000371802.1_Missense_Mutation_p.L421I|STAU1_ENST00000371828.3_Missense_Mutation_p.L421I|STAU1_ENST00000360426.4_Missense_Mutation_p.L415I|STAU1_ENST00000347458.5_Missense_Mutation_p.L415I|STAU1_ENST00000371792.1_Missense_Mutation_p.L413I	NM_017453.2	NP_059347.2	O95793	STAU1_HUMAN	staufen double-stranded RNA binding protein 1	496					intracellular mRNA localization (GO:0008298)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|rough endoplasmic reticulum (GO:0005791)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	23			BRCA - Breast invasive adenocarcinoma(12;0.000644)|Colorectal(8;0.198)			ACTCTGGAAAGATAGTCCAGT	0.517																																					p.L496I													.	.			0			c.C1486A												67.0	66.0	67.0					20																	47734337		2203	4300	6503	SO:0001583	missense	6780	exon11			TGGAAAGATAGTC		CCDS13414.1, CCDS13415.1, CCDS33481.1	20q13.1	2014-06-13	2013-06-05	2005-11-04	ENSG00000124214	ENSG00000124214			11370	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 150"""	601716	"""staufen (Drosophila, RNA-binding protein)"", ""staufen, RNA binding protein (Drosophila)"", ""staufen, RNA binding protein, homolog 1 (Drosophila)"""	STAU		8884277, 15680326	Standard	XM_005260524		Approved	PPP1R150	uc002xud.3	O95793	OTTHUMG00000032691	ENST00000371856.2:c.1486C>A	20.37:g.47734337G>T	ENSP00000360922:p.Leu496Ile		31	0	0		20	0.10	2	NM_017453	143	0.00	0	A8K9Z4|E1P5Y1|E1P608|Q5JW29|Q6GTM4|Q9H5B4|Q9H5B5|Q9Y3Q2	Missense_Mutation	SNP	ENST00000371856.2	37	CCDS13414.1	.	.	.	.	.	.	.	.	.	.	G	32	5.134733	0.94517	.	.	ENSG00000124214	ENST00000371828;ENST00000340954;ENST00000371856;ENST00000360426;ENST00000347458;ENST00000371805;ENST00000371802;ENST00000371792	D;D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.89873	0.6841	L	0.55481	1.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.90265	0.4303	10	0.87932	D	0	-14.2071	19.6778	0.95943	0.0:0.0:1.0:0.0	.	496;421	O95793;Q5JW29	STAU1_HUMAN;.	I	421;415;496;415;415;415;421;413	ENSP00000360893:L421I;ENSP00000345425:L415I;ENSP00000360922:L496I;ENSP00000353604:L415I;ENSP00000323443:L415I;ENSP00000360867:L421I;ENSP00000360857:L413I	ENSP00000345425:L415I	L	-	1	0	STAU1	47167744	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.993000	0.88291	2.645000	0.89757	0.650000	0.86243	CTT			0.517	STAU1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079633.1		NM_017453	
MIR646HG	284757	broad.mit.edu	37	20	58883399	58883400	+	lincRNA	INS	-	-	T	rs35369169|rs111867069|rs11408280	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr20:58883399_58883400insT	ENST00000432910.1	+	0	332				MIR646_ENST00000385067.1_RNA	NR_046099.1																						ggaccgggaaacagatgcttac	0.569													T|-|T|deletion	1366	0.272764	0.4244	0.1657	5008	,	,		18567	0.127		0.2455	False		,,,				2504	0.3221				.													.	.			0			.																																											0	.			CGGGAAACAGATG																													20.37:g.58883399_58883400insT			7	0	0		10	0.90	9	.	0		0		RNA	INS	ENST00000432910.1	37																																																																																						0.569	RP5-1043L13.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000079947.1			
SON	6651	hgsc.bcm.edu	37	21	34927489	34927489	+	Silent	SNP	G	G	C	rs545015873	byFrequency	TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr21:34927489G>C	ENST00000356577.4	+	3	6427	c.5952G>C	c.(5950-5952)cgG>cgC	p.R1984R	SON_ENST00000381679.4_Silent_p.R1984R|SON_ENST00000290239.6_Silent_p.R1984R|SON_ENST00000300278.4_Silent_p.R1984R|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1984	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1984R(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						ccagccgccggagccgcaccc	0.701													g|||	4	0.000798722	0.0023	0.0	5008	,	,		5843	0.0		0.001	False		,,,				2504	0.0				p.R1984R													SON_ENST00000300278,NS,carcinoma,0,2	SON_ENST00000300278	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.G5952C												20.0	22.0	21.0					21																	34927489		2199	4293	6492	SO:0001819	synonymous_variant	6651	exon3			CCGCCGGAGCCGC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5952G>C	21.37:g.34927489G>C			16	0	0		13	0.23	3	NM_032195	31	0.00	0	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	g	3.291	-0.145003	0.06627	.	.	ENSG00000159140	ENST00000436227	.	.	.	4.22	-0.891	0.10573	.	.	.	.	.	T	0.57519	0.2059	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	10.594	0.45327	0.0789:0.5195:0.4016:0.0	.	.	.	.	A	979	.	.	G	+	2	0	SON	33849359	0.998000	0.40836	0.805000	0.32314	0.728000	0.41692	0.803000	0.27083	-0.153000	0.11137	-0.126000	0.14955	GGA			0.701	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140978.2		NM_138927	
TMEM211	255349	mdanderson.org	37	22	25334150	25334150	+	Missense_Mutation	SNP	G	G	T	rs553917131		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr22:25334150G>T	ENST00000423535.1	-	2	305	c.306C>A	c.(304-306)agC>agA	p.S102R	TMEM211_ENST00000382744.1_Missense_Mutation_p.S31R|TMEM211_ENST00000407886.1_Missense_Mutation_p.S31R			Q6ICI0	TM211_HUMAN	transmembrane protein 211	102						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						TTGGAACACTGCTTCTCCTTG	0.522																																					p.S31R													.	.			0			c.C93A												108.0	85.0	93.0					22																	25334150		2203	4300	6503	SO:0001583	missense	255349	exon2			AACACTGCTTCTC		CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.306C>A	22.37:g.25334150G>T	ENSP00000387813:p.Ser102Arg		52	0	0		36	0.08	3	NM_001001663	0		0		Missense_Mutation	SNP	ENST00000423535.1	37		.	.	.	.	.	.	.	.	.	.	G	2.167	-0.390785	0.04932	.	.	ENSG00000206069	ENST00000407886;ENST00000423535;ENST00000382744	T;T;T	0.78246	-1.16;-0.6;-1.16	4.17	1.92	0.25849	.	0.687482	0.13244	N	0.402639	T	0.54159	0.1841	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.12156	0.007	T	0.41928	-0.9481	10	0.33940	T	0.23	-30.1335	5.9403	0.19189	0.1093:0.3019:0.5887:0.0	.	102	Q6ICI0	TM211_HUMAN	R	31;102;31	ENSP00000385494:S31R;ENSP00000387813:S102R;ENSP00000372192:S31R	ENSP00000372192:S31R	S	-	3	2	TMEM211	23664150	0.001000	0.12720	0.005000	0.12908	0.038000	0.13279	0.354000	0.20146	1.113000	0.41760	0.555000	0.69702	AGC			0.522	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001001663	
CSPG5	10675	broad.mit.edu	37	3	47619395	47619395	+	Frame_Shift_Del	DEL	C	C	-			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr3:47619395delC	ENST00000383738.2	-	2	2219	c.121delG	c.(121-123)gagfs	p.E41fs	CSPG5_ENST00000465441.1_5'UTR|CSPG5_ENST00000456150.1_5'UTR|CSPG5_ENST00000264723.4_Frame_Shift_Del_p.E41fs	NM_001206943.1|NM_001206945.1	NP_001193872.1|NP_001193874.1	O95196	CSPG5_HUMAN	chondroitin sulfate proteoglycan 5 (neuroglycan C)	41					axon regeneration (GO:0031103)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|intracellular transport (GO:0046907)|nervous system development (GO:0007399)|regulation of growth (GO:0040008)|regulation of synaptic transmission (GO:0050804)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	growth factor activity (GO:0008083)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	22				BRCA - Breast invasive adenocarcinoma(193;0.000266)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		TCTTCGGCCTCAACCGCGCTG	0.761																																					p.E41fs													.	CSPG5	46		0			c.121delG												4.0	5.0	5.0					3																	47619395		1718	3469	5187	SO:0001589	frameshift_variant	10675	exon2			CGGCCTCAACCGC	AF059274	CCDS2757.1, CCDS56252.1, CCDS56253.1, CCDS74930.1	3p21.3	2008-07-18			ENSG00000114646	ENSG00000114646			2467	protein-coding gene	gene with protein product		606775				9950058	Standard	NM_006574		Approved	NGC	uc003crp.4	O95196	OTTHUMG00000133518	ENST00000383738.2:c.121delG	3.37:g.47619395delC	ENSP00000373244:p.Glu41fs		6	0	0		6	0.33	2	NM_006574	2	0.00	0	Q71M39|Q71M40	Frame_Shift_Del	DEL	ENST00000383738.2	37	CCDS56253.1																																																																																					0.761	CSPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257489.1		NM_006574	
PHF7	51533	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52443757	52443757	+	5'Flank	DEL	G	G	-			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr3:52443757delG	ENST00000327906.3	+	0	0				PHF7_ENST00000347025.2_5'Flank|BAP1_ENST00000460680.1_Frame_Shift_Del_p.L14fs|BAP1_ENST00000296288.5_Frame_Shift_Del_p.L14fs	NM_016483.4	NP_057567.3	Q9BWX1	PHF7_HUMAN	PHD finger protein 7							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.?(2)		breast(2)|large_intestine(4)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(193;1.71e-05)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)|OV - Ovarian serous cystadenocarcinoma(275;0.0275)		AGGGTGAAGAGGCCTGGGTGG	0.701																																					p.L14fs													.	BAP1	371		2	Unknown(2)	eye(2)	c.41delT												29.0	35.0	33.0					3																	52443757		2203	4298	6501	SO:0001631	upstream_gene_variant	8314	exon2			TGAAGAGGCCTGG	AY014283	CCDS2854.1, CCDS2855.1	3p21.31	2013-01-28			ENSG00000010318	ENSG00000010318		"""Zinc fingers, PHD-type"""	18458	protein-coding gene	gene with protein product						11042152, 11829468	Standard	NM_016483		Approved	NYD-SP6, HSPC226	uc003ddy.3	Q9BWX1	OTTHUMG00000158495		3.37:g.52443757delG	Exception_encountered		42	0	0		51	0.33	17	NM_004656	25	0.00	0	K4DI82	Frame_Shift_Del	DEL	ENST00000327906.3	37	CCDS2854.1																																																																																					0.701	PHF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351155.1		NM_016483	
TP63	8626	mdanderson.org	37	3	189586427	189586427	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr3:189586427G>T	ENST00000264731.3	+	8	1140	c.1051G>T	c.(1051-1053)Gac>Tac	p.D351Y	TP63_ENST00000320472.5_Missense_Mutation_p.D351Y|TP63_ENST00000456148.1_Missense_Mutation_p.D257Y|TP63_ENST00000382063.4_Missense_Mutation_p.D266Y|TP63_ENST00000449992.1_Missense_Mutation_p.D172Y|TP63_ENST00000392463.2_Missense_Mutation_p.D257Y|TP63_ENST00000437221.1_Missense_Mutation_p.D257Y|TP63_ENST00000392460.3_Missense_Mutation_p.D351Y|TP63_ENST00000418709.2_Missense_Mutation_p.D351Y|TP63_ENST00000354600.5_Missense_Mutation_p.D257Y|TP63_ENST00000440651.2_Missense_Mutation_p.D351Y|TP63_ENST00000392461.3_Missense_Mutation_p.D257Y	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	351			D -> G (in EEC3). {ECO:0000269|PubMed:12838557}.|D -> H (in EEC3). {ECO:0000269|PubMed:11462173}.		apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		CCCAGGAAGAGACAGGAAGGC	0.493										HNSCC(45;0.13)																											p.D351Y													.	.			0			c.G1051T	GRCh37	CM013072|CM063214	TP63	M								85.0	84.0	84.0					3																	189586427		2203	4300	6503	SO:0001583	missense	8626	exon8			GGAAGAGACAGGA	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1051G>T	3.37:g.189586427G>T	ENSP00000264731:p.Asp351Tyr		69	0	0		87	0.06	5	NM_001114979	1	0.00	0	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	37	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570089	0.86542	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99874	-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39;-7.39	5.83	5.83	0.93111	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99891	0.9948	M	0.91196	3.185	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.995;0.998;0.997;0.998;0.995;0.997;0.997;0.999;0.995	D	0.96779	0.9574	9	.	.	.	-14.6055	19.1141	0.93331	0.0:0.0:1.0:0.0	.	172;351;351;257;257;257;257;351;351;351	Q9H3D4-10;Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;.;P63_HUMAN;.	Y	351;351;351;351;351;266;257;257;257;257;172;257	ENSP00000264731:D351Y;ENSP00000407144:D351Y;ENSP00000317510:D351Y;ENSP00000376253:D351Y;ENSP00000394337:D351Y;ENSP00000371495:D266Y;ENSP00000346614:D257Y;ENSP00000392488:D257Y;ENSP00000376256:D257Y;ENSP00000376254:D257Y;ENSP00000387839:D172Y;ENSP00000389485:D257Y	.	D	+	1	0	TP63	191069121	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.700000	0.98707	2.749000	0.94314	0.655000	0.94253	GAC			0.493	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000343865.1		NM_003722	
GRK4	2868	mdanderson.org	37	4	2990561	2990561	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr4:2990561G>T	ENST00000398052.4	+	3	599	c.256G>T	c.(256-258)Gca>Tca	p.A86S	GRK4_ENST00000345167.6_Missense_Mutation_p.A54S|GRK4_ENST00000504933.1_Missense_Mutation_p.A86S|GRK4_ENST00000398051.4_Missense_Mutation_p.A54S	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	86	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATTCTTGGATGCAGTGGTGAG	0.438																																					p.A86S													.	.			0			c.G256T												131.0	129.0	130.0					4																	2990561		2203	4300	6503	SO:0001583	missense	2868	exon3			TTGGATGCAGTGG		CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.256G>T	4.37:g.2990561G>T	ENSP00000381129:p.Ala86Ser		54	0	0		31	0.10	3	NM_001004057	0		0	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Missense_Mutation	SNP	ENST00000398052.4	37	CCDS33946.1	.	.	.	.	.	.	.	.	.	.	G	8.011	0.757554	0.15846	.	.	ENSG00000125388	ENST00000398051;ENST00000398052;ENST00000345167;ENST00000504933	T;T;T;T	0.02944	4.1;4.1;4.1;4.1	5.56	4.72	0.59763	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.139622	0.47093	U	0.000258	T	0.04588	0.0125	L	0.60455	1.87	0.80722	D	1	P;B;P;P	0.41313	0.745;0.138;0.745;0.673	B;B;B;B	0.42522	0.27;0.073;0.27;0.39	T	0.48592	-0.9022	10	0.09590	T	0.72	-18.0643	12.1383	0.53984	0.0837:0.0:0.9163:0.0	.	54;54;86;86	P32298-3;P32298-2;P32298-4;P32298	.;.;.;GRK4_HUMAN	S	54;86;54;86	ENSP00000381128:A54S;ENSP00000381129:A86S;ENSP00000264764:A54S;ENSP00000427445:A86S	ENSP00000264764:A54S	A	+	1	0	GRK4	2960359	1.000000	0.71417	0.995000	0.50966	0.487000	0.33371	4.169000	0.58223	1.335000	0.45486	0.573000	0.79308	GCA			0.438	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358176.2		NM_005307	
ZBTB49	166793	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	4304033	4304033	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr4:4304033T>C	ENST00000337872.4	+	3	591	c.470T>C	c.(469-471)cTg>cCg	p.L157P	ZBTB49_ENST00000355834.3_Missense_Mutation_p.L157P|ZBTB49_ENST00000538529.1_5'UTR	NM_145291.3	NP_660334.3	Q6ZSB9	ZBT49_HUMAN	zinc finger and BTB domain containing 49	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	28						CCTCATTTACTGCAGGAATGT	0.478																																					p.L157P													.	.			0			c.T470C												126.0	122.0	123.0					4																	4304033		2203	4300	6503	SO:0001583	missense	166793	exon3			ATTTACTGCAGGA	AK095878	CCDS3375.1	4p16.2	2013-01-08	2010-01-26	2010-01-26	ENSG00000168826	ENSG00000168826		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19883	protein-coding gene	gene with protein product			"""zinc finger protein 509"""	ZNF509		12477932	Standard	NM_145291		Approved	FLJ38559	uc003ghu.3	Q6ZSB9	OTTHUMG00000090325	ENST00000337872.4:c.470T>C	4.37:g.4304033T>C	ENSP00000338807:p.Leu157Pro		169	0	0		137	0.08	11	NM_145291	4	0.00	0	Q59FJ4|Q5EBN0|Q8TB80	Missense_Mutation	SNP	ENST00000337872.4	37	CCDS3375.1	.	.	.	.	.	.	.	.	.	.	T	8.373	0.835749	0.16820	.	.	ENSG00000168826	ENST00000355834;ENST00000337872	T;T	0.14766	2.48;2.85	5.17	2.74	0.32292	.	0.000000	0.43919	D	0.000510	T	0.12433	0.0302	L	0.46885	1.475	0.80722	D	1	B	0.20887	0.049	B	0.19666	0.026	T	0.06499	-1.0823	10	0.46703	T	0.11	.	9.2007	0.37256	0.0:0.1485:0.0:0.8515	.	157	Q6ZSB9	ZBT49_HUMAN	P	157	ENSP00000348091:L157P;ENSP00000338807:L157P	ENSP00000338807:L157P	L	+	2	0	ZBTB49	4354934	0.182000	0.23173	0.783000	0.31826	0.030000	0.12068	0.386000	0.20702	0.927000	0.37143	0.482000	0.46254	CTG			0.478	ZBTB49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206688.3		NM_145291	
CC2D2A	57545	bcgsc.ca	37	4	15539540	15539540	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr4:15539540A>G	ENST00000503292.1	+	17	1963	c.1783A>G	c.(1783-1785)Agg>Ggg	p.R595G	CC2D2A_ENST00000389652.5_Missense_Mutation_p.R546G|CC2D2A_ENST00000424120.1_Missense_Mutation_p.R595G|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000413206.1_Missense_Mutation_p.R595G	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	595	Poly-Lys.				cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GAAGAAGAAAAGGAAACAAGC	0.493																																					p.R595G													.	CC2D2A	158		0			c.A1783G												60.0	65.0	63.0					4																	15539540		1967	4170	6137	SO:0001583	missense	57545	exon17			AAGAAAAGGAAAC	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1783A>G	4.37:g.15539540A>G	ENSP00000421809:p.Arg595Gly		87	0	0		59	0.07	4	NM_001080522	7	0.00	0	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	37	CCDS47026.1	.	.	.	.	.	.	.	.	.	.	A	14.29	2.491186	0.44249	.	.	ENSG00000048342	ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000503292;ENST00000389652	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.39	5.39	0.77823	.	0.175469	0.49305	D	0.000153	T	0.12817	0.0311	N	0.08118	0	0.80722	D	1	B;B	0.26902	0.163;0.163	B;B	0.26969	0.075;0.047	T	0.13019	-1.0525	10	0.35671	T	0.21	.	15.4144	0.74952	1.0:0.0:0.0:0.0	.	595;546	Q9P2K1;Q9P2K1-2	C2D2A_HUMAN;.	G	595;595;546;546;595;546	ENSP00000403465:R595G;ENSP00000398391:R595G;ENSP00000421809:R595G;ENSP00000374303:R546G	ENSP00000374303:R546G	R	+	1	2	CC2D2A	15148638	1.000000	0.71417	0.979000	0.43373	0.710000	0.40934	3.417000	0.52714	2.044000	0.60594	0.383000	0.25322	AGG			0.493	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359906.2		NM_001080522	
FAT4	79633	ucsc.edu	37	4	126329610	126329610	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr4:126329610G>T	ENST00000394329.3	+	4	5594	c.5581G>T	c.(5581-5583)Gca>Tca	p.A1861S	FAT4_ENST00000335110.5_Missense_Mutation_p.A159S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1861	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTCTTTGGTAGCAGCCATTTT	0.313																																					p.A1861S													.	FAT4	1752		0			c.G5581T												88.0	91.0	90.0					4																	126329610		2203	4300	6503	SO:0001583	missense	79633	exon4			TTGGTAGCAGCCA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5581G>T	4.37:g.126329610G>T	ENSP00000377862:p.Ala1861Ser		51	0	0		38	0.11	4	NM_024582	1	0.00	0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	20.4	3.977644	0.74360	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01767	4.65;4.65	5.03	5.03	0.67393	Cadherin (3);Cadherin-like (1);	0.000000	0.34088	U	0.004277	T	0.05593	0.0147	L	0.31804	0.96	0.49582	D	0.999804	D;D	0.67145	0.995;0.996	D;D	0.76575	0.97;0.988	T	0.63554	-0.6611	10	0.22109	T	0.4	.	18.3766	0.90437	0.0:0.0:1.0:0.0	.	159;1861	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	S	1861;159	ENSP00000377862:A1861S;ENSP00000335169:A159S	ENSP00000335169:A159S	A	+	1	0	FAT4	126549060	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.027000	0.93706	2.337000	0.79520	0.591000	0.81541	GCA			0.313	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256765.2		NM_024582	
GALNTL6	442117	mdanderson.org	37	4	172735869	172735869	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr4:172735869G>T	ENST00000506823.1	+	2	795	c.138G>T	c.(136-138)caG>caT	p.Q46H	GALNTL6_ENST00000511251.1_Missense_Mutation_p.Q46H	NM_001034845.2	NP_001030017.2	Q49A17	GLTL6_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 6	46					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(2)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	45						GGGAGCAGCAGGTAAGTGCCA	0.552																																					p.Q46H													.	.			0			c.G138T												66.0	65.0	66.0					4																	172735869		2203	4300	6503	SO:0001630	splice_region_variant	442117	exon2			GCAGCAGGTAAGT		CCDS34104.1	4q34.1	2014-03-13	2014-03-13		ENSG00000174473	ENSG00000174473		"""Glycosyltransferase family 2 domain containing"""	33844	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 6"""	615138	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6"""				Standard	NM_001034845		Approved	GALNT17, GalNAc-T6L	uc003isv.3	Q49A17	OTTHUMG00000160807	ENST00000506823.1:c.138+1G>T	4.37:g.172735869G>T			56	0	0		41	0.07	3	NM_001034845	1	0.00	0	Q2L4S6	Missense_Mutation	SNP	ENST00000506823.1	37	CCDS34104.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124197	0.56613	.	.	ENSG00000174473	ENST00000511251;ENST00000506823;ENST00000404275	T	0.56444	0.46	5.8	5.8	0.92144	.	.	.	.	.	T	0.46308	0.1386	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.24905	-1.0147	9	0.42905	T	0.14	.	19.0445	0.93013	0.0:0.0:1.0:0.0	.	46	Q49A17	GLTL6_HUMAN	H	46	ENSP00000423313:Q46H	ENSP00000385382:Q46H	Q	+	3	2	GALNTL6	172972444	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.315000	0.65810	2.746000	0.94184	0.563000	0.77884	CAG			0.552	GALNTL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362395.1		NM_001034845	Missense_Mutation
NSUN2	54888	mdanderson.org	37	5	6623369	6623369	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr5:6623369G>T	ENST00000264670.6	-	5	806	c.495C>A	c.(493-495)agC>agA	p.S165R	NSUN2_ENST00000539938.1_5'UTR|NSUN2_ENST00000505264.1_5'UTR|NSUN2_ENST00000506139.1_Missense_Mutation_p.S130R	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	165					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						GTGGGATCATGCTAACAGCTT	0.433																																					p.S165R													.	.			0			c.C495A												133.0	126.0	128.0					5																	6623369		2203	4300	6503	SO:0001583	missense	54888	exon5			GATCATGCTAACA	AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.495C>A	5.37:g.6623369G>T	ENSP00000264670:p.Ser165Arg		75	0	0		53	0.08	4	NM_017755	83	0.00	0	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	ENST00000264670.6	37	CCDS3869.1	.	.	.	.	.	.	.	.	.	.	G	18.06	3.540103	0.65085	.	.	ENSG00000037474	ENST00000264670;ENST00000506139	T;T	0.72282	-0.64;-0.4	5.38	3.09	0.35607	.	0.000000	0.85682	D	0.000000	D	0.88691	0.6505	H	0.99130	4.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87744	0.2587	10	0.87932	D	0	-34.9309	6.2518	0.20850	0.4345:0.0:0.5655:0.0	.	130;165	B4DQW2;Q08J23	.;NSUN2_HUMAN	R	165;130	ENSP00000264670:S165R;ENSP00000420957:S130R	ENSP00000264670:S165R	S	-	3	2	NSUN2	6676369	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	2.222000	0.42926	1.139000	0.42245	0.585000	0.79938	AGC			0.433	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206902.1		NM_017755	
C7	730	mdanderson.org	37	5	40955571	40955571	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr5:40955571G>T	ENST00000313164.9	+	10	1535	c.1176G>T	c.(1174-1176)gaG>gaT	p.E392D		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	392	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				GTTACCTAGAGCTGGACAATC	0.453																																					p.E392D													.	.			0			c.G1176T												122.0	121.0	121.0					5																	40955571		1896	4127	6023	SO:0001583	missense	730	exon10			CCTAGAGCTGGAC	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1176G>T	5.37:g.40955571G>T	ENSP00000322061:p.Glu392Asp		72	0	0		48	0.06	3	NM_000587	6	0.00	0	Q6P3T5|Q92489	Missense_Mutation	SNP	ENST00000313164.9	37	CCDS47201.1	.	.	.	.	.	.	.	.	.	.	G	4.272	0.049604	0.08243	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.64085	-0.08	5.26	-3.58	0.04597	Membrane attack complex component/perforin (MACPF) domain (3);	0.548907	0.19471	N	0.113455	T	0.28699	0.0711	N	0.12471	0.22	0.19775	N	0.99996	B	0.06786	0.001	B	0.08055	0.003	T	0.34079	-0.9843	10	0.02654	T	1	-5.194	5.0858	0.14680	0.0724:0.2491:0.1433:0.5353	.	392	P10643	CO7_HUMAN	D	392;232	ENSP00000322061:E392D	ENSP00000322061:E392D	E	+	3	2	C7	40991328	0.000000	0.05858	0.918000	0.36340	0.983000	0.72400	-1.521000	0.02239	-0.300000	0.08895	0.655000	0.94253	GAG			0.453	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317680.1			
NBPF22P	285622	broad.mit.edu	37	5	85589184	85589185	+	RNA	INS	-	-	CTT			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr5:85589184_85589185insCTT	ENST00000590707.1	+	0	1383					NR_003719.2				neuroblastoma breakpoint family, member 22, pseudogene																		AGCTGCACTCACTTATTTCTCT	0.48																																					.													.	.			0			.																																											0	.			GCACTCACTTATT	BC050328		5q14.3	2013-01-17	2011-04-15		ENSG00000205449	ENSG00000205449		"""neuroblastoma breakpoint family"""	28731	pseudogene	pseudogene						16079250	Standard	NR_003719		Approved	MGC48637	uc003kiq.3		OTTHUMG00000162585		5.37:g.85589185_85589187dupCTT			292	0.0136986301	4		184	0.05	9	.	0		0		RNA	INS	ENST00000590707.1	37																																																																																						0.480	NBPF22P-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000453100.1		XM_208333	
PCDHGA9	56107	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140784930	140784930	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr5:140784930C>A	ENST00000573521.1	+	1	2411	c.2411C>A	c.(2410-2412)aCc>aAc	p.T804N	PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB6_ENST00000520790.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018921.2|NM_032089.1	NP_061744.1|NP_114478.1	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9	804					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATAGAAGACACCCCTTTGGTT	0.403																																					p.T804N													.	.			0			c.C2411A												48.0	52.0	51.0					5																	140784930		2129	4271	6400	SO:0001583	missense	56107	exon1			AAGACACCCCTTT	AF152516	CCDS58981.1, CCDS75341.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8707	other	protocadherin		606296				10380929	Standard	NM_018921		Approved	PCDH-GAMMA-A9		Q9Y5G4		ENST00000573521.1:c.2411C>A	5.37:g.140784930C>A	ENSP00000460274:p.Thr804Asn		111	0	0		83	0.33	27	NM_032089	1	1.00	1	A2RU65|Q9Y5C9	Missense_Mutation	SNP	ENST00000573521.1	37	CCDS58981.1																																																																																					0.403	PCDHGA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437105.1		NM_018921	
NSD1	64324	mdanderson.org	37	5	176665473	176665473	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr5:176665473C>T	ENST00000439151.2	+	7	4202	c.4157C>T	c.(4156-4158)gCc>gTc	p.A1386V	NSD1_ENST00000354179.4_Missense_Mutation_p.A1117V|NSD1_ENST00000361032.4_Missense_Mutation_p.A1283V|NSD1_ENST00000347982.4_Missense_Mutation_p.A1117V	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1386					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CCACGGCCTGCCCTTGAGTCT	0.532			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																											p.A1386V				Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	.	.			0			c.C4157T												94.0	94.0	94.0					5																	176665473		2203	4300	6503	SO:0001583	missense	64324	exon7	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	GGCCTGCCCTTGA	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4157C>T	5.37:g.176665473C>T	ENSP00000395929:p.Ala1386Val		43	0	0		45	0.07	3	NM_022455	42	0.00	0	Q96PD8|Q96RN7	Missense_Mutation	SNP	ENST00000439151.2	37	CCDS4412.1	.	.	.	.	.	.	.	.	.	.	C	16.42	3.117930	0.56505	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.93076	-3.05;-3.05;-3.05;-3.16	5.44	2.7	0.31948	.	0.911551	0.09413	N	0.805484	D	0.85089	0.5617	N	0.14661	0.345	0.30505	N	0.769987	B;B;B	0.15141	0.012;0.012;0.007	B;B;B	0.15052	0.012;0.012;0.003	T	0.76534	-0.2924	10	0.37606	T	0.19	.	5.0608	0.14557	0.165:0.6644:0.0:0.1706	.	1117;1283;1386	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	V	1117;1386;1117;1283	ENSP00000346111:A1117V;ENSP00000395929:A1386V;ENSP00000343209:A1117V;ENSP00000354310:A1283V	ENSP00000343209:A1117V	A	+	2	0	NSD1	176598079	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	1.735000	0.38176	0.416000	0.25844	0.655000	0.94253	GCC			0.532	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253412.2		NM_172349	
HIST1H4B	8366	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26027303	26027303	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr6:26027303T>C	ENST00000377364.3	-	1	177	c.178A>G	c.(178-180)Aag>Gag	p.K60E		NM_003544.2	NP_003535.1	P62805	H4_HUMAN	histone cluster 1, H4b	60					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			large_intestine(4)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	13						AGAAACACCTTGAGAACGCCA	0.567											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K60E													.	.			0			c.A178G												97.0	83.0	88.0					6																	26027303		2203	4300	6503	SO:0001583	missense	8366	exon1			ACACCTTGAGAAC	X67081	CCDS4572.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000124529	ENSG00000278705		"""Histones / Replication-dependent"""	4789	protein-coding gene	gene with protein product		602829	"""H4 histone family, member I"", ""histone 1, H4b"""	H4FI		9119399, 12408966	Standard	NM_003544		Approved	H4/I	uc003nfr.3	P62805	OTTHUMG00000014417	ENST00000377364.3:c.178A>G	6.37:g.26027303T>C	ENSP00000366581:p.Lys60Glu		128	0	0	783	112	0.35	39	NM_003544	0		0	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Missense_Mutation	SNP	ENST00000377364.3	37	CCDS4572.1	.	.	.	.	.	.	.	.	.	.	t	17.60	3.430036	0.62844	.	.	ENSG00000124529	ENST00000377364	T	0.54479	0.57	4.65	4.65	0.58169	.	0.000000	0.56097	U	0.000032	T	0.57607	0.2065	.	.	.	0.42561	D	0.993141	.	.	.	.	.	.	T	0.63238	-0.6682	7	0.59425	D	0.04	.	13.9697	0.64233	0.0:0.0:0.0:1.0	.	.	.	.	E	60	ENSP00000366581:K60E	ENSP00000366581:K60E	K	-	1	0	HIST1H4B	26135282	1.000000	0.71417	0.900000	0.35374	0.003000	0.03518	7.516000	0.81772	2.028000	0.59812	0.460000	0.39030	AAG			0.567	HIST1H4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040079.2		NM_003544	
TEAD3	7005	mdanderson.org	37	6	35445113	35445113	+	Silent	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr6:35445113C>T	ENST00000402886.3	-	6	540	c.387G>A	c.(385-387)caG>caA	p.Q129Q	TEAD3_ENST00000338863.7_Silent_p.Q189Q			Q99594	TEAD3_HUMAN	TEA domain family member 3	189					female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						GCAGGGGCGGCTGGATGGGGT	0.637																																					p.Q189Q													.	.			0			c.G567A												33.0	43.0	40.0					6																	35445113		2026	4180	6206	SO:0001819	synonymous_variant	7005	exon8			GGGCGGCTGGATG	X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.387G>A	6.37:g.35445113C>T			32	0	0		24	0.08	2	NM_003214	14	0.00	0	O95910|Q5BJG7|Q8N6Y4	Silent	SNP	ENST00000402886.3	37																																																																																						0.637	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000316961.2			
TTBK1	84630	mdanderson.org	37	6	43221327	43221327	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr6:43221327C>T	ENST00000259750.4	+	5	435	c.352C>T	c.(352-354)Cgc>Tgc	p.R118C	TTBK1_ENST00000304139.5_Missense_Mutation_p.R67C	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	118	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GGCCGACCTGCGCCGTAGCCA	0.627																																					p.R118C													.	.			0			c.C352T												38.0	33.0	35.0					6																	43221327		2203	4300	6503	SO:0001583	missense	84630	exon5			GACCTGCGCCGTA	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.352C>T	6.37:g.43221327C>T	ENSP00000259750:p.Arg118Cys		25	0	0		31	0.10	3	NM_032538	0		0	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905097	0.72868	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.64991	-0.13	4.8	4.8	0.61643	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.259849	0.35555	N	0.003124	T	0.80783	0.4689	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.85458	0.1165	10	0.66056	D	0.02	.	12.4026	0.55422	0.1691:0.8309:0.0:0.0	.	118	Q5TCY1	TTBK1_HUMAN	C	67;118;67	ENSP00000259750:R118C	ENSP00000259750:R118C	R	+	1	0	TTBK1	43329305	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.327000	0.43858	2.205000	0.71048	0.462000	0.41574	CGC			0.627	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040584.3			
PTCHD4	442213	mdanderson.org	37	6	47847374	47847374	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr6:47847374G>T	ENST00000339488.4	-	3	1239	c.1206C>A	c.(1204-1206)caC>caA	p.H402Q		NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	402						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										AAAAGATGCTGTGGTAGCGGT	0.463																																					p.H402Q													C6orf138,NS,haematopoietic_neoplasm,-1,1	C6orf138	-1	1	0			c.C1206A												90.0	82.0	85.0					6																	47847374		2203	4300	6503	SO:0001583	missense	442213	exon3			GATGCTGTGGTAG		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.1206C>A	6.37:g.47847374G>T	ENSP00000341914:p.His402Gln		80	0	0		72	0.06	4	NM_001013732	0		0	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	37	CCDS34473.2	.	.	.	.	.	.	.	.	.	.	G	15.15	2.747830	0.49257	.	.	ENSG00000244694	ENST00000339488	D	0.85861	-2.04	5.01	4.14	0.48551	.	0.000000	0.85682	D	0.000000	D	0.84973	0.5591	M	0.61703	1.905	0.80722	D	1	D	0.56035	0.974	P	0.59012	0.85	D	0.83462	0.0054	10	0.30078	T	0.28	.	13.5087	0.61499	0.0759:0.0:0.9241:0.0	.	402	Q6ZW05	CF138_HUMAN	Q	402	ENSP00000341914:H402Q	ENSP00000341914:H402Q	H	-	3	2	C6orf138	47955333	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.994000	0.56994	1.116000	0.41820	0.650000	0.86243	CAC			0.463	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317987.2		NM_001013732	
HDAC9	9734	mdanderson.org	37	7	18767261	18767261	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:18767261C>T	ENST00000432645.2	+	12	1781	c.1781C>T	c.(1780-1782)gCg>gTg	p.A594V	HDAC9_ENST00000441542.2_Missense_Mutation_p.A597V|HDAC9_ENST00000401921.1_Missense_Mutation_p.A553V|HDAC9_ENST00000406451.4_Missense_Mutation_p.A594V	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	594					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CCGCTGGCTGCGGTTGGCATG	0.562																																					p.A597V													HDAC9_ENST00000262069,caecum,carcinoma,-1,4	HDAC9_ENST00000262069	-1	4	0			c.C1790T												42.0	47.0	45.0					7																	18767261		2032	4191	6223	SO:0001583	missense	9734	exon12			TGGCTGCGGTTGG	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1781C>T	7.37:g.18767261C>T	ENSP00000410337:p.Ala594Val		62	0	0		79	0.05	4	NM_178425	0		0	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	37	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	C	10.72	1.428500	0.25726	.	.	ENSG00000048052	ENST00000406451;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000341009	T;T;T;T	0.59083	0.29;0.29;0.29;0.29	5.27	-1.87	0.07737	.	2.023590	0.02511	N	0.091503	T	0.54532	0.1864	L	0.58810	1.83	0.09310	N	0.999999	B;B;B;B;B;B;B	0.22146	0.0;0.0;0.0;0.0;0.0;0.0;0.065	B;B;B;B;B;B;B	0.09377	0.0;0.0;0.001;0.0;0.0;0.0;0.004	T	0.44221	-0.9342	10	0.29301	T	0.29	-2.7209	12.8687	0.57953	0.0:0.7015:0.0:0.2985	.	594;506;553;597;594;594;572	Q9UKV0-4;Q9UKV0-2;Q9UKV0-6;Q9UKV0-7;Q9UKV0;Q9UKV0-5;Q8N879	.;.;.;.;HDAC9_HUMAN;.;.	V	594;553;594;597;506	ENSP00000384657:A594V;ENSP00000383912:A553V;ENSP00000410337:A594V;ENSP00000408617:A597V	ENSP00000339165:A506V	A	+	2	0	HDAC9	18733786	0.594000	0.26849	0.571000	0.28486	0.820000	0.46376	-0.188000	0.09642	-0.205000	0.10219	0.557000	0.71058	GCG			0.562	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000376176.1			
ITGB8	3696	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	20449503	20449503	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:20449503G>C	ENST00000222573.4	+	14	2877	c.2193G>C	c.(2191-2193)aaG>aaC	p.K731N	ITGB8_ENST00000537992.1_Missense_Mutation_p.K596N	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	731					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						TTAAGGATAAGTTGATTCTGC	0.328																																					p.K731N													.	.			0			c.G2193C												55.0	61.0	59.0					7																	20449503		2203	4300	6503	SO:0001583	missense	3696	exon14			GGATAAGTTGATT		CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.2193G>C	7.37:g.20449503G>C	ENSP00000222573:p.Lys731Asn		182	0	0		216	0.20	43	NM_002214	3	0.33	1	A4D133|B4DHD4	Missense_Mutation	SNP	ENST00000222573.4	37	CCDS5370.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848192	0.51164	.	.	ENSG00000105855	ENST00000537992;ENST00000222573	T;T	0.48836	0.8;0.8	5.97	2.71	0.32032	.	0.165992	0.42821	D	0.000656	T	0.50990	0.1648	L	0.44542	1.39	0.52099	D	0.999943	D	0.64830	0.994	P	0.57911	0.829	T	0.50338	-0.8840	10	0.87932	D	0	.	8.2035	0.31438	0.4264:0.0:0.5736:0.0	.	731	P26012	ITB8_HUMAN	N	596;731	ENSP00000441561:K596N;ENSP00000222573:K731N	ENSP00000222573:K731N	K	+	3	2	ITGB8	20416028	1.000000	0.71417	0.994000	0.49952	0.805000	0.45488	1.347000	0.33975	0.611000	0.30052	0.591000	0.81541	AAG			0.328	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059915.3		NM_002214	
LINC00957	255031	broad.mit.edu	37	7	44081003	44081004	+	lincRNA	INS	-	-	C			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:44081003_44081004insC	ENST00000441052.1	+	0	1688_1689				RASA4CP_ENST00000446874.1_RNA					long intergenic non-protein coding RNA 957																		ACACACATTCTTTTGGGGGGGG	0.554																																					.													.	.			0			.																																											0	.			ACATTCTTTTGGG	BC014556		7p13	2013-06-04			ENSG00000235314	ENSG00000235314		"""Long non-coding RNAs"""	22332	non-coding RNA	RNA, long non-coding							Standard	NR_015401		Approved				OTTHUMG00000155351		7.37:g.44081003_44081004insC			4	0	0		11	0.36	4	.	0		0		RNA	INS	ENST00000441052.1	37																																																																																						0.554	LINC00957-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000339589.1			
CCT6A	908	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	56119654	56119654	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:56119654T>A	ENST00000275603.4	+	1	332	c.113T>A	c.(112-114)cTg>cAg	p.L38Q	CCT6A_ENST00000540286.1_Intron|PSPH_ENST00000275605.3_5'Flank|PSPH_ENST00000395471.3_5'Flank|CCT6A_ENST00000335503.3_Missense_Mutation_p.L38Q	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	38					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AGGACCAACCTGGGGCCCAAG	0.736																																					p.L38Q													.	.			0			c.T113A												8.0	8.0	8.0					7																	56119654		2060	4021	6081	SO:0001583	missense	908	exon1			CCAACCTGGGGCC	M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.113T>A	7.37:g.56119654T>A	ENSP00000275603:p.Leu38Gln		62	0	0		127	0.25	32	NM_001762	806	0.22	180	A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	ENST00000275603.4	37	CCDS5523.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.968093	0.92855	.	.	ENSG00000146731	ENST00000275603;ENST00000335503	D;D	0.87103	-2.21;-2.21	4.41	4.41	0.53225	Chaperonin TCP-1, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.96062	0.8717	H	0.99026	4.405	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.97229	0.9883	10	0.87932	D	0	-8.3829	12.9709	0.58511	0.0:0.0:0.0:1.0	.	38;38	A6NCD2;P40227	.;TCPZ_HUMAN	Q	38	ENSP00000275603:L38Q;ENSP00000352019:L38Q	ENSP00000275603:L38Q	L	+	2	0	CCT6A	56087148	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	6.944000	0.75940	1.856000	0.53863	0.260000	0.18958	CTG			0.736	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251526.2		NM_001762	
PEX1	5189	mdanderson.org	37	7	92143220	92143220	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:92143220G>T	ENST00000248633.4	-	6	1396	c.1301C>A	c.(1300-1302)cCa>cAa	p.P434Q	PEX1_ENST00000541751.1_5'UTR|PEX1_ENST00000428214.1_Missense_Mutation_p.P434Q|PEX1_ENST00000438045.1_Missense_Mutation_p.P112Q	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	434					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			AACTTCCACTGGAGTTATCCT	0.303																																					p.P434Q													.	.			0			c.C1301A												107.0	112.0	110.0					7																	92143220		2203	4298	6501	SO:0001583	missense	5189	exon6			TCCACTGGAGTTA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.1301C>A	7.37:g.92143220G>T	ENSP00000248633:p.Pro434Gln		26	0	0		42	0.07	3	NM_000466	24	0.00	0	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	ENST00000248633.4	37	CCDS5627.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060436	0.76074	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214;ENST00000545192	D;D;D	0.94897	-3.53;-3.45;-3.55	5.84	4.94	0.65067	.	0.623994	0.17390	N	0.175968	D	0.93374	0.7887	L	0.47716	1.5	0.80722	D	1	P;P;B	0.46706	0.883;0.624;0.437	P;B;B	0.45037	0.467;0.347;0.203	D	0.93192	0.6584	10	0.72032	D	0.01	-2.2254	16.0817	0.81010	0.0:0.0:0.865:0.135	.	112;226;434	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	Q	112;434;434;434	ENSP00000410438:P112Q;ENSP00000248633:P434Q;ENSP00000394413:P434Q	ENSP00000248633:P434Q	P	-	2	0	PEX1	91981156	1.000000	0.71417	0.996000	0.52242	0.968000	0.65278	5.371000	0.66150	1.414000	0.47017	0.561000	0.74099	CCA			0.303	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254066.3		NM_000466	
Unknown	0	hgsc.bcm.edu	37	7	97599705	97599705	+	IGR	SNP	T	T	G			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:97599705T>G								MIR5692C2 (5912 upstream) : OCM2 (14290 downstream)																							tttttttttttttggagacgg	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTTTTTTTTGGAG																													7.37:g.97599705T>G			168	0	0		250	0.05	13	.	2	0.00	0		RNA	SNP		37																																																																																					0	0.473										
ZNF777	27153	mdanderson.org	37	7	149129364	149129364	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:149129364G>T	ENST00000247930.4	-	6	2322	c.1999C>A	c.(1999-2001)Ccc>Acc	p.P667T		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	667					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TTGCACTCGGGGCACGTGTAG	0.612																																					p.P667T													.	.			0			c.C1999A												83.0	96.0	91.0					7																	149129364		2187	4290	6477	SO:0001583	missense	27153	exon6			ACTCGGGGCACGT	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.1999C>A	7.37:g.149129364G>T	ENSP00000247930:p.Pro667Thr		39	0	0		40	0.08	3	NM_015694	29	0.00	0	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	37	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.257087	0.39896	.	.	ENSG00000196453	ENST00000247930;ENST00000314683	T	0.07114	3.22	4.65	4.65	0.58169	.	0.143688	0.32147	N	0.006512	T	0.13030	0.0316	N	0.25286	0.73	0.34796	D	0.736214	D	0.63880	0.993	P	0.59761	0.863	T	0.31916	-0.9926	10	0.20519	T	0.43	-23.2965	15.0378	0.71764	0.0:0.0:1.0:0.0	.	667	Q9ULD5-2	.	T	667;410	ENSP00000247930:P667T	ENSP00000247930:P667T	P	-	1	0	ZNF777	148760297	0.972000	0.33761	1.000000	0.80357	0.994000	0.84299	0.786000	0.26844	2.137000	0.66172	0.460000	0.39030	CCC			0.612	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352708.1		NM_015694	
KMT2C	58508	mdanderson.org	37	7	151843697	151843697	+	Missense_Mutation	SNP	C	C	T	rs151112171		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr7:151843697C>T	ENST00000262189.6	-	53	14236	c.14018G>A	c.(14017-14019)cGc>cAc	p.R4673H	KMT2C_ENST00000355193.2_Missense_Mutation_p.R4730H	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4673	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCCGCTATGCGTGCCACTGC	0.473											OREG0018460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R4673H													.	.			0			c.G14018A							C	HIS/ARG	0,4406		0,0,2203	77.0	70.0	72.0		14018	5.4	1.0	7	dbSNP_134	72	1,8599	1.2+/-3.3	0,1,4299	no	missense	MLL3	NM_170606.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	4673/4912	151843697	1,13005	2203	4300	6503	SO:0001583	missense	58508	exon53			GCTATGCGTGCCA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14018G>A	7.37:g.151843697C>T	ENSP00000262189:p.Arg4673His		35	0	0	1743	51	0.06	3	NM_170606	34	0.00	0	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171191	0.57584	0.0	1.16E-4	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	T;T;T	0.49139	0.79;0.79;0.79	5.43	5.43	0.79202	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);	0.000000	0.41001	U	0.000962	T	0.73853	0.3640	M	0.86178	2.8	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.982;0.982	T	0.78301	-0.2257	10	0.87932	D	0	.	19.2232	0.93806	0.0:1.0:0.0:0.0	.	4673;3791;4730	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	H	4673;4730;1290	ENSP00000262189:R4673H;ENSP00000347325:R4730H;ENSP00000410411:R1290H	ENSP00000262189:R4673H	R	-	2	0	MLL3	151474630	1.000000	0.71417	0.995000	0.50966	0.601000	0.36947	4.871000	0.63042	2.530000	0.85305	0.557000	0.71058	CGC	0		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3			
FAM66D	100132923	broad.mit.edu	37	8	11986539	11986539	+	RNA	SNP	G	G	A	rs186086528		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr8:11986539G>A	ENST00000434078.2	+	0	608					NR_027425.1				family with sequence similarity 66, member D																		GCATTCAAGTGGCAGGTATTT	0.557																																					.													.	.			0			.																																											0	.			TCAAGTGGCAGGT			8p23.1	2013-07-05			ENSG00000255052	ENSG00000255052		"""Long non-coding RNAs"""	24159	non-coding RNA	RNA, long non-coding							Standard	NR_027425		Approved				OTTHUMG00000165269		8.37:g.11986539G>A			82	0.0243902439	2		96	0.21	20	.	0		0		RNA	SNP	ENST00000434078.2	37																																																																																						0.557	FAM66D-201	KNOWN	basic	antisense	antisense				NR_027425	
GSR	2936	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	30560672	30560672	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr8:30560672G>A	ENST00000221130.5	-	5	668	c.578C>T	c.(577-579)gCc>gTc	p.A193V	GSR_ENST00000537535.1_Missense_Mutation_p.A193V|GSR_ENST00000546342.1_Missense_Mutation_p.A193V|GSR_ENST00000414019.1_Missense_Mutation_p.A150V|GSR_ENST00000541648.1_Missense_Mutation_p.A193V	NM_000637.3|NM_001195102.1|NM_001195103.1	NP_000628.2|NP_001182031.1|NP_001182032.1	P00390	GSHR_HUMAN	glutathione reductase	193					cell redox homeostasis (GO:0045454)|glutathione metabolic process (GO:0006749)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|glutathione-disulfide reductase activity (GO:0004362)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	23				KIRC - Kidney renal clear cell carcinoma(542;0.105)|Kidney(114;0.125)	Carmustine(DB00262)|Flavin adenine dinucleotide(DB03147)|Glutathione(DB00143)	GATGTGTGGGGCGGTGTACTT	0.527																																					p.A193V													.	.			0			c.C578T												273.0	227.0	243.0					8																	30560672		2203	4300	6503	SO:0001583	missense	2936	exon5			TGTGGGGCGGTGT		CCDS34877.1, CCDS56530.1, CCDS56531.1, CCDS56532.1	8p21.1	2012-10-02			ENSG00000104687	ENSG00000104687	1.8.1.7		4623	protein-coding gene	gene with protein product		138300					Standard	NM_000637		Approved		uc003xih.2	P00390	OTTHUMG00000163946	ENST00000221130.5:c.578C>T	8.37:g.30560672G>A	ENSP00000221130:p.Ala193Val		134	0	0		128	0.29	37	NM_001195103	70	0.33	23	C8KIL8|C8KIL9|C8KIM0|D3DSV3|Q7Z5C9|Q9NP63	Missense_Mutation	SNP	ENST00000221130.5	37	CCDS34877.1	.	.	.	.	.	.	.	.	.	.	G	17.83	3.485291	0.63962	.	.	ENSG00000104687	ENST00000221130;ENST00000414019;ENST00000546342;ENST00000541648;ENST00000537535;ENST00000521479	T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77	6.14	5.28	0.74379	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.75693	0.3884	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82364	-0.0494	10	0.87932	D	0	-11.2681	13.1736	0.59613	0.0762:0.0:0.9238:0.0	.	193	P00390	GSHR_HUMAN	V	193;150;193;193;193;81	ENSP00000221130:A193V;ENSP00000390065:A150V;ENSP00000445516:A193V;ENSP00000444559:A193V;ENSP00000438845:A193V;ENSP00000430825:A81V	ENSP00000221130:A193V	A	-	2	0	GSR	30680214	1.000000	0.71417	0.166000	0.22797	0.002000	0.02628	8.656000	0.91102	1.621000	0.50320	0.637000	0.83480	GCC			0.527	GSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376519.1			
Unknown	0	bcgsc.ca	37	9	45377030	45377030	+	IGR	SNP	G	G	A	rs60100140		TCGA-2G-AAG7-01A-11D-A42Y-10	TCGA-2G-AAG7-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	35345420-69f0-4148-9040-4d0e2079bca1	e44e99f1-5a48-41f2-adf0-0cc3bd073cf8	g.chr9:45377030G>A								RP11-449H15.2 (164529 upstream) : RP11-187C18.5 (16814 downstream)																							TGAAGAACAGGTAACAGTGGC	0.468																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441420	.			GAACAGGTAACAG																													9.37:g.45377030G>A			56	0.0535714286	3		49	0.22	11	.	0		0		RNA	SNP		37																																																																																					0	0.468										
