#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CELA2B	51032	broad.mit.edu	37	1	15813823	15813823	+	Missense_Mutation	SNP	G	G	A	rs376020731		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:15813823G>A	ENST00000375910.3	+	7	708	c.683G>A	c.(682-684)cGg>cAg	p.R228Q		NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	228	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						TCTGACGGCCGGTGGGAGGTG	0.597																																					p.R228Q													.	CELA2B	37		0			c.G683A							G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	108.0	105.0	106.0		683	0.9	0.1	1		106	0,8600		0,0,4300	no	missense	CELA2B	NM_015849.2	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	228/270	15813823	1,13005	2203	4300	6503	SO:0001583	missense	51032	exon7			ACGGCCGGTGGGA		CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.683G>A	1.37:g.15813823G>A	ENSP00000365075:p.Arg228Gln		90	0	0		99	0.04	4	NM_015849	0		0	Q14D16|Q6ISM5|Q96QV5	Missense_Mutation	SNP	ENST00000375910.3	37	CCDS30605.1	.	.	.	.	.	.	.	.	.	.	G	0.070	-1.204755	0.01568	2.27E-4	0.0	ENSG00000215704	ENST00000375910	D	0.93712	-3.27	4.73	0.903	0.19296	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.023360	0.07829	N	0.961114	D	0.87216	0.6122	L	0.49571	1.57	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.68432	-0.5410	10	0.10902	T	0.67	.	0.9564	0.01386	0.5078:0.1595:0.1782:0.1545	.	228	P08218	CEL2B_HUMAN	Q	228	ENSP00000365075:R228Q	ENSP00000365075:R228Q	R	+	2	0	CELA2B	15686410	0.000000	0.05858	0.050000	0.19076	0.019000	0.09904	-1.973000	0.01500	-0.037000	0.13646	-0.943000	0.02675	CGG			0.597	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006448.1		NM_015849	
MST1L	11223	broad.mit.edu	37	1	17084508	17084508	+	RNA	SNP	T	T	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:17084508T>C	ENST00000455405.2	-	0	381							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GGACCCGCTGTAGGCCTGGCT	0.587																																					p.L530L													.	.			0			c.A1590G																																											0	exon12			CCGCTGTAGGCCT	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084508T>C			339	0	0		341	0.04	14	NM_001271733	23	0.00	0	B7WPB1|Q13209	RNA	SNP	ENST00000455405.2	37																																																																																						0.587	MST1L-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000400328.1		NM_001271733	
ASAP3	55616	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	23763670	23763670	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:23763670A>G	ENST00000336689.3	-	14	1339	c.1295T>C	c.(1294-1296)gTg>gCg	p.V432A	ASAP3_ENST00000437606.2_Missense_Mutation_p.V423A|ASAP3_ENST00000495646.1_5'Flank	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	432	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CCTGCTCTTCACCTCCGCGAT	0.716																																					p.V432A													.	.			0			c.T1295C												20.0	21.0	20.0					1																	23763670		2201	4299	6500	SO:0001583	missense	55616	exon14			CTCTTCACCTCCG	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1295T>C	1.37:g.23763670A>G	ENSP00000338769:p.Val432Ala		120	0	0		122	0.12	15	NM_017707	45	0.20	9	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	37	CCDS235.1	.	.	.	.	.	.	.	.	.	.	A	33	5.233890	0.95207	.	.	ENSG00000088280	ENST00000336689;ENST00000437606	T;T	0.46451	0.87;0.87	4.35	4.35	0.52113	.	0.185474	0.36444	N	0.002599	T	0.62307	0.2417	M	0.74467	2.265	0.39040	D	0.960102	D;D;P	0.64830	0.967;0.994;0.894	P;D;P	0.70227	0.645;0.968;0.627	T	0.69595	-0.5103	10	0.87932	D	0	.	12.7886	0.57520	1.0:0.0:0.0:0.0	.	423;301;432	Q8TDY4-3;B4DRP2;Q8TDY4	.;.;ASAP3_HUMAN	A	432;423	ENSP00000338769:V432A;ENSP00000408826:V423A	ENSP00000338769:V432A	V	-	2	0	ASAP3	23636257	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	5.615000	0.67702	1.954000	0.56735	0.391000	0.25812	GTG			0.716	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000008916.2		NM_017707	
PDIK1L	149420	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	26441057	26441057	+	Missense_Mutation	SNP	C	C	G	rs370757336		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:26441057C>G	ENST00000374271.4	+	3	545	c.258C>G	c.(256-258)caC>caG	p.H86Q	PDIK1L_ENST00000374269.1_Missense_Mutation_p.H86Q	NM_001243532.1|NM_001243533.1|NM_152835.4	NP_001230461.1|NP_001230462.1|NP_690048.1	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like	86	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		AGATGTCCCACGGCTCTAATT	0.423																																					p.H86Q													.	.			0			c.C258G												126.0	125.0	125.0					1																	26441057		2203	4300	6503	SO:0001583	missense	149420	exon2			GTCCCACGGCTCT	AF411102	CCDS274.1	1p35.1	2008-02-05			ENSG00000175087	ENSG00000175087			18981	protein-coding gene	gene with protein product		610785				14631099	Standard	NM_152835		Approved	CLIK1L	uc009vsb.3	Q8N165	OTTHUMG00000007511	ENST00000374271.4:c.258C>G	1.37:g.26441057C>G	ENSP00000363389:p.His86Gln		87	0	0		104	0.08	8	NM_001243532	6	0.17	1	B2R777|D3DPK2|Q5T2I0|Q8NDB3	Missense_Mutation	SNP	ENST00000374271.4	37	CCDS274.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.021992	0.75275	.	.	ENSG00000175087	ENST00000444713;ENST00000374271;ENST00000374269	T;T;T	0.63255	0.22;-0.03;-0.03	6.02	-5.26	0.02772	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51007	0.1649	L	0.41415	1.275	0.23862	N	0.996638	P	0.39883	0.693	B	0.41135	0.348	T	0.55398	-0.8147	10	0.62326	D	0.03	-9.6898	15.5397	0.76031	0.0:0.2163:0.0:0.7837	.	86	Q8N165	PDK1L_HUMAN	Q	86	ENSP00000406510:H86Q;ENSP00000363389:H86Q;ENSP00000363387:H86Q	ENSP00000363387:H86Q	H	+	3	2	PDIK1L	26313644	0.259000	0.24043	0.933000	0.37362	0.999000	0.98932	-0.461000	0.06712	-0.964000	0.03595	0.655000	0.94253	CAC			0.423	PDIK1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019752.1		NM_152835	
WDTC1	23038	broad.mit.edu	37	1	27632718	27632718	+	Silent	SNP	T	T	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:27632718T>G	ENST00000319394.3	+	16	2413	c.1878T>G	c.(1876-1878)ggT>ggG	p.G626G	WDTC1_ENST00000361771.3_Silent_p.G625G	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	626					cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		ATATGGAGGGTGCTTCACAGG	0.622																																					p.G626G													.	WDTC1	69		0			c.T1878G												95.0	81.0	86.0					1																	27632718		2203	4300	6503	SO:0001819	synonymous_variant	23038	exon16			GGAGGGTGCTTCA	AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.1878T>G	1.37:g.27632718T>G			101	0.0594059406	6		110	0.09	10	NM_001276252	102	0.05	5	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	Silent	SNP	ENST00000319394.3	37																																																																																						0.622	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015023	
TEX38	374973	broad.mit.edu	37	1	47138732	47138732	+	Silent	SNP	C	C	T	rs377090983		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:47138732C>T	ENST00000334122.4	+	2	332	c.225C>T	c.(223-225)taC>taT	p.Y75Y	EFCAB14_ENST00000544071.1_Intron|EFCAB14-AS1_ENST00000418985.1_RNA|ATPAF1_ENST00000525633.1_Intron|TEX38_ENST00000415500.1_5'UTR|EFCAB14-AS1_ENST00000442839.1_RNA|TEX38_ENST00000564373.1_Silent_p.Y21Y|TEX38_ENST00000569393.1_Silent_p.Y129Y	NM_001145474.2	NP_001138946.1	Q6PEX7	TEX38_HUMAN	testis expressed 38	75						integral component of membrane (GO:0016021)											GACGGCGCTACGGCATGAATG	0.567																																					p.Y75Y													.	.			0			c.C225T							C		0,1384		0,0,692	109.0	100.0	103.0		225	0.3	1.0	1		103	1,3181		0,1,1590	no	coding-synonymous	ATPAF1-AS1	NM_001145474.2		0,1,2282	TT,TC,CC		0.0314,0.0,0.0219		75/207	47138732	1,4565	692	1591	2283	SO:0001819	synonymous_variant	374973	exon2			GCGCTACGGCATG		CCDS57999.1, CCDS72780.1, CCDS72781.1	1p33	2012-10-12	2012-10-12	2012-10-12	ENSG00000186118	ENSG00000186118			29589	protein-coding gene	gene with protein product	"""testis highly expressed protein 4"""		"""chromosome 1 open reading frame 223"", ""ATPAF1 antisense RNA 1 (non-protein coding)"", ""ATPAF1 antisense RNA 1"""	C1orf223, ATPAF1-AS1		12477932	Standard	XM_005270845		Approved	LOC374973, THEG4	uc001cqj.3	Q6PEX7	OTTHUMG00000007991	ENST00000334122.4:c.225C>T	1.37:g.47138732C>T			114	0	0		116	0.03	4	NM_001145474	12	0.00	0	A1A4F8	Silent	SNP	ENST00000334122.4	37	CCDS57999.1																																																																																					0.567	TEX38-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000021929.2		NM_001145474	
LRP8	7804	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	53724042	53724042	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:53724042C>A	ENST00000306052.6	-	14	2259	c.2158G>T	c.(2158-2160)Gcc>Tcc	p.A720S	LRP8_ENST00000354412.3_Missense_Mutation_p.A591S|LRP8_ENST00000465675.1_Missense_Mutation_p.A273S|LRP8_ENST00000371454.2_Missense_Mutation_p.A720S|LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000347547.2_Missense_Mutation_p.A550S	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	720					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TCAGGACAGGCACATGTGTAC	0.567																																					p.A720S													.	.			0			c.G2158T												156.0	134.0	142.0					1																	53724042		2203	4300	6503	SO:0001583	missense	7804	exon14			GACAGGCACATGT	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2158G>T	1.37:g.53724042C>A	ENSP00000303634:p.Ala720Ser		134	0	0		163	0.07	12	NM_004631	43	0.05	2	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	37	CCDS578.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648468	0.87958	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58;-1.58	5.35	5.35	0.76521	Growth factor, receptor (1);Epidermal growth factor-like (1);	.	.	.	.	D	0.90407	0.6997	M	0.65498	2.005	0.80722	D	1	D;D;P;D;B;D	0.69078	0.978;0.994;0.95;0.997;0.362;0.978	D;D;D;D;B;D	0.85130	0.914;0.995;0.975;0.997;0.28;0.914	D	0.89808	0.3980	9	0.45353	T	0.12	.	19.0618	0.93096	0.0:1.0:0.0:0.0	.	273;591;550;720;720;273	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	S	720;720;273;591;550	ENSP00000303634:A720S;ENSP00000360509:A720S;ENSP00000437009:A273S;ENSP00000346391:A591S;ENSP00000334522:A550S	ENSP00000303634:A720S	A	-	1	0	LRP8	53496630	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.747000	0.85070	2.497000	0.84241	0.563000	0.77884	GCC			0.567	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000024699.1		NM_004631	
CELSR2	1952	mdanderson.org	37	1	109792751	109792751	+	Missense_Mutation	SNP	T	T	C	rs200277265		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:109792751T>C	ENST00000271332.3	+	1	111	c.50T>C	c.(49-51)cTg>cCg	p.L17P		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	17					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		ccgccgccgctgctgctgctg	0.751																																					p.L17P	NSCLC(158;1285 2011 34800 34852 42084)												CELSR2,colon,carcinoma,0,1	CELSR2	0	1	0			c.T50C												8.0	10.0	9.0					1																	109792751		1799	3668	5467	SO:0001583	missense	1952	exon1			CGCCGCTGCTGCT	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.50T>C	1.37:g.109792751T>C	ENSP00000271332:p.Leu17Pro		33	0	0		48	0.06	3	NM_001408	1	0.00	0	Q5T2Y7|Q92566	Missense_Mutation	SNP	ENST00000271332.3	37	CCDS796.1	.	.	.	.	.	.	.	.	.	.	N	5.977	0.364215	0.11296	.	.	ENSG00000143126	ENST00000271332	T	0.70631	-0.5	4.25	-3.77	0.04346	.	.	.	.	.	T	0.20251	0.0487	N	0.08118	0	0.58432	P	4.000000000004E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.13098	-1.0522	8	0.51188	T	0.08	.	1.1702	0.01823	0.161:0.339:0.1649:0.3351	.	17	Q9HCU4	CELR2_HUMAN	P	17	ENSP00000271332:L17P	ENSP00000271332:L17P	L	+	2	0	CELSR2	109594274	0.000000	0.05858	0.003000	0.11579	0.062000	0.15995	-0.618000	0.05578	-0.422000	0.07405	0.404000	0.27445	CTG			0.751	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033200.1		NM_001408	
ANKRD35	148741	broad.mit.edu	37	1	145560171	145560171	+	Silent	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:145560171G>T	ENST00000355594.4	+	8	744	c.657G>T	c.(655-657)ggG>ggT	p.G219G	ANKRD35_ENST00000544626.1_3'UTR	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	219										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					ACAGCACAGGGCATGATGCTC	0.632																																					p.G219G	Melanoma(9;127 754 22988 51047)												.	ANKRD35	96		0			c.G657T												76.0	70.0	72.0					1																	145560171		2203	4300	6503	SO:0001819	synonymous_variant	148741	exon8			CACAGGGCATGAT	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.657G>T	1.37:g.145560171G>T			184	0	0		153	0.03	4	NM_144698	0		0	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	ENST00000355594.4	37	CCDS919.1																																																																																					0.632	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000038515.1		NM_144698	
PRG4	10216	broad.mit.edu	37	1	186276240	186276240	+	Silent	SNP	T	T	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:186276240T>C	ENST00000445192.2	+	7	1434	c.1389T>C	c.(1387-1389)acT>acC	p.T463T	PRG4_ENST00000367485.4_Silent_p.T370T|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.T420T|PRG4_ENST00000367483.4_Silent_p.T422T	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	463	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T463T(3)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CACCCACCACTCCCAAGGAGC	0.657																																					p.T463T													PRG4,NS,carcinoma,0,4	PRG4	259	4	3	Substitution - coding silent(3)	endometrium(3)	c.T1389C												86.0	95.0	92.0					1																	186276240		2203	4298	6501	SO:0001819	synonymous_variant	10216	exon7			CACCACTCCCAAG	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1389T>C	1.37:g.186276240T>C			34	0.0588235294	2		54	0.28	15	NM_005807	0		0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	37	CCDS1369.1																																																																																					0.657	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086346.1		NM_005807	
CR1	1378	broad.mit.edu	37	1	207751340	207751340	+	Missense_Mutation	SNP	C	C	G	rs113578474	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr1:207751340C>G	ENST00000367049.4	+	29	4728	c.4728C>G	c.(4726-4728)agC>agG	p.S1576R	RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367052.1_Missense_Mutation_p.S1126R|CR1_ENST00000367051.1_Missense_Mutation_p.S1126R|CR1_ENST00000367053.1_Missense_Mutation_p.S1126R|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Missense_Mutation_p.S1126R	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1126	Sushi 24. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						GCATCTGGAGCGGCCCCGCCC	0.483																																					p.S1576R													.	CR1	354		0			c.C4728G												89.0	87.0	88.0					1																	207751340		1824	4046	5870	SO:0001583	missense	1378	exon29			CTGGAGCGGCCCC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4728C>G	1.37:g.207751340C>G	ENSP00000356016:p.Ser1576Arg		487	0.0020533881	1		401	0.01	5	NM_000651	0		0	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	37	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	T	9.594	1.126946	0.20959	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	3.5	-2.44	0.06502	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.81716	0.4881	M	0.89715	3.055	0.23510	N	0.997528	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.979;0.999;0.998	T	0.73151	-0.4073	9	0.72032	D	0.01	.	9.5893	0.39537	0.0:0.4942:0.0:0.5058	.	1126;1126;1576	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	R	1126;1126;1126;1126;676;1576	ENSP00000356019:S1126R;ENSP00000356018:S1126R;ENSP00000356020:S1126R;ENSP00000383744:S1126R;ENSP00000436139:S676R;ENSP00000356016:S1576R	ENSP00000356016:S1576R	S	+	3	2	CR1	205817963	0.000000	0.05858	0.791000	0.31998	0.034000	0.12701	-2.057000	0.01395	-1.102000	0.03023	-2.225000	0.00294	AGC			0.483	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382527.1		NM_000573	
GLUD1P2	100381203	broad.mit.edu	37	10	48968566	48968566	+	RNA	SNP	A	A	G	rs201727873		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr10:48968566A>G	ENST00000594520.1	+	0	723									glutamate dehydrogenase 1 pseudogene 2																		ACAGGATAACAAACTGGAAAA	0.318																																					.													.	.			0			.																																											0	.			GATAACAAACTGG	X66313, X66315, X66319		10q11.22	2013-02-15	2010-01-18	2010-01-18	ENSG00000227781				4337	pseudogene	pseudogene			"""glutamate dehydrogenase pseudogene 2"""	GLUDP2		8486350	Standard			Approved				OTTHUMG00000018156		10.37:g.48968566A>G			51	0.0196078431	1		46	0.15	7	.	1	0.00	0		RNA	SNP	ENST00000594520.1	37																																																																																						0.318	GLUD1P2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000461126.1		NG_016765	
USP54	159195	hgsc.bcm.edu	37	10	75279658	75279658	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr10:75279658G>A	ENST00000339859.4	-	18	2675	c.2575C>T	c.(2575-2577)Cgg>Tgg	p.R859W	USP54_ENST00000422491.2_Missense_Mutation_p.R41W|USP54_ENST00000408019.1_Missense_Mutation_p.R859W|USP54_ENST00000394811.2_De_novo_Start_OutOfFrame|RP11-137L10.6_ENST00000597958.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000497106.1_Intron|RP11-137L10.6_ENST00000593790.1_RNA|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000428547.1_Missense_Mutation_p.R709W			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	859					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					TGCAGGCTCCGTGCTTTTCGA	0.557																																					p.R859W	Colon(195;880 2046 8854 25025 38456)												.	.			0			c.C2575T												49.0	54.0	52.0					10																	75279658		2143	4272	6415	SO:0001583	missense	159195	exon17			GGCTCCGTGCTTT	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.2575C>T	10.37:g.75279658G>A	ENSP00000345216:p.Arg859Trp		67	0	0		83	0.05	4	NM_152586	10	0.00	0	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	37	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.136702	0.77662	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000422491	T;T;T;T	0.63417	1.54;1.54;1.54;-0.04	6.03	4.13	0.48395	.	0.190679	0.34828	U	0.003653	T	0.76572	0.4006	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.78879	-0.2030	10	0.87932	D	0	-10.039	15.4188	0.74995	0.0:0.0:0.7457:0.2543	.	41;859;859	E7EW90;Q70EL1-6;Q70EL1	.;.;UBP54_HUMAN	W	859;859;709;41	ENSP00000345216:R859W;ENSP00000386080:R859W;ENSP00000408714:R709W;ENSP00000407368:R41W	ENSP00000345216:R859W	R	-	1	2	USP54	74949664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.276000	0.58933	0.827000	0.34685	0.557000	0.71058	CGG			0.557	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316563.2		NM_152586	
CRTAC1	55118	mdanderson.org	37	10	99655119	99655119	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr10:99655119A>T	ENST00000370597.3	-	11	1724	c.1369T>A	c.(1369-1371)Ttt>Att	p.F457I	CRTAC1_ENST00000298819.4_Missense_Mutation_p.F457I|CRTAC1_ENST00000370591.2_Missense_Mutation_p.F457I	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	457						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		CCCCTGGCAAAGGCCCCAAAC	0.627																																					p.F457I													.	.			0			c.T1369A												73.0	66.0	68.0					10																	99655119		2203	4300	6503	SO:0001583	missense	55118	exon11			TGGCAAAGGCCCC	AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1369T>A	10.37:g.99655119A>T	ENSP00000359629:p.Phe457Ile		50	0	0		49	0.06	3	NM_001206528	19	0.00	0	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039850	0.75732	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.73789	1.46;-0.78;1.46;0.06;0.06	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.82268	0.5000	M	0.86740	2.835	0.80722	D	1	P;D;P	0.54397	0.523;0.966;0.85	B;P;P	0.52109	0.19;0.69;0.658	T	0.82067	-0.0641	10	0.19590	T	0.45	-15.6966	14.81	0.69989	1.0:0.0:0.0:0.0	.	457;457;353	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	I	353;457;457;449;457	ENSP00000408445:F353I;ENSP00000359629:F457I;ENSP00000298819:F457I;ENSP00000310810:F449I;ENSP00000359623:F457I	ENSP00000298819:F457I	F	-	1	0	CRTAC1	99645109	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.403000	0.79983	1.896000	0.54893	0.379000	0.24179	TTT			0.627	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000049754.1		NM_018058	
MUC2	4583	mdanderson.org	37	11	1092971	1092971	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:1092971C>T	ENST00000441003.2	+	30	4817	c.4790C>T	c.(4789-4791)aCa>aTa	p.T1597I	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Intron|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ccaaccccaacacccaccggc	0.632																																					p.T1597I													MUC2_ENST00000441003,NS,carcinoma,0,1	MUC2_ENST00000441003	0	1	0			c.C4790T												47.0	82.0	70.0					11																	1092971		1782	3233	5015	SO:0001583	missense	4583	exon30			CCCCAACACCCAC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4790C>T	11.37:g.1092971C>T	ENSP00000415183:p.Thr1597Ile		38	0.0263157895	1		16	0.13	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	2.395	-0.338980	0.05243	.	.	ENSG00000198788	ENST00000441003	T	0.14640	2.49	1.75	0.762	0.18454	.	.	.	.	.	T	0.07143	0.0181	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.41520	-0.9504	8	0.22109	T	0.4	.	4.3366	0.11089	0.0:0.6142:0.0:0.3858	.	1597	E7EUV1	.	I	1597	ENSP00000415183:T1597I	ENSP00000415183:T1597I	T	+	2	0	MUC2	1082971	0.029000	0.19370	0.001000	0.08648	0.134000	0.20937	1.107000	0.31110	0.104000	0.17725	0.121000	0.15741	ACA			0.632	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
ZDHHC5	25921	mdanderson.org	37	11	57456091	57456091	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:57456091G>T	ENST00000287169.3	+	4	1700	c.338G>T	c.(337-339)cGt>cTt	p.R113L	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.R60L	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	113					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						CGCTTTTACCGTCCCCCTCGA	0.517																																					p.R113L													.	.			0			c.G338T												113.0	93.0	100.0					11																	57456091		2201	4296	6497	SO:0001583	missense	25921	exon4			TTTACCGTCCCCC	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.338G>T	11.37:g.57456091G>T	ENSP00000287169:p.Arg113Leu		106	0	0		56	0.05	3	NM_015457	72	0.00	0	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	ENST00000287169.3	37	CCDS7965.1	.	.	.	.	.	.	.	.	.	.	G	36	5.620420	0.96660	.	.	ENSG00000156599	ENST00000527985;ENST00000287169;ENST00000528177;ENST00000532842;ENST00000529447	D;D;D;D;D	0.98807	-5.15;-5.15;-5.15;-5.15;-5.15	5.02	5.02	0.67125	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.99450	0.9805	H	0.96430	3.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98340	1.0538	10	0.87932	D	0	-3.9462	18.1316	0.89603	0.0:0.0:1.0:0.0	.	113	Q9C0B5	ZDHC5_HUMAN	L	60;113;11;11;39	ENSP00000432202:R60L;ENSP00000287169:R113L;ENSP00000431209:R11L;ENSP00000435593:R11L;ENSP00000435722:R39L	ENSP00000287169:R113L	R	+	2	0	ZDHHC5	57212667	1.000000	0.71417	0.980000	0.43619	0.993000	0.82548	9.110000	0.94302	2.614000	0.88457	0.561000	0.74099	CGT			0.517	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393694.1		NM_015457	
LTBP3	4054	broad.mit.edu	37	11	65325326	65325328	+	In_Frame_Del	DEL	CAG	CAG	-	rs577530923	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:65325326_65325328delCAG	ENST00000301873.5	-	1	371_373	c.103_105delCTG	c.(103-105)ctgdel	p.L35del	LTBP3_ENST00000536982.1_5'Flank|LTBP3_ENST00000322147.4_In_Frame_Del_p.L35del	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	35	Gly-rich.			Missing (in Ref. 2; BAB15767). {ECO:0000305}.	bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						cgcccaggcccagcagcagcagc	0.818																																					p.35_35del													.	LTBP3	55		0			c.103_105del								,,	2,10,52		1,0,0,5,0,26					,,	2.7	1.0			1	37,32,177		18,0,1,14,4,86	no	codingComplex,utr-5,codingComplex	LTBP3	NM_021070.4,NM_001164266.1,NM_001130144.2	,,	19,0,1,19,4,112	A1A1,A1A2,A1R,A2A2,A2R,RR		28.0488,18.75,26.129	,,	,,		39,42,229				SO:0001651	inframe_deletion	4054	exon1			CAGGCCCAGCAGC	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.103_105delCTG	11.37:g.65325335_65325337delCAG	ENSP00000301873:p.Leu35del		10	0	0		6	0.33	2	NM_001130144	0		0	O15107|Q96HB9|Q9H7K2|Q9UFN4	In_Frame_Del	DEL	ENST00000301873.5	37	CCDS44647.1																																																																																					0.818	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390538.1		NM_021070	
RIN1	9610	broad.mit.edu	37	11	66103323	66103323	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:66103323T>G	ENST00000311320.4	-	3	418	c.292A>C	c.(292-294)Acc>Ccc	p.T98P	RIN1_ENST00000530056.1_5'UTR|RP11-867G23.12_ENST00000526655.1_RNA|RIN1_ENST00000524804.1_5'Flank|RIN1_ENST00000424433.2_5'UTR	NM_004292.2	NP_004283.2	Q13671	RIN1_HUMAN	Ras and Rab interactor 1	98	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				associative learning (GO:0008306)|endocytosis (GO:0006897)|memory (GO:0007613)|negative regulation of synaptic plasticity (GO:0031914)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|lung(8)|ovary(1)	14						CACTGGCGGGTGTTAGATTTC	0.647																																					p.T98P													.	RIN1	64		0			c.A292C												27.0	32.0	30.0					11																	66103323		2200	4291	6491	SO:0001583	missense	9610	exon3			GGCGGGTGTTAGA	L36463	CCDS31614.1	11q13.2	2005-09-18				ENSG00000174791			18749	protein-coding gene	gene with protein product		605965				9144171, 1849280	Standard	NM_004292		Approved		uc001ohn.1	Q13671		ENST00000311320.4:c.292A>C	11.37:g.66103323T>G	ENSP00000310406:p.Thr98Pro		47	0.1489361702	7		47	0.32	15	NM_004292	4	0.00	0	O15010|Q00427|Q96CC8	Missense_Mutation	SNP	ENST00000311320.4	37	CCDS31614.1	.	.	.	.	.	.	.	.	.	.	T	8.888	0.953287	0.18431	.	.	ENSG00000174791	ENST00000311320	T	0.46063	0.88	4.46	3.28	0.37604	SH2 motif (3);	0.377544	0.22674	N	0.057033	T	0.28632	0.0709	L	0.35487	1.065	0.80722	D	1	B	0.16802	0.019	B	0.14023	0.01	T	0.05599	-1.0875	10	0.33141	T	0.24	-11.8941	7.2275	0.26024	0.1981:0.0:0.0:0.8019	.	98	Q13671	RIN1_HUMAN	P	98	ENSP00000310406:T98P	ENSP00000310406:T98P	T	-	1	0	RIN1	65859899	1.000000	0.71417	0.826000	0.32828	0.076000	0.17211	0.450000	0.21762	0.637000	0.30526	0.379000	0.24179	ACC			0.647	RIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392980.2		NM_004292	
EXPH5	23086	broad.mit.edu	37	11	108381652	108381652	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:108381652G>T	ENST00000265843.4	-	6	4692	c.4582C>A	c.(4582-4584)Cca>Aca	p.P1528T	EXPH5_ENST00000443411.1_Missense_Mutation_p.P1340T|EXPH5_ENST00000525344.1_Missense_Mutation_p.P1521T|EXPH5_ENST00000428840.1_Missense_Mutation_p.P1452T|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1528					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TCTAAGTTTGGTTCATCTGAC	0.423																																					p.P1528T													.	EXPH5	193		0			c.C4582A												65.0	60.0	61.0					11																	108381652		2201	4298	6499	SO:0001583	missense	23086	exon6			AGTTTGGTTCATC		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4582C>A	11.37:g.108381652G>T	ENSP00000265843:p.Pro1528Thr		131	0.0229007634	3		99	0.04	4	NM_015065	0		0	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	ENST00000265843.4	37	CCDS8341.1	.	.	.	.	.	.	.	.	.	.	G	9.751	1.167459	0.21621	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312	T;T;T;T;T	0.03035	4.29;4.22;4.07;4.29;4.13	5.72	2.71	0.32032	.	0.747577	0.12679	N	0.448166	T	0.04452	0.0122	L	0.56769	1.78	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.45542	-0.9254	10	0.21014	T	0.42	0.2028	5.5115	0.16884	0.0749:0.1365:0.6366:0.1521	.	1528	Q8NEV8	EXPH5_HUMAN	T	1528;1452;1340;1521;1452	ENSP00000265843:P1528T;ENSP00000391966:P1452T;ENSP00000411390:P1340T;ENSP00000432546:P1521T;ENSP00000432683:P1452T	ENSP00000265843:P1528T	P	-	1	0	EXPH5	107886862	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.268000	0.08607	0.280000	0.22209	0.561000	0.74099	CCA			0.423	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390279.1		NM_015065	
ST3GAL4	6484	broad.mit.edu;mdanderson.org	37	11	126276436	126276436	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr11:126276436G>T	ENST00000526727.1	+	2	459	c.85G>T	c.(85-87)Gac>Tac	p.D29Y	ST3GAL4_ENST00000392669.2_Missense_Mutation_p.D29Y|ST3GAL4_ENST00000530591.1_Missense_Mutation_p.D29Y|ST3GAL4_ENST00000227495.6_Missense_Mutation_p.D29Y|ST3GAL4_ENST00000449406.2_Missense_Mutation_p.D18Y|ST3GAL4_ENST00000532243.1_Missense_Mutation_p.D28Y|ST3GAL4_ENST00000526756.1_3'UTR|ST3GAL4_ENST00000534083.1_Missense_Mutation_p.D29Y|ST3GAL4_ENST00000534457.1_Missense_Mutation_p.D28Y|ST3GAL4_ENST00000356132.4_Missense_Mutation_p.D29Y|ST3GAL4_ENST00000444328.2_Missense_Mutation_p.D29Y			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	29					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		CTCCCGGGAAGACAGGTACAT	0.577																																					p.D29Y													.	ST3GAL4	25		0			c.G85T												186.0	146.0	160.0					11																	126276436		2201	4298	6499	SO:0001583	missense	6484	exon3			CGGGAAGACAGGT	X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.85G>T	11.37:g.126276436G>T	ENSP00000436047:p.Asp29Tyr		79	0	0		53	0.08	4	NM_001254757	116	0.00	0	A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Missense_Mutation	SNP	ENST00000526727.1	37	CCDS58193.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084912	0.55861	.	.	ENSG00000110080	ENST00000227495;ENST00000444328;ENST00000356132;ENST00000530591;ENST00000534083;ENST00000526311;ENST00000528858;ENST00000534452;ENST00000392669;ENST00000526727;ENST00000449406;ENST00000532243;ENST00000534457	T;T;T;T;T;T;T;T;T;T;T	0.47528	0.87;0.91;0.86;0.87;0.91;0.9;0.91;0.91;0.91;0.9;0.84	5.32	4.41	0.53225	.	0.269957	0.31660	N	0.007269	T	0.52224	0.1721	L	0.50333	1.59	0.42229	D	0.991884	D;P;P	0.56968	0.978;0.868;0.868	P;B;B	0.53146	0.719;0.406;0.31	T	0.50533	-0.8817	10	0.35671	T	0.21	.	12.4666	0.55762	0.0781:0.0:0.9219:0.0	.	10;29;29	Q9HAA9;Q6IBE6;Q11206	.;.;SIA4C_HUMAN	Y	29;29;29;29;29;29;29;29;29;29;18;28;28	ENSP00000227495:D29Y;ENSP00000394354:D29Y;ENSP00000348451:D29Y;ENSP00000433989:D29Y;ENSP00000433318:D29Y;ENSP00000432424:D29Y;ENSP00000376437:D29Y;ENSP00000436047:D29Y;ENSP00000399444:D18Y;ENSP00000434349:D28Y;ENSP00000434668:D28Y	ENSP00000227495:D29Y	D	+	1	0	ST3GAL4	125781646	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.023000	0.70848	1.236000	0.43740	0.650000	0.86243	GAC			0.577	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000386470.1		NM_006278	
BCAT1	586	broad.mit.edu	37	12	24995152	24995152	+	Silent	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr12:24995152G>A	ENST00000261192.7	-	7	1207	c.681C>T	c.(679-681)taC>taT	p.Y227Y	BCAT1_ENST00000538118.1_Silent_p.Y226Y|BCAT1_ENST00000539282.1_Silent_p.Y239Y|BCAT1_ENST00000539780.1_Silent_p.Y190Y|BCAT1_ENST00000544418.1_5'UTR|BCAT1_ENST00000342945.5_Silent_p.Y166Y	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	227					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	GAGATGAGCCGTAATTCCTTT	0.438																																					p.Y239Y													.	BCAT1	44		0			c.C717T												60.0	58.0	58.0					12																	24995152		1910	4138	6048	SO:0001819	synonymous_variant	586	exon7			TGAGCCGTAATTC		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.681C>T	12.37:g.24995152G>A			73	0	0		154	0.03	4	NM_001178093	2119	0.00	1	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Silent	SNP	ENST00000261192.7	37	CCDS44845.1																																																																																					0.438	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000402080.1		NM_005504	
TUBA1C	84790	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49663613	49663613	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr12:49663613G>A	ENST00000301072.6	+	3	504	c.229G>A	c.(229-231)Gaa>Aaa	p.E77K	TUBA1C_ENST00000549183.1_Missense_Mutation_p.E77K|TUBA1C_ENST00000541364.1_Missense_Mutation_p.E147K|RP11-161H23.5_ENST00000550468.2_RNA	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	77					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						TTCTCCAGATGAAGTTCGCAC	0.597																																					p.E77K													.	.			0			c.G229A												90.0	88.0	89.0					12																	49663613		2203	4300	6503	SO:0001583	missense	84790	exon3			CCAGATGAAGTTC	BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.229G>A	12.37:g.49663613G>A	ENSP00000301072:p.Glu77Lys		109	0	0		135	0.16	21	NM_032704	7170	0.22	1610		Missense_Mutation	SNP	ENST00000301072.6	37	CCDS8782.1	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015434	0.54468	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000549183;ENST00000321665	T;T;T	0.69040	-0.37;-0.37;-0.37	4.28	4.28	0.50868	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	T	0.74921	0.3780	M	0.90252	3.1	0.58432	D	0.999993	B;B	0.20887	0.03;0.049	B;B	0.27715	0.082;0.067	T	0.78270	-0.2269	10	0.87932	D	0	.	16.7586	0.85506	0.0:0.0:1.0:0.0	.	147;77	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	K	147;77;77;77	ENSP00000443475:E147K;ENSP00000301072:E77K;ENSP00000448211:E77K	ENSP00000301072:E77K	E	+	1	0	TUBA1C	47949880	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	7.561000	0.82288	2.675000	0.91044	0.549000	0.68633	GAA			0.597	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404424.1		NM_032704	
BEST3	144453	broad.mit.edu	37	12	70049388	70049388	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr12:70049388G>T	ENST00000330891.5	-	10	1532	c.1306C>A	c.(1306-1308)Ctg>Atg	p.L436M	BEST3_ENST00000488961.1_Missense_Mutation_p.L223M|BEST3_ENST00000553096.1_Missense_Mutation_p.L330M|BEST3_ENST00000331471.4_Intron	NM_001282613.1|NM_032735.2	NP_001269542.1|NP_116124.2	Q8N1M1	BEST3_HUMAN	bestrophin 3	436					negative regulation of ion transport (GO:0043271)	chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(2)	12	Breast(13;2.31e-06)|Esophageal squamous(21;0.187)		Lung(24;0.000278)|OV - Ovarian serous cystadenocarcinoma(12;0.0019)|STAD - Stomach adenocarcinoma(21;0.00694)			GGCACATCCAGTAGGTCCCTG	0.592																																					p.L436M													.	BEST3	129		0			c.C1306A												89.0	94.0	92.0					12																	70049388		2000	4176	6176	SO:0001583	missense	144453	exon10			CATCCAGTAGGTC	AF440758	CCDS8992.2, CCDS41810.1, CCDS61192.1, CCDS61193.1, CCDS73496.1	12q14.2-q15	2012-09-26	2006-10-18	2006-10-18	ENSG00000127325	ENSG00000127325		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	17105	protein-coding gene	gene with protein product		607337	"""vitelliform macular dystrophy 2-like 3"""	VMD2L3		12032738	Standard	NM_032735		Approved	MGC40411, MGC13168	uc001svg.3	Q8N1M1	OTTHUMG00000149919	ENST00000330891.5:c.1306C>A	12.37:g.70049388G>T	ENSP00000332413:p.Leu436Met		78	0	0		75	0.04	3	NM_032735	0		0	B5MDI8|F8VVZ2|Q53YQ7|Q8N356|Q8NFT9|Q9BR80	Missense_Mutation	SNP	ENST00000330891.5	37	CCDS8992.2	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041888	0.35989	.	.	ENSG00000127325	ENST00000488961;ENST00000330891;ENST00000553096	D;D;D	0.98120	-4.42;-4.73;-4.7	5.63	5.63	0.86233	.	0.533626	0.17202	N	0.183086	D	0.98033	0.9352	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.68192	0.897;0.956	D	0.96642	0.9475	10	0.29301	T	0.29	-11.6734	11.8624	0.52474	0.0812:0.0:0.9188:0.0	.	436;223	Q8N1M1;B5MDI8	BEST3_HUMAN;.	M	223;436;330	ENSP00000433213:L223M;ENSP00000332413:L436M;ENSP00000449548:L330M	ENSP00000332413:L436M	L	-	1	2	BEST3	68335655	1.000000	0.71417	0.993000	0.49108	0.032000	0.12392	1.555000	0.36277	2.636000	0.89361	0.655000	0.94253	CTG			0.592	BEST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313908.2		NM_152439	
NBEA	26960	mdanderson.org	37	13	35672447	35672447	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr13:35672447G>A	ENST00000400445.3	+	11	2119	c.1585G>A	c.(1585-1587)Gca>Aca	p.A529T	NBEA_ENST00000540320.1_Missense_Mutation_p.A529T|NBEA_ENST00000379939.2_Missense_Mutation_p.A529T|NBEA_ENST00000310336.4_Missense_Mutation_p.A529T	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	529					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TACTCTGTTGGCATTCCTGGT	0.368																																					p.A529T													.	.			0			c.G1585A												79.0	69.0	72.0					13																	35672447		1890	4128	6018	SO:0001583	missense	26960	exon11			CTGTTGGCATTCC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.1585G>A	13.37:g.35672447G>A	ENSP00000383295:p.Ala529Thr		46	0	0		34	0.09	3	NM_015678	0		0	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	37	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.991608	0.93106	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.46034	0.1372	L	0.53249	1.67	0.80722	D	1	P	0.48834	0.916	P	0.45712	0.491	T	0.36939	-0.9727	10	0.30078	T	0.28	.	18.4524	0.90709	0.0:0.0:1.0:0.0	.	529	Q5T321	.	T	529	ENSP00000440951:A529T;ENSP00000383295:A529T;ENSP00000369271:A529T;ENSP00000308534:A529T	ENSP00000308534:A529T	A	+	1	0	NBEA	34570447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.690000	0.84178	2.345000	0.79718	0.585000	0.79938	GCA			0.368	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_015678	
RNF113B	140432	mdanderson.org	37	13	98829478	98829478	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr13:98829478G>T	ENST00000267291.6	-	1	41	c.13C>A	c.(13-15)Cct>Act	p.P5T	FARP1_ENST00000319562.6_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000595437.1_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	5							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CCTGGAGAAGGTGGCGCTGCC	0.657																																					p.P5T													.	.			0			c.C13A												40.0	36.0	38.0					13																	98829478		2203	4300	6503	SO:0001583	missense	140432	exon1			GAGAAGGTGGCGC	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.13C>A	13.37:g.98829478G>T	ENSP00000267291:p.Pro5Thr		27	0	0		19	0.16	3	NM_178861	10	0.00	0	Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.813514	0.00600	.	.	ENSG00000139797	ENST00000267291	T	0.29917	1.55	1.17	-1.1	0.09872	.	1.399460	0.04811	U	0.435243	T	0.12518	0.0304	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.11329	0.006	T	0.17379	-1.0371	10	0.08599	T	0.76	.	2.6064	0.04879	0.2337:0.3101:0.4562:0.0	.	5	Q8IZP6	R113B_HUMAN	T	5	ENSP00000267291:P5T	ENSP00000267291:P5T	P	-	1	0	RNF113B	97627479	0.083000	0.21467	0.000000	0.03702	0.003000	0.03518	0.558000	0.23469	-0.435000	0.07264	-0.424000	0.05967	CCT			0.657	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045536.3		NM_178861	
IRS2	8660	mdanderson.org	37	13	110434903	110434903	+	Silent	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr13:110434903G>A	ENST00000375856.3	-	1	4012	c.3498C>T	c.(3496-3498)gcC>gcT	p.A1166A		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1166					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			TGGGGTTGTGGGCGAAGGACG	0.692																																					p.A1166A	Melanoma(100;613 2409 40847)												.	.			0			c.C3498T												4.0	4.0	4.0					13																	110434903		1798	3702	5500	SO:0001819	synonymous_variant	8660	exon1			GTTGTGGGCGAAG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3498C>T	13.37:g.110434903G>A			46	0	0		42	0.07	3	NM_003749	4	0.00	0	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																					0.692	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045755.1		NM_003749	
NRL	4901	broad.mit.edu;mdanderson.org	37	14	24551760	24551760	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr14:24551760G>T	ENST00000561028.1	-	2	617	c.298C>A	c.(298-300)Cag>Aag	p.Q100K	NRL_ENST00000560550.1_5'Flank|NRL_ENST00000397002.2_Missense_Mutation_p.Q100K|NRL_ENST00000396997.1_Missense_Mutation_p.Q100K|NRL_ENST00000396995.1_5'Flank			P54845	NRL_HUMAN	neural retina leucine zipper	100					positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of rhodopsin gene expression (GO:0007468)|response to stimulus (GO:0050896)|retinal rod cell development (GO:0046548)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)	2				GBM - Glioblastoma multiforme(265;0.0181)		CCCTGACCCTGCAGCAGCTCC	0.662																																					p.Q100K													.	NRL	8		0			c.C298A												33.0	36.0	35.0					14																	24551760		2199	4294	6493	SO:0001583	missense	4901	exon2			GACCCTGCAGCAG		CCDS9608.1	14q11.1-q11.2	2013-01-08			ENSG00000129535	ENSG00000129535			8002	protein-coding gene	gene with protein product		162080				1427865, 10192380	Standard	NM_006177		Approved	D14S46E, RP27, NRL-MAF	uc021rrk.1	P54845	OTTHUMG00000028789	ENST00000561028.1:c.298C>A	14.37:g.24551760G>T	ENSP00000454062:p.Gln100Lys		88	0	0		75	0.05	4	NM_006177	5	0.00	0	A8MX14|Q53XD0	Missense_Mutation	SNP	ENST00000561028.1	37	CCDS9608.1	.	.	.	.	.	.	.	.	.	.	G	11.21	1.571478	0.28003	.	.	ENSG00000129535	ENST00000397002;ENST00000396997	T;T	0.77098	-1.07;-1.07	5.19	5.19	0.71726	Maf transcription factor, N-terminal (1);	0.226336	0.34025	N	0.004322	T	0.71542	0.3352	L	0.36672	1.1	0.80722	D	1	P	0.44195	0.828	P	0.47251	0.542	T	0.65853	-0.6067	10	0.17369	T	0.5	-31.6105	11.184	0.48644	0.0:0.0:0.8169:0.1831	.	100	P54845	NRL_HUMAN	K	100	ENSP00000380197:Q100K;ENSP00000380193:Q100K	ENSP00000337023:Q100K	Q	-	1	0	NRL	23621600	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.502000	0.53332	2.695000	0.91970	0.655000	0.94253	CAG			0.662	NRL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415595.1			
LTB4R2	56413	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	24780848	24780848	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr14:24780848G>C	ENST00000528054.1	+	1	2688	c.1071G>C	c.(1069-1071)gaG>gaC	p.E357D	LTB4R2_ENST00000533293.1_Missense_Mutation_p.E326D|LTB4R2_ENST00000543919.1_Missense_Mutation_p.E326D|LTB4R_ENST00000396789.4_5'Flank|CIDEB_ENST00000258807.5_5'Flank|CIDEB_ENST00000555817.1_5'Flank|CIDEB_ENST00000336557.5_5'Flank|LTB4R_ENST00000345363.3_5'UTR			Q9NPC1	LT4R2_HUMAN	leukotriene B4 receptor 2	357					chemotaxis (GO:0006935)|keratinocyte migration (GO:0051546)|negative regulation of adenylate cyclase activity (GO:0007194)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene B4 receptor activity (GO:0001632)|leukotriene receptor activity (GO:0004974)			endometrium(1)|lung(1)|ovary(1)	3				GBM - Glioblastoma multiforme(265;0.018)		GGACCATGGAGCTCCGAACTA	0.677																																					p.E326D													.	.			0			c.G978C												36.0	46.0	42.0					14																	24780848		2194	4287	6481	SO:0001583	missense	56413	exon2			CATGGAGCTCCGA	AB008193	CCDS9625.1, CCDS9625.2	14q12	2014-04-11			ENSG00000213906	ENSG00000213906		"""GPCR / Class A : Leukotriene receptors"""	19260	protein-coding gene	gene with protein product		605773				11006272, 10934229	Standard	NM_001164692		Approved	BLTR2, BLT2, JULF2, NOP9	uc001wor.3	Q9NPC1	OTTHUMG00000186500	ENST00000528054.1:c.1071G>C	14.37:g.24780848G>C	ENSP00000432146:p.Glu357Asp		41	0.0243902439	1		38	0.13	5	NM_019839	25	0.20	5	Q5KU28|Q9NPE5	Missense_Mutation	SNP	ENST00000528054.1	37		.	.	.	.	.	.	.	.	.	.	G	16.55	3.153429	0.57259	.	.	ENSG00000213906	ENST00000528054;ENST00000533293;ENST00000543919	T;T;T	0.68624	-0.34;-0.34;-0.34	4.81	-0.322	0.12713	.	0.898456	0.09303	U	0.820662	T	0.56601	0.1996	N	0.24115	0.695	0.80722	D	1	D	0.58268	0.982	P	0.49999	0.628	T	0.51188	-0.8737	10	0.21540	T	0.41	.	9.8653	0.41140	0.3307:0.0:0.6693:0.0	.	357	Q9NPC1	LT4R2_HUMAN	D	357;326;326	ENSP00000432146:E357D;ENSP00000433290:E326D;ENSP00000445772:E326D	ENSP00000337731:E357D	E	+	3	2	LTB4R2	23850688	0.002000	0.14202	0.998000	0.56505	0.986000	0.74619	-0.281000	0.08456	-0.063000	0.13065	-0.423000	0.05987	GAG			0.677	LTB4R2-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000073194.4			
LINGO1	84894	ucsc.edu	37	15	77906739	77906739	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr15:77906739C>T	ENST00000355300.6	-	2	1684	c.1510G>A	c.(1510-1512)Ggc>Agc	p.G504S	LINGO1_ENST00000561030.1_Missense_Mutation_p.G498S	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	504	Ig-like C2-type.				central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						GAGTCGTTGCCGCCCGCGTTG	0.652																																					p.G504S													.	LINGO1	76		0			c.G1510A												43.0	47.0	45.0					15																	77906739		2135	4221	6356	SO:0001583	missense	84894	exon2			CGTTGCCGCCCGC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1510G>A	15.37:g.77906739C>T	ENSP00000347451:p.Gly504Ser		51	0	0		43	0.09	4	NM_032808	208	0.00	1	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Missense_Mutation	SNP	ENST00000355300.6	37	CCDS45313.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.339250	0.81911	.	.	ENSG00000169783	ENST00000355300	T	0.74315	-0.83	5.08	5.08	0.68730	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89733	0.6800	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92324	0.5868	10	0.87932	D	0	.	18.482	0.90815	0.0:1.0:0.0:0.0	.	504	Q96FE5	LIGO1_HUMAN	S	504	ENSP00000347451:G504S	ENSP00000347451:G504S	G	-	1	0	LINGO1	75693794	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.818000	0.86416	2.359000	0.80004	0.462000	0.41574	GGC			0.652	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419546.1		NM_032808	
AXIN1	8312	broad.mit.edu;mdanderson.org	37	16	396715	396715	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:396715G>T	ENST00000262320.3	-	2	682	c.311C>A	c.(310-312)aCt>aAt	p.T104N	AXIN1_ENST00000354866.3_Missense_Mutation_p.T104N|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	104	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				CTTCAGGAAAGTCCTGAACAG	0.582											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T104N													.	AXIN1	290		0			c.C311A												45.0	41.0	42.0					16																	396715		2203	4300	6503	SO:0001583	missense	8312	exon2			AGGAAAGTCCTGA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.311C>A	16.37:g.396715G>T	ENSP00000262320:p.Thr104Asn		61	0	0	588	46	0.07	3	NM_181050	57	0.00	0	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	ENST00000262320.3	37	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	12.61	1.989705	0.35131	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.01902	4.57;4.57	5.51	4.55	0.56014	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.141247	0.64402	D	0.000005	T	0.02455	0.0075	L	0.33137	0.985	0.58432	D	0.999998	B;B	0.19706	0.017;0.038	B;B	0.23275	0.018;0.045	T	0.53279	-0.8461	10	0.41790	T	0.15	-29.7606	10.2023	0.43092	0.074:0.1381:0.7879:0.0	.	104;104	O15169-2;O15169	.;AXIN1_HUMAN	N	104	ENSP00000262320:T104N;ENSP00000346935:T104N	ENSP00000262320:T104N	T	-	2	0	AXIN1	336716	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.020000	0.49643	2.605000	0.88082	0.655000	0.94253	ACT			0.582	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000139441.3			
METRN	79006	mdanderson.org	37	16	767135	767135	+	Silent	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:767135G>T	ENST00000568223.2	+	4	805	c.630G>T	c.(628-630)gtG>gtT	p.V210V	METRN_ENST00000568415.1_Silent_p.V77V	NM_024042.2	NP_076947.1	Q9UJH8	METRN_HUMAN	meteorin, glial cell differentiation regulator	210					glial cell differentiation (GO:0010001)|positive regulation of axonogenesis (GO:0050772)	extracellular space (GO:0005615)				skin(1)	1		Hepatocellular(780;0.00335)				TCATCACTGTGGTGGCCGCCC	0.652																																					p.V210V													.	.			0			c.G630T												30.0	38.0	35.0					16																	767135		2185	4289	6474	SO:0001819	synonymous_variant	79006	exon4			CACTGTGGTGGCC	BC000662	CCDS10422.1	16p13.3	2008-02-05	2004-11-26	2004-12-01	ENSG00000103260	ENSG00000103260			14151	protein-coding gene	gene with protein product		610998	"""chromosome 16 open reading frame 23"""	C16orf23		15085178	Standard	NM_024042		Approved	MGC2601	uc002cjd.3	Q9UJH8	OTTHUMG00000047851	ENST00000568223.2:c.630G>T	16.37:g.767135G>T			59	0	0		36	0.08	3	NM_024042	94	0.00	0	Q9UJH9	Silent	SNP	ENST00000568223.2	37	CCDS10422.1																																																																																					0.652	METRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109074.4		NM_024042	
ZSCAN10	84891	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	16	3142732	3142732	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:3142732G>T	ENST00000252463.2	-	1	129	c.42C>A	c.(40-42)tgC>tgA	p.C14*	ZSCAN10_ENST00000538082.2_Silent_p.R22R|ZSCAN10_ENST00000572548.1_Nonsense_Mutation_p.C14*|ZSCAN10_ENST00000575108.1_Intron	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	14	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GCCAGTGGCCGCAGAGCTCCC	0.667																																					p.C14X													ZSCAN10,NS,carcinoma,-1,1	ZSCAN10	-1	1	0			c.C42A												12.0	15.0	14.0					16																	3142732		2172	4251	6423	SO:0001587	stop_gained	84891	exon1			GTGGCCGCAGAGC	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.42C>A	16.37:g.3142732G>T	ENSP00000252463:p.Cys14*		78	0	0		72	0.06	4	NM_032805	365	0.01	2	B3KQD3|H0YFS6|Q1WWM2	Nonsense_Mutation	SNP	ENST00000252463.2	37	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266937	0.80469	.	.	ENSG00000130182	ENST00000252463	.	.	.	5.39	2.33	0.28932	.	0.000000	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-37.1522	7.2639	0.26219	0.2875:0.0:0.7125:0.0	.	.	.	.	X	14	.	ENSP00000252463:C14X	C	-	3	2	ZSCAN10	3082733	0.005000	0.15991	0.145000	0.22337	0.381000	0.30169	0.263000	0.18478	0.245000	0.21373	0.555000	0.69702	TGC			0.667	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437124.2		NM_032805	
ACSM5	54988	mdanderson.org	37	16	20441066	20441066	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:20441066G>T	ENST00000331849.4	+	8	1215	c.1068G>T	c.(1066-1068)gaG>gaT	p.E356D		NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	356					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						ACGTGAGGGAGAAGTGGAAAC	0.587																																					p.E356D													.	.			0			c.G1068T												91.0	93.0	92.0					16																	20441066		2203	4300	6503	SO:0001583	missense	54988	exon8			GAGGGAGAAGTGG		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1068G>T	16.37:g.20441066G>T	ENSP00000327916:p.Glu356Asp		47	0	0		38	0.08	3	NM_017888	1	0.00	0	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	37	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	G	9.662	1.144476	0.21288	.	.	ENSG00000183549	ENST00000331849	T	0.44881	0.91	4.44	-2.14	0.07123	AMP-dependent synthetase/ligase (1);	0.591885	0.15848	N	0.241658	T	0.23688	0.0573	L	0.37466	1.105	0.24431	N	0.994573	B	0.02656	0.0	B	0.06405	0.002	T	0.12630	-1.0540	10	0.46703	T	0.11	-11.0633	1.0836	0.01647	0.4642:0.1745:0.1985:0.1628	.	356	Q6NUN0	ACSM5_HUMAN	D	356	ENSP00000327916:E356D	ENSP00000327916:E356D	E	+	3	2	ACSM5	20348567	0.000000	0.05858	0.989000	0.46669	0.218000	0.24690	-1.506000	0.02271	-0.179000	0.10654	0.557000	0.71058	GAG			0.587	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254413.1		NM_017888	
TNRC6A	27327	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	24826529	24826529	+	Silent	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:24826529C>T	ENST00000395799.3	+	19	4863	c.4734C>T	c.(4732-4734)aaC>aaT	p.N1578N	CTD-2515A14.1_ENST00000568895.1_RNA|TNRC6A_ENST00000432286.2_Silent_p.N56N|TNRC6A_ENST00000315183.7_Silent_p.N1529N	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1578					cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ACTTTATGAACAGCAGTACTT	0.458																																					p.N1578N													.	TNRC6A	171		0			c.C4734T												100.0	96.0	97.0					16																	24826529		2197	4300	6497	SO:0001819	synonymous_variant	27327	exon19			TATGAACAGCAGT	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.4734C>T	16.37:g.24826529C>T			115	0.0086956522	1		84	0.20	17	NM_014494	36	0.17	6	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	37	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	C	9.281	1.048072	0.19827	.	.	ENSG00000090905	ENST00000450465	.	.	.	5.92	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.7773	11.9331	0.52857	0.0:0.8585:0.0:0.1415	.	.	.	.	X	469	.	.	Q	+	1	0	TNRC6A	24734030	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.282000	0.43461	0.833000	0.34828	0.655000	0.94253	CAG			0.458	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000214081.1		NM_020847	
MAZ	4150	mdanderson.org	37	16	29818593	29818593	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:29818593G>C	ENST00000322945.6	+	2	652	c.487G>C	c.(487-489)Gcc>Ccc	p.A163P	MAZ_ENST00000566906.2_Intron|AC009133.20_ENST00000569039.1_RNA|MAZ_ENST00000562337.1_Intron|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_5'Flank|AC009133.14_ENST00000569981.1_RNA|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000563402.1_Intron|MAZ_ENST00000569978.1_5'Flank|MAZ_ENST00000219782.6_Missense_Mutation_p.A163P|MAZ_ENST00000568282.1_5'Flank|MAZ_ENST00000545521.1_Missense_Mutation_p.A140P	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)	163					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						ggcggccaccgccgtcgtagc	0.766																																					p.A163P	Colon(72;875 1167 15364 30899 37091)												.	.			0			c.G487C												2.0	3.0	3.0					16																	29818593		1451	3483	4934	SO:0001583	missense	4150	exon2			GCCACCGCCGTCG	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.487G>C	16.37:g.29818593G>C	ENSP00000313362:p.Ala163Pro		41	0.1463414634	6		37	0.24	9	NM_002383	56	0.07	4	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Missense_Mutation	SNP	ENST00000322945.6	37	CCDS42143.1	.	.	.	.	.	.	.	.	.	.	G	9.108	1.005950	0.19199	.	.	ENSG00000103495	ENST00000545521;ENST00000322945;ENST00000219782	T;T;T	0.10382	2.94;2.88;2.9	2.67	0.277	0.15668	.	1.123320	0.06978	U	0.819346	T	0.04679	0.0127	N	0.08118	0	0.19300	N	0.999978	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.001;0.001;0.002	T	0.42258	-0.9462	10	0.39692	T	0.17	-3.8263	0.8803	0.01232	0.1603:0.2273:0.3807:0.2317	.	140;163;163	C6G496;P56270;G5E927	.;MAZ_HUMAN;.	P	140;163;163	ENSP00000443956:A140P;ENSP00000313362:A163P;ENSP00000219782:A163P	ENSP00000219782:A163P	A	+	1	0	MAZ	29726094	0.078000	0.21339	0.928000	0.36995	0.129000	0.20672	2.550000	0.45811	1.237000	0.43756	0.281000	0.19383	GCC			0.766	MAZ-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000435536.1		NM_002383	
CCDC102A	92922	mdanderson.org	37	16	57552171	57552171	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:57552171C>T	ENST00000258214.2	-	6	1303	c.1057G>A	c.(1057-1059)Gaa>Aaa	p.E353K		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	353										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						GCAGCGTTTTCGGCCTGCAGC	0.687																																					p.E353K													.	.			0			c.G1057A												36.0	46.0	43.0					16																	57552171		2191	4283	6474	SO:0001583	missense	92922	exon6			CGTTTTCGGCCTG	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.1057G>A	16.37:g.57552171C>T	ENSP00000258214:p.Glu353Lys		27	0	0		23	0.09	2	NM_033212	27	0.00	0	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	37	CCDS10784.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.422165	0.62622	.	.	ENSG00000135736	ENST00000258214	D	0.85088	-1.94	4.37	2.36	0.29203	.	0.000000	0.85682	D	0.000000	D	0.87513	0.6196	M	0.80616	2.505	0.54753	D	0.999984	D	0.65815	0.995	P	0.51297	0.665	D	0.88617	0.3160	10	0.87932	D	0	-12.493	9.946	0.41609	0.0:0.8429:0.0:0.1571	.	353	Q96A19	C102A_HUMAN	K	353	ENSP00000258214:E353K	ENSP00000258214:E353K	E	-	1	0	CCDC102A	56109672	1.000000	0.71417	0.730000	0.30809	0.118000	0.20060	7.543000	0.82106	1.986000	0.57962	0.555000	0.69702	GAA			0.687	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257348.1		NM_033212	
ZNF469	84627	mdanderson.org	37	16	88501768	88501768	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr16:88501768G>T	ENST00000437464.1	+	2	7806	c.7806G>T	c.(7804-7806)aaG>aaT	p.K2602N	ZNF469_ENST00000565624.1_Missense_Mutation_p.K2630N	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2602					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CAGAGGGGAAGTCAAATAAGA	0.567																																					p.K2602N													.	.			0			c.G7806T												23.0	31.0	29.0					16																	88501768		692	1589	2281	SO:0001583	missense	84627	exon2			GGGGAAGTCAAAT	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7806G>T	16.37:g.88501768G>T	ENSP00000402343:p.Lys2602Asn		55	0	0		26	0.12	3	NM_001127464	4	0.00	0		Missense_Mutation	SNP	ENST00000437464.1	37	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	12.35	1.910765	0.33721	.	.	ENSG00000225614	ENST00000437464	T	0.55930	0.49	4.76	-6.75	0.01738	.	.	.	.	.	T	0.30230	0.0758	L	0.27053	0.805	0.09310	N	1	P	0.38827	0.649	B	0.32211	0.142	T	0.31998	-0.9923	9	0.87932	D	0	.	8.0892	0.30790	0.2584:0.2437:0.4979:0.0	.	2602	Q96JG9	ZN469_HUMAN	N	2602	ENSP00000402343:K2602N	ENSP00000402343:K2602N	K	+	3	2	ZNF469	87029269	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.806000	0.04525	-1.097000	0.03042	-0.291000	0.09656	AAG			0.567	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NG_012236	
PELP1	27043	broad.mit.edu	37	17	4575679	4575679	+	Silent	SNP	T	T	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:4575679T>C	ENST00000574876.1	-	16	2624	c.2607A>G	c.(2605-2607)ggA>ggG	p.G869G	PELP1_ENST00000572293.1_Silent_p.G919G|PELP1_ENST00000436683.2_Silent_p.G722G|PELP1_ENST00000301396.4_Silent_p.G1013G|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000269230.7_Silent_p.G779G			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	869	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						CTGGGGGTCCTCCCCCACCAG	0.592																																					p.G869G													.	PELP1	102		0			c.A2607G												7.0	8.0	7.0					17																	4575679		1885	4050	5935	SO:0001819	synonymous_variant	27043	exon16			GGGTCCTCCCCCA		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2607A>G	17.37:g.4575679T>C			135	0.0222222222	3		157	0.03	5	NM_014389	744	0.01	4	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Silent	SNP	ENST00000574876.1	37	CCDS58503.1																																																																																					0.592	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000439140.2		NM_014389	
NLGN2	57555	broad.mit.edu	37	17	7320787	7320787	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:7320787G>C	ENST00000302926.2	+	7	2250	c.2177G>C	c.(2176-2178)gGc>gCc	p.G726A	RP11-104H15.7_ENST00000575310.1_RNA|SPEM1_ENST00000323675.3_5'Flank|NLGN2_ENST00000575301.1_Missense_Mutation_p.G726A	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	726					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				CCTGGTGGGGGCCCCCTGCTC	0.731																																					p.G726A													.	NLGN2	61		0			c.G2177C												7.0	7.0	7.0					17																	7320787		2114	4108	6222	SO:0001583	missense	57555	exon7			GTGGGGGCCCCCT	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.2177G>C	17.37:g.7320787G>C	ENSP00000305288:p.Gly726Ala		14	0.0714285714	1		23	0.26	6	NM_020795	29	0.00	0	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	G	1.936	-0.444810	0.04604	.	.	ENSG00000169992	ENST00000302926	T	0.64438	-0.1	3.61	3.61	0.41365	.	0.077148	0.50627	D	0.000113	T	0.37237	0.0996	N	0.04636	-0.2	0.29375	N	0.863732	B	0.02656	0.0	B	0.01281	0.0	T	0.30822	-0.9965	10	0.37606	T	0.19	.	10.9279	0.47201	0.0:0.0:1.0:0.0	.	726	Q8NFZ4	NLGN2_HUMAN	A	726	ENSP00000305288:G726A	ENSP00000305288:G726A	G	+	2	0	NLGN2	7261511	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	2.778000	0.47726	1.995000	0.58328	0.549000	0.68633	GGC			0.731	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226941.2		NM_020795	
DNAH2	146754	broad.mit.edu;mdanderson.org	37	17	7702429	7702429	+	Silent	SNP	G	G	A	rs149452093		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:7702429G>A	ENST00000572933.1	+	56	10028	c.8568G>A	c.(8566-8568)tcG>tcA	p.S2856S	DNAH2_ENST00000389173.2_Silent_p.S2856S			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2856	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGATCCAGTCGCATATCATAG	0.607																																					p.S2856S													.	DNAH2	498		0			c.G8568A							G		0,4406		0,0,2203	86.0	68.0	74.0		8568	-11.3	0.0	17	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	DNAH2	NM_020877.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		2856/4428	7702429	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	146754	exon55			CCAGTCGCATATC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.8568G>A	17.37:g.7702429G>A			88	0	0		87	0.05	4	NM_020877	0		0	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Silent	SNP	ENST00000572933.1	37	CCDS32551.1																																																																																					0.607	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440241.1		NM_020877	
ERBB2	2064	broad.mit.edu	37	17	37879599	37879599	+	Silent	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:37879599G>T	ENST00000269571.5	+	17	2133	c.1974G>T	c.(1972-1974)gtG>gtT	p.V658V	ERBB2_ENST00000584450.1_Silent_p.V658V|ERBB2_ENST00000540147.1_Silent_p.V628V|ERBB2_ENST00000445658.2_Silent_p.V382V|ERBB2_ENST00000584601.1_Silent_p.V628V|ERBB2_ENST00000541774.1_Silent_p.V643V|ERBB2_ENST00000406381.2_Silent_p.V628V			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	658					axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	TCTCTGCGGTGGTTGGCATTC	0.622		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																											p.V658V				Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	.	ERBB2	429		0			c.G1974T												121.0	109.0	113.0					17																	37879599		2203	4300	6503	SO:0001819	synonymous_variant	2064	exon17			TGCGGTGGTTGGC	X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.1974G>T	17.37:g.37879599G>T			106	0	0		120	0.04	5	NM_004448	119	0.00	0	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Silent	SNP	ENST00000269571.5	37	CCDS32642.1																																																																																					0.622	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000445621.2			
TANC2	26115	broad.mit.edu	37	17	61498459	61498459	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:61498459C>T	ENST00000424789.2	+	25	5120	c.5116C>T	c.(5116-5118)Cga>Tga	p.R1706*	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Nonsense_Mutation_p.R1716*	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1706					in utero embryonic development (GO:0001701)			p.R1716*(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CTCAGCATACCGAGGTGGCGT	0.567																																					p.R1706X													TANC2_ENST00000389520,NS,carcinoma,0,2	TANC2	266	2	2	Substitution - Nonsense(2)	lung(2)	c.C5116T												170.0	172.0	171.0					17																	61498459		2186	4266	6452	SO:0001587	stop_gained	26115	exon25			GCATACCGAGGTG	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.5116C>T	17.37:g.61498459C>T	ENSP00000387593:p.Arg1706*		85	0	0		101	0.03	3	NM_025185	3	0.00	0	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Nonsense_Mutation	SNP	ENST00000424789.2	37	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	41	8.641087	0.98897	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	.	.	.	5.06	5.06	0.68205	.	0.074862	0.53938	D	0.000048	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1352	0.59405	0.17:0.83:0.0:0.0	.	.	.	.	X	1716;1706	.	ENSP00000374171:R1716X	R	+	1	2	TANC2	58852191	0.987000	0.35691	1.000000	0.80357	0.788000	0.44548	1.158000	0.31737	2.797000	0.96272	0.561000	0.74099	CGA			0.567	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444765.1			
ITGB4	3691	mdanderson.org	37	17	73733624	73733624	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:73733624C>T	ENST00000200181.3	+	18	2306	c.2119C>T	c.(2119-2121)Cct>Tct	p.P707S	ITGB4_ENST00000339591.3_Missense_Mutation_p.P707S|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000449880.2_Missense_Mutation_p.P707S|ITGB4_ENST00000579662.1_Missense_Mutation_p.P707S|ITGB4_ENST00000450894.3_Missense_Mutation_p.P707S	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	707					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			tccagactgccctccgggctc	0.692																																					p.P707S													.	.			0			c.C2119T												63.0	57.0	59.0					17																	73733624		2191	4283	6474	SO:0001583	missense	3691	exon18			GACTGCCCTCCGG		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2119C>T	17.37:g.73733624C>T	ENSP00000200181:p.Pro707Ser		56	0	0		52	0.06	3	NM_000213	32	0.00	0	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	37	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	C	12.04	1.818020	0.32145	.	.	ENSG00000132470	ENST00000450894;ENST00000200181;ENST00000339591;ENST00000449880	D;D;D;D	0.93604	-3.25;-2.23;-2.23;-2.23	3.93	3.93	0.45458	Integrin beta subunit, tail (2);	0.000000	0.85682	D	0.000000	D	0.96457	0.8844	M	0.85197	2.74	0.54753	D	0.999989	D;D;D;D	0.67145	0.996;0.991;0.996;0.993	P;D;D;D	0.72338	0.892;0.938;0.963;0.977	D	0.96760	0.9560	10	0.72032	D	0.01	.	13.1912	0.59711	0.1596:0.8404:0.0:0.0	.	707;707;707;707	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	S	623;707;707;707	ENSP00000405536:P623S;ENSP00000200181:P707S;ENSP00000344079:P707S;ENSP00000400217:P707S	ENSP00000200181:P707S	P	+	1	0	ITGB4	71245219	0.562000	0.26586	0.980000	0.43619	0.194000	0.23727	2.601000	0.46249	2.211000	0.71520	0.462000	0.41574	CCT			0.692	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000448334.1			
PCYT2	5833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79866849	79866849	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:79866849C>G	ENST00000538936.2	-	3	351	c.243G>C	c.(241-243)caG>caC	p.Q81H	PCYT2_ENST00000570388.1_Missense_Mutation_p.Q3H|PCYT2_ENST00000570391.1_Missense_Mutation_p.Q49H|PCYT2_ENST00000571105.1_Missense_Mutation_p.Q81H|PCYT2_ENST00000331285.3_Missense_Mutation_p.Q3H|PCYT2_ENST00000538721.2_Missense_Mutation_p.Q81H	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	81					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	ATTTGATGGCCTGCACCATCT	0.572																																					p.Q81H													.	.			0			c.G243C												124.0	124.0	124.0					17																	79866849		2203	4296	6499	SO:0001583	missense	5833	exon3			GATGGCCTGCACC	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.243G>C	17.37:g.79866849C>G	ENSP00000439245:p.Gln81His		142	0	0		119	0.13	16	NM_002861	84	0.13	11	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Missense_Mutation	SNP	ENST00000538936.2	37	CCDS11791.1	.	.	.	.	.	.	.	.	.	.	C	19.94	3.919628	0.73098	.	.	ENSG00000185813	ENST00000538721;ENST00000538936;ENST00000331285	D;D	0.96619	-4.07;-4.07	4.23	-1.44	0.08856	Cytidylyltransferase (1);Rossmann-like alpha/beta/alpha sandwich fold (1);Cytidyltransferase-related (1);	0.275252	0.37857	N	0.001919	D	0.94046	0.8092	L	0.41710	1.295	0.36931	D	0.891882	B;P;P;B;P	0.49358	0.404;0.755;0.58;0.239;0.923	B;P;P;B;P	0.53266	0.389;0.637;0.504;0.139;0.722	D	0.90854	0.4733	10	0.72032	D	0.01	-14.0541	6.3346	0.21289	0.0:0.4444:0.1214:0.4341	.	49;49;81;3;81	B7Z4W6;B7ZAS0;F5H8B1;B7Z7A5;Q99447	.;.;.;.;PCY2_HUMAN	H	81;81;3	ENSP00000442050:Q81H;ENSP00000439245:Q81H	ENSP00000331719:Q3H	Q	-	3	2	PCYT2	77460141	0.918000	0.31147	0.860000	0.33809	0.969000	0.65631	0.021000	0.13489	-0.424000	0.07382	0.549000	0.68633	CAG			0.572	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439939.1		NM_002861	
LRRC45	201255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	79988252	79988252	+	Silent	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr17:79988252C>T	ENST00000306688.3	+	16	2068	c.1726C>T	c.(1726-1728)Ctg>Ttg	p.L576L	RAC3_ENST00000306897.4_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	576						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			GCGCGTGGAGCTGCAGGAGCA	0.701																																					p.L576L													.	.			0			c.C1726T												20.0	23.0	22.0					17																	79988252		2066	4059	6125	SO:0001819	synonymous_variant	201255	exon16			GTGGAGCTGCAGG	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1726C>T	17.37:g.79988252C>T			59	0	0		62	0.11	7	NM_144999	68	0.26	18		Silent	SNP	ENST00000306688.3	37	CCDS11797.1																																																																																					0.701	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442058.1		NM_144999	
CCDC102B	79839	broad.mit.edu	37	18	66504389	66504389	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr18:66504389C>T	ENST00000360242.5	+	2	506	c.389C>T	c.(388-390)gCg>gTg	p.A130V	CCDC102B_ENST00000319445.6_Missense_Mutation_p.A130V|CCDC102B_ENST00000584156.1_Missense_Mutation_p.A130V|CCDC102B_ENST00000358653.5_Missense_Mutation_p.A130V|CCDC102B_ENST00000577772.1_3'UTR	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	130										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				CTAGAGATGGCGATGAAAGAA	0.448																																					p.A130V													CCDC102B,NS,carcinoma,-1,1	CCDC102B	92	1	0			c.C389T												98.0	96.0	97.0					18																	66504389		1920	4129	6049	SO:0001583	missense	79839	exon4			AGATGGCGATGAA	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.389C>T	18.37:g.66504389C>T	ENSP00000353377:p.Ala130Val		189	0	0		105	0.03	3	NM_001093729	7	0.00	0	Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	C	12.33	1.904685	0.33628	.	.	ENSG00000150636	ENST00000319445;ENST00000358653;ENST00000360242	T;T;T	0.46063	0.88;0.88;0.88	5.36	3.59	0.41128	.	0.931002	0.09089	N	0.850191	T	0.31104	0.0786	L	0.34521	1.04	0.09310	N	1	B;B	0.23891	0.093;0.093	B;B	0.14578	0.011;0.011	T	0.22277	-1.0221	10	0.37606	T	0.19	0.2512	7.1111	0.25390	0.0:0.7126:0.0:0.2874	.	130;130	Q68D86-3;Q68D86	.;C102B_HUMAN	V	130	ENSP00000316237:A130V;ENSP00000351479:A130V;ENSP00000353377:A130V	ENSP00000316237:A130V	A	+	2	0	CCDC102B	64655369	0.000000	0.05858	0.001000	0.08648	0.468000	0.32798	1.103000	0.31062	0.650000	0.30769	-0.259000	0.10710	GCG			0.448	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256225.2		NM_024781	
TICAM1	148022	mdanderson.org	37	19	4818059	4818059	+	Missense_Mutation	SNP	C	C	T	rs201291933		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr19:4818059C>T	ENST00000248244.5	-	2	560	c.331G>A	c.(331-333)Gcc>Acc	p.A111T		NM_182919.3	NP_891549.1	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	111					apoptotic signaling pathway (GO:0097190)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation involved in immune response (GO:0002281)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|regulation of protein homodimerization activity (GO:0043496)|response to exogenous dsRNA (GO:0043330)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|ripoptosome (GO:0097342)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CGCAGCGAGGCGGGGCACAGC	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		16279	0.0		0.001	False		,,,				2504	0.0				p.A111T													.	.			0			c.G331A							C	THR/ALA	0,4406		0,0,2203	38.0	37.0	37.0		331	4.1	0.0	19		37	2,8598	2.2+/-6.3	0,2,4298	yes	missense	TICAM1	NM_182919.2	58	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	111/713	4818059	2,13004	2203	4300	6503	SO:0001583	missense	148022	exon2			GCGAGGCGGGGCA	AB086380	CCDS12136.1	19p13.3	2014-09-17				ENSG00000127666			18348	protein-coding gene	gene with protein product		607601				12539043, 12471095	Standard	NM_182919		Approved	TRIF, TICAM-1, MGC35334, PRVTIRB	uc002mbi.4	Q8IUC6		ENST00000248244.5:c.331G>A	19.37:g.4818059C>T	ENSP00000248244:p.Ala111Thr		32	0	0		21	0.10	2	NM_182919	5	0.00	0	B3Y691|O75532|Q86XP8|Q96GA0	Missense_Mutation	SNP	ENST00000248244.5	37	CCDS12136.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	16.41	3.115982	0.56505	0.0	2.33E-4	ENSG00000127666	ENST00000248244	T	0.48836	0.8	4.08	4.08	0.47627	.	0.503904	0.14849	N	0.294788	T	0.40196	0.1107	L	0.54323	1.7	0.09310	N	1	P	0.43352	0.804	B	0.35899	0.213	T	0.40365	-0.9567	10	0.52906	T	0.07	-7.0897	10.8115	0.46549	0.0:0.7399:0.2601:0.0	.	111	Q8IUC6	TCAM1_HUMAN	T	111	ENSP00000248244:A111T	ENSP00000248244:A111T	A	-	1	0	TICAM1	4769059	0.003000	0.15002	0.031000	0.17742	0.007000	0.05969	1.488000	0.35551	2.266000	0.75297	0.484000	0.47621	GCC	0		0.687	TICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450435.1		NM_014261	
CCDC159	126075	broad.mit.edu	37	19	11464523	11464523	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr19:11464523G>T	ENST00000588790.1	+	11	1192	c.745G>T	c.(745-747)Gcc>Tcc	p.A249S	DKFZP761J1410_ENST00000591608.1_5'Flank|DKFZP761J1410_ENST00000251473.5_5'Flank|CCDC159_ENST00000458408.1_Missense_Mutation_p.A249S			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159	364										endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						GTGCTCGGGGGCCTGTCCCAA	0.587																																					p.A249S													.	CCDC159	35		0			c.G745T												19.0	21.0	20.0					19																	11464523		1911	4137	6048	SO:0001583	missense	126075	exon9			TCGGGGGCCTGTC	BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.745G>T	19.37:g.11464523G>T	ENSP00000468232:p.Ala249Ser		94	0.0106382979	1		73	0.08	6	NM_001080503	10	0.10	1	B4DEG3|B4DWR8|B4E133|B7ZAM4	Missense_Mutation	SNP	ENST00000588790.1	37	CCDS45976.1	.	.	.	.	.	.	.	.	.	.	G	6.981	0.551134	0.13374	.	.	ENSG00000183401	ENST00000458408;ENST00000427879	T	0.44881	0.91	4.03	-1.86	0.07760	.	.	.	.	.	T	0.20618	0.0496	N	0.22421	0.69	0.09310	N	1	B;B	0.19200	0.034;0.003	B;B	0.21151	0.033;0.01	T	0.28933	-1.0028	9	0.10377	T	0.69	.	3.2836	0.06924	0.4716:0.0:0.3389:0.1894	.	364;249	P0C7I6;P0C7I6-2	CC159_HUMAN;.	S	249;364	ENSP00000402239:A249S	ENSP00000390400:A364S	A	+	1	0	CCDC159	11325523	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.226000	0.17776	-0.209000	0.10156	0.313000	0.20887	GCC			0.587	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458761.1		NM_001080503	
MAN2B1	4125	mdanderson.org	37	19	12766567	12766567	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr19:12766567G>T	ENST00000456935.2	-	14	1811	c.1771C>A	c.(1771-1773)Cgc>Agc	p.R591S	MAN2B1_ENST00000495617.1_5'Flank|MAN2B1_ENST00000221363.4_Missense_Mutation_p.R590S	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	591					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TGTGGTGCGCGGGCCTGGGGC	0.612																																					p.R591S													.	.			0			c.C1771A												79.0	89.0	86.0					19																	12766567		2203	4300	6503	SO:0001583	missense	4125	exon14			GTGCGCGGGCCTG		CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.1771C>A	19.37:g.12766567G>T	ENSP00000395473:p.Arg591Ser		74	0	0		53	0.06	3	NM_000528	227	0.00	0	G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	ENST00000456935.2	37	CCDS32919.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.328|8.328	0.825877|0.825877	0.16749|0.16749	.|.	.|.	ENSG00000104774|ENSG00000104774	ENST00000433513|ENST00000456935;ENST00000536796;ENST00000221363	.|T;T	.|0.78246	.|-1.16;-1.16	5.04|5.04	2.85|2.85	0.33270|0.33270	.|Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	.|.	.|.	.|.	.|.	T|T	0.52789|0.52789	0.1756|0.1756	N|N	0.11284|0.11284	0.12|0.12	0.09310|0.09310	N|N	1|1	.|B;B	.|0.18863	.|0.031;0.014	.|B;B	.|0.15052	.|0.012;0.009	T|T	0.37641|0.37641	-0.9697|-0.9697	5|9	.|0.07030	.|T	.|0.85	-5.2955|-5.2955	6.1521|6.1521	0.20318|0.20318	0.0971:0.0:0.7182:0.1847|0.0971:0.0:0.7182:0.1847	.|.	.|590;591	.|G5E928;O00754	.|.;MA2B1_HUMAN	Q|S	126|591;530;590	.|ENSP00000395473:R591S;ENSP00000221363:R590S	.|ENSP00000221363:R590S	P|R	-|-	2|1	0|0	MAN2B1|MAN2B1	12627567|12627567	0.000000|0.000000	0.05858|0.05858	0.002000|0.002000	0.10522|0.10522	0.152000|0.152000	0.21847|0.21847	0.474000|0.474000	0.22148|0.22148	0.494000|0.494000	0.27859|0.27859	0.313000|0.313000	0.20887|0.20887	CCG|CGC			0.612	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000344062.1			
SIGLEC11	114132	broad.mit.edu	37	19	50462655	50462655	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr19:50462655A>G	ENST00000447370.2	-	5	1109	c.1019T>C	c.(1018-1020)cTt>cCt	p.L340P	SIGLEC11_ENST00000426971.2_Missense_Mutation_p.L340P|CTC-326K19.6_ENST00000451973.1_5'Flank	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	340	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		CTGGGAGCCAAGCCTGTTCTC	0.677																																					p.L340P													.	SIGLEC11	70		0			c.T1019C												35.0	55.0	49.0					19																	50462655		1959	4292	6251	SO:0001583	missense	114132	exon5			GAGCCAAGCCTGT	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1019T>C	19.37:g.50462655A>G	ENSP00000412361:p.Leu340Pro		98	0	0		75	0.04	3	NM_052884	0		0		Missense_Mutation	SNP	ENST00000447370.2	37	CCDS12790.2	.	.	.	.	.	.	.	.	.	.	A	9.009	0.982115	0.18889	.	.	ENSG00000161640	ENST00000447370;ENST00000458019	T	0.68903	-0.36	1.61	1.61	0.23674	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.401214	0.18443	N	0.141083	T	0.81513	0.4838	M	0.92219	3.285	0.52099	D	0.99994	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.79014	-0.1976	10	0.45353	T	0.12	.	5.3754	0.16162	1.0:0.0:0.0:0.0	.	340;340	Q96RL6-2;Q96RL6	.;SIG11_HUMAN	P	340	ENSP00000412361:L340P	ENSP00000412361:L340P	L	-	2	0	SIGLEC11	55154467	0.009000	0.17119	0.774000	0.31636	0.049000	0.14656	2.053000	0.41326	0.993000	0.38866	0.529000	0.55759	CTT			0.677	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000347382.1		NM_052884	
APOB	338	mdanderson.org	37	2	21234845	21234845	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:21234845C>G	ENST00000233242.1	-	26	5022	c.4895G>C	c.(4894-4896)gGc>gCc	p.G1632A		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1632					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGTCAGTGCCTAAGATGTC	0.438																																					p.G1632A													.	.			0			c.G4895C												86.0	79.0	81.0					2																	21234845		2203	4300	6503	SO:0001583	missense	338	exon26			TCAGTGCCTAAGA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4895G>C	2.37:g.21234845C>G	ENSP00000233242:p.Gly1632Ala		47	0	0		49	0.06	3	NM_000384	0		0	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	37	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	C	7.702	0.693332	0.15039	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00669	5.9	6.07	6.07	0.98685	.	0.214936	0.33144	N	0.005228	T	0.00906	0.0030	L	0.54323	1.7	0.80722	D	1	B	0.32829	0.386	B	0.31495	0.131	T	0.53788	-0.8389	10	0.02654	T	1	.	10.1952	0.43049	0.2383:0.6427:0.119:0.0	.	1632	P04114	APOB_HUMAN	A	1632	ENSP00000233242:G1632A	ENSP00000233242:G1632A	G	-	2	0	APOB	21088350	0.000000	0.05858	1.000000	0.80357	0.946000	0.59487	0.140000	0.16056	2.890000	0.99128	0.650000	0.86243	GGC			0.438	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207571.1			
PPP1R21	129285	broad.mit.edu	37	2	48698417	48698417	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:48698417G>T	ENST00000294952.8	+	11	1156		c.e11-1		PPP1R21_ENST00000281394.4_Splice_Site|PPP1R21_ENST00000449090.2_Splice_Site	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21							membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						TTCTTTTCCAGGAGACAACTG	0.358																																					.													.	PPP1R21	47		0			c.1000-1G>T												72.0	84.0	80.0					2																	48698417		2200	4298	6498	SO:0001630	splice_region_variant	129285	exon11			TTTCCAGGAGACA	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1000-1G>T	2.37:g.48698417G>T			298	0.0033557047	1		308	0.02	5	NM_001135629	1	0.00	0	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Splice_Site	SNP	ENST00000294952.8	37	CCDS46278.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282573	0.59867	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.59	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9286	0.86183	0.0:0.1279:0.8721:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLRAQ1	48551921	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	8.894000	0.92506	1.488000	0.48433	0.561000	0.74099	.			0.358	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251238.4		NM_152994	Intron
LINC01122	400955	broad.mit.edu	37	2	58688842	58688843	+	lincRNA	DEL	CT	CT	-			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:58688842_58688843delCT	ENST00000452840.1	+	0	127																											TCTCTGCTAGCTCTCTCTCTCT	0.465																																					.													.	.			0			.																																											0	.			TGCTAGCTCTCTC																													2.37:g.58688852_58688853delCT			123	0	0		92	0.08	7	.	33	0.00	0		RNA	DEL	ENST00000452840.1	37																																																																																						0.465	AC007092.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000327022.1			
EDAR	10913	broad.mit.edu	37	2	109527398	109527398	+	Intron	SNP	G	G	A	rs191975348		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:109527398G>A	ENST00000258443.2	-	7	1086				EDAR_ENST00000409271.1_Silent_p.D220D|EDAR_ENST00000376651.1_Silent_p.D220D	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CATGGGGGCCGTCACCTGGGG	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19055	0.0		0.0	False		,,,				2504	0.0				.													.	EDAR	49		0			.												93.0	82.0	86.0					2																	109527398		2203	4300	6503	SO:0001627	intron_variant	10913	.			GGGGCCGTCACCT	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.655+4C>T	2.37:g.109527398G>A			180	0	0		172	0.03	6	.	0		0	B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	ENST00000258443.2	37	CCDS2081.1																																																																																					0.597	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253595.1			
RIF1	55183	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	152320914	152320914	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:152320914C>G	ENST00000243326.5	+	29	5363	c.4880C>G	c.(4879-4881)aCt>aGt	p.T1627S	RIF1_ENST00000428287.2_Missense_Mutation_p.T1627S|RIF1_ENST00000430328.2_Missense_Mutation_p.T1627S|RIF1_ENST00000444746.2_Missense_Mutation_p.T1627S|RIF1_ENST00000453091.2_Missense_Mutation_p.T1627S			Q9Y581	INSL6_HUMAN	replication timing regulatory factor 1	0					fertilization (GO:0009566)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			NS(2)|breast(8)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(19)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	97				BRCA - Breast invasive adenocarcinoma(221;0.0429)		GAAAGTAATACTGTAATATGT	0.318																																					p.T1627S													.	.			0			c.C4880G												48.0	48.0	48.0					2																	152320914		2203	4300	6503	SO:0001583	missense	55183	exon30			GTAATACTGTAAT	AK022932	CCDS2194.1, CCDS54406.1	2q23.3	2014-06-02	2014-06-02		ENSG00000080345	ENSG00000080345			23207	protein-coding gene	gene with protein product		608952	"""RAP1 interacting factor homolog (yeast)"""			15342490, 15042697, 22850674	Standard	NM_018151		Approved	FLJ12870, FLJ10599	uc002txm.3	Q5UIP0	OTTHUMG00000131886	ENST00000243326.5:c.4880C>G	2.37:g.152320914C>G	ENSP00000243326:p.Thr1627Ser		112	0	0		88	0.27	24	NM_018151	70	0.31	22	A0AVS0|Q9NS16	Missense_Mutation	SNP	ENST00000243326.5	37	CCDS2194.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.559004	0.00136	.	.	ENSG00000080345	ENST00000444746;ENST00000453091;ENST00000428287;ENST00000243326;ENST00000430328	T;T;T;T;T	0.09445	2.98;2.98;2.98;2.98;2.98	5.26	4.36	0.52297	.	1.078580	0.07001	N	0.823290	T	0.06371	0.0164	N	0.12182	0.205	0.20821	N	0.999848	B;B	0.15141	0.007;0.012	B;B	0.09377	0.002;0.004	T	0.42582	-0.9443	10	0.15952	T	0.53	-1.5529	5.9609	0.19299	0.0:0.6736:0.1939:0.1326	.	1627;1627	Q5UIP0;Q5UIP0-2	RIF1_HUMAN;.	S	1627	ENSP00000390181:T1627S;ENSP00000414615:T1627S;ENSP00000415691:T1627S;ENSP00000243326:T1627S;ENSP00000416123:T1627S	ENSP00000243326:T1627S	T	+	2	0	RIF1	152029160	0.000000	0.05858	0.008000	0.14137	0.032000	0.12392	-1.222000	0.02965	1.158000	0.42547	0.557000	0.71058	ACT			0.318	RIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254836.3			
C2orf72	257407	mdanderson.org	37	2	231906019	231906019	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr2:231906019G>T	ENST00000373640.4	+	2	719	c.643G>T	c.(643-645)Gcc>Tcc	p.A215S	C2orf72_ENST00000477463.1_3'UTR	NM_001144994.1	NP_001138466.1	A6NCS6	CB072_HUMAN	chromosome 2 open reading frame 72	215																	AGTGGAAGGAGCCTGGGAGAG	0.562																																					p.A215S													.	.			0			c.G643T												38.0	44.0	42.0					2																	231906019		692	1591	2283	SO:0001583	missense	257407	exon2			GAAGGAGCCTGGG		CCDS46539.1	2q37.1	2012-08-06			ENSG00000204128	ENSG00000204128			27418	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001144994		Approved	LOC257407	uc002vrl.4	A6NCS6	OTTHUMG00000153996	ENST00000373640.4:c.643G>T	2.37:g.231906019G>T	ENSP00000362743:p.Ala215Ser		49	0	0		48	0.06	3	NM_001144994	0		0		Missense_Mutation	SNP	ENST00000373640.4	37	CCDS46539.1	.	.	.	.	.	.	.	.	.	.	G	8.685	0.906007	0.17760	.	.	ENSG00000204128	ENST00000373640	.	.	.	4.38	-1.44	0.08856	.	0.681426	0.12107	N	0.498953	T	0.29093	0.0723	L	0.59436	1.845	0.09310	N	1	B	0.16396	0.017	B	0.19391	0.025	T	0.28650	-1.0037	9	0.20046	T	0.44	-1.8269	0.5469	0.00655	0.3487:0.1736:0.301:0.1767	.	215	A6NCS6	CB072_HUMAN	S	215	.	ENSP00000362743:A215S	A	+	1	0	C2orf72	231614263	0.997000	0.39634	0.006000	0.13384	0.106000	0.19336	0.518000	0.22847	-0.171000	0.10797	0.467000	0.42956	GCC			0.562	C2orf72-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000333376.2		NM_001144994	
OCSTAMP	128506	ucsc.edu;bcgsc.ca	37	20	45170332	45170332	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr20:45170332C>A	ENST00000279028.2	-	3	1295	c.1282G>T	c.(1282-1284)Gcc>Tcc	p.A428S		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	428					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						GCGGCGATGGCATGCCGCAGG	0.746																																					p.A428S													.	OCSTAMP	34		0			c.G1282T												13.0	18.0	16.0					20																	45170332		692	1591	2283	SO:0001583	missense	128506	exon3			CGATGGCATGCCG	AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1282G>T	20.37:g.45170332C>A	ENSP00000279028:p.Ala428Ser		44	0	0		34	0.12	4	NM_080721	0		0		Missense_Mutation	SNP	ENST00000279028.2	37	CCDS54468.1	.	.	.	.	.	.	.	.	.	.	C	13.54	2.268647	0.40095	.	.	ENSG00000149635	ENST00000279028	T	0.31247	1.5	5.06	-1.22	0.09494	Dendritic cell-specific transmembrane protein-like (1);	0.579725	0.16778	N	0.199923	T	0.09024	0.0223	N	0.02539	-0.55	0.21499	N	0.999668	B	0.17465	0.022	B	0.17433	0.018	T	0.31888	-0.9927	10	0.17369	T	0.5	-5.7951	4.6138	0.12415	0.1644:0.233:0.0:0.6026	.	428	Q9BR26	CT123_HUMAN	S	428	ENSP00000279028:A428S	ENSP00000279028:A428S	A	-	1	0	C20orf123	44603739	0.001000	0.12720	0.994000	0.49952	0.980000	0.70556	-0.240000	0.08952	-0.050000	0.13356	0.655000	0.94253	GCC			0.746	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079573.2		XM_496476	
DPM1	8813	mdanderson.org	37	20	49575689	49575689	+	5'Flank	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr20:49575689G>T	ENST00000371588.5	-	0	0				DPM1_ENST00000371583.5_5'Flank|DPM1_ENST00000371582.4_5'Flank|MOCS3_ENST00000244051.1_Missense_Mutation_p.A104S|DPM1_ENST00000466152.1_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						CTTGGCAGCGGCCGGCGTGGG	0.682																																					p.A104S													.	.			0			c.G310T												35.0	45.0	41.0					20																	49575689		2180	4262	6442	SO:0001631	upstream_gene_variant	27304	exon1			GCAGCGGCCGGCG	AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575689G>T	Exception_encountered		60	0	0		46	0.07	3	NM_014484	27	0.00	0	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	ENST00000371588.5	37	CCDS13434.1	.	.	.	.	.	.	.	.	.	.	G	35	5.460336	0.96240	.	.	ENSG00000124217	ENST00000244051	T	0.32272	1.46	6.08	6.08	0.98989	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.165616	0.53938	D	0.000060	T	0.54046	0.1834	M	0.72624	2.21	0.80722	D	1	D	0.57257	0.979	P	0.59889	0.865	T	0.44251	-0.9340	9	.	.	.	-6.4354	20.2585	0.98435	0.0:0.0:1.0:0.0	.	104	O95396	MOCS3_HUMAN	S	104	ENSP00000244051:A104S	.	A	+	1	0	MOCS3	49009096	1.000000	0.71417	0.975000	0.42487	0.950000	0.60333	7.840000	0.86819	2.894000	0.99253	0.655000	0.94253	GCC			0.682	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079716.1		NM_003859	
MIR3687-2	103504728	broad.mit.edu	37	21	9825838	9825839	+	RNA	INS	-	-	GCG	rs372061766|rs369177681|rs563875271	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr21:9825838_9825839insGCG	ENST00000577708.1	+	0	0				MIR3648_ENST00000581792.1_RNA	NR_037458.1																						cggccgcgactgcggcggcggt	0.842																																					.													.	.			0			.																																											0	.			CGCGACTGCGGCG																													21.37:g.9825845_9825847dupGCG			4	0	0		6	0.50	3	.	0		0		RNA	INS	ENST00000577708.1	37																																																																																						0.842	MIR3687-201	KNOWN	basic	miRNA	miRNA					
AP001347.6	0	broad.mit.edu	37	21	15461084	15461085	+	RNA	DEL	AG	AG	-	rs199958475|rs9917537	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr21:15461084_15461085delAG	ENST00000428809.1	+	0	372				AP001347.6_ENST00000448463.1_RNA|AP001347.6_ENST00000432621.1_RNA																							ACTTaaaaaaagaaaagaaaag	0.337																																					.													.	.			0			.																																											0	.			AAAAAAAGAAAAG																													21.37:g.15461084_15461085delAG			8	0	0		9	0.33	3	.	0		0		RNA	DEL	ENST00000428809.1	37																																																																																						0.337	AP001347.6-001	KNOWN	basic	antisense	antisense		OTTHUMT00000157812.1			
NF1P6	644637	bcgsc.ca	37	22	16349432	16349432	+	IGR	SNP	G	G	A	rs2106719	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr22:16349432G>A								POTEH (61495 upstream) : LA16c-2F2.8 (23648 downstream)																							GCTGACAAGCGCAGACCAGTC	0.507																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	644637	.			ACAAGCGCAGACC																													22.37:g.16349432G>A			38	0	0		42	0.17	7	.	0		0		RNA	SNP		37																																																																																					0	0.507										
RIMBP3	85376	mdanderson.org	37	22	20460125	20460125	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr22:20460125T>G	ENST00000426804.1	-	1	1661	c.1177A>C	c.(1177-1179)Acc>Ccc	p.T393P		NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	393										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			GCTTGCAGGGTATAACAGCGG	0.652																																					p.T393P													.	.			0			c.A1177C												19.0	18.0	18.0					22																	20460125		1124	1692	2816	SO:0001583	missense	85376	exon1			GCAGGGTATAACA	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.1177A>C	22.37:g.20460125T>G	ENSP00000391564:p.Thr393Pro		127	0.0157480315	2		51	0.08	4	NM_015672	5	0.00	0	Q8IYP7|Q9BY94|Q9UFQ5	Missense_Mutation	SNP	ENST00000426804.1	37	CCDS46665.1	.	.	.	.	.	.	.	.	.	.	t	8.941	0.965836	0.18583	.	.	ENSG00000196622	ENST00000355186;ENST00000426804	T	0.19250	2.16	2.64	-1.04	0.10068	.	0.797289	0.10926	U	0.618957	T	0.10078	0.0247	N	0.14661	0.345	0.09310	N	1	B	0.24483	0.104	B	0.23150	0.044	T	0.29243	-1.0018	10	0.42905	T	0.14	0.9862	4.2421	0.10654	0.0:0.549:0.193:0.2579	.	299	Q9UFD9	RIM3A_HUMAN	P	299;393	ENSP00000391564:T393P	ENSP00000347318:T299P	T	-	1	0	RIMBP3	18840125	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.446000	0.21694	-0.114000	0.11936	-0.508000	0.04489	ACC			0.652	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318945.2		NM_015672	
CBY1	25776	mdanderson.org	37	22	39067165	39067165	+	Missense_Mutation	SNP	G	G	T	rs140554782		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr22:39067165G>T	ENST00000216029.3	+	4	409	c.275G>T	c.(274-276)cGg>cTg	p.R92L	RP3-508I15.9_ENST00000444381.1_RNA|RP3-508I15.10_ENST00000423346.1_RNA|RP3-508I15.9_ENST00000431924.2_RNA|RP3-508I15.9_ENST00000422408.2_RNA	NM_015373.3	NP_056188.1	Q9Y3M2	CBY1_HUMAN	chibby homolog 1 (Drosophila)	92	Minimal region for the interaction with PKD2.				cardiac muscle cell differentiation (GO:0055007)|cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein localization (GO:0008104)	ciliary basal body (GO:0036064)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	beta-catenin binding (GO:0008013)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	Melanoma(58;0.04)					AATCTCTTGCGGCTGAAAGTG	0.562																																					p.R135L													.	.			0			c.G404T												137.0	132.0	133.0					22																	39067165		2203	4300	6503	SO:0001583	missense	25776	exon5			TCTTGCGGCTGAA	BK005534	CCDS13974.1, CCDS74861.1	22q12	2014-02-06	2007-01-26	2007-01-26	ENSG00000100211	ENSG00000100211			1307	protein-coding gene	gene with protein product	"""chibby CTNNB1-mediated transcription inhibitor"""	607757	"""chromosome 22 open reading frame 2"", ""PKD2 interactor, golgi and endoplasmic reticulum associated 1"""	C22orf2, PGEA1		10591208, 15194699	Standard	NM_015373		Approved	PIGEA14, PIGEA-14, Chibby, Cby	uc003awb.4	Q9Y3M2	OTTHUMG00000150990	ENST00000216029.3:c.275G>T	22.37:g.39067165G>T	ENSP00000216029:p.Arg92Leu		70	0	0		47	0.06	3	NM_001002880	72	0.00	0	B2R4S2|Q66GT6|Q9UIK9	Missense_Mutation	SNP	ENST00000216029.3	37	CCDS13974.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152406	0.78001	.	.	ENSG00000100211	ENST00000396811;ENST00000216029;ENST00000416285	.	.	.	5.66	4.65	0.58169	.	0.098253	0.64402	D	0.000005	T	0.58250	0.2109	L	0.59436	1.845	0.47009	D	0.999285	P	0.48640	0.913	B	0.44133	0.442	T	0.64816	-0.6318	9	0.87932	D	0	.	14.6069	0.68486	0.0701:0.0:0.9299:0.0	.	92	Q9Y3M2	CBY1_HUMAN	L	92	.	ENSP00000216029:R92L	R	+	2	0	CBY1	37397111	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.813000	0.62620	1.399000	0.46721	0.557000	0.71058	CGG			0.562	CBY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320832.1		NM_015373	
CERK	64781	mdanderson.org	37	22	47083093	47083093	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr22:47083093G>T	ENST00000216264.8	-	13	1664	c.1552C>A	c.(1552-1554)Cag>Aag	p.Q518K	CERK_ENST00000471929.1_5'Flank|CERK_ENST00000541677.1_Missense_Mutation_p.Q320K	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	518					ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGAACCAGCTGGCAGTGGACT	0.567																																					p.Q518K													.	.			0			c.C1552A												59.0	58.0	59.0					22																	47083093		2203	4300	6503	SO:0001583	missense	64781	exon13			CCAGCTGGCAGTG	AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.1552C>A	22.37:g.47083093G>T	ENSP00000216264:p.Gln518Lys		40	0	0		48	0.06	3	NM_022766	40	0.00	0	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Missense_Mutation	SNP	ENST00000216264.8	37	CCDS14077.1	.	.	.	.	.	.	.	.	.	.	g	28.4	4.919778	0.92249	.	.	ENSG00000100422	ENST00000216264;ENST00000541677	T;T	0.12879	2.64;2.64	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.27866	0.0686	M	0.79805	2.47	0.80722	D	1	P	0.45986	0.87	P	0.47251	0.542	T	0.04930	-1.0917	10	0.33940	T	0.23	-15.7133	17.0303	0.86459	0.0:0.0:1.0:0.0	.	518	Q8TCT0	CERK1_HUMAN	K	518;320	ENSP00000216264:Q518K;ENSP00000438659:Q320K	ENSP00000216264:Q518K	Q	-	1	0	CERK	45461757	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	8.463000	0.90377	2.335000	0.79485	0.563000	0.77884	CAG			0.567	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317924.2		NM_022766	
SYCE3	644186	mdanderson.org	37	22	50989812	50989812	+	Silent	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr22:50989812G>T	ENST00000406915.3	-	3	176	c.129C>A	c.(127-129)gcC>gcA	p.A43A	SYCE3_ENST00000402753.1_Silent_p.A43A	NM_001123225.1	NP_001116697.1	A1L190	SYCE3_HUMAN	synaptonemal complex central element protein 3	43					positive regulation of apoptotic process (GO:0043065)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|chromosome (GO:0005694)|nucleus (GO:0005634)				endometrium(1)|kidney(1)	2						CCATGTCATAGGCCATCCAGG	0.612																																					p.A43A													.	.			0			c.C129A												50.0	45.0	46.0					22																	50989812		692	1591	2283	SO:0001819	synonymous_variant	644186	exon3			GTCATAGGCCATC		CCDS46733.1	22q13.33	2011-10-05	2011-10-05	2011-10-05	ENSG00000217442	ENSG00000217442			35245	protein-coding gene	gene with protein product	"""testis highly expressed protein 2"""	615775	"""chromosome 22 open reading frame 41"""	C22orf41		21637789	Standard	NM_001123225		Approved		uc010hbe.3	A1L190	OTTHUMG00000150273	ENST00000406915.3:c.129C>A	22.37:g.50989812G>T			43	0	0		35	0.09	3	NM_001123225	20	0.00	0		Silent	SNP	ENST00000406915.3	37	CCDS46733.1																																																																																					0.612	SYCE3-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000317660.1		NM_001123225	
NUP210	23225	broad.mit.edu	37	3	13395547	13395547	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr3:13395547G>A	ENST00000254508.5	-	17	2471	c.2389C>T	c.(2389-2391)Cgc>Tgc	p.R797C		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	797					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					TCGAACCGGCGGCCCTCCTGG	0.642																																					p.R797C													.	NUP210	182		0			c.C2389T												24.0	20.0	21.0					3																	13395547		2203	4298	6501	SO:0001583	missense	23225	exon17			ACCGGCGGCCCTC	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.2389C>T	3.37:g.13395547G>A	ENSP00000254508:p.Arg797Cys		173	0	0		130	0.03	4	NM_024923	27	0.00	0	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Missense_Mutation	SNP	ENST00000254508.5	37	CCDS33704.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553276	0.86127	.	.	ENSG00000132182	ENST00000254508	T	0.26067	1.76	5.53	5.53	0.82687	.	0.155567	0.47852	D	0.000219	T	0.47040	0.1424	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.62014	0.897;0.791	T	0.44697	-0.9311	10	0.87932	D	0	-21.7297	15.1885	0.73023	0.0:0.0:0.8504:0.1496	.	797;797	Q8TEM1-2;Q8TEM1	.;PO210_HUMAN	C	797	ENSP00000254508:R797C	ENSP00000254508:R797C	R	-	1	0	NUP210	13370547	1.000000	0.71417	0.990000	0.47175	0.971000	0.66376	4.868000	0.63021	2.606000	0.88127	0.563000	0.77884	CGC			0.642	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340085.1		NM_024923	
COPG1	22820	broad.mit.edu	37	3	128973510	128973510	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr3:128973510G>T	ENST00000314797.6	+	6	427		c.e6-1			NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1						COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										CTTCCCTGCAGCCTAACAAAA	0.582																																					.													.	.			0			c.324-1G>T												52.0	54.0	53.0					3																	128973510		2203	4300	6503	SO:0001630	splice_region_variant	22820	exon6			CCTGCAGCCTAAC	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.324-1G>T	3.37:g.128973510G>T			60	0	0		52	0.06	3	NM_016128	14	0.00	0	A8K6M8|B3KMF6|Q54AC4	Splice_Site	SNP	ENST00000314797.6	37	CCDS33851.1	.	.	.	.	.	.	.	.	.	.	G	17.30	3.355858	0.61293	.	.	ENSG00000181789	ENST00000314797	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3755	0.66869	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COPG	130456200	1.000000	0.71417	0.997000	0.53966	0.759000	0.43091	9.508000	0.98000	2.255000	0.74692	0.591000	0.81541	.			0.582	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355456.1		NM_016128	Intron
MUC4	4585	broad.mit.edu;mdanderson.org	37	3	195509308	195509308	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr3:195509308G>A	ENST00000463781.3	-	2	9602	c.9143C>T	c.(9142-9144)tCa>tTa	p.S3048L	MUC4_ENST00000475231.1_Missense_Mutation_p.S3048L|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	989					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTGGATGCTGAGGAAGTGTC	0.607																																					p.S3048L													.	MUC4	1505		0			c.C9143T																																									SO:0001583	missense	4585	exon2			GATGCTGAGGAAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9143C>T	3.37:g.195509308G>A	ENSP00000417498:p.Ser3048Leu		100	0.01	1		88	0.06	5	NM_018406	20	0.05	1	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	8.283	0.816093	0.16607	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32988	1.44;1.43	.	.	.	.	.	.	.	.	T	0.15869	0.0382	N	0.19112	0.55	0.20975	N	0.999814	B	0.22480	0.07	B	0.14023	0.01	T	0.26360	-1.0105	7	.	.	.	.	5.4195	0.16392	0.0:0.0:1.0:0.0	.	2920	E7ESK3	.	L	3048	ENSP00000417498:S3048L;ENSP00000420243:S3048L	.	S	-	2	0	MUC4	196994087	0.286000	0.24305	0.013000	0.15412	0.000000	0.00434	2.555000	0.45854	0.497000	0.27926	0.000000	0.15137	TCA			0.607	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
RGS12	6002	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	3319118	3319118	+	Silent	SNP	C	C	T	rs372019148		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:3319118C>T	ENST00000344733.5	+	2	2125	c.1221C>T	c.(1219-1221)gaC>gaT	p.D407D	RGS12_ENST00000336727.3_Silent_p.D407D|RGS12_ENST00000382788.3_Silent_p.D407D|RGS12_ENST00000543385.1_Silent_p.D407D	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	407					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCTTTCTGGACGGGGACGCCG	0.617																																					p.D407D													.	.			0			c.C1221T							C	,	0,4406		0,0,2203	59.0	63.0	62.0		1221,1221	-5.0	0.3	4		62	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	RGS12	NM_002926.3,NM_198229.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	407/1377,407/1448	3319118	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	6002	exon2			TCTGGACGGGGAC	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1221C>T	4.37:g.3319118C>T			113	0	0		57	0.25	14	NM_002926	4	0.25	1	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Silent	SNP	ENST00000344733.5	37	CCDS3366.1																																																																																					0.617	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206602.1		NM_002926	
PACRGL	133015	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	20706400	20706400	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:20706400G>C	ENST00000503585.1	+	3	561	c.170G>C	c.(169-171)aGa>aCa	p.R57T	PACRGL_ENST00000360916.5_Missense_Mutation_p.R57T|PACRGL_ENST00000507634.1_Missense_Mutation_p.R57T|PACRGL_ENST00000502374.1_Missense_Mutation_p.R57T|PACRGL_ENST00000513459.1_Missense_Mutation_p.R57T|PACRGL_ENST00000444671.2_Missense_Mutation_p.R57T|PACRGL_ENST00000502938.1_Missense_Mutation_p.R57T|PACRGL_ENST00000295290.8_Missense_Mutation_p.R57T|PACRGL_ENST00000538990.1_Missense_Mutation_p.R57T	NM_001258345.1	NP_001245274.1	Q8N7B6	PACRL_HUMAN	PARK2 co-regulated-like	57										endometrium(2)|lung(7)|prostate(1)	10						CTTCATCCTAGACCAAGTGAT	0.388																																					p.R57T													.	.			0			c.G170C												125.0	119.0	121.0					4																	20706400		2203	4300	6503	SO:0001583	missense	133015	exon3			ATCCTAGACCAAG	AK098692	CCDS3427.1, CCDS47034.1, CCDS58895.1, CCDS58896.1	4p15.31	2008-10-02	2008-10-02	2008-10-02	ENSG00000163138	ENSG00000163138			28442	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 28"""	C4orf28		12477932	Standard	NM_145048		Approved	MGC29898	uc010iek.3	Q8N7B6	OTTHUMG00000128550	ENST00000503585.1:c.170G>C	4.37:g.20706400G>C	ENSP00000423881:p.Arg57Thr		220	0	0		126	0.25	32	NM_001258345	38	0.26	10	B2RDB9|B4DFF8|B4DMN7|Q8TBA8	Missense_Mutation	SNP	ENST00000503585.1	37	CCDS58895.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101411	0.76983	.	.	ENSG00000163138	ENST00000510051;ENST00000503585;ENST00000360916;ENST00000295290;ENST00000514485;ENST00000444671;ENST00000506745;ENST00000514663;ENST00000509469;ENST00000515339;ENST00000513861;ENST00000502374;ENST00000538990;ENST00000504630;ENST00000513590;ENST00000514292;ENST00000502938;ENST00000507634;ENST00000513459;ENST00000511089	.	.	.	5.56	5.56	0.83823	.	0.092812	0.43416	D	0.000570	T	0.67059	0.2853	M	0.62723	1.935	0.33400	D	0.577183	D;P;D;D;D;P	0.76494	0.992;0.745;0.984;0.999;0.993;0.9	P;P;P;D;P;P	0.69479	0.864;0.529;0.835;0.964;0.738;0.72	T	0.72574	-0.4252	9	0.35671	T	0.21	-14.7063	13.5974	0.61998	0.0806:0.0:0.9194:0.0	.	57;57;105;57;57;57	B4DFF8;Q8N7B6;D6R9N9;B4DMN7;D6RGK2;Q8N7B6-2	.;PACRL_HUMAN;.;.;.;.	T	105;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57;57	.	ENSP00000295290:R57T	R	+	2	0	PACRGL	20315498	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.950000	0.56676	2.778000	0.95560	0.655000	0.94253	AGA			0.388	PACRGL-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000360321.2		NM_145048	
KCTD8	386617	broad.mit.edu	37	4	44177058	44177058	+	Missense_Mutation	SNP	G	G	T	rs549391615		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:44177058G>T	ENST00000360029.3	-	2	1454	c.1171C>A	c.(1171-1173)Cgc>Agc	p.R391S		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	391					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTAGAGGGGCGATCCAATGTT	0.507										HNSCC(17;0.042)																											p.R391S													KCTD8,caecum,carcinoma,+1,1	KCTD8	96	1	0			c.C1171A												165.0	164.0	164.0					4																	44177058		2203	4300	6503	SO:0001583	missense	386617	exon2			AGGGGCGATCCAA	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1171C>A	4.37:g.44177058G>T	ENSP00000353129:p.Arg391Ser		120	0	0		107	0.04	4	NM_198353	0		0	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	37	CCDS3467.1	.	.	.	.	.	.	.	.	.	.	G	12.14	1.849512	0.32699	.	.	ENSG00000183783	ENST00000360029	T	0.40476	1.03	4.56	3.68	0.42216	.	0.000000	0.46758	D	0.000275	T	0.41880	0.1178	L	0.36672	1.1	0.38039	D	0.935411	P	0.50272	0.933	P	0.49226	0.603	T	0.51004	-0.8760	10	0.87932	D	0	.	12.9862	0.58594	0.0:0.0:0.8317:0.1682	.	391	Q6ZWB6	KCTD8_HUMAN	S	391	ENSP00000353129:R391S	ENSP00000353129:R391S	R	-	1	0	KCTD8	43871815	1.000000	0.71417	0.995000	0.50966	0.196000	0.23810	3.014000	0.49590	1.202000	0.43218	0.650000	0.86243	CGC			0.507	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216868.1			
BMP2K	55589	mdanderson.org	37	4	79792166	79792166	+	Missense_Mutation	SNP	C	C	G	rs202184856|rs200441916	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:79792166C>G	ENST00000335016.5	+	11	1627	c.1461C>G	c.(1459-1461)caC>caG	p.H487Q	BMP2K_ENST00000502871.1_Missense_Mutation_p.H487Q	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	487	Gln/His-rich.				regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						agcagcagcaccaccaccacc	0.502													c|||	68	0.0135783	0.0416	0.0043	5008	,	,		11259	0.001		0.007	False		,,,				2504	0.002				p.H487Q													BMP2K_ENST00000502871,caecum,carcinoma,0,4	BMP2K_ENST00000502871	0	4	0			c.C1461G							-	GLN/HIS,GLN/HIS	12,4302		0,12,2145	20.0	24.0	23.0		1461,1461		0.1	4		23	2,8424		0,2,4211	no	missense,missense	BMP2K	NM_017593.3,NM_198892.1	24,24	0,14,6356	GG,GC,CC		0.0237,0.2782,0.1099	possibly-damaging,possibly-damaging	487/663,487/1162	79792166	14,12726	2157	4213	6370	SO:0001583	missense	55589	exon11			GCAGCACCACCAC	AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.1461C>G	4.37:g.79792166C>G	ENSP00000334836:p.His487Gln		16	0	0		14	0.14	2	NM_017593	8	0.13	1	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	ENST00000335016.5	37	CCDS47083.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	0.755|0.755	-0.771272|-0.771272	0.02951|0.02951	0.002782|0.002782	2.37E-4|2.37E-4	ENSG00000138756|ENSG00000138756	ENST00000502871;ENST00000335016;ENST00000264889|ENST00000502613	T;T|.	0.71341|.	1.16;-0.56|.	.|.	.|.	.|.	.|.	3.253760|.	0.01410|.	N|.	0.013962|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.39094|.	0.659;0.404|.	B;B|.	0.18263|.	0.021;0.021|.	T|T	0.24119|0.24119	-1.0169|-1.0169	9|4	0.10902|.	T|.	0.67|.	.|.	3.2348|3.2348	0.06761|0.06761	0.4658:0.5342:0.0:0.0|0.4658:0.5342:0.0:0.0	.|.	487;487|.	Q9NSY1;Q4W5H2|.	BMP2K_HUMAN;.|.	Q|A	487;487;501|180	ENSP00000421768:H487Q;ENSP00000334836:H487Q|.	ENSP00000264889:H501Q|.	H|P	+|+	3|1	2|0	BMP2K|BMP2K	80011190|80011190	0.000000|0.000000	0.05858|0.05858	0.126000|0.126000	0.21872|0.21872	0.030000|0.030000	0.12068|0.12068	-1.617000|-1.617000	0.02051|0.02051	0.372000|0.372000	0.24591|0.24591	0.377000|0.377000	0.23210|0.23210	CAC|CCA			0.502	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				NM_017593	
TRAM1L1	133022	broad.mit.edu	37	4	118006429	118006429	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:118006429C>G	ENST00000310754.4	-	1	307	c.121G>C	c.(121-123)Gag>Cag	p.E41Q		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	41					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						GCTGTTCCCTCGAACACAAGC	0.547																																					p.E41Q													.	TRAM1L1	55		0			c.G121C												71.0	64.0	66.0					4																	118006429		2203	4300	6503	SO:0001583	missense	133022	exon1			TTCCCTCGAACAC	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.121G>C	4.37:g.118006429C>G	ENSP00000309402:p.Glu41Gln		126	0	0		94	0.04	4	NM_152402	8	0.00	0	Q8N2L7	Missense_Mutation	SNP	ENST00000310754.4	37	CCDS3707.1	.	.	.	.	.	.	.	.	.	.	C	13.27	2.186778	0.38609	.	.	ENSG00000174599	ENST00000310754	T	0.43688	0.94	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.31575	0.0801	L	0.34521	1.04	0.80722	D	1	B	0.28178	0.202	B	0.30782	0.12	T	0.06232	-1.0838	10	0.12766	T	0.61	5.9967	14.426	0.67215	0.0:1.0:0.0:0.0	.	41	Q8N609	TR1L1_HUMAN	Q	41	ENSP00000309402:E41Q	ENSP00000309402:E41Q	E	-	1	0	TRAM1L1	118225877	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	6.797000	0.75150	2.512000	0.84698	0.655000	0.94253	GAG			0.547	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256513.1		NM_152402	
BBS7	55212	mdanderson.org	37	4	122770033	122770033	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:122770033G>T	ENST00000264499.4	-	9	1083	c.900C>A	c.(898-900)gaC>gaA	p.D300E	BBS7_ENST00000506636.1_Missense_Mutation_p.D300E	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	300					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						CATCATAGCTGTCTTTTCCTA	0.323									Bardet-Biedl syndrome																												p.D300E													.	.			0			c.C900A												123.0	122.0	122.0					4																	122770033		2203	4300	6503	SO:0001583	missense	55212	exon9	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	ATAGCTGTCTTTT	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.900C>A	4.37:g.122770033G>T	ENSP00000264499:p.Asp300Glu		79	0	0		39	0.08	3	NM_018190	15	0.00	0	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	37	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	G	0.118	-1.128844	0.01756	.	.	ENSG00000138686	ENST00000264499;ENST00000506636	T;T	0.75050	-0.9;-0.9	5.45	-1.3	0.09259	WD40 repeat-like-containing domain (1);	0.103806	0.64402	D	0.000003	T	0.50360	0.1611	N	0.21583	0.68	0.45822	D	0.998697	B	0.06786	0.001	B	0.09377	0.004	T	0.08371	-1.0725	10	0.19590	T	0.45	-12.6596	4.5703	0.12207	0.3908:0.0:0.3607:0.2485	.	300	Q8IWZ6	BBS7_HUMAN	E	300	ENSP00000264499:D300E;ENSP00000423626:D300E	ENSP00000264499:D300E	D	-	3	2	BBS7	122989483	0.726000	0.28059	0.974000	0.42286	0.279000	0.26890	0.000000	0.12993	-0.453000	0.07076	-0.469000	0.05056	GAC			0.323	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256716.1			
RTN3P1	152905	bcgsc.ca	37	4	146296708	146296708	+	IGR	SNP	C	C	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr4:146296708C>G								RP11-142A22.4 (35135 upstream) : SMAD1 (106235 downstream)																							GCGGAGCCATCGGCGGCCACT	0.652																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	152905	.			AGCCATCGGCGGC																													4.37:g.146296708C>G			72	0	0		41	0.17	7	.	15	0.00	0		RNA	SNP		37																																																																																					0	0.652										
SDHA	6389	bcgsc.ca	37	5	236628	236628	+	Missense_Mutation	SNP	C	C	T	rs201139275	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr5:236628C>T	ENST00000264932.6	+	10	1461	c.1346C>T	c.(1345-1347)gCc>gTc	p.A449V	SDHA_ENST00000504309.1_Missense_Mutation_p.A449V|SDHA_ENST00000510361.1_Missense_Mutation_p.A401V	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	449					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	GTACATGGTGCCAACCGCCTC	0.592									Familial Paragangliomas				C|||	9	0.00179712	0.003	0.0014	5008	,	,		17830	0.002		0.001	False		,,,				2504	0.001				p.A449V													.	SDHA	80		0			c.C1346T												81.0	74.0	77.0					5																	236628		2203	4300	6503	SO:0001583	missense	6389	exon10	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	ATGGTGCCAACCG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1346C>T	5.37:g.236628C>T	ENSP00000264932:p.Ala449Val		150	0.0133333333	2		101	0.09	9	NM_004168	215	0.00	0	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	ENST00000264932.6	37	CCDS3853.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	21.6|21.6	4.176378|4.176378	0.78564|0.78564	.|.	.|.	ENSG00000073578|ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361|ENST00000515815	T;T;T|.	0.70986|.	-0.53;-0.53;-0.53|.	4.9|4.9	4.9|4.9	0.64082|0.64082	Fumarate reductase/succinate dehydrogenase flavoprotein, N-terminal (1);|.	0.142014|.	0.46758|.	U|.	0.000265|.	D|D	0.92519|0.92519	0.7624|0.7624	H|H	0.99971|0.99971	5.125|5.125	0.80722|0.80722	D|D	1|1	D;D;P;P;D|.	0.63046|.	0.96;0.992;0.881;0.955;0.99|.	P;P;P;P;P|.	0.54924|.	0.764;0.675;0.448;0.548;0.585|.	D|D	0.96100|0.96100	0.9068|0.9068	10|5	0.87932|.	D|.	0|.	.|.	15.9089|15.9089	0.79456|0.79456	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	401;449;43;449;449|.	E9PBJ5;B4DYN5;B3KYA5;D6RFM5;P31040|.	.;.;.;.;DHSA_HUMAN|.	V|S	449;304;449;401|1	ENSP00000264932:A449V;ENSP00000426514:A449V;ENSP00000427703:A401V|.	ENSP00000264932:A449V|.	A|P	+|+	2|1	0|0	SDHA|SDHA	289628|289628	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.230000|0.230000	0.25150|0.25150	5.793000|5.793000	0.69060|0.69060	2.411000|2.411000	0.81874|0.81874	0.650000|0.650000	0.86243|0.86243	GCC|CCA			0.592	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206599.1		NM_004168	
STARD4-AS1	100505678	broad.mit.edu	37	5	110908045	110908045	+	RNA	DEL	A	A	-			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr5:110908045delA	ENST00000500779.2	+	0	283					NR_040093.1				STARD4 antisense RNA 1																		AAATGAAGCCAAAAAAAGTTA	0.408																																					.													.	.			0			.																																											0	.			GAAGCCAAAAAAA	CR749489		5q22.1	2012-10-12	2012-08-15		ENSG00000246859	ENSG00000246859		"""Long non-coding RNAs"""	44117	non-coding RNA	RNA, long non-coding			"""STARD4 antisense RNA 1 (non-protein coding)"""				Standard	NR_040093		Approved		uc021ych.1		OTTHUMG00000162858		5.37:g.110908045delA			7	0	0		9	0.33	3	.	0		0		RNA	DEL	ENST00000500779.2	37																																																																																						0.408	STARD4-AS1-002	KNOWN	basic	antisense	antisense		OTTHUMT00000370803.2		NR_040093	
HSPA9	3313	hgsc.bcm.edu;ucsc.edu	37	5	137902698	137902699	+	Missense_Mutation	DNP	TG	TG	GT	rs202180095|rs199831172		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	TG	TG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr5:137902698_137902699TG>GT	ENST00000297185.3	-	8	995_996	c.870_871CA>AC	c.(868-873)ttCAag>ttACag	p.290_291FK>LQ	HSPA9_ENST00000501917.2_5'Flank	NM_004134.6	NP_004125.3	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 (mortalin)	290					cellular protein metabolic process (GO:0044267)|negative regulation of apoptotic process (GO:0043066)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(1)|kidney(4)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACCTCTCTCTTGAACTCCTTCA	0.416																																					p.FK290LQ													.	.			0			c.C870A																																									SO:0001583	missense	3313	exon8			CTCTCTTGAACTC	L11066	CCDS4208.1	5q31.1	2011-09-02	2006-10-31	2006-10-31	ENSG00000113013	ENSG00000113013		"""Heat shock proteins / HSP70"""	5244	protein-coding gene	gene with protein product		600548	"""heat shock 70kDa protein 9B (mortalin-2)"""	HSPA9B		7684501	Standard	NM_004134		Approved	GRP75, PBP74, mot-2, mthsp75	uc003ldf.3	P38646	OTTHUMG00000129206	ENST00000297185.3:c.870_871delinsGT	5.37:g.137902698_137902699delinsGT	ENSP00000297185:p.F290_K291delinsLQ		228	0	0		247	0.12	29	NM_004134	1445	0.00	0	B2RCM1|P30036|P31932|Q1HB43|Q53H23|Q6GU03|Q9BWB7|Q9UC56	Missense_Mutation	DNP	ENST00000297185.3	37	CCDS4208.1																																																																																			0.001		0.416	HSPA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251285.1		NM_004134	
ZNF346	23567	mdanderson.org	37	5	176449808	176449808	+	Silent	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr5:176449808G>T	ENST00000358149.3	+	1	112	c.69G>T	c.(67-69)tcG>tcT	p.S23S	ZNF346_ENST00000503039.1_Silent_p.S23S|ZNF346_ENST00000512315.1_Silent_p.S23S|ZNF346_ENST00000503425.1_Silent_p.S23S|ZNF346_ENST00000511834.1_Silent_p.S23S|ZNF346_ENST00000506693.1_Silent_p.S23S|ZNF346_ENST00000261948.4_Silent_p.S23S	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346	23					positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAGCAGCTCGGAGTTGCTGG	0.721																																					p.S23S													.	.			0			c.G69T												6.0	8.0	7.0					5																	176449808		2075	4043	6118	SO:0001819	synonymous_variant	23567	exon1			CAGCTCGGAGTTG	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.69G>T	5.37:g.176449808G>T			16	0	0		21	0.10	2	NM_012279	14	0.00	0	B7Z367|Q68CV9|Q6ZMW1	Silent	SNP	ENST00000358149.3	37	CCDS4409.1																																																																																					0.721	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253415.2		NM_012279	
SQSTM1	8878	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	179250972	179250972	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr5:179250972G>A	ENST00000389805.4	+	3	594	c.416G>A	c.(415-417)cGc>cAc	p.R139H	SQSTM1_ENST00000402874.3_Missense_Mutation_p.R55H|SQSTM1_ENST00000360718.5_Missense_Mutation_p.R55H|SQSTM1_ENST00000376929.3_Missense_Mutation_p.R55H|SQSTM1_ENST00000510187.1_Missense_Mutation_p.R139H	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	139	Interaction with GABRR3. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTAGGAACCCGCTACAAGTGC	0.647																																					p.R139H													.	SQSTM1	30		0			c.G416A												79.0	74.0	76.0					5																	179250972		2203	4300	6503	SO:0001583	missense	8878	exon3			GAACCCGCTACAA	U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.416G>A	5.37:g.179250972G>A	ENSP00000374455:p.Arg139His		59	0	0		64	0.08	5	NM_003900	371	0.00	1	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	ENST00000389805.4	37	CCDS34317.1	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743720	0.69418	.	.	ENSG00000161011	ENST00000376929;ENST00000514093;ENST00000422245;ENST00000389805;ENST00000504627;ENST00000402874;ENST00000510187;ENST00000360718	D;D;D;D;D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04;-4.04	5.59	2.78	0.32641	Zinc finger, ZZ-type (4);	0.054467	0.64402	N	0.000001	D	0.98617	0.9537	H	0.97758	4.07	0.53688	D	0.999979	D;D	0.89917	1.0;0.973	D;P	0.97110	1.0;0.512	D	0.98076	1.0401	10	0.87932	D	0	-30.9191	10.872	0.46889	0.0664:0.2449:0.6887:0.0	.	139;139	Q13501;E7EMC7	SQSTM_HUMAN;.	H	55;55;55;139;162;55;139;55	ENSP00000366128:R55H;ENSP00000427308:R55H;ENSP00000394534:R55H;ENSP00000374455:R139H;ENSP00000425957:R162H;ENSP00000385553:R55H;ENSP00000424477:R139H;ENSP00000353944:R55H	ENSP00000353944:R55H	R	+	2	0	SQSTM1	179183578	1.000000	0.71417	0.992000	0.48379	0.315000	0.28087	9.622000	0.98378	0.287000	0.22375	-0.258000	0.10820	CGC			0.647	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319344.1			
BTN2A3P	54718	broad.mit.edu;mdanderson.org	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	.		9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											0	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			92	0.0108695652	1		78	0.06	5	.	1	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
TTBK1	84630	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	43230837	43230837	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr6:43230837G>A	ENST00000259750.4	+	13	1818	c.1735G>A	c.(1735-1737)Gag>Aag	p.E579K	TTBK1_ENST00000304139.5_Missense_Mutation_p.E528K	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	579					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GCCACTGCCCGAGGAGGGCGA	0.711																																					p.E579K													.	.			0			c.G1735A												14.0	13.0	13.0					6																	43230837		2123	4156	6279	SO:0001583	missense	84630	exon13			CTGCCCGAGGAGG	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1735G>A	6.37:g.43230837G>A	ENSP00000259750:p.Glu579Lys		106	0	0		130	0.06	8	NM_032538	0		0	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	37	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	18.22	3.576260	0.65878	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	T	0.27557	1.66	5.48	5.48	0.80851	.	0.111999	0.64402	D	0.000013	T	0.13543	0.0328	L	0.40543	1.245	0.38117	D	0.937752	P;P	0.46020	0.82;0.871	B;B	0.30495	0.116;0.078	T	0.08046	-1.0741	10	0.72032	D	0.01	.	16.2562	0.82517	0.0:0.0:1.0:0.0	.	102;579	Q9H6N8;Q5TCY1	.;TTBK1_HUMAN	K	528;579;528	ENSP00000259750:E579K	ENSP00000259750:E579K	E	+	1	0	TTBK1	43338815	1.000000	0.71417	0.996000	0.52242	0.725000	0.41563	7.504000	0.81646	2.580000	0.87095	0.555000	0.69702	GAG			0.711	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040584.3			
FBXL4	26235	broad.mit.edu	37	6	99323347	99323347	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr6:99323347G>T	ENST00000369244.2	-	9	2074	c.1646C>A	c.(1645-1647)aCa>aAa	p.T549K	FBXL4_ENST00000229971.1_Missense_Mutation_p.T549K	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	549					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		ATCAATGTCTGTGTCACACAC	0.413																																					p.T549K													.	FBXL4	54		0			c.C1646A												84.0	82.0	83.0					6																	99323347		2203	4300	6503	SO:0001583	missense	26235	exon8			ATGTCTGTGTCAC	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1646C>A	6.37:g.99323347G>T	ENSP00000358247:p.Thr549Lys		97	0	0		99	0.03	3	NM_012160	27	0.00	0	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	37	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.391015	0.25118	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.02258	4.37;4.37	5.87	5.01	0.66863	.	0.241563	0.45126	D	0.000385	T	0.00608	0.0020	N	0.12961	0.28	0.47547	D	0.999452	P;B	0.49090	0.919;0.008	B;B	0.38562	0.276;0.004	T	0.59316	-0.7477	10	0.07175	T	0.84	.	14.9133	0.70776	0.0684:0.0:0.9316:0.0	.	549;549	B2R7Q5;Q9UKA2	.;FBXL4_HUMAN	K	549	ENSP00000358247:T549K;ENSP00000229971:T549K	ENSP00000229971:T549K	T	-	2	0	FBXL4	99430068	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	6.304000	0.72800	1.500000	0.48636	-0.225000	0.12378	ACA			0.413	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041587.2			
SHPRH	257218	broad.mit.edu	37	6	146256416	146256416	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr6:146256416G>T	ENST00000367505.2	-	12	2995	c.2731C>A	c.(2731-2733)Caa>Aaa	p.Q911K	SHPRH_ENST00000438092.2_Missense_Mutation_p.Q911K|SHPRH_ENST00000367503.3_Missense_Mutation_p.Q911K|SHPRH_ENST00000275233.7_Missense_Mutation_p.Q911K			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	911					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GTACTGACTTGGTCAATCACA	0.333																																					p.Q911K													.	SHPRH	169		0			c.C2731A												77.0	71.0	72.0					6																	146256416		1859	4088	5947	SO:0001583	missense	257218	exon12			TGACTTGGTCAAT	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2731C>A	6.37:g.146256416G>T	ENSP00000356475:p.Gln911Lys		91	0	0		85	0.04	3	NM_173082	17	0.00	0	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	37	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	G	25.8	4.674664	0.88445	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95	5.73	5.73	0.89815	SNF2-related (1);	0.000000	0.64402	D	0.000001	T	0.78916	0.4359	L	0.39245	1.2	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.998	D;D;D	0.80764	0.991;0.994;0.99	T	0.80553	-0.1331	10	0.72032	D	0.01	-21.6024	18.0771	0.89431	0.0:0.0:1.0:0.0	.	800;911;911	Q149N8-2;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	K	911	ENSP00000356475:Q911K;ENSP00000356473:Q911K;ENSP00000412797:Q911K;ENSP00000275233:Q911K	ENSP00000275233:Q911K	Q	-	1	0	SHPRH	146298109	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.869000	0.99810	2.700000	0.92200	0.655000	0.94253	CAA			0.333	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000042571.2		NM_173082	
GRM1	2911	mdanderson.org	37	6	146755748	146755748	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr6:146755748C>T	ENST00000282753.1	+	8	3636	c.3401C>T	c.(3400-3402)gCc>gTc	p.A1134V	GRM1_ENST00000355289.4_3'UTR|GRM1_ENST00000361719.2_Missense_Mutation_p.A1134V|GRM1_ENST00000492807.2_3'UTR|GRM1_ENST00000507907.1_3'UTR|GRM1_ENST00000392299.2_3'UTR			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	1134					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		CTGCAGGCGGCCAGCAAACTG	0.642																																					p.A1134V													.	.			0			c.C3401T												49.0	54.0	52.0					6																	146755748		2202	4300	6502	SO:0001583	missense	2911	exon9			AGGCGGCCAGCAA	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.3401C>T	6.37:g.146755748C>T	ENSP00000282753:p.Ala1134Val		55	0	0		22	0.09	2	NM_000838	0		0	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	ENST00000282753.1	37	CCDS5209.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997657	0.74818	.	.	ENSG00000152822	ENST00000361719;ENST00000282753	D;D	0.87966	-2.32;-2.32	5.97	5.97	0.96955	.	0.504996	0.18281	N	0.146025	T	0.77558	0.4148	L	0.29908	0.895	0.80722	D	1	B	0.15141	0.012	B	0.16289	0.015	T	0.70124	-0.4958	10	0.49607	T	0.09	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	1134	Q13255	GRM1_HUMAN	V	1134	ENSP00000354896:A1134V;ENSP00000282753:A1134V	ENSP00000282753:A1134V	A	+	2	0	GRM1	146797441	0.995000	0.38212	0.995000	0.50966	0.989000	0.77384	3.032000	0.49736	2.837000	0.97791	0.655000	0.94253	GCC			0.642	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042574.1		NM_000838	
SP8	221833	mdanderson.org	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S													.	.			0			c.G466A																																									SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	7.37:g.20824970C>T	ENSP00000354482:p.Gly138Ser		40	0	0		57	0.05	3	NM_182700	4	0.50	2	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC			0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326904.2			
SP4	6671	broad.mit.edu	37	7	21468306	21468306	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr7:21468306G>A	ENST00000222584.3	+	2	237	c.19G>A	c.(19-21)Gag>Aag	p.E7K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	7	Poly-Glu.				regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAGAAGAAGGAGGAGGAGGA	0.512																																					p.E7K													SP4,colon,carcinoma,0,1	SP4	91	1	0			c.G19A												20.0	20.0	20.0					7																	21468306		2171	4251	6422	SO:0001583	missense	6671	exon2			AAGAAGGAGGAGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.19G>A	7.37:g.21468306G>A	ENSP00000222584:p.Glu7Lys		66	0	0		79	0.04	3	NM_003112	1	0.00	0	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318989	0.41096	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.09911	2.93	4.5	4.5	0.54988	.	0.061123	0.64402	N	0.000005	T	0.10937	0.0267	L	0.36672	1.1	0.44142	D	0.996934	P	0.34587	0.458	B	0.39152	0.292	T	0.20907	-1.0261	10	0.23891	T	0.37	.	12.5742	0.56355	0.0:0.0:1.0:0.0	.	7	Q02446	SP4_HUMAN	K	7	ENSP00000222584:E7K	ENSP00000222584:E7K	E	+	1	0	SP4	21434831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.345000	0.79718	0.563000	0.77884	GAG			0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211617.2		NM_003112	
ORAI2	80228	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	102087325	102087325	+	Silent	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr7:102087325C>T	ENST00000356387.2	+	4	826	c.591C>T	c.(589-591)gcC>gcT	p.A197A	ORAI2_ENST00000488996.1_3'UTR|ORAI2_ENST00000473939.1_Silent_p.A197A|ORAI2_ENST00000403646.3_Silent_p.A197A|ORAI2_ENST00000478730.2_Silent_p.A197A	NM_001126340.1|NM_001271818.1|NM_001271819.1|NM_032831.3	NP_001119812.1|NP_001258747.1|NP_001258748.1|NP_116220.1	Q96SN7	ORAI2_HUMAN	ORAI calcium release-activated calcium modulator 2	197						growth cone (GO:0030426)|integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|lung(4)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	15						GGCAGGCCGCCCTGGTGTCCA	0.662																																					p.A197A													.	.			0			c.C591T												53.0	51.0	52.0					7																	102087325		2203	4300	6503	SO:0001819	synonymous_variant	80228	exon3			GGCCGCCCTGGTG	AF258552	CCDS5722.1	7q22.1	2007-08-14	2007-08-14	2007-08-14	ENSG00000160991	ENSG00000160991		"""ORAI calcium release-activated calcium modulators"""	21667	protein-coding gene	gene with protein product	"""CAP-binding protein complex interacting protein 2"""	610929	"""chromosome 7 open reading frame 19"", ""transmembrane protein 142B"""	C7orf19, TMEM142B		16582901	Standard	NM_001126340		Approved	CBCIP2, FLJ12474, FLJ14733, H_NH0514P08.8	uc003uzj.3	Q96SN7	OTTHUMG00000157722	ENST00000356387.2:c.591C>T	7.37:g.102087325C>T			61	0	0		75	0.27	20	NM_032831	13	0.38	5	Q6IA68|Q8WY94|Q9H9Y3	Silent	SNP	ENST00000356387.2	37	CCDS5722.1																																																																																					0.662	ORAI2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000349509.2		NM_032831	
SLC13A4	26266	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	135406263	135406263	+	Silent	SNP	C	C	T	rs370307347		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr7:135406263C>T	ENST00000354042.4	-	2	797	c.108G>A	c.(106-108)tcG>tcA	p.S36S		NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	36					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						CGTAAGCACACGAGGCCTCCT	0.602																																					p.S36S													.	.			0			c.G108A							C		1,4405	2.1+/-5.4	0,1,2202	52.0	42.0	46.0		108	-6.2	0.0	7		46	0,8600		0,0,4300	no	coding-synonymous	SLC13A4	NM_012450.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		36/627	135406263	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26266	exon2			AGCACACGAGGCC	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.108G>A	7.37:g.135406263C>T			341	0	0		426	0.18	75	NM_012450	1	0.00	0	A4D1Q4|Q8N631	Silent	SNP	ENST00000354042.4	37	CCDS5840.1																																																																																					0.602	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340558.1		NM_012450	
LZTS1	11178	mdanderson.org	37	8	20107717	20107717	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:20107717A>G	ENST00000381569.1	-	4	1664	c.1307T>C	c.(1306-1308)cTg>cCg	p.L436P	LZTS1_ENST00000265801.6_Missense_Mutation_p.L436P|LZTS1_ENST00000522290.1_Missense_Mutation_p.L436P			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	436					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGCGCCCTCCAGGTCCTGGGT	0.647																																					p.L436P													.	.			0			c.T1307C												79.0	85.0	83.0					8																	20107717		2203	4300	6503	SO:0001583	missense	11178	exon3			CCCTCCAGGTCCT	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1307T>C	8.37:g.20107717A>G	ENSP00000370981:p.Leu436Pro		55	0	0		46	0.07	3	NM_021020	30	0.00	0	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	ENST00000381569.1	37	CCDS6015.1	.	.	.	.	.	.	.	.	.	.	a	15.03	2.713654	0.48517	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.55588	0.51;0.51;0.51	4.7	4.7	0.59300	.	0.437967	0.23389	N	0.048711	T	0.70876	0.3274	M	0.78916	2.43	0.58432	D	0.999994	D;D	0.76494	0.998;0.999	D;D	0.81914	0.953;0.995	T	0.74312	-0.3706	10	0.66056	D	0.02	-17.0768	11.5671	0.50811	1.0:0.0:0.0:0.0	.	436;436	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	P	436	ENSP00000370981:L436P;ENSP00000265801:L436P;ENSP00000429263:L436P	ENSP00000265801:L436P	L	-	2	0	LZTS1	20151997	1.000000	0.71417	0.995000	0.50966	0.887000	0.51463	4.386000	0.59620	1.756000	0.51951	0.454000	0.30748	CTG			0.647	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000214122.1		NM_021020	
AGPAT6	137964	broad.mit.edu	37	8	41478445	41478445	+	Silent	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:41478445C>T	ENST00000396987.3	+	13	2223	c.1296C>T	c.(1294-1296)gaC>gaT	p.D432D	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	432					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			AGGTGAAGGACACGTTCAAGG	0.602																																					p.D432D													.	AGPAT6	32		0			c.C1296T												68.0	43.0	51.0					8																	41478445		2080	4025	6105	SO:0001819	synonymous_variant	137964	exon13			GAAGGACACGTTC	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.1296C>T	8.37:g.41478445C>T			218	0	0		240	0.02	5	NM_178819	387	0.05	18	Q86V89	Silent	SNP	ENST00000396987.3	37	CCDS6117.1																																																																																					0.602	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377158.1	rescued with RNA-seq	NM_178819	
POLB	5423	broad.mit.edu	37	8	42210059	42210059	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:42210059G>T	ENST00000265421.4	+	6	513	c.343G>T	c.(343-345)Gta>Tta	p.V115L	POLB_ENST00000538005.1_Intron	NM_002690.2	NP_002681.1	P06746	DPOLB_HUMAN	polymerase (DNA directed), beta	115					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neuron apoptotic process (GO:0051402)|pyrimidine dimer repair (GO:0006290)|response to ethanol (GO:0045471)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|enzyme binding (GO:0019899)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)|microtubule binding (GO:0008017)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(1)	16	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;2.58e-12)|Lung NSC(13;4.24e-11)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.1)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.18e-11)|Lung(22;0.00467)|OV - Ovarian serous cystadenocarcinoma(14;0.00523)|LUSC - Lung squamous cell carcinoma(45;0.024)		Cytarabine(DB00987)	AAGGAAGTTTGTAGATGAAGG	0.368								DNA polymerases (catalytic subunits)																													p.V115L													.	POLB	60		0			c.G343T												209.0	186.0	193.0					8																	42210059		2203	4300	6503	SO:0001583	missense	5423	exon6			AAGTTTGTAGATG		CCDS6129.1	8p12-p11	2012-10-02			ENSG00000070501	ENSG00000070501	2.7.7.7	"""DNA polymerases"""	9174	protein-coding gene	gene with protein product		174760					Standard	NM_002690		Approved		uc003xoz.2	P06746	OTTHUMG00000164093	ENST00000265421.4:c.343G>T	8.37:g.42210059G>T	ENSP00000265421:p.Val115Leu		102	0	0		110	0.03	3	NM_002690	108	0.00	0	B2RC78|Q3KP48|Q6FI34	Missense_Mutation	SNP	ENST00000265421.4	37	CCDS6129.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.50|12.50	1.957373|1.957373	0.34565|0.34565	.|.	.|.	ENSG00000070501|ENSG00000070501	ENST00000521290|ENST00000265421;ENST00000518925	.|T;T	.|0.42513	.|0.97;1.01	5.62|5.62	5.62|5.62	0.85841|0.85841	.|DNA-directed DNA polymerase X (1);Helix-hairpin-helix DNA-binding motif, class 1 (1);DNA polymerase lambda, fingers domain (2);	.|0.056412	.|0.64402	.|D	.|0.000001	T|T	0.44685|0.44685	0.1305|0.1305	L|L	0.56396|0.56396	1.775|1.775	0.80722|0.80722	D|D	1|1	.|B;B	.|0.20550	.|0.025;0.046	.|B;B	.|0.27608	.|0.071;0.081	T|T	0.27571|0.27571	-1.0070|-1.0070	5|10	.|0.37606	.|T	.|0.19	-5.5251|-5.5251	17.16|17.16	0.86801|0.86801	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|115;115	.|Q53EV2;P06746	.|.;DPOLB_HUMAN	F|L	45|115	.|ENSP00000265421:V115L;ENSP00000430784:V115L	.|ENSP00000265421:V115L	C|V	+|+	2|1	0|0	POLB|POLB	42329216|42329216	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.905000|4.905000	0.63286|0.63286	2.642000|2.642000	0.89623|0.89623	0.655000|0.655000	0.94253|0.94253	TGT|GTA			0.368	POLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377242.1		NM_002690	
FNTA	2339	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	42940420	42940420	+	Nonsense_Mutation	SNP	C	C	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:42940420C>T	ENST00000302279.3	+	9	1329	c.1135C>T	c.(1135-1137)Caa>Taa	p.Q379*	FNTA_ENST00000529687.1_Nonsense_Mutation_p.Q228*|FNTA_ENST00000342116.4_Nonsense_Mutation_p.Q312*	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	379					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			AAATGTACAGCAATAACACCA	0.398																																					p.Q379X													FNTA,NS,carcinoma,-1,1	FNTA	-1	1	0			c.C1135T												95.0	81.0	86.0					8																	42940420		2203	4300	6503	SO:0001587	stop_gained	2339	exon9			GTACAGCAATAAC	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.1135C>T	8.37:g.42940420C>T	ENSP00000303423:p.Gln379*		281	0	0		297	0.20	59	NM_002027	387	0.21	80	A6NJW0|Q53XJ9|Q9UDC1	Nonsense_Mutation	SNP	ENST00000302279.3	37	CCDS6140.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.914976	0.92178	.	.	ENSG00000168522	ENST00000302279;ENST00000342116	.	.	.	5.7	5.7	0.88788	.	0.515163	0.20695	N	0.087400	.	.	.	.	.	.	0.34259	D	0.679706	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.3299	0.87259	0.0:1.0:0.0:0.0	.	.	.	.	X	379;312	.	ENSP00000303423:Q379X	Q	+	1	0	FNTA	43059577	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	3.645000	0.54389	2.703000	0.92315	0.650000	0.86243	CAA			0.398	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383178.1		NM_002027	
ZFHX4	79776	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	77761779	77761779	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:77761779G>C	ENST00000521891.2	+	8	4125	c.3677G>C	c.(3676-3678)aGt>aCt	p.S1226T	ZFHX4_ENST00000455469.2_Missense_Mutation_p.S1181T|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S1200T|ZFHX4_ENST00000050961.6_Missense_Mutation_p.S1181T	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AACTACAATAGTAGGGACCAA	0.408										HNSCC(33;0.089)																											p.S1226T													.	.			0			c.G3677C												135.0	129.0	131.0					8																	77761779		1944	4153	6097	SO:0001583	missense	79776	exon8			ACAATAGTAGGGA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.3677G>C	8.37:g.77761779G>C	ENSP00000430497:p.Ser1226Thr		104	0	0		102	0.09	9	NM_024721	0		0	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	37	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579728	0.46006	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50548	0.74;0.79;0.75;0.75	4.71	4.71	0.59529	Zinc finger, C2H2-like (1);	0.000000	0.49305	U	0.000141	T	0.37517	0.1006	L	0.42686	1.345	0.51767	D	0.99993	B;P;B	0.35272	0.322;0.493;0.275	B;B;B	0.28139	0.086;0.074;0.051	T	0.22208	-1.0223	10	0.12103	T	0.63	.	18.2145	0.89881	0.0:0.0:1.0:0.0	.	1181;1181;1226	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	T	1226;1226;1181;1181;1200	ENSP00000430497:S1226T;ENSP00000399605:S1181T;ENSP00000050961:S1181T;ENSP00000430848:S1200T	ENSP00000050961:S1181T	S	+	2	0	ZFHX4	77924334	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.459000	0.73513	2.593000	0.87608	0.650000	0.86243	AGT			0.408	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379197.2		NM_024721	
STK3	6788	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	99608285	99608285	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:99608285C>A	ENST00000419617.2	-	7	937	c.797G>T	c.(796-798)aGa>aTa	p.R266I	STK3_ENST00000521768.1_5'UTR|STK3_ENST00000523601.1_Missense_Mutation_p.R294I	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	266	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		TGCAGTAGCTCTCTGCTCAGG	0.428																																					p.R294I													.	.			0			c.G881T												72.0	70.0	70.0					8																	99608285		1896	4105	6001	SO:0001583	missense	6788	exon9			GTAGCTCTCTGCT	BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.797G>T	8.37:g.99608285C>A	ENSP00000390500:p.Arg266Ile		190	0	0		185	0.19	35	NM_001256312	33	0.06	2	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	ENST00000419617.2	37	CCDS47900.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604549	0.87157	.	.	ENSG00000104375	ENST00000419617;ENST00000523601;ENST00000518165	T;T;T	0.50277	0.91;0.91;0.75	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.83059	0.5172	H	0.99357	4.53	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	D;D;D	0.97110	0.985;1.0;1.0	D	0.90379	0.4386	10	0.87932	D	0	.	19.2729	0.94018	0.0:1.0:0.0:0.0	.	155;266;294	E5RFQ9;Q13188;B3KYA7	.;STK3_HUMAN;.	I	266;294;155	ENSP00000390500:R266I;ENSP00000429744:R294I;ENSP00000428014:R155I	ENSP00000390500:R266I	R	-	2	0	STK3	99677461	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.000000	0.70678	2.638000	0.89438	0.467000	0.42956	AGA			0.428	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379635.1		NM_006281	
TATDN1	83940	mdanderson.org	37	8	125499847	125499847	+	IGR	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr8:125499847G>T	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Missense_Mutation_p.G653C|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TCAGCACACAGGCGCAGCAGC	0.368																																					p.G653C													.	.			0			c.G1957T												71.0	66.0	68.0					8																	125499847		2203	4299	6502	SO:0001628	intergenic_variant	11236	exon2			CACACAGGCGCAG	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		8.37:g.125499847G>T			52	0	0		49	0.06	3	NM_007218	257	0.00	0	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528543	0.27299	.	.	ENSG00000170881	ENST00000303545	T	0.23754	1.89	5.55	5.55	0.83447	.	0.562593	0.19428	N	0.114511	T	0.20901	0.0503	N	0.14661	0.345	0.30266	N	0.792663	P	0.43412	0.806	B	0.41946	0.371	T	0.05225	-1.0898	10	0.54805	T	0.06	-3.191	18.0353	0.89301	0.0:0.0:1.0:0.0	.	653	Q8WU17	RN139_HUMAN	C	653	ENSP00000304051:G653C	ENSP00000304051:G653C	G	+	1	0	RNF139	125569028	1.000000	0.71417	0.957000	0.39632	0.944000	0.59088	4.411000	0.59781	2.769000	0.95229	0.491000	0.48974	GGC			0.368	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381655.1		NM_032026	
Unknown	0	bcgsc.ca	37	9	40500069	40500069	+	IGR	SNP	A	A	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr9:40500069A>T								AL353791.1 (467652 upstream) : RN7SL422P (16736 downstream)																							TTCAAACCCAACTTTTTTTTT	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AACCCAACTTTTT																													9.37:g.40500069A>T			137	0.0072992701	1		118	0.06	7	.	0		0		RNA	SNP		37																																																																																					0	0.353										
COL15A1	1306	broad.mit.edu	37	9	101797339	101797339	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr9:101797339A>G	ENST00000375001.3	+	18	2546	c.2123A>G	c.(2122-2124)aAg>aGg	p.K708R		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	708	Collagen-like 2.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CCGGGGAAAAAGGGACAAGCT	0.617																																					p.K708R													.	COL15A1	211		0			c.A2123G												48.0	48.0	48.0					9																	101797339		2202	4299	6501	SO:0001583	missense	1306	exon18			GGAAAAAGGGACA	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2123A>G	9.37:g.101797339A>G	ENSP00000364140:p.Lys708Arg		106	0.0094339623	1		104	0.04	4	NM_001855	62	0.00	0	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	A	8.041	0.763906	0.15914	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.93547	-3.24	5.69	4.53	0.55603	.	0.498001	0.19952	N	0.102410	T	0.80654	0.4664	N	0.01482	-0.84	0.19300	N	0.999977	B	0.14438	0.01	B	0.16722	0.016	T	0.68969	-0.5269	10	0.26408	T	0.33	-4.0721	9.8533	0.41070	0.8277:0.1723:0.0:0.0	.	708	P39059	COFA1_HUMAN	R	708;678	ENSP00000364140:K708R	ENSP00000364140:K708R	K	+	2	0	COL15A1	100837160	0.371000	0.25056	0.707000	0.30419	0.304000	0.27724	1.029000	0.30140	0.961000	0.38030	0.533000	0.62120	AAG			0.617	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053386.3		NM_001855	
GTF3C4	9329	mdanderson.org	37	9	135553575	135553575	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr9:135553575G>T	ENST00000372146.4	+	2	1133	c.569G>T	c.(568-570)cGc>cTc	p.R190L	GTF3C4_ENST00000483873.2_Intron	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	190					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		ATGGACAATCGCCTGACCATC	0.522																																					p.R190L	Pancreas(142;417 1875 11086 31973 47667)												.	.			0			c.G569T												86.0	82.0	83.0					9																	135553575		2203	4300	6503	SO:0001583	missense	9329	exon2			ACAATCGCCTGAC	AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.569G>T	9.37:g.135553575G>T	ENSP00000361219:p.Arg190Leu		61	0	0		54	0.06	3	NM_012204	53	0.00	0	Q5VZJ7	Missense_Mutation	SNP	ENST00000372146.4	37	CCDS6953.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418652	0.83559	.	.	ENSG00000125484	ENST00000372146	T	0.45668	0.89	5.72	5.72	0.89469	Transcription factor IIIC, 90kDa subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.54398	0.1856	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56878	-0.7906	10	0.72032	D	0.01	-31.2408	18.4551	0.90717	0.0:0.0:1.0:0.0	.	190	Q9UKN8	TF3C4_HUMAN	L	190	ENSP00000361219:R190L	ENSP00000361219:R190L	R	+	2	0	GTF3C4	134543396	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.238000	0.95380	2.709000	0.92574	0.561000	0.74099	CGC			0.522	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054792.1			
NDOR1	27158	mdanderson.org	37	9	140109564	140109564	+	Silent	SNP	G	G	A	rs145912724		TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chr9:140109564G>A	ENST00000344894.5	+	9	1166	c.1083G>A	c.(1081-1083)ccG>ccA	p.P361P	NDOR1_ENST00000371521.4_Silent_p.P361P|NDOR1_ENST00000427047.2_Silent_p.P327P|NDOR1_ENST00000458322.2_Silent_p.P361P	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		GTGACTTCCCGCACACAGCTG	0.662																																					p.P361P													.	.			0			c.G1083A							G	,,,	0,4404		0,0,2202	82.0	64.0	70.0		1083,981,1083,1083	-8.1	0.7	9	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NDOR1	NM_001144026.1,NM_001144027.1,NM_001144028.1,NM_014434.2	,,,	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	,,,	361/607,327/522,361/591,361/598	140109564	1,13003	2202	4300	6502	SO:0001819	synonymous_variant	27158	exon9			CTTCCCGCACACA	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1083G>A	9.37:g.140109564G>A			56	0	0		52	0.06	3	NM_001144026	89	0.00	0		Silent	SNP	ENST00000344894.5	37	CCDS7036.1																																																																																			0		0.662	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254704.1		NM_014434	
GPR64	10149	broad.mit.edu	37	X	19026144	19026144	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:19026144G>T	ENST00000379869.3	-	19	1683	c.1520C>A	c.(1519-1521)gCt>gAt	p.A507D	GPR64_ENST00000356606.4_Missense_Mutation_p.A493D|GPR64_ENST00000379876.1_Missense_Mutation_p.A483D|GPR64_ENST00000340581.3_Intron|GPR64_ENST00000357991.3_Missense_Mutation_p.A504D|GPR64_ENST00000379873.2_Missense_Mutation_p.A507D|GPR64_ENST00000360279.4_Missense_Mutation_p.A485D|GPR64_ENST00000354791.3_Missense_Mutation_p.A491D|GPR64_ENST00000379878.3_Missense_Mutation_p.A491D|GPR64_ENST00000357544.3_Missense_Mutation_p.A477D	NM_001079858.2|NM_005756.3	NP_001073327.1|NP_005747.2	Q8IZP9	GPR64_HUMAN	G protein-coupled receptor 64	507					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)|spermatogenesis (GO:0007283)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(18)|stomach(1)|urinary_tract(1)	42	Hepatocellular(33;0.183)					AACCCTGGAAGCTAGCTCCAT	0.433																																					p.A507D													.	GPR64	102		0			c.C1520A												85.0	74.0	78.0					X																	19026144		2203	4300	6503	SO:0001583	missense	10149	exon19			CTGGAAGCTAGCT	X81892	CCDS14191.1, CCDS43921.1, CCDS43922.1, CCDS43923.1, CCDS55376.1, CCDS55377.1, CCDS55378.1, CCDS55379.1	Xp22.13	2014-08-08			ENSG00000173698	ENSG00000173698		"""-"", ""GPCR / Class B : Orphans"""	4516	protein-coding gene	gene with protein product	"""epididymal protein 6"""	300572				9739419, 9150425	Standard	NM_005756		Approved	HE6, TM7LN2, EDDM6	uc004cyx.3	Q8IZP9	OTTHUMG00000021223	ENST00000379869.3:c.1520C>A	X.37:g.19026144G>T	ENSP00000369198:p.Ala507Asp		162	0	0		268	0.01	4	NM_001184834	11	0.00	0	B1AWB3|B1AWB4|B1AWB6|B1AWB7|O00406|Q14CE0|Q8IWT2|Q8IZE4|Q8IZE5|Q8IZE6|Q8IZE7|Q8IZP3|Q8IZP4	Missense_Mutation	SNP	ENST00000379869.3	37	CCDS43923.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199862	0.79015	.	.	ENSG00000173698	ENST00000379873;ENST00000379878;ENST00000354791;ENST00000379876;ENST00000357544;ENST00000379869;ENST00000360279;ENST00000357991;ENST00000356606	T;T;T;T;T;T;T;T;T	0.35236	1.32;1.43;1.43;1.44;1.44;1.47;1.44;1.47;1.47	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000025	T	0.62563	0.2438	M	0.69823	2.125	0.54753	D	0.999985	P;D;D;D;D;D;D;D;D;D	0.89917	0.729;1.0;0.997;0.997;1.0;1.0;1.0;1.0;0.994;1.0	B;D;D;D;D;D;D;D;D;D	0.87578	0.437;0.997;0.963;0.963;0.998;0.998;0.997;0.997;0.92;0.996	T	0.64807	-0.6320	10	0.87932	D	0	.	19.1445	0.93459	0.0:0.0:1.0:0.0	.	469;477;483;491;507;485;493;504;507;491	Q8IZP9-8;Q8IZP9-7;Q8IZP9-5;Q8IZP9-3;Q8IZP9-9;Q8IZP9-6;Q8IZP9-4;Q8IZP9-2;Q8IZP9;Q14CE1	.;.;.;.;.;.;.;.;GPR64_HUMAN;.	D	507;491;491;483;477;507;485;504;493	ENSP00000369202:A507D;ENSP00000369207:A491D;ENSP00000346845:A491D;ENSP00000369205:A483D;ENSP00000350152:A477D;ENSP00000369198:A507D;ENSP00000353421:A485D;ENSP00000350680:A504D;ENSP00000349015:A493D	ENSP00000346845:A491D	A	-	2	0	GPR64	18936065	1.000000	0.71417	0.994000	0.49952	0.864000	0.49448	4.682000	0.61671	2.471000	0.83476	0.600000	0.82982	GCT			0.433	GPR64-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000055970.2			
EIF1AX	1964	broad.mit.edu	37	X	20148690	20148690	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:20148690C>A	ENST00000379607.5	-	6	576	c.373G>T	c.(373-375)Gat>Tat	p.D125Y	EIF1AX_ENST00000379593.1_Missense_Mutation_p.D97Y	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	125					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						TCATCATCATCTCCAGGACCA	0.323																																					p.D125Y													.	EIF1AX	21		0			c.G373T												169.0	135.0	147.0					X																	20148690		2203	4297	6500	SO:0001583	missense	1964	exon6			CATCATCTCCAGG	L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.373G>T	X.37:g.20148690C>A	ENSP00000368927:p.Asp125Tyr		282	0	0		462	0.02	7	NM_001412	276	0.01	4	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	ENST00000379607.5	37	CCDS14196.1	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458351	0.63401	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.47177	0.85;0.85	4.82	4.82	0.62117	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.66458	0.2791	M	0.64170	1.965	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.69030	-0.5253	9	0.52906	T	0.07	-17.661	17.1436	0.86760	0.0:1.0:0.0:0.0	.	125	P47813	IF1AX_HUMAN	Y	125;97	ENSP00000368927:D125Y;ENSP00000368912:D97Y	ENSP00000368912:D97Y	D	-	1	0	EIF1AX	20058611	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.087000	0.76893	1.967000	0.57214	0.594000	0.82650	GAT			0.323	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058913.1			
TSPAN7	7102	bcgsc.ca	37	X	37402545	37402545	+	Intron	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:37402545G>T	ENST00000465127.1	+	3	278																				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						GGAGGCTCTGGGCAGAGACTG	0.632																																					.													.	.			0			.																																									SO:0001627	intron_variant	139249	.			GCTCTGGGCAGAG																												ENST00000465127.1:c.171+117292G>T	X.37:g.37402545G>T			24	0	0		32	0.44	14	.	0		0		RNA	SNP	ENST00000465127.1	37																																																																																						0.632	TM4SF2-001	PUTATIVE	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000363378.1			
WDR45	11152	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	48935722	48935722	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:48935722G>C	ENST00000376372.3	-	2	214	c.33C>G	c.(31-33)agC>agG	p.S11R	WDR45_ENST00000465431.1_5'UTR|WDR45_ENST00000376368.2_Missense_Mutation_p.S11R|WDR45_ENST00000322995.8_Missense_Mutation_p.S11R|WDR45_ENST00000473974.1_Missense_Mutation_p.S11R|WDR45_ENST00000485908.1_Missense_Mutation_p.S11R|AF196779.12_ENST00000376358.3_Missense_Mutation_p.S11R|WDR45_ENST00000553851.1_Missense_Mutation_p.S11R|WDR45_ENST00000396681.4_Missense_Mutation_p.S11R|WDR45_ENST00000356463.3_Missense_Mutation_p.S11R	NM_001029896.1	NP_001025067.1	Q9Y484	WIPI4_HUMAN	WD repeat domain 45	11					autophagy (GO:0006914)|cell death (GO:0008219)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	19						TGAAACGCAGGCTGGTCACTC	0.537																																					p.S11R													.	.			0			c.C33G												141.0	99.0	113.0					X																	48935722		2203	4300	6503	SO:0001583	missense	11152	exon3			ACGCAGGCTGGTC	BC003037	CCDS14318.1, CCDS35250.1	Xp11.23	2013-06-06	2004-09-02	2004-09-03	ENSG00000196998	ENSG00000196998		"""WD repeat domain containing"""	28912	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 5"""	300526	"""WD repeat domain, X-linked 1"""	WDRX1		12477932	Standard	NM_007075		Approved	JM5, WIPI4, NBIA5	uc004dmk.1	Q9Y484	OTTHUMG00000034500	ENST00000376372.3:c.33C>G	X.37:g.48935722G>C	ENSP00000365551:p.Ser11Arg		69	0	0		93	0.08	7	NM_007075	110	0.02	2	A6NGH5|B7WPI2|Q5MNZ5|Q6IBS7|Q6NT94|Q96H03	Missense_Mutation	SNP	ENST00000376372.3	37	CCDS35250.1	.	.	.	.	.	.	.	.	.	.	G	12.80	2.046870	0.36085	.	.	ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000196998;ENSG00000250232	ENST00000553851;ENST00000376372;ENST00000322995;ENST00000356463;ENST00000485908;ENST00000473974;ENST00000376368;ENST00000396681;ENST00000471338;ENST00000475880;ENST00000474053;ENST00000419567;ENST00000476728;ENST00000465382;ENST00000423215;ENST00000376358	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.57436	2.13;0.9;0.9;0.9;0.52;0.9;0.9;0.9;0.9;0.4;0.9;0.9;0.52;0.9;1.38;2.13	4.04	2.18	0.27775	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.110748	0.64402	D	0.000011	T	0.58935	0.2157	L	0.46157	1.445	0.24768	N	0.992881	P;D;P;P;P;P;B	0.61697	0.955;0.99;0.907;0.842;0.681;0.677;0.014	P;D;B;P;P;P;B	0.66497	0.702;0.944;0.372;0.452;0.503;0.452;0.097	T	0.50162	-0.8860	10	0.87932	D	0	-16.6748	7.3314	0.26584	0.2364:0.0:0.7636:0.0	.	11;11;11;11;11;11;11	B4DVH6;A6NM71;C9J471;Q9Y484-2;C9JYH8;Q9Y484-3;Q9Y484	.;.;.;.;.;.;WIPI4_HUMAN	R	11	ENSP00000451962:S11R;ENSP00000365551:S11R;ENSP00000365543:S11R;ENSP00000348848:S11R;ENSP00000419897:S11R;ENSP00000417211:S11R;ENSP00000365546:S11R;ENSP00000379913:S11R;ENSP00000418466:S11R;ENSP00000418919:S11R;ENSP00000420728:S11R;ENSP00000393640:S11R;ENSP00000419324:S11R;ENSP00000420534:S11R;ENSP00000397657:S11R;ENSP00000365536:S11R	ENSP00000365536:S11R	S	-	3	2	AF196779.12;WDR45	48822666	1.000000	0.71417	0.990000	0.47175	0.986000	0.74619	1.048000	0.30379	0.270000	0.21984	0.468000	0.43344	AGC			0.537	WDR45-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000083418.2		NM_007075	
SPIN3	169981	broad.mit.edu	37	X	57020933	57020933	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:57020933T>C	ENST00000374919.3	-	2	770	c.448A>G	c.(448-450)Atg>Gtg	p.M150V		NM_001010862.2	NP_001010862.2	Q5JUX0	SPIN3_HUMAN	spindlin family, member 3	150					gamete generation (GO:0007276)					central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)	4						GCTAAGACCATCCCCCTCCAT	0.383																																					p.M150V													.	SPIN3	33		0			c.A448G												131.0	128.0	129.0					X																	57020933		2157	4261	6418	SO:0001583	missense	169981	exon2			AGACCATCCCCCT	AL832091	CCDS43963.1	Xp11.22	2008-02-05			ENSG00000204271	ENSG00000204271			27272	protein-coding gene	gene with protein product							Standard	NM_001010862		Approved		uc004dux.1	Q5JUX0	OTTHUMG00000021677	ENST00000374919.3:c.448A>G	X.37:g.57020933T>C	ENSP00000364054:p.Met150Val		94	0.0212765957	2		211	0.03	7	NM_001010862	3	0.00	0	B2RUW3|B7Z8W2|Q8N5D9	Missense_Mutation	SNP	ENST00000374919.3	37	CCDS43963.1	.	.	.	.	.	.	.	.	.	.	T	12.01	1.808669	0.31961	.	.	ENSG00000204271	ENST00000374919	T	0.45276	0.9	2.45	2.45	0.29901	.	0.000000	0.64402	U	0.000001	T	0.34250	0.0891	L	0.41573	1.285	0.34752	D	0.731888	P	0.42375	0.778	P	0.45276	0.475	T	0.40831	-0.9542	10	0.25106	T	0.35	-4.9335	8.0376	0.30502	0.0:0.0:0.0:1.0	.	150	Q5JUX0	SPIN3_HUMAN	V	150	ENSP00000364054:M150V	ENSP00000364054:M150V	M	-	1	0	SPIN3	57037658	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	4.662000	0.61525	1.229000	0.43630	0.486000	0.48141	ATG			0.383	SPIN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056908.1		XM_093024	
HMGB3	3149	mdanderson.org	37	X	150156378	150156378	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGA-01A-11D-A42Y-10	TCGA-2G-AAGA-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	9df6892b-86ee-426c-9e0b-583e6831cc56	f5daa72a-daaa-4cf0-bdc9-fde932b3440e	g.chrX:150156378G>T	ENST00000325307.7	+	5	690	c.594G>T	c.(592-594)gaG>gaT	p.E198D	HMGB3_ENST00000448905.2_Missense_Mutation_p.E198D	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	198	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaggaggaggaTGAATAAA	0.463																																					p.E198D													.	.			0			c.G594T												49.0	48.0	49.0					X																	150156378		2203	4299	6502	SO:0001583	missense	3149	exon5			GGAGGAGGATGAA	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.594G>T	X.37:g.150156378G>T	ENSP00000359393:p.Glu198Asp		10	0	0		19	0.11	2	NM_005342	163	0.00	0	O95556|Q6NS40	Missense_Mutation	SNP	ENST00000325307.7	37	CCDS35428.1	.	.	.	.	.	.	.	.	.	.	g	0.347	-0.947364	0.02304	.	.	ENSG00000029993	ENST00000325307;ENST00000448905	T;T	0.35048	1.33;1.33	4.84	-6.29	0.02013	.	0.320496	0.22526	N	0.058902	T	0.10208	0.0250	N	0.08118	0	0.20764	N	0.999851	B	0.02656	0.0	B	0.01281	0.0	T	0.15636	-1.0430	9	.	.	.	.	0.6043	0.00750	0.3103:0.1878:0.1198:0.3821	.	198	O15347	HMGB3_HUMAN	D	198	ENSP00000359393:E198D;ENSP00000442758:E198D	.	E	+	3	2	HMGB3	149907036	0.210000	0.23517	0.059000	0.19551	0.160000	0.22226	0.068000	0.14531	-1.155000	0.02822	0.600000	0.82982	GAG			0.463	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060867.1		NM_005342	
