#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MMP23B	8510	hgsc.bcm.edu	37	1	1569784	1569784	+	Intron	SNP	C	C	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:1569784C>G	ENST00000356026.5	+	8	1122				MMP23B_ENST00000378675.3_Intron			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	GGGCAGGCAGCGGGGGGGGCT	0.731																																					.													.	.			0			.												3.0	3.0	3.0					1																	1569784		908	2382	3290	SO:0001627	intron_variant	8511	.			AGGCAGCGGGGGG		CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713	ENST00000356026.5:c.999-43C>G	1.37:g.1569784C>G			52	0	0		62	0.06	4	.	0		0	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	RNA	SNP	ENST00000356026.5	37	CCDS30559.1																																																																																					0.731	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000158492.2		NM_006983	
NBPF1	55672	broad.mit.edu;mdanderson.org	37	1	16890591	16890591	+	Silent	SNP	T	T	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:16890591T>C	ENST00000430580.2	-	29	4154	c.3267A>G	c.(3265-3267)gaA>gaG	p.E1089E		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1069	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AGTCAGGTAGTTCAAAGTACA	0.463																																					.													.	.			0			.												598.0	509.0	539.0					1																	16890591		2203	4294	6497	SO:0001819	synonymous_variant	55672	.			AGGTAGTTCAAAG	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3267A>G	1.37:g.16890591T>C			752	0.0013297872	1		1011	0.02	19	.	85	0.00	0	Q8N4E8|Q9C0H0	Silent	SNP	ENST00000430580.2	37																																																																																						0.463	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000106436.3		NM_017940	
Unknown	0	bcgsc.ca	37	1	17077186	17077186	+	IGR	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:17077186G>A								RNU1-4 (10012 upstream) : MST1L (4218 downstream)																							GCACAGCCAAGACCTGGAGAG	0.687																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100421113	.			AGCCAAGACCTGG																													1.37:g.17077186G>A			92	0	0		119	0.08	9	.	0		0		RNA	SNP		37																																																																																					0	0.687										
FNBP1L	54874	broad.mit.edu;ucsc.edu;mdanderson.org	37	1	93996313	93996313	+	Splice_Site	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:93996313C>T	ENST00000271234.7	+	7	663	c.512C>T	c.(511-513)gCc>gTc	p.A171V	FNBP1L_ENST00000370256.4_Splice_Site_p.A171V|FNBP1L_ENST00000260506.8_Splice_Site_p.A171V|FNBP1L_ENST00000604705.1_Splice_Site_p.A171V|FNBP1L_ENST00000370253.2_Splice_Site_p.A171V	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	171	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		TGCCCCTAGGCCAAACAGCAG	0.318																																					p.A171V													.	FNBP1L	56		0			c.C512T												33.0	31.0	32.0					1																	93996313		1826	4092	5918	SO:0001630	splice_region_variant	54874	exon7			CCTAGGCCAAACA		CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.511-1C>T	1.37:g.93996313C>T			591	0.0016920474	1		871	0.11	97	NM_001164473	140	0.29	40	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Splice_Site	SNP	ENST00000271234.7	37	CCDS53343.1	.	.	.	.	.	.	.	.	.	.	C	17.81	3.480139	0.63849	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253;ENST00000424449	T;T;T;T	0.18810	2.19;2.19;2.19;2.19	5.07	5.07	0.68467	.	0.097197	0.64402	D	0.000001	T	0.12008	0.0292	L	0.51422	1.61	0.80722	D	1	B;P	0.44380	0.2;0.834	B;B	0.38020	0.026;0.263	T	0.06698	-1.0812	10	0.22706	T	0.39	-15.4086	18.7964	0.91995	0.0:1.0:0.0:0.0	.	171;171	Q5T0N5-4;Q5T0N5-3	.;.	V	171;171;171;171;38	ENSP00000359278:A171V;ENSP00000271234:A171V;ENSP00000260506:A171V;ENSP00000359275:A171V	ENSP00000260506:A171V	A	+	2	0	FNBP1L	93768901	1.000000	0.71417	0.993000	0.49108	0.660000	0.38997	7.487000	0.81328	2.527000	0.85204	0.655000	0.94253	GCC			0.318	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding				NM_017737	Missense_Mutation
NAV1	89796	hgsc.bcm.edu	37	1	201786261	201786261	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:201786261C>T	ENST00000367296.4	+	29	5806	c.5386C>T	c.(5386-5388)Cgg>Tgg	p.R1796W	NAV1_ENST00000295624.6_Missense_Mutation_p.R1793W|IPO9-AS1_ENST00000421449.1_RNA|NAV1_ENST00000367297.4_Missense_Mutation_p.R1788W|NAV1_ENST00000367300.3_Missense_Mutation_p.R1736W|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000367302.1_Missense_Mutation_p.R1749W|NAV1_ENST00000367295.1_Missense_Mutation_p.R1402W	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	1796					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GGAATGGGTCCGGGACACACT	0.547																																					p.R1796W													.	.			0			c.C5386T												82.0	74.0	77.0					1																	201786261		2203	4300	6503	SO:0001583	missense	89796	exon29			TGGGTCCGGGACA	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.5386C>T	1.37:g.201786261C>T	ENSP00000356265:p.Arg1796Trp		84	0	0		96	0.04	4	NM_020443	61	0.00	0	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	37	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423876	0.83667	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000367295;ENST00000367301	T;T;T;T;T;T	0.07567	3.21;3.18;3.18;3.18;3.21;3.19	5.56	5.56	0.83823	.	0.063686	0.64402	D	0.000018	T	0.26159	0.0638	M	0.64997	1.995	0.52099	D	0.999942	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00125	-1.2022	10	0.66056	D	0.02	-24.6543	14.0372	0.64651	0.1511:0.8489:0.0:0.0	.	1402;1793	Q8NEY1-5;Q8NEY1-3	.;.	W	1749;1796;1793;1788;1736;1402;206	ENSP00000356271:R1749W;ENSP00000356265:R1796W;ENSP00000295624:R1793W;ENSP00000356266:R1788W;ENSP00000356269:R1736W;ENSP00000356264:R1402W	ENSP00000295624:R1793W	R	+	1	2	NAV1	200052884	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.507000	0.45442	2.618000	0.88619	0.650000	0.86243	CGG			0.547	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000087013.1		NM_020443	
TRIM11	81559	ucsc.edu	37	1	228582736	228582736	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr1:228582736G>T	ENST00000284551.6	-	6	1355	c.1077C>A	c.(1075-1077)tgC>tgA	p.C359*	TRIM11_ENST00000493030.2_Nonsense_Mutation_p.C234*|RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000460651.1_5'UTR	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11	359	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CGTTCTCCCTGCACACCCCCA	0.662																																					p.C359X													.	TRIM11	38		0			c.C1077A												77.0	74.0	75.0					1																	228582736		2203	4300	6503	SO:0001587	stop_gained	81559	exon6			CTCCCTGCACACC	AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.1077C>A	1.37:g.228582736G>T	ENSP00000284551:p.Cys359*		45	0	0		42	0.10	4	NM_145214	113	0.00	0	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	Nonsense_Mutation	SNP	ENST00000284551.6	37	CCDS31048.1	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208819	0.58343	.	.	ENSG00000154370	ENST00000284551	.	.	.	5.17	-0.707	0.11245	.	0.000000	0.56097	D	0.000034	.	.	.	.	.	.	0.43667	D	0.996099	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.0303	0.36254	0.4793:0.0:0.5207:0.0	.	.	.	.	X	359	.	ENSP00000284551:C359X	C	-	3	2	TRIM11	226649359	0.051000	0.20477	0.445000	0.26908	0.028000	0.11728	0.186000	0.16978	0.028000	0.15324	-0.136000	0.14681	TGC			0.662	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095995.3		NM_145214	
PRR26	414235	mdanderson.org	37	10	696311	696311	+	Missense_Mutation	SNP	C	C	T	rs187635206		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:696311C>T	ENST00000441152.2	+	2	312	c.149C>T	c.(148-150)aCg>aTg	p.T50M	DIP2C_ENST00000280886.6_Intron|PRR26_ENST00000381489.5_Silent_p.N87N			Q8N8Z3	PRR26_HUMAN	proline rich 26	50																	CTGTGGATAACGCCAGCCCAC	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		16878	0.0		0.001	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001583	missense	414235	.			GGATAACGCCAGC	AK096000		10p15.3	2012-12-03	2012-12-03	2012-12-03	ENSG00000180525	ENSG00000180525			30724	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 108"""	C10orf108			Standard	NR_027151		Approved	FLJ38681	uc001ifr.3	Q8N8Z3	OTTHUMG00000017529	ENST00000441152.2:c.149C>T	10.37:g.696311C>T	ENSP00000414034:p.Thr50Met		43	0	0		51	0.08	4	.	1	0.00	0		RNA	SNP	ENST00000441152.2	37		1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	-	0.057	-1.232732	0.01505	.	.	ENSG00000180525	ENST00000441152	.	.	.	0.469	-0.938	0.10412	.	.	.	.	.	T	0.26593	0.0650	.	.	.	0.09310	N	1	B	0.24576	0.106	B	0.06405	0.002	T	0.20240	-1.0281	6	0.87932	D	0	.	.	.	.	.	50	B4DJP4	.	M	50	.	ENSP00000414034:T50M	T	+	2	0	C10orf108	686311	0.001000	0.12720	0.000000	0.03702	0.008000	0.06430	-0.684000	0.05173	-0.250000	0.09555	-1.674000	0.00743	ACG	0		0.622	PRR26-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000046386.1			
SKIDA1	387640	broad.mit.edu;mdanderson.org	37	10	21806056	21806056	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:21806056G>A	ENST00000449193.2	-	4	2948	c.696C>T	c.(694-696)gcC>gcT	p.A232A	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Intron	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	232	Ala-rich.			Missing (in Ref. 2; BAD18601). {ECO:0000305}.		nucleus (GO:0005634)											cggcagcagcggcggcggcgg	0.766																																					p.A232A													.	.			0			c.C696T												1.0	1.0	1.0					10																	21806056		64	241	305	SO:0001819	synonymous_variant	387640	exon4			AGCAGCGGCGGCG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.696C>T	10.37:g.21806056G>A			23	0	0		16	0.25	4	NM_207371	0		0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																					0.766	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
KIAA1217	56243	hgsc.bcm.edu;mdanderson.org	37	10	24810770	24810770	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:24810770G>T	ENST00000376454.3	+	12	2398	c.2368G>T	c.(2368-2370)Gtg>Ttg	p.V790L	KIAA1217_ENST00000376451.2_Missense_Mutation_p.V473L|KIAA1217_ENST00000307544.6_Missense_Mutation_p.V473L|KIAA1217_ENST00000396445.1_Missense_Mutation_p.V473L|KIAA1217_ENST00000376462.1_Missense_Mutation_p.V710L|KIAA1217_ENST00000458595.1_Missense_Mutation_p.V755L|KIAA1217_ENST00000430453.2_Intron|KIAA1217_ENST00000396446.1_Missense_Mutation_p.V473L|KIAA1217_ENST00000376452.3_Missense_Mutation_p.V755L	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	790					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)		p.V790M(1)		breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AGTGGAGGCCGTGCGGTTTCT	0.567																																					p.V790L													KIAA1217,colon,carcinoma,0,1	KIAA1217	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G2368T												79.0	77.0	78.0					10																	24810770		2203	4300	6503	SO:0001583	missense	56243	exon12			GAGGCCGTGCGGT	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2368G>T	10.37:g.24810770G>T	ENSP00000365637:p.Val790Leu		48	0	0		58	0.05	3	NM_019590	3	0.00	0	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	G	32	5.115367	0.94339	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.57907	0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37;0.37	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.79693	2.465	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D;D	0.91635	0.997;0.997;0.997;0.999;0.999;0.997;0.995;0.997	T	0.77787	-0.2457	10	0.87932	D	0	.	20.3802	0.98930	0.0:0.0:1.0:0.0	.	755;755;473;473;473;473;790;790	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	L	710;755;755;473;790;755;605;473;473;473;473;473	ENSP00000365645:V710L;ENSP00000365639:V755L;ENSP00000392625:V755L;ENSP00000365637:V790L;ENSP00000365635:V755L;ENSP00000404798:V605L;ENSP00000302343:V473L;ENSP00000379722:V473L;ENSP00000365634:V473L;ENSP00000379723:V473L	ENSP00000302343:V473L	V	+	1	0	KIAA1217	24850776	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.062000	0.89475	2.822000	0.97130	0.563000	0.77884	GTG			0.567	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047223.2		NM_019590	
ANK3	288	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	61844468	61844468	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:61844468A>T	ENST00000280772.2	-	32	4157	c.3966T>A	c.(3964-3966)gaT>gaA	p.D1322E	ANK3_ENST00000503366.1_Missense_Mutation_p.D1323E|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000355288.2_Missense_Mutation_p.D456E|ANK3_ENST00000373827.2_Missense_Mutation_p.D1316E	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1322	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ATTCTACGGGATCATTCATTT	0.393																																					p.D1323E													.	.			0			c.T3969A												133.0	126.0	128.0					10																	61844468		2203	4300	6503	SO:0001583	missense	288	exon33			TACGGGATCATTC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.3966T>A	10.37:g.61844468A>T	ENSP00000280772:p.Asp1322Glu		135	0	0		176	0.13	23	NM_001204404	24	0.38	9	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	37	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	18.56	3.650751	0.67472	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789;ENST00000536348	T;T;T;T	0.29142	1.58;1.58;1.58;1.58	6.04	2.46	0.29980	.	0.184955	0.26546	N	0.023775	T	0.43144	0.1234	L	0.52905	1.665	0.80722	D	1	D;D;D;D;B;P;B	0.71674	0.989;0.997;0.995;0.998;0.032;0.92;0.018	P;P;D;P;B;P;B	0.75020	0.766;0.817;0.985;0.846;0.023;0.754;0.009	T	0.23797	-1.0178	10	0.66056	D	0.02	.	5.012	0.14317	0.6499:0.0:0.2235:0.1266	.	1323;456;855;1316;1322;557;456	E9PE32;A8KA62;Q59G01;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;.;ANK3_HUMAN;.;.	E	1322;1316;456;456;1323;1302;557;957;957;455;855	ENSP00000280772:D1322E;ENSP00000362933:D1316E;ENSP00000347436:D456E;ENSP00000425236:D1323E	ENSP00000280772:D1322E	D	-	3	2	ANK3	61514474	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.798000	0.27014	0.174000	0.19809	0.459000	0.35465	GAT			0.393	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000048201.4		NM_020987	
TET1	80312	bcgsc.ca	37	10	70332383	70332383	+	Silent	SNP	C	C	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:70332383C>G	ENST00000373644.4	+	2	497	c.288C>G	c.(286-288)tcC>tcG	p.S96S		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	96					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						ACCCAGAGTCCTTAACCTGCA	0.512																																					p.S96S													.	TET1	255		0			c.C288G												56.0	56.0	56.0					10																	70332383		2203	4300	6503	SO:0001819	synonymous_variant	80312	exon2			AGAGTCCTTAACC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.288C>G	10.37:g.70332383C>G			104	0	0		148	0.00	0	NM_030625	17	0.00	0	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	ENST00000373644.4	37	CCDS7281.1																																																																																					0.512	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
GRID1	2894	broad.mit.edu;mdanderson.org	37	10	87373227	87373227	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:87373227G>T	ENST00000327946.7	-	15	2623	c.2538C>A	c.(2536-2538)tgC>tgA	p.C846*	GRID1_ENST00000552278.2_5'Flank|GRID1_ENST00000536331.1_Nonsense_Mutation_p.C417*	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	846					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						CAGCCACCAGGCAGGCCAGGA	0.662										Multiple Myeloma(13;0.14)																											p.C846X													.	GRID1	204		0			c.C2538A												40.0	44.0	43.0					10																	87373227		2203	4300	6503	SO:0001587	stop_gained	2894	exon15			CACCAGGCAGGCC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2538C>A	10.37:g.87373227G>T	ENSP00000330148:p.Cys846*		135	0.0074074074	1		121	0.08	10	NM_017551	1	0.00	0	B3KXD5|B7Z7L0|Q8IXT3	Nonsense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	40	8.026984	0.98616	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	.	.	.	5.39	5.39	0.77823	.	0.329025	0.37261	N	0.002170	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5933	0.50957	0.0812:0.0:0.9188:0.0	.	.	.	.	X	846;417	.	ENSP00000330148:C846X	C	-	3	2	GRID1	87363207	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.274000	0.51631	2.531000	0.85337	0.650000	0.86243	TGC			0.662	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049148.3		XM_043613	
STAMBPL1	57559	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	90672864	90672864	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:90672864T>C	ENST00000371926.3	+	6	1385	c.427T>C	c.(427-429)Tat>Cat	p.Y143H	STAMBPL1_ENST00000371924.1_Missense_Mutation_p.Y143H|STAMBPL1_ENST00000371922.1_5'UTR|STAMBPL1_ENST00000371927.3_Missense_Mutation_p.Y143H	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	143						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		TTAGAACAAATATAAAGCTGA	0.413																																					p.Y143H													.	.			0			c.T427C												66.0	77.0	73.0					10																	90672864		2203	4299	6502	SO:0001583	missense	57559	exon6			AACAAATATAAAG	AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.427T>C	10.37:g.90672864T>C	ENSP00000360994:p.Tyr143His		38	0	0		51	0.12	6	NM_020799	19	0.00	0	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	ENST00000371926.3	37	CCDS7391.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613028	0.28712	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.21932	1.99;1.98;1.99	5.98	4.85	0.62838	.	0.335916	0.29579	N	0.011746	T	0.11324	0.0276	N	0.22421	0.69	0.80722	D	1	P;P	0.41748	0.56;0.761	B;B	0.31751	0.095;0.135	T	0.14172	-1.0482	10	0.28530	T	0.3	-3.6019	9.5956	0.39571	0.0:0.0798:0.0:0.9202	.	143;143	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	H	143	ENSP00000360994:Y143H;ENSP00000360995:Y143H;ENSP00000360992:Y143H	ENSP00000360992:Y143H	Y	+	1	0	STAMBPL1	90662844	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	1.393000	0.34497	1.076000	0.40961	0.533000	0.62120	TAT			0.413	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049283.1		NM_020799	
MMS19	64210	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	99218609	99218609	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:99218609C>T	ENST00000438925.2	-	30	3348	c.3013G>A	c.(3013-3015)Gat>Aat	p.D1005N	MMS19_ENST00000327277.7_3'UTR|MMS19_ENST00000327238.10_Missense_Mutation_p.D907N|MMS19_ENST00000355839.6_Missense_Mutation_p.D962N|MMS19_ENST00000370782.2_Missense_Mutation_p.D1005N	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	1005					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		TTCTTGTCATCCAGGGGTTTG	0.532								Direct reversal of damage																													p.D1005N													.	.			0			c.G3013A												124.0	95.0	105.0					10																	99218609		2203	4300	6503	SO:0001583	missense	64210	exon30			TGTCATCCAGGGG	AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.3013G>A	10.37:g.99218609C>T	ENSP00000412698:p.Asp1005Asn		150	0	0		206	0.11	22	NM_022362	488	0.20	100	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Missense_Mutation	SNP	ENST00000438925.2	37	CCDS7464.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.147874|5.147874	0.94603|0.94603	.|.	.|.	ENSG00000155229|ENSG00000155229	ENST00000438925;ENST00000370782;ENST00000327238;ENST00000422291;ENST00000355839|ENST00000444411;ENST00000434538	T;T;T;T|.	0.67865|.	-0.1;-0.1;-0.29;-0.1|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.83986|.	0.5373|.	M|M	0.86420|0.86420	2.815|2.815	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;0.999;1.0|.	D;D;D;D;D|.	0.91635|.	0.983;0.999;0.999;0.961;0.983|.	D|.	0.85197|.	0.1013|.	10|.	0.48119|.	T|.	0.1|.	.|.	19.7572|19.7572	0.96298|0.96298	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1026;907;962;1005;962|.	B4DQX2;Q96T76-5;F8W9Y2;Q96T76;B4E2I3|.	.;.;.;MMS19_HUMAN;.|.	N|X	1005;1005;907;984;962|64;572	ENSP00000412698:D1005N;ENSP00000359818:D1005N;ENSP00000320059:D907N;ENSP00000348097:D962N|.	ENSP00000320059:D907N|.	D|W	-|-	1|3	0|0	MMS19|MMS19	99208599|99208599	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.987000|0.987000	0.75469|0.75469	5.439000|5.439000	0.66556|0.66556	2.667000|2.667000	0.90743|0.90743	0.650000|0.650000	0.86243|0.86243	GAT|TGG			0.532	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049706.2			
SEC31B	25956	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	10	102250017	102250017	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr10:102250017G>A	ENST00000370345.3	-	21	2810	c.2713C>T	c.(2713-2715)Cct>Tct	p.P905S		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	905	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CATGTCCCAGGGAATCCCACC	0.542																																					p.P905S													.	.			0			c.C2713T												90.0	76.0	81.0					10																	102250017		2203	4300	6503	SO:0001583	missense	25956	exon21			TCCCAGGGAATCC	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2713C>T	10.37:g.102250017G>A	ENSP00000359370:p.Pro905Ser		137	0	0		177	0.10	18	NM_015490	11	0.09	1	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Missense_Mutation	SNP	ENST00000370345.3	37	CCDS7495.1	.	.	.	.	.	.	.	.	.	.	G	13.43	2.234124	0.39498	.	.	ENSG00000075826	ENST00000370345	T	0.56275	0.47	5.75	3.83	0.44106	.	0.363651	0.34802	N	0.003669	T	0.45236	0.1332	M	0.66939	2.045	0.80722	D	1	B;B	0.28636	0.218;0.013	B;B	0.22386	0.039;0.007	T	0.35101	-0.9802	10	0.38643	T	0.18	-0.0345	6.507	0.22200	0.0931:0.0:0.7274:0.1794	.	904;905	Q9NQW1-5;Q9NQW1	.;SC31B_HUMAN	S	905	ENSP00000359370:P905S	ENSP00000359370:P905S	P	-	1	0	SEC31B	102240007	0.998000	0.40836	0.286000	0.24833	0.917000	0.54804	1.025000	0.30090	0.707000	0.31934	0.561000	0.74099	CCT			0.542	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051198.1		NM_015490	
RASSF7	8045	mdanderson.org	37	11	562658	562658	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:562658C>A	ENST00000397583.3	+	3	1137	c.704C>A	c.(703-705)gCa>gAa	p.A235E	RP11-496I9.1_ENST00000527113.1_RNA|RASSF7_ENST00000431809.1_Missense_Mutation_p.A235E|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397582.3_Missense_Mutation_p.A235E|RASSF7_ENST00000454668.2_Missense_Mutation_p.A235E|RASSF7_ENST00000344375.4_Missense_Mutation_p.A235E|C11orf35_ENST00000329451.3_5'Flank	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7	235	Pro-rich.				apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TCACCTATGGCATCTGCCACT	0.721																																					p.A235E	Pancreas(184;1170 3913 7268)												.	.			0			c.C704A												3.0	4.0	4.0					11																	562658		1894	3731	5625	SO:0001583	missense	8045	exon3			CTATGGCATCTGC	M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.704C>A	11.37:g.562658C>A	ENSP00000380713:p.Ala235Glu		14	0	0		19	0.16	3	NM_001143994	42	0.00	0	G5E9N9|Q3KP41|Q3KP42	Missense_Mutation	SNP	ENST00000397583.3	37	CCDS7702.1	.	.	.	.	.	.	.	.	.	.	C	4.193	0.034488	0.08101	.	.	ENSG00000099849	ENST00000431809;ENST00000397582;ENST00000344375;ENST00000397583;ENST00000454668	D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13	3.52	1.48	0.22813	.	0.551023	0.17343	N	0.177662	T	0.80954	0.4723	N	0.21142	0.635	0.09310	N	1	B;B;P	0.35982	0.378;0.396;0.531	B;B;B	0.35510	0.204;0.142;0.204	T	0.71417	-0.4599	10	0.05351	T	0.99	10.0124	7.4308	0.27126	0.0:0.6142:0.2667:0.1192	.	235;235;235	G5E9N9;Q02833;Q02833-2	.;RASF7_HUMAN;.	E	235	ENSP00000403068:A235E;ENSP00000380712:A235E;ENSP00000344226:A235E;ENSP00000380713:A235E;ENSP00000405606:A235E	ENSP00000344226:A235E	A	+	2	0	RASSF7	552658	0.000000	0.05858	0.002000	0.10522	0.210000	0.24377	-0.216000	0.09266	0.706000	0.31912	0.462000	0.41574	GCA			0.721	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254972.2		NM_003475	
CDHR5	53841	broad.mit.edu	37	11	617401	617401	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:617401T>C	ENST00000358353.3	-	16	2810	c.2488A>G	c.(2488-2490)Agg>Ggg	p.R830G	CDHR5_ENST00000397542.2_Missense_Mutation_p.R830G|IRF7_ENST00000525445.1_5'Flank|IRF7_ENST00000397570.1_5'Flank|CDHR5_ENST00000349570.7_Missense_Mutation_p.R636G|IRF7_ENST00000348655.6_5'Flank|IRF7_ENST00000330243.5_5'Flank|IRF7_ENST00000397566.1_5'Flank|IRF7_ENST00000397574.2_5'Flank|IRF7_ENST00000397562.3_5'Flank			Q9HBB8	CDHR5_HUMAN	cadherin-related family member 5	830					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	23						CCCCCACCCCTCCCCGCGCCC	0.697																																					p.R830G													.	CDHR5	77		0			c.A2488G												27.0	25.0	25.0					11																	617401		2196	4293	6489	SO:0001583	missense	53841	exon15			CACCCCTCCCCGC	AF258675	CCDS7707.1, CCDS7708.1	11p15.5	2011-07-01	2010-01-25	2010-01-25	ENSG00000099834	ENSG00000099834		"""Cadherins / Cadherin-related"""	7521	protein-coding gene	gene with protein product		606839	"""mucin and cadherin-like"", ""mucin-like protocadherin"""	MUCDHL, MUPCDH		11031102, 10801787	Standard	NM_021924		Approved	FLJ20219, MU-PCDH	uc001lqj.3	Q9HBB8	OTTHUMG00000132018	ENST00000358353.3:c.2488A>G	11.37:g.617401T>C	ENSP00000351118:p.Arg830Gly		143	0.0839160839	12		114	0.19	22	NM_021924	1	0.00	0	C9J7X1|Q9H746|Q9HAU3|Q9HBB5|Q9HBB6|Q9HBB7|Q9NX86|Q9NXI9	Missense_Mutation	SNP	ENST00000358353.3	37	CCDS7707.1	.	.	.	.	.	.	.	.	.	.	T	4.577	0.107155	0.08780	.	.	ENSG00000099834	ENST00000397542;ENST00000358353;ENST00000349570	T;T;T	0.50001	0.91;0.91;0.76	3.03	-2.22	0.06952	.	.	.	.	.	T	0.18964	0.0455	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.21109	-1.0255	9	0.14656	T	0.56	0.0602	2.0389	0.03545	0.1299:0.4044:0.2825:0.1832	.	824;636;830	Q9HBB8-4;Q9HBB8-2;Q9HBB8	.;.;CDHR5_HUMAN	G	830;830;636	ENSP00000380676:R830G;ENSP00000351118:R830G;ENSP00000345726:R636G	ENSP00000345726:R636G	R	-	1	2	CDHR5	607401	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.509000	0.06336	-0.184000	0.10567	-1.692000	0.00727	AGG			0.697	CDHR5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255023.2		NM_021924	
STIM1	6786	mdanderson.org	37	11	4107735	4107735	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:4107735G>T	ENST00000300737.4	+	11	2072	c.1503G>T	c.(1501-1503)caG>caT	p.Q501H	STIM1_ENST00000533977.1_Missense_Mutation_p.Q328H|STIM1_ENST00000527651.1_Missense_Mutation_p.Q501H	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	501					activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GTGTTCGGCAGCGCCTGACGG	0.612																																					p.Q501H													.	.			0			c.G1503T												43.0	38.0	39.0					11																	4107735		2201	4298	6499	SO:0001583	missense	6786	exon11			TCGGCAGCGCCTG	BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.1503G>T	11.37:g.4107735G>T	ENSP00000300737:p.Gln501His		131	0	0		134	0.04	5	NM_003156	91	0.00	0	E9PQJ4|Q8N382	Missense_Mutation	SNP	ENST00000300737.4	37	CCDS7749.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.64|16.64	3.179894|3.179894	0.57800|0.57800	.|.	.|.	ENSG00000167323|ENSG00000167323	ENST00000300737;ENST00000527651;ENST00000533977|ENST00000526596	T;T;T|.	0.54279|.	0.58;0.58;0.58|.	5.33|5.33	4.42|4.42	0.53409|0.53409	.|.	0.268675|.	0.39475|.	N|.	0.001352|.	T|T	0.63200|0.63200	0.2491|0.2491	L|L	0.59436|0.59436	1.845|1.845	0.45366|0.45366	D|D	0.998355|0.998355	P;D|.	0.56968|.	0.952;0.978|.	B;P|.	0.45881|.	0.36;0.496|.	T|T	0.61327|0.61327	-0.7085|-0.7085	10|5	0.62326|.	D|.	0.03|.	-18.7927|-18.7927	11.8924|11.8924	0.52637|0.52637	0.0859:0.0:0.9141:0.0|0.0859:0.0:0.9141:0.0	.|.	501;501|.	E9PQJ4;Q13586|.	.;STIM1_HUMAN|.	H|I	501;501;328|263	ENSP00000300737:Q501H;ENSP00000436208:Q501H;ENSP00000434767:Q328H|.	ENSP00000300737:Q501H|.	Q|S	+|+	3|2	2|0	STIM1|STIM1	4064311|4064311	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	3.944000|3.944000	0.56629|0.56629	1.247000|1.247000	0.43917|0.43917	0.407000|0.407000	0.27541|0.27541	CAG|AGC			0.612	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257196.1		NM_003156	
CKAP5	9793	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	11	46812057	46812057	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:46812057C>G	ENST00000529230.1	-	14	1773	c.1727G>C	c.(1726-1728)gGa>gCa	p.G576A	CKAP5_ENST00000415402.1_Missense_Mutation_p.G576A|CKAP5_ENST00000354558.3_Missense_Mutation_p.G576A|CKAP5_ENST00000312055.5_Missense_Mutation_p.G576A			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	576					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						AGTCTCCAGTCCTTTCTTGTT	0.448																																					p.G576A	Ovarian(4;85 273 2202 4844 13323)												.	.			0			c.G1727C												159.0	141.0	147.0					11																	46812057		2201	4299	6500	SO:0001583	missense	9793	exon14			TCCAGTCCTTTCT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1727G>C	11.37:g.46812057C>G	ENSP00000432768:p.Gly576Ala		165	0	0		146	0.06	9	NM_001008938	137	0.36	49	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	ENST00000529230.1	37	CCDS31477.1	.	.	.	.	.	.	.	.	.	.	C	1.689	-0.504582	0.04261	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.39997	1.06;1.05;1.05;1.05	5.96	-1.0	0.10196	.	0.614994	0.18119	N	0.151107	T	0.13927	0.0337	N	0.01493	-0.835	0.29881	N	0.826045	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.0	T	0.34950	-0.9808	10	0.02654	T	1	-7.6756	14.9236	0.70859	0.111:0.3033:0.5857:0.0	.	576;576;576	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	A	576	ENSP00000432768:G576A;ENSP00000395302:G576A;ENSP00000310227:G576A;ENSP00000346566:G576A	ENSP00000310227:G576A	G	-	2	0	CKAP5	46768633	0.002000	0.14202	0.117000	0.21633	0.891000	0.51852	-0.035000	0.12205	-0.119000	0.11830	-0.315000	0.08773	GGA			0.448	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390679.1		NM_014756	
FTH1	2495	mdanderson.org	37	11	61732885	61732885	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:61732885G>T	ENST00000273550.7	-	2	451	c.217C>A	c.(217-219)Ctg>Atg	p.L73M	AP003733.1_ENST00000601917.1_5'Flank|BEST1_ENST00000449131.2_3'UTR|FTH1_ENST00000529631.1_Intron|FTH1_ENST00000532601.1_Missense_Mutation_p.L3M|FTH1_ENST00000529191.1_Intron|FTH1_ENST00000526640.1_Missense_Mutation_p.L43M	NM_002032.2	NP_002023.2	P02794	FRIH_HUMAN	ferritin, heavy polypeptide 1	73	Ferritin-like diiron. {ECO:0000255|PROSITE-ProRule:PRU00085}.				cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|intracellular sequestering of iron ion (GO:0006880)|iron ion transport (GO:0006826)|membrane organization (GO:0061024)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|post-Golgi vesicle-mediated transport (GO:0006892)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular ferritin complex (GO:0008043)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)|iron ion binding (GO:0005506)			NS(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8					Iron Dextran(DB00893)	TGGTTCTGCAGCTTCATCAGT	0.453																																					p.L73M													.	.			0			c.C217A												203.0	191.0	195.0					11																	61732885		1901	4122	6023	SO:0001583	missense	2495	exon2			TCTGCAGCTTCAT		CCDS41655.1	11q13	2012-10-02			ENSG00000167996	ENSG00000167996			3976	protein-coding gene	gene with protein product	"""apoferritin"", ""placenta immunoregulatory factor"", ""proliferation-inducing protein 15"""	134770		FTHL6		3020541	Standard	NM_002032		Approved	FTH, PLIF, PIG15, FHC	uc001nsu.3	P02794		ENST00000273550.7:c.217C>A	11.37:g.61732885G>T	ENSP00000273550:p.Leu73Met		54	0	0		51	0.06	3	NM_002032	3467	0.00	0	B3KNR5|Q3KRA8|Q3SWW1	Missense_Mutation	SNP	ENST00000273550.7	37	CCDS41655.1	.	.	.	.	.	.	.	.	.	.	.	16.63	3.175510	0.57692	.	.	ENSG00000167996	ENST00000530019;ENST00000273550;ENST00000406545;ENST00000526640;ENST00000532601;ENST00000529548	T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05	4.7	3.78	0.43462	Ferritin/ribonucleotide reductase-like (1);Ferritin, conserved site (1);Ferritin-related (1);Ferritin/DPS protein domain (1);Ferritin-like (1);	0.202213	0.43579	D	0.000550	T	0.55673	0.1935	L	0.31526	0.94	0.34284	D	0.68251	P	0.42973	0.796	P	0.50617	0.646	T	0.62364	-0.6870	10	0.28530	T	0.3	.	7.7418	0.28845	0.0841:0.0:0.7546:0.1613	.	73	P02794	FRIH_HUMAN	M	73;73;122;43;3;3	ENSP00000433470:L73M;ENSP00000273550:L73M;ENSP00000433321:L43M;ENSP00000435111:L3M;ENSP00000436947:L3M	ENSP00000273550:L73M	L	-	1	2	FTH1	61489461	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	2.752000	0.47516	1.085000	0.41206	0.563000	0.77884	CTG			0.453	FTH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388444.1		NM_002032	
CEP164	22897	broad.mit.edu	37	11	117268013	117268013	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr11:117268013G>A	ENST00000278935.3	+	27	3632	c.3485G>A	c.(3484-3486)cGc>cAc	p.R1162H	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	1162					cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		GAAGATATGCGCAAGAACCTG	0.622																																					p.R1165H													.	CEP164	121		0			c.G3494A												28.0	26.0	27.0					11																	117268013		2200	4296	6496	SO:0001583	missense	22897	exon26			ATATGCGCAAGAA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.3485G>A	11.37:g.117268013G>A	ENSP00000278935:p.Arg1162His		133	0	0		111	0.04	4	NM_001271933	37	0.00	0	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	5.269	0.234979	0.09969	.	.	ENSG00000110274	ENST00000278935;ENST00000529538	T	0.27256	1.68	5.02	-0.431	0.12295	.	0.163547	0.29239	N	0.012733	T	0.15089	0.0364	L	0.34521	1.04	0.23953	N	0.996361	B;B;B	0.22480	0.07;0.003;0.003	B;B;B	0.16722	0.016;0.006;0.006	T	0.13602	-1.0503	10	0.52906	T	0.07	-1.9239	5.4392	0.16498	0.2924:0.1341:0.5736:0.0	.	936;1162;1165	Q9NTH6;Q9UPV0;Q9UPV0-2	.;CE164_HUMAN;.	H	1162;1073	ENSP00000278935:R1162H	ENSP00000278935:R1162H	R	+	2	0	CEP164	116773223	0.150000	0.22732	0.462000	0.27118	0.030000	0.12068	0.792000	0.26929	0.017000	0.15025	-0.964000	0.02622	CGC			0.622	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392893.1		NM_014956	
WNT5B	81029	bcgsc.ca	37	12	1755317	1755317	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:1755317A>G	ENST00000397196.2	+	5	1211	c.979A>G	c.(979-981)Aag>Gag	p.K327E	WNT5B_ENST00000545747.1_3'UTR|WNT5B_ENST00000537031.1_Missense_Mutation_p.K327E|WNT5B_ENST00000310594.3_Missense_Mutation_p.K327E	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	327					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CAACCAGTTCAAGAGCGTGCA	0.597																																					p.K327E													.	WNT5B	27		0			c.A979G												47.0	51.0	50.0					12																	1755317		2203	4300	6503	SO:0001583	missense	81029	exon5			CAGTTCAAGAGCG	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.979A>G	12.37:g.1755317A>G	ENSP00000380379:p.Lys327Glu		61	0	0		90	0.00	0	NM_032642	36	0.00	0	A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	ENST00000397196.2	37	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.431233	0.83776	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196	T;T;T	0.75260	-0.92;-0.92;-0.92	5.15	5.15	0.70609	.	0.047856	0.85682	D	0.000000	T	0.75576	0.3868	L	0.31420	0.93	0.80722	D	1	P	0.49559	0.925	P	0.56648	0.803	T	0.76971	-0.2761	10	0.48119	T	0.1	.	15.1447	0.72641	1.0:0.0:0.0:0.0	.	327	Q9H1J7	WNT5B_HUMAN	E	327	ENSP00000439312:K327E;ENSP00000308887:K327E;ENSP00000380379:K327E	ENSP00000308887:K327E	K	+	1	0	WNT5B	1625578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.202000	0.77856	2.159000	0.67721	0.533000	0.62120	AAG			0.597	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206747.2			
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank|RP11-273B20.1_ENST00000538062.1_RNA|RP11-273B20.1_ENST00000544657.1_RNA	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		5	0	0		8	0.38	3	.	12	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
ZFC3H1	196441	mdanderson.org	37	12	72057209	72057209	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:72057209G>A	ENST00000378743.3	-	1	540	c.182C>T	c.(181-183)gCc>gTc	p.A61V	ZFC3H1_ENST00000548100.1_Missense_Mutation_p.A61V|ZFC3H1_ENST00000552037.1_Missense_Mutation_p.A61V|THAP2_ENST00000547843.1_5'Flank|ZFC3H1_ENST00000549407.1_5'Flank|THAP2_ENST00000308086.2_5'UTR	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	61	Ser-rich.				RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACCGCCCCGGGCCGAGTGAGG	0.642											OREG0021993	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A61V													.	.			0			c.C182T												39.0	48.0	45.0					12																	72057209		2016	4173	6189	SO:0001583	missense	196441	exon1			CCCCGGGCCGAGT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.182C>T	12.37:g.72057209G>A	ENSP00000368017:p.Ala61Val		33	0	0	1134	51	0.06	3	NM_144982	13	0.00	0	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	37	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.393443	0.42410	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.31247	1.5	4.66	3.76	0.43208	.	0.454447	0.18886	N	0.128458	T	0.12987	0.0315	N	0.08118	0	0.80722	D	1	B;B;B	0.09022	0.002;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.09443	-1.0674	10	0.15066	T	0.55	.	6.0345	0.19699	0.1741:0.1582:0.6677:0.0	.	61;61;61	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	V	61	ENSP00000368017:A61V	ENSP00000368017:A61V	A	-	2	0	ZFC3H1	70343476	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.151000	0.42263	1.183000	0.42943	0.455000	0.32223	GCC			0.642	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404751.1		NM_144982	
HECTD4	283450	bcgsc.ca	37	12	112641514	112641514	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:112641514C>T	ENST00000430131.2	-	53	8211	c.7066G>A	c.(7066-7068)Gct>Act	p.A2356T	HECTD4_ENST00000377560.5_Missense_Mutation_p.A2606T|HECTD4_ENST00000550722.1_Missense_Mutation_p.A2632T			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2356					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										TTTGGCAGAGCAGTTCCAACA	0.458																																					p.A2644T													.	.			0			c.G7930A												64.0	61.0	62.0					12																	112641514		1883	4113	5996	SO:0001583	missense	283450	exon54			GCAGAGCAGTTCC	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.7066G>A	12.37:g.112641514C>T	ENSP00000404379:p.Ala2356Thr		175	0	0		243	0.00	0	NM_001109662	29	0.00	0	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	37		.	.	.	.	.	.	.	.	.	.	C	36	5.947589	0.97134	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.24723	1.84;1.84;1.84	6.17	6.17	0.99709	.	0.182643	0.36972	U	0.002303	T	0.40171	0.1106	N	0.19112	0.55	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.25257	-1.0137	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	2356	Q9Y4D8	K0614_HUMAN	T	2606;2356;2632	ENSP00000366783:A2606T;ENSP00000404379:A2356T;ENSP00000449784:A2632T	ENSP00000366783:A2606T	A	-	1	0	C12orf51	111125897	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.478000	0.81082	2.941000	0.99782	0.655000	0.94253	GCT			0.458	HECTD4-202	KNOWN	basic	protein_coding	protein_coding				NM_173813	
KDM2B	84678	mdanderson.org	37	12	121881564	121881564	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr12:121881564G>T	ENST00000377071.4	-	17	2556	c.2484C>A	c.(2482-2484)tcC>tcA	p.S828S	KDM2B_ENST00000542973.1_Silent_p.S196S|KDM2B_ENST00000377069.4_Intron|KDM2B_ENST00000536437.1_Intron	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	828					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						AGAGGTGAGAGGAGGAACCGG	0.627											OREG0022201	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S828S													.	.			0			c.C2484A												41.0	49.0	46.0					12																	121881564		1996	4160	6156	SO:0001819	synonymous_variant	84678	exon17			GTGAGAGGAGGAA	AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.2484C>A	12.37:g.121881564G>T			26	0	0	1514	24	0.08	2	NM_032590	167	0.00	0	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Silent	SNP	ENST00000377071.4	37	CCDS41850.1																																																																																					0.627	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000402132.2		NM_032590	
TPTE2	93492	broad.mit.edu	37	13	20025336	20025336	+	Silent	SNP	A	A	G	rs545861513	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr13:20025336A>G	ENST00000400230.2	-	11	815	c.771T>C	c.(769-771)caT>caC	p.H257H	TPTE2_ENST00000400103.2_Silent_p.H146H|TPTE2_ENST00000382975.4_Silent_p.H217H|TPTE2_ENST00000457266.2_Silent_p.H146H|TPTE2_ENST00000255310.6_Silent_p.H180H|TPTE2_ENST00000390680.2_Silent_p.H180H|TPTE2_ENST00000382978.1_Silent_p.H217H|TPTE2_ENST00000382977.4_Silent_p.H257H			Q6XPS3	TPTE2_HUMAN	transmembrane phosphoinositide 3-phosphatase and tensin homolog 2	257	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(2)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(8)|lung(21)|pancreas(1)|prostate(8)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGTGGTTTCGATGTTTCTTAT	0.358													a|||	6	0.00119808	0.003	0.0014	5008	,	,		20859	0.0		0.001	False		,,,				2504	0.0				p.H257H													.	TPTE2	225		0			c.T771C												132.0	116.0	122.0					13																	20025336		2203	4299	6502	SO:0001819	synonymous_variant	93492	exon12			GTTTCGATGTTTC	AJ421032	CCDS9285.1, CCDS45013.1, CCDS45014.1	13q12.11	2012-12-10			ENSG00000132958	ENSG00000132958		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	17299	protein-coding gene	gene with protein product		606791				11716755, 12717346, 15057823	Standard	NM_130785		Approved	TPIP	uc001umd.3	Q6XPS3	OTTHUMG00000016493	ENST00000400230.2:c.771T>C	13.37:g.20025336A>G			86	0.011627907	1		94	0.10	9	NM_199254	2	0.00	0	A1A4X0|A1A4X1|A8MX64|B1AQ16|B4DWZ2|Q5VUH2|Q8WWL4|Q8WWL5	Silent	SNP	ENST00000400230.2	37	CCDS45014.1																																																																																					0.358	TPTE2-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_199254	
RNF113B	140432	mdanderson.org	37	13	98829406	98829406	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr13:98829406C>A	ENST00000267291.6	-	1	113	c.85G>T	c.(85-87)Ggg>Tgg	p.G29W	FARP1_ENST00000319562.6_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000595437.1_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	29							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CCTGCAGCCCCTTTCCGTCCA	0.652																																					p.G29W													.	.			0			c.G85T												40.0	39.0	40.0					13																	98829406		2203	4300	6503	SO:0001583	missense	140432	exon1			CAGCCCCTTTCCG	AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.85G>T	13.37:g.98829406C>A	ENSP00000267291:p.Gly29Trp		30	0	0		24	0.13	3	NM_178861	2	0.00	0	Q8WWF9|Q96QY9	Missense_Mutation	SNP	ENST00000267291.6	37	CCDS9486.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752698	0.69533	.	.	ENSG00000139797	ENST00000267291	T	0.32988	1.43	1.17	1.17	0.20885	.	0.360806	0.23856	U	0.043889	T	0.40196	0.1107	M	0.72118	2.19	0.22701	N	0.998831	D	0.71674	0.998	P	0.55785	0.784	T	0.14227	-1.0480	10	0.72032	D	0.01	.	5.6818	0.17780	0.0:1.0:0.0:0.0	.	29	Q8IZP6	R113B_HUMAN	W	29	ENSP00000267291:G29W	ENSP00000267291:G29W	G	-	1	0	RNF113B	97627407	0.013000	0.17824	0.980000	0.43619	0.921000	0.55340	-0.061000	0.11693	0.941000	0.37499	0.491000	0.48974	GGG			0.652	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045536.3		NM_178861	
RP11-597A11.1	0	broad.mit.edu	37	14	20138373	20138374	+	RNA	INS	-	-	AAG	rs375739374|rs542749146		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:20138373_20138374insAAG	ENST00000548261.1	+	0	391																											GAAACAaaagaaagaaagaaag	0.396																																					.													.	.			0			.																																											0	.			CAAAAGAAAGAAA																													14.37:g.20138374_20138376dupAAG			31	0	0		29	0.31	9	.	0		0		RNA	INS	ENST00000548261.1	37																																																																																						0.396	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
Unknown	0	bcgsc.ca	37	14	22054477	22054477	+	IGR	SNP	C	C	T	rs11847952	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:22054477C>T								OR10G3 (15602 upstream) : TRAV1-1 (35513 downstream)																							AATGCTTCATCGCCAGTAAAG	0.378													c|||	156	0.0311502	0.1135	0.0072	5008	,	,		19118	0.0		0.0	False		,,,				2504	0.001				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CTTCATCGCCAGT																													14.37:g.22054477C>T			34	0	0		46	0.00	0	.	0		0		RNA	SNP		37																																																																																					0	0.378										
EFS	10278	broad.mit.edu	37	14	23828820	23828820	+	Silent	SNP	T	T	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:23828820T>G	ENST00000216733.3	-	4	1474	c.867A>C	c.(865-867)ccA>ccC	p.P289P	EFS_ENST00000429593.2_Silent_p.P120P|RP11-124D2.3_ENST00000554010.1_RNA|EFS_ENST00000351354.3_Silent_p.P196P	NM_005864.2	NP_005855.1	O43281	EFS_HUMAN	embryonal Fyn-associated substrate	289	Pro-rich.				cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(5)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)	16	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00649)		TGTGTGGGGGTGGGGGGCTTC	0.726																																					p.P289P													.	EFS	37		0			c.A867C												7.0	10.0	9.0					14																	23828820		1935	4040	5975	SO:0001819	synonymous_variant	0	exon4			TGGGGGTGGGGGG	AB001466	CCDS9595.1, CCDS9596.1, CCDS61404.1	14q11.2-q12	2011-04-13			ENSG00000100842	ENSG00000100842		"""Cas scaffolding proteins"""	16898	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 3"""	609906				9349509	Standard	NM_005864		Approved	EFS2, EFS1, HEFS, SIN, CASS3	uc001wjo.4	O43281	OTTHUMG00000028741	ENST00000216733.3:c.867A>C	14.37:g.23828820T>G			40	0.025	1		54	0.22	12	NM_005864	1	0.00	0	B2RAJ7|B4DJ56|E9PGU2|O43282	Silent	SNP	ENST00000216733.3	37	CCDS9595.1																																																																																					0.726	EFS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071770.2			
KLHDC2	23588	bcgsc.ca	37	14	50249093	50249093	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:50249093G>C	ENST00000298307.5	+	11	1823	c.962G>C	c.(961-963)tGg>tCg	p.W321S	KLHDC2_ENST00000554589.1_Missense_Mutation_p.W321S|NEMF_ENST00000556925.1_5'Flank|KLHDC2_ENST00000557247.1_Missense_Mutation_p.G297R	NM_014315.2	NP_055130.1	Q9Y2U9	KLDC2_HUMAN	kelch domain containing 2	321						nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	all_epithelial(31;0.000959)|Breast(41;0.0117)					TGCAGGTTATGGCACACAGCT	0.413																																					p.W321S													.	KLHDC2	33		0			c.G962C												156.0	152.0	154.0					14																	50249093		2203	4300	6503	SO:0001583	missense	23588	exon11			GGTTATGGCACAC	AK001771	CCDS9693.1	14q21.3	2003-01-15			ENSG00000165516	ENSG00000165516			20231	protein-coding gene	gene with protein product		611280				11384994	Standard	NM_014315		Approved	HCLP-1, LCP	uc001wwx.3	Q9Y2U9	OTTHUMG00000140288	ENST00000298307.5:c.962G>C	14.37:g.50249093G>C	ENSP00000298307:p.Trp321Ser		119	0	0		220	0.00	1	NM_014315	286	0.00	0	B3KPF9|Q6IAF0|Q86TY9	Missense_Mutation	SNP	ENST00000298307.5	37	CCDS9693.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.576928|4.576928	0.86645|0.86645	.|.	.|.	ENSG00000165516|ENSG00000165516	ENST00000557247|ENST00000298307;ENST00000554589	T|T;T	0.05319|0.61392	3.46|0.11;0.11	5.04|5.04	5.04|5.04	0.67666|0.67666	.|Kelch-type beta propeller (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74397|0.74397	0.3711|0.3711	M|M	0.73962|0.73962	2.25|2.25	0.46241|0.46241	D|D	0.998943|0.998943	P|D;D	0.36144|0.76494	0.539|0.999;0.998	B|D;D	0.38755|0.85130	0.281|0.997;0.991	T|T	0.69698|0.69698	-0.5075|-0.5075	8|10	.|0.18710	.|T	.|0.47	-6.5579|-6.5579	17.5601|17.5601	0.87903|0.87903	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	297|321;321	G3V2H2|G3V3U8;Q9Y2U9	.|.;KLDC2_HUMAN	R|S	297|321	ENSP00000450658:G297R|ENSP00000298307:W321S;ENSP00000451439:W321S	.|ENSP00000298307:W321S	G|W	+|+	1|2	0|0	KLHDC2|KLHDC2	49318843|49318843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.038000|9.038000	0.93771|0.93771	2.630000|2.630000	0.89119|0.89119	0.655000|0.655000	0.94253|0.94253	GGC|TGG			0.413	KLHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276869.1			
ATG2B	55102	broad.mit.edu	37	14	96752258	96752258	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:96752258A>C	ENST00000359933.4	-	42	6964	c.6071T>G	c.(6070-6072)gTg>gGg	p.V2024G		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	2024					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GGCACCAGTCACCCCTCTGCT	0.582																																					p.V2024G													.	ATG2B	169		0			c.T6071G												66.0	60.0	62.0					14																	96752258		2203	4300	6503	SO:0001583	missense	55102	exon42			CCAGTCACCCCTC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.6071T>G	14.37:g.96752258A>C	ENSP00000353010:p.Val2024Gly		158	0.0886075949	14		214	0.16	34	NM_018036	75	0.04	3	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	37	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	29.2	4.989431	0.93106	.	.	ENSG00000066739	ENST00000359933	T	0.10288	2.89	5.8	5.8	0.92144	Autophagy-related, C-terminal (1);	0.170648	0.51477	D	0.000082	T	0.20373	0.0490	L	0.51422	1.61	0.80722	D	1	D	0.54964	0.969	P	0.53401	0.725	T	0.00901	-1.1521	10	0.29301	T	0.29	.	16.1596	0.81693	1.0:0.0:0.0:0.0	.	2024	Q96BY7	ATG2B_HUMAN	G	2024	ENSP00000353010:V2024G	ENSP00000353010:V2024G	V	-	2	0	ATG2B	95822011	1.000000	0.71417	0.466000	0.27168	0.893000	0.52053	8.938000	0.92943	2.216000	0.71823	0.533000	0.62120	GTG			0.582	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314037.1		NM_018036	
EVL	51466	broad.mit.edu	37	14	100594980	100594980	+	Silent	SNP	A	A	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr14:100594980A>C	ENST00000402714.2	+	6	1210	c.606A>C	c.(604-606)ccA>ccC	p.P202P	EVL_ENST00000392920.3_Silent_p.P204P|EVL_ENST00000544450.2_Silent_p.P208P			Q9UI08	EVL_HUMAN	Enah/Vasp-like	202	Pro-rich.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)			cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				CACCTCCCCCACCCCCACTGC	0.697																																					p.P204P													.	EVL	42		0			c.A612C												7.0	9.0	8.0					14																	100594980		2136	4206	6342	SO:0001819	synonymous_variant	51466	exon6			TCCCCCACCCCCA	AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.606A>C	14.37:g.100594980A>C			58	0.1551724138	9		75	0.35	26	NM_016337	96	0.01	1	A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Silent	SNP	ENST00000402714.2	37																																																																																						0.697	EVL-006	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000413958.1			
TNFRSF12A	51330	mdanderson.org	37	16	3071298	3071298	+	Silent	SNP	G	G	A	rs2232797	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:3071298G>A	ENST00000326577.4	+	2	263	c.177G>A	c.(175-177)ccG>ccA	p.P59P	THOC6_ENST00000574549.1_5'Flank|THOC6_ENST00000575576.1_5'Flank|THOC6_ENST00000253952.9_5'Flank|TNFRSF12A_ENST00000341627.5_Intron|THOC6_ENST00000326266.8_5'Flank|TNFRSF12A_ENST00000573001.1_Silent_p.P10P|TNFRSF12A_ENST00000575124.1_Intron|CLDN6_ENST00000396925.1_5'Flank	NM_016639.2	NP_057723.1	Q9NP84	TNR12_HUMAN	tumor necrosis factor receptor superfamily, member 12A	59					angiogenesis (GO:0001525)|extrinsic apoptotic signaling pathway (GO:0097191)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axon extension (GO:0045773)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of angiogenesis (GO:0045765)|regulation of wound healing (GO:0061041)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				lung(1)|skin(1)	2						GGGCGCGACCGCACAGCGACT	0.741													G|||	9	0.00179712	0.0	0.0	5008	,	,		11625	0.0089		0.0	False		,,,				2504	0.0				p.P59P													.	.			0			c.G177A												12.0	14.0	13.0					16																	3071298		2185	4279	6464	SO:0001819	synonymous_variant	51330	exon2			GCGACCGCACAGC	AB035480	CCDS10489.1	16p13.3	2008-02-05			ENSG00000006327	ENSG00000006327		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18152	protein-coding gene	gene with protein product		605914				10751351, 10551889	Standard	NM_016639		Approved	FN14, TweakR, CD266	uc002csv.4	Q9NP84	OTTHUMG00000129001	ENST00000326577.4:c.177G>A	16.37:g.3071298G>A			22	0	0		22	0.09	2	NM_016639	16	0.00	0	D3DUA6|Q9HCS0	Silent	SNP	ENST00000326577.4	37	CCDS10489.1																																																																																			0.002		0.741	TNFRSF12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250990.1			
ZNF205	7755	bcgsc.ca	37	16	3169402	3169402	+	Silent	SNP	G	G	T	rs553718182	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:3169402G>T	ENST00000382192.3	+	7	946	c.741G>T	c.(739-741)ccG>ccT	p.P247P	ZNF205_ENST00000219091.4_Silent_p.P247P|RP11-473M20.14_ENST00000576490.1_RNA|RP11-473M20.14_ENST00000575139.1_RNA	NM_001278158.1|NM_003456.2	NP_001265087.1|NP_003447.2	O95201	ZN205_HUMAN	zinc finger protein 205	247					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hydrogen peroxide biosynthetic process (GO:0010729)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	20						GCTCAGGGCCGGCCAAAGACT	0.701																																					p.P247P													.	ZNF205	42		0			c.G741T												13.0	16.0	15.0					16																	3169402		2188	4284	6472	SO:0001819	synonymous_variant	7755	exon7			AGGGCCGGCCAAA	AF060865	CCDS10494.2	16p13.3	2013-01-08			ENSG00000122386	ENSG00000122386		"""Zinc fingers, C2H2-type"", ""-"""	12996	protein-coding gene	gene with protein product		603436		ZNF210		9787081	Standard	NM_003456		Approved	Zfp13	uc002cub.3	O95201	OTTHUMG00000148676	ENST00000382192.3:c.741G>T	16.37:g.3169402G>T			57	0	0		44	0.00	0	NM_003456	50	0.00	0	A8MZK0|D3DUB4|Q9BU95	Silent	SNP	ENST00000382192.3	37	CCDS10494.2																																																																																					0.701	ZNF205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309057.1		NM_003456	
SMG1	23049	bcgsc.ca	37	16	18846457	18846457	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr16:18846457G>T	ENST00000446231.2	-	49	8499	c.8087C>A	c.(8086-8088)cCc>cAc	p.P2696H	SMG1_ENST00000389467.3_Missense_Mutation_p.P2696H			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2696					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CACTGTTGGGGGTGGCTGGGG	0.423																																					p.P2696H													.	SMG1	401		0			c.C8087A												84.0	83.0	83.0					16																	18846457		1905	4123	6028	SO:0001583	missense	23049	exon49			GTTGGGGGTGGCT	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.8087C>A	16.37:g.18846457G>T	ENSP00000402515:p.Pro2696His		74	0	0		81	0.00	0	NM_015092	42	0.00	0	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	37	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999947	0.74818	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01126	5.3;5.3	5.59	5.59	0.84812	Armadillo-type fold (1);	0.000000	0.64402	D	0.000004	T	0.02083	0.0065	N	0.08118	0	0.48632	D	0.999685	D	0.69078	0.997	P	0.55545	0.778	T	0.72666	-0.4224	10	0.87932	D	0	.	19.9542	0.97213	0.0:0.0:1.0:0.0	.	2696	Q96Q15	SMG1_HUMAN	H	2696	ENSP00000402515:P2696H;ENSP00000374118:P2696H	ENSP00000374118:P2696H	P	-	2	0	SMG1	18753958	1.000000	0.71417	0.985000	0.45067	0.998000	0.95712	7.287000	0.78681	2.788000	0.95919	0.585000	0.79938	CCC			0.423	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000391817.1		NM_015092	
MNT	4335	broad.mit.edu;mdanderson.org	37	17	2298498	2298498	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:2298498G>A	ENST00000174618.4	-	2	729	c.324C>T	c.(322-324)ccC>ccT	p.P108P	MNT_ENST00000575394.1_Intron	NM_020310.2	NP_064706.1	Q99583	MNT_HUMAN	MAX network transcriptional repressor	108					cell aging (GO:0007569)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cell cycle (GO:0051726)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			endometrium(4)|large_intestine(5)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	12				Colorectal(2;1.37e-05)|READ - Rectum adenocarcinoma(2;8.68e-05)		GGGCTGCCGCgggcaagggtg	0.711																																					p.P108P													.	MNT	35		0			c.C324T												4.0	5.0	4.0					17																	2298498		1971	3921	5892	SO:0001819	synonymous_variant	4335	exon2			TGCCGCGGGCAAG	Y13444	CCDS11018.1	17p13.3	2013-11-15	2013-11-15		ENSG00000070444	ENSG00000070444		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	7188	protein-coding gene	gene with protein product	"""myc antagonist"", ""Max-interacting protein"""	603039	"""MAX binding protein"", ""MNT, MAX dimerization protein"""			9598315	Standard	NM_020310		Approved	ROX, MXD6, MAD6, bHLHd3	uc002fur.3	Q99583	OTTHUMG00000090603	ENST00000174618.4:c.324C>T	17.37:g.2298498G>A			23	0	0		17	0.24	4	NM_020310	12	0.50	6	A8K6D1|D3DTI7|Q1ED38	Silent	SNP	ENST00000174618.4	37	CCDS11018.1																																																																																					0.711	MNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207158.1		NM_020310	
KRT17P2	339241	broad.mit.edu	37	17	18334177	18334177	+	RNA	DEL	T	T	-			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:18334177delT	ENST00000326333.8	+	0	1174				KRT16P1_ENST00000581027.1_RNA					keratin 17 pseudogene 2																		TTCCTCTCTGTTTTTTTTTTC	0.572																																					.													.	.			0			.																																											0	.			TCTCTGTTTTTTT			17p11.2	2013-06-25			ENSG00000186831	ENSG00000186831			6429	pseudogene	pseudogene						1281771	Standard	NG_002778		Approved				OTTHUMG00000059248		17.37:g.18334177delT			155	0	0		150	0.05	8	.	0		0		RNA	DEL	ENST00000326333.8	37																																																																																						0.572	KRT17P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446573.1		NG_002778	
SLC47A2	146802	mdanderson.org	37	17	19618501	19618501	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:19618501G>T	ENST00000325411.5	-	2	203	c.153C>A	c.(151-153)atC>atA	p.I51I	SLC47A2_ENST00000463318.1_5'UTR|SLC47A2_ENST00000350657.5_Silent_p.I51I	NM_152908.3	NP_690872.2	Q86VL8	S47A2_HUMAN	solute carrier family 47 (multidrug and toxin extrusion), member 2	51					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antiporter activity (GO:0015297)|drug transmembrane transporter activity (GO:0015238)			endometrium(2)|kidney(3)|large_intestine(2)|lung(1)|ovary(1)	9	all_cancers(12;2.3e-05)|all_epithelial(12;0.0024)|Breast(13;0.245)				Aciclovir(DB00787)	TCACGATGTAGATCATAAAAG	0.632																																					p.I51I													.	.			0			c.C153A												75.0	74.0	74.0					17																	19618501		2203	4300	6503	SO:0001819	synonymous_variant	146802	exon2			GATGTAGATCATA	AB250364	CCDS11211.1, CCDS58530.1	17p11.2	2013-07-17	2013-07-17		ENSG00000180638	ENSG00000180638		"""Solute carriers"""	26439	protein-coding gene	gene with protein product	"""multidrug and toxin extrusion 2"""	609833				16996621, 16807400	Standard	NM_152908		Approved	FLJ31196, MATE2, MATE2-K	uc002gwf.4	Q86VL8	OTTHUMG00000059464	ENST00000325411.5:c.153C>A	17.37:g.19618501G>T			22	0	0		33	0.09	3	NM_001099646	1	0.00	0	A0JBX9|A0P8Z7|Q63HJ9|Q8IV44|Q96NA1	Silent	SNP	ENST00000325411.5	37	CCDS11211.1																																																																																					0.632	SLC47A2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000132242.2		NM_152908	
PLEKHM1	9842	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	17	43522989	43522989	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:43522989G>A	ENST00000430334.3	-	9	2817	c.2684C>T	c.(2683-2685)gCc>gTc	p.A895V	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.A806V|PLEKHM1_ENST00000580404.1_5'UTR	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	895					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GAGGGGCTGGGCCCGGATCTG	0.597																																					p.A895V													.	.			0			c.C2684T												64.0	61.0	62.0					17																	43522989		2200	4300	6500	SO:0001583	missense	9842	exon9			GGCTGGGCCCGGA	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2684C>T	17.37:g.43522989G>A	ENSP00000389913:p.Ala895Val		118	0	0		166	0.19	32	NM_014798	18	0.00	0	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	37	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.003887	0.35320	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.64085	-0.08;-0.08	4.59	1.29	0.21616	.	0.606178	0.17478	N	0.172828	T	0.43722	0.1260	L	0.34521	1.04	0.25376	N	0.988656	B;B	0.02656	0.0;0.0	B;B	0.09377	0.002;0.004	T	0.23655	-1.0182	10	0.38643	T	0.18	.	4.2158	0.10533	0.1878:0.0:0.5629:0.2493	.	806;895	F8W648;Q9Y4G2	.;PKHM1_HUMAN	V	895;844;806	ENSP00000389913:A895V;ENSP00000414352:A806V	ENSP00000414352:A806V	A	-	2	0	PLEKHM1	40878772	0.413000	0.25400	1.000000	0.80357	0.987000	0.75469	2.116000	0.41930	0.654000	0.30846	-0.663000	0.03849	GCC			0.597	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444659.1		NM_014798	
ACE	1636	mdanderson.org	37	17	61574523	61574523	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:61574523C>A	ENST00000290866.4	+	25	3741	c.3717C>A	c.(3715-3717)gaC>gaA	p.D1239E	ACE_ENST00000428043.1_Intron|ACE_ENST00000577647.1_Intron|ACE_ENST00000421982.2_Missense_Mutation_p.D444E|ACE_ENST00000490216.2_Intron|ACE_ENST00000290863.6_Missense_Mutation_p.D665E|ACE_ENST00000413513.3_Missense_Mutation_p.D624E	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme	1239					angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CCCTCCCAGACAGCGGCCGCG	0.711																																					p.D1239E													.	.			0			c.C3717A												12.0	15.0	14.0					17																	61574523		2189	4274	6463	SO:0001583	missense	1636	exon25			CCCAGACAGCGGC	J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.3717C>A	17.37:g.61574523C>A	ENSP00000290866:p.Asp1239Glu		31	0	0		39	0.08	3	NM_000789	270	0.00	0	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Missense_Mutation	SNP	ENST00000290866.4	37	CCDS11637.1	.	.	.	.	.	.	.	.	.	.	c	1.014	-0.686851	0.03328	.	.	ENSG00000159640	ENST00000290866;ENST00000290863;ENST00000413513;ENST00000421982	T;T;T;T	0.30448	1.53;1.71;1.65;1.74	4.74	-1.17	0.09648	.	0.977000	0.08399	N	0.951773	T	0.10121	0.0248	N	0.04880	-0.145	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.10450	0.005;0.001;0.001;0.0	T	0.31280	-0.9949	10	0.06365	T	0.9	-6.5014	1.4263	0.02324	0.1342:0.3411:0.2793:0.2455	.	444;624;665;1239	F6X3S4;B4DXI3;P12821-3;P12821	.;.;.;ACE_HUMAN	E	1239;665;624;444	ENSP00000290866:D1239E;ENSP00000290863:D665E;ENSP00000392247:D624E;ENSP00000387760:D444E	ENSP00000290863:D665E	D	+	3	2	ACE	58928255	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	0.484000	0.22308	-0.209000	0.10156	0.550000	0.68814	GAC			0.711	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337675.2			
BIRC5	332	broad.mit.edu	37	17	76219856	76219857	+	Frame_Shift_Del	DEL	TC	TC	-	rs369792774		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:76219856_76219857delTC	ENST00000600484.1	-	4	424_425	c.425_426delGA	c.(424-426)agafs	p.R142fs	BIRC5_ENST00000589892.1_3'UTR|BIRC5_ENST00000374948.2_3'UTR|BIRC5_ENST00000301633.4_3'UTR|BIRC5_ENST00000350051.3_3'UTR																							AGTGGCTGCTTCTCTCTCTCTC	0.49																																					.													.	BIRC5	32		0			.																																									SO:0001589	frameshift_variant	0	.			GCTGCTTCTCTCT																												ENST00000600484.1:c.425_426delGA	17.37:g.76219866_76219867delTC	ENSP00000473193:p.Arg142fs		12	0	0		56	0.13	7	.	304	0.00	0		Frame_Shift_Del	DEL	ENST00000600484.1	37																																																																																						0.490	AC087645.1-201	NOVEL	basic|appris_principal	protein_coding	protein_coding					
DNAH17	8632	broad.mit.edu	37	17	76488820	76488820	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:76488820G>T	ENST00000585328.1	-	42	6545	c.6421C>A	c.(6421-6423)Cag>Aag	p.Q2141K	RP11-559N14.5_ENST00000591373.1_RNA|RP11-559N14.5_ENST00000588565.1_RNA|DNAH17_ENST00000586052.1_5'Flank|DNAH17_ENST00000389840.5_Missense_Mutation_p.Q2132K|RP11-559N14.5_ENST00000585969.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2132	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TTCAGGTTCTGATAGGTCTTG	0.587																																					p.Q2146K													.	DNAH17	347		0			c.C6436A												51.0	54.0	53.0					17																	76488820		1949	4141	6090	SO:0001583	missense	8632	exon42			GGTTCTGATAGGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.6421C>A	17.37:g.76488820G>T	ENSP00000465516:p.Gln2141Lys		98	0	0		147	0.03	5	NM_173628	1	0.00	0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	37		.	.	.	.	.	.	.	.	.	.	G	7.690	0.690896	0.15039	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.24350	1.86	4.74	4.74	0.60224	.	.	.	.	.	T	0.11623	0.0283	N	0.12663	0.25	0.21719	N	0.999573	.	.	.	.	.	.	T	0.26258	-1.0108	7	0.06236	T	0.91	.	7.8036	0.29189	0.0882:0.1652:0.7466:0.0	.	.	.	.	K	2141;2132	ENSP00000374490:Q2132K	ENSP00000300671:Q2141K	Q	-	1	0	DNAH17	74000415	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.294000	0.43567	2.160000	0.67779	0.543000	0.68304	CAG			0.587	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000318962.2		NM_173628	
AATK	9625	mdanderson.org	37	17	79104942	79104942	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr17:79104942C>T	ENST00000326724.4	-	3	277	c.253G>A	c.(253-255)Gca>Aca	p.A85T	AATK_ENST00000572339.1_5'Flank|MIR1250_ENST00000408098.1_RNA|AATK_ENST00000417379.1_5'UTR	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	85					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TTCTGTGCTGCCGTGGCCGGG	0.706																																					p.A85T													.	.			0			c.G253A												14.0	23.0	20.0					17																	79104942		2038	4147	6185	SO:0001583	missense	9625	exon3			GTGCTGCCGTGGC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.253G>A	17.37:g.79104942C>T	ENSP00000324196:p.Ala85Thr		33	0	0		48	0.06	3	NM_001080395	2	0.00	0	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	37	CCDS45807.1	.	.	.	.	.	.	.	.	.	.	c	8.320	0.824010	0.16678	.	.	ENSG00000181409	ENST00000326724;ENST00000374792	T;T	0.77877	-1.13;-1.04	3.61	-1.38	0.09027	.	0.454369	0.16323	N	0.219443	T	0.54224	0.1845	N	0.14661	0.345	0.22666	N	0.998878	B	0.02656	0.0	B	0.04013	0.001	T	0.37641	-0.9697	10	0.35671	T	0.21	.	5.3182	0.15866	0.0:0.3747:0.2987:0.3266	.	85	Q6ZMQ8	LMTK1_HUMAN	T	85	ENSP00000324196:A85T;ENSP00000363924:A85T	ENSP00000324196:A85T	A	-	1	0	AATK	76719537	0.024000	0.19004	0.000000	0.03702	0.072000	0.16883	0.669000	0.25142	0.004000	0.14682	-0.461000	0.05368	GCA			0.706	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256055.1		NM_004920	
DSG2	1829	bcgsc.ca	37	18	29122743	29122743	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr18:29122743C>T	ENST00000261590.8	+	14	2471	c.2262C>T	c.(2260-2262)tcC>tcT	p.S754S	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	754					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CAGGGGCTTCCAGAGACATGG	0.498																																					p.S754S													DSG2,NS,malignant_melanoma,+1,2	DSG2	115	2	0			c.C2262T												78.0	86.0	83.0					18																	29122743		2046	4201	6247	SO:0001819	synonymous_variant	1829	exon14			GGCTTCCAGAGAC	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2262C>T	18.37:g.29122743C>T			115	0	0		127	0.00	0	NM_001943	251	0.00	0	Q4KKU6	Silent	SNP	ENST00000261590.8	37	CCDS42423.1																																																																																					0.498	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447506.1		NM_001943	
RYR1	6261	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	38948767	38948767	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:38948767G>T	ENST00000359596.3	+	18	2002	c.2002G>T	c.(2002-2004)Gac>Tac	p.D668Y	RYR1_ENST00000360985.3_Missense_Mutation_p.D668Y|RYR1_ENST00000355481.4_Missense_Mutation_p.D668Y			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	668	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGTGATGGTGGACGAGGTGAC	0.632																																					p.D668Y													.	.			0			c.G2002T												84.0	71.0	75.0					19																	38948767		2203	4300	6503	SO:0001583	missense	6261	exon18			ATGGTGGACGAGG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2002G>T	19.37:g.38948767G>T	ENSP00000352608:p.Asp668Tyr		91	0	0		128	0.13	16	NM_001042723	2	0.00	0	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	37	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	17.85	3.489336	0.64074	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	T;T;T	0.70986	-0.53;-0.53;-0.53	4.85	4.85	0.62838	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	U	0.000001	D	0.86351	0.5912	M	0.87547	2.89	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.88861	0.3326	10	0.87932	D	0	.	17.8062	0.88601	0.0:0.0:1.0:0.0	.	668;668	P21817-2;P21817	.;RYR1_HUMAN	Y	668	ENSP00000352608:D668Y;ENSP00000347667:D668Y;ENSP00000354254:D668Y	ENSP00000347667:D668Y	D	+	1	0	RYR1	43640607	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	9.657000	0.98554	2.540000	0.85666	0.549000	0.68633	GAC			0.632	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462137.1			
CTD-2126E3.4	0	broad.mit.edu	37	19	50578553	50578554	+	lincRNA	INS	-	-	GG			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:50578553_50578554insGG	ENST00000600998.1	+	0	71																											gaggaggggctgggcctgggac	0.653																																					.													.	.			0			.																																											0	.			AGGGGCTGGGCCT																													19.37:g.50578554_50578555dupGG			208	0	0		228	0.03	7	.	0		0		RNA	INS	ENST00000600998.1	37																																																																																						0.653	CTD-2126E3.4-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA		OTTHUMT00000465243.1			
CTD-2126E3.4	0	broad.mit.edu	37	19	50578560	50578560	+	lincRNA	DEL	G	G	-	rs375126068		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:50578560delG	ENST00000600998.1	+	0	71																											ggctgggcctgggactcctgg	0.657																																					.													.	.			0			.																																											0	.			GGGCCTGGGACTC																													19.37:g.50578560delG			190	0	0		213	0.04	9	.	0		0		RNA	DEL	ENST00000600998.1	37																																																																																						0.657	CTD-2126E3.4-001	KNOWN	not_best_in_genome_evidence|basic	lincRNA	lincRNA		OTTHUMT00000465243.1			
ZNF28	7576	ucsc.edu	37	19	53304632	53304632	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr19:53304632G>A	ENST00000457749.2	-	4	585	c.466C>T	c.(466-468)Cct>Tct	p.P156S	ZNF28_ENST00000360272.4_Missense_Mutation_p.P103S|ZNF28_ENST00000438150.2_Missense_Mutation_p.P103S|ZNF28_ENST00000414252.2_Missense_Mutation_p.P103S	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	156					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TTCCCTTCAGGCTGAAATATG	0.398																																					p.P156S													.	ZNF28	191		0			c.C466T												189.0	189.0	189.0					19																	53304632		2203	4300	6503	SO:0001583	missense	7576	exon4			CTTCAGGCTGAAA	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.466C>T	19.37:g.53304632G>A	ENSP00000397693:p.Pro156Ser		122	0.0491803279	6		201	0.03	7	NM_006969	66	0.12	8	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	ENST00000457749.2	37	CCDS33093.2	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.057245	0.00390	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.06528	3.29;3.37;3.29;3.29;3.31	1.81	-3.62	0.04543	.	.	.	.	.	T	0.02083	0.0065	N	0.01729	-0.75	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.39921	-0.9590	9	0.38643	T	0.18	.	4.0042	0.09593	0.4998:0.0:0.1766:0.3236	.	156	P17035	ZNF28_HUMAN	S	103;156;103;103;103	ENSP00000412143:P103S;ENSP00000397693:P156S;ENSP00000353410:P103S;ENSP00000444965:P103S;ENSP00000375661:P103S	ENSP00000353410:P103S	P	-	1	0	ZNF28	57996444	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.732000	0.04904	-3.046000	0.00261	-2.369000	0.00236	CCT			0.398	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336038.2	rescued with RNA-seq	NM_006969	
BIRC6	57448	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	32626436	32626436	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:32626436G>C	ENST00000421745.2	+	7	1374	c.1240G>C	c.(1240-1242)Gtt>Ctt	p.V414L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	414					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					CATATGGGATGTTTCCAAACT	0.378																																					p.V414L	Pancreas(94;175 1509 16028 18060 45422)												.	.			0			c.G1240C												156.0	162.0	160.0					2																	32626436		2203	4300	6503	SO:0001583	missense	57448	exon7			TGGGATGTTTCCA	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.1240G>C	2.37:g.32626436G>C	ENSP00000393596:p.Val414Leu		131	0	0		200	0.13	26	NM_016252	5	0.40	2	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	37	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466278	0.63625	.	.	ENSG00000115760	ENST00000421745	T	0.75821	-0.97	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);	0.079718	0.51477	D	0.000089	T	0.69797	0.3151	L	0.43152	1.355	0.54753	D	0.999988	B	0.32302	0.363	B	0.28232	0.087	T	0.70583	-0.4832	10	0.66056	D	0.02	.	19.6727	0.95916	0.0:0.0:1.0:0.0	.	414	Q9NR09	BIRC6_HUMAN	L	414	ENSP00000393596:V414L	ENSP00000393596:V414L	V	+	1	0	BIRC6	32479940	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.912000	0.87465	2.661000	0.90470	0.491000	0.48974	GTT			0.378	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318769.3		NM_016252	
MSH6	2956	bcgsc.ca	37	2	48026849	48026849	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:48026849A>C	ENST00000234420.5	+	4	1879	c.1727A>C	c.(1726-1728)gAt>gCt	p.D576A	FBXO11_ENST00000405808.1_Intron|MSH6_ENST00000540021.1_Missense_Mutation_p.D446A|MSH6_ENST00000538136.1_Missense_Mutation_p.D274A	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	576					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTTTCAGATGATCGCCATTGT	0.378			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.D576A			yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341		2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.A1727C												158.0	156.0	157.0					2																	48026849		2195	4299	6494	SO:0001583	missense	2956	exon4	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CAGATGATCGCCA	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.1727A>C	2.37:g.48026849A>C	ENSP00000234420:p.Asp576Ala		153	0	0		217	0.00	0	NM_000179	350	0.00	0	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	37	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	A	18.51	3.639486	0.67244	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000540021;ENST00000538136	D;D;D	0.89617	-2.26;-2.39;-2.54	5.04	5.04	0.67666	DNA mismatch repair protein MutS, connector (1);	0.095938	0.64402	D	0.000001	D	0.95294	0.8473	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.96232	0.9169	10	0.87932	D	0	-16.0126	15.0848	0.72142	1.0:0.0:0.0:0.0	.	446;576;576	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	A	576;574;446;274	ENSP00000234420:D576A;ENSP00000446475:D446A;ENSP00000438580:D274A	ENSP00000234420:D576A	D	+	2	0	MSH6	47880353	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.217000	0.95160	2.035000	0.60131	0.528000	0.53228	GAT			0.378	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251180.4		NM_000179	
STON1	11037	bcgsc.ca	37	2	48809124	48809124	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:48809124A>G	ENST00000406226.1	+	3	1547	c.1352A>G	c.(1351-1353)aAc>aGc	p.N451S	STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.N451S|STON1_ENST00000309835.3_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.N451S|STON1_ENST00000404752.1_Missense_Mutation_p.N451S|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.N451S	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	451	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GTGAATGGGAACCTGGAATGC	0.378																																					p.N451S													.	STON1	100		0			c.A1352G												129.0	134.0	132.0					2																	48809124		2203	4300	6503	SO:0001583	missense	11037	exon3			ATGGGAACCTGGA	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1352A>G	2.37:g.48809124A>G	ENSP00000384615:p.Asn451Ser		148	0	0		179	0.00	0	NM_001198595	2	0.00	0	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	37	CCDS1841.1	.	.	.	.	.	.	.	.	.	.	A	6.690	0.496016	0.12762	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.54	0.473	0.16763	Clathrin adaptor, mu subunit, C-terminal (3);	0.714838	0.15423	N	0.263123	T	0.09423	0.0232	N	0.19112	0.55	0.09310	N	1	P;B;P	0.35124	0.473;0.01;0.485	B;B;B	0.37047	0.191;0.022;0.24	T	0.21965	-1.0230	10	0.10377	T	0.69	.	1.572	0.02617	0.42:0.1457:0.3016:0.1327	.	451;451;451	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	S	451	ENSP00000385273:N451S;ENSP00000384615:N451S;ENSP00000310969:N451S;ENSP00000385499:N451S;ENSP00000385701:N451S;ENSP00000378236:N451S;ENSP00000311493:N451S;ENSP00000378234:N451S	ENSP00000310969:N451S	N	+	2	0	STON1-GTF2A1L;STON1	48662628	0.000000	0.05858	0.050000	0.19076	0.984000	0.73092	-0.111000	0.10807	-0.053000	0.13289	0.533000	0.62120	AAC			0.378	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323848.2		NM_006873	
PSME4	23198	bcgsc.ca	37	2	54155274	54155274	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:54155274T>C	ENST00000404125.1	-	11	1538	c.1483A>G	c.(1483-1485)Aat>Gat	p.N495D	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	495					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CTAAAGTCATTTGGATCCACC	0.443																																					p.N495D													.	PSME4	247		0			c.A1483G												118.0	101.0	107.0					2																	54155274		2203	4300	6503	SO:0001583	missense	23198	exon11			AGTCATTTGGATC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1483A>G	2.37:g.54155274T>C	ENSP00000384211:p.Asn495Asp		169	0	0		170	0.01	1	NM_014614	46	0.00	0	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	37	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	32	5.120552	0.94385	.	.	ENSG00000068878	ENST00000404125	T	0.04758	3.56	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.03296	-1.1051	10	0.87932	D	0	.	15.9884	0.80179	0.0:0.0:0.0:1.0	.	495	Q14997	PSME4_HUMAN	D	495	ENSP00000384211:N495D	ENSP00000374643:N495D	N	-	1	0	PSME4	54008778	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.037000	0.88933	2.172000	0.68678	0.473000	0.43528	AAT			0.443	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324163.1		XM_040158	
IGKV4-1	28908	broad.mit.edu	37	2	89185535	89185535	+	RNA	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:89185535G>T	ENST00000390243.2	+	0	404							P06312	KV401_HUMAN	immunoglobulin kappa variable 4-1						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										CATTTACTGGGCATCTACCCG	0.532																																					.													.	.			0			.												66.0	66.0	66.0					2																	89185535		1883	4101	5984			0	.			TACTGGGCATCTA	Z00023		2p11.2	2012-02-08			ENSG00000211598	ENSG00000211598		"""Immunoglobulins / IGK locus"""	5834	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV41, B3		P06312	OTTHUMG00000151533		2.37:g.89185535G>T			246	0	0		225	0.02	5	.	12435	0.00	55		RNA	SNP	ENST00000390243.2	37																																																																																						0.532	IGKV4-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000323037.2		NG_000834	
BUB1	699	broad.mit.edu	37	2	111406949	111406949	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:111406949T>A	ENST00000302759.6	-	19	2327	c.2209A>T	c.(2209-2211)Att>Ttt	p.I737F	BUB1_ENST00000535254.1_Missense_Mutation_p.I717F|BUB1_ENST00000409311.1_Missense_Mutation_p.I737F	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	737					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TTCCCAACAATGAAGTCTTAA	0.318																																					p.I737F													.	BUB1	91		0			c.A2209T												68.0	70.0	69.0					2																	111406949		2203	4300	6503	SO:0001583	missense	699	exon19			CAACAATGAAGTC	AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2209A>T	2.37:g.111406949T>A	ENSP00000302530:p.Ile737Phe		223	0.0448430493	10		316	0.07	23	NM_004336	298	0.00	0	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	ENST00000302759.6	37	CCDS33273.1	.	.	.	.	.	.	.	.	.	.	T	14.13	2.444417	0.43429	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	T;T;T	0.38560	2.01;1.13;2.27	5.63	1.82	0.25136	.	0.401455	0.27060	N	0.021137	T	0.24586	0.0596	L	0.27053	0.805	0.30100	N	0.807492	B;P;P	0.48230	0.235;0.907;0.526	B;B;B	0.41988	0.083;0.372;0.078	T	0.23476	-1.0187	10	0.56958	D	0.05	-3.7843	2.2867	0.04128	0.1252:0.1447:0.1299:0.6001	.	717;737;737	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	F	717;737;737;737	ENSP00000441013:I717F;ENSP00000386701:I737F;ENSP00000302530:I737F	ENSP00000302530:I737F	I	-	1	0	BUB1	111123421	0.144000	0.22641	0.076000	0.20297	0.836000	0.47400	0.142000	0.16096	0.062000	0.16340	0.383000	0.25322	ATT			0.318	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331925.1		NM_004336	
EEF1B2	1933	broad.mit.edu	37	2	207025358	207025358	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:207025358A>G	ENST00000392222.2	+	2	502	c.127A>G	c.(127-129)Agc>Ggc	p.S43G	NDUFS1_ENST00000423725.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000392221.1_Missense_Mutation_p.S43G|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Missense_Mutation_p.S43G|NDUFS1_ENST00000432169.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	43	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.S43G(4)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						AGCCGTGTCCAGCCCACCGCC	0.468																																					p.S43G													EEF1B2,NS,carcinoma,0,19	EEF1B2	58	19	4	Substitution - Missense(4)	endometrium(2)|lung(1)|kidney(1)	c.A127G												109.0	99.0	102.0					2																	207025358		2203	4300	6503	SO:0001583	missense	1933	exon3			GTGTCCAGCCCAC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.127A>G	2.37:g.207025358A>G	ENSP00000376056:p.Ser43Gly		201	0.0049751244	1		219	0.02	4	NM_021121	3352	0.00	5	A8K795|Q6IBH9	Missense_Mutation	SNP	ENST00000392222.2	37	CCDS2367.1	.	.	.	.	.	.	.	.	.	.	A	0.014	-1.585588	0.00872	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222;ENST00000445505	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.47	0.911	0.19343	Glutathione S-transferase, C-terminal-like (2);	0.442134	0.26800	N	0.022437	T	0.19846	0.0477	N	0.16098	0.37	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18745	-1.0327	10	0.17832	T	0.49	-2.1703	6.3337	0.21285	0.2348:0.0:0.6384:0.1268	.	43	P24534	EF1B_HUMAN	G	43	ENSP00000236957:S43G;ENSP00000376055:S43G;ENSP00000376056:S43G;ENSP00000407730:S43G	ENSP00000236957:S43G	S	+	1	0	EEF1B2	206733603	0.049000	0.20398	0.145000	0.22337	0.051000	0.14879	0.879000	0.28146	-0.027000	0.13873	-0.252000	0.11476	AGC			0.468	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336436.1		NM_001037663	
EEF1B2	1933	broad.mit.edu	37	2	207025366	207025366	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:207025366G>A	ENST00000392222.2	+	2	510	c.135G>A	c.(133-135)ccG>ccA	p.P45P	NDUFS1_ENST00000423725.1_5'Flank|SNORA41_ENST00000384675.1_RNA|NDUFS1_ENST00000455934.2_5'Flank|EEF1B2_ENST00000392221.1_Silent_p.P45P|NDUFS1_ENST00000457011.1_5'Flank|NDUFS1_ENST00000233190.6_5'Flank|NDUFS1_ENST00000440274.1_5'Flank|SNORD51_ENST00000384320.2_RNA|NDUFS1_ENST00000449699.1_5'Flank|EEF1B2_ENST00000236957.5_Silent_p.P45P|NDUFS1_ENST00000432169.1_5'Flank	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	45	GST C-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)	p.P45P(5)		breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						CCAGCCCACCGCCTGCCGACT	0.448																																					p.P45P													EEF1B2,NS,carcinoma,0,19	EEF1B2	58	19	5	Substitution - coding silent(5)	kidney(2)|endometrium(2)|lung(1)	c.G135A												109.0	99.0	102.0					2																	207025366		2203	4300	6503	SO:0001819	synonymous_variant	1933	exon3			CCCACCGCCTGCC	X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.135G>A	2.37:g.207025366G>A			194	0.0051546392	1		216	0.02	4	NM_021121	3453	0.00	1	A8K795|Q6IBH9	Silent	SNP	ENST00000392222.2	37	CCDS2367.1																																																																																					0.448	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336436.1		NM_001037663	
HDAC4	9759	broad.mit.edu	37	2	240048208	240048208	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:240048208G>T	ENST00000345617.3	-	12	2253	c.1462C>A	c.(1462-1464)Cag>Aag	p.Q488K	HDAC4_ENST00000541256.1_Missense_Mutation_p.Q462K|HDAC4_ENST00000543185.1_Missense_Mutation_p.Q72K	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	488					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		tccagaaactgctgatgctgc	0.657																																					p.Q488K													.	HDAC4	127		0			c.C1462A												41.0	32.0	35.0					2																	240048208		2202	4299	6501	SO:0001583	missense	9759	exon12			GAAACTGCTGATG	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.1462C>A	2.37:g.240048208G>T	ENSP00000264606:p.Gln488Lys		87	0	0		100	0.03	3	NM_006037	7	0.00	0	Q9UND6	Missense_Mutation	SNP	ENST00000345617.3	37	CCDS2529.1	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684772	0.68157	.	.	ENSG00000068024	ENST00000345617;ENST00000456922;ENST00000543185;ENST00000541256;ENST00000393621	T;T;T	0.65178	4.39;-0.14;4.39	4.31	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.75744	0.3891	M	0.80746	2.51	0.80722	D	1	D;D;B;B;P;P	0.63046	0.965;0.992;0.18;0.025;0.846;0.918	P;P;B;B;B;P	0.56042	0.777;0.79;0.067;0.022;0.218;0.53	T	0.79586	-0.1742	9	.	.	.	.	17.1604	0.86802	0.0:0.0:1.0:0.0	.	488;371;462;462;456;488	B7Z8G5;F5H0Q9;F5H5W4;B7Z8I2;Q53SM2;P56524	.;.;.;.;.;HDAC4_HUMAN	K	488;376;72;462;371	ENSP00000264606:Q488K;ENSP00000440481:Q72K;ENSP00000443057:Q462K	.	Q	-	1	0	HDAC4	239713145	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.489000	0.81451	2.140000	0.66376	0.563000	0.77884	CAG			0.657	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257174.2		NM_006037	
PRR21	643905	broad.mit.edu	37	2	240982060	240982060	+	Missense_Mutation	SNP	C	C	A	rs201132375		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr2:240982060C>A	ENST00000408934.1	-	1	339	c.340G>T	c.(340-342)Ggc>Tgc	p.G114C		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	114	Pro-rich.									NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GACGAAGGGCCGTGGGTGAAG	0.632																																					p.G114C													.	PRR21	53		0			c.G340T												5.0	6.0	5.0					2																	240982060		1780	3608	5388	SO:0001583	missense	643905	exon1			AAGGGCCGTGGGT	AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.340G>T	2.37:g.240982060C>A	ENSP00000386166:p.Gly114Cys		71	0.0281690141	2		85	0.07	6	NM_001080835	0		0		Missense_Mutation	SNP	ENST00000408934.1	37	CCDS33417.1	.	.	.	.	.	.	.	.	.	.	-	6.902	0.535956	0.13188	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.38401	1.14;1.14	1.79	-0.572	0.11745	.	.	.	.	.	T	0.31327	0.0793	N	0.08118	0	0.09310	N	1	D	0.61697	0.99	D	0.65987	0.94	T	0.19353	-1.0308	9	0.54805	T	0.06	.	5.7444	0.18112	0.0:0.6255:0.0:0.3745	.	114	Q8WXC7	PRR21_HUMAN	C	114	ENSP00000386166:G114C;ENSP00000418240:G114C	ENSP00000386166:G114C	G	-	1	0	PRR21	240630733	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.452000	0.06787	-0.179000	0.10654	-0.438000	0.05819	GGC			0.632	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001080835	
ANGPT4	51378	mdanderson.org	37	20	865968	865968	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr20:865968G>T	ENST00000381922.3	-	4	690	c.588C>A	c.(586-588)agC>agA	p.S196R	ANGPT4_ENST00000546022.1_Splice_Site_p.S196R	NM_015985.2	NP_057069.1	Q9Y264	ANGP4_HUMAN	angiopoietin 4	196					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to hypoxia (GO:0071456)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)	27						TCTCGAGCGCGCTGCGGGGTA	0.697																																					p.S196R	Pancreas(181;481 2077 3259 31286 49856)												.	.			0			c.C588A												11.0	9.0	10.0					20																	865968		2181	4271	6452	SO:0001630	splice_region_variant	51378	exon4			GAGCGCGCTGCGG	AF074332	CCDS13009.1	20p13	2013-02-06			ENSG00000101280	ENSG00000101280		"""Fibrinogen C domain containing"""	487	protein-coding gene	gene with protein product		603705				10051567, 10218486	Standard	NM_015985		Approved		uc002wei.3	Q9Y264	OTTHUMG00000031652	ENST00000381922.3:c.588-1C>A	20.37:g.865968G>T			20	0	0		23	0.09	2	NM_015985	0		0	B4E3J9|Q5TFF4|Q9H4Z4	Missense_Mutation	SNP	ENST00000381922.3	37	CCDS13009.1	.	.	.	.	.	.	.	.	.	.	g	8.020	0.759349	0.15846	.	.	ENSG00000101280	ENST00000381922;ENST00000546022	T;T	0.12879	2.64;2.64	4.69	-0.617	0.11579	.	0.143577	0.42420	N	0.000717	T	0.09024	0.0223	L	0.45352	1.415	0.29711	N	0.839437	B;B	0.14012	0.009;0.004	B;B	0.10450	0.005;0.005	T	0.17077	-1.0381	10	0.27785	T	0.31	.	5.0078	0.14297	0.3785:0.1629:0.4586:0.0	.	196;196	B4E3J9;Q9Y264	.;ANGP4_HUMAN	R	196	ENSP00000371347:S196R;ENSP00000439605:S196R	ENSP00000371347:S196R	S	-	3	2	ANGPT4	813968	0.854000	0.29725	0.902000	0.35471	0.039000	0.13416	1.035000	0.30216	0.056000	0.16144	0.450000	0.29827	AGC			0.697	ANGPT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077493.1		NM_015985	Missense_Mutation
TMX4	56255	broad.mit.edu	37	20	8000252	8000252	+	Silent	SNP	A	A	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr20:8000252A>C	ENST00000246024.2	-	1	224	c.9T>G	c.(7-9)ggT>ggG	p.G3G	RP5-971N18.3_ENST00000457707.1_RNA|RP5-971N18.3_ENST00000607924.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	3					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CGCAGCGCCCACCCGCCATGT	0.761																																					p.G3G													.	TMX4	39		0			c.T9G												1.0	1.0	1.0					20																	8000252		958	2169	3127	SO:0001819	synonymous_variant	56255	exon1			GCGCCCACCCGCC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.9T>G	20.37:g.8000252A>C			47	0.2978723404	14		50	0.54	27	NM_021156	5	0.00	0	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Silent	SNP	ENST00000246024.2	37	CCDS13101.1																																																																																					0.761	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000077928.2		NM_021156	
BAGE2	85319	broad.mit.edu	37	21	11057305	11057306	+	RNA	INS	-	-	G	rs150202290		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:11057305_11057306insG	ENST00000470054.1	-	0	487							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGGAGAAGATAGGAAAAAAAGC	0.347																																					.													.	.			0			.																																											85319	.			GAAGATAGGAAAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11057307_11057307dupG			6	0	0		7	0.43	3	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.347	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
FBXW11P1	54099	bcgsc.ca	37	21	33000644	33000644	+	IGR	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:33000644G>A								AP000251.3 (67844 upstream) : AP000253.1 (25261 downstream)																							TGGTAACCAGGTACAAAAGAA	0.448																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	54099	.			AACCAGGTACAAA																													21.37:g.33000644G>A			89	0	0		155	0.00	0	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.448										
UMODL1	89766	bcgsc.ca	37	21	43531009	43531009	+	Missense_Mutation	SNP	G	G	A	rs200274014		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:43531009G>A	ENST00000408910.2	+	11	1677	c.1677G>A	c.(1675-1677)atG>atA	p.M559I	UMODL1_ENST00000400427.1_Missense_Mutation_p.M487I|UMODL1_ENST00000400424.2_Missense_Mutation_p.M487I|UMODL1_ENST00000408989.2_Missense_Mutation_p.M559I|C21orf128_ENST00000329015.2_5'Flank	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	559			M -> T (in dbSNP:rs220126). {ECO:0000269|PubMed:15194491, ECO:0000269|PubMed:16026467}.		adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						TGAGCCCCATGGGCGGTGGAC	0.632																																					p.M559I	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)												.	UMODL1	186		0			c.G1677A																																									SO:0001583	missense	89766	exon11			CCCCATGGGCGGT		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1677G>A	21.37:g.43531009G>A	ENSP00000386147:p.Met559Ile		182	0	0		215	0.00	0	NM_173568	0		0	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	37	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	6.659	0.490150	0.12702	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.70516	-0.48;-0.49;-0.48;-0.49	3.7	-7.41	0.01392	.	0.642001	0.12970	N	0.424186	T	0.43389	0.1245	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.15052	0.012;0.0	T	0.26643	-1.0097	10	0.66056	D	0.02	-0.9973	8.8428	0.35153	0.4946:0.3748:0.1306:0.0	.	559;559	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	I	487;487;559;559	ENSP00000383279:M487I;ENSP00000383276:M487I;ENSP00000386126:M559I;ENSP00000386147:M559I	ENSP00000383276:M487I	M	+	3	0	UMODL1	42404078	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.158000	0.01281	-3.017000	0.00271	-1.741000	0.00685	ATG			0.632	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195292.2			
SLC37A1	54020	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	21	43999906	43999906	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr21:43999906G>A	ENST00000352133.2	+	19	2564	c.1582G>A	c.(1582-1584)Gtt>Att	p.V528I	SLC37A1_ENST00000398341.3_Missense_Mutation_p.V528I			P57057	GLPT_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 1	528					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(3)	15						GGGGGACCAAGTTCCGTAAGT	0.567																																					p.V528I													.	.			0			c.G1582A												66.0	53.0	58.0					21																	43999906		2203	4300	6503	SO:0001583	missense	54020	exon20			GACCAAGTTCCGT	AJ269529	CCDS13689.1	21q22.3	2013-07-17	2013-07-17		ENSG00000160190	ENSG00000160190		"""Solute carriers"""	11024	protein-coding gene	gene with protein product		608094	"""solute carrier family 37 (glycerol-3-phosphate transporter), member 1"""			11112347	Standard	NM_018964		Approved		uc002zbi.3	P57057	OTTHUMG00000086803	ENST00000352133.2:c.1582G>A	21.37:g.43999906G>A	ENSP00000344648:p.Val528Ile		42	0	0		95	0.12	11	NM_018964	77	0.22	17	D3DSJ7|Q9HAQ1	Missense_Mutation	SNP	ENST00000352133.2	37	CCDS13689.1	.	.	.	.	.	.	.	.	.	.	G	10.73	1.432987	0.25813	.	.	ENSG00000160190	ENST00000398341;ENST00000352133	T;T	0.22743	1.94;1.94	4.86	2.89	0.33648	.	0.317898	0.27831	N	0.017672	T	0.16300	0.0392	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18524	-1.0334	10	0.21014	T	0.42	-5.5118	11.8725	0.52529	0.0:0.3353:0.6647:0.0	.	528	P57057	GLPT_HUMAN	I	528	ENSP00000381383:V528I;ENSP00000344648:V528I	ENSP00000344648:V528I	V	+	1	0	SLC37A1	42872975	0.910000	0.30920	0.485000	0.27403	0.677000	0.39632	1.350000	0.34010	1.154000	0.42482	0.462000	0.41574	GTT			0.567	SLC37A1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195377.1			
LRP5L	91355	bcgsc.ca	37	22	25755835	25755835	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr22:25755835G>A	ENST00000402785.2	-	1	321	c.225C>T	c.(223-225)gaC>gaT	p.D75D	LRP5L_ENST00000444995.3_Silent_p.D75D|LRP5L_ENST00000402859.2_Silent_p.D75D			A4QPB2	LRP5L_HUMAN	low density lipoprotein receptor-related protein 5-like	75					canonical Wnt signaling pathway (GO:0060070)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)		Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	6						GCTCGTCCATGTCCTCTGACA	0.622																																					p.D75D													.	LRP5L	23		0			c.C225T												170.0	143.0	152.0					22																	25755835		2200	4300	6500	SO:0001819	synonymous_variant	91355	exon3			GTCCATGTCCTCT	AL137651	CCDS33626.1	22q11.23	2013-05-30			ENSG00000100068	ENSG00000100068			25323	protein-coding gene	gene with protein product							Standard	NM_182492		Approved	DKFZp434O0213	uc011ajz.2	A4QPB2	OTTHUMG00000150900	ENST00000402785.2:c.225C>T	22.37:g.25755835G>A			163	0	0		151	0.00	0	NM_001135772	9	0.00	0	B0QYF3|B0QYF4|B2RPI5	Silent	SNP	ENST00000402785.2	37	CCDS33626.1																																																																																					0.622	LRP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320477.2		NM_182492	
ITPR1	3708	bcgsc.ca	37	3	4747945	4747945	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:4747945G>T	ENST00000443694.2	+	34	4707	c.4707G>T	c.(4705-4707)atG>atT	p.M1569I	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000423119.2_Missense_Mutation_p.M1575I|ITPR1_ENST00000302640.8_Missense_Mutation_p.M1569I|ITPR1_ENST00000354582.6_Missense_Mutation_p.M1584I|ITPR1_ENST00000357086.4_Missense_Mutation_p.M1575I|ITPR1_ENST00000456211.2_Missense_Mutation_p.M1560I			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1584				AIAIPVDLDSQVNNLFLKSHSIVQK -> HCHSRGPGQPSQ QPLSQVPQHCAE (in Ref. 6; AAD14386). {ECO:0000305}.	activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	AAACAGCCATGAACTGGCGGC	0.557																																					p.M1575I													.	ITPR1	659		0			c.G4725T												51.0	55.0	54.0					3																	4747945		1999	4169	6168	SO:0001583	missense	3708	exon37			AGCCATGAACTGG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4707G>T	3.37:g.4747945G>T	ENSP00000401671:p.Met1569Ile		73	0	0		110	0.00	0	NM_001099952	4	0.00	0	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	G	8.333	0.827011	0.16749	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.62788	0.0;0.0;0.0;0.0;0.0;0.0	5.26	4.36	0.52297	.	0.208186	0.50627	D	0.000104	T	0.51176	0.1659	L	0.34521	1.04	0.80722	D	1	B;B	0.22909	0.01;0.077	B;B	0.21917	0.013;0.037	T	0.43032	-0.9416	10	0.21014	T	0.42	.	15.8935	0.79318	0.0:0.1359:0.8641:0.0	.	1584;1575	Q14643;G5E9P1	ITPR1_HUMAN;.	I	1584;1569;1584;1575;30;1575;1560;1569	ENSP00000306253:M1569I;ENSP00000346595:M1584I;ENSP00000405934:M1575I;ENSP00000349597:M1575I;ENSP00000397885:M1560I;ENSP00000401671:M1569I	ENSP00000306253:M1569I	M	+	3	0	ITPR1	4722945	1.000000	0.71417	1.000000	0.80357	0.309000	0.27889	2.790000	0.47821	1.291000	0.44653	0.655000	0.94253	ATG			0.557	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
SLC4A7	9497	broad.mit.edu	37	3	27473139	27473140	+	Frame_Shift_Ins	INS	-	-	G	rs369043562|rs145640462	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:27473139_27473140insG	ENST00000295736.5	-	7	842_843	c.772_773insC	c.(772-774)cgcfs	p.R258fs	SLC4A7_ENST00000455077.1_Intron|SLC4A7_ENST00000454389.1_Frame_Shift_Ins_p.R267fs|SLC4A7_ENST00000388777.4_5'UTR|SLC4A7_ENST00000446700.1_Frame_Shift_Ins_p.R250fs|SLC4A7_ENST00000445684.1_Frame_Shift_Ins_p.R254fs|SLC4A7_ENST00000437179.1_Intron|SLC4A7_ENST00000425128.2_Frame_Shift_Ins_p.R250fs|SLC4A7_ENST00000440156.1_Frame_Shift_Ins_p.R254fs|SLC4A7_ENST00000428386.1_Intron|SLC4A7_ENST00000435667.2_Intron	NM_003615.4	NP_003606.3	Q9Y6M7	S4A7_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 7	258					auditory receptor cell development (GO:0060117)|bicarbonate transport (GO:0015701)|cochlear nucleus development (GO:0021747)|ion transport (GO:0006811)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal cell programmed cell death (GO:0046666)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(12)|lung(9)|ovary(4)|skin(1)	38					Sodium bicarbonate(DB01390)	CAAAGAGTGGCGGGAGGCTGAA	0.401																																					p.R258fs													SLC4A7,NS,carcinoma,-1,1	SLC4A7	119	1	0			c.773_774insC																																									SO:0001589	frameshift_variant	9497	exon7			GAGTGGCGGGAGG	AB012130	CCDS33721.1, CCDS58819.1, CCDS58820.1	3p24.1	2013-05-22			ENSG00000033867	ENSG00000033867		"""Solute carriers"""	11033	protein-coding gene	gene with protein product		603353		SLC4A6		10198178, 9610397	Standard	NM_003615		Approved	NBC3, SBC2	uc003cdv.4	Q9Y6M7	OTTHUMG00000155679	ENST00000295736.5:c.773dupC	3.37:g.27473142_27473142dupG	ENSP00000295736:p.Arg258fs		97	0	0		149	0.07	11	NM_003615	0		0	A6NIA8|B2CI53|B5M449|B5M451|B5M452|B5M453|B6DY52|B6DY53|C9JST9|D3K174|D3K175|O60350|Q6AHZ9|Q9HC88|Q9UIB9	Frame_Shift_Ins	INS	ENST00000295736.5	37	CCDS33721.1																																																																																					0.401	SLC4A7-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000341230.2		NM_003615	
TNIK	23043	broad.mit.edu	37	3	170875321	170875321	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr3:170875321G>T	ENST00000436636.2	-	12	1493	c.1149C>A	c.(1147-1149)caC>caA	p.H383Q	TNIK_ENST00000470834.1_Missense_Mutation_p.H383Q|TNIK_ENST00000369326.5_Missense_Mutation_p.H383Q|TNIK_ENST00000475336.1_Missense_Mutation_p.H383Q|TNIK_ENST00000341852.6_Missense_Mutation_p.H383Q|TNIK_ENST00000460047.1_Missense_Mutation_p.H383Q|TNIK_ENST00000488470.1_Missense_Mutation_p.H383Q|TNIK_ENST00000284483.8_Missense_Mutation_p.H383Q|TNIK_ENST00000357327.5_Missense_Mutation_p.H383Q|TNIK_ENST00000538048.1_Missense_Mutation_p.H383Q	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	383	Mediates interaction with NEDD4.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			gctgccgcttgtgctcctcat	0.652																																					p.H383Q													.	TNIK	313		0			c.C1149A												12.0	15.0	14.0					3																	170875321		2122	4240	6362	SO:0001583	missense	23043	exon12			CCGCTTGTGCTCC	AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.1149C>A	3.37:g.170875321G>T	ENSP00000399511:p.His383Gln		197	0.0101522843	2		216	0.02	5	NM_001161562	2	0.00	0	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	ENST00000436636.2	37	CCDS46956.1	.	.	.	.	.	.	.	.	.	.	G	17.07	3.294222	0.60086	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834	T;T;T;T;T;T;T;T;T;T	0.40225	3.76;1.04;3.75;1.04;4.39;1.04;1.04;3.75;3.75;1.04	5.62	1.81	0.25067	.	0.100250	0.64402	D	0.000002	T	0.37183	0.0994	M	0.74881	2.28	0.49483	D	0.999792	P;P;P;P;P;P;P;B	0.36535	0.557;0.557;0.557;0.557;0.557;0.557;0.557;0.421	B;B;B;B;B;B;B;B	0.33620	0.167;0.167;0.167;0.167;0.167;0.167;0.167;0.08	T	0.12682	-1.0538	10	0.18710	T	0.47	.	9.8847	0.41255	0.3374:0.0:0.6626:0.0	.	383;383;383;383;383;383;383;383	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	Q	383	ENSP00000399511:H383Q;ENSP00000358332:H383Q;ENSP00000443278:H383Q;ENSP00000345352:H383Q;ENSP00000284483:H383Q;ENSP00000418156:H383Q;ENSP00000349880:H383Q;ENSP00000418916:H383Q;ENSP00000418378:H383Q;ENSP00000419990:H383Q	ENSP00000284483:H383Q	H	-	3	2	TNIK	172358015	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.522000	0.45572	0.049000	0.15920	0.561000	0.74099	CAC			0.652	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000352973.2		XM_039796	
FGFRL1	53834	broad.mit.edu	37	4	1016078	1016078	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:1016078A>C	ENST00000398484.2	+	4	747	c.167A>C	c.(166-168)gAc>gCc	p.D56A	FGFRL1_ENST00000510644.1_Missense_Mutation_p.D56A|FGFRL1_ENST00000504138.1_Missense_Mutation_p.D56A|FGFRL1_ENST00000264748.6_Missense_Mutation_p.D56A			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	56	Ig-like C2-type 1.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTGGAGGGGGACCCGCCGCCG	0.716																																					p.D56A													.	FGFRL1	77		0			c.A167C																																									SO:0001583	missense	53834	exon3			AGGGGGACCCGCC		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.167A>C	4.37:g.1016078A>C	ENSP00000381498:p.Asp56Ala		78	0.0897435897	7		90	0.12	11	NM_001004356	21	0.00	0	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Missense_Mutation	SNP	ENST00000398484.2	37	CCDS3344.1	.	.	.	.	.	.	.	.	.	.	a	15.57	2.874135	0.51695	.	.	ENSG00000127418	ENST00000398484;ENST00000542622;ENST00000510644;ENST00000504138;ENST00000512174;ENST00000507339;ENST00000264748	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	4.62	3.45	0.39498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.72447	0.3461	L	0.48362	1.52	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.72027	-0.4414	10	0.49607	T	0.09	-37.0128	8.5416	0.33395	0.9055:0.0:0.0945:0.0	.	56	Q8N441	FGRL1_HUMAN	A	56;26;56;56;56;56;56	ENSP00000381498:D56A;ENSP00000425025:D56A;ENSP00000423091:D56A;ENSP00000426740:D56A;ENSP00000424037:D56A;ENSP00000264748:D56A	ENSP00000264748:D56A	D	+	2	0	FGFRL1	1006078	1.000000	0.71417	0.988000	0.46212	0.004000	0.04260	3.361000	0.52306	1.713000	0.51359	0.375000	0.23000	GAC			0.716	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239195.2		NM_021923	
FGFRL1	53834	hgsc.bcm.edu	37	4	1019078	1019078	+	Silent	SNP	T	T	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:1019078T>A	ENST00000398484.2	+	8	2038	c.1458T>A	c.(1456-1458)tcT>tcA	p.S486S	FGFRL1_ENST00000510644.1_Silent_p.S486S|FGFRL1_ENST00000504138.1_Silent_p.S486S|RP11-460I19.2_ENST00000503095.1_lincRNA|FGFRL1_ENST00000264748.6_Silent_p.S486S			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	486	His-rich.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			acacacactctcacacacact	0.607																																					p.S486S													FGFRL1,colon,carcinoma,+2,1	FGFRL1	2	1	0			c.T1458A												12.0	14.0	13.0					4																	1019078		2171	4277	6448	SO:0001819	synonymous_variant	53834	exon7			ACACTCTCACACA		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.1458T>A	4.37:g.1019078T>A			264	0.0075757576	2		224	0.04	9	NM_001004356	98	0.00	0	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Silent	SNP	ENST00000398484.2	37	CCDS3344.1																																																																																					0.607	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239195.2		NM_021923	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	55599338	55599338	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:55599338A>T	ENST00000288135.5	+	17	2561	c.2464A>T	c.(2464-2466)Aat>Tat	p.N822Y		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	822	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		N -> K (in a germ cell tumor of the testis; somatic mutation). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N822Y(5)|p.N822H(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAATGATTCTAATTATGTGGT	0.378		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.N822Y			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,malignant_melanoma,0,44	KIT	0	44	6	Substitution - Missense(6)	genital_tract(2)|testis(1)|haematopoietic_and_lymphoid_tissue(1)|soft_tissue(1)|skin(1)	c.A2464T	GRCh37	CM087050	KIT	M								146.0	149.0	148.0					4																	55599338		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GATTCTAATTATG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2464A>T	4.37:g.55599338A>T	ENSP00000288135:p.Asn822Tyr		90	0	0		159	0.09	15	NM_000222	976	0.20	198	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.416486	0.83449	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82255	-1.59;-1.59	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000009	D	0.85080	0.5615	N	0.20445	0.575	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.92;1.0	D	0.87693	0.2555	10	0.87932	D	0	.	15.5485	0.76129	1.0:0.0:0.0:0.0	.	818;822	P10721-2;P10721	.;KIT_HUMAN	Y	822;818	ENSP00000288135:N822Y;ENSP00000390987:N818Y	ENSP00000288135:N822Y	N	+	1	0	KIT	55294095	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.138000	0.94501	2.084000	0.62774	0.477000	0.44152	AAT			0.378	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
UGT2B11	10720	mdanderson.org	37	4	70066408	70066408	+	Missense_Mutation	SNP	C	C	A	rs200919649		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:70066408C>A	ENST00000446444.1	-	6	1348	c.1340G>T	c.(1339-1341)aGa>aTa	p.R447I	RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	447					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						ATGTTGAATTCTTGATAATTT	0.373																																					p.R447I													.	.			0			c.G1340T												66.0	71.0	69.0					4																	70066408		2203	4298	6501	SO:0001583	missense	10720	exon6			TGAATTCTTGATA	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.1340G>T	4.37:g.70066408C>A	ENSP00000387683:p.Arg447Ile		80	0.0375	3		188	0.06	11	NM_001073	0		0	Q3KNV9	Missense_Mutation	SNP	ENST00000446444.1	37	CCDS3527.1	.	.	.	.	.	.	.	.	.	.	-	4.019	0.000882	0.07819	.	.	ENSG00000213759	ENST00000446444	T	0.62788	0.0	1.27	0.283	0.15696	.	0.310296	0.24102	U	0.041536	T	0.51787	0.1695	L	0.50993	1.605	0.30965	N	0.723211	B	0.20780	0.048	B	0.25987	0.065	T	0.53351	-0.8451	10	0.72032	D	0.01	.	7.0366	0.24996	0.0:0.7131:0.2869:0.0	.	447	O75310	UDB11_HUMAN	I	447	ENSP00000387683:R447I	ENSP00000387683:R447I	R	-	2	0	UGT2B11	70100997	0.000000	0.05858	0.541000	0.28102	0.201000	0.24016	-0.075000	0.11431	0.079000	0.16929	0.184000	0.17185	AGA			0.373	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251551.2		NM_001073	
TENM3	55714	broad.mit.edu	37	4	183090233	183090234	+	RNA	INS	-	-	ACAT	rs147460271|rs35896361		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr4:183090233_183090234insACAT	ENST00000505389.1	+	0	120				MIR1305_ENST00000408300.1_RNA																							GCcatacacacacacacacaca	0.371																																					.													.	.			0			.																																											0	.			TACACACACACAC																													4.37:g.183090233_183090234insACAT			7	0	0		20	0.45	9	.	0		0		RNA	INS	ENST00000505389.1	37																																																																																						0.371	RP11-402C9.1-001	KNOWN	basic	sense_intronic	sense_intronic		OTTHUMT00000361751.1			
RANBP17	64901	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	5	170669748	170669748	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr5:170669748G>T	ENST00000523189.1	+	24	2864	c.2700G>T	c.(2698-2700)atG>atT	p.M900I	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	900					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGGACCATATGAGCTTCATCA	0.428			T	TRD@	ALL																																p.M900I				Dom	yes		5	5q34	64901	RAN binding protein 17		L	.	.			0			c.G2700T												200.0	177.0	185.0					5																	170669748		2203	4300	6503	SO:0001583	missense	64901	exon24			CCATATGAGCTTC	AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.2700G>T	5.37:g.170669748G>T	ENSP00000427975:p.Met900Ile		152	0	0		193	0.10	20	NM_022897	26	0.15	4	Q8IU74	Missense_Mutation	SNP	ENST00000523189.1	37	CCDS34287.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.287880	0.59976	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.66280	-0.2	5.39	5.39	0.77823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52996	0.1769	L	0.31157	0.91	0.58432	D	0.999998	B;B	0.13145	0.007;0.007	B;B	0.19148	0.024;0.024	T	0.44112	-0.9349	10	0.22109	T	0.4	-18.2485	19.5244	0.95197	0.0:0.0:1.0:0.0	.	900;900	Q546R4;Q9H2T7	.;RBP17_HUMAN	I	900;330	ENSP00000427975:M900I	ENSP00000427975:M900I	M	+	3	0	RANBP17	170602353	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.813000	0.99286	2.683000	0.91414	0.655000	0.94253	ATG			0.428	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000372036.1		NM_022897	
LOC105375009	105375009	broad.mit.edu	37	6	29478153	29478156	+	lincRNA	DEL	AGAG	AGAG	-	rs146053000		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	AGAG	AGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:29478153_29478156delAGAG	ENST00000436804.1	+	0	697_700																											GTGTGGGGGCAGAGAGAGAGAGAG	0.529																																					.													.	.			0			.																																											0	.			GGGGGCAGAGAGA																													6.37:g.29478161_29478164delAGAG			5	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000436804.1	37																																																																																						0.529	XXbac-BPG13B8.10-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000194570.1			
PRRC2A	7916	broad.mit.edu	37	6	31593349	31593349	+	Silent	SNP	A	A	C	rs200705973		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:31593349A>C	ENST00000376033.2	+	7	954	c.720A>C	c.(718-720)ccA>ccC	p.P240P	SNORA38_ENST00000363946.1_RNA|PRRC2A_ENST00000376007.4_Silent_p.P240P|PRRC2A_ENST00000469577.1_3'UTR	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	240	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.P240P(1)		breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CTTCAGGCCCACCCCAGTTCC	0.602																																					p.P240P													PRRC2A,NS,carcinoma,0,1	PRRC2A	152	1	1	Substitution - coding silent(1)	endometrium(1)	c.A720C												79.0	80.0	79.0					6																	31593349		2203	4300	6503	SO:0001819	synonymous_variant	7916	exon7			AGGCCCACCCCAG	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.720A>C	6.37:g.31593349A>C			134	0.0597014925	8		148	0.14	20	NM_004638	214	0.01	3	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	37	CCDS4708.1																																																																																					0.602	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259319.1		NM_080686	
ARMC12	221481	mdanderson.org	37	6	35705924	35705924	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr6:35705924G>A	ENST00000373866.3	+	2	306	c.284G>A	c.(283-285)cGc>cAc	p.R95H	RP3-510O8.4_ENST00000452048.1_RNA|ARMC12_ENST00000288065.2_Missense_Mutation_p.R122H|ARMC12_ENST00000373869.3_Missense_Mutation_p.R95H			Q5T9G4	ARM12_HUMAN	armadillo repeat containing 12	95						nucleus (GO:0005634)											AGTATCACTCGCTGTGTGTAC	0.622											OREG0017379	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R122H													.	.			0			c.G365A												85.0	86.0	86.0					6																	35705924		2203	4300	6503	SO:0001583	missense	221481	exon2			TCACTCGCTGTGT	AK058119	CCDS4809.1, CCDS69093.1, CCDS69094.1	6p21.31	2013-02-14	2011-12-14	2011-12-14	ENSG00000157343	ENSG00000157343		"""Armadillo repeat containing"""	21099	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 81"""	C6orf81			Standard	XM_005248920		Approved	FLJ25390	uc003ola.3	Q5T9G4	OTTHUMG00000014577	ENST00000373866.3:c.284G>A	6.37:g.35705924G>A	ENSP00000362973:p.Arg95His		40	0	0	857	42	0.07	3	NM_145028	0		0	Q8NEB2|Q96LL8	Missense_Mutation	SNP	ENST00000373866.3	37		.	.	.	.	.	.	.	.	.	.	G	24.0	4.482022	0.84747	.	.	ENSG00000157343	ENST00000373869;ENST00000288065;ENST00000373866	T;T;T	0.66995	-0.24;-0.24;-0.24	5.28	5.28	0.74379	.	0.000000	0.56097	D	0.000039	T	0.66187	0.2764	L	0.32530	0.975	0.38677	D	0.952443	D;D	0.89917	1.0;1.0	D;D	0.74023	0.973;0.982	T	0.66578	-0.5888	10	0.40728	T	0.16	.	14.8248	0.70104	0.0:0.0:1.0:0.0	.	95;122	Q5T9G4-3;Q5T9G4-2	.;.	H	95;122;95	ENSP00000362976:R95H;ENSP00000288065:R122H;ENSP00000362973:R95H	ENSP00000288065:R122H	R	+	2	0	C6orf81	35813902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.192000	0.65115	2.631000	0.89168	0.558000	0.71614	CGC			0.622	ARMC12-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000040311.2		NM_145028	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	4304811	4304811	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:4304811A>G	ENST00000404826.2	+	45	6576	c.6437A>G	c.(6436-6438)tAc>tGc	p.Y2146C	SDK1_ENST00000389531.3_Missense_Mutation_p.Y2126C|SDK1_ENST00000466611.1_3'UTR	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	2146					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTGAACCACTACATGAGCGAC	0.687																																					p.Y2146C													.	.			0			c.A6437G												66.0	68.0	68.0					7																	4304811		2203	4300	6503	SO:0001583	missense	221935	exon45			ACCACTACATGAG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.6437A>G	7.37:g.4304811A>G	ENSP00000385899:p.Tyr2146Cys		82	0	0		116	0.07	8	NM_152744	3	0.00	0	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	20.6	4.024556	0.75390	.	.	ENSG00000146555	ENST00000404826;ENST00000446104;ENST00000389531	T;T	0.72725	-0.66;-0.68	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000007	D	0.83862	0.5346	M	0.83953	2.67	0.58432	D	0.999997	D;D;D;D	0.89917	1.0;0.998;0.999;0.999	D;D;D;P	0.80764	0.994;0.911;0.98;0.903	D	0.86348	0.1709	10	0.87932	D	0	.	12.5626	0.56291	1.0:0.0:0.0:0.0	.	2126;206;633;2146	F8W6X9;Q7Z5N4-2;F2Z3E9;Q7Z5N4	.;.;.;SDK1_HUMAN	C	2146;394;2126	ENSP00000385899:Y2146C;ENSP00000374182:Y2126C	ENSP00000374182:Y2126C	Y	+	2	0	SDK1	4271337	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	8.706000	0.91362	1.698000	0.51180	0.454000	0.30748	TAC			0.687	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323702.1		NM_152744	
INHBA	3624	broad.mit.edu	37	7	41729988	41729988	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:41729988G>T	ENST00000242208.4	-	3	787	c.541C>A	c.(541-543)Cac>Aac	p.H181N	AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR|INHBA_ENST00000442711.1_Missense_Mutation_p.H181N	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	181					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CCCTGCGGGTGCTTCTGCTGC	0.572										TSP Lung(11;0.080)																											p.H181N													.	INHBA	118		0			c.C541A												99.0	92.0	94.0					7																	41729988		2203	4300	6503	SO:0001583	missense	3624	exon3			GCGGGTGCTTCTG		CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.541C>A	7.37:g.41729988G>T	ENSP00000242208:p.His181Asn		131	0.0076335878	1		167	0.03	5	NM_002192	2	0.00	0	Q14599	Missense_Mutation	SNP	ENST00000242208.4	37	CCDS5464.1	.	.	.	.	.	.	.	.	.	.	.	10.05	1.243471	0.22796	.	.	ENSG00000122641	ENST00000242208;ENST00000442711	T;T	0.63580	-0.05;-0.05	6.06	6.06	0.98353	Transforming growth factor-beta, N-terminal (1);	0.613516	0.17095	N	0.187228	T	0.43277	0.1240	N	0.08118	0	0.09310	N	0.999993	B	0.11235	0.004	B	0.09377	0.004	T	0.13845	-1.0494	10	0.19590	T	0.45	-8.2963	16.0307	0.80574	0.0:0.1335:0.8665:0.0	.	181	P08476	INHBA_HUMAN	N	181	ENSP00000242208:H181N;ENSP00000397197:H181N	ENSP00000242208:H181N	H	-	1	0	INHBA	41696513	0.991000	0.36638	0.985000	0.45067	0.977000	0.68977	4.134000	0.57990	2.882000	0.98803	0.655000	0.94253	CAC			0.572	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250793.1			
CCT6P3	643180	broad.mit.edu;ucsc.edu	37	7	64528850	64528850	+	RNA	SNP	T	T	G	rs2949472	byFrequency	TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:64528850T>G	ENST00000426828.1	+	0	638				SNORA15_ENST00000384334.1_RNA|SNORA22_ENST00000384614.1_RNA	NR_033416.1				chaperonin containing TCP1, subunit 6 (zeta) pseudogene 3																		GAATTCTGGCTTTTTTTACAA	0.284													t|||	73	0.0145767	0.034	0.0029	5008	,	,		16287	0.0169		0.004	False		,,,				2504	0.0051				.													.	.			0			.																																											0	.			TCTGGCTTTTTTT			7q11.21	2010-06-29			ENSG00000234585	ENSG00000234585			35137	pseudogene	pseudogene							Standard	NR_033416		Approved		uc010kzt.1		OTTHUMG00000156630		7.37:g.64528850T>G			22	0	0		37	0.16	6	.	9	0.00	0		RNA	SNP	ENST00000426828.1	37																																																																																						0.284	CCT6P3-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344862.1			
TRIM74	378108	broad.mit.edu	37	7	72436665	72436666	+	Missense_Mutation	DNP	CA	CA	TG	rs375481461|rs369836495		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:72436665_72436666CA>TG	ENST00000285805.3	-	2	222_223	c.23_24TG>CA	c.(22-24)cTG>cCA	p.L8P	TRIM74_ENST00000395244.1_Missense_Mutation_p.L8P	NM_198853.1	NP_942150.1	Q86UV6	TRI74_HUMAN	tripartite motif containing 74	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			prostate(1)	1						CCTCCAGCTCCAGCAGGCTCAC	0.609																																					p.L8P													TRIM74,NS,carcinoma,0,1	.		1	0			.																																									SO:0001583	missense	378108	.			CAGCTCCAGCAGG	AF498999	CCDS5545.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000155428	ENSG00000155428		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	17453	protein-coding gene	gene with protein product		612550	"""tripartite motif-containing 50C"", ""tripartite motif-containing 74"""	TRIM50C			Standard	NM_198853		Approved	MGC45440		Q86UV6	OTTHUMG00000129851	ENST00000285805.3:c.23_24delinsTG	7.37:g.72436665_72436666delinsTG	ENSP00000285805:p.Leu8Pro		138	0.0072463768	1		192	0.04	7	.	0		0	B7WP46	Missense_Mutation	DNP	ENST00000285805.3	37	CCDS5545.1																																																																																					0.609	TRIM74-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252093.1		NM_198853	
MUC17	140453	hgsc.bcm.edu	37	7	100681533	100681533	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:100681533C>A	ENST00000306151.4	+	3	6900	c.6836C>A	c.(6835-6837)aCt>aAt	p.T2279N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2279	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAACGACTCCATTAACA	0.478																																					p.T2279N													.	.			0			c.C6836A																																									SO:0001583	missense	140453	exon3			GAACGACTCCATT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6836C>A	7.37:g.100681533C>A	ENSP00000302716:p.Thr2279Asn		102	0	0		175	0.05	8	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	2.491	-0.317530	0.05386	.	.	ENSG00000169876	ENST00000306151	T	0.02472	4.28	0.762	0.762	0.18454	.	.	.	.	.	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	P	0.51933	0.949	P	0.51297	0.665	T	0.49679	-0.8914	9	0.35671	T	0.21	.	6.9517	0.24548	0.0:0.9999:0.0:1.0E-4	.	2279	Q685J3	MUC17_HUMAN	N	2279	ENSP00000302716:T2279N	ENSP00000302716:T2279N	T	+	2	0	MUC17	100468253	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.068000	0.14531	0.132000	0.18615	0.134000	0.15878	ACT			0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
KMT2E	55904	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	104703808	104703808	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:104703808A>G	ENST00000311117.3	+	5	742	c.197A>G	c.(196-198)tAt>tGt	p.Y66C	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Missense_Mutation_p.Y66C|KMT2E_ENST00000476671.1_Missense_Mutation_p.Y66C|KMT2E_ENST00000334877.4_Missense_Mutation_p.Y66C	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	66					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GACCATAATTATGGTGCTCGT	0.343																																					p.Y66C													.	.			0			c.A197G												75.0	77.0	77.0					7																	104703808		2203	4299	6502	SO:0001583	missense	55904	exon4			ATAATTATGGTGC	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.197A>G	7.37:g.104703808A>G	ENSP00000312379:p.Tyr66Cys		134	0	0		241	0.12	30	NM_018682	29	0.07	2	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	37	CCDS34723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.3|21.3	4.129288|4.129288	0.77549|0.77549	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000537308|ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000495267;ENST00000476671;ENST00000474203	.|D;D;D;T;D	.|0.94897	.|-3.23;-2.77;-3.23;1.29;-3.55	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.96027|0.96027	0.8706|0.8706	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.997;0.997	D|D	0.96655|0.96655	0.9484|0.9484	6|10	0.87932|0.87932	D|D	0|0	.|.	15.8148|15.8148	0.78592|0.78592	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|66;66	.|Q8IZD2;Q8IZD2-3	.|MLL5_HUMAN;.	V|C	1|66	.|ENSP00000312379:Y66C;ENSP00000335599:Y66C;ENSP00000257745:Y66C;ENSP00000420415:Y66C;ENSP00000417888:Y66C	ENSP00000439074:M1V|ENSP00000257745:Y66C	M|Y	+|+	1|2	0|0	MLL5|MLL5	104491044|104491044	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.043000|9.043000	0.93799|0.93799	2.200000|2.200000	0.70718|0.70718	0.477000|0.477000	0.44152|0.44152	ATG|TAT			0.343	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348697.1			
HYAL4	23553	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	123508991	123508991	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:123508991G>A	ENST00000223026.4	+	3	1302	c.664G>A	c.(664-666)Gat>Aat	p.D222N	HYAL4_ENST00000476325.1_Missense_Mutation_p.D222N	NM_012269.2	NP_036401.2	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	222					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|glycosaminoglycan catabolic process (GO:0006027)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	hyalurononglucosaminidase activity (GO:0004415)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	23						TTTATATCCTGATTGCCACAA	0.433																																					p.D222N													.	.			0			c.G664A												73.0	75.0	75.0					7																	123508991		2203	4300	6503	SO:0001583	missense	23553	exon3			TATCCTGATTGCC	AF009010	CCDS5789.1	7q31.3	2010-01-14			ENSG00000106302	ENSG00000106302			5323	protein-coding gene	gene with protein product	"""hyaluronidase 4"""	604510				10493834	Standard	NM_012269		Approved		uc003vlc.3	Q2M3T9	OTTHUMG00000157349	ENST00000223026.4:c.664G>A	7.37:g.123508991G>A	ENSP00000223026:p.Asp222Asn		103	0	0		178	0.12	22	NM_012269	89	0.10	9	D0VXG1|Q9UL99|Q9Y6T9	Missense_Mutation	SNP	ENST00000223026.4	37	CCDS5789.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777274	0.49786	.	.	ENSG00000106302	ENST00000223026;ENST00000476325	T;T	0.25912	1.77;1.77	6.03	5.16	0.70880	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	T	0.26557	0.0649	M	0.72624	2.21	0.41888	D	0.990353	B;P	0.42357	0.117;0.777	B;B	0.35931	0.084;0.214	T	0.08186	-1.0734	9	.	.	.	-23.7794	11.322	0.49428	0.1379:0.0:0.8621:0.0	.	222;222	F8WDH9;Q2M3T9	.;HYAL4_HUMAN	N	222	ENSP00000223026:D222N;ENSP00000417186:D222N	.	D	+	1	0	HYAL4	123296227	1.000000	0.71417	0.984000	0.44739	0.034000	0.12701	5.694000	0.68272	1.561000	0.49584	-0.136000	0.14681	GAT			0.433	HYAL4-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348545.1		NM_012269	
SLC37A3	84255	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	7	140064288	140064288	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:140064288G>A	ENST00000326232.9	-	5	498	c.295C>T	c.(295-297)Cta>Tta	p.L99L	SLC37A3_ENST00000447932.2_Silent_p.L99L|SLC37A3_ENST00000429996.2_Silent_p.L99L|SLC37A3_ENST00000340308.3_Silent_p.L99L|SLC37A3_ENST00000461089.1_5'UTR	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	99					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					CTGATGAATAGGCCCTAAAAA	0.368																																					p.L99L	Esophageal Squamous(133;211 1716 4665 11387 37873)												.	.			0			c.C295T												98.0	83.0	88.0					7																	140064288		2203	4300	6503	SO:0001819	synonymous_variant	84255	exon5			TGAATAGGCCCTA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.295C>T	7.37:g.140064288G>A			110	0	0		207	0.09	18	NM_207113	210	0.14	30	Q6PIU7|Q86SS4|Q9BQG7	Silent	SNP	ENST00000326232.9	37	CCDS5859.1																																																																																					0.368	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348492.1		NM_032295	
EPHB6	2051	bcgsc.ca;mdanderson.org	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S													.	EPHB6	168		0			c.C516T												83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	7.37:g.142562074C>T			95	0.0105263158	1		151	0.06	9	NM_004445	8	0.00	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																					0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341329.1			
ZFHX4	79776	bcgsc.ca	37	8	77775451	77775451	+	Silent	SNP	T	T	A	rs199874527		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:77775451T>A	ENST00000521891.2	+	11	9949	c.9501T>A	c.(9499-9501)ccT>ccA	p.P3167P	ZFHX4_ENST00000455469.2_Silent_p.P3122P|ZFHX4_ENST00000518282.1_Silent_p.P3141P|ZFHX4_ENST00000050961.6_Silent_p.P3118P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	3118					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ctccaccacctcctcctcctc	0.522										HNSCC(33;0.089)																											p.P3167P													ZFHX4,colon,carcinoma,0,3	ZFHX4	878	3	0			c.T9501A												52.0	53.0	53.0					8																	77775451		2064	4225	6289	SO:0001819	synonymous_variant	79776	exon11			ACCACCTCCTCCT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.9501T>A	8.37:g.77775451T>A			118	0	0		143	0.01	1	NM_024721	2	0.00	0	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	37	CCDS47878.2																																																																																					0.522	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379197.2		NM_024721	
KLF10	7071	broad.mit.edu	37	8	103663762	103663762	+	Silent	SNP	T	T	C			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:103663762T>C	ENST00000285407.6	-	3	1098	c.798A>G	c.(796-798)ggA>ggG	p.G266G	KLF10_ENST00000395884.3_Silent_p.G255G	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	266					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			TAGGTGGCACTCCCCCTGCAG	0.592											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G266G	Esophageal Squamous(16;495 519 2144 16528 44005)												.	KLF10	44		0			c.A798G												70.0	68.0	69.0					8																	103663762		2203	4300	6503	SO:0001819	synonymous_variant	7071	exon3			TGGCACTCCCCCT	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.798A>G	8.37:g.103663762T>C			70	0.0142857143	1	1375	96	0.04	4	NM_005655	121	0.00	0	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Silent	SNP	ENST00000285407.6	37	CCDS6294.1																																																																																					0.592	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379967.1			
LRP12	29967	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	8	105509852	105509852	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr8:105509852C>A	ENST00000276654.5	-	5	1036	c.928G>T	c.(928-930)Ggt>Tgt	p.G310C	LRP12_ENST00000424843.2_Missense_Mutation_p.G291C|LRP12_ENST00000518375.1_5'Flank	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	310	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TCACCATAACCAGTACCATCA	0.393																																					p.G310C													.	.			0			c.G928T												61.0	60.0	60.0					8																	105509852		2203	4300	6503	SO:0001583	missense	29967	exon5			CATAACCAGTACC	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.928G>T	8.37:g.105509852C>A	ENSP00000276654:p.Gly310Cys		255	0	0		401	0.09	37	NM_013437	11	0.18	2	A8K137|B4DRQ2	Missense_Mutation	SNP	ENST00000276654.5	37	CCDS6303.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645452	0.67358	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.09073	3.02;3.02	5.65	5.65	0.86999	CUB (5);	0.000000	0.85682	D	0.000000	T	0.14098	0.0341	N	0.04275	-0.24	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.47222	-0.9134	10	0.54805	T	0.06	-26.2997	19.7343	0.96195	0.0:1.0:0.0:0.0	.	291;310	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	C	291;310	ENSP00000399148:G291C;ENSP00000276654:G310C	ENSP00000276654:G310C	G	-	1	0	LRP12	105579028	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	7.294000	0.78760	2.660000	0.90430	0.467000	0.42956	GGT			0.393	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380821.1		NM_013437	
Unknown	0	bcgsc.ca	37	9	40500069	40500069	+	IGR	SNP	A	A	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:40500069A>T								AL353791.1 (467652 upstream) : RN7SL422P (16736 downstream)																							TTCAAACCCAACTTTTTTTTT	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AACCCAACTTTTT																													9.37:g.40500069A>T			189	0.0158730159	3		207	0.06	12	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.353										
LINC01410	103352539	broad.mit.edu	37	9	66458656	66458657	+	lincRNA	DEL	TT	TT	-	rs112515286		TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chr9:66458656_66458657delTT	ENST00000424345.1	+	0	67				RNA5SP283_ENST00000365604.1_RNA																							atcccttaactttttaactttt	0.45																																					.													.	.			0			.																																											0	.			CTTAACTTTTTAA																													9.37:g.66458658_66458659delTT			4	0	0		8	0.38	3	.	1	0.00	0		RNA	DEL	ENST00000424345.1	37																																																																																						0.450	RP11-262H14.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000128851.1			
RBM10	8241	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	X	47039331	47039331	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:47039331G>T	ENST00000377604.3	+	10	1696	c.954G>T	c.(952-954)ggG>ggT	p.G318G	RBM10_ENST00000478410.1_3'UTR|RBM10_ENST00000329236.7_Silent_p.G241G|RBM10_ENST00000345781.6_Silent_p.G241G	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	318	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						CCATCCTGGGGGCCCTGGCAC	0.592																																					p.G383G	Melanoma(171;120 2705 19495 39241)												.	.			0			c.G1149T												46.0	28.0	34.0					X																	47039331		2203	4300	6503	SO:0001819	synonymous_variant	8241	exon10			CCTGGGGGCCCTG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.954G>T	X.37:g.47039331G>T			134	0	0		136	0.21	28	NM_001204468	94	0.45	42	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Silent	SNP	ENST00000377604.3	37	CCDS14274.1																																																																																					0.592	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056381.1		NM_005676	
FOXP3	50943	broad.mit.edu;mdanderson.org	37	X	49108105	49108105	+	Intron	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:49108105G>A	ENST00000376207.4	-	11	1334				FOXP3_ENST00000557224.1_Missense_Mutation_p.A354V|FOXP3_ENST00000376199.2_Intron|FOXP3_ENST00000455775.2_Intron|FOXP3_ENST00000518685.1_Intron|FOXP3_ENST00000376197.1_Missense_Mutation_p.A339V	NM_014009.3	NP_054728.2	Q9BZS1	FOXP3_HUMAN	forkhead box P3						B cell homeostasis (GO:0001782)|CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|chromatin remodeling (GO:0006338)|cytokine production (GO:0001816)|myeloid cell homeostasis (GO:0002262)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chronic inflammatory response (GO:0002677)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of immune response (GO:0050777)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0032831)|positive regulation of histone acetylation (GO:0035066)|positive regulation of immature T cell proliferation in thymus (GO:0033092)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peripheral T cell tolerance induction (GO:0002851)|positive regulation of T cell anergy (GO:0002669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|T cell activation (GO:0042110)|T cell homeostasis (GO:0043029)|T cell mediated immunity (GO:0002456)|T cell receptor signaling pathway (GO:0050852)|tolerance induction to self antigen (GO:0002513)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|NFAT protein binding (GO:0051525)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)	10	Ovarian(276;0.236)					CCCAGTCACCGCCACCTCAGA	0.572													G|||	1	0.000264901	0.0	0.0014	3775	,	,		14753	0.0		0.0	False		,,,				2504	0.0				.	GBM(182;1432 2112 16160 23073 31774)												.	FOXP3	26		0			.												70.0	46.0	54.0					X																	49108105		2203	4299	6502	SO:0001627	intron_variant	50943	.			GTCACCGCCACCT		CCDS14323.1, CCDS48109.1	Xp11.23	2014-09-17		2002-09-20	ENSG00000049768	ENSG00000049768		"""Forkhead boxes"""	6106	protein-coding gene	gene with protein product		300292	"""immune dysregulation, polyendocrinopathy, enteropathy, X-linked"""	IPEX		10677306, 11138001	Standard	NM_014009		Approved	JM2, XPID, AIID, PIDX, DIETER, SCURFIN	uc004dnf.4	Q9BZS1	OTTHUMG00000024135	ENST00000376207.4:c.1146+19C>T	X.37:g.49108105G>A			29	0	0		56	0.07	4	.	0		0	A5HJT1|B7ZLG0|B9UN80|O60827|Q14DD8|Q4ZH51	Missense_Mutation	SNP	ENST00000376207.4	37	CCDS14323.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720286	0.30503	.	.	ENSG00000049768	ENST00000557224;ENST00000376197	D;D	0.97924	-4.61;-4.58	4.06	-1.33	0.09172	.	.	.	.	.	D	0.92289	0.7554	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	D	0.83530	0.0090	7	.	.	.	.	3.9159	0.09222	0.4467:0.1826:0.3707:0.0	.	354	Q9BZS1-3	.	V	354;339	ENSP00000451208:A354V;ENSP00000365369:A339V	.	A	-	2	0	FOXP3	48995049	0.000000	0.05858	0.000000	0.03702	0.347000	0.29111	0.365000	0.20348	-0.278000	0.09180	-0.729000	0.03580	GCG			0.572	FOXP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060814.1		NM_014009	
PPP1R3F	89801	mdanderson.org	37	X	49143522	49143522	+	Silent	SNP	G	G	T			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:49143522G>T	ENST00000055335.6	+	4	2386	c.2370G>T	c.(2368-2370)gcG>gcT	p.A790A	PPP1R3F_ENST00000438316.1_Silent_p.A461A|PPP1R3F_ENST00000466508.1_Silent_p.A444A|PPP1R3F_ENST00000376188.1_Silent_p.A444A|PPP1R3F_ENST00000495799.1_Silent_p.A444A	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	790					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TGGTGCTTGCGCTGTGCCTCT	0.627																																					p.A790A													.	.			0			c.G2370T												59.0	46.0	50.0					X																	49143522		2203	4300	6503	SO:0001819	synonymous_variant	89801	exon4			GCTTGCGCTGTGC		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.2370G>T	X.37:g.49143522G>T			39	0	0		59	0.05	3	NM_033215	2	0.00	0	A2VDJ8|B3KPW2|E9PCM3	Silent	SNP	ENST00000055335.6	37	CCDS35254.1																																																																																					0.627	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000060819.2		NM_033215	
TRO	7216	broad.mit.edu	37	X	54949634	54949634	+	Silent	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:54949634G>A	ENST00000173898.7	+	3	781	c.669G>A	c.(667-669)tcG>tcA	p.S223S	TRO_ENST00000420798.2_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375022.4_Silent_p.S223S|TRO_ENST00000319167.8_Silent_p.S223S|TRO_ENST00000375041.2_Intron|TRO_ENST00000484031.1_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	223					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCGAGGTCTCGCTGGCTGCAA	0.522																																					p.S223S													.	TRO	246		0			c.G669A												48.0	52.0	50.0					X																	54949634		2119	4204	6323	SO:0001819	synonymous_variant	7216	exon3			GGTCTCGCTGGCT	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.669G>A	X.37:g.54949634G>A			166	0.0060240964	1		230	0.02	5	NM_016157	86	0.00	0	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	37	CCDS43959.1																																																																																					0.522	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000056837.3		NM_016157	
PDZD4	57595	mdanderson.org	37	X	153069413	153069413	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrX:153069413G>A	ENST00000164640.4	-	8	1896	c.1705C>T	c.(1705-1707)Cgg>Tgg	p.R569W	PDZD4_ENST00000393758.2_Missense_Mutation_p.R494W|PDZD4_ENST00000475140.1_5'Flank|PDZD4_ENST00000544474.1_Missense_Mutation_p.R460W	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	569						cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGTGGCGCCGCGAGAGGTAA	0.751																																					p.R569W													.	.			0			c.C1705T												4.0	4.0	4.0					X																	153069413		1896	3663	5559	SO:0001583	missense	57595	exon8			GGCGCCGCGAGAG	AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.1705C>T	X.37:g.153069413G>A	ENSP00000164640:p.Arg569Trp		29	0.0344827586	1		43	0.07	3	NM_032512	7	0.00	0	B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	ENST00000164640.4	37	CCDS14732.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289510	0.23478	.	.	ENSG00000067840	ENST00000164640;ENST00000393758;ENST00000537633;ENST00000544474	T;T;T	0.04970	3.52;3.52;3.73	5.52	-0.547	0.11836	.	0.115678	0.56097	D	0.000024	T	0.17152	0.0412	L	0.48642	1.525	0.30192	N	0.799391	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.75484	0.973;0.962;0.986;0.986;0.973	T	0.02560	-1.1141	10	0.66056	D	0.02	-33.4993	16.4799	0.84155	0.0:0.0:0.2482:0.7518	.	460;575;569;494;473	B7ZKY3;Q17RL8;Q76G19;D3DWW0;B3KVR9	.;.;PDZD4_HUMAN;.;.	W	569;494;473;460	ENSP00000164640:R569W;ENSP00000377355:R494W;ENSP00000442033:R460W	ENSP00000164640:R569W	R	-	1	2	PDZD4	152722607	0.201000	0.23410	0.003000	0.11579	0.026000	0.11368	1.721000	0.38032	-0.226000	0.09899	-0.351000	0.07748	CGG			0.751	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061013.3		NM_032512	
CTBP2P1	352905	bcgsc.ca	37	Y	59001457	59001457	+	IGR	SNP	A	A	G			TCGA-2G-AAGI-05A-11D-A42Y-10	TCGA-2G-AAGI-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	459ea529-76c5-4fde-9e29-b455607c9d96	30b85f09-03f5-4f99-9b77-03a51c118dc8	g.chrY:59001457A>G								None (None upstream) : SPRY3 (99022 downstream)																							CCAGCAAGCAATTCATCCAGT	0.438																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	352905	.			CAAGCAATTCATC																													Y.37:g.59001457A>G			35	0	0		42	0.05	2	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.438										
