#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
DFFB	1677	mdanderson.org	37	1	3775322	3775322	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr1:3775322G>T	ENST00000378209.3	+	2	478	c.155G>T	c.(154-156)gGc>gTc	p.G52V	DFFB_ENST00000378212.2_Missense_Mutation_p.G52V|DFFB_ENST00000341385.3_Missense_Mutation_p.G52V|CEP104_ENST00000378230.3_5'Flank|DFFB_ENST00000338895.3_Missense_Mutation_p.G52V|CEP104_ENST00000378223.3_5'Flank	NM_004402.2	NP_004393.1	O76075	DFFB_HUMAN	DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase)	52	CIDE-N. {ECO:0000255|PROSITE- ProRule:PRU00447}.				apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)		TACGAGGATGGCACGGAGCTG	0.627																																					p.G52V													.	.			0			c.G155T												70.0	65.0	67.0					1																	3775322		2203	4300	6503	SO:0001583	missense	1677	exon2			AGGATGGCACGGA		CCDS52.1, CCDS72693.1	1p36.3	2014-03-06	2002-08-29		ENSG00000169598	ENSG00000169598			2773	protein-coding gene	gene with protein product		601883				9108473, 9560346	Standard	NM_004402		Approved	CAD, CPAN, DFF-40, DFF40	uc001alc.3	O76075	OTTHUMG00000003525	ENST00000378209.3:c.155G>T	1.37:g.3775322G>T	ENSP00000367454:p.Gly52Val		85	0	0		122	0.04	5	NM_004402	10	0.00	0	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Missense_Mutation	SNP	ENST00000378209.3	37	CCDS52.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034648	0.75617	.	.	ENSG00000169598	ENST00000378209;ENST00000338895;ENST00000378212;ENST00000341385;ENST00000448632;ENST00000430539	D;D;D	0.85484	-1.99;-1.99;-1.99	4.65	4.65	0.58169	Caspase-activated nuclease CIDE-N (2);	0.000000	0.85682	D	0.000000	D	0.92691	0.7677	M	0.86268	2.805	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93943	0.7225	10	0.87932	D	0	-38.1911	15.0267	0.71674	0.0:0.0:1.0:0.0	.	52;52;52;52	B4DZS0;O76075-2;O76075;Q96P73	.;.;DFFB_HUMAN;.	V	52	ENSP00000367454:G52V;ENSP00000339524:G52V;ENSP00000367457:G52V	ENSP00000339524:G52V	G	+	2	0	DFFB	3765182	1.000000	0.71417	0.916000	0.36221	0.564000	0.35744	5.928000	0.70088	2.116000	0.64780	0.561000	0.74099	GGC			0.627	DFFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000009821.2		NM_001282669	
Unknown	0	bcgsc.ca	37	1	17077216	17077216	+	IGR	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr1:17077216G>T								RNU1-4 (10042 upstream) : MST1L (4188 downstream)																							CTGGCTGGAGGAGGAGCAGCA	0.672																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	100421113	.			CTGGAGGAGGAGC																													1.37:g.17077216G>T			54	0.0185185185	1		84	0.15	13	.	0		0		RNA	SNP		37																																																																																					0	0.672										
HORMAD1	84072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	150675839	150675839	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr1:150675839G>A	ENST00000361824.2	-	13	1084	c.979C>T	c.(979-981)Ctt>Ttt	p.L327F	RNU6-1042P_ENST00000384204.1_RNA|HORMAD1_ENST00000368993.2_Missense_Mutation_p.L327F|HORMAD1_ENST00000322343.7_Missense_Mutation_p.L320F|HORMAD1_ENST00000368995.4_Missense_Mutation_p.L247F	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	327					blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			GACATATCAAGTTCAGATGTT	0.269																																					p.L327F													.	.			0			c.C979T												43.0	40.0	41.0					1																	150675839		2194	4286	6480	SO:0001583	missense	84072	exon13			TATCAAGTTCAGA	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.979C>T	1.37:g.150675839G>A	ENSP00000355167:p.Leu327Phe		97	0	0		107	0.27	29	NM_032132	14	0.57	8	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	37	CCDS967.1	.	.	.	.	.	.	.	.	.	.	G	13.91	2.378222	0.42207	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824	T;T;T;T	0.54071	0.59;1.23;1.18;1.23	4.99	4.08	0.47627	.	0.100586	0.41194	D	0.000924	T	0.42877	0.1222	N	0.17082	0.46	0.42957	D	0.994399	D;D;D	0.76494	0.999;0.996;0.99	D;D;P	0.72075	0.976;0.931;0.845	T	0.50591	-0.8810	10	0.51188	T	0.08	-13.9882	10.8394	0.46706	0.0885:0.0:0.9115:0.0	.	247;320;327	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	F	247;327;256;247;320;327	ENSP00000357991:L247F;ENSP00000357989:L327F;ENSP00000326489:L320F;ENSP00000355167:L327F	ENSP00000326489:L320F	L	-	1	0	HORMAD1	148942463	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	4.669000	0.61575	1.485000	0.48380	-0.261000	0.10672	CTT			0.269	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000084722.1		NM_032132	
MAP10	54627	broad.mit.edu	37	1	232942071	232942071	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr1:232942071G>T	ENST00000418460.1	+	1	1429	c.1302G>T	c.(1300-1302)ttG>ttT	p.L434F		NM_019090.2	NP_061963.2	Q9P2G4	MAP10_HUMAN	microtubule-associated protein 10	292					cytoplasmic microtubule organization (GO:0031122)|positive regulation of cytokinesis (GO:0032467)|regulation of microtubule-based process (GO:0032886)|spindle midzone assembly involved in mitosis (GO:0051256)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|mitotic spindle pole (GO:0097431)	microtubule binding (GO:0008017)										TCACAGAATTGGACATGGAGA	0.448																																					p.L434F													.	.			0			c.G1302T												220.0	225.0	224.0					1																	232942071		1931	4127	6058	SO:0001583	missense	54627	exon1			AGAATTGGACATG	AB037804	CCDS44334.1	1q42.2	2013-02-12	2013-02-12	2013-02-12	ENSG00000212916	ENSG00000212916			29265	protein-coding gene	gene with protein product	"""microtubule regulator 120 KDa"""		"""KIAA1383"""	KIAA1383		23264731	Standard	NM_019090		Approved	MTR120	uc001hvh.2	Q9P2G4	OTTHUMG00000037819	ENST00000418460.1:c.1302G>T	1.37:g.232942071G>T	ENSP00000403208:p.Leu434Phe		56	0	0		76	0.05	4	NM_019090	7	0.00	0	A8K2F1|Q32MI1|Q58EZ9|Q5VV83	Missense_Mutation	SNP	ENST00000418460.1	37	CCDS44334.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.952430	0.34471	.	.	ENSG00000212916	ENST00000418460	.	.	.	5.93	2.64	0.31445	.	1.244450	0.06435	U	0.724840	T	0.58090	0.2098	M	0.64997	1.995	0.27072	N	0.963301	D	0.67145	0.996	D	0.65010	0.931	T	0.36383	-0.9750	9	0.41790	T	0.15	-0.5695	7.8492	0.29444	0.3838:0.0:0.6162:0.0	.	292	Q9P2G4	K1383_HUMAN	F	434	.	ENSP00000403208:L434F	L	+	3	2	KIAA1383	231008694	0.989000	0.36119	0.752000	0.31206	0.018000	0.09664	0.522000	0.22909	0.856000	0.35383	-0.136000	0.14681	TTG			0.448	MAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000092317.3		NM_019090	
RET	5979	mdanderson.org	37	10	43604576	43604576	+	Silent	SNP	C	C	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr10:43604576C>T	ENST00000355710.3	+	6	1393	c.1161C>T	c.(1159-1161)ggC>ggT	p.G387G	RET_ENST00000340058.5_Silent_p.G387G	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	387					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CAGGAGCGGGCGTCCTCTTGC	0.637		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												p.G387G	Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	RET_ENST00000340058,NS,carcinoma,0,2	RET_ENST00000340058	0	2	0			c.C1161T												75.0	71.0	72.0					10																	43604576		2203	4300	6503	SO:0001819	synonymous_variant	5979	exon6	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	AGCGGGCGTCCTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.1161C>T	10.37:g.43604576C>T			61	0	0		45	0.07	3	NM_020630	2	0.00	0	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Silent	SNP	ENST00000355710.3	37	CCDS7200.1																																																																																					0.637	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047694.2		NM_020975	
COL17A1	1308	broad.mit.edu	37	10	105821178	105821178	+	Missense_Mutation	SNP	C	C	T	rs200123495		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr10:105821178C>T	ENST00000353479.5	-	13	1254	c.964G>A	c.(964-966)Gtt>Att	p.V322I	COL17A1_ENST00000393211.3_Missense_Mutation_p.V322I|COL17A1_ENST00000369733.3_Missense_Mutation_p.V322I	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	322	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GAGGTGGAAACGCCAGTGTTC	0.572																																					p.V322I													.	COL17A1	149		0			c.G964A												60.0	48.0	52.0					10																	105821178		2203	4300	6503	SO:0001583	missense	1308	exon13			TGGAAACGCCAGT	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.964G>A	10.37:g.105821178C>T	ENSP00000340937:p.Val322Ile		33	0	0		50	0.06	3	NM_000494	28	0.00	0	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	37	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	C	9.735	1.163200	0.21538	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	T;T;T	0.58797	0.31;0.31;0.31	5.93	-0.16	0.13375	.	0.163773	0.28268	N	0.015969	T	0.42944	0.1225	L	0.55103	1.725	0.22620	N	0.998926	P;P	0.47034	0.889;0.685	B;B	0.33960	0.173;0.119	T	0.41270	-0.9518	10	0.72032	D	0.01	-1.2129	9.3101	0.37898	0.0:0.5743:0.0:0.4257	.	322;322	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	I	322;322;306;322	ENSP00000340937:V322I;ENSP00000358748:V322I;ENSP00000376905:V322I	ENSP00000340937:V322I	V	-	1	0	COL17A1	105811168	0.014000	0.17966	0.023000	0.16930	0.033000	0.12548	0.033000	0.13754	-0.284000	0.09102	-0.258000	0.10820	GTT			0.572	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050181.1		NM_130778, NM_000494	
TSSC2	650368	broad.mit.edu	37	11	3427845	3427845	+	RNA	SNP	C	C	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:3427845C>T	ENST00000529482.1	+	0	962									tumor suppressing subtransferable candidate 2 pseudogene																		CTTCAAGTGGCAGGAGCAGAA	0.587																																					.													.	.			0			.																																											0	.			AAGTGGCAGGAGC			11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3427845C>T			16	0	0		19	0.16	3	.	5	0.00	0		RNA	SNP	ENST00000529482.1	37																																																																																						0.587	TSSC2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000392020.1			
OR51B2	79345	mdanderson.org	37	11	5345000	5345000	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:5345000G>T	ENST00000328813.2	-	1	582	c.528C>A	c.(526-528)ttC>ttA	p.F176L	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGTGGAGGCAGAAAGCACGTG	0.388																																					p.F176L													.	.			0			c.C528A												93.0	92.0	92.0					11																	5345000		2201	4297	6498	SO:0001583	missense	79345	exon1			GAGGCAGAAAGCA	AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.528C>A	11.37:g.5345000G>T	ENSP00000327540:p.Phe176Leu		61	0	0		47	0.06	3	NM_033180	1	0.00	0	Q96RD4	Missense_Mutation	SNP	ENST00000328813.2	37	CCDS31377.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.658533	0.67586	.	.	ENSG00000184881	ENST00000328813	T	0.00346	8.01	4.28	-2.18	0.07037	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40302	U	0.001125	T	0.00666	0.0022	M	0.84219	2.685	0.25222	N	0.989898	D	0.89917	1.0	D	0.91635	0.999	T	0.20107	-1.0285	10	0.72032	D	0.01	.	10.5657	0.45171	0.5722:0.0:0.4278:0.0	.	176	Q9Y5P1	O51B2_HUMAN	L	176	ENSP00000327540:F176L	ENSP00000327540:F176L	F	-	3	2	OR51B2	5301576	0.019000	0.18553	0.989000	0.46669	0.876000	0.50452	0.072000	0.14617	-0.348000	0.08286	0.644000	0.83932	TTC			0.388	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142983.1		NM_033180	
OR51B5	282763	mdanderson.org	37	11	5364396	5364396	+	Missense_Mutation	SNP	C	C	T	rs369290068	byFrequency	TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:5364396C>T	ENST00000300773.2	-	1	413	c.359G>A	c.(358-360)cGt>cAt	p.R120H	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005567.2	NP_001005567.2	Q9H339	O51B5_HUMAN	olfactory receptor, family 51, subfamily B, member 5	120					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	28		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;3.05e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCAATAAAACGGTCATAGGC	0.473													C|||	4	0.000798722	0.0023	0.0014	5008	,	,		20852	0.0		0.0	False		,,,				2504	0.0				p.R120H													.	.			0			c.G359A							C	HIS/ARG	5,4397	9.9+/-24.2	0,5,2196	51.0	52.0	51.0		359	3.9	0.2	11		51	1,8593	1.2+/-3.3	0,1,4296	no	missense	OR51B5	NM_001005567.2	29	0,6,6492	TT,TC,CC		0.0116,0.1136,0.0462	probably-damaging	120/313	5364396	6,12990	2201	4297	6498	SO:0001583	missense	282763	exon5			ATAAAACGGTCAT	BK004430	CCDS31378.1	11p15.4	2012-08-09			ENSG00000242180	ENSG00000242180		"""GPCR / Class A : Olfactory receptors"""	19599	protein-coding gene	gene with protein product							Standard	NM_001005567		Approved		uc001maq.2	Q9H339	OTTHUMG00000066676	ENST00000300773.2:c.359G>A	11.37:g.5364396C>T	ENSP00000300773:p.Arg120His		38	0	0		29	0.10	3	NM_001005567	4	0.00	0	B2RN59	Missense_Mutation	SNP	ENST00000300773.2	37	CCDS31378.1	.	.	.	.	.	.	.	.	.	.	C	16.76	3.211671	0.58452	0.001136	1.16E-4	ENSG00000242180	ENST00000300773	T	0.77489	-1.1	4.76	3.86	0.44501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000875	T	0.81014	0.4735	M	0.93808	3.46	0.36033	D	0.83952	P	0.35684	0.515	B	0.30572	0.117	D	0.86525	0.1818	10	0.72032	D	0.01	.	11.866	0.52493	0.0:0.9145:0.0:0.0855	.	120	Q9H339	O51B5_HUMAN	H	120	ENSP00000300773:R120H	ENSP00000300773:R120H	R	-	2	0	OR51B5	5320972	0.003000	0.15002	0.229000	0.23960	0.961000	0.63080	1.870000	0.39529	1.255000	0.44051	0.650000	0.86243	CGT			0.473	OR51B5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142975.1		NM_001005567	
UBQLN3	50613	mdanderson.org	37	11	5529308	5529308	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:5529308G>T	ENST00000311659.4	-	2	1628	c.1481C>A	c.(1480-1482)gCt>gAt	p.A494D	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_5'Flank|HBE1_ENST00000380237.1_5'Flank|AC104389.28_ENST00000415970.1_RNA	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	494										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAACTGTGGAGCTGGATTCAT	0.582																																					p.A494D	Ovarian(72;684 1260 12332 41642 52180)												.	.			0			c.C1481A												59.0	63.0	61.0					11																	5529308		2201	4297	6498	SO:0001583	missense	50613	exon2			TGTGGAGCTGGAT	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1481C>A	11.37:g.5529308G>T	ENSP00000347997:p.Ala494Asp		70	0	0		54	0.06	3	NM_017481	0		0	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	0.026	-1.367071	0.01225	.	.	ENSG00000175520	ENST00000311659	T	0.36520	1.25	4.83	-8.05	0.01106	.	1.511260	0.04430	N	0.369124	T	0.26231	0.0640	L	0.47716	1.5	0.09310	N	1	B	0.26400	0.148	B	0.19946	0.027	T	0.29458	-1.0011	10	0.45353	T	0.12	2.6614	7.402	0.26969	0.2511:0.3693:0.3796:0.0	.	494	Q9H347	UBQL3_HUMAN	D	494	ENSP00000347997:A494D	ENSP00000347997:A494D	A	-	2	0	UBQLN3	5485884	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.064000	0.03461	-1.172000	0.02762	-0.302000	0.09304	GCT			0.582	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143348.1		NM_017481	
TRIM6	117854	mdanderson.org	37	11	5631468	5631468	+	Silent	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:5631468G>T	ENST00000278302.5	+	6	1007	c.867G>T	c.(865-867)gtG>gtT	p.V289V	TRIM6-TRIM34_ENST00000354852.5_Silent_p.V317V|TRIM6_ENST00000445329.1_Silent_p.V114V|HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000507320.1_Silent_p.V114V|TRIM6_ENST00000515022.1_Silent_p.V114V|TRIM6_ENST00000506134.1_Silent_p.V114V|TRIM6_ENST00000380097.3_Silent_p.V317V|TRIM6_ENST00000380107.1_Silent_p.V263V|TRIM6_ENST00000481603.1_3'UTR	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	289	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		TGCTGCGAGTGTGTAGAGGTA	0.468																																					p.V317V													.	.			0			c.G951T												85.0	88.0	87.0					11																	5631468		2201	4297	6498	SO:0001819	synonymous_variant	445372	exon6			GCGAGTGTGTAGA	AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.867G>T	11.37:g.5631468G>T			57	0	0		45	0.07	3	NM_001003819	8	0.00	0	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Silent	SNP	ENST00000278302.5	37	CCDS31390.1																																																																																					0.468	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143376.2		NM_001003818	
RRAS2	22800	mdanderson.org	37	11	14380339	14380339	+	Silent	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:14380339G>T	ENST00000256196.4	-	1	391	c.78C>A	c.(76-78)ggC>ggA	p.G26G	RRAS2_ENST00000529237.1_Intron|RRAS2_ENST00000545643.1_Silent_p.G26G|RRAS2_ENST00000537760.1_Intron|RRAS2_ENST00000532814.1_5'Flank|RRAS2_ENST00000526063.1_5'Flank			P62070	RRAS2_HUMAN	related RAS viral (r-ras) oncogene homolog 2	26					osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|endometrium(4)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	12				Epithelial(150;0.203)		GCGCCGACTTGCCCACGCCGC	0.766																																					p.G26G													.	.			0			c.C78A												7.0	9.0	9.0					11																	14380339		1886	3839	5725	SO:0001819	synonymous_variant	22800	exon1			CGACTTGCCCACG	M31468	CCDS7814.1, CCDS44544.1, CCDS53603.1	11p15.2	2014-05-09			ENSG00000133818	ENSG00000133818			17271	protein-coding gene	gene with protein product		600098				2108320, 8052619	Standard	NM_012250		Approved	TC21	uc001mlf.4	P62070	OTTHUMG00000165756	ENST00000256196.4:c.78C>A	11.37:g.14380339G>T			12	0	0		18	0.17	3	NM_012250	170	0.01	1	B2R9Z3|B7Z5Z2|B7Z6C4|B7Z7H6|P17082	Silent	SNP	ENST00000256196.4	37	CCDS7814.1																																																																																					0.766	RRAS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386035.1		NM_012250	
SPTBN2	6712	mdanderson.org	37	11	66468012	66468012	+	Silent	SNP	G	G	A	rs374033075		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:66468012G>A	ENST00000533211.1	-	17	3889	c.3558C>T	c.(3556-3558)ggC>ggT	p.G1186G	SPTBN2_ENST00000309996.2_Silent_p.G1186G|SPTBN2_ENST00000529997.1_Silent_p.G1186G			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1186					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TGCTGAGCACGCCCTCAGCCT	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		15064	0.0		0.0	False		,,,				2504	0.001				p.G1186G													.	.			0			c.C3558T							G		0,4400		0,0,2200	30.0	35.0	33.0		3558	-6.7	0.1	11		33	1,8587		0,1,4293	no	coding-synonymous	SPTBN2	NM_006946.2		0,1,6493	AA,AG,GG		0.0116,0.0,0.0077		1186/2391	66468012	1,12987	2200	4294	6494	SO:0001819	synonymous_variant	6712	exon16			GAGCACGCCCTCA	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3558C>T	11.37:g.66468012G>A			22	0	0		22	0.09	2	NM_006946	15	0.00	0	O14872|O14873	Silent	SNP	ENST00000533211.1	37	CCDS8150.1																																																																																					0.642	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393892.2		NM_006946	
GAL	51083	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	68455486	68455486	+	Silent	SNP	C	C	T	rs367644530		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr11:68455486C>T	ENST00000265643.3	+	4	399	c.141C>T	c.(139-141)gcC>gcT	p.A47A		NM_015973.3	NP_057057.2	P22466	GALA_HUMAN	galanin/GMAP prepropeptide	47					cAMP-mediated signaling (GO:0019933)|feeding behavior (GO:0007631)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of root hair elongation (GO:1902891)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catagen (GO:0051795)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of large conductance calcium-activated potassium channel activity (GO:1902608)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein kinase A signaling (GO:0010737)|regulation of glucocorticoid metabolic process (GO:0031943)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to insulin (GO:0032868)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|secretory granule (GO:0030141)	neuropeptide hormone activity (GO:0005184)|type 1 galanin receptor binding (GO:0031764)|type 2 galanin receptor binding (GO:0031765)|type 3 galanin receptor binding (GO:0031766)			lung(4)	4	Esophageal squamous(3;7.33e-10)	Melanoma(852;0.0749)	LUAD - Lung adenocarcinoma(13;0.0514)	Kidney(183;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.000152)|LUSC - Lung squamous cell carcinoma(976;0.00154)		AAACAGATGCCGTTGGCAACC	0.572																																					p.A47A													.	.			0			c.C141T							C		0,4400		0,0,2200	83.0	68.0	73.0		141	-3.5	0.0	11		73	1,8587	1.2+/-3.3	0,1,4293	no	coding-synonymous	GAL	NM_015973.3		0,1,6493	TT,TC,CC		0.0116,0.0,0.0077		47/124	68455486	1,12987	2200	4294	6494	SO:0001819	synonymous_variant	51083	exon4			AGATGCCGTTGGC	L11144	CCDS8183.1	11q13.2	2013-02-26	2012-10-23		ENSG00000069482	ENSG00000069482		"""Endogenous ligands"""	4114	protein-coding gene	gene with protein product	"""galanin-message-associated peptide"", ""galanin/GMAP prepropeptide"""	137035	"""galanin"", ""galanin prepropeptide"""	GALN		7508413	Standard	XM_006718580		Approved	GMAP, GAL-GMAP, GLNN	uc001oob.3	P22466	OTTHUMG00000167890	ENST00000265643.3:c.141C>T	11.37:g.68455486C>T			220	0	0		173	0.06	10	NM_015973	316	0.15	47	Q14413	Silent	SNP	ENST00000265643.3	37	CCDS8183.1																																																																																					0.572	GAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396843.2		NM_001479	
MARCH9	92979	broad.mit.edu	37	12	58152467	58152467	+	Silent	SNP	A	A	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr12:58152467A>G	ENST00000266643.5	+	4	1259	c.828A>G	c.(826-828)ggA>ggG	p.G276G	MARCH9_ENST00000548358.1_Silent_p.G163G	NM_138396.5	NP_612405.2	Q86YJ5	MARH9_HUMAN	membrane-associated ring finger (C3HC4) 9	276					protein ubiquitination (GO:0016567)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|trans-Golgi network (GO:0005802)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|large_intestine(2)|lung(1)	4	all_cancers(7;4.96e-69)|Lung NSC(6;5.5e-25)|all_lung(6;3.87e-23)|all_epithelial(6;1.66e-15)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)		GBM - Glioblastoma multiforme(5;4.21e-120)|all cancers(5;3.75e-83)|BRCA - Breast invasive adenocarcinoma(9;0.0294)			ATGCAGGGGGAGGGACGGCAG	0.637																																					p.G276G													.	MARCH9	28		0			c.A828G												52.0	49.0	50.0					12																	58152467		2203	4300	6503	SO:0001819	synonymous_variant	92979	exon4			AGGGGGAGGGACG	BC009489	CCDS31847.1	12q14.1	2013-01-09				ENSG00000139266		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	25139	protein-coding gene	gene with protein product		613336				14722266	Standard	NM_138396		Approved	RNF179, FLJ36578	uc001spx.2	Q86YJ5		ENST00000266643.5:c.828A>G	12.37:g.58152467A>G			105	0.0095238095	1		128	0.04	5	NM_138396	61	0.00	0	B2R9U9|Q86VN5|Q96GG2	Silent	SNP	ENST00000266643.5	37	CCDS31847.1																																																																																					0.637	MARCH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000409244.1		NM_138396	
ASCL4	121549	mdanderson.org	37	12	108169178	108169178	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr12:108169178G>T	ENST00000342331.4	+	1	1017	c.186G>T	c.(184-186)ttG>ttT	p.L62F		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	61					regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						GGCAGTACTTGCCCGTGCCGC	0.746																																					p.L62F	GBM(170;776 3695 11650)												.	.			0			c.G186T												5.0	7.0	6.0					12																	108169178		2079	4050	6129	SO:0001583	missense	121549	exon1			GTACTTGCCCGTG	AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.186G>T	12.37:g.108169178G>T	ENSP00000345420:p.Leu62Phe		23	0	0		23	0.09	2	NM_203436	1	0.00	0	Q7RTS2	Missense_Mutation	SNP	ENST00000342331.4	37	CCDS31894.2	.	.	.	.	.	.	.	.	.	.	G	9.319	1.057595	0.19907	.	.	ENSG00000187855	ENST00000342331	D	0.96716	-4.1	4.32	1.24	0.21308	.	1.351640	0.05104	N	0.487761	D	0.89174	0.6640	N	0.17082	0.46	0.09310	N	1	B	0.18741	0.03	B	0.14578	0.011	T	0.80665	-0.1281	10	0.09590	T	0.72	-21.3786	1.6428	0.02756	0.2672:0.156:0.4366:0.1402	.	61	Q6XD76	ASCL4_HUMAN	F	62	ENSP00000345420:L62F	ENSP00000345420:L62F	L	+	3	2	ASCL4	106693308	0.000000	0.05858	0.331000	0.25455	0.061000	0.15899	0.109000	0.15417	0.929000	0.37192	0.305000	0.20034	TTG			0.746	ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346845.1		NM_203436	
SBNO1	55206	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	123830101	123830101	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr12:123830101G>C	ENST00000602398.1	-	4	381	c.254C>G	c.(253-255)aCt>aGt	p.T85S	SBNO1_ENST00000267176.4_Missense_Mutation_p.T84S|SBNO1_ENST00000420886.2_Missense_Mutation_p.T85S|SBNO1_ENST00000602750.1_Missense_Mutation_p.T84S			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	85					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		AAATGTTGTAGTAGATGGAGG	0.383																																					p.T85S													.	.			0			c.C254G												115.0	104.0	108.0					12																	123830101		2203	4300	6503	SO:0001583	missense	55206	exon3			GTTGTAGTAGATG	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.254C>G	12.37:g.123830101G>C	ENSP00000473665:p.Thr85Ser		92	0	0		81	0.26	21	NM_001167856	10	0.30	3	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	37	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.229547	0.58777	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.32988	1.43;1.43	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	L	0.29908	0.895	0.49798	D	0.999829	P;D;D	0.56035	0.956;0.974;0.974	P;D;D	0.70487	0.899;0.953;0.969	T	0.06643	-1.0815	10	0.18710	T	0.47	-24.6935	18.1163	0.89556	0.0:0.0:1.0:0.0	.	85;84;83	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	S	85;84;84	ENSP00000387361:T85S;ENSP00000267176:T84S	ENSP00000267176:T84S	T	-	2	0	SBNO1	122396054	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.035000	0.93752	2.715000	0.92844	0.655000	0.94253	ACT			0.383	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000467684.1		NM_018183	
SACS	26278	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	23906199	23906199	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr13:23906199C>G	ENST00000382292.3	-	9	12089	c.11816G>C	c.(11815-11817)gGt>gCt	p.G3939A	SACS_ENST00000382298.3_Missense_Mutation_p.G3939A|SACS_ENST00000402364.1_Missense_Mutation_p.G3189A			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3939					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CATTTGCACACCAATATTCCC	0.423																																					p.G3939A													.	.			0			c.G11816C												125.0	116.0	119.0					13																	23906199		2203	4300	6503	SO:0001583	missense	26278	exon10			TGCACACCAATAT	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11816G>C	13.37:g.23906199C>G	ENSP00000371729:p.Gly3939Ala		123	0	0		108	0.46	50	NM_014363	16	0.31	5	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	37	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.265826	0.80358	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87334	-2.09;-2.24;-2.09	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.89577	0.6755	N	0.19112	0.55	0.58432	D	0.999997	D	0.76494	0.999	D	0.85130	0.997	D	0.90467	0.4450	10	0.59425	D	0.04	.	20.1013	0.97878	0.0:1.0:0.0:0.0	.	3939	Q9NZJ4	SACS_HUMAN	A	3939;3189;3939	ENSP00000371729:G3939A;ENSP00000385844:G3189A;ENSP00000371735:G3939A	ENSP00000371729:G3939A	G	-	2	0	SACS	22804199	1.000000	0.71417	0.959000	0.39883	0.922000	0.55478	7.818000	0.86416	2.748000	0.94277	0.655000	0.94253	GGT			0.423	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044148.3		NM_014363	
MAB21L1	4081	hgsc.bcm.edu	37	13	36050493	36050493	+	5'UTR	SNP	T	T	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr13:36050493T>G	ENST00000379919.4	-	0	339				NBEA_ENST00000540320.1_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)						anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		tgctgctgctTTTCCCTTCCT	0.517																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	4081	.			GCTGCTTTTCCCT	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.-218A>C	13.37:g.36050493T>G			95	0	0		80	0.05	4	.	0		0	Q6I9T5	RNA	SNP	ENST00000379919.4	37	CCDS9353.1																																																																																					0.517	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044459.3		NM_005584	
FREM2	341640	broad.mit.edu;bcgsc.ca;mdanderson.org	37	13	39264104	39264104	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr13:39264104G>T	ENST00000280481.7	+	1	2839	c.2623G>T	c.(2623-2625)Ggc>Tgc	p.G875C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	875					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACCCAAACATGGCCACATGAG	0.502																																					p.G875C													.	FREM2	385		0			c.G2623T												94.0	79.0	84.0					13																	39264104		2203	4300	6503	SO:0001583	missense	341640	exon1			AAACATGGCCACA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2623G>T	13.37:g.39264104G>T	ENSP00000280481:p.Gly875Cys		78	0	0		86	0.06	5	NM_207361	1	0.00	0	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	37	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121806	0.56613	.	.	ENSG00000150893	ENST00000280481	T	0.73152	-0.72	5.8	4.96	0.65561	.	0.000000	0.85682	D	0.000000	D	0.88213	0.6376	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91466	0.5193	10	0.87932	D	0	.	14.8491	0.70284	0.0688:0.0:0.9312:0.0	.	875	Q5SZK8	FREM2_HUMAN	C	875	ENSP00000280481:G875C	ENSP00000280481:G875C	G	+	1	0	FREM2	38162104	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	9.844000	0.99494	1.476000	0.48215	-0.136000	0.14681	GGC			0.502	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044599.2		NM_207361	
Unknown	0	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	13	54886174	54886174	+	IGR	SNP	G	G	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr13:54886174G>C								LINC00458 (179173 upstream) : AL512655.1 (493827 downstream)																							ATCAACCCTAGAGATAAACAC	0.318																																					.													.	.			0			.												70.0	66.0	68.0					13																	54886174		1565	3581	5146	SO:0001628	intergenic_variant	100302187	.			ACCCTAGAGATAA																													13.37:g.54886174G>C			285	0	0		237	0.30	72	.	0		0		RNA	SNP		37																																																																																					0	0.318										
MBNL2	10150	mdanderson.org	37	13	97995343	97995343	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr13:97995343C>T	ENST00000376673.3	+	4	1194	c.413C>T	c.(412-414)aCc>aTc	p.T138I	MBNL2_ENST00000343600.4_Missense_Mutation_p.T138I|MBNL2_ENST00000397601.1_Missense_Mutation_p.T138I|MBNL2_ENST00000445661.2_Intron|MBNL2_ENST00000345429.6_Missense_Mutation_p.T138I			Q5VZF2	MBNL2_HUMAN	muscleblind-like splicing regulator 2	138					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			GCACCTGTAACCCCTGGAGTT	0.537																																					p.T138I													.	.			0			c.C413T												91.0	85.0	87.0					13																	97995343		2203	4300	6503	SO:0001583	missense	10150	exon4			CTGTAACCCCTGG	AF061261	CCDS9483.1, CCDS9484.1	13q31.1	2013-01-18	2012-02-23		ENSG00000139793	ENSG00000139793		"""Zinc fingers, CCCH-type domain containing"""	16746	protein-coding gene	gene with protein product		607327	"""muscleblind-like 2 (Drosophila)"""			11929853	Standard	NM_207304		Approved	MBLL, MBLL39	uc001vmz.4	Q5VZF2	OTTHUMG00000017239	ENST00000376673.3:c.413C>T	13.37:g.97995343C>T	ENSP00000365861:p.Thr138Ile		115	0	0		105	0.05	5	NM_207304	3	0.00	0	Q3SXY5|Q58F19|Q8NEV3|Q8TD82	Missense_Mutation	SNP	ENST00000376673.3	37		.	.	.	.	.	.	.	.	.	.	C	16.94	3.262002	0.59431	.	.	ENSG00000139793	ENST00000397601;ENST00000343600;ENST00000345429;ENST00000376673	T;T;T;T	0.47528	0.84;0.84;0.86;0.9	5.56	5.56	0.83823	.	0.334930	0.34291	N	0.004094	T	0.47154	0.1430	N	0.22421	0.69	0.80722	D	1	B;P;P	0.52170	0.271;0.536;0.951	B;B;P	0.51385	0.096;0.074;0.668	T	0.21724	-1.0237	10	0.23891	T	0.37	.	19.8898	0.96926	0.0:1.0:0.0:0.0	.	138;138;138	Q5VZF2;A2A3S3;Q5VZF2-2	MBNL2_HUMAN;.;.	I	138	ENSP00000380726:T138I;ENSP00000344214:T138I;ENSP00000267287:T138I;ENSP00000365861:T138I	ENSP00000344214:T138I	T	+	2	0	MBNL2	96793344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.655000	0.54460	2.781000	0.95711	0.650000	0.86243	ACC			0.537	MBNL2-202	KNOWN	basic	protein_coding	protein_coding				NM_144778	
LIPC	3990	mdanderson.org	37	15	58855705	58855705	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr15:58855705G>T	ENST00000356113.6	+	10	1786	c.1171G>T	c.(1171-1173)Ggc>Tgc	p.G391C	LIPC_ENST00000414170.3_Splice_Site_p.G391C|LIPC_ENST00000433326.2_Splice_Site_p.G330C|LIPC_ENST00000299022.5_Splice_Site_p.G391C			P11150	LIPC_HUMAN	lipase, hepatic	391	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		GTATTCAAGGGGCAAAGGAAT	0.413																																					p.G391C													.	.			0			c.G1171T												85.0	72.0	76.0					15																	58855705		2192	4292	6484	SO:0001630	splice_region_variant	3990	exon8			TCAAGGGGCAAAG		CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.1170-1G>T	15.37:g.58855705G>T			47	0	0		33	0.09	3	NM_000236	18	0.00	0	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	ENST00000356113.6	37	CCDS10166.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443847	0.25987	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	T;T;T;T	0.74315	0.66;-0.83;0.66;0.66	5.9	2.98	0.34508	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.488693	0.23587	N	0.046597	T	0.77003	0.4067	L	0.50333	1.59	0.25147	N	0.990456	B;D	0.67145	0.107;0.996	B;P	0.59948	0.1;0.866	T	0.66578	-0.5888	10	0.49607	T	0.09	.	7.952	0.30021	0.1962:0.1153:0.6885:0.0	.	330;391	E7EUK6;P11150	.;LIPC_HUMAN	C	391;391;391;330	ENSP00000348425:G391C;ENSP00000395569:G391C;ENSP00000299022:G391C;ENSP00000395002:G330C	ENSP00000299022:G391C	G	+	1	0	LIPC	56642997	0.997000	0.39634	0.258000	0.24420	0.079000	0.17450	1.928000	0.40104	0.375000	0.24679	0.563000	0.77884	GGC			0.413	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416209.1			Missense_Mutation
LACTB	114294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	63414877	63414877	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr15:63414877G>A	ENST00000261893.4	+	2	472	c.400G>A	c.(400-402)Gat>Aat	p.D134N	LACTB_ENST00000413507.2_Missense_Mutation_p.D134N	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	134						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						AGTTTCTGTAGATGGAAAAGA	0.473																																					p.D134N	Melanoma(85;443 1381 6215 27308 35583)												.	.			0			c.G400A												184.0	159.0	167.0					15																	63414877		2203	4300	6503	SO:0001583	missense	114294	exon2			TCTGTAGATGGAA	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.400G>A	15.37:g.63414877G>A	ENSP00000261893:p.Asp134Asn		165	0	0		135	0.22	30	NM_171846	32	0.41	13	P83096	Missense_Mutation	SNP	ENST00000261893.4	37	CCDS10182.1	.	.	.	.	.	.	.	.	.	.	G	18.89	3.719221	0.68844	.	.	ENSG00000103642	ENST00000261893;ENST00000413507	T;T	0.51071	0.72;0.72	5.86	5.86	0.93980	Beta-lactamase/transpeptidase-like (2);Beta-lactamase-related (1);	0.044521	0.85682	D	0.000000	T	0.35219	0.0924	N	0.12663	0.25	0.53005	D	0.999967	B	0.27264	0.173	B	0.32533	0.147	T	0.13656	-1.0501	10	0.17832	T	0.49	-31.1158	19.1765	0.93604	0.0:0.0:1.0:0.0	.	134	P83111	LACTB_HUMAN	N	134	ENSP00000261893:D134N;ENSP00000392956:D134N	ENSP00000261893:D134N	D	+	1	0	LACTB	61201930	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.385000	0.73182	2.776000	0.95493	0.650000	0.86243	GAT			0.473	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256224.1		NM_032857	
WDR90	197335	broad.mit.edu	37	16	705131	705131	+	Frame_Shift_Del	DEL	T	T	-			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:705131delT	ENST00000293879.4	+	14	1540	c.1540delT	c.(1540-1542)tttfs	p.F515fs	LA16c-349E10.1_ENST00000573609.1_RNA|WDR90_ENST00000549091.1_Frame_Shift_Del_p.F515fs			Q96KV7	WDR90_HUMAN	WD repeat domain 90	515										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				CCGGGTCACCTTTTTTGATGA	0.667																																					p.F514fs													.	WDR90	107		0			c.1540delT												51.0	58.0	56.0					16																	705131		2053	4174	6227	SO:0001589	frameshift_variant	197335	exon14			GTCACCTTTTTTG	AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.1540delT	16.37:g.705131delT	ENSP00000293879:p.Phe515fs		168	0	0		173	0.05	8	NM_145294	6	0.00	0	Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Frame_Shift_Del	DEL	ENST00000293879.4	37	CCDS42092.1																																																																																					0.667	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000404335.1		NM_145294	
PAQR4	124222	mdanderson.org	37	16	3021699	3021699	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:3021699G>A	ENST00000318782.8	+	3	1002	c.572G>A	c.(571-573)cGg>cAg	p.R191Q	PKMYT1_ENST00000571102.1_5'Flank|PAQR4_ENST00000293978.8_Missense_Mutation_p.R152Q|PAQR4_ENST00000572687.1_Missense_Mutation_p.R117Q|PAQR4_ENST00000576565.1_Missense_Mutation_p.R124Q|PKMYT1_ENST00000431515.2_Intron|PAQR4_ENST00000574988.1_Missense_Mutation_p.R124Q	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV	191						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R191L(1)		kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						TTTGGGGCCCGGGGAGTGGGT	0.682																																					p.R191Q													PAQR4,NS,carcinoma,0,1	PAQR4	0	1	1	Substitution - Missense(1)	kidney(1)	c.G572A												31.0	37.0	35.0					16																	3021699		2198	4297	6495	SO:0001583	missense	124222	exon3			GGGCCCGGGGAGT		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.572G>A	16.37:g.3021699G>A	ENSP00000321804:p.Arg191Gln		37	0	0		46	0.07	3	NM_152341	38	0.00	0	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Missense_Mutation	SNP	ENST00000318782.8	37	CCDS10485.1	.	.	.	.	.	.	.	.	.	.	g	17.53	3.411911	0.62511	.	.	ENSG00000162073	ENST00000318782;ENST00000293978	T	0.32023	1.47	5.09	3.1	0.35709	.	0.129612	0.52532	D	0.000070	T	0.49012	0.1532	M	0.79123	2.44	0.58432	D	0.999998	D;D;D	0.89917	1.0;0.984;0.995	D;P;D	0.67382	0.951;0.602;0.928	T	0.40440	-0.9563	10	0.28530	T	0.3	-21.6174	8.6467	0.34009	0.0856:0.1533:0.7611:0.0	.	116;152;191	Q8N4S7-3;Q8N4S7-2;Q8N4S7	.;.;PAQR4_HUMAN	Q	191;117	ENSP00000321804:R191Q	ENSP00000293978:R117Q	R	+	2	0	PAQR4	2961700	1.000000	0.71417	0.989000	0.46669	0.792000	0.44763	5.974000	0.70465	0.528000	0.28580	0.457000	0.33378	CGG			0.682	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250966.1		NM_152341	
RRAD	6236	broad.mit.edu	37	16	66956073	66956073	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:66956073G>T	ENST00000299759.6	-	5	1083	c.833C>A	c.(832-834)gCg>gAg	p.A278E	RRAD_ENST00000420652.1_Missense_Mutation_p.A278E			P55042	RAD_HUMAN	Ras-related associated with diabetes	278	Calmodulin-binding.				small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.A278E(6)		endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GAAGCGCTTCGCCTTTTTGCC	0.612																																					p.A278E													RRAD,NS,carcinoma,0,6	RRAD	31	6	6	Substitution - Missense(6)	kidney(4)|prostate(1)|endometrium(1)	c.C833A												94.0	75.0	81.0					16																	66956073		2200	4300	6500	SO:0001583	missense	6236	exon5			CGCTTCGCCTTTT	L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.833C>A	16.37:g.66956073G>T	ENSP00000299759:p.Ala278Glu		122	0.0081967213	1		125	0.06	7	NM_001128850	479	0.05	25	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	36	5.625454	0.96671	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.68181	-0.31;-0.31	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.83524	0.5273	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84232	0.0467	10	0.87932	D	0	.	20.328	0.98708	0.0:0.0:1.0:0.0	.	278	P55042	RAD_HUMAN	E	278	ENSP00000388744:A278E;ENSP00000299759:A278E	ENSP00000299759:A278E	A	-	2	0	RRAD	65513574	1.000000	0.71417	0.969000	0.41365	0.983000	0.72400	9.471000	0.97696	2.802000	0.96397	0.561000	0.74099	GCG			0.612	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268830.1		NM_004165	
DDX19B	11269	mdanderson.org	37	16	70333207	70333207	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:70333207A>T	ENST00000288071.6	+	1	252	c.7A>T	c.(7-9)Act>Tct	p.T3S	RP11-529K1.3_ENST00000567706.1_Missense_Mutation_p.T3S|DDX19B_ENST00000568625.1_Intron|DDX19B_ENST00000563392.1_Intron|DDX19B_ENST00000563206.1_Intron|DDX19B_ENST00000570055.1_Intron|DDX19B_ENST00000393657.2_5'UTR|DDX19B_ENST00000355992.3_Missense_Mutation_p.T3S|DDX19B_ENST00000451014.3_Intron	NM_007242.5	NP_009173.1	Q9UMR2	DD19B_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19B	3	N-terminal lobe.				mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)	9		Ovarian(137;0.0694)				GACCATGGCCACTGACTCATG	0.662																																					p.T3S	Esophageal Squamous(26;382 757 1343 9728 15939)												.	.			0			c.A7T												24.0	20.0	22.0					16																	70333207		2194	4291	6485	SO:0001583	missense	11269	exon1			ATGGCCACTGACT	AJ237946	CCDS10888.1, CCDS32475.1, CCDS42187.1, CCDS58478.1	16q22.3	2012-02-23	2012-02-23	2005-07-13	ENSG00000157349	ENSG00000157349		"""DEAD-boxes"""	2742	protein-coding gene	gene with protein product		605812	"""DEAD (Asp-Glu-Ala-As) box polypeptide 19"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 19 (Dbp5, yeast, homolog)"""	DDX19		10428971	Standard	NM_007242		Approved	DBP5	uc002eyo.4	Q9UMR2	OTTHUMG00000137577	ENST00000288071.6:c.7A>T	16.37:g.70333207A>T	ENSP00000288071:p.Thr3Ser		49	0	0		34	0.09	3	NM_001014451	33	0.00	0	B3KNE9|B4DXS6|E7EMK4|Q6FIB7|Q6IAE0|Q96KE7|Q9H0U0	Missense_Mutation	SNP	ENST00000288071.6	37	CCDS10888.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.959472	0.53400	.	.	ENSG00000157349	ENST00000355992;ENST00000288071	T;T	0.52295	0.67;0.67	5.04	5.04	0.67666	.	0.265917	0.38492	N	0.001673	T	0.34716	0.0907	L	0.37630	1.12	0.39051	D	0.96033	B;B;B	0.17268	0.013;0.005;0.021	B;B;B	0.12156	0.003;0.005;0.007	T	0.19128	-1.0315	10	0.13108	T	0.6	.	11.3632	0.49655	1.0:0.0:0.0:0.0	.	3;3;3	Q7Z4W5;Q9UMR2-2;Q9UMR2	.;.;DD19B_HUMAN	S	3	ENSP00000348271:T3S;ENSP00000288071:T3S	ENSP00000288071:T3S	T	+	1	0	DDX19B	68890708	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.788000	0.47806	2.254000	0.74563	0.528000	0.53228	ACT			0.662	DDX19B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268965.3		NM_007242	
CTD-2336H13.2	0	broad.mit.edu	37	16	76828308	76828309	+	lincRNA	INS	-	-	T	rs553295054|rs551791963|rs146165581	byFrequency	TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:76828308_76828309insT	ENST00000567777.1	+	0	138																											ttgttactttgttttttttttt	0.505																																					.													.	.			0			.																																											0	.			TACTTTGTTTTTT																													16.37:g.76828319_76828319dupT			4	0	0		6	0.33	2	.	0		0		RNA	INS	ENST00000567777.1	37																																																																																						0.505	CTD-2336H13.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000433024.2			
CDH15	1013	broad.mit.edu;mdanderson.org	37	16	89254650	89254650	+	Missense_Mutation	SNP	G	G	A	rs374936482		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:89254650G>A	ENST00000289746.2	+	7	1000	c.935G>A	c.(934-936)cGc>cAc	p.R312H		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	312	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TTCACCATCCGCACGGACCCC	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14428	0.0		0.0	False		,,,				2504	0.0				p.R312H													CDH15,NS,carcinoma,0,1	CDH15	54	1	0			c.G935A							G	HIS/ARG	1,4393	2.1+/-5.4	0,1,2196	63.0	52.0	56.0		935	3.5	0.1	16		56	0,8600		0,0,4300	no	missense	CDH15	NM_004933.2	29	0,1,6496	AA,AG,GG		0.0,0.0228,0.0077	probably-damaging	312/815	89254650	1,12993	2197	4300	6497	SO:0001583	missense	1013	exon7			CCATCCGCACGGA	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.935G>A	16.37:g.89254650G>A	ENSP00000289746:p.Arg312His		92	0	0		90	0.06	5	NM_004933	0		0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.780458	0.31502	2.28E-4	0.0	ENSG00000129910	ENST00000289746	T	0.51071	0.72	4.45	3.48	0.39840	Cadherin (4);Cadherin-like (1);	0.249276	0.25777	N	0.028367	T	0.37839	0.1018	L	0.46157	1.445	0.09310	N	1	B	0.20164	0.042	B	0.20384	0.029	T	0.24835	-1.0149	10	0.36615	T	0.2	.	8.0104	0.30351	0.2067:0.0:0.7933:0.0	.	312	P55291	CAD15_HUMAN	H	312	ENSP00000289746:R312H	ENSP00000289746:R312H	R	+	2	0	CDH15	87782151	0.000000	0.05858	0.102000	0.21198	0.788000	0.44548	0.127000	0.15790	0.856000	0.35383	0.449000	0.29647	CGC			0.642	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269920.1		NM_004933	
CDH15	1013	mdanderson.org	37	16	89260268	89260268	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr16:89260268C>T	ENST00000289746.2	+	13	2163	c.2098C>T	c.(2098-2100)Cca>Tca	p.P700S		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	700					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCACCCCCAGCCACCCCGAGT	0.672																																					p.P700S													.	.			0			c.C2098T												14.0	19.0	17.0					16																	89260268		2160	4258	6418	SO:0001583	missense	1013	exon13			CCCCAGCCACCCC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.2098C>T	16.37:g.89260268C>T	ENSP00000289746:p.Pro700Ser		55	0	0		57	0.05	3	NM_004933	2	0.00	0		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	C	12.79	2.043229	0.36085	.	.	ENSG00000129910	ENST00000289746	T	0.75938	-0.98	4.52	-3.88	0.04205	Cadherin, cytoplasmic domain (1);	0.657623	0.13360	N	0.393697	T	0.65790	0.2725	L	0.41079	1.255	0.09310	N	1	B	0.19935	0.04	B	0.33121	0.158	T	0.55224	-0.8174	10	0.36615	T	0.2	.	12.9468	0.58376	0.0:0.1793:0.6931:0.1276	.	700	P55291	CAD15_HUMAN	S	700	ENSP00000289746:P700S	ENSP00000289746:P700S	P	+	1	0	CDH15	87787769	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.294000	0.19047	-1.190000	0.02698	-0.357000	0.07601	CCA			0.672	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269920.1		NM_004933	
NKIRAS2	28511	mdanderson.org	37	17	40175799	40175799	+	Missense_Mutation	SNP	G	G	A	rs375322757		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:40175799G>A	ENST00000307641.5	+	4	1085	c.464G>A	c.(463-465)cGc>cAc	p.R155H	NKIRAS2_ENST00000479407.1_3'UTR|NKIRAS2_ENST00000393884.2_Missense_Mutation_p.R153H|NKIRAS2_ENST00000393885.4_Missense_Mutation_p.R155H|NKIRAS2_ENST00000393881.3_Missense_Mutation_p.R155H|NKIRAS2_ENST00000449471.4_Missense_Mutation_p.R99H|NKIRAS2_ENST00000316082.4_Missense_Mutation_p.R193H|NKIRAS2_ENST00000462043.2_3'UTR|NKIRAS2_ENST00000393880.1_Missense_Mutation_p.R155H|ZNF385C_ENST00000461831.1_5'Flank	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2	155	Small GTPase-like.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GCGGACCGGCGCTCCCTCCTG	0.617																																					p.R155H													.	.			0			c.G464A							G	HIS/ARG,HIS/ARG,HIS/ARG,,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	99.0	94.0	95.0		464,464,296,,464	5.7	1.0	17		95	0,8600		0,0,4300	no	missense,missense,missense,utr-3,missense	NKIRAS2	NM_001001349.2,NM_001144927.1,NM_001144928.1,NM_001144929.1,NM_017595.5	29,29,29,,29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,,probably-damaging	155/192,155/192,99/136,,155/192	40175799	1,13005	2203	4300	6503	SO:0001583	missense	28511	exon4			ACCGGCGCTCCCT	AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503	ENST00000307641.5:c.464G>A	17.37:g.40175799G>A	ENSP00000303580:p.Arg155His		45	0	0		70	0.06	4	NM_017595	126	0.00	0	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Missense_Mutation	SNP	ENST00000307641.5	37	CCDS11415.1	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889086	0.72524	2.27E-4	0.0	ENSG00000168256	ENST00000307641;ENST00000393884;ENST00000393880;ENST00000393881;ENST00000393885;ENST00000462043;ENST00000316082	T;T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31;-1.31	5.65	5.65	0.86999	Small GTP-binding protein domain (1);	0.048786	0.85682	D	0.000000	T	0.73799	0.3633	L	0.31526	0.94	0.80722	D	1	B;B	0.18863	0.007;0.031	B;B	0.18561	0.002;0.022	T	0.66524	-0.5902	10	0.30078	T	0.28	-25.9701	19.7343	0.96195	0.0:0.0:1.0:0.0	.	99;155	B4DNM3;Q9NYR9	.;KBRS2_HUMAN	H	155;153;155;155;155;99;193	ENSP00000303580:R155H;ENSP00000377462:R153H;ENSP00000377458:R155H;ENSP00000377459:R155H;ENSP00000377463:R155H;ENSP00000312773:R193H	ENSP00000303580:R155H	R	+	2	0	NKIRAS2	37429325	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.178000	0.58284	2.660000	0.90430	0.467000	0.42956	CGC			0.617	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257457.1		NM_017595	
HDAC5	10014	mdanderson.org	37	17	42160955	42160955	+	Silent	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:42160955G>A	ENST00000393622.2	-	18	2752	c.2421C>T	c.(2419-2421)tgC>tgT	p.C807C	HDAC5_ENST00000586802.1_Silent_p.C807C|HDAC5_ENST00000336057.5_Silent_p.C722C|HDAC5_ENST00000225983.6_Silent_p.C808C	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	807	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		GCTCCAGCAGGCAGCCCACTG	0.632																																					p.C808C													.	.			0			c.C2424T												65.0	52.0	56.0					17																	42160955		2203	4299	6502	SO:0001819	synonymous_variant	10014	exon18			CAGCAGGCAGCCC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.2421C>T	17.37:g.42160955G>A			88	0	0		82	0.05	4	NM_001015053	192	0.00	0	C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	ENST00000393622.2	37	CCDS45696.1																																																																																					0.632	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000457686.1		NM_001015053	
HEXIM1	10614	broad.mit.edu	37	17	43229646	43229647	+	IGR	INS	-	-	A	rs34159133|rs71373537|rs12450963|rs141039553|rs112374579		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:43229646_43229647insA	ENST00000332499.2	+	0	4785				AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						ttttctttattttttttttttt	0.46																																					.													.	HEXIM1	25		0			.																																									SO:0001628	intergenic_variant	0	.			CTTTATTTTTTTT	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992			17.37:g.43229646_43229647insA			4	0	0		7	0.57	4	.	1	0.00	0	B2R8Y5	RNA	INS	ENST00000332499.2	37	CCDS11495.1																																																																																					0.460	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449821.2		NM_006460	
RPTOR	57521	hgsc.bcm.edu;mdanderson.org	37	17	78921151	78921151	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:78921151G>T	ENST00000306801.3	+	27	3627	c.3265G>T	c.(3265-3267)Gac>Tac	p.D1089Y	RPTOR_ENST00000544334.2_Splice_Site_p.D931Y|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1089					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GACGGCCACAGGTGAGCGGGG	0.562																																					p.D1089Y													.	.			0			c.G3265T												50.0	42.0	44.0					17																	78921151		2203	4300	6503	SO:0001630	splice_region_variant	57521	exon27			GCCACAGGTGAGC		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3265+1G>T	17.37:g.78921151G>T			86	0	0		90	0.04	4	NM_020761	42	0.00	0	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	ENST00000306801.3	37	CCDS11773.1	.	.	.	.	.	.	.	.	.	.	G	17.04	3.286501	0.59867	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.29397	1.57;1.57	5.12	5.12	0.69794	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58075	0.2097	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.956	T	0.61667	-0.7016	10	0.59425	D	0.04	.	18.5401	0.91024	0.0:0.0:1.0:0.0	.	931;1089	F5H7J5;Q8N122	.;RPTOR_HUMAN	Y	1089;931	ENSP00000307272:D1089Y;ENSP00000442479:D931Y	ENSP00000307272:D1089Y	D	+	1	0	RPTOR	76535746	1.000000	0.71417	0.979000	0.43373	0.012000	0.07955	9.325000	0.96381	2.374000	0.81015	0.561000	0.74099	GAC			0.562	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438125.1		NM_020761	Missense_Mutation
FN3KRP	79672	broad.mit.edu	37	17	80674698	80674698	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:80674698G>T	ENST00000269373.6	+	1	140	c.67G>T	c.(67-69)Ggg>Tgg	p.G23W	RP11-388C12.1_ENST00000574471.1_lincRNA|FN3KRP_ENST00000535965.1_5'UTR	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	23							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CTCGGGGGGCGGGTGCATCAG	0.716																																					p.G23W													.	FN3KRP	31		0			c.G67T												23.0	25.0	24.0					17																	80674698		2195	4292	6487	SO:0001583	missense	79672	exon1			GGGGGCGGGTGCA	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.67G>T	17.37:g.80674698G>T	ENSP00000269373:p.Gly23Trp		345	0.0028985507	1		410	0.02	7	NM_024619	33	0.00	0	Q969F4|Q9H0U7	Missense_Mutation	SNP	ENST00000269373.6	37	CCDS11817.1	.	.	.	.	.	.	.	.	.	.	G	35	5.434427	0.96150	.	.	ENSG00000141560	ENST00000269373	T	0.70164	-0.46	5.29	5.29	0.74685	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.88962	0.6580	H	0.97340	3.985	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92670	0.6149	10	0.87932	D	0	-34.9178	19.2907	0.94098	0.0:0.0:1.0:0.0	.	23	Q9HA64	KT3K_HUMAN	W	23	ENSP00000269373:G23W	ENSP00000269373:G23W	G	+	1	0	FN3KRP	78267987	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	8.691000	0.91279	2.610000	0.88304	0.650000	0.86243	GGG			0.716	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439219.1		NM_024619	
FN3K	64122	broad.mit.edu;mdanderson.org	37	17	80696387	80696387	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr17:80696387A>G	ENST00000300784.7	+	2	226	c.164A>G	c.(163-165)gAg>gGg	p.E55G		NM_022158.3	NP_071441.1	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	55					epithelial cell differentiation (GO:0030855)|fructoselysine metabolic process (GO:0030393)		fructosamine-3-kinase activity (GO:0030387)			central_nervous_system(1)|kidney(1)|lung(1)|urinary_tract(1)	4	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			TTTGAGGGGGAGGTGGCCAGC	0.657																																					p.E55G	Melanoma(10;391 597 14592 32548 32749)												.	FN3K	17		0			c.A164G												46.0	51.0	49.0					17																	80696387		2203	4300	6503	SO:0001583	missense	64122	exon2			AGGGGGAGGTGGC	AJ404615	CCDS11818.1	17q25	2008-02-05				ENSG00000167363			24822	protein-coding gene	gene with protein product		608425				11522682, 14641062	Standard	NM_022158		Approved		uc010wvs.1	Q9H479		ENST00000300784.7:c.164A>G	17.37:g.80696387A>G	ENSP00000300784:p.Glu55Gly		27	0	0		52	0.08	4	NM_022158	43	0.00	0		Missense_Mutation	SNP	ENST00000300784.7	37	CCDS11818.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.854601	0.91355	.	.	ENSG00000167363	ENST00000300784;ENST00000457624;ENST00000536165	T	0.80304	-1.36	4.93	4.93	0.64822	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.92928	0.7750	H	0.97240	3.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94847	0.8010	9	.	.	.	-18.8499	12.8398	0.57794	1.0:0.0:0.0:0.0	.	55;10	Q9H479;B3KNR9	FN3K_HUMAN;.	G	55;55;10	ENSP00000300784:E55G	.	E	+	2	0	FN3K	78289676	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.263000	0.89864	1.975000	0.57531	0.477000	0.44152	GAG			0.657	FN3K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439229.1		NM_022158	
ATP8B1	5205	mdanderson.org	37	18	55371824	55371824	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr18:55371824G>T	ENST00000283684.4	-	3	355	c.356C>A	c.(355-357)gCa>gAa	p.A119E	RP11-35G9.5_ENST00000588925.1_RNA|ATP8B1_ENST00000589147.1_5'UTR|ATP8B1_ENST00000536015.1_Missense_Mutation_p.A119E|RP11-35G9.3_ENST00000599199.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	119					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				TAAATTGGCTGCTCTCTTAAA	0.318																																					p.A119E													.	.			0			c.C356A												126.0	130.0	129.0					18																	55371824		2202	4300	6502	SO:0001583	missense	5205	exon4			TTGGCTGCTCTCT	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.356C>A	18.37:g.55371824G>T	ENSP00000283684:p.Ala119Glu		53	0	0		34	0.09	3	NM_005603	8	0.00	0	Q9BTP8	Missense_Mutation	SNP	ENST00000283684.4	37	CCDS11965.1	.	.	.	.	.	.	.	.	.	.	G	18.86	3.713706	0.68730	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	T;T	0.63580	-0.05;-0.05	6.03	4.06	0.47325	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.211717	0.49305	D	0.000155	T	0.63733	0.2536	M	0.76574	2.34	0.44966	D	0.997982	P	0.51240	0.943	P	0.45099	0.469	T	0.68439	-0.5408	10	0.62326	D	0.03	.	10.2696	0.43475	0.2191:0.0:0.7809:0.0	.	119	O43520	AT8B1_HUMAN	E	119	ENSP00000283684:A119E;ENSP00000445359:A119E	ENSP00000283684:A119E	A	-	2	0	ATP8B1	53522822	0.988000	0.35896	1.000000	0.80357	0.927000	0.56198	1.927000	0.40094	1.400000	0.46741	0.637000	0.83480	GCA			0.318	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256097.1		NM_005603	
ICAM5	7087	mdanderson.org	37	19	10402486	10402486	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:10402486G>T	ENST00000221980.4	+	3	736		c.e3+1		CTD-2369P2.8_ENST00000589379.1_RNA	NM_003259.3	NP_003250.3	Q9UMF0	ICAM5_HUMAN	intercellular adhesion molecule 5, telencephalin						phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(20;2.64e-09)|Epithelial(33;4.31e-06)|all cancers(31;9.75e-06)			CGAACCTTCTGTGAGTGGGTG	0.592																																					.													.	.			0			c.673+1G>T												18.0	22.0	20.0					19																	10402486		1983	3987	5970	SO:0001630	splice_region_variant	7087	exon3			CCTTCTGTGAGTG	U72671	CCDS12233.1	19p13.2	2013-01-14				ENSG00000105376		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5348	protein-coding gene	gene with protein product	"""telencephalin"""	601852		TLCN		8995416, 9828136	Standard	NM_003259		Approved	TLN	uc002mnu.4	Q9UMF0		ENST00000221980.4:c.673+1G>T	19.37:g.10402486G>T			62	0	0		54	0.06	3	NM_003259	0		0	Q9Y6F3	Splice_Site	SNP	ENST00000221980.4	37	CCDS12233.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.633369	0.67015	.	.	ENSG00000105376	ENST00000221980	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5068	0.67758	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ICAM5	10263486	1.000000	0.71417	0.989000	0.46669	0.838000	0.47535	5.109000	0.64615	2.508000	0.84585	0.472000	0.43445	.			0.592	ICAM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451217.1		NM_003259	Intron
GTPBP3	84705	mdanderson.org	37	19	17449511	17449511	+	Silent	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:17449511G>T	ENST00000324894.8	+	4	620	c.552G>T	c.(550-552)ctG>ctT	p.L184L	GTPBP3_ENST00000358792.7_Silent_p.L184L|GTPBP3_ENST00000598038.1_3'UTR|GTPBP3_ENST00000600625.1_Silent_p.L184L|GTPBP3_ENST00000361619.5_Silent_p.L206L	NM_032620.3|NM_133644.3	NP_116009.2|NP_598399.2	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial)	184					tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	18						ACGGAGAGCTGGGCCACCTCT	0.642																																					p.L206L													.	.			0			c.G618T												35.0	50.0	45.0					19																	17449511		2202	4298	6500	SO:0001819	synonymous_variant	84705	exon4			AGAGCTGGGCCAC	AF360742	CCDS32950.1, CCDS32951.1, CCDS56088.1, CCDS59364.1	19p13.2	2008-02-05				ENSG00000130299			14880	protein-coding gene	gene with protein product		608536				1290633	Standard	NM_001128855		Approved	MSS1, THDF1, GTPBG3, MTGP1, FLJ14700	uc010xpo.2	Q969Y2		ENST00000324894.8:c.552G>T	19.37:g.17449511G>T			49	0	0		41	0.07	3	NM_001195422	84	0.00	0	A6NFH1|A6NIG5|A6NKR4|A8K7B4|B7Z4V8|Q8TCY6|Q8WUW9|Q969G4|Q9BX61	Silent	SNP	ENST00000324894.8	37	CCDS32951.1																																																																																					0.642	GTPBP3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463624.1		NM_032620	
COMP	1311	mdanderson.org	37	19	18896612	18896612	+	Silent	SNP	C	C	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:18896612C>A	ENST00000222271.2	-	14	1583	c.1539G>T	c.(1537-1539)gtG>gtT	p.V513V	COMP_ENST00000425807.1_Silent_p.V460V|COMP_ENST00000542601.2_Silent_p.V480V	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	513			Missing (in PSACH; mild form). {ECO:0000269|PubMed:9184241}.		apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						TCTTGTCTACCACCTTGTCTG	0.637																																					p.V513V													.	.			0			c.G1539T												89.0	75.0	79.0					19																	18896612		2203	4300	6503	SO:0001819	synonymous_variant	1311	exon14			GTCTACCACCTTG	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.1539G>T	19.37:g.18896612C>A			50	0	0		41	0.07	3	NM_000095	30	0.00	0	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Silent	SNP	ENST00000222271.2	37	CCDS12385.1																																																																																					0.637	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403457.1		NM_000095	
NFKBIB	4793	mdanderson.org	37	19	39390769	39390769	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:39390769G>T	ENST00000313582.5	+	1	131	c.97G>T	c.(97-99)Gga>Tga	p.G33*	NFKBIB_ENST00000572515.1_Nonsense_Mutation_p.G33*|SIRT2_ENST00000392081.2_5'Flank|SIRT2_ENST00000358931.5_5'Flank|SIRT2_ENST00000481381.1_5'Flank|SIRT2_ENST00000249396.7_5'Flank|NFKBIB_ENST00000392079.3_Missense_Mutation_p.E19D	NM_002503.4	NP_002494.2	Q15653	IKBB_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, beta	33					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|signal transduction (GO:0007165)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)	8	all_cancers(60;4.39e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGCCCCCGGAGGACCTGGGTT	0.687											OREG0032100	type=REGULATORY REGION|TFbs=RELA|Dataset=RELA (p65) ChIP-PET Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with paired-end diTag sequencing (ChIP-PET)																									p.G33X	Pancreas(165;1492 2005 6979 7739 34483)												.	.			0			c.G97T												12.0	15.0	14.0					19																	39390769		2197	4293	6490	SO:0001587	stop_gained	4793	exon1			CCCGGAGGACCTG	L40407	CCDS12524.1, CCDS74362.1	19q13.1	2013-01-10				ENSG00000104825		"""Ankyrin repeat domain containing"""	7798	protein-coding gene	gene with protein product		604495				9763672	Standard	NM_002503		Approved	IKBB, TRIP9	uc002ojw.3	Q15653		ENST00000313582.5:c.97G>T	19.37:g.39390769G>T	ENSP00000312988:p.Gly33*		37	0	0	885	36	0.08	3	NM_002503	70	0.00	0	A8K3F4|Q96BJ7	Nonsense_Mutation	SNP	ENST00000313582.5	37	CCDS12524.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.478906|5.478906	0.96291|0.96291	.|.	.|.	ENSG00000104825|ENSG00000104825	ENST00000392079|ENST00000509705;ENST00000313582	T|.	0.48201|.	0.82|.	4.97|4.97	4.97|4.97	0.65823|0.65823	.|.	.|0.132080	.|0.34777	.|N	.|0.003700	T|.	0.41305|.	0.1153|.	.|.	.|.	.|.	0.20563|0.20563	N|N	0.999888|0.999888	B|.	0.21905|.	0.062|.	B|.	0.21917|.	0.037|.	T|.	0.28138|.	-1.0053|.	8|.	0.14656|0.24483	T|T	0.56|0.36	-11.6372|-11.6372	15.2583|15.2583	0.73601|0.73601	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	19|.	G5E9C2|.	.|.	D|X	19|56;33	ENSP00000375929:E19D|.	ENSP00000375929:E19D|ENSP00000312988:G33X	E|G	+|+	3|1	2|0	NFKBIB|NFKBIB	44082609|44082609	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.680000|0.680000	0.39746|0.39746	3.418000|3.418000	0.52721|0.52721	2.605000|2.605000	0.88082|0.88082	0.609000|0.609000	0.83330|0.83330	GAG|GGA			0.687	NFKBIB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438155.1		NM_002503	
LIPE	3991	mdanderson.org	37	19	42914477	42914477	+	Silent	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:42914477G>T	ENST00000244289.4	-	2	1677	c.1401C>A	c.(1399-1401)ggC>ggA	p.G467G	LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE_ENST00000602000.1_Intron|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	467					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				CCAGGCAGCGGCCATAGAAGC	0.627																																					p.G467G													.	.			0			c.C1401A												20.0	19.0	19.0					19																	42914477		2191	4291	6482	SO:0001819	synonymous_variant	3991	exon2			GCAGCGGCCATAG	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1401C>A	19.37:g.42914477G>T			69	0	0		54	0.06	3	NM_005357	6	0.00	0	Q3LRT2|Q6NSL7	Silent	SNP	ENST00000244289.4	37	CCDS12607.1																																																																																					0.627	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463861.1		NM_005357	
LIPE	3991	mdanderson.org	37	19	42914758	42914758	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr19:42914758G>T	ENST00000244289.4	-	2	1396	c.1120C>A	c.(1120-1122)Cgc>Agc	p.R374S	LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE_ENST00000602000.1_Intron|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	374					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				ACTAGGCTGCGGTACCCGTTG	0.682																																					p.R374S													.	.			0			c.C1120A												36.0	33.0	34.0					19																	42914758		2203	4299	6502	SO:0001583	missense	3991	exon2			GGCTGCGGTACCC	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.1120C>A	19.37:g.42914758G>T	ENSP00000244289:p.Arg374Ser		48	0	0		42	0.07	3	NM_005357	7	0.00	0	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.182615	0.78677	.	.	ENSG00000079435	ENST00000244289	T	0.51574	0.7	4.42	4.42	0.53409	Hormone-sensitive lipase, N-terminal (1);	0.070377	0.56097	N	0.000024	T	0.70193	0.3196	M	0.85373	2.75	0.80722	D	1	D;P	0.69078	0.997;0.868	D;P	0.64410	0.925;0.453	T	0.76879	-0.2796	10	0.87932	D	0	-18.5216	16.3274	0.82990	0.0:0.0:1.0:0.0	.	374;374	A8K8W7;Q05469	.;LIPS_HUMAN	S	374	ENSP00000244289:R374S	ENSP00000244289:R374S	R	-	1	0	LIPE	47606598	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	7.722000	0.84778	2.479000	0.83701	0.455000	0.32223	CGC			0.682	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463861.1		NM_005357	
DYSF	8291	broad.mit.edu	37	2	71795194	71795194	+	Silent	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr2:71795194G>T	ENST00000258104.3	+	25	2902	c.2625G>T	c.(2623-2625)ctG>ctT	p.L875L	DYSF_ENST00000429174.2_Silent_p.L875L|DYSF_ENST00000409744.1_Silent_p.L862L|DYSF_ENST00000394120.2_Silent_p.L876L|DYSF_ENST00000409651.1_Silent_p.L907L|DYSF_ENST00000410020.3_Silent_p.L893L|DYSF_ENST00000413539.2_Silent_p.L906L|DYSF_ENST00000409582.3_Silent_p.L892L|DYSF_ENST00000410041.1_Silent_p.L893L|DYSF_ENST00000409762.1_Silent_p.L892L|DYSF_ENST00000409366.1_Silent_p.L876L	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	875					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGGGGAAGCTGTCTGTCTTTG	0.602																																					p.L907L													.	DYSF	536		0			c.G2721T												166.0	153.0	157.0					2																	71795194		2203	4300	6503	SO:0001819	synonymous_variant	8291	exon26			GAAGCTGTCTGTC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.2625G>T	2.37:g.71795194G>T			192	0	0		210	0.02	5	NM_001130982	142	0.00	0	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	ENST00000258104.3	37	CCDS1918.1																																																																																					0.602	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000251970.3		NM_003494	
Unknown	0	bcgsc.ca	37	2	81426047	81426047	+	IGR	SNP	T	T	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr2:81426047T>G								AC084193.1 (328732 upstream) : AC012075.2 (263771 downstream)																							TTTCTTGTCATTTTTTTTTTC	0.408																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TTGTCATTTTTTT																													2.37:g.81426047T>G			21	0	0		14	0.21	3	.	0		0		RNA	SNP		37																																																																																					0	0.408										
TTN	7273	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	179499171	179499171	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr2:179499171C>A	ENST00000591111.1	-	180	37638	c.37414G>T	c.(37414-37416)Gat>Tat	p.D12472Y	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D11545Y|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D5240Y|TTN_ENST00000359218.5_Missense_Mutation_p.D5173Y|TTN_ENST00000589042.1_Missense_Mutation_p.D14113Y|TTN_ENST00000460472.2_Missense_Mutation_p.D5048Y|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12472					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTGAGAATCATTAATAACA	0.393																																					p.D14113Y													.	.			0			c.G42337T												74.0	75.0	75.0					2																	179499171		1859	4109	5968	SO:0001583	missense	7273	exon230			GAGAATCATTAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37414G>T	2.37:g.179499171C>A	ENSP00000465570:p.Asp12472Tyr		78	0	0		109	0.20	22	NM_001267550	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	C	11.53	1.667637	0.29604	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	6.17	-3.97	0.04094	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.49423	0.1556	M	0.87900	2.915	0.37588	D	0.920061	B;B;B;B	0.27765	0.188;0.093;0.188;0.093	B;B;B;B	0.33799	0.17;0.17;0.17;0.17	T	0.52495	-0.8568	9	0.87932	D	0	.	6.7067	0.23254	0.0:0.394:0.1997:0.4063	.	5048;5173;5240;12472	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Y	11545;5048;5240;5173;5048	ENSP00000343764:D11545Y;ENSP00000434586:D5048Y;ENSP00000340554:D5240Y;ENSP00000352154:D5173Y	ENSP00000340554:D5240Y	D	-	1	0	TTN	179207416	0.044000	0.20184	0.881000	0.34555	0.975000	0.68041	-0.660000	0.05317	-0.721000	0.04929	-0.136000	0.14681	GAT			0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
KANSL1L	151050	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	2	211018586	211018588	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	TTC	TTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr2:211018586_211018588delTTC	ENST00000281772.9	-	2	982_984	c.719_721delGAA	c.(718-723)agaact>act	p.R240del	KANSL1L_ENST00000457374.1_In_Frame_Del_p.R240del|KANSL1L_ENST00000452086.1_In_Frame_Del_p.R240del|KANSL1L_ENST00000418791.1_In_Frame_Del_p.R240del|KANSL1L_ENST00000429908.2_5'Flank	NM_152519.2	NP_689732.2	A0AUZ9	KAL1L_HUMAN	KAT8 regulatory NSL complex subunit 1-like	240						histone acetyltransferase complex (GO:0000123)											TGTTTCTGAGTTCTTCTAGCCTG	0.404																																					p.240_241del													.	.			0			c.720_722del																																									SO:0001651	inframe_deletion	151050	exon2			TCTGAGTTCTTCT	AK074441	CCDS33370.1	2q34	2012-02-20	2012-02-20	2012-02-20	ENSG00000144445	ENSG00000144445			26310	protein-coding gene	gene with protein product	"""KIAA1267-like"""	613833	"""chromosome 2 open reading frame 67"""	C2orf67		12477932	Standard	NM_152519		Approved	FLJ23861, FLJ32349, MSL1v2, KIAA1267L	uc002vds.3	A0AUZ9	OTTHUMG00000154697	ENST00000281772.9:c.719_721delGAA	2.37:g.211018589_211018591delTTC	ENSP00000281772:p.Arg240del		109	0	0		106	0.23	24	NM_152519	12	0.00	0	B7ZLN1|I6L9A8|Q53TV8|Q53TW3|Q6IS05|Q8TCI1|Q96MI0|Q9UFC3	In_Frame_Del	DEL	ENST00000281772.9	37	CCDS33370.1																																																																																					0.404	KANSL1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336633.3		NM_152519	
ESPNL	339768	mdanderson.org	37	2	239040289	239040289	+	Silent	SNP	C	C	T	rs182590742		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr2:239040289C>T	ENST00000343063.3	+	9	3197	c.2934C>T	c.(2932-2934)aaC>aaT	p.N978N	ESPNL_ENST00000477241.1_3'UTR|ESPNL_ENST00000409169.1_Silent_p.N934N|ESPNL_ENST00000409506.1_Silent_p.N610N	NM_194312.2	NP_919288.2	Q6ZVH7	ESPNL_HUMAN	espin-like	978										endometrium(1)|lung(8)|pancreas(2)|skin(2)	13		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GCAGCTTCAACGGTGAGGACA	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		17020	0.0		0.001	False		,,,				2504	0.0				p.N978N													ESPNL,NS,carcinoma,+2,1	ESPNL	2	1	0			c.C2934T												40.0	42.0	41.0					2																	239040289		2203	4300	6503	SO:0001819	synonymous_variant	339768	exon9			CTTCAACGGTGAG	AK124559	CCDS2525.1	2q37.3	2013-01-10			ENSG00000144488	ENSG00000144488		"""Ankyrin repeat domain containing"""	27937	protein-coding gene	gene with protein product						12975309	Standard	NM_194312		Approved	FLJ42568	uc002vxq.4	Q6ZVH7	OTTHUMG00000133335	ENST00000343063.3:c.2934C>T	2.37:g.239040289C>T			100	0	0		99	0.05	5	NM_194312	0		0	Q66K27|Q6ZVG1|Q8IVU2	Silent	SNP	ENST00000343063.3	37	CCDS2525.1																																																																																			0		0.637	ESPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257164.2		NM_194312	
NCOR1P1	149934	broad.mit.edu	37	20	26094406	26094407	+	RNA	INS	-	-	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr20:26094406_26094407insC	ENST00000478176.1	-	0	150					NR_003678.1		Q9H4R4	CT191_HUMAN	nuclear receptor corepressor 1 pseudogene 1																		AGCTCTTGCCATTTAAAAAAAA	0.322																																					.													.	.			0			.																																											0	.			CTTGCCATTTAAA	AL391119		20p11.1	2011-09-16	2011-09-16	2011-09-16	ENSG00000240108	ENSG00000240108			16724	pseudogene	pseudogene			"""chromosome 20 open reading frame 191"""	C20orf191			Standard	NR_003678		Approved	bB329D4.2	uc002wvj.5	Q9H4R4	OTTHUMG00000032145		20.37:g.26094406_26094407insC			5	0.4	2		6	0.33	2	.	0		0	A2RUA0	RNA	INS	ENST00000478176.1	37																																																																																						0.322	NCOR1P1-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000078478.2			
LINC01598	105379478	broad.mit.edu	37	20	29572402	29572403	+	RNA	INS	-	-	AC	rs58615714|rs112353720|rs200824028|rs527353404|rs71333757	byFrequency	TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr20:29572402_29572403insAC	ENST00000445151.1	-	0	0				RP4-610C12.1_ENST00000432067.1_RNA																							gagagaACGGGacacacacaca	0.495														1343	0.268171	0.3805	0.2233	5008	,	,		15046	0.2123		0.2207	False		,,,				2504	0.2546				.													.	.			0			.																																											0	.			GAACGGGACACAC																													20.37:g.29572411_29572412dupAC			4	0	0		6	0.50	3	.	0		0		RNA	INS	ENST00000445151.1	37																																																																																						0.495	RP4-610C12.1-003	KNOWN	non_canonical_polymorphism|basic	antisense	antisense		OTTHUMT00000078491.2			
FRG1B	284802	bcgsc.ca	37	20	29628229	29628229	+	Silent	SNP	G	G	T	rs373737774		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr20:29628229G>T	ENST00000278882.3	+	6	611	c.231G>T	c.(229-231)ggG>ggT	p.G77G	FRG1B_ENST00000439954.2_Silent_p.G82G|FRG1B_ENST00000358464.4_Silent_p.G77G			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	77										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						TCACTTAGGGGAAAATGGCTT	0.353																																					.													.	FRG1B	181		0			.																																									SO:0001819	synonymous_variant	284802	.			TTAGGGGAAAATG			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.231G>T	20.37:g.29628229G>T			508	0.0255905512	13		428	0.04	18	.	100	0.00	0	C4AME5	Silent	SNP	ENST00000278882.3	37																																																																																						0.353	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2		NR_003579	
NFATC2	4773	broad.mit.edu;ucsc.edu;mdanderson.org	37	20	50049133	50049133	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr20:50049133G>T	ENST00000396009.3	-	9	2412	c.2193C>A	c.(2191-2193)ttC>ttA	p.F731L	NFATC2_ENST00000414705.1_Missense_Mutation_p.F711L|NFATC2_ENST00000610033.1_Missense_Mutation_p.F512L|NFATC2_ENST00000371564.3_Missense_Mutation_p.F731L|NFATC2_ENST00000609943.1_Missense_Mutation_p.F711L|NFATC2_ENST00000609507.1_Missense_Mutation_p.F512L	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	731					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GCCCCGTGCGGAACTGCTGGC	0.687																																					p.F731L													.	NFATC2	112		0			c.C2193A												22.0	27.0	26.0					20																	50049133		2203	4299	6502	SO:0001583	missense	4773	exon9			CGTGCGGAACTGC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2193C>A	20.37:g.50049133G>T	ENSP00000379330:p.Phe731Leu		35	0.0285714286	1		38	0.13	5	NM_012340	3	0.33	1	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	G	11.20	1.568125	0.28003	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.12672	2.67;2.67;2.66	5.45	3.39	0.38822	.	0.152429	0.50627	D	0.000120	T	0.04363	0.0120	N	0.03608	-0.345	0.30083	N	0.808962	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.31888	-0.9927	10	0.11485	T	0.65	-23.8473	4.3959	0.11363	0.0866:0.2438:0.5445:0.1251	.	711;711;731;731	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	L	731;731;711	ENSP00000360619:F731L;ENSP00000379330:F731L;ENSP00000396471:F711L	ENSP00000360619:F731L	F	-	3	2	NFATC2	49482540	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	2.396000	0.44468	1.310000	0.45006	-0.145000	0.13849	TTC			0.687	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079730.2		NM_012340	
SDF2L1	23753	broad.mit.edu	37	22	21997332	21997332	+	Silent	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr22:21997332G>A	ENST00000248958.4	+	2	445	c.369G>A	c.(367-369)ccG>ccA	p.P123P	KB-1440D3.14_ENST00000609038.1_lincRNA	NM_022044.2	NP_071327.2	Q9HCN8	SDF2L_HUMAN	stromal cell-derived factor 2-like 1	123	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				prostate(1)	1	Colorectal(54;0.105)					TCCCGTCGCCGCTGTCCAACA	0.692											OREG0026342	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P123P													.	SDF2L1	5		0			c.G369A												8.0	9.0	9.0					22																	21997332		2141	4199	6340	SO:0001819	synonymous_variant	23753	exon2			GTCGCCGCTGTCC		CCDS13792.1	22q11.21	2008-07-01			ENSG00000128228	ENSG00000128228			10676	protein-coding gene	gene with protein product	"""dihydropyrimidinase-like 2"", ""PWP1-interacting protein 8"""	607551				10591208, 11162531	Standard	NM_022044		Approved	AP000553.C22.4, OTTHUMT00000075032	uc002zvf.3	Q9HCN8	OTTHUMG00000150820	ENST00000248958.4:c.369G>A	22.37:g.21997332G>A			145	0	0	752	176	0.03	5	NM_022044	222	0.00	0	A2RUD3|Q9BRI5	Silent	SNP	ENST00000248958.4	37	CCDS13792.1																																																																																					0.692	SDF2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320197.1		NM_022044	
CELSR1	9620	mdanderson.org	37	22	46931106	46931106	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr22:46931106G>T	ENST00000262738.3	-	1	1961	c.1962C>A	c.(1960-1962)agC>agA	p.S654R	CELSR1_ENST00000497509.1_5'Flank|CELSR1_ENST00000395964.1_Missense_Mutation_p.S654R	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	654	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CCACCCCGAAGCTGTAGTGCT	0.637																																					p.S654R													.	.			0			c.C1962A												30.0	25.0	27.0					22																	46931106		2200	4295	6495	SO:0001583	missense	9620	exon1			CCCGAAGCTGTAG	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.1962C>A	22.37:g.46931106G>T	ENSP00000262738:p.Ser654Arg		18	0	0		34	0.09	3	NM_014246	11	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.078|6.078	0.382667|0.382667	0.11524|0.11524	.|.	.|.	ENSG00000075275|ENSG00000075275	ENST00000454637|ENST00000262738;ENST00000395964	.|T;T	.|0.01821	.|4.62;4.62	4.52|4.52	3.5|3.5	0.40072|0.40072	.|Cadherin (4);Cadherin-like (1);	.|0.073333	.|0.52532	.|U	.|0.000075	T|T	0.01092|0.01092	0.0036|0.0036	N|N	0.05467|0.05467	-0.045|-0.045	0.29474|0.29474	N|N	0.85682|0.85682	.|B	.|0.21688	.|0.059	.|B	.|0.18263	.|0.021	T|T	0.42413|0.42413	-0.9453|-0.9453	5|10	.|0.18710	.|T	.|0.47	.|.	8.8|8.8	0.34903|0.34903	0.1759:0.0:0.8241:0.0|0.1759:0.0:0.8241:0.0	.|.	.|654	.|Q9NYQ6	.|CELR1_HUMAN	D|R	29|654	.|ENSP00000262738:S654R;ENSP00000379293:S654R	.|ENSP00000262738:S654R	A|S	-|-	2|3	0|2	CELSR1|CELSR1	45309770|45309770	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.835000|0.835000	0.47333|0.47333	1.825000|1.825000	0.39081|0.39081	0.898000|0.898000	0.36418|0.36418	0.313000|0.313000	0.20887|0.20887	GCT|AGC			0.637	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
FANCD2	2177	mdanderson.org	37	3	10089633	10089633	+	Silent	SNP	G	G	T	rs564577177		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr3:10089633G>T	ENST00000419585.1	+	16	1472	c.1311G>T	c.(1309-1311)tcG>tcT	p.S437S	FANCD2_ENST00000287647.3_Silent_p.S437S|FANCD2_ENST00000383807.1_Silent_p.S437S|FANCD2_ENST00000383806.1_Silent_p.S437S			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	437					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CCATTCTGTCGCTGGCTCAGA	0.408			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia				g|||	1	0.000199681	0.0	0.0	5008	,	,		19546	0.0		0.0	False		,,,				2504	0.001				p.S437S			yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	.			0			c.G1311T												171.0	174.0	173.0					3																	10089633		2203	4300	6503	SO:0001819	synonymous_variant	2177	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TCTGTCGCTGGCT	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1311G>T	3.37:g.10089633G>T			81	0	0		93	0.04	4	NM_001018115	16	0.00	0	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Silent	SNP	ENST00000419585.1	37	CCDS33696.1																																																																																					0.408	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339873.1			
IQSEC1	9922	mdanderson.org	37	3	12950917	12950917	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr3:12950917G>A	ENST00000273221.4	-	11	2692	c.2476C>T	c.(2476-2478)Cgg>Tgg	p.R826W		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	826	PH.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.R826W(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAGGTGAGCCGGATGCCATTG	0.542																																					p.R826W													IQSEC1,colon,carcinoma,0,1	IQSEC1	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2476T												78.0	79.0	79.0					3																	12950917		2203	4300	6503	SO:0001583	missense	9922	exon11			TGAGCCGGATGCC	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.2476C>T	3.37:g.12950917G>A	ENSP00000273221:p.Arg826Trp		60	0	0		74	0.05	4	NM_014869	39	0.00	0	O94863|Q96D85	Missense_Mutation	SNP	ENST00000273221.4	37	CCDS33703.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.27|19.27	3.794463|3.794463	0.70452|0.70452	.|.	.|.	ENSG00000144711|ENSG00000144711	ENST00000450726|ENST00000273221;ENST00000435445;ENST00000429247	.|T;T	.|0.53857	.|0.6;0.6	4.76|4.76	3.86|3.86	0.44501|0.44501	.|Pleckstrin homology-type (1);Pleckstrin homology domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.70885|0.70885	0.3275|0.3275	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.77004	.|0.94;0.989;0.94	T|T	0.74615|0.74615	-0.3606|-0.3606	4|9	.|0.87932	.|D	.|0	.|.	12.2582|12.2582	0.54634|0.54634	0.0:0.0:0.691:0.309|0.0:0.0:0.691:0.309	.|.	.|812;812;826	.|E9PG60;C9JMG9;Q6DN90	.|.;.;IQEC1_HUMAN	L|W	826|826;812;812	.|ENSP00000273221:R826W;ENSP00000402299:R812W	.|ENSP00000273221:R826W	P|R	-|-	2|1	0|2	IQSEC1|IQSEC1	12925917|12925917	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	4.006000|4.006000	0.57083|0.57083	1.089000|1.089000	0.41292|0.41292	0.655000|0.655000	0.94253|0.94253	CCG|CGG			0.542	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000339865.2		NM_014869	
RP11-190P13.2	0	broad.mit.edu	37	3	114998899	114998900	+	lincRNA	INS	-	-	A	rs566064368		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr3:114998899_114998900insA	ENST00000459855.1	+	0	338																											GTGCTAAATTTAAAAAAAAAAA	0.366																																					.													.	.			0			.																																											0	.			TAAATTTAAAAAA																													3.37:g.114998910_114998910dupA			5	0	0		7	0.43	3	.	1	0.00	0		RNA	INS	ENST00000459855.1	37																																																																																						0.366	RP11-190P13.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000354479.1			
EIF4G1	1981	broad.mit.edu	37	3	184040514	184040514	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr3:184040514G>T	ENST00000346169.2	+	12	2062	c.1791G>T	c.(1789-1791)aaG>aaT	p.K597N	EIF4G1_ENST00000352767.3_Missense_Mutation_p.K604N|EIF4G1_ENST00000414031.1_Missense_Mutation_p.K557N|EIF4G1_ENST00000427845.1_Missense_Mutation_p.K510N|EIF4G1_ENST00000424196.1_Missense_Mutation_p.K604N|EIF4G1_ENST00000435046.2_Missense_Mutation_p.K401N|EIF4G1_ENST00000382330.3_Missense_Mutation_p.K604N|EIF4G1_ENST00000319274.6_Missense_Mutation_p.K597N|EIF4G1_ENST00000350481.5_Missense_Mutation_p.K433N|EIF4G1_ENST00000434061.2_Missense_Mutation_p.K401N|EIF4G1_ENST00000411531.1_Missense_Mutation_p.K557N|SNORD66_ENST00000390856.1_RNA|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000342981.4_Missense_Mutation_p.K597N|EIF4G1_ENST00000392537.2_Missense_Mutation_p.K510N|EIF4G1_ENST00000441154.1_Missense_Mutation_p.K433N	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	597	MIF4G. {ECO:0000255|PROSITE- ProRule:PRU00698}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ATGAATATAAGTCAGGTATGC	0.458																																					p.K604N													.	EIF4G1	151		0			c.G1812T												64.0	67.0	66.0					3																	184040514		2203	4300	6503	SO:0001583	missense	1981	exon13			ATATAAGTCAGGT	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1791G>T	3.37:g.184040514G>T	ENSP00000316879:p.Lys597Asn		148	0	0		193	0.02	4	NM_001194946	855	0.00	0	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	37	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651417	0.47362	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.37	2.67	0.31697	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	L	0.41906	1.305	0.50313	D	0.999867	D;D;B;D	0.76494	0.999;0.997;0.402;0.997	D;P;B;D	0.67725	0.953;0.885;0.119;0.922	T	0.59118	-0.7514	10	0.24483	T	0.36	-20.7827	10.8203	0.46601	0.204:0.0:0.796:0.0	.	604;597;597;604	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	N	597;557;510;597;604;604;538;433;604;510;597;597;604;557;433;433;401;401	ENSP00000316879:K597N;ENSP00000391935:K557N;ENSP00000376320:K510N;ENSP00000391412:K597N;ENSP00000413159:K604N;ENSP00000371767:K604N;ENSP00000403269:K538N;ENSP00000317600:K433N;ENSP00000338020:K604N;ENSP00000407682:K510N;ENSP00000343450:K597N;ENSP00000323737:K597N;ENSP00000416255:K604N;ENSP00000395974:K557N;ENSP00000398145:K433N;ENSP00000399858:K433N;ENSP00000411826:K401N;ENSP00000404754:K401N	ENSP00000323737:K597N	K	+	3	2	EIF4G1	185523208	1.000000	0.71417	0.993000	0.49108	0.697000	0.40408	2.761000	0.47589	0.419000	0.25927	-0.463000	0.05309	AAG			0.458	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000345733.1		NM_182917	
LOX	4015	mdanderson.org	37	5	121413599	121413599	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr5:121413599G>T	ENST00000231004.4	-	1	381	c.82C>A	c.(82-84)Caa>Aaa	p.Q28K	LOX_ENST00000513319.1_5'Flank	NM_001178102.1|NM_002317.5	NP_001171573.1|NP_002308.2	P28300	LYOX_HUMAN	lysyl oxidase	28					blood vessel development (GO:0001568)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|elastic fiber assembly (GO:0048251)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|wound healing (GO:0042060)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)			endometrium(1)|lung(6)|prostate(1)	8		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		GGCTGCTGTTGGCCGGCGGCG	0.697																																					p.Q28K													.	.			0			c.C82A												4.0	5.0	5.0					5																	121413599		1810	3614	5424	SO:0001583	missense	4015	exon1			GCTGTTGGCCGGC		CCDS4129.1	5q23.3-q31.2	2008-02-05			ENSG00000113083	ENSG00000113083	1.4.3.13		6664	protein-coding gene	gene with protein product		153455				1685472	Standard	NM_002317		Approved		uc003ksu.3	P28300	OTTHUMG00000128914	ENST00000231004.4:c.82C>A	5.37:g.121413599G>T	ENSP00000231004:p.Gln28Lys		30	0	0		36	0.08	3	NM_002317	3	0.00	0	B2R5Q3|Q5FWF0	Missense_Mutation	SNP	ENST00000231004.4	37	CCDS4129.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758733	0.31137	.	.	ENSG00000113083	ENST00000231004;ENST00000543620;ENST00000395480	T	0.23950	1.88	4.34	4.34	0.51931	.	0.263388	0.38217	N	0.001778	T	0.12561	0.0305	N	0.08118	0	0.22947	N	0.998525	B	0.13594	0.008	B	0.14578	0.011	T	0.18871	-1.0323	10	0.11794	T	0.64	.	13.1635	0.59557	0.0:0.1617:0.8383:0.0	.	28	P28300	LYOX_HUMAN	K	28	ENSP00000231004:Q28K	ENSP00000231004:Q28K	Q	-	1	0	LOX	121441498	0.981000	0.34729	0.439000	0.26833	0.625000	0.37756	1.627000	0.37050	1.953000	0.56701	0.313000	0.20887	CAA			0.697	LOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250887.2			
JAKMIP2	9832	broad.mit.edu	37	5	147051343	147051343	+	Silent	SNP	G	G	T	rs180692323		TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr5:147051343G>T	ENST00000265272.5	-	2	494	c.27C>A	c.(25-27)ggC>ggA	p.G9G	JAKMIP2_ENST00000333010.6_Intron|JAKMIP2_ENST00000507386.1_Silent_p.G9G	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	9						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCTTCTCGCCCTTATTTC	0.453																																					p.G9G													.	JAKMIP2	154		0			c.C27A												145.0	135.0	139.0					5																	147051343		2203	4300	6503	SO:0001819	synonymous_variant	9832	exon2			CTTCTCGCCCTTA	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.27C>A	5.37:g.147051343G>T			128	0	0		114	0.04	4	NM_001270941	2	0.00	0	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Silent	SNP	ENST00000265272.5	37	CCDS4285.1																																																																																					0.453	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251941.1		NM_014790	
RGS14	10636	broad.mit.edu	37	5	176798511	176798511	+	Silent	SNP	T	T	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr5:176798511T>C	ENST00000408923.3	+	14	1607	c.1419T>C	c.(1417-1419)caT>caC	p.H473H	RGS14_ENST00000506944.1_3'UTR	NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	473					cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGGCCACCCATCCCCCTCCAG	0.597																																					p.H473H	NSCLC(47;353 1896 28036)												RGS14,NS,adenocarcinoma,0,1	RGS14	34	1	0			c.T1419C												122.0	134.0	130.0					5																	176798511		1973	4163	6136	SO:0001819	synonymous_variant	10636	exon14			CACCCATCCCCCT	AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1419T>C	5.37:g.176798511T>C			157	0	0		165	0.02	4	NM_006480	97	0.01	1	O43565|Q506M1|Q6ZWA4|Q8TD62	Silent	SNP	ENST00000408923.3	37	CCDS43405.1	.	.	.	.	.	.	.	.	.	.	T	7.070	0.568078	0.13560	.	.	ENSG00000169220	ENST00000511890	.	.	.	4.92	-9.82	0.00484	.	.	.	.	.	T	0.27027	0.0662	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29701	-1.0003	4	.	.	.	-11.1371	10.0903	0.42443	0.0814:0.6515:0.0875:0.1797	.	.	.	.	T	344	.	.	I	+	2	0	RGS14	176731117	0.000000	0.05858	0.000000	0.03702	0.732000	0.41865	-1.476000	0.02333	-1.708000	0.01401	-0.503000	0.04515	ATC			0.597	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000372676.1		NM_006480	
GMPR	2766	mdanderson.org	37	6	16290845	16290845	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr6:16290845G>T	ENST00000259727.4	+	8	964	c.850G>T	c.(850-852)Gag>Tag	p.E284*	GMPR_ENST00000544145.1_3'UTR	NM_006877.3	NP_006868.3	P36959	GMPR1_HUMAN	guanosine monophosphate reductase	284					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to cold (GO:0009409)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	20	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				AGGAGTTGCTGAGTACAGGTG	0.572																																					p.E284X													.	.			0			c.G850T												110.0	101.0	104.0					6																	16290845		2203	4300	6503	SO:0001587	stop_gained	2766	exon8			GTTGCTGAGTACA		CCDS4537.1	6p23	2009-07-10			ENSG00000137198	ENSG00000137198	1.7.1.7		4376	protein-coding gene	gene with protein product		139265				2194676	Standard	NM_006877		Approved		uc003nbs.3	P36959	OTTHUMG00000014302	ENST00000259727.4:c.850G>T	6.37:g.16290845G>T	ENSP00000259727:p.Glu284*		64	0	0		43	0.07	3	NM_006877	132	0.00	0	Q96HQ6	Nonsense_Mutation	SNP	ENST00000259727.4	37	CCDS4537.1	.	.	.	.	.	.	.	.	.	.	G	39	7.647499	0.98409	.	.	ENSG00000137198	ENST00000259727	.	.	.	5.55	5.55	0.83447	.	0.100264	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.6346	19.4992	0.95086	0.0:0.0:1.0:0.0	.	.	.	.	X	284	.	ENSP00000259727:E284X	E	+	1	0	GMPR	16398824	1.000000	0.71417	0.956000	0.39512	0.908000	0.53690	9.869000	0.99810	2.598000	0.87819	0.655000	0.94253	GAG			0.572	GMPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039942.2			
ZNF391	346157	mdanderson.org	37	6	27369205	27369205	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr6:27369205G>C	ENST00000244576.4	+	3	1601	c.1056G>C	c.(1054-1056)caG>caC	p.Q352H	RP1-153G14.4_ENST00000607727.1_lincRNA	NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						TCAGACATCAGCACCTTCATA	0.368																																					p.Q352H													.	.			0			c.G1056C												51.0	51.0	51.0					6																	27369205		1962	4164	6126	SO:0001583	missense	346157	exon3			ACATCAGCACCTT	BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.1056G>C	6.37:g.27369205G>C	ENSP00000244576:p.Gln352His		33	0	0		22	0.09	2	NM_001076781	9	0.00	0	B4DH77	Missense_Mutation	SNP	ENST00000244576.4	37	CCDS43429.1	.	.	.	.	.	.	.	.	.	.	G	9.199	1.027892	0.19512	.	.	ENSG00000124613	ENST00000244576	T	0.36520	1.25	3.61	2.72	0.32119	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13157	0.0319	L	0.53617	1.68	0.25327	N	0.989062	B	0.30870	0.298	B	0.23018	0.043	T	0.17806	-1.0357	9	0.66056	D	0.02	.	5.7544	0.18164	0.2561:0.0:0.7439:0.0	.	352	Q9UJN7	ZN391_HUMAN	H	352	ENSP00000244576:Q352H	ENSP00000244576:Q352H	Q	+	3	2	ZNF391	27477184	0.495000	0.26051	0.644000	0.29465	0.049000	0.14656	2.192000	0.42649	0.610000	0.30035	0.557000	0.71058	CAG			0.368	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040145.2		NM_001076781	
DDR1	780	mdanderson.org	37	6	30865223	30865223	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr6:30865223G>T	ENST00000324771.8	+	17	2613	c.2065G>T	c.(2065-2067)Ggc>Tgc	p.G689C	DDR1_ENST00000513240.1_Missense_Mutation_p.G695C|DDR1_ENST00000452441.1_Missense_Mutation_p.G689C|DDR1_ENST00000376569.3_Missense_Mutation_p.G652C|DDR1_ENST00000454612.2_Missense_Mutation_p.G652C|DDR1_ENST00000508312.1_Missense_Mutation_p.G670C|DDR1_ENST00000376575.3_Missense_Mutation_p.G695C|DDR1_ENST00000418800.2_Missense_Mutation_p.G652C|DDR1_ENST00000376568.3_Missense_Mutation_p.G689C|DDR1_ENST00000376567.2_Missense_Mutation_p.G652C|DDR1_ENST00000376570.4_Missense_Mutation_p.G652C|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000361741.4_Missense_Mutation_p.G356C			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	689	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	TCGGCTGCTGGGCGTGTGTGT	0.542																																					p.G695C													DDR1_ENST00000376575,NS,adenocarcinoma,-2,3	DDR1_ENST00000376575	-2	3	0			c.G2083T												106.0	96.0	99.0					6																	30865223		2203	4300	6503	SO:0001583	missense	780	exon14			CTGCTGGGCGTGT	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.2065G>T	6.37:g.30865223G>T	ENSP00000318217:p.Gly689Cys		65	0	0		57	0.05	3	NM_013994	129	0.00	0	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	37	CCDS34385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.4|27.4	4.832003|4.832003	0.91036|0.91036	.|.	.|.	ENSG00000204580|ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240;ENST00000417521;ENST00000361741|ENST00000484556	D;D;D;D;D;D;D;D;D;D;D;D;D|.	0.89343|.	-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5;-2.5|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.82949|0.82949	0.5148|0.5148	M|M	0.91920|0.91920	3.255|3.255	0.80722|0.80722	D|D	1|1	D;P;D;P;D|.	0.89917|.	1.0;0.886;1.0;0.653;1.0|.	D;P;D;P;D|.	0.97110|.	1.0;0.648;0.995;0.482;1.0|.	D|D	0.86583|0.86583	0.1855|0.1855	10|5	0.59425|.	D|.	0.04|.	.|.	16.6419|16.6419	0.85128|0.85128	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	670;153;421;695;689|.	B7Z2K0;A2ABL4;A2ABM8;Q08345-5;Q08345|.	.;.;.;.;DDR1_HUMAN|.	C|C	689;652;652;652;695;652;689;689;670;652;695;421;356|45	ENSP00000318217:G689C;ENSP00000407699:G652C;ENSP00000406091:G652C;ENSP00000365753:G652C;ENSP00000365759:G695C;ENSP00000365754:G652C;ENSP00000365752:G689C;ENSP00000405039:G689C;ENSP00000422442:G670C;ENSP00000365751:G652C;ENSP00000427552:G695C;ENSP00000398682:G421C;ENSP00000354844:G356C|.	ENSP00000318217:G689C|.	G|W	+|+	1|3	0|0	DDR1|DDR1	30973202|30973202	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	9.697000|9.697000	0.98697|0.98697	2.525000|2.525000	0.85131|0.85131	0.462000|0.462000	0.41574|0.41574	GGC|TGG			0.542	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000076494.3		NM_013994	
CUL9	23113	mdanderson.org	37	6	43193827	43193827	+	IGR	SNP	C	C	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr6:43193827C>T	ENST00000252050.4	+	0	7780				DNPH1_ENST00000393987.2_Missense_Mutation_p.R107Q|RP3-330M21.5_ENST00000500590.1_RNA|DNPH1_ENST00000230431.6_Missense_Mutation_p.R107Q	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9						microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						GGCCACGGCCCGGCCCAGCTC	0.622																																					p.R107Q													.	.			0			c.G320A												37.0	30.0	33.0					6																	43193827		2202	4296	6498	SO:0001628	intergenic_variant	10591	exon3			ACGGCCCGGCCCA	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723		6.37:g.43193827C>T			41	0	0		37	0.08	3	NM_006443	227	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.127974	0.77549	.	.	ENSG00000112667	ENST00000230431;ENST00000509253;ENST00000393987	.	.	.	4.73	0.882	0.19172	.	0.085063	0.47852	N	0.000208	T	0.29749	0.0743	M	0.82323	2.585	0.44359	D	0.997258	P;P	0.49358	0.923;0.758	B;B	0.39068	0.283;0.289	T	0.09618	-1.0666	9	0.30854	T	0.27	-1.2515	4.241	0.10648	0.0:0.5459:0.1685:0.2856	.	107;107	O43598-2;O43598	.;RCL_HUMAN	Q	107;176;107	.	ENSP00000230431:R107Q	R	-	2	0	C6orf108	43301805	1.000000	0.71417	0.983000	0.44433	0.795000	0.44927	3.528000	0.53524	-0.022000	0.13986	0.462000	0.41574	CGG			0.622	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
PMS2P3	5387	broad.mit.edu	37	7	75154976	75154977	+	RNA	INS	-	-	A			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr7:75154976_75154977insA	ENST00000418756.1	-	0	618					NR_028059.1		Q13401	PM2P3_HUMAN	postmeiotic segregation increased 2 pseudogene 3						mismatch repair (GO:0006298)|regulation of transcription, DNA-templated (GO:0006355)	mismatch repair complex (GO:0032300)	nucleic acid binding (GO:0003676)			lung(1)	1						gactccgtctcaaaaaaaaaaa	0.559																																					.	NSCLC(70;602 1339 5301 18528 38453)												.	PMS2P3	7		0			.																																											0	.			CCGTCTCAAAAAA	D38437		7q11.23	2010-10-26	2010-10-26	2010-10-26	ENSG00000127957	ENSG00000127957			9128	pseudogene	pseudogene			"""postmeiotic segregation increased 2-like 3"", ""postmeiotic segregation increased 2-like 3, pseudogene"""	PMS2L9, PMS2L3		8586419	Standard	NR_028059		Approved	PMS5, PMSR3	uc022agi.1	Q13401	OTTHUMG00000156049		7.37:g.75154987_75154987dupA			6	0	0		12	0.42	5	.	0		0	A6NG70|Q3MJ29	RNA	INS	ENST00000418756.1	37																																																																																						0.559	PMS2P3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000342862.2		NR_028059	
MIR29B1	407024	broad.mit.edu	37	7	130561833	130561833	+	lincRNA	DEL	A	A	-	rs67760466|rs370025452	byFrequency	TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr7:130561833delA	ENST00000447430.1	+	0	156				MIR29B1_ENST00000385015.1_lincRNA|MIR29B1_ENST00000362111.2_lincRNA																							tctctgatagaaaatggtgta	0.383													AAAA|AAAA|AAA|deletion	847	0.169129	0.236	0.1628	5008	,	,		22057	0.1925		0.0447	False		,,,				2504	0.1871				.													.	.			0			.																																											0	.			TGATAGAAAATGG																													7.37:g.130561833delA			5	0	0		14	0.36	5	.	0		0		RNA	DEL	ENST00000447430.1	37																																																																																						0.383	AC016831.7-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000338093.1			
FOXD4	2298	mdanderson.org	37	9	117487	117487	+	Silent	SNP	C	C	T	rs201596201	byFrequency	TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr9:117487C>T	ENST00000382500.2	-	1	930	c.633G>A	c.(631-633)ctG>ctA	p.L211L		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	211	Pro-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		AGGGGTGGGGCAGGTGGGCTC	0.716																																					p.L211L													.	.			0			c.G633A																																									SO:0001819	synonymous_variant	2298	exon1			GTGGGGCAGGTGG	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.633G>A	9.37:g.117487C>T			30	0.0333333333	1		28	0.25	7	NM_207305	1	1.00	1	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Silent	SNP	ENST00000382500.2	37	CCDS34975.1																																																																																			0.004		0.716	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055433.1		NM_207305	
COL15A1	1306	broad.mit.edu	37	9	101797339	101797339	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr9:101797339A>G	ENST00000375001.3	+	18	2546	c.2123A>G	c.(2122-2124)aAg>aGg	p.K708R		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	708	Collagen-like 2.|Triple-helical region 2 (COL2).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				CCGGGGAAAAAGGGACAAGCT	0.617																																					p.K708R													.	COL15A1	211		0			c.A2123G												48.0	48.0	48.0					9																	101797339		2202	4299	6501	SO:0001583	missense	1306	exon18			GGAAAAAGGGACA	L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.2123A>G	9.37:g.101797339A>G	ENSP00000364140:p.Lys708Arg		114	0	0		124	0.03	4	NM_001855	43	0.00	0	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	ENST00000375001.3	37	CCDS35081.1	.	.	.	.	.	.	.	.	.	.	A	8.041	0.763906	0.15914	.	.	ENSG00000204291	ENST00000375001;ENST00000536083	D	0.93547	-3.24	5.69	4.53	0.55603	.	0.498001	0.19952	N	0.102410	T	0.80654	0.4664	N	0.01482	-0.84	0.19300	N	0.999977	B	0.14438	0.01	B	0.16722	0.016	T	0.68969	-0.5269	10	0.26408	T	0.33	-4.0721	9.8533	0.41070	0.8277:0.1723:0.0:0.0	.	708	P39059	COFA1_HUMAN	R	708;678	ENSP00000364140:K708R	ENSP00000364140:K708R	K	+	2	0	COL15A1	100837160	0.371000	0.25056	0.707000	0.30419	0.304000	0.27724	1.029000	0.30140	0.961000	0.38030	0.533000	0.62120	AAG			0.617	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053386.3		NM_001855	
CRB2	286204	mdanderson.org	37	9	126129887	126129887	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr9:126129887T>C	ENST00000373631.3	+	6	977	c.976T>C	c.(976-978)Tca>Cca	p.S326P	CRB2_ENST00000373629.2_5'Flank|CRB2_ENST00000359999.3_Missense_Mutation_p.S326P	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	326	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						CGAGTGTGCCTCACGGCCATG	0.672																																					p.S326P													.	.			0			c.T976C												44.0	36.0	39.0					9																	126129887		2185	4279	6464	SO:0001583	missense	286204	exon6			TGTGCCTCACGGC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.976T>C	9.37:g.126129887T>C	ENSP00000362734:p.Ser326Pro		44	0	0		38	0.08	3	NM_173689	3	0.00	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	T	25.1	4.605714	0.87157	.	.	ENSG00000148204	ENST00000359999;ENST00000373631	D;D	0.91843	-2.92;-2.92	5.09	5.09	0.68999	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.38436	N	0.001693	D	0.95153	0.8429	M	0.69463	2.115	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95523	0.8596	10	0.72032	D	0.01	.	13.9725	0.64250	0.0:0.0:0.0:1.0	.	326;326	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	P	326	ENSP00000353092:S326P;ENSP00000362734:S326P	ENSP00000353092:S326P	S	+	1	0	CRB2	125169708	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	3.142000	0.50601	2.046000	0.60703	0.448000	0.29417	TCA			0.672	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053990.3		NM_173689	
ENG	2022	mdanderson.org	37	9	130587145	130587145	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr9:130587145T>C	ENST00000373203.4	-	7	1325	c.925A>G	c.(925-927)Agc>Ggc	p.S309G	ENG_ENST00000344849.3_Missense_Mutation_p.S309G|RP11-228B15.4_ENST00000439298.1_RNA|ENG_ENST00000480266.1_5'UTR	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	309	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						GCCACAATGCTGGCATTGAGC	0.572									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.S309G													.	.			0			c.A925G												67.0	67.0	67.0					9																	130587145		2203	4300	6503	SO:0001583	missense	2022	exon7	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	CAATGCTGGCATT	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.925A>G	9.37:g.130587145T>C	ENSP00000362299:p.Ser309Gly		61	0	0		56	0.05	3	NM_000118	96	0.01	1	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	ENST00000373203.4	37	CCDS48029.1	.	.	.	.	.	.	.	.	.	.	t	14.46	2.541964	0.45280	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345;ENST00000546301	T;T	0.59083	0.29;0.83	4.36	4.36	0.52297	.	0.086147	0.50627	D	0.000115	T	0.71762	0.3378	M	0.72118	2.19	0.33446	D	0.583008	D;D	0.69078	0.997;0.997	D;D	0.70716	0.97;0.97	T	0.80865	-0.1191	10	0.72032	D	0.01	-8.1646	11.0482	0.47872	0.0:0.0:0.0:1.0	.	309;309	Q5T9B9;P17813	.;EGLN_HUMAN	G	309;309;309;127	ENSP00000362299:S309G;ENSP00000341917:S309G	ENSP00000341917:S309G	S	-	1	0	ENG	129626966	1.000000	0.71417	0.995000	0.50966	0.048000	0.14542	3.834000	0.55798	1.837000	0.53436	0.370000	0.22315	AGC			0.572	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054313.1			
COL5A1	1289	mdanderson.org	37	9	137620596	137620596	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chr9:137620596G>T	ENST00000371817.3	+	6	1281	c.867G>T	c.(865-867)gaG>gaT	p.E289D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	289	Nonhelical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TAGGGAAGGAGCCCACCCCCA	0.617																																					p.E289D													.	.			0			c.G867T												108.0	119.0	115.0					9																	137620596		2203	4300	6503	SO:0001583	missense	1289	exon6			GAAGGAGCCCACC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.867G>T	9.37:g.137620596G>T	ENSP00000360882:p.Glu289Asp		52	0	0		41	0.07	3	NM_000093	40	0.00	0	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	9.468	1.094992	0.20471	.	.	ENSG00000130635	ENST00000371817	D	0.89939	-2.59	4.24	-1.93	0.07594	.	1.427170	0.04730	U	0.420900	T	0.81312	0.4796	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.61574	-0.7035	10	0.18276	T	0.48	.	4.8861	0.13704	0.1968:0.5603:0.1333:0.1095	.	289	P20908	CO5A1_HUMAN	D	289	ENSP00000360882:E289D	ENSP00000360882:E289D	E	+	3	2	COL5A1	136760417	0.361000	0.24972	0.101000	0.21167	0.912000	0.54170	0.083000	0.14871	-0.121000	0.11787	0.462000	0.41574	GAG			0.617	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054954.2		NM_000093	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P|PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24		0			c.T668C												57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro		309	0.003236246	1		533	0.01	5	NM_004650	277	0.00	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT			0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055687.1		NM_004650	
SPIN2A	54466	broad.mit.edu	37	X	57162583	57162583	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAGK-01A-11D-A42Y-10	TCGA-2G-AAGK-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	7bcb4a63-6ec0-420e-a4a3-92c2def85631	0d7f38e3-4f2b-481a-a7ec-4a19c0dda625	g.chrX:57162583T>C	ENST00000374908.1	-	1	847	c.448A>G	c.(448-450)Atg>Gtg	p.M150V	SPIN2A_ENST00000374906.3_Missense_Mutation_p.M150V			Q99865	SPI2A_HUMAN	spindlin family, member 2A	150					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				breast(1)|kidney(1)|ovary(1)	3						GCTAAGACCATCCCCCTCCAT	0.413																																					p.M150V													.	SPIN2A	7		0			c.A448G												88.0	79.0	82.0					X																	57162583		2201	4294	6495	SO:0001583	missense	54466	exon2			AGACCATCCCCCT	Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.448A>G	X.37:g.57162583T>C	ENSP00000364043:p.Met150Val		415	0.0024096386	1		760	0.01	6	NM_019003	0		0	O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	ENST00000374908.1	37	CCDS35312.1	.	.	.	.	.	.	.	.	.	.	.	10.86	1.471027	0.26423	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.45276	0.9;0.9	2.74	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.46014	0.1371	L	0.33753	1.03	0.39768	D	0.972128	P	0.42827	0.791	P	0.62740	0.906	T	0.32428	-0.9907	10	0.23302	T	0.38	-23.7792	8.4178	0.32681	0.0:0.0:0.0:1.0	.	150	Q99865	SPI2A_HUMAN	V	150	ENSP00000364043:M150V;ENSP00000364041:M150V	ENSP00000364041:M150V	M	-	1	0	SPIN2A	57179308	1.000000	0.71417	0.997000	0.53966	0.897000	0.52465	6.373000	0.73128	1.327000	0.45338	0.345000	0.21793	ATG			0.413	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058915.1		NM_019003	
