#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	mdanderson.org	37	1	1223348	1223348	+	Silent	SNP	C	C	T	rs370866963	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:1223348C>T	ENST00000338555.2	+	9	2245	c.1101C>T	c.(1099-1101)taC>taT	p.Y367Y	SCNN1D_ENST00000379116.5_Silent_p.Y531Y|SCNN1D_ENST00000400928.3_Silent_p.Y367Y|SCNN1D_ENST00000325425.8_Silent_p.Y433Y			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	367					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	GGAGCCCCTACGGCCACTGCA	0.711													C|||	18	0.00359425	0.0121	0.0029	5008	,	,		11514	0.0		0.0	False		,,,				2504	0.0				p.Y531Y													.	.			0			c.C1593T							C		30,3908		0,30,1939	6.0	8.0	7.0		1593	-3.0	0.0	1		7	7,7861		0,7,3927	no	coding-synonymous	SCNN1D	NM_001130413.3		0,37,5866	TT,TC,CC		0.089,0.7618,0.3134		531/803	1223348	37,11769	1969	3934	5903	SO:0001819	synonymous_variant	6339	exon12			CCCCTACGGCCAC	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.1101C>T	1.37:g.1223348C>T			67	0	0		81	0.05	4	NM_001130413	5	0.00	0	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Silent	SNP	ENST00000338555.2	37		.	.	.	.	.	.	.	.	.	.	C	4.528	0.097917	0.08681	0.007618	8.9E-4	ENSG00000162572	ENST00000379099	.	.	.	2.95	-2.97	0.05530	.	.	.	.	.	T	0.21267	0.0512	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30995	-0.9959	4	.	.	.	.	7.0863	0.25259	0.0:0.159:0.1502:0.6908	.	.	.	.	W	184	.	.	R	+	1	2	SCNN1D	1213211	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-3.478000	0.00457	-0.563000	0.06078	0.313000	0.20887	CGG			0.711	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000005802.2		NM_002978	
CSF3R	1441	broad.mit.edu	37	1	36932281	36932281	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:36932281G>T	ENST00000373106.1	-	17	2735	c.2188C>A	c.(2188-2190)Cag>Aag	p.Q730K	CSF3R_ENST00000418048.2_Missense_Mutation_p.Q730K|CSF3R_ENST00000373103.1_Missense_Mutation_p.Q757K|CSF3R_ENST00000361632.4_Missense_Mutation_p.Q730K|CSF3R_ENST00000440588.2_Missense_Mutation_p.Q757K|MRPS15_ENST00000373116.5_5'Flank|CSF3R_ENST00000338937.5_Silent_p.S698S|CSF3R_ENST00000373104.1_Missense_Mutation_p.Q730K|CSF3R_ENST00000331941.5_Missense_Mutation_p.Q730K|CSF3R_ENST00000487540.2_5'UTR	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	730					cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGGTCCCCCTGGAGCACATAG	0.617																																					p.Q757K													.	CSF3R	157		0			c.C2269A												66.0	70.0	69.0					1																	36932281		2203	4300	6503	SO:0001583	missense	1441	exon17			CCCCCTGGAGCAC	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.2188C>A	1.37:g.36932281G>T	ENSP00000362198:p.Gln730Lys		111	0	0		69	0.04	3	NM_156039	85	0.00	0		Missense_Mutation	SNP	ENST00000373106.1	37	CCDS413.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.021238	0.75275	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000440588	T;T;T;T;T;T;T	0.71934	0.86;0.2;-0.61;0.86;0.2;0.86;-0.61	5.81	5.81	0.92471	.	1.064840	0.07213	N	0.859522	D	0.82921	0.5142	L	0.52364	1.645	0.80722	D	1	P;P;P;D	0.71674	0.787;0.865;0.787;0.998	B;P;B;D	0.81914	0.32;0.519;0.32;0.995	T	0.73471	-0.3972	10	0.49607	T	0.09	-13.4104	16.8018	0.85616	0.0:0.0:1.0:0.0	.	730;757;730;730	Q1ZYL6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	K	730;730;757;730;730;730;757	ENSP00000362198:Q730K;ENSP00000362196:Q730K;ENSP00000362195:Q757K;ENSP00000355406:Q730K;ENSP00000332180:Q730K;ENSP00000401588:Q730K;ENSP00000397568:Q757K	ENSP00000332180:Q730K	Q	-	1	0	CSF3R	36704868	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.438000	0.66550	2.746000	0.94184	0.655000	0.94253	CAG			0.617	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021997.2		NM_156039	
FOXJ3	22887	broad.mit.edu	37	1	42693609	42693609	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:42693609G>T	ENST00000372572.1	-	7	784	c.473C>A	c.(472-474)cCg>cAg	p.P158Q	FOXJ3_ENST00000361776.1_Missense_Mutation_p.P158Q|FOXJ3_ENST00000545068.1_Missense_Mutation_p.P158Q|FOXJ3_ENST00000372573.1_Missense_Mutation_p.P158Q|FOXJ3_ENST00000361346.1_Missense_Mutation_p.P158Q	NM_001198851.1	NP_001185780.1	Q9UPW0	FOXJ3_HUMAN	forkhead box J3	158					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCTTCCTTCGGATTGGTGTC	0.373																																					p.P158Q													.	FOXJ3	59		0			c.C473A												96.0	87.0	90.0					1																	42693609		2203	4300	6503	SO:0001583	missense	22887	exon5			TCCTTCGGATTGG	AB028964	CCDS30689.1, CCDS55594.1	1p34.2	2008-04-10			ENSG00000198815	ENSG00000198815		"""Forkhead boxes"""	29178	protein-coding gene	gene with protein product							Standard	NM_014947		Approved	KIAA1041	uc001chf.3	Q9UPW0	OTTHUMG00000007026	ENST00000372572.1:c.473C>A	1.37:g.42693609G>T	ENSP00000361653:p.Pro158Gln		160	0	0		96	0.03	3	NM_001198852	25	0.00	0	A7MBL7|A7MD18|D3DPW2|Q9NSS7	Missense_Mutation	SNP	ENST00000372572.1	37	CCDS30689.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818978	0.90873	.	.	ENSG00000198815	ENST00000372573;ENST00000372572;ENST00000361346;ENST00000361776;ENST00000545068;ENST00000445886	D;D;D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65;-3.65;-3.65	5.68	5.68	0.88126	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.059113	0.64402	D	0.000003	D	0.96574	0.8882	M	0.63428	1.95	0.80722	D	1	P;D	0.89917	0.855;1.0	P;D	0.91635	0.884;0.999	D	0.95813	0.8843	10	0.40728	T	0.16	.	17.2843	0.87137	0.0:0.0:1.0:0.0	.	158;158	Q9UPW0-2;Q9UPW0	.;FOXJ3_HUMAN	Q	158	ENSP00000361654:P158Q;ENSP00000361653:P158Q;ENSP00000354620:P158Q;ENSP00000354449:P158Q;ENSP00000439044:P158Q;ENSP00000393408:P158Q	ENSP00000354620:P158Q	P	-	2	0	FOXJ3	42466196	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.770000	0.85390	2.666000	0.90696	0.655000	0.94253	CCG			0.373	FOXJ3-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000018310.1		NM_014947	
C1orf177	163747	hgsc.bcm.edu	37	1	55277575	55277575	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:55277575A>G	ENST00000371273.3	+	5	604	c.589A>G	c.(589-591)Agc>Ggc	p.S197G	C1orf177_ENST00000358193.3_Missense_Mutation_p.S197G	NM_001110533.1	NP_001104003	Q3ZCV2	CA177_HUMAN	chromosome 1 open reading frame 177	197										breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(6)|prostate(2)	17						GTGCAGGATGAGCAACAAGCC	0.622																																					p.S197G													.	.			0			c.A589G												69.0	66.0	67.0					1																	55277575		2203	4300	6503	SO:0001583	missense	163747	exon5			AGGATGAGCAACA	AK097520	CCDS599.1, CCDS44153.1	1p32.3	2012-07-25			ENSG00000162398	ENSG00000162398			26854	protein-coding gene	gene with protein product							Standard	NM_152607		Approved	FLJ40201	uc001cyb.4	Q3ZCV2	OTTHUMG00000009986	ENST00000371273.3:c.589A>G	1.37:g.55277575A>G	ENSP00000360320:p.Ser197Gly		120	0	0		123	0.04	5	NM_001110533	0		0	B7WPL2|Q8N7Y9	Missense_Mutation	SNP	ENST00000371273.3	37	CCDS44153.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.590792	0.28357	.	.	ENSG00000162398	ENST00000358193;ENST00000371273	T;T	0.24151	1.87;1.87	4.66	-0.404	0.12396	.	0.929485	0.09054	N	0.855445	T	0.17365	0.0417	L	0.43152	1.355	0.24000	N	0.996213	B;B	0.17038	0.02;0.02	B;B	0.15484	0.013;0.013	T	0.33085	-0.9882	10	0.25106	T	0.35	1.0062	3.0126	0.06049	0.3337:0.0:0.2229:0.4434	.	197;197	Q3ZCV2;Q3ZCV2-2	CA177_HUMAN;.	G	197	ENSP00000350924:S197G;ENSP00000360320:S197G	ENSP00000350924:S197G	S	+	1	0	C1orf177	55050163	0.938000	0.31826	0.994000	0.49952	0.844000	0.47949	0.172000	0.16704	0.019000	0.15079	0.459000	0.35465	AGC			0.622	C1orf177-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000027674.1		NM_152607	
SLC30A7	148867	broad.mit.edu;mdanderson.org	37	1	101387372	101387372	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:101387372C>G	ENST00000370112.4	+	8	1004	c.817C>G	c.(817-819)Ctt>Gtt	p.L273V	SLC30A7_ENST00000357650.4_Missense_Mutation_p.L273V	NM_001144884.1|NM_133496.4	NP_001138356.1|NP_598003.2	Q8NEW0	ZNT7_HUMAN	solute carrier family 30 (zinc transporter), member 7	273					cellular protein metabolic process (GO:0044267)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	cation transmembrane transporter activity (GO:0008324)			endometrium(3)|large_intestine(2)|lung(10)	15		all_epithelial(167;0.000445)|all_lung(203;0.00645)|Lung NSC(277;0.0119)		Epithelial(280;0.0437)|all cancers(265;0.0498)|COAD - Colon adenocarcinoma(174;0.162)|Colorectal(144;0.19)|Lung(183;0.201)		CTGTTCAATTCTTATAGCCAT	0.323																																					p.L273V	NSCLC(91;473 1491 3102 16827 21633)												.	SLC30A7	33		0			c.C817G												151.0	143.0	146.0					1																	101387372		2202	4299	6501	SO:0001583	missense	148867	exon8			TCAATTCTTATAG	AF233345	CCDS776.1	1p21.1	2013-05-22			ENSG00000162695	ENSG00000162695		"""Solute carriers"""	19306	protein-coding gene	gene with protein product		611149				12446736	Standard	NM_133496		Approved	ZnTL2, ZNT7	uc001dto.2	Q8NEW0	OTTHUMG00000011815	ENST00000370112.4:c.817C>G	1.37:g.101387372C>G	ENSP00000359130:p.Leu273Val		71	0	0		54	0.06	3	NM_001144884	11	0.18	2	B2R949|D3DT61|Q8TCH2	Missense_Mutation	SNP	ENST00000370112.4	37	CCDS776.1	.	.	.	.	.	.	.	.	.	.	C	17.56	3.418995	0.62622	.	.	ENSG00000162695	ENST00000370112;ENST00000357650	T;T	0.66460	-0.21;-0.21	5.62	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.45657	0.1353	L	0.43646	1.37	0.80722	D	1	D	0.53462	0.96	P	0.46510	0.519	T	0.50825	-0.8782	10	0.08837	T	0.75	-7.919	14.3841	0.66931	0.0:0.9287:0.0:0.0712	.	273	Q8NEW0	ZNT7_HUMAN	V	273	ENSP00000359130:L273V;ENSP00000350278:L273V	ENSP00000350278:L273V	L	+	1	0	SLC30A7	101159960	1.000000	0.71417	0.979000	0.43373	0.931000	0.56810	4.545000	0.60698	1.357000	0.45904	0.655000	0.94253	CTT			0.323	SLC30A7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032711.1		NM_133496	
DENND2C	163259	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115130380	115130380	+	Silent	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:115130380T>C	ENST00000393274.1	-	19	3250	c.2625A>G	c.(2623-2625)gcA>gcG	p.A875A	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Silent_p.A763A|DENND2C_ENST00000393276.3_Silent_p.A818A	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	875	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGATGAATCCTGCAAACATCT	0.448																																					p.A875A													.	.			0			c.A2625G												76.0	68.0	71.0					1																	115130380		2203	4300	6503	SO:0001819	synonymous_variant	163259	exon19			GAATCCTGCAAAC		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2625A>G	1.37:g.115130380T>C			113	0	0		108	0.14	15	NM_001256404	7	0.43	3	B1AL26|Q5TCX6|Q6P3R3	Silent	SNP	ENST00000393274.1	37	CCDS58018.1																																																																																					0.448	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000314822.1		NM_198459	
OR14A2	388761	broad.mit.edu;bcgsc.ca	37	1	247886683	247886685	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr1:247886683_247886685delGGA	ENST00000366485.1	-	1	660_662	c.661_663delTCC	c.(661-663)tccdel	p.S221del	RP11-634B7.4_ENST00000449298.1_RNA|RP11-634B7.5_ENST00000426444.1_RNA			Q96R54	O14A2_HUMAN	olfactory receptor, family 14, subfamily A, member 2	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										TCAGTACAGTGGAGAAGATATAA	0.365																																					.													.	.			0			.																																									SO:0001651	inframe_deletion	0	.			TACAGTGGAGAAG	AB065620		1q44	2013-01-16	2008-04-02	2008-04-02	ENSG00000241128	ENSG00000241128		"""GPCR / Class A : Olfactory receptors"""	15024	other	unknown			"""olfactory receptor, family 5, subfamily AX, member 1 pseudogene"", ""olfactory receptor, family 5, subfamily AX, member 1"""	OR5AX1P, OR5AX1			Standard	NG_002409		Approved			Q96R54	OTTHUMG00000040207	ENST00000366485.1:c.661_663delTCC	1.37:g.247886683_247886685delGGA	ENSP00000355441:p.Ser221del		88	0	0		76	0.12	9	.	0		0		In_Frame_Del	DEL	ENST00000366485.1	37																																																																																						0.365	OR14A2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000096864.1		NG_002409	
DDIT4	54541	mdanderson.org	37	10	74034544	74034544	+	Silent	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr10:74034544G>T	ENST00000307365.3	+	3	498	c.297G>T	c.(295-297)ctG>ctT	p.L99L	RP11-442H21.2_ENST00000491934.2_RNA	NM_019058.2	NP_061931.1	Q9NX09	DDIT4_HUMAN	DNA-damage-inducible transcript 4	99					brain development (GO:0007420)|cell proliferation (GO:0008283)|defense response to virus (GO:0051607)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of glycolytic process (GO:0045820)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of TOR signaling (GO:0032007)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron death (GO:1901216)|protein complex disassembly (GO:0043241)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|lung(5)|pancreas(1)|prostate(2)|urinary_tract(1)	12						TGATGCAGCTGCTGCAGGAGA	0.622											OREG0020262	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L99L													.	.			0			c.G297T												98.0	102.0	101.0					10																	74034544		2203	4300	6503	SO:0001819	synonymous_variant	54541	exon3			GCAGCTGCTGCAG	AK000507	CCDS7315.1	10q22.1	2008-05-14			ENSG00000168209	ENSG00000168209			24944	protein-coding gene	gene with protein product	"""HIF-1 responsive RTP801"""	607729				11884613	Standard	NM_019058		Approved	RTP801, FLJ20500, REDD-1, REDD1, Dig2	uc001jsx.1	Q9NX09	OTTHUMG00000018435	ENST00000307365.3:c.297G>T	10.37:g.74034544G>T			58	0	0	1149	36	0.08	3	NM_019058	89	0.00	0	Q9H0S3	Silent	SNP	ENST00000307365.3	37	CCDS7315.1																																																																																					0.622	DDIT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048577.1		NM_019058	
PKD2L1	9033	ucsc.edu	37	10	102050229	102050229	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr10:102050229G>T	ENST00000318222.3	-	13	2437	c.2055C>A	c.(2053-2055)agC>agA	p.S685R	PKD2L1_ENST00000353274.3_Missense_Mutation_p.S685R|PKD2L1_ENST00000338519.3_Missense_Mutation_p.S610R	NM_001253837.1|NM_016112.2	NP_001240766.1|NP_057196.2	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	685					cation transport (GO:0006812)|cellular response to acidic pH (GO:0071468)|detection of chemical stimulus involved in sensory perception of sour taste (GO:0001581)|detection of mechanical stimulus (GO:0050982)|potassium ion transmembrane transport (GO:0071805)|protein homotrimerization (GO:0070207)|sensory perception of sour taste (GO:0050915)|smoothened signaling pathway (GO:0007224)|sodium ion transmembrane transport (GO:0035725)	calcium channel complex (GO:0034704)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	alpha-actinin binding (GO:0051393)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-activated potassium channel activity (GO:0015269)|cation channel activity (GO:0005261)|cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|sodium channel activity (GO:0005272)|sour taste receptor activity (GO:0033040)			NS(2)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	43		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		CTTGTGGGCTGCTCACAATAG	0.532																																					p.S685R													.	PKD2L1	103		0			c.C2055A												73.0	61.0	65.0					10																	102050229		2203	4300	6503	SO:0001583	missense	9033	exon13			TGGGCTGCTCACA	AF094827	CCDS7492.1	10q24.31	2011-12-16			ENSG00000107593	ENSG00000107593		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9011	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 3"""	604532		PKD2L, PKDL		9878261, 9748274	Standard	NM_016112		Approved	PCL, TRPP3	uc001kqx.1	Q9P0L9	OTTHUMG00000018910	ENST00000318222.3:c.2055C>A	10.37:g.102050229G>T	ENSP00000325296:p.Ser685Arg		53	0	0		38	0.11	4	NM_016112	3	0.00	0	O75972|Q5W039|Q9UP35|Q9UPA2	Missense_Mutation	SNP	ENST00000318222.3	37	CCDS7492.1	.	.	.	.	.	.	.	.	.	.	G	0.067	-1.211461	0.01555	.	.	ENSG00000107593	ENST00000338519;ENST00000353274;ENST00000318222;ENST00000339977	T;T;T	0.72394	-0.65;-0.65;-0.65	5.05	-10.1	0.00402	.	1.257480	0.05082	N	0.483766	T	0.48978	0.1530	N	0.21448	0.665	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.36890	-0.9729	10	0.30854	T	0.27	1.8125	7.5925	0.28029	0.0789:0.3095:0.4696:0.1421	.	638;685	Q1L4F0;Q9P0L9	.;PK2L1_HUMAN	R	610;685;685;683	ENSP00000345068:S610R;ENSP00000266049:S685R;ENSP00000325296:S685R	ENSP00000325296:S685R	S	-	3	2	PKD2L1	102040219	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.989000	0.03736	-3.254000	0.00203	0.313000	0.20887	AGC			0.532	PKD2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049863.2		NM_016112	
MUC6	4588	bcgsc.ca	37	11	1016871	1016871	+	Missense_Mutation	SNP	G	G	T	rs554068781		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:1016871G>T	ENST00000421673.2	-	31	5980	c.5930C>A	c.(5929-5931)cCc>cAc	p.P1977H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1977	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGAAGAGAAGGGACTGCTCCC	0.587																																					p.P1977H													.	MUC6	408		0			c.C5930A												1308.0	1300.0	1302.0					11																	1016871		2203	4299	6502	SO:0001583	missense	4588	exon31			GAGAAGGGACTGC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5930C>A	11.37:g.1016871G>T	ENSP00000406861:p.Pro1977His		409	0.02200489	9		357	0.04	13	NM_005961	1	0.00	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923756	0.34002	.	.	ENSG00000184956	ENST00000421673	T	0.18657	2.2	2.69	1.71	0.24356	.	.	.	.	.	T	0.14614	0.0353	L	0.29908	0.895	0.09310	N	1	B	0.29212	0.237	B	0.28553	0.091	T	0.22382	-1.0218	9	0.56958	D	0.05	.	7.0992	0.25327	0.0:0.0:0.7301:0.2699	.	1977	Q6W4X9	MUC6_HUMAN	H	1977	ENSP00000406861:P1977H	ENSP00000406861:P1977H	P	-	2	0	MUC6	1006871	0.015000	0.18098	0.001000	0.08648	0.026000	0.11368	1.250000	0.32850	0.416000	0.25844	0.306000	0.20318	CCC			0.587	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
OR51B6	390058	broad.mit.edu	37	11	5373576	5373576	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:5373576T>C	ENST00000380219.1	+	1	839	c.839T>C	c.(838-840)cTt>cCt	p.L280P	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	280					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ATCCACTTCCTTTTCCCACCT	0.393																																					p.L280P													.	OR51B6	53		0			c.T839C												166.0	155.0	159.0					11																	5373576		2201	4297	6498	SO:0001583	missense	390058	exon1			ACTTCCTTTTCCC		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.839T>C	11.37:g.5373576T>C	ENSP00000369568:p.Leu280Pro		115	0	0		92	0.03	3	NM_001004750	0		0		Missense_Mutation	SNP	ENST00000380219.1	37	CCDS31379.1	.	.	.	.	.	.	.	.	.	.	T	16.64	3.179342	0.57800	.	.	ENSG00000176239	ENST00000537299;ENST00000380219	T	0.00207	8.55	5.13	5.13	0.70059	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000201	T	0.00815	0.0027	H	0.96111	3.77	0.52501	D	0.999959	D	0.89917	1.0	D	0.80764	0.994	T	0.43015	-0.9417	10	0.87932	D	0	.	9.1268	0.36821	0.0:0.0855:0.0:0.9145	.	280	Q9H340	O51B6_HUMAN	P	279;280	ENSP00000369568:L280P	ENSP00000369568:L280P	L	+	2	0	OR51B6	5330152	0.307000	0.24500	0.896000	0.35187	0.898000	0.52572	3.590000	0.53979	2.148000	0.66965	0.528000	0.53228	CTT			0.393	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000142960.1		NM_001004750	
Unknown	0	bcgsc.ca	37	11	62815368	62815368	+	IGR	SNP	G	G	A	rs150679703|rs374048942|rs7125680|rs372143980	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:62815368G>A								SLC22A8 (32057 upstream) : SLC22A24 (32043 downstream)																							CCAAGGTGCAGCATGCCATGT	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGCAGCATGCC																													11.37:g.62815368G>A			36	0	0		43	0.16	7	.	0		0		RNA	SNP		37																																																																																					0	0.562										
CAPN1	823	bcgsc.ca	37	11	64956151	64956152	+	Frame_Shift_Ins	INS	-	-	ACACCAC			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:64956151_64956152insACACCAC	ENST00000527323.1	+	9	1339_1340	c.1099_1100insACACCAC	c.(1099-1101)aacfs	p.-369fs	CAPN1_ENST00000533820.1_Frame_Shift_Ins_p.-369fs|CAPN1_ENST00000533129.1_Frame_Shift_Ins_p.-369fs|CAPN1_ENST00000524773.1_Frame_Shift_Ins_p.-369fs|CAPN1_ENST00000279247.6_Frame_Shift_Ins_p.-369fs			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		CCGCAAATGGAACACCACACTC	0.644																																					p.N367fs													.	CAPN1	44		0			c.1099_1100insACACCAC																																									SO:0001589	frameshift_variant	823	exon10			AAATGGAACACCA	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614	ENST00000527323.1:c.1100_1106dupACACCAC	11.37:g.64956152_64956158dupACACCAC	ENSP00000431984:p.Thr369fs		115	0	0		84	0.06	5	NM_001198869	128	0.00	0	Q2TTR0|Q6DHV4	Frame_Shift_Ins	INS	ENST00000527323.1	37	CCDS44644.1																																																																																					0.644	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385325.1			
PPFIA1	8500	mdanderson.org	37	11	70184504	70184504	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:70184504G>T	ENST00000253925.7	+	13	1731	c.1516G>T	c.(1516-1518)Gca>Tca	p.A506S	PPFIA1_ENST00000389547.3_Missense_Mutation_p.A506S|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	506					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AAACATTGAAGCACTGAGGGC	0.413																																					p.A506S													.	.			0			c.G1516T												142.0	134.0	137.0					11																	70184504		2200	4294	6494	SO:0001583	missense	8500	exon13			ATTGAAGCACTGA	U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.1516G>T	11.37:g.70184504G>T	ENSP00000253925:p.Ala506Ser		60	0	0		39	0.08	3	NM_003626	92	0.00	0	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	ENST00000253925.7	37	CCDS31627.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.885|4.885	0.164414|0.164414	0.09287|0.09287	.|.	.|.	ENSG00000131626|ENSG00000131626	ENST00000253925;ENST00000389547|ENST00000530798	T;T|.	0.35048|.	1.33;1.33|.	4.45|4.45	2.41|2.41	0.29592|0.29592	.|.	0.162937|.	0.44097|.	U|.	0.000484|.	T|T	0.08891|0.08891	0.0220|0.0220	N|N	0.01576|0.01576	-0.805|-0.805	0.24323|0.24323	N|N	0.995039|0.995039	B;B|.	0.11235|.	0.001;0.004|.	B;B|.	0.09377|.	0.004;0.004|.	T|T	0.28808|0.28808	-1.0032|-1.0032	10|5	0.72032|.	D|.	0.01|.	.|.	4.5077|4.5077	0.11896|0.11896	0.1759:0.0:0.5387:0.2854|0.1759:0.0:0.5387:0.2854	.|.	506;506|.	Q13136;Q13136-2|.	LIPA1_HUMAN;.|.	S|I	506|57	ENSP00000253925:A506S;ENSP00000374198:A506S|.	ENSP00000253925:A506S|.	A|S	+|+	1|2	0|0	PPFIA1|PPFIA1	69862152|69862152	0.991000|0.991000	0.36638|0.36638	0.494000|0.494000	0.27515|0.27515	0.049000|0.049000	0.14656|0.14656	1.401000|1.401000	0.34589|0.34589	1.026000|1.026000	0.39733|0.39733	0.655000|0.655000	0.94253|0.94253	GCA|AGC			0.413	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000393905.1		NM_003626	
AMOTL1	154810	mdanderson.org	37	11	94592856	94592856	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:94592856C>T	ENST00000433060.2	+	9	2252	c.2111C>T	c.(2110-2112)gCc>gTc	p.A704V	AMOTL1_ENST00000317829.8_Missense_Mutation_p.A654V|AMOTL1_ENST00000317837.9_Intron	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	704					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				GCCATGAATGCCGCAGCCACT	0.527																																					p.A704V													.	.			0			c.C2111T												26.0	30.0	29.0					11																	94592856		2193	4298	6491	SO:0001583	missense	154810	exon9			TGAATGCCGCAGC	AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.2111C>T	11.37:g.94592856C>T	ENSP00000387739:p.Ala704Val		92	0	0		35	0.09	3	NM_130847	5	0.00	0	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	ENST00000433060.2	37	CCDS44712.1	.	.	.	.	.	.	.	.	.	.	C	18.36	3.606608	0.66558	.	.	ENSG00000166025	ENST00000317829;ENST00000433060	T;T	0.28069	1.66;1.63	6.08	6.08	0.98989	Angiomotin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56217	0.1970	M	0.65498	2.005	0.80722	D	1	D;D	0.55605	0.972;0.972	D;D	0.64687	0.918;0.928	T	0.51949	-0.8640	10	0.62326	D	0.03	-19.2403	20.6634	0.99662	0.0:1.0:0.0:0.0	.	654;704	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	V	654;704	ENSP00000320968:A654V;ENSP00000387739:A704V	ENSP00000320968:A654V	A	+	2	0	AMOTL1	94232504	1.000000	0.71417	0.237000	0.24090	0.032000	0.12392	5.872000	0.69636	2.894000	0.99253	0.655000	0.94253	GCC			0.527	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396474.3		NM_130847	
C11orf1	64776	mdanderson.org	37	11	111754552	111754552	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr11:111754552G>T	ENST00000260276.3	+	4	738	c.401G>T	c.(400-402)cGa>cTa	p.R134L	C11orf1_ENST00000529270.1_Missense_Mutation_p.R174L|C11orf1_ENST00000528125.1_Missense_Mutation_p.R88L|C11orf1_ENST00000530214.1_Missense_Mutation_p.D112Y	NM_022761.2	NP_073598.1	Q9H5F2	CK001_HUMAN	chromosome 11 open reading frame 1	134						nucleus (GO:0005634)				kidney(2)|lung(3)	5		all_cancers(61;1.26e-15)|all_epithelial(67;9.52e-10)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|Medulloblastoma(222;0.0228)|all_neural(223;0.0281)		all cancers(92;6.28e-09)|Epithelial(105;4.11e-08)|OV - Ovarian serous cystadenocarcinoma(223;1.52e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)		GATCCTCCCCGATACAAATGC	0.393																																					p.R134L													.	.			0			c.G401T												123.0	118.0	120.0					11																	111754552		2201	4297	6498	SO:0001583	missense	64776	exon4			CTCCCCGATACAA	AJ250229	CCDS8350.1	11q23.1	2012-05-30			ENSG00000137720	ENSG00000137720			1163	protein-coding gene	gene with protein product						10873569	Standard	NM_022761		Approved	FLJ23499	uc001pmd.3	Q9H5F2	OTTHUMG00000166884	ENST00000260276.3:c.401G>T	11.37:g.111754552G>T	ENSP00000260276:p.Arg134Leu		81	0	0		54	0.06	3	NM_022761	40	0.00	0	Q6I9X7|Q9NQC6	Missense_Mutation	SNP	ENST00000260276.3	37	CCDS8350.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.268|7.268	0.606592|0.606592	0.14002|0.14002	.|.	.|.	ENSG00000137720|ENSG00000137720	ENST00000530214|ENST00000528125;ENST00000260276;ENST00000529270	T|T;T;T	0.27256|0.25085	1.68|1.82;1.82;1.82	5.37|5.37	-8.06|-8.06	0.01102|0.01102	.|.	.|1.441010	.|0.04218	.|N	.|0.332982	T|T	0.07728|0.07728	0.0194|0.0194	N|N	0.02011|0.02011	-0.69|-0.69	0.09310|0.09310	N|N	1|1	.|B;B	.|0.09022	.|0.002;0.0	.|B;B	.|0.11329	.|0.006;0.003	T|T	0.25882|0.25882	-1.0119|-1.0119	7|10	0.59425|0.27785	D|T	0.04|0.31	-15.9739|-15.9739	4.8838|4.8838	0.13692|0.13692	0.2596:0.4116:0.2517:0.0772|0.2596:0.4116:0.2517:0.0772	.|.	.|174;134	.|E9PMC1;Q9H5F2	.|.;CK001_HUMAN	Y|L	112|88;134;174	ENSP00000435864:D112Y|ENSP00000433224:R88L;ENSP00000260276:R134L;ENSP00000431180:R174L	ENSP00000435864:D112Y|ENSP00000260276:R134L	D|R	+|+	1|2	0|0	C11orf1|C11orf1	111259762|111259762	0.000000|0.000000	0.05858|0.05858	0.014000|0.014000	0.15608|0.15608	0.232000|0.232000	0.25224|0.25224	-1.946000|-1.946000	0.01536|0.01536	-1.089000|-1.089000	0.03073|0.03073	-1.000000|-1.000000	0.02509|0.02509	GAT|CGA			0.393	C11orf1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391650.1		NM_022761	
RERGL	79785	mdanderson.org	37	12	18238558	18238558	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr12:18238558G>T	ENST00000229002.2	-	4	388	c.182C>A	c.(181-183)tCt>tAt	p.S61Y	RERGL_ENST00000538724.1_Missense_Mutation_p.S60Y|RERGL_ENST00000536890.1_Missense_Mutation_p.S60Y|RERGL_ENST00000541632.1_5'UTR	NM_024730.2	NP_079006.1	Q9H628	RERGL_HUMAN	RERG/RAS-like	61	Small GTPase-like.				GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	17						ACTTACTTGAGAACAAGGGTC	0.279																																					p.S61Y													.	.			0			c.C182A												109.0	109.0	109.0					12																	18238558		2202	4296	6498	SO:0001583	missense	79785	exon4			ACTTGAGAACAAG	AK026308	CCDS8679.1, CCDS66332.1	12p12.3	2014-08-12			ENSG00000111404	ENSG00000111404			26213	protein-coding gene	gene with protein product						24127187	Standard	NM_001286201		Approved	FLJ22655	uc001rdq.3	Q9H628	OTTHUMG00000168820	ENST00000229002.2:c.182C>A	12.37:g.18238558G>T	ENSP00000229002:p.Ser61Tyr		57	0	0		41	0.07	3	NM_024730	0		0		Missense_Mutation	SNP	ENST00000229002.2	37	CCDS8679.1	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038112	0.54896	.	.	ENSG00000111404	ENST00000229002;ENST00000538724;ENST00000536890	T;T;T	0.76839	-1.05;-1.05;-0.49	4.1	4.1	0.47936	.	0.128954	0.53938	D	0.000041	D	0.87696	0.6242	M	0.79926	2.475	0.80722	D	1	B;D	0.76494	0.067;0.999	B;D	0.72982	0.039;0.979	D	0.89093	0.3484	10	0.62326	D	0.03	.	15.7719	0.78176	0.0:0.0:1.0:0.0	.	60;61	F5H686;Q9H628	.;RERGL_HUMAN	Y	61;60;60	ENSP00000229002:S61Y;ENSP00000437814:S60Y;ENSP00000437490:S60Y	ENSP00000229002:S61Y	S	-	2	0	RERGL	18129825	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	5.692000	0.68256	2.561000	0.86390	0.557000	0.71058	TCT			0.279	RERGL-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000401198.1		NM_024730	
ASCL1	429	mdanderson.org	37	12	103352218	103352218	+	Silent	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr12:103352218C>T	ENST00000266744.3	+	1	755	c.196C>T	c.(196-198)Ctg>Ttg	p.L66L		NM_004316.3	NP_004307.2	P50553	ASCL1_HUMAN	achaete-scute family bHLH transcription factor 1	66					adrenal chromaffin cell differentiation (GO:0061104)|carotid body glomus cell differentiation (GO:0061103)|cell maturation (GO:0048469)|cellular response to magnetism (GO:0071259)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|lung epithelial cell differentiation (GO:0060487)|lung neuroendocrine cell differentiation (GO:0061100)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of apoptotic process (GO:0043066)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast fate determination (GO:0007400)|neuroblast proliferation (GO:0007405)|neurogenesis (GO:0022008)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|noradrenergic neuron development (GO:0003358)|noradrenergic neuron fate commitment (GO:0003359)|Notch signaling pathway (GO:0007219)|olfactory pit development (GO:0060166)|oligodendrocyte development (GO:0014003)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial cell differentiation (GO:0030856)|regulation of gene expression (GO:0010468)|regulation of mitotic cell cycle (GO:0007346)|regulation of timing of subpallium neuron differentiation (GO:0060165)|response to epidermal growth factor (GO:0070849)|response to folic acid (GO:0051593)|response to lithium ion (GO:0010226)|response to retinoic acid (GO:0032526)|spinal cord association neuron differentiation (GO:0021527)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|stomach neuroendocrine cell differentiation (GO:0061102)|subpallium neuron fate commitment (GO:0060163)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)|vestibular nucleus development (GO:0021750)	neuronal cell body (GO:0043025)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)			NS(3)|large_intestine(1)|lung(1)	5						gGCGCCGCAGCTGAGACCGGC	0.736																																					p.L66L													.	.			0			c.C196T												3.0	4.0	3.0					12																	103352218		1388	2954	4342	SO:0001819	synonymous_variant	429	exon1			CCGCAGCTGAGAC	L08424	CCDS31886.1	12q22-q23	2013-10-17	2013-10-17			ENSG00000139352		"""Basic helix-loop-helix proteins"""	738	protein-coding gene	gene with protein product		100790	"""achaete-scute complex (Drosophila) homolog-like 1"", ""achaete-scute complex-like 1 (Drosophila)"", ""achaete-scute complex homolog 1 (Drosophila)"""			8390674	Standard	NM_004316		Approved	ASH1, HASH1, bHLHa46	uc001tjr.4	P50553		ENST00000266744.3:c.196C>T	12.37:g.103352218C>T			35	0	0		44	0.07	3	NM_004316	0		0	A8K3C4|Q9BQ30	Silent	SNP	ENST00000266744.3	37	CCDS31886.1																																																																																					0.736	ASCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406707.1			
NT5DC3	51559	mdanderson.org	37	12	104190747	104190747	+	Silent	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr12:104190747G>T	ENST00000392876.3	-	6	718	c.678C>A	c.(676-678)ctC>ctA	p.L226L	NT5DC3_ENST00000465502.1_5'UTR	NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	226						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						CGCAGGACAGGAGGGTCATCT	0.478																																					p.L226L													.	.			0			c.C678A												189.0	160.0	170.0					12																	104190747		2203	4300	6503	SO:0001819	synonymous_variant	51559	exon6			GGACAGGAGGGTC	AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.678C>A	12.37:g.104190747G>T			72	0	0		42	0.07	3	NM_001031701	19	0.00	0	Q9NUM7|Q9P2T2|Q9P2T3	Silent	SNP	ENST00000392876.3	37	CCDS41824.1																																																																																					0.478	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347118.2		NM_016575	
CYSLTR2	57105	mdanderson.org	37	13	49280977	49280977	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr13:49280977G>T	ENST00000282018.3	+	1	27	c.24G>T	c.(22-24)ttG>ttT	p.L8F		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	8					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	TTATGTCCTTGCAACCATCCA	0.373																																					p.L8F													.	.			0			c.G24T												71.0	74.0	73.0					13																	49280977		2203	4300	6503	SO:0001583	missense	57105	exon1			GTCCTTGCAACCA	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.24G>T	13.37:g.49280977G>T	ENSP00000282018:p.Leu8Phe		67	0	0		45	0.07	3	NM_020377	0		0	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	37	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.450099	0.43531	.	.	ENSG00000152207	ENST00000282018	T	0.71461	-0.57	5.17	-0.933	0.10431	.	1.204550	0.06530	U	0.741242	T	0.44201	0.1282	N	0.08118	0	0.09310	N	1	P	0.38582	0.638	B	0.37304	0.246	T	0.30090	-0.9990	10	0.10902	T	0.67	.	5.1821	0.15165	0.409:0.0:0.4574:0.1336	.	8	Q9NS75	CLTR2_HUMAN	F	8	ENSP00000282018:L8F	ENSP00000282018:L8F	L	+	3	2	CYSLTR2	48178978	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.489000	0.22387	0.072000	0.16694	-0.137000	0.14449	TTG			0.373	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044894.1			
LRRC16B	90668	mdanderson.org	37	14	24529228	24529228	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr14:24529228G>T	ENST00000342740.5	+	23	2072	c.1918G>T	c.(1918-1920)Gcc>Tcc	p.A640S	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	640						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		CATCTCCCAAGCCTATCGCAG	0.662																																					p.A640S													.	.			0			c.G1918T												148.0	129.0	135.0					14																	24529228		2203	4300	6503	SO:0001583	missense	90668	exon23			TCCCAAGCCTATC	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.1918G>T	14.37:g.24529228G>T	ENSP00000340467:p.Ala640Ser		46	0	0		49	0.06	3	NM_138360	10	0.00	0	Q8TEF7|Q96HS9	Missense_Mutation	SNP	ENST00000342740.5	37	CCDS32054.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742841	0.69418	.	.	ENSG00000186648	ENST00000342740	T	0.54279	0.58	4.52	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.56819	0.2011	L	0.52126	1.63	0.80722	D	1	D	0.58268	0.982	P	0.51657	0.676	T	0.56691	-0.7937	10	0.38643	T	0.18	-17.5941	14.7808	0.69766	0.0:0.0:1.0:0.0	.	640	Q8ND23	LR16B_HUMAN	S	640	ENSP00000340467:A640S	ENSP00000340467:A640S	A	+	1	0	LRRC16B	23599068	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.200000	0.95010	2.331000	0.79229	0.561000	0.74099	GCC			0.662	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000416527.1		NM_138360	
WHAMMP3	339005	broad.mit.edu	37	15	23191911	23191911	+	RNA	SNP	C	C	T	rs147199465		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr15:23191911C>T	ENST00000400153.2	-	0	1785					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		TGATTTTCTTCGCACTGATCC	0.408																																					.													.	.			0			.																																											0	.			TTTCTTCGCACTG	BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23191911C>T			25	0	0		26	0.23	6	.	0		0	Q1A5X8|Q52M16|Q52M18	RNA	SNP	ENST00000400153.2	37																																																																																						0.408	WHAMMP3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000415907.1		NR_003521	
MYO9A	4649	mdanderson.org	37	15	72208799	72208799	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr15:72208799G>T	ENST00000356056.5	-	19	3069	c.2597C>A	c.(2596-2598)aCa>aAa	p.T866K	MYO9A_ENST00000424560.1_Missense_Mutation_p.T866K|MYO9A_ENST00000566885.1_Missense_Mutation_p.T486K|MYO9A_ENST00000444904.1_Missense_Mutation_p.T847K|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000564571.1_Missense_Mutation_p.T866K	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	866	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						TGTCAGTCTTGTCAGGTGCTT	0.358																																					p.T866K													.	.			0			c.C2597A												93.0	96.0	95.0					15																	72208799		2199	4297	6496	SO:0001583	missense	4649	exon19			AGTCTTGTCAGGT	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.2597C>A	15.37:g.72208799G>T	ENSP00000348349:p.Thr866Lys		67	0	0		45	0.07	3	NM_006901	32	0.00	0	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	ENST00000356056.5	37	CCDS10239.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062651	0.55432	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864	D;D;D	0.84298	-1.83;-1.83;-1.83	5.24	4.31	0.51392	Myosin head, motor domain (1);	.	.	.	.	T	0.72358	0.3450	N	0.02539	-0.55	0.37208	D	0.904676	P;B;B	0.44429	0.835;0.002;0.1	P;B;B	0.45794	0.493;0.008;0.063	T	0.78868	-0.2034	9	0.37606	T	0.19	.	14.8048	0.69945	0.0:0.1453:0.8547:0.0	.	847;847;866	B2RTY4-2;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	K	866;866;847;847	ENSP00000348349:T866K;ENSP00000399162:T866K;ENSP00000398250:T847K	ENSP00000261864:T847K	T	-	2	0	MYO9A	69995853	0.998000	0.40836	0.998000	0.56505	0.986000	0.74619	4.577000	0.60922	1.405000	0.46838	0.655000	0.94253	ACA			0.358	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257308.1		NM_006901	
TSC2	7249	mdanderson.org	37	16	2106707	2106707	+	Silent	SNP	G	G	T	rs189380607		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr16:2106707G>T	ENST00000219476.3	+	8	1341	c.711G>T	c.(709-711)ccG>ccT	p.P237P	TSC2_ENST00000439673.2_Silent_p.P200P|TSC2_ENST00000401874.2_Silent_p.P237P|TSC2_ENST00000568454.1_Silent_p.P248P|TSC2_ENST00000350773.4_Silent_p.P237P|TSC2_ENST00000382538.6_Silent_p.P188P|TSC2_ENST00000353929.4_Silent_p.P237P	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	237	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				AGAGCCTCCCGCTGTTCATCG	0.617			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.P237P			yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.			0			c.G711T												103.0	93.0	96.0					16																	2106707		2198	4300	6498	SO:0001819	synonymous_variant	7249	exon8	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	CCTCCCGCTGTTC	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.711G>T	16.37:g.2106707G>T			61	0	0		39	0.08	3	NM_001114382	40	0.03	1	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Silent	SNP	ENST00000219476.3	37	CCDS10458.1																																																																																					0.617	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250657.2		NM_000548	
OR2C1	4993	mdanderson.org	37	16	3406282	3406282	+	Silent	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr16:3406282G>T	ENST00000304936.2	+	1	394	c.342G>T	c.(340-342)ctG>ctT	p.L114L		NM_012368.2	NP_036500.2	O95371	OR2C1_HUMAN	olfactory receptor, family 2, subfamily C, member 1	114					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)	cell cortex (GO:0005938)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(2)|liver(1)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						AGTGCATCCTGCTGGTGGTGA	0.587																																					p.L114L													.	.			0			c.G342T												47.0	38.0	41.0					16																	3406282		2197	4300	6497	SO:0001819	synonymous_variant	4993	exon1			CATCCTGCTGGTG	AF098664	CCDS10502.1	16p13.3	2012-08-09			ENSG00000168158	ENSG00000168158		"""GPCR / Class A : Olfactory receptors"""	8242	protein-coding gene	gene with protein product				OR2C2P		9847080	Standard	NM_012368		Approved	OLFmf3	uc002cuw.1	O95371	OTTHUMG00000090505	ENST00000304936.2:c.342G>T	16.37:g.3406282G>T			48	0	0		32	0.09	3	NM_012368	3	0.00	0	A0AVA4|Q6IF34|Q6IF55	Silent	SNP	ENST00000304936.2	37	CCDS10502.1																																																																																					0.587	OR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206993.3			
APOBR	55911	broad.mit.edu	37	16	28511194	28511194	+	IGR	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr16:28511194C>T	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E170E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcctcttcctcct	0.677																																					p.E170E													.	IL27	27		0			c.G510A												9.0	10.0	9.0					16																	28511194		2158	4227	6385	SO:0001628	intergenic_variant	246778	exon5			CTCCTCCTCTTCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511194C>T			48	0	0		47	0.09	4	NM_145659	4	0.00	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																						0.677	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_182804	
APOBR	55911	broad.mit.edu	37	16	28511197	28511197	+	IGR	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr16:28511197T>C	ENST00000431282.1	+	0	3414				IL27_ENST00000356897.1_Silent_p.E169E			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor						cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						cctcctcctcttcctcctcct	0.672																																					p.E169E													.	IL27	27		0			c.A507G												8.0	9.0	9.0					16																	28511197		2149	4215	6364	SO:0001628	intergenic_variant	246778	exon5			CTCCTCTTCCTCC	AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83			16.37:g.28511197T>C			44	0	0		46	0.11	5	NM_145659	4	0.00	0	H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Silent	SNP	ENST00000431282.1	37																																																																																						0.672	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_182804	
METTL16	79066	mdanderson.org	37	17	2323696	2323696	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:2323696G>T	ENST00000263092.6	-	10	1384	c.1257C>A	c.(1255-1257)agC>agA	p.S419R	METTL16_ENST00000538844.1_Missense_Mutation_p.S201R|METTL16_ENST00000571669.2_5'UTR	NM_024086.3	NP_076991.3	Q86W50	MET16_HUMAN	methyltransferase like 16	419				S -> R (in Ref. 1; BAB55094). {ECO:0000305}.			methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(9)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	19						CCAGTTCTTGGCTATTGCCAG	0.642																																					p.S419R													.	.			0			c.C1257A												67.0	73.0	71.0					17																	2323696		1817	4072	5889	SO:0001583	missense	79066	exon10			TTCTTGGCTATTG	AK027410	CCDS42232.1	17p13.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000127804	ENSG00000127804			28484	protein-coding gene	gene with protein product			"""methyltransferase 10 domain containing"""	METT10D		18021804	Standard	NM_024086		Approved	MGC3329	uc002fut.3	Q86W50		ENST00000263092.6:c.1257C>A	17.37:g.2323696G>T	ENSP00000263092:p.Ser419Arg		47	0	0		35	0.09	3	NM_024086	45	0.00	0	D3DTI8|Q86TE5|Q96T16|Q9BVG7	Missense_Mutation	SNP	ENST00000263092.6	37	CCDS42232.1	.	.	.	.	.	.	.	.	.	.	G	10.52	1.372834	0.24857	.	.	ENSG00000127804	ENST00000263092;ENST00000537138;ENST00000538844	T;T	0.44881	0.93;0.91	5.62	4.65	0.58169	.	0.373752	0.30365	N	0.009791	T	0.28995	0.0720	L	0.29908	0.895	0.31948	N	0.610021	B	0.24823	0.112	B	0.20767	0.031	T	0.28522	-1.0041	10	0.15952	T	0.53	-3.0548	12.192	0.54277	0.083:0.0:0.9169:0.0	.	419	Q86W50	MET16_HUMAN	R	419;99;201	ENSP00000263092:S419R;ENSP00000443633:S201R	ENSP00000263092:S419R	S	-	3	2	METTL16	2270446	0.962000	0.33011	0.779000	0.31741	0.427000	0.31564	2.634000	0.46528	1.371000	0.46172	0.609000	0.83330	AGC			0.642	METTL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437653.2		NM_024086	
NEURL4	84461	mdanderson.org	37	17	7225246	7225246	+	Missense_Mutation	SNP	C	C	T	rs199946910		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:7225246C>T	ENST00000399464.2	-	17	2824	c.2809G>A	c.(2809-2811)Gct>Act	p.A937T	NEURL4_ENST00000570460.1_Missense_Mutation_p.A913T|NEURL4_ENST00000315614.7_Missense_Mutation_p.A935T|RP11-542C16.2_ENST00000575474.1_5'Flank	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	937	NHR 5. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GCATAGCCAGCGGCACGCACT	0.592													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21009	0.0		0.0	False		,,,				2504	0.0				p.A937T													.	.			0			c.G2809A							C	THR/ALA,THR/ALA	2,4286		0,2,2142	104.0	104.0	104.0		2803,2809	2.8	0.1	17		104	0,8480		0,0,4240	no	missense,missense	NEURL4	NM_001005408.1,NM_032442.2	58,58	0,2,6382	TT,TC,CC		0.0,0.0466,0.0157	benign,benign	935/1561,937/1563	7225246	2,12766	2144	4240	6384	SO:0001583	missense	84461	exon17			AGCCAGCGGCACG		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.2809G>A	17.37:g.7225246C>T	ENSP00000382390:p.Ala937Thr		44	0	0		41	0.07	3	NM_032442	24	0.00	0	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	37	CCDS42251.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	10.46	1.355761	0.24598	4.66E-4	0.0	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.30714	1.53;1.52	5.87	2.84	0.33178	NEUZ (3);	0.316276	0.33309	N	0.005041	T	0.18299	0.0439	N	0.25485	0.75	0.29130	N	0.879716	B;B	0.06786	0.001;0.001	B;B	0.09377	0.002;0.004	T	0.22208	-1.0223	10	0.15066	T	0.55	-0.6577	9.4594	0.38776	0.0:0.7686:0.0:0.2314	.	935;937	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	T	935;937	ENSP00000319826:A935T;ENSP00000382390:A937T	ENSP00000319826:A935T	A	-	1	0	NEURL4	7165970	0.739000	0.28196	0.124000	0.21820	0.354000	0.29330	1.536000	0.36072	0.404000	0.25506	-0.136000	0.14681	GCT	0		0.592	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255434.2		NM_032442	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		220	0.05	11		148	0.07	10	NM_145301	36	0.42	15	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
CCL15	6359	mdanderson.org	37	17	34325386	34325386	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:34325386G>T	ENST00000354059.4	-	3	730	c.178C>A	c.(178-180)Caa>Aaa	p.Q60K	CCL14_ENST00000536149.1_5'UTR|CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.Q60K	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	60					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GGGATGCTTTGTGAGATGTAG	0.493																																					p.Q60K													.	.			0			c.C178A												77.0	65.0	69.0					17																	34325386		2203	4300	6503	SO:0001583	missense	6359	exon3			TGCTTTGTGAGAT	AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.178C>A	17.37:g.34325386G>T	ENSP00000293276:p.Gln60Lys		61	0	0		44	0.09	4	NM_032965	3	0.00	0	B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	ENST00000354059.4	37	CCDS11304.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.76|12.76	2.034702|2.034702	0.35893|0.35893	.|.	.|.	ENSG00000161574|ENSG00000161574	ENST00000394506|ENST00000354059	.|T	.|0.04049	.|3.72	4.44|4.44	4.44|4.44	0.53790|0.53790	.|CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	.|0.410909	.|0.21511	.|N	.|0.073363	T|T	0.03871|0.03871	0.0109|0.0109	N|N	0.11870|0.11870	0.19|0.19	0.09310|0.09310	N|N	1|1	.|B	.|0.27192	.|0.171	.|B	.|0.30646	.|0.118	T|T	0.42783|0.42783	-0.9431|-0.9431	5|10	.|0.40728	.|T	.|0.16	.|.	12.7539|12.7539	0.57323|0.57323	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|60	.|Q16663	.|CCL15_HUMAN	Q|K	7|60	.|ENSP00000293276:Q60K	.|ENSP00000293276:Q60K	H|Q	-|-	3|1	2|0	CCL15|CCL15	31349499|31349499	0.002000|0.002000	0.14202|0.14202	0.007000|0.007000	0.13788|0.13788	0.013000|0.013000	0.08279|0.08279	1.113000|1.113000	0.31184|0.31184	2.437000|2.437000	0.82529|0.82529	0.655000|0.655000	0.94253|0.94253	CAC|CAA			0.493	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256584.2		NM_004167	
ARHGAP23	57636	mdanderson.org	37	17	36654704	36654704	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:36654704C>A	ENST00000431231.2	+	22	3435	c.3367C>A	c.(3367-3369)Ctc>Atc	p.L1123I	ARHGAP23_ENST00000437668.3_Missense_Mutation_p.L1123I|ARHGAP23_ENST00000443378.1_Missense_Mutation_p.L1029I	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	1123					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						CATTGAGTACCTCCTGCCCAA	0.662																																					p.L1123I													.	.			0			c.C3367A												29.0	29.0	29.0					17																	36654704		692	1591	2283	SO:0001583	missense	57636	exon22			GAGTACCTCCTGC	AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.3367C>A	17.37:g.36654704C>A	ENSP00000393539:p.Leu1123Ile		65	0	0		46	0.07	3	NM_001199417	30	0.00	0		Missense_Mutation	SNP	ENST00000431231.2	37	CCDS56027.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030251	0.75504	.	.	ENSG00000225485	ENST00000437668;ENST00000431231;ENST00000443378	T;T;T	0.21031	2.03;2.54;2.49	4.76	4.76	0.60689	.	0.000000	0.64402	U	0.000003	T	0.46833	0.1413	M	0.71206	2.165	0.40506	D	0.980694	D;D	0.71674	0.997;0.998	D;D	0.83275	0.972;0.996	T	0.49588	-0.8924	10	0.62326	D	0.03	.	16.7036	0.85366	0.0:1.0:0.0:0.0	.	1123;1123	Q9P227;Q9P227-2	RHG23_HUMAN;.	I	1123;1123;1029	ENSP00000394153:L1123I;ENSP00000393539:L1123I;ENSP00000407333:L1029I	ENSP00000393539:L1123I	L	+	1	0	ARHGAP23	33908230	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.821000	0.55700	2.476000	0.83614	0.585000	0.79938	CTC			0.662	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441789.1		XM_290799	
PLEKHH3	79990	mdanderson.org	37	17	40822007	40822007	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:40822007C>T	ENST00000591022.1	-	11	2329	c.1942G>A	c.(1942-1944)Gcc>Acc	p.A648T	PLEKHH3_ENST00000293349.6_Missense_Mutation_p.A645T|PLEKHH3_ENST00000412503.1_Intron|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	648	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		GCCAGGTAGGCGGCCATGGCC	0.711																																					p.A648T													.	.			0			c.G1942A												24.0	21.0	22.0					17																	40822007		2200	4293	6493	SO:0001583	missense	79990	exon11			GGTAGGCGGCCAT	BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.1942G>A	17.37:g.40822007C>T	ENSP00000468678:p.Ala648Thr		37	0	0		33	0.09	3	NM_024927	9	0.00	0	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	ENST00000591022.1	37	CCDS11434.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.997061	0.74818	.	.	ENSG00000068137	ENST00000456950;ENST00000293349	T	0.40756	1.02	4.11	0.989	0.19802	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	0.297741	0.24217	N	0.040478	T	0.18341	0.0440	N	0.11255	0.115	0.80722	D	1	B;B	0.21821	0.061;0.021	B;B	0.15052	0.012;0.005	T	0.06625	-1.0816	10	0.13853	T	0.58	-3.7732	7.7048	0.28644	0.0:0.5722:0.0:0.4278	.	645;648	Q7Z736-2;Q7Z736	.;PKHH3_HUMAN	T	307;648	ENSP00000293349:A648T	ENSP00000293349:A648T	A	-	1	0	PLEKHH3	38075533	0.627000	0.27129	1.000000	0.80357	0.985000	0.73830	0.727000	0.25999	0.492000	0.27815	-0.224000	0.12420	GCC			0.711	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452332.1		NM_024927	
KCNH6	81033	broad.mit.edu	37	17	61607872	61607872	+	Missense_Mutation	SNP	G	G	T	rs146703318		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:61607872G>T	ENST00000583023.1	+	4	655	c.644G>T	c.(643-645)cGg>cTg	p.R215L	KCNH6_ENST00000456941.2_Missense_Mutation_p.R215L|KCNH6_ENST00000580652.1_Missense_Mutation_p.R215L|KCNH6_ENST00000314672.5_Missense_Mutation_p.R215L|KCNH6_ENST00000581784.1_Missense_Mutation_p.R215L	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	215					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	GTGGTGGAGCGGACACAGAAC	0.622																																					p.R215L													.	KCNH6	122		0			c.G644T												103.0	83.0	90.0					17																	61607872		2203	4300	6503	SO:0001583	missense	81033	exon4			TGGAGCGGACACA	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.644G>T	17.37:g.61607872G>T	ENSP00000463533:p.Arg215Leu		109	0	0		103	0.04	4	NM_030779	1	0.00	0	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	G	13.89	2.372346	0.42003	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.94376	-3.41;-3.41	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	D	0.96408	0.8828	M	0.73598	2.24	0.53005	D	0.999966	D;D;P;D;P	0.76494	0.999;0.979;0.766;0.995;0.948	D;P;P;D;P	0.74674	0.984;0.769;0.597;0.934;0.846	D	0.96817	0.9601	10	0.72032	D	0.01	.	18.1092	0.89529	0.0:0.0:1.0:0.0	.	92;215;215;215;215	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	L	215	ENSP00000318212:R215L;ENSP00000396900:R215L	ENSP00000318212:R215L	R	+	2	0	KCNH6	58961604	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.860000	0.86993	2.515000	0.84797	0.462000	0.41574	CGG			0.622	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443853.1		NM_030779	
GPRC5C	55890	mdanderson.org	37	17	72436963	72436963	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:72436963G>T	ENST00000392627.1	+	2	2309	c.1183G>T	c.(1183-1185)Gca>Tca	p.A395S	GPRC5C_ENST00000392629.2_Missense_Mutation_p.A362S|GPRC5C_ENST00000342648.5_Missense_Mutation_p.A35S|GPRC5C_ENST00000481232.1_Intron	NM_022036.2	NP_071319.2	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor, class C, group 5, member C	350					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|vesicle (GO:0031982)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	17						TGAGCCGGTTGCAGGTGGGTC	0.552																																					p.A395S													.	.			0			c.G1183T												73.0	71.0	72.0					17																	72436963		2203	4300	6503	SO:0001583	missense	55890	exon2			CCGGTTGCAGGTG	AF207989	CCDS11699.1, CCDS42378.1	17q25	2014-01-30	2014-01-30		ENSG00000170412	ENSG00000170412		"""GPCR / Class C : Orphans"""	13309	protein-coding gene	gene with protein product		605949	"""G protein-coupled receptor, family C, group 5, member C"""			10945465	Standard	NM_022036		Approved	RAIG-3	uc002jkr.3	Q9NQ84	OTTHUMG00000067613	ENST00000392627.1:c.1183G>T	17.37:g.72436963G>T	ENSP00000376403:p.Ala395Ser		38	0	0		37	0.08	3	NM_022036	256	0.00	0	B5BUN4|Q2NL85|Q9NZG5	Missense_Mutation	SNP	ENST00000392627.1	37	CCDS11699.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.689630	0.00738	.	.	ENSG00000170412	ENST00000392627;ENST00000342648;ENST00000262616;ENST00000392629;ENST00000392628	T	0.18174	2.23	4.9	1.28	0.21552	.	0.521148	0.21578	N	0.072291	T	0.05318	0.0141	N	0.01482	-0.84	0.19300	N	0.999975	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.41698	-0.9494	10	0.08599	T	0.76	-18.1132	12.2085	0.54365	0.0:0.0:0.476:0.524	.	350;350;362	A8MXZ4;Q9NQ84;Q9NQ84-2	.;GPC5C_HUMAN;.	S	350;395;61;362;350	ENSP00000376405:A362S	ENSP00000262616:A61S	A	+	1	0	GPRC5C	69948558	0.526000	0.26298	0.451000	0.26982	0.381000	0.30169	0.641000	0.24720	0.030000	0.15379	0.561000	0.74099	GCA			0.552	GPRC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000145094.2			
DUS1L	64118	mdanderson.org	37	17	80018749	80018749	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr17:80018749G>A	ENST00000354321.7	-	8	1416	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	DUS1L_ENST00000306796.5_Missense_Mutation_p.R311W			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	311							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GCCTGACACCGCAGCTTCAGC	0.662																																					p.R311W													.	.			0			c.C931T												43.0	40.0	41.0					17																	80018749		2202	4300	6502	SO:0001583	missense	64118	exon9			GACACCGCAGCTT		CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.931C>T	17.37:g.80018749G>A	ENSP00000346280:p.Arg311Trp		37	0	0		37	0.08	3	NM_022156	143	0.00	0	A6NHV4|Q96AI3	Missense_Mutation	SNP	ENST00000354321.7	37	CCDS32775.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778828	0.49891	.	.	ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088;ENST00000538833	T;T;T	0.35605	1.34;1.34;1.3	5.28	5.28	0.74379	.	0.053250	0.85682	D	0.000000	T	0.34308	0.0893	M	0.64080	1.96	0.80722	D	1	B;P	0.37398	0.148;0.593	B;B	0.30572	0.077;0.117	T	0.25882	-1.0119	10	0.51188	T	0.08	-27.7187	13.8062	0.63233	0.0:0.0:0.8466:0.1534	.	311;180	Q6P1R4;Q9BTJ3	DUS1L_HUMAN;.	W	311;311;174;179	ENSP00000346280:R311W;ENSP00000303515:R311W;ENSP00000445110:R179W	ENSP00000303515:R311W	R	-	1	2	DUS1L	77612038	1.000000	0.71417	0.985000	0.45067	0.894000	0.52154	5.992000	0.70609	2.467000	0.83353	0.561000	0.74099	CGG			0.662	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442347.1		NM_022156	
MC4R	4160	mdanderson.org	37	18	58039043	58039043	+	Silent	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr18:58039043T>C	ENST00000299766.3	-	1	958	c.540A>G	c.(538-540)tcA>tcG	p.S180S		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	180					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				ACAAAATGCCTGAAACCGTGC	0.438																																					p.S180S													.	.			0			c.A540G												89.0	81.0	83.0					18																	58039043		2203	4300	6503	SO:0001819	synonymous_variant	4160	exon1			AATGCCTGAAACC	AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.540A>G	18.37:g.58039043T>C			46	0	0		38	0.08	3	NM_005912	0		0	B2RAC3|Q16317|Q3MIJ6	Silent	SNP	ENST00000299766.3	37	CCDS11976.1																																																																																					0.438	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256139.1		NM_005912	
CCDC102B	79839	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	18	66504042	66504042	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr18:66504042G>T	ENST00000360242.5	+	2	159	c.42G>T	c.(40-42)caG>caT	p.Q14H	CCDC102B_ENST00000577772.1_3'UTR|CCDC102B_ENST00000319445.6_Missense_Mutation_p.Q14H|CCDC102B_ENST00000358653.5_Missense_Mutation_p.Q14H|CCDC102B_ENST00000584156.1_Missense_Mutation_p.Q14H	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	14										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AGGAAACACAGATCTTCCAGA	0.413																																					p.Q14H													.	.			0			c.G42T												56.0	56.0	56.0					18																	66504042		1922	4113	6035	SO:0001583	missense	79839	exon4			AACACAGATCTTC	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.42G>T	18.37:g.66504042G>T	ENSP00000353377:p.Gln14His		52	0	0		43	0.14	6	NM_001093729	4	0.00	0	Q7Z467|Q8NDK7|Q9H5C1	Missense_Mutation	SNP	ENST00000360242.5	37	CCDS11996.2	.	.	.	.	.	.	.	.	.	.	G	7.314	0.615609	0.14129	.	.	ENSG00000150636	ENST00000319445;ENST00000358653;ENST00000360242	T;T;T	0.20881	2.56;2.04;2.56	5.17	-4.25	0.03766	.	0.253660	0.27787	N	0.017847	T	0.09730	0.0239	N	0.19112	0.55	0.09310	N	0.999997	B;B	0.16802	0.008;0.019	B;B	0.18561	0.009;0.022	T	0.10268	-1.0637	10	0.40728	T	0.16	-1.636	6.4919	0.22119	0.2739:0.3917:0.3344:0.0	.	14;14	Q68D86-3;Q68D86	.;C102B_HUMAN	H	14	ENSP00000316237:Q14H;ENSP00000351479:Q14H;ENSP00000353377:Q14H	ENSP00000316237:Q14H	Q	+	3	2	CCDC102B	64655022	0.009000	0.17119	0.086000	0.20670	0.587000	0.36485	0.198000	0.17217	-1.111000	0.02988	-0.384000	0.06662	CAG			0.413	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256225.2		NM_024781	
PTBP1	5725	mdanderson.org	37	19	804539	804539	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:804539A>G	ENST00000349038.4	+	6	516	c.443A>G	c.(442-444)cAg>cGg	p.Q148R	PTBP1_ENST00000356948.6_Missense_Mutation_p.Q148R|PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000394601.4_Missense_Mutation_p.Q148R|MIR4745_ENST00000577608.1_RNA	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	148					alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGGGCCCAGGCGGCCCTG	0.781																																					p.Q148R													.	.			0			c.A443G												14.0	18.0	16.0					19																	804539		2194	4226	6420	SO:0001583	missense	5725	exon6			GGGCCCAGGCGGC	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.443A>G	19.37:g.804539A>G	ENSP00000014112:p.Gln148Arg		17	0	0		22	0.09	2	NM_031991	530	0.00	1	Q9BUQ0	Missense_Mutation	SNP	ENST00000349038.4	37	CCDS32859.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.343374	0.41498	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.48836	0.82;0.8;1.14	4.81	4.81	0.61882	.	0.061459	0.64402	D	0.000003	T	0.57651	0.2068	M	0.78049	2.395	0.80722	D	1	B;B;B	0.29085	0.232;0.2;0.029	B;B;B	0.40038	0.104;0.317;0.076	T	0.62445	-0.6853	10	0.62326	D	0.03	-39.2304	13.5836	0.61917	1.0:0.0:0.0:0.0	.	148;148;148	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	R	148	ENSP00000349428:Q148R;ENSP00000408096:Q148R;ENSP00000014112:Q148R	ENSP00000014112:Q148R	Q	+	2	0	PTBP1	755539	1.000000	0.71417	0.998000	0.56505	0.469000	0.32828	5.858000	0.69532	1.806000	0.52798	0.533000	0.62120	CAG			0.781	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457605.1			
CD97	976	mdanderson.org	37	19	14513646	14513646	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:14513646G>T	ENST00000242786.5	+	12	1501	c.1421G>T	c.(1420-1422)gGg>gTg	p.G474V	CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.G425V|CD97_ENST00000358600.3_Missense_Mutation_p.G381V	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	474					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						TCCTCCGATGGGGAGGCGGGA	0.577																																					p.G474V													.	.			0			c.G1421T												128.0	112.0	117.0					19																	14513646		2203	4300	6503	SO:0001583	missense	976	exon12			CCGATGGGGAGGC		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1421G>T	19.37:g.14513646G>T	ENSP00000242786:p.Gly474Val		48	0	0		51	0.06	3	NM_078481	252	0.00	0	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	37	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	G	7.246	0.602172	0.13939	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.70045	-0.45;-0.36;0.02	3.96	1.81	0.25067	.	.	.	.	.	T	0.39436	0.1078	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.26809	0.034;0.16;0.003	B;B;B	0.22601	0.027;0.04;0.006	T	0.20840	-1.0263	9	0.17369	T	0.5	.	6.0593	0.19828	0.2393:0.0:0.7607:0.0	.	381;425;474	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	V	474;425;381;424	ENSP00000242786:G474V;ENSP00000349918:G425V;ENSP00000351413:G381V	ENSP00000242786:G474V	G	+	2	0	CD97	14374646	0.106000	0.21978	0.001000	0.08648	0.008000	0.06430	2.026000	0.41069	0.329000	0.23460	0.400000	0.26472	GGG			0.577	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459821.2		NM_078481	
MEF2B	100271849	mdanderson.org	37	19	19256700	19256700	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:19256700G>T	ENST00000602424.2	-	10	1627	c.901C>A	c.(901-903)Cct>Act	p.P301T	MEF2B_ENST00000162023.5_Missense_Mutation_p.P338H|MEF2BNB-MEF2B_ENST00000514819.3_Missense_Mutation_p.P318T|MEF2B_ENST00000409224.1_3'UTR|MEF2BNB-MEF2B_ENST00000602276.1_5'Flank|MEF2BNB-MEF2B_ENST00000444486.3_Missense_Mutation_p.P301T|MEF2B_ENST00000424583.2_Missense_Mutation_p.P338H|MEF2B_ENST00000410050.1_Missense_Mutation_p.P345H|MEF2B_ENST00000409447.2_Missense_Mutation_p.P256H	NM_005919.3	NP_005910.1	Q02080	MEF2B_HUMAN	myocyte enhancer factor 2B	301					muscle organ development (GO:0007517)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|haematopoietic_and_lymphoid_tissue(21)|large_intestine(1)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(5;0.00011)|Epithelial(12;0.00412)			CAAGGGATAGGGGAAGGTCTT	0.741																																					p.P338H													.	.			0			c.C1013A												2.0	3.0	3.0					19																	19256700		1667	3504	5171	SO:0001583	missense	100271849	exon9			GGATAGGGGAAGG	X63380	CCDS12394.1, CCDS46024.1	19p13.11	2010-05-12	2007-04-24					"""Myocyte enhancer factors"""	6995	protein-coding gene	gene with protein product		600661				1516833, 8575763	Standard	NM_001145785		Approved	RSRFR2	uc002nll.2	Q02080		ENST00000602424.2:c.901C>A	19.37:g.19256700G>T	ENSP00000473308:p.Pro301Thr		29	0	0		22	0.14	3	NM_001145785	5	0.00	0	A0AV80|B4DVH7|B7ZVY1|G5E9M1	Missense_Mutation	SNP	ENST00000602424.2	37	CCDS12394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.50|17.50	3.404715|3.404715	0.62288|0.62288	.|.	.|.	ENSG00000213999|ENSG00000213999	ENST00000424583;ENST00000410050;ENST00000409447;ENST00000162023|ENST00000444486	D;D;D|D	0.92545|0.86432	-3.06;-3.05;-3.06|-2.12	4.11|4.11	0.431|0.431	0.16523|0.16523	.|.	1.775420|1.775420	0.04098|0.04098	N|N	0.312455|0.312455	T|T	0.69415|0.69415	0.3108|0.3108	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P;B;P|P	0.45827|0.39480	0.697;0.41;0.867|0.675	B;B;B|B	0.43950|0.34093	0.339;0.258;0.437|0.175	T|T	0.64106|0.64106	-0.6485|-0.6485	10|10	0.23302|0.16420	T|T	0.38|0.52	-0.3699|-0.3699	3.8898|3.8898	0.09114|0.09114	0.2286:0.0:0.5821:0.1894|0.2286:0.0:0.5821:0.1894	.|.	303;345;338|301	B8ZZJ5;C9J4J4;G5E9M1|Q02080	.;.;.|MEF2B_HUMAN	H|T	338;345;303;338|301	ENSP00000402154:P338H;ENSP00000386374:P345H;ENSP00000162023:P338H|ENSP00000390762:P301T	ENSP00000162023:P338H|ENSP00000390762:P301T	P|P	-|-	2|1	0|0	MEF2B|MEF2B	19117700|19117700	0.127000|0.127000	0.22367|0.22367	0.001000|0.001000	0.08648|0.08648	0.957000|0.957000	0.61999|0.61999	2.801000|2.801000	0.47908|0.47908	0.303000|0.303000	0.22785|0.22785	0.491000|0.491000	0.48974|0.48974	CCC|CCT			0.741	MEF2B-202	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_005919	
NUDT19	390916	broad.mit.edu	37	19	33183263	33183263	+	Frame_Shift_Del	DEL	T	T	-	rs546154641		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:33183263delT	ENST00000397061.3	+	1	397	c.397delT	c.(397-399)tttfs	p.F133fs	CTD-2538C1.2_ENST00000592431.1_lincRNA	NM_001105570.1	NP_001099040.1	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 19	133	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					mitochondrion (GO:0005739)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	8	Esophageal squamous(110;0.137)					GCGGGAGGCCTTTGAGGAGGC	0.716																																					p.F133fs													.	NUDT19	15		0			c.397delT												13.0	17.0	15.0					19																	33183263		2104	4215	6319	SO:0001589	frameshift_variant	390916	exon1			GAGGCCTTTGAGG		CCDS42543.1	19q13.11	2011-11-16			ENSG00000213965	ENSG00000213965		"""Nudix motif containing"""	32036	protein-coding gene	gene with protein product							Standard	NM_001105570		Approved	RP2	uc010edf.3	A8MXV4		ENST00000397061.3:c.397delT	19.37:g.33183263delT	ENSP00000380251:p.Phe133fs		16	0	0		6	0.33	2	NM_001105570	1	0.00	0		Frame_Shift_Del	DEL	ENST00000397061.3	37	CCDS42543.1																																																																																					0.716	NUDT19-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000450338.3		XM_372723	
PPP1R14A	94274	mdanderson.org	37	19	38746835	38746835	+	Silent	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:38746835G>T	ENST00000301242.4	-	1	396	c.145C>A	c.(145-147)Cgg>Agg	p.R49R	PPP1R14A_ENST00000591291.1_Silent_p.R49R|PPP1R14A_ENST00000347262.4_Silent_p.R49R|PPP1R14A_ENST00000587515.1_5'Flank|PPP1R14A_ENST00000591585.1_Silent_p.R49R	NM_033256.2	NP_150281.1	Q96A00	PP14A_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14A	49	Inhibitory.				regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			lung(1)	1	all_cancers(60;9.57e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACGTCCAGCCGCCGCTGCAGC	0.731																																					p.R49R													.	.			0			c.C145A												5.0	6.0	6.0					19																	38746835		2026	3991	6017	SO:0001819	synonymous_variant	94274	exon1			CCAGCCGCCGCTG	AB056508	CCDS12509.1, CCDS58660.1	19q13.1	2012-04-17		2001-07-02	ENSG00000167641	ENSG00000167641		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14871	protein-coding gene	gene with protein product	"""17-kDa PKC-potentiated inhibitory protein of PP1"", ""PKC-potentiated inhibitory protein of PP1"", ""17-KDa protein"""	608153		PPP1INL		11467857	Standard	NM_033256		Approved	CPI-17	uc002ohq.3	Q96A00		ENST00000301242.4:c.145C>A	19.37:g.38746835G>T			33	0	0		28	0.11	3	NM_033256	67	0.00	0	Q7Z4X7|Q96S54	Silent	SNP	ENST00000301242.4	37	CCDS12509.1																																																																																					0.731	PPP1R14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458164.1		NM_033256	
CD79A	973	mdanderson.org	37	19	42383293	42383293	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr19:42383293G>T	ENST00000221972.3	+	2	498	c.313G>T	c.(313-315)Gtg>Ttg	p.V105L	CD79A_ENST00000444740.2_Intron	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	105	Ig-like C2-type.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						GGGCATATACGTGTGCCGGGT	0.637			"""O, S"""		DLBCL																																p.V105L				Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	.	.			0			c.G313T												73.0	64.0	67.0					19																	42383293		2203	4300	6503	SO:0001583	missense	973	exon2			ATATACGTGTGCC	M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.313G>T	19.37:g.42383293G>T	ENSP00000221972:p.Val105Leu		18	0	0		20	0.15	3	NM_001783	148	0.00	0	A0N775|Q53FB8	Missense_Mutation	SNP	ENST00000221972.3	37	CCDS12589.1	.	.	.	.	.	.	.	.	.	.	G	5.030	0.191288	0.09547	.	.	ENSG00000105369	ENST00000221972	T	0.64260	-0.09	5.06	-5.99	0.02213	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.604720	0.03628	N	0.237454	T	0.31979	0.0814	N	0.08118	0	0.19775	N	0.999957	B	0.02656	0.0	B	0.04013	0.001	T	0.10428	-1.0630	10	0.15952	T	0.53	-3.4258	1.7318	0.02933	0.3949:0.3125:0.0993:0.1932	.	105	P11912	CD79A_HUMAN	L	105	ENSP00000221972:V105L	ENSP00000221972:V105L	V	+	1	0	CD79A	47075133	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.769000	0.04710	-0.992000	0.03472	-2.547000	0.00178	GTG			0.637	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463058.1			
ANKRD36C	400986	broad.mit.edu	37	2	96521862	96521862	+	Missense_Mutation	SNP	T	T	A	rs200835769		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr2:96521862T>A	ENST00000456556.1	-	63	4231	c.4147A>T	c.(4147-4149)Agg>Tgg	p.R1383W	ANKRD36C_ENST00000419039.2_Missense_Mutation_p.R410W|ANKRD36C_ENST00000420871.2_Missense_Mutation_p.R634W			Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	1383							ion channel inhibitor activity (GO:0008200)	p.R634W(6)|p.R1383W(3)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AGCCTGAGCCTGGCAATTTCA	0.348																																					.													ENSG00000174501,NS,carcinoma,0,8	.		8	9	Substitution - Missense(9)	endometrium(6)|kidney(3)	.																																									SO:0001583	missense	400986	.			TGAGCCTGGCAAT	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.4147A>T	2.37:g.96521862T>A	ENSP00000403302:p.Arg1383Trp		177	0	0		140	0.04	6	.	20	0.15	3	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	8.916	0.959780	0.18507	.	.	ENSG00000174501	ENST00000420871;ENST00000456556;ENST00000419039	T;T;T	0.14144	2.53;2.53;2.53	1.87	0.59	0.17458	.	.	.	.	.	T	0.11623	0.0283	L	0.55481	1.735	0.09310	N	1	B	0.33841	0.428	B	0.33960	0.173	T	0.31833	-0.9929	9	0.72032	D	0.01	.	1.6467	0.02763	0.295:0.1818:0.0:0.5232	.	1383	Q5JPF3	AN36C_HUMAN	W	634;1383;410	ENSP00000415231:R634W;ENSP00000403302:R1383W;ENSP00000407838:R410W	ENSP00000407838:R410W	R	-	1	2	AC073995.2	95885589	0.082000	0.21442	0.122000	0.21767	0.024000	0.10985	0.206000	0.17375	0.152000	0.19188	0.260000	0.18958	AGG			0.348	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000338799.2		NM_001010914	
LONRF2	164832	mdanderson.org	37	2	100916315	100916315	+	Silent	SNP	A	A	T	rs11123823	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr2:100916315A>T	ENST00000393437.3	-	5	1770	c.1131T>A	c.(1129-1131)ggT>ggA	p.G377G	LONRF2_ENST00000409647.1_Silent_p.G134G	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	377							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)	p.G377G(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CAAAGTGTAGACCCAGTATAA	0.408																																					p.G377G													LONRF2,NS,carcinoma,0,1	LONRF2	0	1	1	Substitution - coding silent(1)	stomach(1)	c.T1131A												64.0	63.0	63.0					2																	100916315		2203	4300	6503	SO:0001819	synonymous_variant	164832	exon5			GTGTAGACCCAGT	AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1131T>A	2.37:g.100916315A>T			78	0	0		75	0.04	3	NM_198461	2	0.00	0	B9A006|Q6ZSR4	Silent	SNP	ENST00000393437.3	37	CCDS2046.2																																																																																					0.408	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253161.2		NM_198461	
TMEM87B	84910	mdanderson.org	37	2	112843654	112843654	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr2:112843654T>C	ENST00000283206.4	+	9	1280	c.911T>C	c.(910-912)aTt>aCt	p.I304T	TMEM87B_ENST00000463427.1_3'UTR	NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	304						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						CTCGTGATCATTGTGAGCCTG	0.448																																					p.I304T													.	.			0			c.T911C												156.0	143.0	147.0					2																	112843654		2203	4300	6503	SO:0001583	missense	84910	exon9			TGATCATTGTGAG	AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.911T>C	2.37:g.112843654T>C	ENSP00000283206:p.Ile304Thr		75	0	0		50	0.06	3	NM_032824	18	0.00	0	A8K2M9|Q1RLN2|Q53R54	Missense_Mutation	SNP	ENST00000283206.4	37	CCDS33275.1	.	.	.	.	.	.	.	.	.	.	T	18.92	3.725798	0.69074	.	.	ENSG00000153214	ENST00000283206	.	.	.	5.84	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.76219	0.3957	M	0.79258	2.445	0.58432	D	0.999998	D	0.59357	0.985	D	0.65874	0.939	T	0.77887	-0.2420	9	0.87932	D	0	-9.6723	10.2105	0.43138	0.0:0.0784:0.0:0.9216	.	304	Q96K49	TM87B_HUMAN	T	304	.	ENSP00000283206:I304T	I	+	2	0	TMEM87B	112560125	1.000000	0.71417	0.773000	0.31616	0.715000	0.41141	7.946000	0.87746	1.025000	0.39708	0.533000	0.62120	ATT			0.448	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000330500.1		NM_032824	
PAX8	7849	ucsc.edu;mdanderson.org	37	2	113992973	113992973	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr2:113992973G>T	ENST00000429538.3	-	9	1279	c.1085C>A	c.(1084-1086)tCa>tAa	p.S362*	PAX8_ENST00000348715.5_Missense_Mutation_p.Q336K|AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000333145.5_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.Q336K|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Intron|PAX8_ENST00000263335.7_Intron|AC016683.6_ENST00000553869.2_RNA|AC016683.6_ENST00000431844.2_RNA|AC016683.6_ENST00000456685.1_RNA|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000451179.1_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	362					anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						TGTCGTACCTGAGAGGAGGGC	0.667			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.S362X	Ovarian(188;7 2067 9084 29802 29892)			Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42		0			c.C1085A												15.0	17.0	17.0					2																	113992973		1894	4105	5999	SO:0001587	stop_gained	7849	exon9			GTACCTGAGAGGA	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.1085C>A	2.37:g.113992973G>T	ENSP00000395498:p.Ser362*		45	0	0		52	0.10	5	NM_003466	15	0.00	0	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	37	CCDS46398.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.544587|8.544587	0.98857|0.98857	.|.	.|.	ENSG00000125618|ENSG00000125618	ENST00000348715;ENST00000263334|ENST00000429538	D;D|.	0.97114|.	-4.25;-4.25|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	.|0.415891	.|0.24727	.|N	.|0.036090	T|.	0.73179|.	0.3554|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|.	0.31817|.	0.341|.	B|.	0.33620|.	0.167|.	T|.	0.69924|.	-0.5013|.	8|.	0.37606|0.38643	T|T	0.19|0.18	.|.	17.5992|17.5992	0.88021|0.88021	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	336|.	Q06710-3|.	.|.	K|X	336|362	ENSP00000314750:Q336K;ENSP00000263334:Q336K|.	ENSP00000263334:Q336K|ENSP00000395498:S362X	Q|S	-|-	1|2	0|0	PAX8|PAX8	113709444|113709444	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	8.019000|8.019000	0.88732|0.88732	2.757000|2.757000	0.94681|0.94681	0.655000|0.655000	0.94253|0.94253	CAG|TCA			0.667	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250353.5			
THAP4	51078	mdanderson.org	37	2	242572743	242572743	+	Missense_Mutation	SNP	C	C	T	rs554537698	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr2:242572743C>T	ENST00000407315.1	-	2	1260	c.829G>A	c.(829-831)Gac>Aac	p.D277N		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	277							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		AGGCCCTTGTCGGGTCCCAGG	0.637													C|||	2	0.000399361	0.0	0.0014	5008	,	,		17342	0.0		0.0	False		,,,				2504	0.001				p.D277N													.	.			0			c.G829A												74.0	80.0	78.0					2																	242572743		2203	4296	6499	SO:0001583	missense	51078	exon2			CCTTGTCGGGTCC	AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.829G>A	2.37:g.242572743C>T	ENSP00000385006:p.Asp277Asn		48	0	0		34	0.09	3	NM_015963	231	0.00	0	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Missense_Mutation	SNP	ENST00000407315.1	37	CCDS2551.1	.	.	.	.	.	.	.	.	.	.	C	10.71	1.427403	0.25726	.	.	ENSG00000176946	ENST00000407315	D	0.96396	-4.0	4.98	4.1	0.47936	.	0.318257	0.21820	N	0.068630	D	0.91489	0.7313	L	0.27053	0.805	0.49687	D	0.999814	P	0.40638	0.725	B	0.33042	0.157	D	0.91264	0.5039	10	0.87932	D	0	-22.8018	13.0532	0.58966	0.1615:0.8385:0.0:0.0	.	277	Q8WY91	THAP4_HUMAN	N	277	ENSP00000385006:D277N	ENSP00000385006:D277N	D	-	1	0	THAP4	242221416	0.557000	0.26546	0.204000	0.23530	0.069000	0.16628	1.155000	0.31700	1.210000	0.43336	0.650000	0.86243	GAC			0.637	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257267.3		NM_015963	
COL18A1	80781	mdanderson.org	37	21	46897716	46897716	+	Missense_Mutation	SNP	G	G	T	rs373030953		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr21:46897716G>T	ENST00000359759.4	+	7	2324	c.2303G>T	c.(2302-2304)cGg>cTg	p.R768L	COL18A1_ENST00000400337.2_Missense_Mutation_p.R353L|COL18A1_ENST00000355480.5_Missense_Mutation_p.R533L			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	768	Triple-helical region 1 (COL1).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCACCTGGCCGGGCAGGCCCC	0.701																																					p.R533L													.	.			0			c.G1598T												8.0	11.0	10.0					21																	46897716		1769	3928	5697	SO:0001583	missense	80781	exon7			CTGGCCGGGCAGG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.2303G>T	21.37:g.46897716G>T	ENSP00000352798:p.Arg768Leu		41	0	0		47	0.06	3	NM_030582	43	0.00	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	ENST00000359759.4	37		.	.	.	.	.	.	.	.	.	.	G	9.174	1.021808	0.19433	.	.	ENSG00000182871	ENST00000400337;ENST00000400347;ENST00000355480;ENST00000359759;ENST00000539645	T;T;T	0.60672	0.17;0.17;0.17	2.84	1.93	0.25924	.	1.967240	0.02808	N	0.123966	T	0.43612	0.1255	N	0.17723	0.515	0.21416	N	0.999691	B;B;B	0.24483	0.063;0.104;0.104	B;B;B	0.27796	0.038;0.083;0.083	T	0.26292	-1.0107	10	0.07482	T	0.82	.	10.216	0.43168	0.0:0.7816:0.2184:0.0	.	768;533;353	P39060;P39060-1;P39060-2	COIA1_HUMAN;.;.	L	353;353;533;768;768	ENSP00000383191:R353L;ENSP00000347665:R533L;ENSP00000352798:R768L	ENSP00000347665:R533L	R	+	2	0	COL18A1	45722144	0.003000	0.15002	0.159000	0.22649	0.003000	0.03518	-1.168000	0.03123	0.300000	0.22699	-0.321000	0.08615	CGG			0.701	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000206827.1			
CCDC174	51244	mdanderson.org	37	3	14693367	14693367	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:14693367G>T	ENST00000383794.3	+	1	97	c.24G>T	c.(22-24)ttG>ttT	p.L8F	CCDC174_ENST00000303688.7_Missense_Mutation_p.L8F|AC090952.5_ENST00000424242.1_RNA	NM_016474.4	NP_057558.3	Q6PII3	CC174_HUMAN	coiled-coil domain containing 174	8						cytoplasm (GO:0005737)|nucleus (GO:0005634)											AAAAGCCTTTGGACGTCACGG	0.582																																					p.L8F													.	.			0			c.G24T												65.0	69.0	68.0					3																	14693367		1955	4144	6099	SO:0001583	missense	51244	exon1			GCCTTTGGACGTC	AF151046	CCDS2620.2	3p25.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000154781	ENSG00000154781			28033	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 19"""	C3orf19		11042152	Standard	NM_016474		Approved	FLJ33839	uc003byw.3	Q6PII3	OTTHUMG00000129837	ENST00000383794.3:c.24G>T	3.37:g.14693367G>T	ENSP00000373304:p.Leu8Phe		50	0	0		39	0.08	3	NM_016474	22	0.00	0	Q96CS5	Missense_Mutation	SNP	ENST00000383794.3	37	CCDS2620.2	.	.	.	.	.	.	.	.	.	.	G	10.23	1.294055	0.23564	.	.	ENSG00000154781	ENST00000383794;ENST00000303688	T;T	0.47177	0.85;0.85	4.61	3.72	0.42706	.	0.250574	0.33457	N	0.004893	T	0.34337	0.0894	L	0.33485	1.01	0.39860	D	0.973364	B	0.13145	0.007	B	0.11329	0.006	T	0.30327	-0.9982	10	0.54805	T	0.06	-24.2657	8.691	0.34267	0.1786:0.0:0.8214:0.0	.	8	Q6PII3	CC019_HUMAN	F	8	ENSP00000373304:L8F;ENSP00000302344:L8F	ENSP00000302344:L8F	L	+	3	2	C3orf19	14668371	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	2.439000	0.44846	2.388000	0.81334	0.467000	0.42956	TTG			0.582	CCDC174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252077.2		NM_016474	
HACL1	26061	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	15633164	15633164	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:15633164G>A	ENST00000321169.5	-	4	618	c.251C>T	c.(250-252)tCt>tTt	p.S84F	HACL1_ENST00000457447.2_Missense_Mutation_p.S84F|HACL1_ENST00000456194.2_Intron|HACL1_ENST00000451445.2_Missense_Mutation_p.S84F|HACL1_ENST00000435217.2_Intron	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	84					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						ACCTGGGCCAGAAACAACAAG	0.383																																					p.S84F													.	.			0			c.C251T												67.0	61.0	63.0					3																	15633164		2203	4300	6503	SO:0001583	missense	26061	exon4			GGGCCAGAAACAA	AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.251C>T	3.37:g.15633164G>A	ENSP00000323811:p.Ser84Phe		199	0	0		128	0.14	18	NM_012260	52	0.50	26	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	37	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.500844	0.85176	.	.	ENSG00000131373	ENST00000321169;ENST00000451445;ENST00000457447	T;T;T	0.53857	1.24;1.15;0.6	5.65	5.65	0.86999	Thiamine pyrophosphate enzyme, N-terminal TPP-binding domain (1);	0.098868	0.64402	D	0.000001	D	0.83681	0.5307	H	0.98027	4.13	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.997	D	0.89496	0.3760	10	0.87932	D	0	.	18.5568	0.91088	0.0:0.0:1.0:0.0	.	84;84;84	B4DXI5;E9PEN4;Q9UJ83	.;.;HACL1_HUMAN	F	84	ENSP00000323811:S84F;ENSP00000403656:S84F;ENSP00000404883:S84F	ENSP00000323811:S84F	S	-	2	0	HACL1	15608168	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.215000	0.72206	2.698000	0.92095	0.585000	0.79938	TCT			0.383	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252104.3		NM_012260	
ARIH2OS	646450	mdanderson.org	37	3	48955993	48955993	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:48955993G>T	ENST00000408959.2	-	1	825	c.590C>A	c.(589-591)gCg>gAg	p.A197E	ARIH2_ENST00000449376.1_5'Flank|ARIH2_ENST00000356401.4_5'Flank	NM_001123040.1	NP_001116512.1	Q8N7S6	ARI2O_HUMAN	ariadne homolog 2 opposite strand	197						integral component of membrane (GO:0016021)		p.A197V(1)									CTCCACTGACGCCAGGATGTC	0.587																																					p.A197E													C3orf71,NS,carcinoma,0,1	C3orf71	0	1	1	Substitution - Missense(1)	breast(1)	c.C590A												70.0	72.0	71.0					3																	48955993		1568	3582	5150	SO:0001583	missense	646450	exon1			ACTGACGCCAGGA	DA461567	CCDS43088.1	3p21.31	2012-10-08	2012-10-08	2012-10-08	ENSG00000221883	ENSG00000221883			34425	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 71"""	C3orf71			Standard	NM_001123040		Approved		uc010hkk.1	Q8N7S6	OTTHUMG00000156672	ENST00000408959.2:c.590C>A	3.37:g.48955993G>T	ENSP00000386193:p.Ala197Glu		64	0	0		47	0.06	3	NM_001123040	15	0.00	0		Missense_Mutation	SNP	ENST00000408959.2	37	CCDS43088.1	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192646	0.21954	.	.	ENSG00000221883	ENST00000408959	.	.	.	3.13	2.24	0.28232	.	.	.	.	.	T	0.32406	0.0828	N	0.08118	0	0.09310	N	1	D	0.63880	0.993	P	0.60236	0.871	T	0.12863	-1.0531	8	0.87932	D	0	.	8.2633	0.31799	0.0:0.245:0.755:0.0	.	197	Q8N7S6	CC071_HUMAN	E	197	.	ENSP00000386193:A197E	A	-	2	0	C3orf71	48930997	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.281000	0.18810	0.879000	0.35944	-0.176000	0.13171	GCG			0.587	ARIH2OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345247.1		NM_001123040	
NISCH	11188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	52522318	52522318	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:52522318A>G	ENST00000479054.1	+	17	2882	c.2810A>G	c.(2809-2811)aAc>aGc	p.N937S	NISCH_ENST00000345716.4_Missense_Mutation_p.N937S			Q9Y2I1	NISCH_HUMAN	nischarin	937					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	AACTGTCGCAACCGCAACAGC	0.647																																					p.N937S													.	.			0			c.A2810G												110.0	101.0	104.0					3																	52522318		2203	4300	6503	SO:0001583	missense	11188	exon16			GTCGCAACCGCAA	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.2810A>G	3.37:g.52522318A>G	ENSP00000418232:p.Asn937Ser		49	0	0		34	0.21	7	NM_007184	185	0.43	80	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	ENST00000479054.1	37	CCDS33767.1	.	.	.	.	.	.	.	.	.	.	A	10.52	1.372194	0.24857	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000414197	T;T	0.05925	3.37;3.37	5.21	2.8	0.32819	.	0.561643	0.19300	N	0.117668	T	0.03095	0.0091	N	0.14661	0.345	0.25095	N	0.990829	B	0.31705	0.336	B	0.23574	0.047	T	0.41556	-0.9502	10	0.30854	T	0.27	-30.0057	6.1865	0.20500	0.6929:0.1574:0.1497:0.0	.	937	Q9Y2I1	NISCH_HUMAN	S	937;937;281	ENSP00000418232:N937S;ENSP00000339958:N937S	ENSP00000339958:N937S	N	+	2	0	NISCH	52497358	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.596000	0.46205	1.971000	0.57363	0.379000	0.24179	AAC			0.647	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351357.1		NM_007184	
DNAJC13	23317	ucsc.edu;bcgsc.ca;mdanderson.org	37	3	132199260	132199260	+	Silent	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:132199260G>T	ENST00000260818.6	+	26	3068	c.2820G>T	c.(2818-2820)gtG>gtT	p.V940V		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	940					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GAATCCTTGTGGACTTGCTTA	0.348																																					p.V940V													.	DNAJC13	253		0			c.G2820T												113.0	99.0	104.0					3																	132199260		2203	4300	6503	SO:0001819	synonymous_variant	23317	exon26			CCTTGTGGACTTG	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2820G>T	3.37:g.132199260G>T			83	0	0		45	0.11	5	NM_015268	47	0.00	0	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	ENST00000260818.6	37	CCDS33857.1																																																																																					0.348	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356807.2		NM_015268	
MUC4	4585	hgsc.bcm.edu	37	3	195515102	195515102	+	Missense_Mutation	SNP	G	G	C	rs199995135		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr3:195515102G>C	ENST00000463781.3	-	2	3808	c.3349C>G	c.(3349-3351)Cac>Gac	p.H1117D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.H1117D	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	556					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H1117D(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTGGTGTGACCTGTGGAT	0.567																																					p.H1117D													MUC4_ENST00000463781,NS,carcinoma,0,1	MUC4_ENST00000463781	0	1	1	Substitution - Missense(1)	kidney(1)	c.C3349G												14.0	8.0	9.0					3																	195515102		671	1542	2213	SO:0001583	missense	4585	exon2			TGGTGTGACCTGT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3349C>G	3.37:g.195515102G>C	ENSP00000417498:p.His1117Asp		114	0.0175438596	2		84	0.07	6	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	0.907	-0.720205	0.03182	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.32753	1.44;1.44	0.814	-1.63	0.08345	.	.	.	.	.	T	0.14270	0.0345	N	0.19112	0.55	0.09310	N	1	B	0.14805	0.011	B	0.21546	0.035	T	0.28170	-1.0052	8	.	.	.	.	0.2358	0.00186	0.3536:0.2031:0.2397:0.2036	.	1117	E7ESK3	.	D	1117	ENSP00000417498:H1117D;ENSP00000420243:H1117D	.	H	-	1	0	MUC4	196999497	0.000000	0.05858	0.000000	0.03702	0.130000	0.20726	-2.660000	0.00851	-2.057000	0.00897	0.064000	0.15345	CAC			0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
GUF1	60558	mdanderson.org	37	4	44691417	44691417	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr4:44691417C>T	ENST00000281543.5	+	10	1387	c.1193C>T	c.(1192-1194)gCt>gTt	p.A398V	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						GCTCTGGGTGCTGGCTGGAGG	0.363																																					p.A398V													.	.			0			c.C1193T												128.0	132.0	130.0					4																	44691417		2203	4300	6503	SO:0001583	missense	60558	exon10			TGGGTGCTGGCTG		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1193C>T	4.37:g.44691417C>T	ENSP00000281543:p.Ala398Val		81	0	0		47	0.06	3	NM_021927	41	0.00	0		Missense_Mutation	SNP	ENST00000281543.5	37	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	C	29.2	4.985515	0.93044	.	.	ENSG00000151806	ENST00000281543	T	0.69561	-0.41	5.63	5.63	0.86233	Elongation factor G/III/V (1);	0.000000	0.85682	D	0.000000	T	0.63757	0.2538	L	0.34521	1.04	0.80722	D	1	P	0.50156	0.932	P	0.45310	0.476	T	0.68659	-0.5350	10	0.87932	D	0	-20.0827	18.6549	0.91448	0.0:1.0:0.0:0.0	.	398	Q8N442	GUF1_HUMAN	V	398	ENSP00000281543:A398V	ENSP00000281543:A398V	A	+	2	0	GUF1	44386174	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.476000	0.81055	2.632000	0.89209	0.650000	0.86243	GCT			0.363	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250469.3		NM_021927	
RP11-25H12.1	0	broad.mit.edu	37	4	66960408	66960411	+	lincRNA	DEL	AAAT	AAAT	-	rs142153899	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	AAAT	AAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr4:66960408_66960411delAAAT	ENST00000508572.1	+	0	463																											TTCTGGtaaaaaataaataaataa	0.353														2196	0.438498	0.3623	0.4323	5008	,	,		11076	0.6935		0.3728	False		,,,				2504	0.3507				.													.	.			0			.																																											0	.			GGTAAAAAATAAA																													4.37:g.66960416_66960419delAAAT			4	0	0		6	0.33	2	.	30	0.00	0		RNA	DEL	ENST00000508572.1	37																																																																																						0.353	RP11-25H12.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000361859.1			
ALB	213	mdanderson.org	37	4	74272367	74272367	+	Silent	SNP	G	G	A			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr4:74272367G>A	ENST00000295897.4	+	3	248	c.159G>A	c.(157-159)caG>caA	p.Q53Q	ALB_ENST00000415165.2_Intron|ALB_ENST00000503124.1_5'UTR|ALB_ENST00000509063.1_Silent_p.Q53Q|ALB_ENST00000401494.3_Intron	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCTTTGCTCAGTATCTTCAGC	0.338																																					p.Q53Q													.	.			0			c.G159A												146.0	137.0	140.0					4																	74272367		2203	4300	6503	SO:0001819	synonymous_variant	213	exon3			TGCTCAGTATCTT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.159G>A	4.37:g.74272367G>A			56	0	0		52	0.06	3	NM_000477	0		0	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000295897.4	37	CCDS3555.1																																																																																					0.338	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252173.3		NM_000477	
DSPP	1834	broad.mit.edu	37	4	88536863	88536863	+	Missense_Mutation	SNP	A	A	G	rs202097694		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr4:88536863A>G	ENST00000282478.7	+	4	3082	c.3049A>G	c.(3049-3051)Aat>Gat	p.N1017D	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.N1017D			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1017	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		tgatagcagtaatagtagtga	0.512																																					p.N1017D													.	DSPP	174		0			c.A3049G												65.0	75.0	71.0					4																	88536863		1633	2903	4536	SO:0001583	missense	1834	exon5			AGCAGTAATAGTA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3049A>G	4.37:g.88536863A>G	ENSP00000282478:p.Asn1017Asp		71	0.014084507	1		56	0.07	4	NM_014208	0		0	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	37	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	a	2.031	-0.422392	0.04734	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88046	-2.33;-2.33	0.486	-0.972	0.10300	.	.	.	.	.	T	0.67524	0.2902	N	0.11427	0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50355	-0.8838	8	0.13470	T	0.59	.	.	.	.	.	1017	Q9NZW4	DSPP_HUMAN	D	1017	ENSP00000382213:N1017D;ENSP00000282478:N1017D	ENSP00000282478:N1017D	N	+	1	0	DSPP	88755887	0.000000	0.05858	0.065000	0.19835	0.046000	0.14306	-0.511000	0.06321	-1.082000	0.03101	-0.891000	0.02926	AAT			0.512	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000363616.3		NM_014208	
FLJ33360	401172	broad.mit.edu	37	5	6337066	6337067	+	lincRNA	DEL	AC	AC	-	rs371668571		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr5:6337066_6337067delAC	ENST00000507444.1	-	0	143					NR_028351.1																						acacatacatacacacacacac	0.475																																					.													.	.			0			.																																											0	.			ATACATACACACA																													5.37:g.6337076_6337077delAC			8	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000507444.1	37																																																																																						0.475	CTD-2324F15.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000365707.1			
SLC22A4	6583	mdanderson.org	37	5	131630459	131630459	+	Silent	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr5:131630459T>C	ENST00000200652.3	+	1	324	c.150T>C	c.(148-150)tgT>tgC	p.C50C	P4HA2_ENST00000471826.1_Intron	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	50					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	AGCACCGCTGTCGAGTGCCGG	0.672																																					p.C50C													.	.			0			c.T150C												38.0	44.0	42.0					5																	131630459		2202	4300	6502	SO:0001819	synonymous_variant	6583	exon1			CCGCTGTCGAGTG	AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.150T>C	5.37:g.131630459T>C			55	0	0		54	0.06	3	NM_003059	2	0.00	0	O14546	Silent	SNP	ENST00000200652.3	37	CCDS4153.1																																																																																					0.672	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132661.1		NM_003059	
FOXF2	2295	broad.mit.edu	37	6	1391085	1391086	+	In_Frame_Ins	INS	-	-	GGC	rs58230522|rs147426137|rs147183226|rs111257067|rs397731476	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr6:1391085_1391086insGGC	ENST00000259806.1	+	1	1017_1018	c.903_904insGGC	c.(904-906)ggc>GGCggc	p.302_302G>GG		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	302	Poly-Gly.				embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		gtgcggccgggggcggcggcgg	0.748														1967	0.392772	0.3812	0.3429	5008	,	,		10454	0.497		0.3072	False		,,,				2504	0.4243				p.G301delinsGG													.	FOXF2	28		0			c.903_904insGGC									240,298		113,14,142						-6.4	0.1		dbSNP_126	1	607,1133		267,73,530	no	coding	FOXF2	NM_001452.1		380,87,672	A1A1,A1R,RR		34.8851,44.6097,37.1817				847,1431				SO:0001652	inframe_insertion	2295	exon1			GGCCGGGGGCGGC	U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.916_918dupGGC	6.37:g.1391092_1391094dupGGC	ENSP00000259806:p.Gly306dup		6	0	0		7	0.43	3	NM_001452	0		0	Q5TGJ1|Q9UQ85	In_Frame_Ins	INS	ENST00000259806.1	37	CCDS4472.1																																																																																					0.748	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043558.1			
FOXC1	2296	mdanderson.org	37	6	1610801	1610801	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr6:1610801C>T	ENST00000380874.2	+	1	121	c.121C>T	c.(121-123)Ccg>Tcg	p.P41S		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	41					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		CACCGCCATGCCGGCCCCCAT	0.756																																					p.P41S	Pancreas(133;719 1821 3197 26645 35015)												.	.			0			c.C121T												5.0	6.0	5.0					6																	1610801		2067	4053	6120	SO:0001583	missense	2296	exon1			GCCATGCCGGCCC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.121C>T	6.37:g.1610801C>T	ENSP00000370256:p.Pro41Ser		65	0	0		45	0.07	3	NM_001453	0		0	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Missense_Mutation	SNP	ENST00000380874.2	37	CCDS4473.1	.	.	.	.	.	.	.	.	.	.	c	14.83	2.652137	0.47362	.	.	ENSG00000054598	ENST00000541209;ENST00000380874	D	0.92699	-3.09	3.33	3.33	0.38152	.	0.078507	0.51477	U	0.000087	D	0.83147	0.5191	M	0.62723	1.935	0.54753	D	0.999986	B	0.24368	0.102	B	0.20577	0.03	T	0.80473	-0.1367	10	0.20519	T	0.43	.	10.9545	0.47349	0.0:0.809:0.191:0.0	.	41	Q12948	FOXC1_HUMAN	S	41	ENSP00000370256:P41S	ENSP00000370256:P41S	P	+	1	0	FOXC1	1555800	0.962000	0.33011	1.000000	0.80357	0.992000	0.81027	0.222000	0.17699	1.842000	0.53543	0.457000	0.33378	CCG			0.756	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043450.1			
HIST1H2BJ	8970	broad.mit.edu	37	6	27100492	27100492	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr6:27100492T>C	ENST00000607124.1	-	1	37	c.38A>G	c.(37-39)aAg>aGg	p.K13R	HIST1H2BJ_ENST00000339812.2_Missense_Mutation_p.K13R|HIST1H2AG_ENST00000359193.2_5'Flank|HIST1H2BJ_ENST00000541790.1_Missense_Mutation_p.K13R			P06899	H2B1J_HUMAN	histone cluster 1, H2bj	13					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(2)|lung(5)|ovary(1)|prostate(1)	10						CTTGGAGCCCTTTTTCGGGGC	0.537																																					p.K13R													HIST1H2BJ,NS,carcinoma,+1,1	HIST1H2BJ	21	1	0			c.A38G												82.0	84.0	83.0					6																	27100492		2203	4300	6503	SO:0001583	missense	8970	exon1			GAGCCCTTTTTCG	X00088	CCDS4618.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000124635	ENSG00000124635		"""Histones / Replication-dependent"""	4761	protein-coding gene	gene with protein product		615044	"""H2B histone family, member R"", ""histone 1, H2bj"""	H2BFR		6647026, 12408966	Standard	NM_021058		Approved	H2B/r	uc003niv.3	P06899	OTTHUMG00000014470	ENST00000607124.1:c.38A>G	6.37:g.27100492T>C	ENSP00000476136:p.Lys13Arg		112	0	0		110	0.04	4	NM_021058	54	0.00	0	B2R4J4|O60816	Missense_Mutation	SNP	ENST00000607124.1	37	CCDS4618.1	.	.	.	.	.	.	.	.	.	.	T	17.02	3.282737	0.59867	.	.	ENSG00000124635	ENST00000541790;ENST00000339812	T;T	0.25250	1.81;1.81	4.27	4.27	0.50696	Histone-fold (2);	.	.	.	.	T	0.18173	0.0436	M	0.82716	2.605	0.44447	D	0.997372	B	0.33694	0.421	B	0.24974	0.057	T	0.10474	-1.0628	9	0.59425	D	0.04	.	11.9985	0.53216	0.0:0.0:0.0:1.0	.	13	P06899	H2B1J_HUMAN	R	13	ENSP00000445633:K13R;ENSP00000342886:K13R	ENSP00000342886:K13R	K	-	2	0	HIST1H2BJ	27208471	1.000000	0.71417	1.000000	0.80357	0.580000	0.36256	7.212000	0.77941	1.883000	0.54544	0.533000	0.62120	AAG			0.537	HIST1H2BJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040138.2		NM_021058	
ITPR3	3710	mdanderson.org	37	6	33655070	33655070	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr6:33655070A>G	ENST00000374316.5	+	46	7203	c.6143A>G	c.(6142-6144)gAa>gGa	p.E2048G	ITPR3_ENST00000605930.1_Missense_Mutation_p.E2048G			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2048					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	AGCCCACGTGAAGTGGGCCAT	0.607																																					p.E2048G													.	.			0			c.A6143G												65.0	55.0	58.0					6																	33655070		2203	4300	6503	SO:0001583	missense	3710	exon45			CACGTGAAGTGGG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6143A>G	6.37:g.33655070A>G	ENSP00000363435:p.Glu2048Gly		56	0	0		39	0.08	3	NM_002224	48	0.00	0	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	37	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.183059	0.78677	.	.	ENSG00000096433	ENST00000374316	D	0.93019	-3.15	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.95878	0.8658	M	0.79805	2.47	0.80722	D	1	P;D	0.76494	0.695;0.999	B;D	0.75484	0.206;0.986	D	0.96322	0.9237	10	0.62326	D	0.03	-14.2905	14.4245	0.67204	1.0:0.0:0.0:0.0	.	2048;1718	Q14573;Q59ES2	ITPR3_HUMAN;.	G	2048	ENSP00000363435:E2048G	ENSP00000363435:E2048G	E	+	2	0	ITPR3	33763048	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	9.204000	0.95041	1.868000	0.54150	0.459000	0.35465	GAA			0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040204.2		NM_002224	
FNDC1	84624	mdanderson.org	37	6	159654735	159654735	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr6:159654735T>C	ENST00000297267.9	+	11	3391	c.3191T>C	c.(3190-3192)cTc>cCc	p.L1064P	FNDC1_ENST00000340366.6_Missense_Mutation_p.L1001P	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1064					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		AGAGGGATGCTCCCCACGGCC	0.721																																					p.L1064P													.	.			0			c.T3191C												10.0	13.0	12.0					6																	159654735		1849	3840	5689	SO:0001583	missense	84624	exon11			GGATGCTCCCCAC	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.3191T>C	6.37:g.159654735T>C	ENSP00000297267:p.Leu1064Pro		30	0	0		26	0.08	2	NM_032532	5	0.00	0	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	ENST00000297267.9	37	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.702094	0.30232	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.08807	3.05;3.84	4.22	-1.7	0.08159	.	1.355720	0.05041	N	0.476297	T	0.01454	0.0047	N	0.24115	0.695	0.23669	N	0.997156	B;B	0.14012	0.009;0.005	B;B	0.12156	0.007;0.003	T	0.47686	-0.9098	10	0.54805	T	0.06	-1.8128	0.4077	0.00436	0.1811:0.218:0.1866:0.4144	.	1001;1064	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	P	1064;1001	ENSP00000297267:L1064P;ENSP00000342460:L1001P	ENSP00000297267:L1064P	L	+	2	0	FNDC1	159574725	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.103000	0.15292	-0.193000	0.10415	0.459000	0.35465	CTC			0.721	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042897.3		NM_032532	
SDK1	221935	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	4056919	4056919	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:4056919C>T	ENST00000404826.2	+	17	2676	c.2537C>T	c.(2536-2538)gCg>gTg	p.A846V	SDK1_ENST00000389531.3_Missense_Mutation_p.A846V	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	846	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		ATACAGGTGGCGGCGTACAAC	0.592																																					p.A846V													SDK1,lower_third,carcinoma,0,1	SDK1	0	1	0			c.C2537T												80.0	69.0	73.0					7																	4056919		2203	4300	6503	SO:0001583	missense	221935	exon17			AGGTGGCGGCGTA	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2537C>T	7.37:g.4056919C>T	ENSP00000385899:p.Ala846Val		171	0	0		115	0.04	5	NM_152744	6	0.00	0	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	37	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	C	35	5.464478	0.96257	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.57752	0.38;0.38	6.07	6.07	0.98685	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.74382	0.3709	M	0.70787	2.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.74526	-0.3636	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	846;846	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	V	846	ENSP00000385899:A846V;ENSP00000374182:A846V	ENSP00000374182:A846V	A	+	2	0	SDK1	4023445	1.000000	0.71417	0.972000	0.41901	0.779000	0.44077	7.726000	0.84824	2.884000	0.98904	0.655000	0.94253	GCG			0.592	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323702.1		NM_152744	
TWIST1	7291	mdanderson.org	37	7	19156499	19156499	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:19156499A>G	ENST00000242261.5	-	1	796	c.446T>C	c.(445-447)cTc>cCc	p.L149P	AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	149	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						CGCCAGCTTGAGGGTCTGAAT	0.637																																					p.L149P													.	.			0			c.T446C												125.0	98.0	107.0					7																	19156499		2203	4300	6503	SO:0001583	missense	7291	exon1			AGCTTGAGGGTCT	U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.446T>C	7.37:g.19156499A>G	ENSP00000242261:p.Leu149Pro		81	0	0		41	0.07	3	NM_000474	125	0.00	0	A4D128|Q92487|Q99804	Missense_Mutation	SNP	ENST00000242261.5	37	CCDS5367.1	.	.	.	.	.	.	.	.	.	.	a	17.23	3.336479	0.60963	.	.	ENSG00000122691	ENST00000242261	D	0.99828	-6.99	4.77	3.59	0.41128	Helix-loop-helix DNA-binding (5);	0.000000	0.43579	D	0.000549	D	0.99871	0.9939	H	0.97564	4.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97357	0.9967	10	0.87932	D	0	-6.5882	10.3203	0.43762	0.852:0.0:0.0:0.148	.	149	Q15672	TWST1_HUMAN	P	149	ENSP00000242261:L149P	ENSP00000242261:L149P	L	-	2	0	TWIST1	19123024	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.180000	0.94867	0.641000	0.30601	0.374000	0.22700	CTC			0.637	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207625.1		NM_000474	
FZD1	8321	mdanderson.org	37	7	90894958	90894958	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:90894958G>T	ENST00000287934.2	+	1	1176	c.763G>T	c.(763-765)Ggc>Tgc	p.G255C		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	255					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			TCAGCACGGCGGCGGAGGGCA	0.721																																					p.G255C													.	.			0			c.G763T												6.0	7.0	7.0					7																	90894958		2101	4157	6258	SO:0001583	missense	8321	exon1			CACGGCGGCGGAG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.763G>T	7.37:g.90894958G>T	ENSP00000287934:p.Gly255Cys		21	0	0		32	0.09	3	NM_003505	8	0.00	0	A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	ENST00000287934.2	37	CCDS5620.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302163	0.40694	.	.	ENSG00000157240	ENST00000287934	T	0.78003	-1.14	4.73	3.82	0.43975	.	0.445042	0.16863	N	0.196422	T	0.71264	0.3319	L	0.31926	0.97	0.42139	D	0.991506	P	0.49635	0.926	P	0.46253	0.509	T	0.74287	-0.3714	10	0.62326	D	0.03	.	11.301	0.49306	0.088:0.0:0.912:0.0	.	255	Q9UP38	FZD1_HUMAN	C	255	ENSP00000287934:G255C	ENSP00000287934:G255C	G	+	1	0	FZD1	90732894	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.512000	0.35812	2.453000	0.82957	0.511000	0.50034	GGC			0.721	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000059367.2		NM_003505	
THAP5	168451	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	108204781	108204781	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:108204781G>T	ENST00000415914.3	-	3	1195	c.1042C>A	c.(1042-1044)Cta>Ata	p.L348I	THAP5_ENST00000493722.1_5'Flank|THAP5_ENST00000313516.5_Missense_Mutation_p.L306I	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	348					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						TTTAACTCTAGAAGAGTTATC	0.358																																					p.L348I													.	THAP5	51		0			c.C1042A												88.0	88.0	88.0					7																	108204781		2202	4298	6500	SO:0001583	missense	168451	exon3			ACTCTAGAAGAGT	AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.1042C>A	7.37:g.108204781G>T	ENSP00000400500:p.Leu348Ile		160	0.00625	1		102	0.11	11	NM_001130475	27	0.19	5		Missense_Mutation	SNP	ENST00000415914.3	37	CCDS47687.1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.737282	0.69304	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.99194	-5.54;-3.98	4.63	4.63	0.57726	.	0.000000	0.29791	U	0.011199	D	0.98495	0.9498	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.98713	1.0705	9	.	.	.	.	16.8395	0.85964	0.0:0.0:1.0:0.0	.	348	Q7Z6K1	THAP5_HUMAN	I	348;306	ENSP00000400500:L348I;ENSP00000322440:L306I	.	L	-	1	2	THAP5	107992017	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.270000	0.58896	2.292000	0.77174	0.650000	0.86243	CTA			0.358	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337777.2		NM_182529	
TMEM229A	730130	broad.mit.edu	37	7	123674631	123674632	+	5'Flank	INS	-	-	T	rs71163720	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:123674631_123674632insT	ENST00000455783.1	-	0	0				RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A							host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						TTTCTGGGGAATTTTTTTTTTT	0.455																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGGGAATTTTTT	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762		7.37:g.123674642_123674642dupT	Exception_encountered		4	0	0		5	0.20	1	.	0		0	A4D0X6	RNA	INS	ENST00000455783.1	37	CCDS47694.1																																																																																					0.455	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336960.3		NM_001136002	
RP11-274B21.1	0	broad.mit.edu	37	7	128217774	128217800	+	RNA	DEL	GGGGGAGAGGGAGAGGGAGAGGGAGAA	GGGGGAGAGGGAGAGGGAGAGGGAGAA	-	rs538369148|rs532120184	byFrequency	TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	GGGGGAGAGGGAGAGGGAGAGGGAGAA	GGGGGAGAGGGAGAGGGAGAGGGAGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr7:128217774_128217800delGGGGGAGAGGGAGAGGGAGAGGGAGAA	ENST00000605862.1	+	0	261																											agagggagaggggggagagggagagggagagggagaagggggagagg	0.568																																					.													.	.			0			.																																											0	.			GGAGAGGGGGGAG																													7.37:g.128217774_128217800delGGGGGAGAGGGAGAGGGAGAGGGAGAA			4	0	0		6	0.83	5	.	0		0		RNA	DEL	ENST00000605862.1	37																																																																																						0.568	RP11-274B21.1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000468355.1			
BHLHE22	27319	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	65494286	65494286	+	Silent	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr8:65494286C>T	ENST00000321870.1	+	1	1473	c.939C>T	c.(937-939)ggC>ggT	p.G313G	RP11-21C4.1_ENST00000517909.1_RNA	NM_152414.4	NP_689627.1	Q8NFJ8	BHE22_HUMAN	basic helix-loop-helix family, member e22	313					anterior commissure morphogenesis (GO:0021960)|cerebral cortex regionalization (GO:0021796)|corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|retinal bipolar neuron differentiation (GO:0060040)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	5						TCAACCAGGGCCAGGCCATCT	0.697																																					p.G313G	Colon(113;104 1586 2865 9855 18065)												.	BHLHE22	21		0			c.C939T												11.0	10.0	10.0					8																	65494286		2192	4287	6479	SO:0001819	synonymous_variant	27319	exon1			CCAGGGCCAGGCC	U80755	CCDS6179.1	8q12.1	2009-01-12	2009-01-12	2009-01-12		ENSG00000180828		"""Basic helix-loop-helix proteins"""	11963	protein-coding gene	gene with protein product		613483	"""trinucleotide repeat containing 20"", ""basic helix-loop-helix domain containing, class B, 5"""	TNRC20, BHLHB5		9225980, 12213201, 18557763	Standard	NM_152414		Approved	CAGL85, Beta3, bHLHe22	uc003xvi.3	Q8NFJ8		ENST00000321870.1:c.939C>T	8.37:g.65494286C>T			27	0	0		26	0.15	4	NM_152414	1	0.00	0		Silent	SNP	ENST00000321870.1	37	CCDS6179.1																																																																																					0.697	BHLHE22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378549.1		NM_152414	
RDH10	157506	broad.mit.edu;mdanderson.org	37	8	74207595	74207595	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr8:74207595G>A	ENST00000240285.5	+	1	749	c.71G>A	c.(70-72)cGc>cAc	p.R24H	RDH10_ENST00000519380.1_5'Flank|RPL7_ENST00000396467.1_5'Flank|RPL7_ENST00000396466.1_Intron|RPL7_ENST00000352983.2_5'Flank|RP11-434I12.2_ENST00000520894.1_RNA|RPL7_ENST00000396465.1_5'Flank	NM_172037.4	NP_742034.1	Q8IZV5	RDH10_HUMAN	retinol dehydrogenase 10 (all-trans)	24					bud elongation involved in lung branching (GO:0060449)|ear development (GO:0043583)|embryonic camera-type eye development (GO:0031076)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|gonad development (GO:0008406)|in utero embryonic development (GO:0001701)|metanephros development (GO:0001656)|neural crest cell development (GO:0014032)|nose development (GO:0043584)|phototransduction, visible light (GO:0007603)|primary lung bud formation (GO:0060431)|retinal metabolic process (GO:0042574)|retinoic acid biosynthetic process (GO:0002138)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|visual perception (GO:0007601)	cell body (GO:0044297)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	NADP-retinol dehydrogenase activity (GO:0052650)|retinol dehydrogenase activity (GO:0004745)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	11	Breast(64;0.0954)		Epithelial(68;0.0105)|all cancers(69;0.0465)|BRCA - Breast invasive adenocarcinoma(89;0.0608)			GCCGCGGCGCGCTGGCTGGTG	0.706																																					p.R24H													.	RDH10	31		0			c.G71A												8.0	11.0	10.0					8																	74207595		2139	4222	6361	SO:0001583	missense	157506	exon1			CGGCGCGCTGGCT	AF456765	CCDS6213.1	8q21.11	2011-09-20			ENSG00000121039	ENSG00000121039	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	19975	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 16C, member 4"""	607599				12407145, 19027726	Standard	NM_172037		Approved	SDR16C4	uc003xzi.3	Q8IZV5	OTTHUMG00000164492	ENST00000240285.5:c.71G>A	8.37:g.74207595G>A	ENSP00000240285:p.Arg24His		27	0	0		34	0.09	3	NM_172037	10	0.00	0		Missense_Mutation	SNP	ENST00000240285.5	37	CCDS6213.1	.	.	.	.	.	.	.	.	.	.	G	8.639	0.895596	0.17686	.	.	ENSG00000121039	ENST00000240285	D	0.84944	-1.92	3.61	1.56	0.23342	.	0.124359	0.50627	D	0.000104	T	0.61375	0.2342	N	0.08118	0	0.80722	D	1	P	0.43024	0.798	B	0.35182	0.197	T	0.56068	-0.8040	10	0.16420	T	0.52	.	6.1553	0.20334	0.4261:0.0:0.5739:0.0	.	24	Q8IZV5	RDH10_HUMAN	H	24	ENSP00000240285:R24H	ENSP00000240285:R24H	R	+	2	0	RDH10	74370149	1.000000	0.71417	0.988000	0.46212	0.344000	0.29017	2.231000	0.43009	0.718000	0.32166	0.462000	0.41574	CGC			0.706	RDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378982.1			
COL14A1	7373	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	8	121210074	121210074	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr8:121210074C>T	ENST00000297848.3	+	7	887	c.617C>T	c.(616-618)cCc>cTc	p.P206L	COL14A1_ENST00000247781.3_Intron|COL14A1_ENST00000537875.1_Missense_Mutation_p.P206L|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000309791.4_Missense_Mutation_p.P206L	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			AGTGGTGACCCCAGAATAGAA	0.408																																					p.P206L													.	.			0			c.C617T												120.0	123.0	122.0					8																	121210074		2203	4300	6503	SO:0001583	missense	7373	exon7			GTGACCCCAGAAT		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.617C>T	8.37:g.121210074C>T	ENSP00000297848:p.Pro206Leu		108	0	0		104	0.16	17	NM_021110	11	0.00	0		Missense_Mutation	SNP	ENST00000297848.3	37	CCDS34938.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.613092	0.87258	.	.	ENSG00000187955	ENST00000537875;ENST00000309791;ENST00000297848;ENST00000434620	T;T;T;D	0.83755	-1.26;-1.26;-1.26;-1.76	5.36	4.48	0.54585	von Willebrand factor, type A (3);	0.052860	0.85682	N	0.000000	D	0.85579	0.5729	M	0.90082	3.085	0.80722	D	1	B	0.29162	0.235	B	0.26693	0.072	D	0.86216	0.1628	10	0.87932	D	0	.	13.9083	0.63850	0.0:0.9275:0.0:0.0725	.	206	Q05707	COEA1_HUMAN	L	206;206;206;19	ENSP00000443974:P206L;ENSP00000311809:P206L;ENSP00000297848:P206L;ENSP00000409461:P19L	ENSP00000297848:P206L	P	+	2	0	COL14A1	121279255	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.462000	0.80851	1.499000	0.48617	0.591000	0.81541	CCC			0.408	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313657.2		NM_021110	
GRINA	2907	broad.mit.edu	37	8	145065539	145065539	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr8:145065539T>C	ENST00000313269.5	+	2	426	c.148T>C	c.(148-150)Tcc>Ccc	p.S50P	GRINA_ENST00000395068.4_Missense_Mutation_p.S50P	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	50	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTTCCAGCCCTCCCCCTACGG	0.716																																					p.S50P													.	GRINA	25		0			c.T148C												12.0	14.0	14.0					8																	145065539		2159	4236	6395	SO:0001583	missense	2907	exon2			CAGCCCTCCCCCT	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.148T>C	8.37:g.145065539T>C	ENSP00000314380:p.Ser50Pro		140	0	0		148	0.03	5	NM_001009184	263	0.00	1	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	ENST00000313269.5	37	CCDS34961.1	.	.	.	.	.	.	.	.	.	.	T	4.847	0.157542	0.09236	.	.	ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000530898;ENST00000537637	T;T;T	0.23147	1.92;1.93;1.92	5.14	-2.0	0.07433	.	1.207690	0.05814	N	0.614483	T	0.12774	0.0310	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33033	-0.9884	10	0.23891	T	0.37	-13.2678	9.4642	0.38802	0.1058:0.0:0.5235:0.3707	.	50	Q7Z429	GRINA_HUMAN	P	50;50;50;50;31	ENSP00000314380:S50P;ENSP00000432706:S50P;ENSP00000378507:S50P	ENSP00000314380:S50P	S	+	1	0	GRINA	145137527	0.000000	0.05858	0.053000	0.19242	0.003000	0.03518	-0.497000	0.06428	-0.290000	0.09025	-0.346000	0.07831	TCC			0.716	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384048.1		NM_001009184	
RUSC2	9853	mdanderson.org	37	9	35548533	35548533	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr9:35548533G>T	ENST00000455600.1	+	2	2583		c.e2+1			NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2							cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AGAGCTGACGGTAAGGAGCCT	0.597																																					.													.	.			0			c.2014+1G>T												46.0	52.0	50.0					9																	35548533		2203	4299	6502	SO:0001630	splice_region_variant	9853	exon2			CTGACGGTAAGGA	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.2014+1G>T	9.37:g.35548533G>T			25	0	0		21	0.10	2	NM_014806	0		0	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Splice_Site	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846823	0.71603	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1505	0.93487	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RUSC2	35538533	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	5.946000	0.70234	2.773000	0.95371	0.650000	0.86243	.			0.597	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052309.1		XM_048462	Intron
Unknown	0	bcgsc.ca	37	9	68427863	68427863	+	IGR	SNP	T	T	C	rs144877320		TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chr9:68427863T>C								MIR4477B (12475 upstream) : CR786580.2 (84482 downstream)																							TCCCAGTCATTTGCAGTATCT	0.289																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AGTCATTTGCAGT																													9.37:g.68427863T>C			272	0.0183823529	5		244	0.06	14	.	5	0.20	1		RNA	SNP		37																																																																																					0	0.289										
FAM47C	442444	broad.mit.edu	37	X	37028094	37028094	+	Silent	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:37028094A>G	ENST00000358047.3	+	1	1663	c.1611A>G	c.(1609-1611)gcA>gcG	p.A537A		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	537										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TCCACCAGGCACCTCCTGAGA	0.597																																					p.A537A													.	FAM47C	267		0			c.A1611G												85.0	85.0	85.0					X																	37028094		2202	4300	6502	SO:0001819	synonymous_variant	442444	exon1			CCAGGCACCTCCT	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1611A>G	X.37:g.37028094A>G			64	0	0		72	0.07	5	NM_001013736	1	0.00	0	Q6ZU46	Silent	SNP	ENST00000358047.3	37	CCDS35227.1																																																																																					0.597	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060508.1		NM_001013736	
PRRG1	5638	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	37312624	37312624	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:37312624A>G	ENST00000542554.1	+	5	679	c.407A>G	c.(406-408)gAt>gGt	p.D136G	PRRG1_ENST00000378628.4_Missense_Mutation_p.D136G|TM4SF2_ENST00000465127.1_Intron|PRRG1_ENST00000449135.2_Missense_Mutation_p.D136G|PRRG1_ENST00000543642.1_Missense_Mutation_p.D136G|PRRG1_ENST00000491253.1_3'UTR	NM_001173489.1	NP_001166960.1	O14668	TMG1_HUMAN	proline rich Gla (G-carboxyglutamic acid) 1	136						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	15						CCCCCACCAGATGAAGTGTTT	0.502																																					p.D136G													.	PRRG1	42		0			c.A407G												110.0	108.0	109.0					X																	37312624		2202	4300	6502	SO:0001583	missense	5638	exon4			CACCAGATGAAGT	AF009242	CCDS14239.1, CCDS55397.1	Xp21.1	2010-08-13	2004-05-27		ENSG00000130962	ENSG00000130962			9469	protein-coding gene	gene with protein product		604428	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 1"""			9256434	Standard	NM_000950		Approved	PRGP1	uc004ddo.3	O14668	OTTHUMG00000021360	ENST00000542554.1:c.407A>G	X.37:g.37312624A>G	ENSP00000444278:p.Asp136Gly		164	0.0182926829	3		120	0.25	30	NM_001173490	5	0.20	1	B2R7A3|C9JXL7|D3DWA9|Q5JT66	Missense_Mutation	SNP	ENST00000542554.1	37	CCDS14239.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.882635	0.51908	.	.	ENSG00000130962	ENST00000378628;ENST00000466533;ENST00000542554;ENST00000543642;ENST00000449135	D;D;D;D;D	0.98876	-5.15;-5.2;-5.15;-5.15;-5.15	6.16	6.16	0.99307	.	0.201597	0.51477	D	0.000084	D	0.94348	0.8183	N	0.08118	0	0.36073	D	0.84226	P	0.37781	0.608	B	0.35413	0.202	D	0.96101	0.9069	10	0.15499	T	0.54	-21.5782	14.4064	0.67086	1.0:0.0:0.0:0.0	.	136	O14668	TMG1_HUMAN	G	136	ENSP00000367894:D136G;ENSP00000418384:D136G;ENSP00000444278:D136G;ENSP00000443271:D136G;ENSP00000390332:D136G	ENSP00000367894:D136G	D	+	2	0	PRRG1	37197545	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	5.791000	0.69045	2.085000	0.62840	0.481000	0.45027	GAT			0.502	PRRG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056228.2		NM_000950	
CASK	8573	broad.mit.edu	37	X	41390360	41390360	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:41390360T>C	ENST00000378163.1	-	25	2894	c.2420A>G	c.(2419-2421)gAg>gGg	p.E807G	CASK_ENST00000318588.9_Missense_Mutation_p.E802G|CASK_ENST00000442742.2_Missense_Mutation_p.E779G|CASK_ENST00000361962.4_Missense_Mutation_p.E790G|CASK_ENST00000378166.4_Missense_Mutation_p.E802G|CASK_ENST00000378158.1_Missense_Mutation_p.E790G|CASK_ENST00000421587.2_Missense_Mutation_p.E778G			O14936	CSKP_HUMAN	calcium/calmodulin-dependent serine protein kinase (MAGUK family)	807	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				calcium ion import (GO:0070509)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of wound healing (GO:0061045)|nucleotide phosphorylation (GO:0046939)|positive regulation of calcium ion import (GO:0090280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	actin cytoskeleton (GO:0015629)|basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nuclear lamina (GO:0005652)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(5)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|ovary(3)|prostate(1)|stomach(1)	32						GCTGCCGTACTCCAAGTACTC	0.463																																					p.E802G	NSCLC(42;104 1086 3090 27189 35040)												.	CASK	93		0			c.A2405G												201.0	138.0	160.0					X																	41390360		2203	4300	6503	SO:0001583	missense	8573	exon25			CCGTACTCCAAGT	AF035582	CCDS14257.1, CCDS48094.1, CCDS48095.1	Xp11.4	2010-02-09			ENSG00000147044	ENSG00000147044			1497	protein-coding gene	gene with protein product		300172	"""trinucleotide repeat containing 8"""	TNRC8		9722958	Standard	NM_003688		Approved	LIN2, CAGH39, FGS4	uc004dfl.4	O14936	OTTHUMG00000021378	ENST00000378163.1:c.2420A>G	X.37:g.41390360T>C	ENSP00000367405:p.Glu807Gly		73	0	0		81	0.04	3	NM_003688	66	0.00	0	A6NES1|B7ZKY0|O43215|Q17RI4|Q59HA0|Q5VT16|Q5VT17|Q5VT18|Q5VT19|Q66T42|Q9BYH6|Q9NYB2|Q9NYB3	Missense_Mutation	SNP	ENST00000378163.1	37		.	.	.	.	.	.	.	.	.	.	T	24.8	4.573244	0.86542	.	.	ENSG00000147044	ENST00000421587;ENST00000318588;ENST00000361962;ENST00000378163;ENST00000378179;ENST00000378168;ENST00000378158;ENST00000378166;ENST00000442742	T;T;T;T;T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-0.61	4.85	4.85	0.62838	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.49916	D	0.000122	D	0.88991	0.6588	H	0.96805	3.885	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.897;1.0;1.0;1.0	D;P;D;D;D	0.97110	0.999;0.819;1.0;0.999;0.998	D	0.92404	0.5932	10	0.87932	D	0	.	13.8475	0.63477	0.0:0.0:0.0:1.0	.	778;779;802;807;399	O14936-3;O14936-4;O14936-2;O14936;Q5JS72	.;.;.;CSKP_HUMAN;.	G	778;802;790;807;399;262;790;802;779	ENSP00000400526:E778G;ENSP00000322727:E802G;ENSP00000354641:E790G;ENSP00000367405:E807G;ENSP00000367421:E399G;ENSP00000367410:E262G;ENSP00000367400:E790G;ENSP00000367408:E802G;ENSP00000398007:E779G	ENSP00000322727:E802G	E	-	2	0	CASK	41275304	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.698000	0.84413	1.714000	0.51371	0.417000	0.27973	GAG			0.463	CASK-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000056285.1		NM_003688	
SLC7A3	84889	hgsc.bcm.edu	37	X	70149798	70149798	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:70149798C>T	ENST00000374299.3	-	2	194	c.50G>A	c.(49-51)cGt>cAt	p.R17H	SLC7A3_ENST00000298085.4_Missense_Mutation_p.R17H			Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 3	17					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)|L-lysine transmembrane transporter activity (GO:0015189)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|urinary_tract(1)	31	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CTCCAGTGTACGTCTGCGTAC	0.532																																					p.R17H													.	.			0			c.G50A												77.0	65.0	69.0					X																	70149798		2203	4300	6503	SO:0001583	missense	84889	exon2			AGTGTACGTCTGC	AF320612	CCDS14404.1	Xq12	2013-05-22			ENSG00000165349	ENSG00000165349		"""Solute carriers"""	11061	protein-coding gene	gene with protein product		300443				11591158	Standard	NM_001048164		Approved	CAT-3, ATRC3, FLJ14541	uc004dyn.3	Q8WY07	OTTHUMG00000021780	ENST00000374299.3:c.50G>A	X.37:g.70149798C>T	ENSP00000363417:p.Arg17His		129	0	0		98	0.04	4	NM_032803	13	0.00	0	D3DVU7|Q5JQR2|Q8N185|Q8NCA7|Q96SZ7	Missense_Mutation	SNP	ENST00000374299.3	37	CCDS14404.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.937948	0.34189	.	.	ENSG00000165349	ENST00000374299;ENST00000298085	D;D	0.89050	-2.46;-2.46	4.98	4.98	0.66077	.	0.111517	0.64402	N	0.000012	D	0.86159	0.5866	L	0.58428	1.81	0.58432	D	0.999999	B	0.30326	0.276	B	0.20955	0.032	D	0.85073	0.0941	10	0.44086	T	0.13	.	16.2112	0.82164	0.0:1.0:0.0:0.0	.	17	Q8WY07	CTR3_HUMAN	H	17	ENSP00000363417:R17H;ENSP00000298085:R17H	ENSP00000298085:R17H	R	-	2	0	SLC7A3	70066523	0.999000	0.42202	0.928000	0.36995	0.024000	0.10985	4.198000	0.58419	2.285000	0.76669	0.600000	0.82982	CGT			0.532	SLC7A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057080.1		NM_032803	
HDAC8	55869	mdanderson.org	37	X	71571681	71571681	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:71571681G>T	ENST00000373573.3	-	10	1354	c.1013C>A	c.(1012-1014)aCa>aAa	p.T338K	HDAC8_ENST00000373589.4_Missense_Mutation_p.T247K|HDAC8_ENST00000373583.1_Intron|HDAC8_ENST00000429103.2_Missense_Mutation_p.T143K	NM_018486.2	NP_060956.1	Q9BY41	HDAC8_HUMAN	histone deacetylase 8	338					chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cohesin localization to chromatin (GO:0071922)|sister chromatid cohesion (GO:0007062)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|transcription factor binding (GO:0008134)			breast(3)|cervix(1)|endometrium(1)|lung(4)|prostate(1)	10	Renal(35;0.156)				Vorinostat(DB02546)	ACCATATGCTGTGAAAAACTG	0.428																																					p.T338K													.	.			0			c.C1013A												118.0	84.0	96.0					X																	71571681		2203	4300	6503	SO:0001583	missense	55869	exon10			TATGCTGTGAAAA	AF230097	CCDS14420.1, CCDS55448.1, CCDS55449.1, CCDS55450.1, CCDS55451.1, CCDS55452.1	Xq13	2014-01-29	2002-09-02	2002-09-06	ENSG00000147099	ENSG00000147099			13315	protein-coding gene	gene with protein product		300269	"""histone deacetylase-like 1"", ""Wilson-Turner X-linked mental retardation syndrome"""	HDACL1, WTS, MRXS6		10756090, 10922473, 22889856	Standard	NM_001166448		Approved	RPD3	uc004eau.3	Q9BY41	OTTHUMG00000021814	ENST00000373573.3:c.1013C>A	X.37:g.71571681G>T	ENSP00000362674:p.Thr338Lys		49	0	0		49	0.06	3	NM_018486	10	0.00	0	A6ND12|A6ND61|A6NET3|A6NJR3|A8MQ62|B4DKN0|B4DV22|Q86VC8|Q9NP76|Q9NYH4	Missense_Mutation	SNP	ENST00000373573.3	37	CCDS14420.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.851679	0.51270	.	.	ENSG00000147099	ENST00000373573;ENST00000373589;ENST00000429103;ENST00000373568	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	4.79	4.79	0.61399	Histone deacetylase domain (1);	0.000000	0.85682	D	0.000000	D	0.90045	0.6891	L	0.61036	1.89	0.80722	D	1	P;D;B	0.67145	0.534;0.996;0.024	B;D;B	0.64144	0.04;0.922;0.004	D	0.91184	0.4978	10	0.87932	D	0	-8.1196	14.8993	0.70666	0.0:0.0:1.0:0.0	.	247;247;338	B4DKN0;A6NGJ7;Q9BY41	.;.;HDAC8_HUMAN	K	338;247;143;247	ENSP00000362674:T338K;ENSP00000362691:T247K;ENSP00000388459:T143K;ENSP00000362669:T247K	ENSP00000362669:T247K	T	-	2	0	HDAC8	71488406	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.943000	0.75934	2.321000	0.78463	0.436000	0.28706	ACA			0.428	HDAC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057193.2		NM_018486	
FRMPD3	84443	broad.mit.edu	37	X	106846478	106846480	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:106846478_106846480delCAG	ENST00000276185.4	+	16	5308_5310	c.5308_5310delCAG	c.(5308-5310)cagdel	p.Q1776del				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1776	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						gcaacaacaacagcagcagcagc	0.586																																					.													.	.			0			.									51,2272		9,27,6,1017,211						0.5	0.8			2	74,3975		18,26,12,1566,817	no	coding	FRMPD3	XM_042978.7		27,53,18,2583,1028	A1A1,A1R,A1,RR,R		1.8276,2.1954,1.9617				125,6247				SO:0001651	inframe_deletion	84443	.			CAACAACAGCAGC	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5308_5310delCAG	X.37:g.106846487_106846489delCAG	ENSP00000276185:p.Gln1776del		141	0	0		132	0.08	11	.	1	0.00	0	Q96JK8	In_Frame_Del	DEL	ENST00000276185.4	37																																																																																						0.586	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_042978	
GRIA3	2892	bcgsc.ca;mdanderson.org	37	X	122599615	122599615	+	Silent	SNP	C	C	T			TCGA-2G-AAHC-01A-11D-A42Y-10	TCGA-2G-AAHC-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	e622a5c0-a57b-4806-800d-d80da386ad04	f324e93c-3bef-4aaa-8cee-548b180cde75	g.chrX:122599615C>T	ENST00000371251.1	+	14	2467	c.2415C>T	c.(2413-2415)tgC>tgT	p.C805C	GRIA3_ENST00000264357.5_Silent_p.C805C|GRIA3_ENST00000542149.1_Silent_p.C805C|GRIA3_ENST00000371256.5_Intron|AL356213.1_ENST00000577653.1_RNA			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	805					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)	p.C805C(1)		breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	AAGGAGAGTGCGGCAGCGGGG	0.468																																					p.C805C													.	GRIA3	386		1	Substitution - coding silent(1)	endometrium(1)	c.C2415T												76.0	67.0	70.0					X																	122599615		2203	4300	6503	SO:0001819	synonymous_variant	2892	exon14			AGAGTGCGGCAGC	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.2415C>T	X.37:g.122599615C>T			121	0	0		109	0.05	5	NM_000828	0		0	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	ENST00000371251.1	37	CCDS14604.1																																																																																					0.468	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058854.1		NM_000828	
