#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	hgsc.bcm.edu	37	1	977425	977425	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:977425G>A	ENST00000379370.2	+	7	1317	c.1267G>A	c.(1267-1269)Ggg>Agg	p.G423R		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	423	Kazal-like 4. {ECO:0000255|PROSITE- ProRule:PRU00798}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)	p.G423W(1)		breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		CACCTGTGACGGGGCCTACAG	0.697																																					p.G423R													AGRN,NS,carcinoma,0,1	AGRN	0	1	1	Substitution - Missense(1)	lung(1)	c.G1267A												30.0	33.0	32.0					1																	977425		2200	4294	6494	SO:0001583	missense	375790	exon7			TGTGACGGGGCCT	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.1267G>A	1.37:g.977425G>A	ENSP00000368678:p.Gly423Arg		23	0	0		37	0.05	2	NM_198576	20	0.00	0	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	G	17.13	3.311528	0.60414	.	.	ENSG00000188157	ENST00000379370	T	0.73047	-0.71	4.89	4.89	0.63831	Proteinase inhibitor I1, Kazal (2);	0.079450	0.50627	D	0.000120	T	0.69913	0.3164	N	0.13299	0.325	0.53005	D	0.999968	D	0.89917	1.0	D	0.81914	0.995	T	0.71540	-0.4562	10	0.44086	T	0.13	-28.3632	11.2383	0.48953	0.0864:0.0:0.9136:0.0	.	423	O00468	AGRIN_HUMAN	R	423	ENSP00000368678:G423R	ENSP00000368678:G423R	G	+	1	0	AGRN	967288	1.000000	0.71417	0.847000	0.33407	0.939000	0.58152	3.563000	0.53784	2.239000	0.73571	0.609000	0.83330	GGG			0.697	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097990.2		NM_198576	
PRAMEF4	400735	ucsc.edu	37	1	12939904	12939904	+	Missense_Mutation	SNP	A	A	C	rs3895133		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:12939904A>C	ENST00000235349.5	-	4	968	c.898T>G	c.(898-900)Ttc>Gtc	p.F300V		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	300					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		ATTGTGAGGAACTTTAACGAG	0.483																																					p.F300V													.	PRAMEF4	62		0			c.T898G												50.0	69.0	62.0					1																	12939904		1404	2644	4048	SO:0001583	missense	400735	exon4			TGAGGAACTTTAA		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.898T>G	1.37:g.12939904A>C	ENSP00000235349:p.Phe300Val		19	0.2631578947	5		50	0.26	13	NM_001009611	0		0	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	37	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	t	1.416	-0.574302	0.03882	.	.	ENSG00000243073	ENST00000235349	T	0.38887	1.11	1.48	-2.96	0.05547	.	1.221790	0.05721	N	0.597800	T	0.18759	0.0450	N	0.04132	-0.27	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09207	-1.0685	10	0.37606	T	0.19	.	3.305	0.06997	0.5711:0.149:0.0:0.2799	.	300	O60810	PRAM4_HUMAN	V	300	ENSP00000235349:F300V	ENSP00000235349:F300V	F	-	1	0	PRAMEF4	12862491	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.518000	0.02246	-3.281000	0.00197	-4.216000	0.00009	TTC			0.483	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005518.1		NM_001009611	
CROCCP2	84809	broad.mit.edu	37	1	16959834	16959834	+	lincRNA	SNP	G	G	T	rs201123694	byFrequency	TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:16959834G>T	ENST00000412962.1	-	0	23							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCCAGCTGCAGCGGGTCCCTT	0.642																																					.													Q6ZWC0_HUMAN,NS,carcinoma,0,1	.		1	0			.																																											0	.			GCTGCAGCGGGTC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16959834G>T			41	0.0243902439	1		57	0.09	5	.	29	0.34	10	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	ENST00000412962.1	37																																																																																						0.642	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
ZMYM4	9202	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	35836147	35836147	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:35836147C>T	ENST00000314607.6	+	7	1180	c.1100C>T	c.(1099-1101)aCa>aTa	p.T367I	ZMYM4_ENST00000373297.2_Missense_Mutation_p.T367I|ZMYM4_ENST00000482131.1_3'UTR	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	367					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTCTGCTCCACACTGTGCCTC	0.473																																					p.T367I													.	.			0			c.C1100T												99.0	97.0	97.0					1																	35836147		2203	4300	6503	SO:0001583	missense	9202	exon7			GCTCCACACTGTG	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1100C>T	1.37:g.35836147C>T	ENSP00000322915:p.Thr367Ile		97	0	0		85	0.07	6	NM_005095	57	0.12	7	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Missense_Mutation	SNP	ENST00000314607.6	37	CCDS389.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.471841	0.84533	.	.	ENSG00000146463	ENST00000314607;ENST00000373297	T;T	0.46063	0.88;0.88	5.48	5.48	0.80851	TRASH (1);Zinc finger, MYM-type (1);	0.054232	0.64402	D	0.000001	T	0.53722	0.1814	L	0.35854	1.095	0.24985	N	0.991578	P	0.46578	0.88	P	0.60541	0.876	T	0.45659	-0.9246	10	0.28530	T	0.3	-10.9595	19.3456	0.94361	0.0:1.0:0.0:0.0	.	367	Q5VZL5	ZMYM4_HUMAN	I	367	ENSP00000322915:T367I;ENSP00000362394:T367I	ENSP00000322915:T367I	T	+	2	0	ZMYM4	35608734	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	6.745000	0.74860	2.573000	0.86826	0.591000	0.81541	ACA			0.473	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012207.3		NM_005095	
LOC729930	729930	bcgsc.ca	37	1	89755966	89755966	+	IGR	SNP	C	C	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:89755966C>A								GBP5 (17422 upstream) : GBP6 (73650 downstream)																							TCCAGGACTTCTTTGATTAAT	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGACTTCTTTGAT																													1.37:g.89755966C>A			33	0	0		29	0.00	0	.	0		0		RNA	SNP		37																																																																																					0	0.353										
DPYD	1806	hgsc.bcm.edu	37	1	97700346	97700346	+	Intron	SNP	T	T	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:97700346T>A	ENST00000370192.3	-	19	2543				DPYD-AS1_ENST00000422980.1_RNA	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase						beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	TTTTGTCACATAACTTACATT	0.393																																					.													.	.			0			.																																									SO:0001627	intron_variant	100873932	.			GTCACATAACTTA	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2442+61A>T	1.37:g.97700346T>A			91	0	0		66	0.20	13	.	0		0	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	RNA	SNP	ENST00000370192.3	37	CCDS30777.1																																																																																					0.393	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095698.3		NM_000110	
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	115256529	115256529	+	Missense_Mutation	SNP	T	T	C	rs11554290	byFrequency	TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:115256529T>C	ENST00000369535.4	-	3	435	c.182A>G	c.(181-183)cAa>cGa	p.Q61R		NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	61			Q -> K (in CMNS and NCMS; somatic mutation). {ECO:0000269|PubMed:23392294}.|Q -> R (in CMNS, NCMS and KNEN; also found in lung carcinoma cell and melanoma; dbSNP:rs11554290). {ECO:0000269|PubMed:18633438, ECO:0000269|PubMed:22499344, ECO:0000269|PubMed:23392294, ECO:0000269|PubMed:3276402}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.Q61R(817)|p.Q61L(175)|p.Q61P(23)|p.Q61K(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTACTCTTCTTGTCCAGCTGT	0.458	Q61L(C3A_LIVER)|Q61L(HEPG2_LIVER)|Q61L(HL60_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(IPC298_SKIN)|Q61L(KMS21BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(MELJUSO_SKIN)|Q61L(MHHES1_BONE)|Q61L(MOLP8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61L(OCIAML3_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61P(TF1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(HT1197_URINARY_TRACT)|Q61R(KMS27_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|Q61R(KU1919_URINARY_TRACT)|Q61R(NCIH2347_LUNG)|Q61R(ONS76_CENTRAL_NERVOUS_SYSTEM)|Q61R(SKMEL2_SKIN)|Q61R(SW1271_LUNG)|Q61R(TT2609C02_THYROID)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.Q61R				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,-1,2068	NRAS	-1	2068	1016	Substitution - Missense(1016)	skin(466)|thyroid(279)|haematopoietic_and_lymphoid_tissue(124)|NS(50)|large_intestine(27)|lung(17)|urinary_tract(11)|adrenal_gland(7)|liver(7)|breast(7)|soft_tissue(4)|testis(3)|endometrium(3)|ovary(3)|central_nervous_system(2)|pancreas(2)|eye(1)|prostate(1)|meninges(1)|autonomic_ganglia(1)	c.A182G												180.0	156.0	164.0					1																	115256529		2203	4300	6503	SO:0001583	missense	4893	exon3	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCTTCTTGTCCAG	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.182A>G	1.37:g.115256529T>C	ENSP00000358548:p.Gln61Arg		103	0	0		183	0.08	14	NM_002524	82	0.32	26	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004139	0.74932	.	.	ENSG00000213281	ENST00000369535	D	0.83673	-1.75	5.08	5.08	0.68730	Small GTP-binding protein domain (1);	0.000000	0.53938	U	0.000043	D	0.86489	0.5945	M	0.92604	3.325	0.80722	D	1	B	0.28512	0.214	B	0.39590	0.304	D	0.88255	0.2919	10	0.66056	D	0.02	.	15.0132	0.71565	0.0:0.0:0.0:1.0	rs11554290;rs11554290	61	P01111	RASN_HUMAN	R	61	ENSP00000358548:Q61R	ENSP00000358548:Q61R	Q	-	2	0	NRAS	115058052	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.761000	0.85260	2.120000	0.65058	0.533000	0.62120	CAA			0.458	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
SEC22B	9554	broad.mit.edu	37	1	145112049	145112050	+	RNA	INS	-	-	GTG	rs147351886|rs367602437		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr1:145112049_145112050insGTG	ENST00000453618.1	+	0	673							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											caggctaaagtgtggtggtgtg	0.48																																					.													.	.			0			.																																											9554	.			CTAAAGTGTGGTG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145112056_145112058dupGTG			6	0	0		8	0.50	4	.	2	0.00	0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.480	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
ARMC3	219681	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	23290962	23290962	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:23290962G>A	ENST00000298032.5	+	12	1624	c.1540G>A	c.(1540-1542)Gcc>Acc	p.A514T	ARMC3_ENST00000409049.3_Missense_Mutation_p.A514T|ARMC3_ENST00000409983.3_Missense_Mutation_p.A514T|ARMC3_ENST00000376528.4_Missense_Mutation_p.A251T	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	514						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CGAGCTGACGGCCAATGAATT	0.542																																					p.A514T													.	.			0			c.G1540A												107.0	90.0	96.0					10																	23290962		2203	4300	6503	SO:0001583	missense	219681	exon12			CTGACGGCCAATG	AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.1540G>A	10.37:g.23290962G>A	ENSP00000298032:p.Ala514Thr		113	0	0		117	0.12	14	NM_173081	1	0.00	0	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	ENST00000298032.5	37	CCDS7142.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033024	0.75504	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000376523;ENST00000409049;ENST00000376528	T;T;T;T	0.64438	-0.1;-0.1;0.95;0.69	5.91	2.9	0.33743	Armadillo-like helical (1);	0.207206	0.49916	D	0.000122	T	0.76550	0.4003	M	0.80746	2.51	0.37084	D	0.899142	D;D	0.67145	0.996;0.978	D;P	0.74348	0.983;0.737	T	0.80752	-0.1242	10	0.87932	D	0	-4.6801	9.8379	0.40980	0.0651:0.0:0.6846:0.2503	.	514;514	Q5W041-4;Q5W041	.;ARMC3_HUMAN	T	514;514;450;514;251	ENSP00000298032:A514T;ENSP00000386943:A514T;ENSP00000387288:A514T;ENSP00000365711:A251T	ENSP00000298032:A514T	A	+	1	0	ARMC3	23330968	1.000000	0.71417	0.005000	0.12908	0.047000	0.14425	4.007000	0.57093	0.799000	0.34018	0.655000	0.94253	GCC			0.542	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000047197.2		NM_173081	
LGI1	9211	mdanderson.org	37	10	95549857	95549857	+	Splice_Site	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:95549857A>G	ENST00000371418.4	+	5	693	c.433A>G	c.(433-435)Agc>Ggc	p.S145G	LGI1_ENST00000542308.1_Splice_Site_p.S97G|LGI1_ENST00000371413.3_Splice_Site_p.S145G	NM_005097.2	NP_005088.1	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1	145			S -> R (in ETL1; loss of protein secretion; does not affect glycosylation status of the protein).		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|positive regulation of cell growth (GO:0030307)|positive regulation of synaptic transmission (GO:0050806)|protein homooligomerization (GO:0051260)	cell junction (GO:0030054)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|synapse (GO:0045202)	receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(18)|ovary(2)|skin(1)	29		Colorectal(252;0.124)				TTTTTCCAGGAGCCTTGCAAA	0.333																																					p.S145G													.	.			0			c.A433G												37.0	40.0	39.0					10																	95549857		2202	4297	6499	SO:0001630	splice_region_variant	9211	exon5			TCCAGGAGCCTTG	AF055636	CCDS7431.1	10q24	2008-08-01	2002-06-05		ENSG00000108231	ENSG00000108231			6572	protein-coding gene	gene with protein product		604619	"""epilepsy, partial"""	EPT		9879993, 11978770, 15079011	Standard	NM_005097		Approved	IB1099, ETL1, EPITEMPIN	uc001kjc.4	O95970	OTTHUMG00000018777	ENST00000371418.4:c.432-1A>G	10.37:g.95549857A>G			39	0.1282051282	5		37	0.27	10	NM_005097	0		0	A8K0Z1|B4E1S0|Q5W001|Q5W002|Q8NI23|Q96LF5	Missense_Mutation	SNP	ENST00000371418.4	37	CCDS7431.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474297	0.63737	.	.	ENSG00000108231	ENST00000542308;ENST00000371418;ENST00000371413	T;T;T	0.58797	0.31;0.31;0.31	5.14	5.14	0.70334	.	0.038359	0.85682	D	0.000000	T	0.68421	0.2999	L	0.55743	1.74	0.80722	D	1	B;P;P	0.49862	0.167;0.929;0.499	B;P;P	0.58577	0.124;0.841;0.672	T	0.71421	-0.4598	10	0.66056	D	0.02	-11.9928	15.1318	0.72530	1.0:0.0:0.0:0.0	.	97;145;145	O95970-3;O95970-2;O95970	.;.;LGI1_HUMAN	G	97;145;145	ENSP00000440763:S97G;ENSP00000360472:S145G;ENSP00000360467:S145G	ENSP00000360467:S145G	S	+	1	0	LGI1	95539847	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.060000	0.76692	2.156000	0.67533	0.533000	0.62120	AGC			0.333	LGI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049445.1		NM_005097	Missense_Mutation
SMC3	9126	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	10	112361739	112361739	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr10:112361739G>C	ENST00000361804.4	+	25	3034	c.2908G>C	c.(2908-2910)Gag>Cag	p.E970Q		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	970					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCGAAAACTTGAGCAGTGCAA	0.299																																					p.E970Q													.	.			0			c.G2908C												40.0	42.0	41.0					10																	112361739		2200	4297	6497	SO:0001583	missense	9126	exon25			AAACTTGAGCAGT	AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.2908G>C	10.37:g.112361739G>C	ENSP00000354720:p.Glu970Gln		140	0	0		170	0.08	13	NM_005445	579	0.27	158	A8K156|O60464|Q5T482	Missense_Mutation	SNP	ENST00000361804.4	37	CCDS31285.1	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850234	0.71719	.	.	ENSG00000108055	ENST00000361804	T	0.75821	-0.97	5.56	5.56	0.83823	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.80270	0.4592	L	0.58101	1.795	0.80722	D	1	P	0.49862	0.929	P	0.52957	0.714	T	0.76008	-0.3116	10	0.27785	T	0.31	.	19.8984	0.96975	0.0:0.0:1.0:0.0	.	970	Q9UQE7	SMC3_HUMAN	Q	970	ENSP00000354720:E970Q	ENSP00000354720:E970Q	E	+	1	0	SMC3	112351729	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.967000	0.93402	2.780000	0.95670	0.585000	0.79938	GAG			0.299	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050337.1		NM_005445	
NLRP6	171389	mdanderson.org	37	11	281471	281471	+	Silent	SNP	G	G	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:281471G>A	ENST00000312165.5	+	4	1737	c.1737G>A	c.(1735-1737)gtG>gtA	p.V579V	NLRP6_ENST00000534750.1_Silent_p.V579V	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	579					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		TGCGGTGGGTGCAGGGACAGG	0.672																																					p.V579V													.	.			0			c.G1737A												24.0	28.0	27.0					11																	281471		2203	4298	6501	SO:0001819	synonymous_variant	171389	exon4			GTGGGTGCAGGGA	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1737G>A	11.37:g.281471G>A			51	0	0		52	0.06	3	NM_138329	5	0.00	0	A8K9F3|E9PJZ8	Silent	SNP	ENST00000312165.5	37	CCDS7693.1																																																																																					0.672	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239283.1		NM_138329	
MUC2	4583	mdanderson.org	37	11	1093295	1093296	+	Missense_Mutation	DNP	CT	CT	TC	rs200837746|rs56068864|rs200145328		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:1093295_1093296CT>TC	ENST00000441003.2	+	30	5141_5142	c.5114_5115CT>TC	c.(5113-5115)aCT>aTC	p.T1705I	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgaccc	0.639																																					p.T1705I													MUC2_ENST00000441003,rectum,carcinoma,+1,2	MUC2_ENST00000441003	1	2	2	Substitution - Missense(2)	large_intestine(2)	c.T5115C																																									SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	Exception_encountered	11.37:g.1093295_1093296delinsTC	ENSP00000415183:p.Thr1705Ile		29	0.1379310345	4		40	0.20	8	NM_002457	0		0	Q14878	Missense_Mutation	DNP	ENST00000441003.2	37																																																																																						0.639	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
FOLH1	2346	bcgsc.ca	37	11	49204790	49204790	+	Silent	SNP	A	A	G	rs76509850	byFrequency	TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:49204790A>G	ENST00000256999.2	-	7	1091	c.831T>C	c.(829-831)taT>taC	p.Y277Y	FOLH1_ENST00000533034.1_Silent_p.Y262Y|FOLH1_ENST00000340334.7_Silent_p.Y262Y|FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000356696.3_Silent_p.Y277Y	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	277	NAALADase.				folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	GCCTATAAGCATATTCTGAAA	0.343																																					p.Y277Y													.	FOLH1	141		0			c.T831C												61.0	61.0	61.0					11																	49204790		2201	4298	6499	SO:0001819	synonymous_variant	2346	exon7			ATAAGCATATTCT	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.831T>C	11.37:g.49204790A>G			182	0.010989011	2		173	0.07	12	NM_004476	4	0.00	0	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Silent	SNP	ENST00000256999.2	37	CCDS7946.1																																																																																					0.343	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390896.1		NM_004476	
OR8U1	219417	broad.mit.edu	37	11	56143593	56143593	+	Missense_Mutation	SNP	G	G	T	rs201539171		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:56143593G>T	ENST00000302270.1	+	1	494	c.494G>T	c.(493-495)cGc>cTc	p.R165L		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	165			R -> C (in dbSNP:rs17150411).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					CTCACCTTCCGCCTCTCCTAT	0.448																																					p.R165L													OR8U1,colon,carcinoma,+1,1	OR8U1	59	1	0			c.G494T							G	LEU/ARG	46,4158		0,46,2056	219.0	211.0	214.0		494	-0.8	0.2	11	dbSNP_134	214	2,8448		0,2,4223	yes	missense	OR8U1	NM_001005204.1	102	0,48,6279	TT,TG,GG		0.0237,1.0942,0.3793	benign	165/310	56143593	48,12606	2102	4225	6327	SO:0001583	missense	219417	exon1			CCTTCCGCCTCTC	AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.494G>T	11.37:g.56143593G>T	ENSP00000304188:p.Arg165Leu		144	0	0		142	0.03	4	NM_001005204	0		0		Missense_Mutation	SNP	ENST00000302270.1	37	CCDS41647.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	G	8.991	0.977801	0.18812	0.010942	2.37E-4	ENSG00000172199	ENST00000302270	T	0.00169	8.63	5.78	-0.795	0.10915	GPCR, rhodopsin-like superfamily (1);	0.274133	0.26467	N	0.024205	T	0.00144	0.0004	L	0.47016	1.485	0.09310	N	1	P	0.35272	0.493	B	0.44085	0.44	T	0.41324	-0.9515	10	0.72032	D	0.01	.	2.2903	0.04136	0.432:0.1201:0.3248:0.1231	.	165	Q8NH10	OR8U1_HUMAN	L	165	ENSP00000304188:R165L	ENSP00000304188:R165L	R	+	2	0	OR8U1	55900169	0.000000	0.05858	0.210000	0.23637	0.000000	0.00434	-2.240000	0.01197	0.118000	0.18165	-0.766000	0.03442	CGC			0.448	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000391607.1		NM_001005204	
MMP8	4317	broad.mit.edu	37	11	102589148	102589148	+	Missense_Mutation	SNP	A	A	G	rs545221221		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:102589148A>G	ENST00000236826.3	-	5	879	c.781T>C	c.(781-783)Tat>Cat	p.Y261H		NM_002424.2	NP_002415.1	P22894	MMP8_HUMAN	matrix metallopeptidase 8 (neutrophil collagenase)	261					collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase activity (GO:0004252)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(4)|skin(6)|stomach(1)|urinary_tract(1)	32	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)	Marimastat(DB00786)	ACCTTACCATAGATGGCCTGA	0.478																																					p.Y261H													.	MMP8	68		0			c.T781C												90.0	75.0	80.0					11																	102589148		2203	4299	6502	SO:0001583	missense	4317	exon5			TACCATAGATGGC	J05556	CCDS8320.1	11q21-q22	2008-02-05	2005-08-08		ENSG00000118113	ENSG00000118113	3.4.24.34		7175	protein-coding gene	gene with protein product		120355	"""matrix metalloproteinase 8 (neutrophil collagenase)"""	CLG1			Standard	NM_002424		Approved		uc001phe.2	P22894	OTTHUMG00000167587	ENST00000236826.3:c.781T>C	11.37:g.102589148A>G	ENSP00000236826:p.Tyr261His		116	0	0		121	0.02	3	NM_002424	0		0	Q45F99	Missense_Mutation	SNP	ENST00000236826.3	37	CCDS8320.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.80|19.80	3.894095|3.894095	0.72639|0.72639	.|.	.|.	ENSG00000118113|ENSG00000118113	ENST00000438475|ENST00000236826;ENST00000544383;ENST00000534942	.|T	.|0.63417	.|-0.04	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	.|0.000000	.|0.53938	.|D	.|0.000053	D|D	0.87358|0.87358	0.6157|0.6157	H|H	0.98577|0.98577	4.27|4.27	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.92315|0.92315	0.5861|0.5861	5|10	.|0.87932	.|D	.|0	.|.	15.8249|15.8249	0.78690|0.78690	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|261;196;261	.|A8K9E4;F5GXB5;P22894	.|.;.;MMP8_HUMAN	P|H	236|261;238;196	.|ENSP00000236826:Y261H	.|ENSP00000236826:Y261H	L|Y	-|-	2|1	0|0	MMP8|MMP8	102094358|102094358	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.454000|0.454000	0.32378|0.32378	8.777000|8.777000	0.91781|0.91781	2.194000|2.194000	0.70268|0.70268	0.533000|0.533000	0.62120|0.62120	CTA|TAT			0.478	MMP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395223.1		NM_002424	
NCAM1	4684	bcgsc.ca	37	11	113076296	113076296	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr11:113076296A>G	ENST00000533760.1	+	4	643	c.44A>G	c.(43-45)gAa>gGa	p.E15G	NCAM1_ENST00000397957.4_3'UTR|NCAM1_ENST00000316851.7_Missense_Mutation_p.E123G|NCAM1_ENST00000401611.2_Missense_Mutation_p.E132G	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	133					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CGGGAGGGGGAAGATGCCGTG	0.507																																					p.E133G													.	NCAM1	372		0			c.A398G												123.0	124.0	123.0					11																	113076296		2001	4150	6151	SO:0001583	missense	4684	exon5			AGGGGGAAGATGC		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.44A>G	11.37:g.113076296A>G	ENSP00000473281:p.Glu15Gly		137	0	0		117	0.00	0	NM_001242608	5	0.00	0	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	37		.	.	.	.	.	.	.	.	.	.	A	19.52	3.843543	0.71488	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851	T;T	0.41758	0.99;0.99	5.73	4.6	0.57074	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.147481	0.64402	N	0.000005	T	0.47060	0.1425	.	.	.	0.80722	D	1	P;P;P;P;D	0.53745	0.922;0.869;0.573;0.932;0.962	B;B;B;P;P	0.47402	0.337;0.179;0.198;0.499;0.546	T	0.50329	-0.8841	9	0.87932	D	0	-40.3969	11.7692	0.51949	0.9311:0.0:0.0689:0.0	.	133;133;133;133;133	P13591-5;P13591-1;P13591;P13591-3;P13591-6	.;.;NCAM1_HUMAN;.;.	G	15;132;123	ENSP00000384055:E132G;ENSP00000318472:E123G	ENSP00000318472:E123G	E	+	2	0	NCAM1	112581506	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	7.240000	0.78192	0.994000	0.38892	-0.290000	0.09829	GAA			0.507	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000394068.2		NM_000615	
KDM5A	5927	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	12	459828	459828	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:459828G>A	ENST00000399788.2	-	10	1629	c.1267C>T	c.(1267-1269)Ccg>Tcg	p.P423S	KDM5A_ENST00000382815.4_Missense_Mutation_p.P423S	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	423					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TCCTTCACCGGAAATCCACTT	0.418			T	NUP98	AML																																p.P423S				Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	KDM5A_ENST00000399788,NS,carcinoma,+1,4	KDM5A_ENST00000399788	1	4	0			c.C1267T												106.0	99.0	101.0					12																	459828		1855	4098	5953	SO:0001583	missense	5927	exon10			TCACCGGAAATCC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.1267C>T	12.37:g.459828G>A	ENSP00000382688:p.Pro423Ser		183	0	0		246	0.06	14	NM_001042603	88	0.16	14	A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	ENST00000399788.2	37	CCDS41736.1	.	.	.	.	.	.	.	.	.	.	G	33	5.253523	0.95336	.	.	ENSG00000073614	ENST00000399787;ENST00000399788;ENST00000382815	D;D	0.89270	-2.49;-2.29	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.95191	0.8441	M	0.83312	2.635	0.80722	D	1	D;D;D	0.89917	0.999;0.986;1.0	D;D;D	0.97110	0.996;0.966;1.0	D	0.95154	0.8275	10	0.87932	D	0	-15.0622	20.058	0.97661	0.0:0.0:1.0:0.0	.	423;423;423	F5H1F7;P29375;P29375-2	.;KDM5A_HUMAN;.	S	382;423;423	ENSP00000382688:P423S;ENSP00000372265:P423S	ENSP00000372265:P423S	P	-	1	0	KDM5A	330089	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.809000	0.99208	2.752000	0.94435	0.655000	0.94253	CCG			0.418	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397812.1		NM_005056	
DENND5B	160518	broad.mit.edu;mdanderson.org	37	12	31632777	31632777	+	Nonsense_Mutation	SNP	G	G	C			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:31632777G>C	ENST00000389082.5	-	3	914	c.650C>G	c.(649-651)tCa>tGa	p.S217*	DENND5B_ENST00000354285.4_Nonsense_Mutation_p.S239*|DENND5B_ENST00000545147.1_Intron|DENND5B_ENST00000536562.1_Nonsense_Mutation_p.S252*|DENND5B_ENST00000306833.6_Nonsense_Mutation_p.S252*	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	217	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGGCTGCTGTGAGGTAACAGC	0.438																																					p.S217X													.	DENND5B	114		0			c.C650G												111.0	114.0	113.0					12																	31632777		1960	4141	6101	SO:0001587	stop_gained	160518	exon3			TGCTGTGAGGTAA	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.650C>G	12.37:g.31632777G>C	ENSP00000373734:p.Ser217*		69	0	0		97	0.05	5	NM_144973	52	0.00	0	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Nonsense_Mutation	SNP	ENST00000389082.5	37	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	G	19.03	3.747654	0.69533	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285;ENST00000546299	.	.	.	4.8	4.8	0.61643	.	0.084454	0.48767	D	0.000175	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-5.1338	14.5619	0.68144	0.0:0.1466:0.8534:0.0	.	.	.	.	X	217;252;252;239;169	.	ENSP00000306482:S252X	S	-	2	0	DENND5B	31524044	1.000000	0.71417	0.911000	0.35937	0.800000	0.45204	7.213000	0.77950	2.490000	0.84030	0.655000	0.94253	TCA			0.438	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402040.1		NM_144973	
LLPH	84298	broad.mit.edu	37	12	66517700	66517700	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:66517700T>C	ENST00000266604.2	-	3	380	c.310A>G	c.(310-312)Agg>Ggg	p.R104G	TMBIM4_ENST00000539652.1_3'UTR|LLPH_ENST00000446587.2_Missense_Mutation_p.R104G	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	104	Lys-rich.						poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						GCCTTCAGCCTTTTTCTTTGC	0.408																																					p.R104G													LLPH,NS,carcinoma,0,1	LLPH	25	1	0			c.A310G												191.0	167.0	175.0					12																	66517700		2203	4300	6503	SO:0001583	missense	84298	exon3			TCAGCCTTTTTCT	AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.310A>G	12.37:g.66517700T>C	ENSP00000266604:p.Arg104Gly		153	0	0		166	0.02	3	NM_032338	128	0.00	0	Q3B766	Missense_Mutation	SNP	ENST00000266604.2	37	CCDS8974.1	.	.	.	.	.	.	.	.	.	.	T	15.17	2.754956	0.49362	.	.	ENSG00000139233	ENST00000266604;ENST00000446587	.	.	.	4.49	2.01	0.26516	.	0.142496	0.64402	D	0.000008	T	0.48926	0.1527	M	0.68593	2.085	0.28223	N	0.92644	B	0.20887	0.049	B	0.27887	0.084	T	0.43909	-0.9362	8	.	.	.	-13.6114	10.5959	0.45338	0.0:0.0:0.3087:0.6913	.	104	Q9BRT6	LLPH_HUMAN	G	104	.	.	R	-	1	2	LLPH	64803967	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	4.237000	0.58681	0.306000	0.22856	0.528000	0.53228	AGG			0.408	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401752.1		NM_032338	
PTPRB	5787	broad.mit.edu;mdanderson.org	37	12	70970172	70970172	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:70970172T>A	ENST00000261266.5	-	9	2207	c.2178A>T	c.(2176-2178)caA>caT	p.Q726H	PTPRB_ENST00000550358.1_Intron|PTPRB_ENST00000334414.6_Missense_Mutation_p.Q944H|PTPRB_ENST00000551525.1_Missense_Mutation_p.Q943H|PTPRB_ENST00000550857.1_Missense_Mutation_p.Q636H|PTPRB_ENST00000451516.2_Missense_Mutation_p.Q636H|PTPRB_ENST00000538708.1_Missense_Mutation_p.Q726H	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	726	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTGTCCGCTCTTGGCTGAAGG	0.512																																					p.Q944H													.	PTPRB	676		0			c.A2832T												57.0	58.0	57.0					12																	70970172		1986	4170	6156	SO:0001583	missense	0	exon11			CCGCTCTTGGCTG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.2178A>T	12.37:g.70970172T>A	ENSP00000261266:p.Gln726His		108	0	0		113	0.06	7	NM_001109754	5	0.00	0	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000261266.5	37	CCDS44944.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347471	0.41599	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000538708;ENST00000550857;ENST00000261266;ENST00000551525;ENST00000548122	T;T;T;T;T;T;T	0.05025	4.03;4.02;4.11;4.02;4.08;3.51;3.56	5.98	-1.95	0.07548	Fibronectin, type III (2);	0.185240	0.48286	N	0.000190	T	0.11410	0.0278	L	0.47716	1.5	0.30825	N	0.737355	D;D;D;P;D;D	0.69078	0.994;0.994;0.988;0.903;0.997;0.981	D;D;P;P;D;P	0.65987	0.914;0.914;0.823;0.605;0.94;0.823	T	0.07347	-1.0777	10	0.27082	T	0.32	.	7.8677	0.29547	0.1095:0.464:0.0:0.4265	.	636;726;823;943;944;726	P23467-2;F5H3G6;Q6ZR19;F8VSD5;P23467-3;P23467	.;.;.;.;.;PTPRB_HUMAN	H	944;636;726;636;726;943;823	ENSP00000334928:Q944H;ENSP00000393028:Q636H;ENSP00000438927:Q726H;ENSP00000447302:Q636H;ENSP00000261266:Q726H;ENSP00000448349:Q943H;ENSP00000446982:Q823H	ENSP00000261266:Q726H	Q	-	3	2	PTPRB	69256439	0.992000	0.36948	0.991000	0.47740	0.930000	0.56654	0.286000	0.18902	-0.394000	0.07727	0.528000	0.53228	CAA			0.512	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000404439.1			
HCAR3	8843	broad.mit.edu	37	12	123201030	123201030	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr12:123201030G>T	ENST00000528880.2	-	1	409	c.255C>A	c.(253-255)gaC>gaA	p.D85E	RP11-324E6.6_ENST00000543611.1_lincRNA|HCAR1_ENST00000356987.2_Intron	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	85					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	GCACATAGTAGTCCATCACGA	0.522																																					p.D85E													.	HCAR3	49		0			c.C255A												61.0	61.0	61.0					12																	123201030		2203	4300	6503	SO:0001583	missense	8843	exon1			ATAGTAGTCCATC	D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.255C>A	12.37:g.123201030G>T	ENSP00000436714:p.Asp85Glu		79	0	0		93	0.04	4	NM_006018	20	0.00	0	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	ENST00000528880.2	37	CCDS53842.1	.	.	.	.	.	.	.	.	.	.	G	10.80	1.451295	0.26074	.	.	ENSG00000255398	ENST00000528880	T	0.37058	1.22	3.27	0.148	0.14843	.	.	.	.	.	T	0.55513	0.1925	M	0.83774	2.66	0.23325	N	0.997906	D	0.89917	1.0	D	0.85130	0.997	T	0.42982	-0.9419	9	0.30854	T	0.27	.	6.7279	0.23367	0.4754:0.0:0.5246:0.0	.	85	E9PI97	.	E	85	ENSP00000436714:D85E	ENSP00000436714:D85E	D	-	3	2	HCAR3	121766983	0.934000	0.31675	0.002000	0.10522	0.010000	0.07245	1.439000	0.35013	0.053000	0.16036	0.184000	0.17185	GAC			0.522	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387549.2		NM_006018	
CCDC169	728591	broad.mit.edu	37	13	36822786	36822786	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr13:36822786G>T	ENST00000239859.7	-	7	533	c.502C>A	c.(502-504)Cag>Aag	p.Q168K	CCDC169_ENST00000239860.6_Missense_Mutation_p.Q68K|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.Q68K|CCDC169_ENST00000503173.1_Missense_Mutation_p.Q168K|SOHLH2_ENST00000554962.1_Missense_Mutation_p.Q68K|CCDC169_ENST00000379864.2_Missense_Mutation_p.Q66K|CCDC169_ENST00000510088.1_Missense_Mutation_p.Q66K|CCDC169_ENST00000491049.2_Missense_Mutation_p.Q66K|CCDC169_ENST00000379862.2_Missense_Mutation_p.Q66K			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169	168										breast(1)|endometrium(1)	2						TGATCCACCTGTTGCCTTTTA	0.348																																					p.Q168K													.	CCDC169	20		0			c.C502A												152.0	133.0	138.0					13																	36822786		692	1591	2283	SO:0001583	missense	54937	exon7			CCACCTGTTGCCT		CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.502C>A	13.37:g.36822786G>T	ENSP00000239859:p.Gln168Lys		92	0	0		74	0.04	3	NM_001144981	0		0	A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	Missense_Mutation	SNP	ENST00000239859.7	37	CCDS45028.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.448571	0.63178	.	.	ENSG00000120669;ENSG00000250709;ENSG00000242715;ENSG00000242715;ENSG00000242715;ENSG00000242715;ENSG00000242715;ENSG00000242715;ENSG00000242715	ENST00000554962;ENST00000511166;ENST00000491049;ENST00000503173;ENST00000239860;ENST00000379864;ENST00000510088;ENST00000379862;ENST00000239859	T;T;T;T;T;T;D;D;D	0.82711	0.95;0.95;0.95;0.95;0.95;0.95;-1.64;-1.64;-1.64	4.78	3.04	0.35103	.	0.375122	0.20334	N	0.094362	T	0.82084	0.4960	L	0.54323	1.7	0.30826	N	0.737284	P;P;P;P;D	0.56287	0.94;0.94;0.94;0.9;0.975	P;P;P;B;P	0.53861	0.731;0.641;0.641;0.376;0.736	T	0.76876	-0.2797	10	0.26408	T	0.33	-3.1418	6.5627	0.22495	0.095:0.1821:0.7229:0.0	.	168;68;66;68;168	A6NNP5-4;B7ZW49;A6NNP5-3;B4DX90;A6NNP5	.;.;.;.;CC169_HUMAN	K	68;68;66;168;68;66;66;66;168	ENSP00000451542:Q68K;ENSP00000421868:Q68K;ENSP00000425252:Q66K;ENSP00000426174:Q168K;ENSP00000239860:Q68K;ENSP00000369193:Q66K;ENSP00000427495:Q66K;ENSP00000369191:Q66K;ENSP00000239859:Q168K	ENSP00000239859:Q168K	Q	-	1	0	CCDC169-SOHLH2;SOHLH2;CCDC169	35720786	1.000000	0.71417	0.978000	0.43139	0.962000	0.63368	2.217000	0.42880	0.930000	0.37217	0.650000	0.86243	CAG			0.348	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000368255.1		NM_001144981	
RP11-146E13.4	0	broad.mit.edu	37	14	19857036	19857036	+	lincRNA	SNP	A	A	G	rs374719458		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr14:19857036A>G	ENST00000548109.1	+	0	72																											CTGGATAATAAAGTTCATCTC	0.373																																					.													.	.			0			.																																											0	.			ATAATAAAGTTCA																													14.37:g.19857036A>G			48	0.0208333333	1		34	0.15	5	.	1	0.00	0		RNA	SNP	ENST00000548109.1	37																																																																																						0.373	RP11-146E13.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409408.1			
KIAA0391	9692	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	35593060	35593060	+	Silent	SNP	C	C	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr14:35593060C>G	ENST00000557565.1	+	2	990	c.609C>G	c.(607-609)gcC>gcG	p.A203A	KIAA0391_ENST00000603588.1_Intron|KIAA0391_ENST00000605870.1_Intron|KIAA0391_ENST00000603544.1_Silent_p.A203A|KIAA0391_ENST00000321130.10_Silent_p.A203A|KIAA0391_ENST00000250377.7_Silent_p.A108A|PPP2R3C_ENST00000555644.1_5'Flank|PPP2R3C_ENST00000261475.5_5'Flank|KIAA0391_ENST00000604948.1_Silent_p.A108A|KIAA0391_ENST00000534898.4_Silent_p.A203A	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	203					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		TTATGAAAGCCAGATATAAGA	0.373																																					p.A203A													.	.			0			c.C609G												61.0	62.0	62.0					14																	35593060		2203	4300	6503	SO:0001819	synonymous_variant	9692	exon2			GAAAGCCAGATAT	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.609C>G	14.37:g.35593060C>G			114	0	0		138	0.09	12	NM_014672	54	0.24	13	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Silent	SNP	ENST00000557565.1	37	CCDS32063.1																																																																																					0.373	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding		OTTHUMT00000411280.1		NM_014672	
EPB42	2038	hgsc.bcm.edu	37	15	43500484	43500484	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:43500484G>T	ENST00000441366.2	-	8	1244	c.1019C>A	c.(1018-1020)cCc>cAc	p.P340H	EPB42_ENST00000563128.1_5'Flank|EPB42_ENST00000540029.1_Missense_Mutation_p.P262H|EPB42_ENST00000300215.3_Missense_Mutation_p.P370H	NM_000119.2|NM_001114134.1	NP_000110.2|NP_001107606.1	P16452	EPB42_HUMAN	erythrocyte membrane protein band 4.2	340					cell morphogenesis (GO:0000902)|erythrocyte maturation (GO:0043249)|hemoglobin metabolic process (GO:0020027)|iron ion homeostasis (GO:0055072)|peptide cross-linking (GO:0018149)|regulation of cell shape (GO:0008360)|spleen development (GO:0048536)	cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.7e-07)		ATAACCCTGGGGCAAGGCAGG	0.537																																					p.P370H													.	.			0			c.C1109A												74.0	63.0	66.0					15																	43500484		2203	4299	6502	SO:0001583	missense	2038	exon8			CCCTGGGGCAAGG	M60298	CCDS10093.1, CCDS45249.1	15q15-q21	2013-05-02			ENSG00000166947	ENSG00000166947		"""Transglutaminases"""	3381	protein-coding gene	gene with protein product	"""Erythrocyte surface protein band 4.2"""	177070				1284644	Standard	NM_000119		Approved	PA, MGC116735, MGC116737	uc001zrb.4	P16452	OTTHUMG00000130701	ENST00000441366.2:c.1019C>A	15.37:g.43500484G>T	ENSP00000396616:p.Pro340His		96	0	0		88	0.05	4	NM_000119	0		0	Q4KKX0|Q4VB97	Missense_Mutation	SNP	ENST00000441366.2	37	CCDS45249.1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533041	0.64972	.	.	ENSG00000166947	ENST00000300215;ENST00000540029;ENST00000441366	T;T;T	0.54675	0.56;0.56;0.56	5.53	-1.8	0.07907	Transglutaminase-like (2);	0.955309	0.08862	N	0.882887	T	0.65312	0.2679	M	0.86502	2.82	0.09310	N	1	P;D;D;D	0.61080	0.746;0.98;0.989;0.98	B;P;P;P	0.60236	0.365;0.871;0.846;0.871	T	0.55418	-0.8144	10	0.66056	D	0.02	-0.479	1.758	0.02986	0.1523:0.2393:0.3638:0.2446	.	262;340;370;340	F5H563;B7Z4C3;P16452-2;P16452	.;.;.;EPB42_HUMAN	H	370;262;340	ENSP00000300215:P370H;ENSP00000444699:P262H;ENSP00000396616:P340H	ENSP00000300215:P370H	P	-	2	0	EPB42	41287776	0.000000	0.05858	0.002000	0.10522	0.169000	0.22640	0.219000	0.17641	-0.147000	0.11254	0.650000	0.86243	CCC			0.537	EPB42-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000432219.1		NM_000119	
CYP19A1	1588	broad.mit.edu;mdanderson.org	37	15	51504564	51504564	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:51504564A>G	ENST00000396402.1	-	9	1369	c.1216T>C	c.(1216-1218)Ttt>Ctt	p.F406L	CYP19A1_ENST00000396404.4_Missense_Mutation_p.F406L|RP11-108K3.1_ENST00000559909.1_lincRNA|CYP19A1_ENST00000260433.2_Missense_Mutation_p.F406L|CYP19A1_ENST00000559878.1_Missense_Mutation_p.F406L	NM_000103.3	NP_000094.2	P11511	CP19A_HUMAN	cytochrome P450, family 19, subfamily A, polypeptide 1	406					androgen metabolic process (GO:0008209)|estrogen biosynthetic process (GO:0006703)|prostate gland growth (GO:0060736)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)	aromatase activity (GO:0070330)|electron carrier activity (GO:0009055)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			endometrium(1)|kidney(4)|large_intestine(9)|lung(11)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	33				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Betamethasone(DB00443)|Bifonazole(DB04794)|Buserelin(DB06719)|Carbimazole(DB00389)|Chlorphenesin(DB00856)|Clomifene(DB00882)|Clotrimazole(DB00257)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Dinoprostone(DB00917)|Drostanolone(DB00858)|Econazole(DB01127)|Edetic Acid(DB00974)|Etomidate(DB00292)|Exemestane(DB00990)|Ketoconazole(DB01026)|Letrozole(DB01006)|Levomethadyl Acetate(DB01227)|Levonorgestrel(DB00367)|Mefloquine(DB00358)|Melatonin(DB01065)|Methadone(DB00333)|Methyltestosterone(DB06710)|Miconazole(DB01110)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nicotine(DB00184)|Paclitaxel(DB01229)|Raloxifene(DB00481)|Sulfathiazole(DB06147)|Tamoxifen(DB00675)|Terbinafine(DB00857)|Testolactone(DB00894)|Testosterone(DB00624)|Tioconazole(DB01007)|Trastuzumab(DB00072)	TTGGGGAAAAACTCGAGTCTG	0.403																																					p.F406L	Melanoma(142;1016 1807 39614 48966 51721)												.	CYP19A1	75		0			c.T1216C												134.0	127.0	129.0					15																	51504564		2196	4293	6489	SO:0001583	missense	0	exon10			GGAAAAACTCGAG	D14473	CCDS10139.1	15q21	2009-01-26	2003-02-14	2003-02-28	ENSG00000137869	ENSG00000137869		"""Cytochrome P450s"""	2594	protein-coding gene	gene with protein product		107910	"""cytochrome P450, subfamily XIX (aromatization of androgens)"""	CYP19		8477708	Standard	NM_031226		Approved	ARO, P-450AROM, CPV1, ARO1, CYAR, aromatase	uc001zza.4	P11511	OTTHUMG00000131747	ENST00000396402.1:c.1216T>C	15.37:g.51504564A>G	ENSP00000379683:p.Phe406Leu		138	0.0072463768	1		169	0.10	17	NM_031226	1	0.00	0	Q16731|Q3B764|Q58FA0|Q8IYJ7	Missense_Mutation	SNP	ENST00000396402.1	37	CCDS10139.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361623	0.82353	.	.	ENSG00000137869	ENST00000396402;ENST00000260433;ENST00000396404	T;T;T	0.66638	-0.22;-0.22;-0.22	6.06	6.06	0.98353	.	0.090176	0.85682	D	0.000000	T	0.63094	0.2482	L	0.48218	1.51	0.50467	D	0.999878	B	0.25169	0.119	B	0.24541	0.054	T	0.61262	-0.7098	10	0.62326	D	0.03	-14.806	16.6093	0.84858	1.0:0.0:0.0:0.0	.	406	P11511	CP19A_HUMAN	L	406	ENSP00000379683:F406L;ENSP00000260433:F406L;ENSP00000379685:F406L	ENSP00000260433:F406L	F	-	1	0	CYP19A1	49291856	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.879000	0.92398	2.324000	0.78689	0.533000	0.62120	TTT			0.403	CYP19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254669.1			
CGNL1	84952	broad.mit.edu	37	15	57731196	57731196	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:57731196G>T	ENST00000281282.5	+	2	1077	c.999G>T	c.(997-999)agG>agT	p.R333S		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	333	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AAAACAGAAGGTATATTCCCT	0.443																																					p.R333S													.	CGNL1	125		0			c.G999T												58.0	55.0	56.0					15																	57731196		2192	4292	6484	SO:0001583	missense	84952	exon3			CAGAAGGTATATT	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.999G>T	15.37:g.57731196G>T	ENSP00000281282:p.Arg333Ser		121	0	0		155	0.03	4	NM_001252335	9	0.00	0	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	37	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655293	0.67472	.	.	ENSG00000128849	ENST00000281282	T	0.55760	0.5	5.79	-1.35	0.09114	.	0.000000	0.56097	D	0.000025	T	0.61590	0.2359	M	0.62723	1.935	0.39376	D	0.966164	D	0.89917	1.0	D	0.75484	0.986	T	0.62238	-0.6896	10	0.87932	D	0	-33.4465	7.1885	0.25813	0.2477:0.3317:0.4206:0.0	.	333	Q0VF96	CGNL1_HUMAN	S	333	ENSP00000281282:R333S	ENSP00000281282:R333S	R	+	3	2	CGNL1	55518488	0.993000	0.37304	0.610000	0.28997	0.982000	0.71751	0.289000	0.18957	0.074000	0.16767	-0.136000	0.14681	AGG			0.443	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255482.2		NM_032866	
CYP1A1	1543	hgsc.bcm.edu	37	15	75012969	75012969	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:75012969A>G	ENST00000379727.3	-	7	1598	c.1400T>C	c.(1399-1401)gTc>gCc	p.V467A	CYP1A1_ENST00000567032.1_Missense_Mutation_p.V467A|CYP1A1_ENST00000395049.4_Missense_Mutation_p.V438A|CYP1A1_ENST00000395048.2_Missense_Mutation_p.V467A			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	467					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	GAAGAGAAAGACCTCCCAGCG	0.537									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												p.V467A													.	.			0			c.T1400C												118.0	106.0	110.0					15																	75012969		2197	4296	6493	SO:0001583	missense	1543	exon7	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	AGAAAGACCTCCC	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.1400T>C	15.37:g.75012969A>G	ENSP00000369050:p.Val467Ala		60	0	0		91	0.04	4	NM_000499	0		0	A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	ENST00000379727.3	37	CCDS10268.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.762559	0.89932	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.69040	-0.37;-0.37;-0.37	5.65	5.65	0.86999	.	0.056522	0.64402	D	0.000001	D	0.85177	0.5637	M	0.92970	3.365	0.80722	D	1	D;D	0.55800	0.973;0.973	D;D	0.64595	0.927;0.927	D	0.88887	0.3343	10	0.87932	D	0	.	15.8715	0.79122	1.0:0.0:0.0:0.0	.	438;467	E7EMT5;P04798	.;CP1A1_HUMAN	A	467;467;438;439	ENSP00000369050:V467A;ENSP00000378488:V467A;ENSP00000378489:V438A	ENSP00000268062:V439A	V	-	2	0	CYP1A1	72800022	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	9.185000	0.94900	2.155000	0.67459	0.533000	0.62120	GTC			0.537	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286396.1		NM_000499	
MEX3B	84206	mdanderson.org	37	15	82336271	82336271	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr15:82336271G>T	ENST00000329713.4	-	2	1375	c.940C>A	c.(940-942)Cgc>Agc	p.R314S	AC026956.1_ENST00000410589.1_RNA|MEX3B_ENST00000558133.1_3'UTR	NM_032246.4	NP_115622.2	Q6ZN04	MEX3B_HUMAN	mex-3 RNA binding family member B	314					protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)	19						TCCGCCAGGCGCTGGGTAGCC	0.607																																					p.R314S													.	.			0			c.C940A												33.0	41.0	38.0					15																	82336271		2192	4283	6475	SO:0001583	missense	84206	exon2			CCAGGCGCTGGGT	AK131424	CCDS10319.1	15q25.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000183496	ENSG00000183496		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	25297	protein-coding gene	gene with protein product		611008	"""ring finger and KH domain containing 3"", ""mex-3 homolog B (C. elegans)"""	RKHD3		11230166, 17267406	Standard	NM_032246		Approved	DKFZp434J0617, RNF195	uc002bgq.2	Q6ZN04	OTTHUMG00000147356	ENST00000329713.4:c.940C>A	15.37:g.82336271G>T	ENSP00000329918:p.Arg314Ser		16	0	0		15	0.13	2	NM_032246	48	0.00	0	Q4G0W1|Q8IVG2|Q9H0J0	Missense_Mutation	SNP	ENST00000329713.4	37	CCDS10319.1	.	.	.	.	.	.	.	.	.	.	G	12.49	1.953357	0.34471	.	.	ENSG00000183496	ENST00000329713	T	0.31510	1.49	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.27313	0.0670	L	0.46614	1.455	0.80722	D	1	B	0.24533	0.105	B	0.21546	0.035	T	0.04621	-1.0938	10	0.17369	T	0.5	-26.8345	14.9972	0.71443	0.0:0.0:1.0:0.0	.	314	Q6ZN04	MEX3B_HUMAN	S	314	ENSP00000329918:R314S	ENSP00000329918:R314S	R	-	1	0	MEX3B	80123326	0.994000	0.37717	1.000000	0.80357	0.389000	0.30415	2.759000	0.47573	2.515000	0.84797	0.563000	0.77884	CGC			0.607	MEX3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000304000.1		XM_290645	
IGFALS	3483	mdanderson.org	37	16	1842006	1842006	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:1842006G>T	ENST00000215539.3	-	2	523	c.413C>A	c.(412-414)gCa>gAa	p.A138E	IGFALS_ENST00000415638.3_Missense_Mutation_p.A176E|IGFALS_ENST00000568221.1_3'UTR			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	138					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						CGTGCCGAGTGCCAGGCTGCG	0.701																																					p.A176E													.	.			0			c.C527A												22.0	20.0	21.0					16																	1842006		2194	4295	6489	SO:0001583	missense	3483	exon2			CCGAGTGCCAGGC	M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.413C>A	16.37:g.1842006G>T	ENSP00000215539:p.Ala138Glu		20	0	0		31	0.10	3	NM_001146006	1	0.00	0	B4DZY8|E9PGU3	Missense_Mutation	SNP	ENST00000215539.3	37	CCDS10446.1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.022940	0.35701	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	T;T	0.79749	-1.3;-1.3	5.09	-0.981	0.10269	.	0.473046	0.23536	N	0.047127	T	0.59307	0.2184	N	0.02736	-0.51	0.09310	N	1	P;P	0.48407	0.91;0.837	P;P	0.49140	0.601;0.598	T	0.59757	-0.7394	10	0.31617	T	0.26	.	5.891	0.18913	0.0736:0.3755:0.4212:0.1297	.	176;138	E9PGU3;P35858	.;ALS_HUMAN	E	138;176	ENSP00000215539:A138E;ENSP00000416683:A176E	ENSP00000215539:A138E	A	-	2	0	IGFALS	1782007	0.999000	0.42202	0.001000	0.08648	0.108000	0.19459	3.021000	0.49651	-0.423000	0.07394	0.549000	0.68633	GCA			0.701	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250509.2			
ABCC6P1	653190	broad.mit.edu	37	16	18597595	18597596	+	RNA	INS	-	-	A	rs199955375		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:18597595_18597596insA	ENST00000546162.2	+	0	999					NR_003569.1				ATP-binding cassette, sub-family C, member 6 pseudogene 1 (functional)																		gactccgtatcaaaaaaaaaaa	0.47																																					.													.	.			0			.																																											0	.			CCGTATCAAAAAA	BC075833		16p12.3	2014-09-11	2014-05-09		ENSG00000256340	ENSG00000256340		"""-"""	33352	pseudogene	pseudogene			"""ATP-binding cassette, sub-family C, member 6 pseudogene 1"""			18405356, 22873774	Standard	NR_003569		Approved		uc002dfg.3		OTTHUMG00000177192		16.37:g.18597606_18597606dupA			7	0.1428571429	1		9	0.33	3	.	0		0		RNA	INS	ENST00000546162.2	37																																																																																						0.470	ABCC6P1-004	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000435772.2		NR_003569	
XPO6	23214	hgsc.bcm.edu	37	16	28167671	28167671	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr16:28167671A>G	ENST00000304658.5	-	7	1321	c.821T>C	c.(820-822)aTc>aCc	p.I274T	XPO6_ENST00000565698.1_Missense_Mutation_p.I260T|XPO6_ENST00000561488.1_5'Flank	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	274					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						AAAGTGGAAGATGGTGGTAAG	0.567																																					p.I274T													XPO6,NS,carcinoma,-1,1	XPO6	-1	1	0			c.T821C												93.0	98.0	97.0					16																	28167671		2033	4192	6225	SO:0001583	missense	23214	exon7			TGGAAGATGGTGG	AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.821T>C	16.37:g.28167671A>G	ENSP00000302790:p.Ile274Thr		106	0	0		94	0.04	4	NM_015171	202	0.00	0	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Missense_Mutation	SNP	ENST00000304658.5	37	CCDS42135.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.301967	0.81136	.	.	ENSG00000169180	ENST00000304658	T	0.51574	0.7	5.87	5.87	0.94306	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65460	0.2693	M	0.61703	1.905	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70487	0.969;0.954	T	0.68172	-0.5479	10	0.87932	D	0	-20.6372	14.5226	0.67863	1.0:0.0:0.0:0.0	.	274;274	B7ZM10;Q96QU8	.;XPO6_HUMAN	T	274	ENSP00000302790:I274T	ENSP00000302790:I274T	I	-	2	0	XPO6	28075172	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	ATC			0.567	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433732.1		XM_055195	
MAP2K3	5606	bcgsc.ca	37	17	21188136	21188136	+	5'UTR	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:21188136C>T	ENST00000342679.4	+	0	153				MAP2K3_ENST00000534743.1_3'UTR	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3						activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		TCCGCCTGGCCTGGGCCGTCT	0.751																																					.													.	MAP2K3	135		0			.																																									SO:0001623	5_prime_UTR_variant	5606	.			CCTGGCCTGGGCC	L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.-97C>T	17.37:g.21188136C>T			77	0	0		32	0.00	0	.	35	0.00	0	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	ENST00000342679.4	37	CCDS11217.1																																																																																					0.751	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259374.2		NM_145109	
ATAD5	79915	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	17	29162012	29162012	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:29162012A>G	ENST00000321990.4	+	2	1291	c.913A>G	c.(913-915)Ata>Gta	p.I305V	CTD-2349P21.11_ENST00000580873.1_RNA	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	305					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AAGTGGTTATATAAGTGAATC	0.393																																					p.I305V													ATAD5,NS,carcinoma,-2,1	ATAD5	-2	1	0			c.A913G												44.0	48.0	47.0					17																	29162012		2202	4298	6500	SO:0001583	missense	79915	exon2			GGTTATATAAGTG		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.913A>G	17.37:g.29162012A>G	ENSP00000313171:p.Ile305Val		226	0	0		252	0.04	11	NM_024857	11	0.27	3	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	A	0.278	-0.988430	0.02162	.	.	ENSG00000176208	ENST00000321990	T	0.15256	2.44	5.91	-0.972	0.10300	.	1.523970	0.03334	N	0.193792	T	0.07548	0.0190	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28776	-1.0033	10	0.02654	T	1	.	6.8054	0.23774	0.5513:0.119:0.3297:0.0	.	305;305	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	V	305	ENSP00000313171:I305V	ENSP00000313171:I305V	I	+	1	0	ATAD5	26186138	0.000000	0.05858	0.000000	0.03702	0.082000	0.17680	0.081000	0.14823	-0.387000	0.07809	-1.125000	0.01998	ATA			0.393	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256206.2		NM_024857	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274343	39274343	+	Silent	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:39274343A>G	ENST00000391413.2	-	1	263	c.225T>C	c.(223-225)tgT>tgC	p.C75C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	75	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCTGGGGCGACAGCAGCTGG	0.657																																					p.C75C													KRTAP4-11,NS,malignant_melanoma,0,2	KRTAP4-11	0	2	0			c.T225C																																									SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.225T>C	17.37:g.39274343A>G			41	0.0487804878	2		47	0.04	2	NM_033059	0		0	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																					0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257690.1			
FAM104A	84923	broad.mit.edu;mdanderson.org	37	17	71228444	71228444	+	Start_Codon_SNP	SNP	A	A	C			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr17:71228444A>C	ENST00000403627.3	-	1	62	c.2T>G	c.(1-3)aTg>aGg	p.M1R	FAM104A_ENST00000583024.1_Start_Codon_SNP_p.M1R|FAM104A_ENST00000581110.1_Start_Codon_SNP_p.M1R|C17orf80_ENST00000535032.2_5'Flank|C17orf80_ENST00000426147.2_5'Flank|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000577615.1_5'Flank|FAM104A_ENST00000405159.3_Start_Codon_SNP_p.M1R|C17orf80_ENST00000268942.8_5'Flank|C17orf80_ENST00000255557.4_5'UTR|C17orf80_ENST00000359042.2_5'Flank|C17orf80_ENST00000582793.1_5'Flank	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	1										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			GCGCCCCCCCATGTCGCTGCC	0.716																																					p.M1R													FAM104A,NS,carcinoma,+1,1	FAM104A	15	1	0			c.T2G												14.0	18.0	17.0					17																	71228444		2014	4139	6153	SO:0001582	initiator_codon_variant	84923	exon1			CCCCCCATGTCGC	AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.2T>G	17.37:g.71228444A>C	ENSP00000384648:p.Met1Arg		34	0	0		41	0.12	5	NM_032837	16	0.25	4	B4E339	Translation_Start_Site	SNP	ENST00000403627.3	37	CCDS11693.2	.	.	.	.	.	.	.	.	.	.	A	17.21	3.331464	0.60853	.	.	ENSG00000133193	ENST00000403627;ENST00000405159	T;T	0.52754	0.74;0.65	4.86	3.75	0.43078	.	.	.	.	.	T	0.52435	0.1734	.	.	.	0.80722	D	1	D;P	0.53745	0.962;0.899	P;P	0.52481	0.7;0.49	T	0.56625	-0.7948	8	0.87932	D	0	.	7.3985	0.26950	0.9001:0.0:0.0999:0.0	.	1;1	Q969W3-2;Q969W3	.;F104A_HUMAN	R	1	ENSP00000384648:M1R;ENSP00000384832:M1R	ENSP00000384648:M1R	M	-	2	0	FAM104A	68740039	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.438000	0.35002	2.036000	0.60181	0.533000	0.62120	ATG			0.716	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318935.1		NM_032837	Missense_Mutation
CTBP2P3	220147	bcgsc.ca	37	18	58330687	58330687	+	lincRNA	SNP	C	C	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr18:58330687C>A	ENST00000591869.1	-	0	228																											CCAACTCAACCATCTGCCACA	0.577																																					.													.	.			0			.																																											0	.			CTCAACCATCTGC																													18.37:g.58330687C>A			35	0	0		22	0.00	0	.	0		0		RNA	SNP	ENST00000591869.1	37																																																																																						0.577	RP11-325K19.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000449086.1			
PDE4A	5141	mdanderson.org	37	19	10572668	10572668	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:10572668G>A	ENST00000352831.6	+	13	1846	c.1736G>A	c.(1735-1737)cGc>cAc	p.R579H	PDE4A_ENST00000293683.5_Missense_Mutation_p.R553H|PDE4A_ENST00000380702.2_Missense_Mutation_p.R557H|PDE4A_ENST00000592685.1_Missense_Mutation_p.R557H|PDE4A_ENST00000440014.2_Missense_Mutation_p.R518H|PDE4A_ENST00000344979.3_Missense_Mutation_p.R340H	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	579	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	TACTCCGACCGCATCCAGGTG	0.577																																					p.R579H													PDE4A,NS,carcinoma,+1,1	PDE4A	1	1	0			c.G1736A												125.0	100.0	109.0					19																	10572668		2203	4300	6503	SO:0001583	missense	5141	exon13			CCGACCGCATCCA		CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1736G>A	19.37:g.10572668G>A	ENSP00000270474:p.Arg579His		41	0	0		41	0.10	4	NM_001111307	59	0.00	0	O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	ENST00000352831.6	37	CCDS45961.1	.	.	.	.	.	.	.	.	.	.	G	35	5.421528	0.96111	.	.	ENSG00000065989	ENST00000419866;ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65	4.49	4.49	0.54785	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.121567	0.53938	D	0.000045	D	0.90253	0.6952	M	0.75615	2.305	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;1.0	D;D;D;P;D	0.91635	0.993;0.999;0.995;0.882;0.997	D	0.91616	0.5307	10	0.87932	D	0	.	14.6592	0.68858	0.0:0.0:1.0:0.0	.	245;340;518;553;579	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	H	21;557;579;553;518;340;245	ENSP00000370078:R557H;ENSP00000270474:R579H;ENSP00000293683:R553H;ENSP00000394754:R518H;ENSP00000341007:R340H	ENSP00000293683:R553H	R	+	2	0	PDE4A	10433668	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.697000	0.98697	2.062000	0.61559	0.484000	0.47621	CGC			0.577	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000451244.1			
RAD23A	5886	mdanderson.org	37	19	13058704	13058704	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:13058704G>T	ENST00000586534.1	+	2	176	c.115G>T	c.(115-117)Gat>Tat	p.D39Y	RAD23A_ENST00000541222.1_5'UTR|RAD23A_ENST00000592268.1_Missense_Mutation_p.D39Y|RAD23A_ENST00000316856.3_Missense_Mutation_p.D39Y|RAD23A_ENST00000588826.2_3'UTR			P54725	RD23A_HUMAN	RAD23 homolog A (S. cerevisiae)	39	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				nucleotide-excision repair (GO:0006289)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)|ubiquitin-specific protease binding (GO:1990381)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12						GAAGGGTCGTGATGCCTTCCC	0.498								Nucleotide excision repair (NER)																													p.D39Y													.	.			0			c.G115T												186.0	154.0	165.0					19																	13058704		2203	4300	6503	SO:0001583	missense	5886	exon2			GGTCGTGATGCCT		CCDS12289.1, CCDS59357.1, CCDS59358.1	19p13.2	2008-07-17	2001-11-28			ENSG00000179262			9812	protein-coding gene	gene with protein product	"""RAD23, yeast homolog, A"""	600061	"""RAD23 (S. cerevisiae) homolog A"""			7851894	Standard	NM_005053		Approved	HHR23A, MGC111083	uc002mvw.2	P54725		ENST00000586534.1:c.115G>T	19.37:g.13058704G>T	ENSP00000467024:p.Asp39Tyr		46	0	0		49	0.06	3	NM_001270363	460	0.00	0	K7ESE3|Q59EU8|Q5M7Z1	Missense_Mutation	SNP	ENST00000586534.1	37	CCDS12289.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258251	0.80246	.	.	ENSG00000179262	ENST00000316856	T	0.20881	2.04	5.05	5.05	0.67936	Ubiquitin supergroup (1);Ubiquitin (2);	0.058284	0.64402	D	0.000003	T	0.55305	0.1912	M	0.91354	3.2	0.80722	D	1	D;D;D	0.89917	1.0;0.991;1.0	D;D;D	0.91635	0.999;0.964;0.985	T	0.66452	-0.5920	10	0.87932	D	0	-14.0386	15.317	0.74089	0.0:0.0:1.0:0.0	.	39;56;39	A8K1J3;Q59EU8;P54725	.;.;RD23A_HUMAN	Y	39	ENSP00000321365:D39Y	ENSP00000321365:D39Y	D	+	1	0	RAD23A	12919704	1.000000	0.71417	0.744000	0.31058	0.998000	0.95712	8.591000	0.90824	2.334000	0.79466	0.650000	0.86243	GAT			0.498	RAD23A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000452752.1		NM_005053	
ELL	8178	broad.mit.edu	37	19	18572422	18572422	+	Missense_Mutation	SNP	G	G	T	rs562927955		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:18572422G>T	ENST00000262809.4	-	5	781	c.710C>A	c.(709-711)gCg>gAg	p.A237E	ELL_ENST00000596124.3_Missense_Mutation_p.A104E	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	237					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GTCCTTGTCCGCCTGCGTCAG	0.652			T	MLL	AL						OREG0025366	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A237E				Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	.	ELL	52		0			c.C710A												59.0	51.0	54.0					19																	18572422		2203	4300	6503	SO:0001583	missense	8178	exon5			TTGTCCGCCTGCG	U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.710C>A	19.37:g.18572422G>T	ENSP00000262809:p.Ala237Glu		35	0	0	726	56	0.05	3	NM_006532	108	0.00	0		Missense_Mutation	SNP	ENST00000262809.4	37	CCDS12380.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.257981	0.22965	.	.	ENSG00000105656	ENST00000262809	T	0.26957	1.7	4.52	2.21	0.28008	.	0.430763	0.24532	N	0.037707	T	0.17195	0.0413	N	0.14661	0.345	0.20638	N	0.999873	B;P	0.35124	0.336;0.485	B;B	0.39660	0.165;0.306	T	0.17899	-1.0354	10	0.62326	D	0.03	-23.0708	10.4179	0.44333	0.0:0.0:0.4401:0.5599	.	181;237	Q59HG4;P55199	.;ELL_HUMAN	E	237	ENSP00000262809:A237E	ENSP00000262809:A237E	A	-	2	0	ELL	18433422	0.995000	0.38212	0.868000	0.34077	0.059000	0.15707	2.473000	0.45145	1.101000	0.41535	0.555000	0.69702	GCG			0.652	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466362.1		NM_006532	
LIPE-AS1	100996307	broad.mit.edu	37	19	43057701	43057701	+	RNA	DEL	A	A	-	rs398041010|rs35431333		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:43057701delA	ENST00000594688.1	+	0	1450				LIPE-AS1_ENST00000594624.2_RNA	NR_073179.1				LIPE antisense RNA 1																		CAATTCCTGCaaaaaaaaaaa	0.468																																					.													.	.			0			.																																											0	.			TCCTGCAAAAAAA	AK096849, BM974950		19q13.2	2013-05-21			ENSG00000213904	ENSG00000213904		"""Long non-coding RNAs"""	48589	non-coding RNA	RNA, long non-coding							Standard	NR_073179		Approved				OTTHUMG00000182815		19.37:g.43057701delA			5	0	0		7	0.29	2	.	0		0		RNA	DEL	ENST00000594688.1	37																																																																																						0.468	LIPE-AS1-004	KNOWN	basic	antisense	antisense		OTTHUMT00000464099.1		NR_073179	
TPRX1	284355	broad.mit.edu	37	19	48305622	48305622	+	Missense_Mutation	SNP	A	A	G	rs201007421		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:48305622A>G	ENST00000322175.3	-	2	801	c.646T>C	c.(646-648)Tca>Cca	p.S216P	TPRX1_ENST00000535759.1_Missense_Mutation_p.S313P|TPRX1_ENST00000543508.1_Missense_Mutation_p.S206P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	216	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		tttgggcctgagattgggcct	0.667																																					p.S216P	Esophageal Squamous(123;175 2281 3051 32395)												TPRX1,caecum,carcinoma,0,2	TPRX1	46	2	0			c.T646C																																									SO:0001583	missense	284355	exon2			GGCCTGAGATTGG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.646T>C	19.37:g.48305622A>G	ENSP00000323455:p.Ser216Pro		49	0.0408163265	2		51	0.10	5	NM_198479	0		0	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.036234	0.00406	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.19250	2.16;2.16;2.16	0.365	-0.73	0.11154	.	.	.	.	.	T	0.07324	0.0185	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40701	-0.9549	8	0.02654	T	1	.	.	.	.	.	216	Q8N7U7	TPRX1_HUMAN	P	216;313;206	ENSP00000323455:S216P;ENSP00000438832:S313P;ENSP00000438712:S206P	ENSP00000323455:S216P	S	-	1	0	TPRX1	52997434	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	0.826000	0.27407	-2.735000	0.00382	-2.728000	0.00130	TCA			0.667	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000409868.1		NM_198479	
UBE2M	9040	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	59067702	59067702	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr19:59067702C>T	ENST00000253023.3	-	5	970	c.392G>A	c.(391-393)gGc>gAc	p.G131D	AC016629.8_ENST00000600726.1_RNA|AC016629.8_ENST00000600534.1_RNA|CHMP2A_ENST00000312547.2_5'Flank|CHMP2A_ENST00000601220.1_5'Flank|AC016629.8_ENST00000593642.1_RNA|CHMP2A_ENST00000600118.1_5'Flank	NM_003969.3	NP_003960.1	P61081	UBC12_HUMAN	ubiquitin-conjugating enzyme E2M	131					cellular protein modification process (GO:0006464)|positive regulation of neuron apoptotic process (GO:0043525)|protein neddylation (GO:0045116)|protein ubiquitination (GO:0016567)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|NEDD8 ligase activity (GO:0019788)|ribosomal S6-glutamic acid ligase activity (GO:0018169)|ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(2)|ovary(1)|pancreas(1)	5		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		ATACTGCAGGCCATAAATTAT	0.552																																					p.G131D													.	.			0			c.G392A												93.0	94.0	93.0					19																	59067702		2203	4300	6503	SO:0001583	missense	9040	exon5			TGCAGGCCATAAA	AB012191	CCDS12987.1	19q13.43	2011-05-19	2011-05-19		ENSG00000130725	ENSG00000130725		"""Ubiquitin-conjugating enzymes E2"""	12491	protein-coding gene	gene with protein product		603173	"""ubiquitin-conjugating enzyme E2M (homologous to yeast UBC12)"", ""ubiquitin-conjugating enzyme E2M (UBC12 homolog, yeast)"""			9694792	Standard	NM_003969		Approved	hUbc12, UBC12	uc002qtl.4	P61081		ENST00000253023.3:c.392G>A	19.37:g.59067702C>T	ENSP00000253023:p.Gly131Asp		115	0	0		118	0.09	11	NM_003969	349	0.13	45	O76069|Q8VC50	Missense_Mutation	SNP	ENST00000253023.3	37	CCDS12987.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.531995	0.64972	.	.	ENSG00000130725	ENST00000253023	T	0.73152	-0.72	4.62	3.55	0.40652	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.64402	D	0.000004	D	0.89770	0.6811	H	0.98754	4.32	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.92742	0.6209	10	0.87932	D	0	-13.5837	12.6159	0.56576	0.0:0.8317:0.1682:0.0	.	131	P61081	UBC12_HUMAN	D	131	ENSP00000253023:G131D	ENSP00000253023:G131D	G	-	2	0	UBE2M	63759514	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.137000	0.50562	1.280000	0.44463	0.655000	0.94253	GGC			0.552	UBE2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000467097.1		NM_003969	
ANKRD36BP2	645784	broad.mit.edu	37	2	89082294	89082295	+	RNA	INS	-	-	TT	rs368332037		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:89082294_89082295insTT	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		TTAAAGTCTCATATGTTGAACT	0.332																																					.													.	.			0			.																																											0	.			AGTCTCATATGTT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082294_89082295insTT			9	0	0		13	0.46	6	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89082296	89082297	+	RNA	INS	-	-	TC	rs370959214		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:89082296_89082297insTC	ENST00000393525.3	+	0	503									ankyrin repeat domain 36B pseudogene 2																		AAAGTCTCATATGTTGAACTAT	0.332																																					.													.	.			0			.																																											0	.			TCTCATATGTTGA			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89082296_89082297insTC			9	0	0		13	0.38	5	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.332	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
ANKRD36B	57730	broad.mit.edu	37	2	98192550	98192550	+	RNA	DEL	T	T	-	rs370632971|rs67020980		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:98192550delT	ENST00000443455.1	-	0	874							Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B																		CATGTGACTATTAAAAAAATA	0.184																																					.													.	.			0			.																																											57730	.			TGACTATTAAAAA	AK024934	CCDS74543.1	2q11.2	2013-01-11	2008-03-25	2008-03-25	ENSG00000196912	ENSG00000196912		"""Ankyrin repeat domain containing"""	29333	protein-coding gene	gene with protein product	"""melanoma-associated antigen"", ""CLL-associated antigen KW-1"""		"""KIAA1641"""	KIAA1641		10997877	Standard	NM_025190		Approved	FLJ21281	uc010yvc.1	Q8N2N9	OTTHUMG00000130547		2.37:g.98192550delT			6	0	0		6	0.50	3	.	0		0	Q08AK5|Q6IPR0|Q6PI49|Q8IZM7|Q8TDH6|Q96N30|Q9H759	RNA	DEL	ENST00000443455.1	37																																																																																						0.184	ANKRD36B-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000328967.2		NM_025190	
WASH2P	375260	broad.mit.edu	37	2	114355774	114355784	+	RNA	DEL	GAGGTGGCTGG	GAGGTGGCTGG	-	rs7578831		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	GAGGTGGCTGG	GAGGTGGCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr2:114355774_114355784delGAGGTGGCTGG	ENST00000538033.2	+	0	2154							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										ccctgtccccgaggtggctgggaggTGGCTC	0.611																																					.													.	.			0			.																																											0	.			GTCCCCGAGGTGG			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355774_114355784delGAGGTGGCTGG			4	0	0		10	0.30	3	.	4	0.00	0		RNA	DEL	ENST00000538033.2	37																																																																																						0.611	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
MYO18B	84700	mdanderson.org	37	22	26165374	26165374	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:26165374C>T	ENST00000407587.2	+	4	1660	c.1491C>T	c.(1489-1491)ggC>ggT	p.G497G	MYO18B_ENST00000536101.1_Silent_p.G497G|MYO18B_ENST00000335473.7_Silent_p.G497G			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	497						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						GCAAAGGAGGCCAGAGCAGAG	0.647																																					p.G497G													.	.			0			c.C1491T												6.0	8.0	7.0					22																	26165374		1999	4111	6110	SO:0001819	synonymous_variant	84700	exon4			AGGAGGCCAGAGC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1491C>T	22.37:g.26165374C>T			52	0	0		71	0.06	4	NM_032608	5	0.00	0	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	37																																																																																						0.647	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000400691.1		NM_032608	
LMF2	91289	mdanderson.org	37	22	50944863	50944863	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr22:50944863C>T	ENST00000474879.2	-	4	461	c.446G>A	c.(445-447)cGc>cAc	p.R149H	LMF2_ENST00000505981.1_5'UTR|LMF2_ENST00000216080.5_Missense_Mutation_p.R124H|NCAPH2_ENST00000299821.11_5'Flank|NCAPH2_ENST00000395701.3_5'Flank|LMF2_ENST00000380796.3_Missense_Mutation_p.R149H|NCAPH2_ENST00000395698.3_5'Flank|NCAPH2_ENST00000420993.2_5'Flank	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	149						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGCCTCCTTGCGGTGGGAGGC	0.677																																					p.R149H													.	.			0			c.G446A												10.0	13.0	12.0					22																	50944863		2140	4193	6333	SO:0001583	missense	91289	exon4			TCCTTGCGGTGGG	BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.446G>A	22.37:g.50944863C>T	ENSP00000424381:p.Arg149His		18	0	0		19	0.16	3	NM_033200	158	0.00	0	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Missense_Mutation	SNP	ENST00000474879.2	37	CCDS14093.2	.	.	.	.	.	.	.	.	.	.	c	3.666	-0.068504	0.07228	.	.	ENSG00000100258	ENST00000380796;ENST00000474879;ENST00000216080	T;T;T	0.32753	1.44;1.85;1.85	4.58	-1.65	0.08291	.	0.651332	0.15355	N	0.266754	T	0.11495	0.0280	N	0.16368	0.405	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.24657	-1.0154	10	0.10636	T	0.68	-13.4093	1.3942	0.02257	0.1292:0.3336:0.2586:0.2785	.	149;124	Q9BU23;Q9BU23-2	LMF2_HUMAN;.	H	149;149;124	ENSP00000370173:R149H;ENSP00000424381:R149H;ENSP00000216080:R124H	ENSP00000216080:R124H	R	-	2	0	LMF2	49291729	0.000000	0.05858	0.004000	0.12327	0.017000	0.09413	0.113000	0.15499	-0.096000	0.12329	0.651000	0.88453	CGC			0.677	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316833.2		NM_033200	
NPHP3	27031	broad.mit.edu	37	3	132426958	132426958	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr3:132426958G>T	ENST00000337331.5	-	7	1348	c.1262C>A	c.(1261-1263)aCc>aAc	p.T421N	NPHP3_ENST00000476742.1_5'UTR|NPHP3_ENST00000326682.8_Missense_Mutation_p.T421N	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	421					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GGCTTTGCTGGTCTTGTTTAG	0.403																																					p.T421N													.	NPHP3	110		0			c.C1262A												85.0	82.0	83.0					3																	132426958		2203	4300	6503	SO:0001583	missense	27031	exon7			TTGCTGGTCTTGT	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.1262C>A	3.37:g.132426958G>T	ENSP00000338766:p.Thr421Asn		121	0	0		92	0.03	3	NM_153240	20	0.00	0	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Missense_Mutation	SNP	ENST00000337331.5	37	CCDS3078.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.889305	0.52014	.	.	ENSG00000113971	ENST00000326682;ENST00000337331	D;D	0.91686	-2.89;-2.78	6.07	5.2	0.72013	.	0.287902	0.37348	N	0.002131	D	0.86732	0.6003	L	0.29908	0.895	0.80722	D	1	B	0.18166	0.026	B	0.14578	0.011	T	0.82295	-0.0528	10	0.34782	T	0.22	-0.7352	13.3792	0.60759	0.0759:0.0:0.9241:0.0	.	421	Q7Z494	NPHP3_HUMAN	N	421	ENSP00000319909:T421N;ENSP00000338766:T421N	ENSP00000319909:T421N	T	-	2	0	NPHP3	133909648	1.000000	0.71417	0.990000	0.47175	0.981000	0.71138	4.618000	0.61211	1.578000	0.49821	0.655000	0.94253	ACC			0.403	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000357020.2		NM_153240	
SI	6476	broad.mit.edu;mdanderson.org	37	3	164709207	164709207	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr3:164709207A>T	ENST00000264382.3	-	44	5104	c.5042T>A	c.(5041-5043)aTa>aAa	p.I1681K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1681	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATGTAGGTTTATTGTGTCATA	0.398										HNSCC(35;0.089)																											p.I1681K													.	SI	500		0			c.T5042A												146.0	132.0	137.0					3																	164709207		2203	4300	6503	SO:0001583	missense	6476	exon44			AGGTTTATTGTGT	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5042T>A	3.37:g.164709207A>T	ENSP00000264382:p.Ile1681Lys		135	0	0		125	0.05	6	NM_001041	0		0	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	37	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.937457	0.73557	.	.	ENSG00000090402	ENST00000264382	D	0.93366	-3.21	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.97860	0.9297	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99113	1.0847	10	0.87932	D	0	.	14.1377	0.65297	1.0:0.0:0.0:0.0	.	1681	P14410	SUIS_HUMAN	K	1681	ENSP00000264382:I1681K	ENSP00000264382:I1681K	I	-	2	0	SI	166191901	1.000000	0.71417	0.987000	0.45799	0.571000	0.35966	8.074000	0.89500	2.003000	0.58678	0.383000	0.25322	ATA			0.398	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350116.1		NM_001041	
KIT	3815	bcgsc.ca	37	4	55593603	55593603	+	Missense_Mutation	SNP	T	T	G	rs121913234|rs121913235		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:55593603T>G	ENST00000288135.5	+	11	1766	c.1669T>G	c.(1669-1671)Tgg>Ggg	p.W557G		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	557			Missing (in GIST; somatic mutation). {ECO:0000269|PubMed:15824741, ECO:0000269|PubMed:9438854}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.W557_K558del(120)|p.W557R(28)|p.W557G(23)|p.W557_E561del(17)|p.Y553_K558>(8)|p.E554_K558del(8)|p.M552_W557del(8)|p.K550_K558del(7)|p.W557_V559del(7)|p.Q556_V560del(6)|p.Y553_K558del(4)|p.W557del(4)|p.V555_K558del(3)|p.Y553_T574>S(3)|p.Y553_W557del(3)|p.V555_I571del(3)|p.V555_V560del(3)|p.V555_P573del(3)|p.Q556_V560>H(3)|p.V555_V559del(3)|p.W557_K558>E(2)|p.Q556_L576del(2)|p.K550_V559del(2)|p.W557_Q575del(2)|p.K550fs*6(2)|p.Q556_K558del(2)|p.V555_E562del(2)|p.W557_V560del(2)|p.Q556_V559del(2)|p.V555_G565del(1)|p.M552_W557>R(1)|p.Q556_W557del(1)|p.P551_K558del(1)|p.Q556_V559>H(1)|p.M552_E561>K(1)|p.V555_I563del(1)|p.W557_K558>S(1)|p.Q556_K558>HPCR(1)|p.E554_I571del(1)|p.Q556_V560>F(1)|p.V555_Y570del(1)|p.Q556_N566>SNNLQLY(1)|p.M552_T574>TESA(1)|p.Q556_D572>PS(1)|p.Q556_D572del(1)|p.W557_E562del(1)|p.V555_N566>D(1)|p.V555_V560>V(1)|p.Q556_V560>HNLQLY(1)|p.M552_K558del(1)|p.Q556_E561del(1)|p.Q556_K558>H(1)|p.Q556_E561>HH(1)|p.W557_I571del(1)|p.Q556_K558>R(1)|p.Q556_W557>R(1)|p.E554_N564del(1)|p.Q556_V560>TTF(1)|p.K550_W557del(1)|p.Q556_D572>H(1)|p.W557_V559>I(1)|p.M552_D572del(1)|p.Y553_V559>E(1)|p.Q556_T574del(1)|p.P551_V559del>L(1)|p.Q556_P573del(1)|p.E554_D572del(1)|p.Q556_V559>HT(1)|p.E554_E562del(1)|p.Y553_V559del(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TGAAGTACAGTGGAAGGTTGT	0.388		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.W557G			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,germ_cell_tumour,0,64	KIT	7396	64	323	Deletion - In frame(233)|Substitution - Missense(51)|Complex - deletion inframe(34)|Complex - insertion inframe(3)|Deletion - Frameshift(2)	soft_tissue(308)|skin(6)|haematopoietic_and_lymphoid_tissue(5)|testis(3)|genital_tract(1)	c.T1669G	GRCh37	CM005329	KIT	M	rs121913235							80.0	82.0	82.0					4																	55593603		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GTACAGTGGAAGG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1669T>G	4.37:g.55593603T>G	ENSP00000288135:p.Trp557Gly		123	0	0		143	0.01	1	NM_000222	212	0.00	1	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.231746	0.79688	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.95622	-3.76;-3.76	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000016	D	0.97974	0.9333	M	0.87617	2.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.994;0.981	D	0.98792	1.0736	10	0.87932	D	0	.	16.6003	0.84812	0.0:0.0:0.0:1.0	.	64;553;557	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	G	557;553	ENSP00000288135:W557G;ENSP00000390987:W553G	ENSP00000288135:W557G	W	+	1	0	KIT	55288360	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	7.880000	0.87243	2.319000	0.78375	0.533000	0.62120	TGG			0.388	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
LOC101927237	101927237	broad.mit.edu	37	4	68311853	68311855	+	lincRNA	DEL	GAG	GAG	-			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:68311853_68311855delGAG	ENST00000502400.1	-	0	34																											TCTCTATGGCGAGGAGGAGGAGG	0.547																																					.													.	.			0			.																																											0	.			TATGGCGAGGAGG																													4.37:g.68311862_68311864delGAG			8	0	0		6	0.17	1	.	11	0.00	0		RNA	DEL	ENST00000502400.1	37																																																																																						0.547	RP11-584P21.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000361926.2			
LINC00575	439934	broad.mit.edu	37	4	83542135	83542137	+	lincRNA	DEL	CAC	CAC	-	rs56218113|rs66550714	byFrequency	TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	CAC	CAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr4:83542135_83542137delCAC	ENST00000426551.1	-	0	226					NR_024087.1		Q6W349	CD011_HUMAN	long intergenic non-protein coding RNA 575																		TCTGTGGAATCACCACCACCTCG	0.498														1276	0.254792	0.2579	0.1888	5008	,	,		20040	0.3631		0.2346	False		,,,				2504	0.2065				.													.	.			0			.																																											0	.			TGGAATCACCACC	AY316301		4q21.23	2012-10-12	2012-02-24	2012-02-24	ENSG00000231782	ENSG00000231782		"""Long non-coding RNAs"""	21342	non-coding RNA	RNA, long non-coding			"""chromosome 4 open reading frame 11"""	C4orf11		15218245	Standard	NR_024087		Approved		uc011cck.2	Q6W349	OTTHUMG00000161121		4.37:g.83542141_83542143delCAC			4	0	0		8	0.50	4	.	0		0		RNA	DEL	ENST00000426551.1	37																																																																																						0.498	LINC00575-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000363866.2		NR_024087	
SEC24A	10802	mdanderson.org	37	5	134007576	134007576	+	Splice_Site	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr5:134007576G>T	ENST00000398844.2	+	4	1105	c.817G>T	c.(817-819)Gca>Tca	p.A273S	SEC24A_ENST00000322887.4_Splice_Site_p.A273S	NM_021982.2	NP_068817.1	O95486	SC24A_HUMAN	SEC24 family member A	273					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of protein secretion (GO:0050714)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045714)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	36			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TGGCTTATTGGGTGAGATGCT	0.328																																					p.A273S													.	.			0			c.G817T												137.0	120.0	126.0					5																	134007576		1833	4092	5925	SO:0001630	splice_region_variant	10802	exon4			TTATTGGGTGAGA	AJ131244	CCDS43363.1, CCDS58967.1	5q31.1	2013-10-21	2013-10-21		ENSG00000113615	ENSG00000113615			10703	protein-coding gene	gene with protein product		607183	"""SEC24 (S. cerevisiae) related gene family, member A"", ""SEC24 family, member A (S. cerevisiae)"""			10075675, 10329445	Standard	NM_021982		Approved		uc003kzs.3	O95486	OTTHUMG00000163064	ENST00000398844.2:c.817+1G>T	5.37:g.134007576G>T			52	0.0192307692	1		58	0.05	3	NM_021982	31	0.00	0	A8MVW3|Q8WUV2|Q96GP7	Missense_Mutation	SNP	ENST00000398844.2	37	CCDS43363.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062083	0.55432	.	.	ENSG00000113615	ENST00000398844;ENST00000322887	T;T	0.46819	1.14;0.86	5.28	5.28	0.74379	.	0.466007	0.21710	N	0.070281	T	0.45276	0.1334	L	0.59436	1.845	0.48511	D	0.999667	B	0.19445	0.036	B	0.17433	0.018	T	0.36672	-0.9738	10	0.14656	T	0.56	-11.5471	17.0754	0.86585	0.0:0.0:1.0:0.0	.	273	O95486	SC24A_HUMAN	S	273	ENSP00000381823:A273S;ENSP00000321749:A273S	ENSP00000321749:A273S	A	+	1	0	SEC24A	134035475	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.029000	0.70895	2.464000	0.83262	0.591000	0.81541	GCA			0.328	SEC24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371563.1			Missense_Mutation
GLYATL3	389396	broad.mit.edu;mdanderson.org	37	6	49494536	49494536	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr6:49494536T>G	ENST00000371197.4	+	6	889	c.776T>G	c.(775-777)cTc>cGc	p.L259R		NM_001010904.1	NP_001010904.1	Q5SZD4	GLYL3_HUMAN	glycine-N-acyltransferase-like 3	259						mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(3)|lung(1)|skin(3)|stomach(2)	11						TCTATAAGCCTCCTGAAGAGT	0.577																																					p.L259R													.	GLYATL3	19		0			c.T776G												50.0	57.0	55.0					6																	49494536		692	1591	2283	SO:0001583	missense	389396	exon6			TAAGCCTCCTGAA		CCDS47440.1	6p12.3	2009-12-14	2009-12-14	2009-12-14	ENSG00000203972	ENSG00000203972			21349	protein-coding gene	gene with protein product		614763	"""chromosome 6 open reading frame 140"""	C6orf140			Standard	NM_001010904		Approved	bA28H17.2	uc003ozi.3	Q5SZD4	OTTHUMG00000014818	ENST00000371197.4:c.776T>G	6.37:g.49494536T>G	ENSP00000360240:p.Leu259Arg		72	0	0		83	0.10	8	NM_001010904	0		0		Missense_Mutation	SNP	ENST00000371197.4	37	CCDS47440.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.617752	0.46736	.	.	ENSG00000203972	ENST00000371197	T	0.28895	1.59	6.06	6.06	0.98353	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.130361	0.52532	D	0.000077	T	0.48995	0.1531	M	0.81614	2.55	0.39812	D	0.972719	D	0.89917	1.0	D	0.81914	0.995	T	0.57165	-0.7858	10	0.72032	D	0.01	-1.7827	13.0011	0.58676	0.0:0.0:0.0:1.0	.	259	Q5SZD4	GLYL3_HUMAN	R	259	ENSP00000360240:L259R	ENSP00000360240:L259R	L	+	2	0	GLYATL3	49602495	0.128000	0.22383	0.526000	0.27913	0.007000	0.05969	2.368000	0.44222	2.324000	0.78689	0.533000	0.62120	CTC			0.577	GLYATL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040866.3		NM_001010904	
NT5C3A	51251	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	33102326	33102326	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:33102326C>G	ENST00000242210.7	-	1	83	c.7G>C	c.(7-9)Gcc>Ccc	p.A3P	NT5C3A_ENST00000610140.1_5'UTR	NM_001002009.2|NM_001002010.2	NP_001002009.1|NP_001002010.1	Q9H0P0	5NT3A_HUMAN	5'-nucleotidase, cytosolic IIIA	3					dephosphorylation (GO:0016311)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide metabolic process (GO:0009117)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside metabolic process (GO:0006213)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	2'-phosphotransferase activity (GO:0008665)|5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										ATGGACGGGGCCCTCATGCGC	0.687																																					p.A3P													.	.			0			c.G7C												7.0	7.0	7.0					7																	33102326		2110	4041	6151	SO:0001583	missense	0	exon1			ACGGGGCCCTCAT	AF312735	CCDS34616.1, CCDS34617.1, CCDS55101.1	7p14.3	2013-03-06	2013-03-06	2013-03-06	ENSG00000122643	ENSG00000122643	3.1.3.5		17820	protein-coding gene	gene with protein product	"""lupin"""	606224	"""5'-nucleotidase, cytosolic III"""	NT5C3		11042152, 10942414	Standard	NM_001002010		Approved	UMPH1, PSN1, PN-I, UMPH, P5'N-1, cN-III, p36, POMP, hUMP1	uc003tdk.4	Q9H0P0	OTTHUMG00000152983	ENST00000242210.7:c.7G>C	7.37:g.33102326C>G	ENSP00000242210:p.Ala3Pro		107	0	0		108	0.06	7	NM_001002010	19	0.05	1	A8K253|B2RAA5|B8ZZC4|Q6IPZ1|Q6NXS6|Q7L3G6|Q9P0P5|Q9UC42|Q9UC43|Q9UC44|Q9UC45	Missense_Mutation	SNP	ENST00000242210.7	37	CCDS34616.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647470	0.47258	.	.	ENSG00000122643	ENST00000242210	T	0.32272	1.46	4.63	0.709	0.18150	.	1.500820	0.05038	N	0.475778	T	0.15696	0.0378	N	0.08118	0	0.27133	N	0.961846	B	0.02656	0.0	B	0.01281	0.0	T	0.28332	-1.0047	10	0.87932	D	0	.	2.4023	0.04404	0.2921:0.4206:0.1883:0.099	.	3	Q9H0P0	5NT3_HUMAN	P	3	ENSP00000242210:A3P	ENSP00000242210:A3P	A	-	1	0	NT5C3	33068851	0.113000	0.22115	0.008000	0.14137	0.570000	0.35934	2.253000	0.43205	-0.080000	0.12685	0.491000	0.48974	GCC			0.687	NT5C3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328880.1		NM_016489	
GS1-124K5.11	493754	broad.mit.edu	37	7	65996561	65996561	+	lincRNA	DEL	T	T	-			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:65996561delT	ENST00000449307.3	-	0	1605																											TCCAGCTCCCTTTTGGGCAAA	0.632																																					.													.	.			0			.																																											0	.			GCTCCCTTTTGGG																													7.37:g.65996561delT			5	0	0		6	0.33	2	.	17	0.00	0		RNA	DEL	ENST00000449307.3	37																																																																																						0.632	GS1-124K5.11-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000345605.3			
GTF2IP7	101927126	broad.mit.edu	37	7	75729556	75729557	+	RNA	INS	-	-	A	rs61650407|rs57445555	byFrequency	TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:75729556_75729557insA	ENST00000434037.1	-	0	424																											CAGATATAATTAAAAAAAAACC	0.421														2570	0.513179	0.5666	0.4914	5008	,	,		19178	0.3681		0.5507	False		,,,				2504	0.5675				.													.	.			0			.																																											0	.			TATAATTAAAAAA																													7.37:g.75729565_75729565dupA			4	0	0		7	0.86	6	.	0		0		RNA	INS	ENST00000434037.1	37																																																																																						0.421	AC005077.12-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344843.1			
AZGP1P1	646282	broad.mit.edu	37	7	99578706	99578706	+	RNA	DEL	A	A	-	rs199656890		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:99578706delA	ENST00000425474.1	+	0	87					NR_036679.1				alpha-2-glycoprotein 1, zinc-binding pseudogene 1																		cttagtttacagtgaaaacaa	0.522																																					.													.	.			0			.																																											0	.			GTTTACAGTGAAA	AW995302		7q22.1	2010-04-16	2006-11-07		ENSG00000214313	ENSG00000214313			911	pseudogene	pseudogene			"""alpha-2-glycoprotein 1, zinc pseudogene 1"""			8241150, 8307568	Standard	NR_036679		Approved		uc003usi.2		OTTHUMG00000156513		7.37:g.99578706delA			6	0	0		7	0.43	3	.	0		0		RNA	DEL	ENST00000425474.1	37																																																																																						0.522	AZGP1P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000344467.1			
VGF	7425	mdanderson.org	37	7	100806424	100806424	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:100806424G>T	ENST00000249330.2	-	2	1940	c.1701C>A	c.(1699-1701)caC>caA	p.H567Q	VGF_ENST00000445482.2_Missense_Mutation_p.H567Q	NM_003378.3	NP_003369.2	O15240	VGF_HUMAN	VGF nerve growth factor inducible	567					defense response to bacterium (GO:0042742)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|ovarian follicle development (GO:0001541)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to dietary excess (GO:0002021)|response to insulin (GO:0032868)|sexual reproduction (GO:0019953)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				cervix(1)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	9	Lung NSC(181;0.168)|all_lung(186;0.215)					GCAAGGCGTGGTGGTAGTGGC	0.746																																					p.H567Q													.	.			0			c.C1701A												20.0	26.0	24.0					7																	100806424		2176	4247	6423	SO:0001583	missense	7425	exon2			GGCGTGGTGGTAG	Y12661	CCDS5712.1	7q22	2008-07-18			ENSG00000128564	ENSG00000128564			12684	protein-coding gene	gene with protein product	"""neuro-endocrine specific protein VGF"""	602186				9344675	Standard	NM_003378		Approved		uc003uxx.4	O15240	OTTHUMG00000157109	ENST00000249330.2:c.1701C>A	7.37:g.100806424G>T	ENSP00000249330:p.His567Gln		41	0	0		19	0.11	2	NM_003378	1	0.00	0	Q9UDW8	Missense_Mutation	SNP	ENST00000249330.2	37	CCDS5712.1	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257294	0.59321	.	.	ENSG00000128564	ENST00000249330;ENST00000445482	.	.	.	4.36	0.361	0.16107	.	0.531595	0.15334	U	0.267874	T	0.20129	0.0484	N	0.14661	0.345	0.29324	N	0.867163	P	0.35982	0.531	B	0.37888	0.26	T	0.13818	-1.0495	9	0.56958	D	0.05	-10.572	6.124	0.20170	0.489:0.0:0.511:0.0	.	567	O15240	VGF_HUMAN	Q	567	.	ENSP00000249330:H567Q	H	-	3	2	VGF	100593144	0.970000	0.33590	0.994000	0.49952	0.985000	0.73830	0.115000	0.15540	-0.003000	0.14444	0.484000	0.47621	CAC			0.746	VGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347462.1		NM_003378	
BRAF	673	broad.mit.edu	37	7	140477807	140477807	+	Missense_Mutation	SNP	C	C	T	rs180177038		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr7:140477807C>T	ENST00000288602.6	-	12	1561	c.1501G>A	c.(1501-1503)Gaa>Aaa	p.E501K		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	501	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		E -> G (in CFC1). {ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404}.|E -> K (in CFC1). {ECO:0000269|PubMed:16439621, ECO:0000269|PubMed:16474404, ECO:0000269|PubMed:19206169}.		activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	ACTCCTACTTCATTTTTGAAG	0.398		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												p.E501K	Colon(40;35 892 2973 5743 27438)			Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	.	BRAF	36346		0			c.G1501A	GRCh37	CM060879	BRAF	M	rs180177038							108.0	97.0	100.0					7																	140477807		2203	4300	6503	SO:0001583	missense	673	exon12	Familial Cancer Database	CFC, CFCS	CTACTTCATTTTT	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.1501G>A	7.37:g.140477807C>T	ENSP00000288602:p.Glu501Lys		146	0	0		134	0.04	5	NM_004333	36	0.06	2	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Missense_Mutation	SNP	ENST00000288602.6	37	CCDS5863.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.126876|5.126876	0.94429|0.94429	.|.	.|.	ENSG00000157764|ENSG00000157764	ENST00000288602|ENST00000496384	D|.	0.99706|.	-6.47|.	4.96|4.96	4.96|4.96	0.65561|0.65561	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87485|0.87485	0.6189|0.6189	H|H	0.95365|0.95365	3.66|3.66	0.80722|0.80722	A|A	1|1	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.91572|0.91572	0.5272|0.5272	9|4	0.72032|.	D|.	0.01|.	.|.	17.8683|17.8683	0.88803|0.88803	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	501|.	P15056|.	BRAF_HUMAN|.	K|I	501|108	ENSP00000288602:E501K|.	ENSP00000288602:E501K|.	E|M	-|-	1|3	0|0	BRAF|BRAF	140124276|140124276	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.782000|7.782000	0.85680|0.85680	2.287000|2.287000	0.76781|0.76781	0.579000|0.579000	0.79373|0.79373	GAA|ATG			0.398	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348886.1	rescued with RNA-seq	NM_004333	
ERICH1	157697	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	623373	623373	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:623373C>T	ENST00000262109.7	-	4	1056	c.979G>A	c.(979-981)Gag>Aag	p.E327K	ERICH1_ENST00000518277.1_5'Flank|ERICH1_ENST00000522706.1_Missense_Mutation_p.E233K	NM_207332.1	NP_997215.1	Q86X53	ERIC1_HUMAN	glutamate-rich 1	327	Glu-rich.									endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)	20		Colorectal(14;0.158)|Ovarian(12;0.17)|Myeloproliferative disorder(644;0.185)|Hepatocellular(245;0.236)		Epithelial(5;3.29e-14)|BRCA - Breast invasive adenocarcinoma(11;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(5;3.65e-06)|READ - Rectum adenocarcinoma(1;0.0325)		TCATCTTCCTCGCTGGCGTCT	0.502																																					p.E327K													ERICH1,NS,carcinoma,+1,1	ERICH1	1	1	0			c.G979A												154.0	159.0	157.0					8																	623373		2203	4300	6503	SO:0001583	missense	157697	exon4			CTTCCTCGCTGGC		CCDS5955.1	8p23.3	2005-09-01			ENSG00000104714	ENSG00000104714			27234	protein-coding gene	gene with protein product							Standard	NM_207332		Approved		uc003wph.3	Q86X53	OTTHUMG00000129163	ENST00000262109.7:c.979G>A	8.37:g.623373C>T	ENSP00000262109:p.Glu327Lys		134	0	0		170	0.15	25	NM_207332	75	0.15	11	A8K2J9|Q9P063	Missense_Mutation	SNP	ENST00000262109.7	37	CCDS5955.1	.	.	.	.	.	.	.	.	.	.	C	9.333	1.061088	0.19987	.	.	ENSG00000104714	ENST00000543819;ENST00000522706;ENST00000262109	T;T	0.34859	1.34;1.37	4.18	1.34	0.21922	.	0.606585	0.15774	N	0.245313	T	0.18215	0.0437	N	0.12182	0.205	0.20196	N	0.99992	B;B;B	0.21452	0.056;0.056;0.056	B;B;B	0.20384	0.029;0.018;0.02	T	0.21552	-1.0242	10	0.25751	T	0.34	-12.1972	8.0641	0.30651	0.0:0.5362:0.3689:0.0948	.	327;327;233	B4DMI5;Q86X53;E5RHA3	.;ERIC1_HUMAN;.	K	327;233;327	ENSP00000428635:E233K;ENSP00000262109:E327K	ENSP00000262109:E327K	E	-	1	0	ERICH1	613373	0.910000	0.30920	0.145000	0.22337	0.009000	0.06853	2.883000	0.48554	0.283000	0.22279	-0.122000	0.15005	GAG			0.502	ERICH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251228.3		NM_207332	
PURG	29942	bcgsc.ca	37	8	30889696	30889696	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:30889696G>T	ENST00000475541.1	-	1	1535	c.603C>A	c.(601-603)acC>acA	p.T201T	PURG_ENST00000339382.2_Silent_p.T201T|WRN_ENST00000298139.5_5'Flank	NM_013357.2	NP_037489.1	Q9UJV8	PURG_HUMAN	purine-rich element binding protein G	201						nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(542;0.0895)|Kidney(114;0.108)		CCCGCATCATGGTTTGTCTAA	0.458																																					p.T201T													PURG_ENST00000475541,colon,carcinoma,-2,2	PURG	79	2	0			c.C603A												92.0	87.0	89.0					8																	30889696		2203	4300	6503	SO:0001819	synonymous_variant	29942	exon1			CATCATGGTTTGT	AF195513	CCDS34878.1, CCDS6081.1	8p11	2004-02-09			ENSG00000172733	ENSG00000172733			17930	protein-coding gene	gene with protein product						12034829	Standard	NM_013357		Approved	PURG-A, PURG-B	uc003xin.3	Q9UJV8	OTTHUMG00000157357	ENST00000475541.1:c.603C>A	8.37:g.30889696G>T			117	0	0		156	0.01	1	NM_013357	1	0.00	0	Q8TE64	Silent	SNP	ENST00000475541.1	37	CCDS6081.1																																																																																					0.458	PURG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000348565.1		NM_013357	
MTFR1	9650	mdanderson.org	37	8	66620263	66620263	+	Intron	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:66620263G>T	ENST00000262146.4	+	7	1059				MTFR1_ENST00000458689.2_Intron	NM_014637.3	NP_055452.3	Q15390	MTFR1_HUMAN	mitochondrial fission regulator 1						aerobic respiration (GO:0009060)|mitochondrial fission (GO:0000266)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|pancreas(1)|urinary_tract(1)	11			Epithelial(68;0.0526)|BRCA - Breast invasive adenocarcinoma(89;0.156)|all cancers(69;0.171)|OV - Ovarian serous cystadenocarcinoma(28;0.194)			TATTTGCCCAGATTTCTTTCC	0.423																																					p.R317I													.	.			0			c.G950T												96.0	98.0	98.0					8																	66620263		2202	4300	6502	SO:0001627	intron_variant	9650	exon7			TGCCCAGATTTCT		CCDS6182.1, CCDS55240.1	8q13.1	2012-11-30							29510	protein-coding gene	gene with protein product	"""likely ortholog of chicken chondrocyte protein with a poly proline region"""					7584026, 7584028, 15389597	Standard	NM_014637		Approved	CHPPR, KIAA0009, FAM54A2	uc003xvn.2	Q15390		ENST00000262146.4:c.933+17G>T	8.37:g.66620263G>T			31	0	0		39	0.08	3	NM_001145839	2	0.00	0	E7EP84|Q6IB94|Q7Z669|Q86XH5|Q8IVD7	Missense_Mutation	SNP	ENST00000262146.4	37	CCDS6182.1																																																																																					0.423	MTFR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378894.1		NM_014637	
KHDRBS3	10656	broad.mit.edu	37	8	136659295	136659295	+	Missense_Mutation	SNP	G	G	T	rs138429826		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:136659295G>T	ENST00000355849.5	+	9	1419	c.1009G>T	c.(1009-1011)Gtc>Ttc	p.V337F	KHDRBS3_ENST00000520981.1_Missense_Mutation_p.V110F	NM_006558.1	NP_006549.1	O75525	KHDR3_HUMAN	KH domain containing, RNA binding, signal transduction associated 3	337					regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	26	all_epithelial(106;2.85e-16)|all_neural(2;2.72e-06)|Lung NSC(106;3.95e-06)|all_lung(105;1.11e-05)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.247)			AGCAAAGGGCGTCTACAGAGA	0.433																																					p.V337F													.	KHDRBS3	53		0			c.G1009T												130.0	116.0	121.0					8																	136659295		2203	4300	6503	SO:0001583	missense	10656	exon9			AAGGGCGTCTACA	AF069681	CCDS6374.1	8q24.23	2008-05-15			ENSG00000131773	ENSG00000131773			18117	protein-coding gene	gene with protein product		610421				10332027, 10564820	Standard	XR_242372		Approved	T-STAR, Etle, etoile, SALP, SLM2, SLM-2	uc003yuv.3	O75525	OTTHUMG00000164164	ENST00000355849.5:c.1009G>T	8.37:g.136659295G>T	ENSP00000348108:p.Val337Phe		108	0.0092592593	1		163	0.03	5	NM_006558	210	0.00	0	Q6NUL8|Q9UPA8	Missense_Mutation	SNP	ENST00000355849.5	37	CCDS6374.1	.	.	.	.	.	.	.	.	.	.	G	15.13	2.743088	0.49151	.	.	ENSG00000131773	ENST00000355849;ENST00000520981	T;T	0.45668	0.91;0.89	5.37	1.51	0.23008	.	0.560450	0.15975	N	0.235584	T	0.40932	0.1137	L	0.36672	1.1	0.43114	D	0.994828	D	0.59767	0.986	P	0.55545	0.778	T	0.14144	-1.0483	10	0.17832	T	0.49	-6.9609	9.1772	0.37118	0.3655:0.0:0.6345:0.0	.	337	O75525	KHDR3_HUMAN	F	337;110	ENSP00000348108:V337F;ENSP00000428607:V110F	ENSP00000348108:V337F	V	+	1	0	KHDRBS3	136728477	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	1.938000	0.40203	0.327000	0.23409	0.655000	0.94253	GTC			0.433	KHDRBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377529.1			
ZNF696	79943	mdanderson.org	37	8	144378441	144378441	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:144378441A>G	ENST00000330143.3	+	3	1005	c.596A>G	c.(595-597)cAc>cGc	p.H199R		NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	199					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			CTCCTCCGGCACCAGCGCGTG	0.731																																					p.H199R													.	.			0			c.A596G												14.0	15.0	15.0					8																	144378441		2196	4288	6484	SO:0001583	missense	79943	exon3			TCCGGCACCAGCG	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.596A>G	8.37:g.144378441A>G	ENSP00000328515:p.His199Arg		11	0	0		12	0.25	3	NM_030895	24	0.04	1	A0AVE2	Missense_Mutation	SNP	ENST00000330143.3	37	CCDS6399.1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927304	0.73327	.	.	ENSG00000185730	ENST00000518575;ENST00000330143	T;D	0.86865	0.18;-2.18	3.09	3.09	0.35607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94518	0.8235	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94482	0.7694	8	.	.	.	.	9.5197	0.39126	1.0:0.0:0.0:0.0	.	199	Q9H7X3	ZN696_HUMAN	R	199	ENSP00000427857:H199R;ENSP00000328515:H199R	.	H	+	2	0	ZNF696	144449816	1.000000	0.71417	0.207000	0.23584	0.008000	0.06430	4.430000	0.59907	1.404000	0.46819	0.450000	0.29827	CAC			0.731	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381164.2		NM_030895	
ZC3H3	23144	mdanderson.org	37	8	144590009	144590009	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr8:144590009C>T	ENST00000262577.5	-	4	1653	c.1622G>A	c.(1621-1623)cGc>cAc	p.R541H		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	541					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CTTGACAATGCGGTAGCGGGT	0.647																																					p.R541H													.	.			0			c.G1622A												85.0	92.0	90.0					8																	144590009		2203	4300	6503	SO:0001583	missense	23144	exon4			ACAATGCGGTAGC	D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1622G>A	8.37:g.144590009C>T	ENSP00000262577:p.Arg541His		29	0	0		40	0.08	3	NM_015117	98	0.00	0	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	ENST00000262577.5	37	CCDS6402.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873561	0.51695	.	.	ENSG00000014164	ENST00000262577;ENST00000528401	T	0.04502	3.61	5.73	5.73	0.89815	.	0.079566	0.49916	D	0.000139	T	0.20495	0.0493	M	0.66939	2.045	0.43798	D	0.996348	D	0.89917	1.0	D	0.79108	0.992	T	0.00015	-1.2399	10	0.72032	D	0.01	-22.753	16.6115	0.84884	0.0:1.0:0.0:0.0	.	541	Q8IXZ2	ZC3H3_HUMAN	H	541;1	ENSP00000262577:R541H	ENSP00000262577:R541H	R	-	2	0	ZC3H3	144661152	1.000000	0.71417	0.999000	0.59377	0.795000	0.44927	3.216000	0.51176	2.698000	0.92095	0.563000	0.77884	CGC			0.647	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382011.2		NM_015117	
MYO5BP3	441442	bcgsc.ca	37	9	68358239	68358239	+	IGR	SNP	G	G	T	rs112095944		TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr9:68358239G>T								RP11-149F8.5 (17595 upstream) : RP11-764K9.1 (39638 downstream)																							GGTGGTGGAGGTCATCAGGGA	0.512																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	441442	.			GTGGAGGTCATCA																													9.37:g.68358239G>T			35	0.0857142857	3		34	0.06	2	.	1	0.00	0		RNA	SNP		37																																																																																					0	0.512										
APBA1	320	mdanderson.org	37	9	72131575	72131575	+	Silent	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chr9:72131575G>T	ENST00000265381.4	-	2	774	c.552C>A	c.(550-552)tcC>tcA	p.S184S		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	184			S -> A (in dbSNP:rs34788368).		axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						CATAGGGCTCGGAGTAGGGCT	0.662																																					p.S184S													.	.			0			c.C552A												34.0	32.0	32.0					9																	72131575		2201	4297	6498	SO:0001819	synonymous_variant	320	exon2			GGGCTCGGAGTAG	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.552C>A	9.37:g.72131575G>T			47	0	0		46	0.07	3	NM_001163	4	0.00	0	O14914|O60570|Q5VYR8	Silent	SNP	ENST00000265381.4	37	CCDS6630.1																																																																																					0.662	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052589.2		NM_001163	
STS	412	broad.mit.edu	37	X	7177555	7177555	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:7177555T>C	ENST00000217961.4	+	5	783	c.563T>C	c.(562-564)cTc>cCc	p.L188P		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	188					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CTGGTCTTCCTCCCCCTGCAG	0.542									Ichthyosis																												p.L188P													.	STS	64		0			c.T563C												95.0	69.0	77.0					X																	7177555		2203	4299	6502	SO:0001583	missense	412	exon5	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTTCCTCCCCCT	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.563T>C	X.37:g.7177555T>C	ENSP00000217961:p.Leu188Pro		110	0.0181818182	2		134	0.02	3	NM_000351	15	0.00	0	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	T	13.48	2.249717	0.39797	.	.	ENSG00000101846	ENST00000217961	D	0.93659	-3.26	3.85	3.85	0.44370	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	2.068010	0.03239	N	0.180114	D	0.91945	0.7449	L	0.42245	1.32	0.22412	N	0.999123	P	0.44380	0.834	B	0.43701	0.428	T	0.81733	-0.0798	10	0.36615	T	0.2	.	9.5832	0.39501	0.0:0.0:0.0:1.0	.	188	P08842	STS_HUMAN	P	188	ENSP00000217961:L188P	ENSP00000217961:L188P	L	+	2	0	STS	7187555	0.015000	0.18098	0.008000	0.14137	0.028000	0.11728	2.045000	0.41250	1.255000	0.44051	0.441000	0.28932	CTC			0.542	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055686.1		NM_000351	
ZFX	7543	bcgsc.ca	37	X	24228773	24228773	+	Silent	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:24228773C>T	ENST00000379177.1	+	11	2125	c.1698C>T	c.(1696-1698)caC>caT	p.H566H	ZFX_ENST00000379188.3_Silent_p.H566H|ZFX_ENST00000539115.1_Silent_p.H337H|ZFX_ENST00000304543.5_Silent_p.H566H|ZFX_ENST00000540034.1_Silent_p.H605H|ZFX_ENST00000338565.3_Silent_p.H516H	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	566					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						TCAAAAAGCACATGAGAATCC	0.453																																					p.H566H	Esophageal Squamous(20;306 562 7346 32868 37983)												.	ZFX	61		0			c.C1698T												109.0	99.0	103.0					X																	24228773		2203	4300	6503	SO:0001819	synonymous_variant	7543	exon10			AAAGCACATGAGA		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.1698C>T	X.37:g.24228773C>T			166	0	0		235	0.00	0	NM_003410	45	0.00	0	B9EG97|O43668|Q8WYJ8	Silent	SNP	ENST00000379177.1	37	CCDS14211.1																																																																																					0.453	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056084.1		NM_003410	
DDX3X	1654	bcgsc.ca	37	X	41204800	41204801	+	Splice_Site	INS	-	-	G			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:41204800_41204801insG	ENST00000399959.2	+	12	2169_2170	c.1314_1315insG	c.(1315-1317)ggc>Gggc	p.G439fs	DDX3X_ENST00000441189.2_Intron|DDX3X_ENST00000457138.2_Splice_Site_p.G423fs|DDX3X_ENST00000478993.1_3'UTR|RN7SL15P_ENST00000582825.1_RNA|DDX3X_ENST00000542215.1_3'UTR	NM_001193416.1|NM_001193417.1|NM_001356.3	NP_001180345.1|NP_001180346.1|NP_001347.3	O00571	DDX3X_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 3, X-linked	439	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with GSK3B.|Necessary for interaction with XPO1.				ATP catabolic process (GO:0006200)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to osmotic stress (GO:0071470)|chromosome segregation (GO:0007059)|DNA duplex unwinding (GO:0032508)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|mature ribosome assembly (GO:0042256)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell growth (GO:0030307)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of translational initiation (GO:0045948)|response to virus (GO:0009615)|RNA secondary structure unwinding (GO:0010501)|stress granule assembly (GO:0034063)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 5'-UTR binding (GO:0048027)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|transcription factor binding (GO:0008134)|translation initiation factor binding (GO:0031369)			NS(3)|breast(8)|central_nervous_system(36)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84						TAAATGCAACAGGTAACATTAT	0.411										HNSCC(61;0.18)																											p.T438fs													.	DDX3X	138		0			c.1314_1315insG																																									SO:0001630	splice_region_variant	1654	exon12			TGCAACAGGTAAC	U50553	CCDS43931.1, CCDS55404.1	Xp11.3-p11.23	2013-07-16	2013-07-16	2003-06-20	ENSG00000215301	ENSG00000215301		"""DEAD-boxes"""	2745	protein-coding gene	gene with protein product		300160	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, X-linked"""	DDX3		9381176, 9730595	Standard	NM_001193416		Approved	DBX, HLP2, DDX14	uc004dfe.3	O00571	OTTHUMG00000021369	ENST00000399959.2:c.1315+1->G	X.37:g.41204802_41204802dupG			226	0	0		259	0.00	0	NM_001356	375	0.00	0	A8K538|B4E3E8|O15536	Frame_Shift_Ins	INS	ENST00000399959.2	37	CCDS43931.1																																																																																					0.411	DDX3X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056253.1		NM_024005	Frame_Shift_Ins
KDM5C	8242	broad.mit.edu	37	X	53231044	53231044	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:53231044C>T	ENST00000375401.3	-	13	2390	c.1858G>A	c.(1858-1860)Gct>Act	p.A620T	KDM5C_ENST00000375379.3_Missense_Mutation_p.A620T|KDM5C_ENST00000404049.3_Missense_Mutation_p.A619T|KDM5C_ENST00000452825.3_Missense_Mutation_p.A553T|KDM5C_ENST00000375383.3_Missense_Mutation_p.A579T|KDM5C_ENST00000465402.1_5'UTR	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	620	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						ACCCAGTCAGCAGTGCAAAAG	0.547			"""N, F, S"""		clear cell renal carcinoma																																p.A620T				Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	385		0			c.G1858A												103.0	85.0	91.0					X																	53231044		2203	4300	6503	SO:0001583	missense	8242	exon13			AGTCAGCAGTGCA	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1858G>A	X.37:g.53231044C>T	ENSP00000364550:p.Ala620Thr		125	0	0		150	0.03	5	NM_004187	240	0.00	0	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	37	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375506	0.82682	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5	5.68	5.68	0.88126	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	T	0.71298	0.3323	M	0.62266	1.93	0.80722	D	1	B;P;B	0.36789	0.099;0.57;0.275	B;B;B	0.38683	0.082;0.279;0.158	T	0.75091	-0.3440	10	0.87932	D	0	-3.3015	16.0037	0.80327	0.0:1.0:0.0:0.0	.	553;619;620	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	T	553;620;619;620;579	ENSP00000445176:A553T;ENSP00000364550:A620T;ENSP00000385394:A619T;ENSP00000364528:A620T;ENSP00000364532:A579T	ENSP00000364528:A620T	A	-	1	0	KDM5C	53247769	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.818000	0.86416	2.380000	0.81148	0.600000	0.82982	GCT			0.547	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000056737.2		NM_004187	
HCFC1	3054	mdanderson.org	37	X	153222908	153222908	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAKO-05A-11D-A42Y-10	TCGA-2G-AAKO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6158162d-f33a-4e39-9246-b19175ac7ba7	ca26dacd-984e-46b3-ad5e-671c3c639fbf	g.chrX:153222908G>T	ENST00000310441.7	-	13	3176	c.2210C>A	c.(2209-2211)aCt>aAt	p.T737N	HCFC1_ENST00000354233.3_Missense_Mutation_p.T668N|HCFC1_ENST00000369984.4_Missense_Mutation_p.T737N|HCFC1_ENST00000461098.1_5'Flank	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	737					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTGCGTGGTAGTGATGATGGT	0.622																																					p.T737N													.	.			0			c.C2210A												92.0	96.0	95.0					X																	153222908		2152	4224	6376	SO:0001583	missense	3054	exon13			GTGGTAGTGATGA		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.2210C>A	X.37:g.153222908G>T	ENSP00000309555:p.Thr737Asn		44	0	0		44	0.07	3	NM_005334	118	0.00	0	Q6P4G5	Missense_Mutation	SNP	ENST00000310441.7	37	CCDS44020.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785963	0.90282	.	.	ENSG00000172534	ENST00000310441;ENST00000369984;ENST00000354233	T;T;T	0.03553	3.92;3.93;3.89	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.10981	0.0268	L	0.27053	0.805	0.54753	D	0.999982	D	0.76494	0.999	D	0.80764	0.994	T	0.09250	-1.0683	10	0.66056	D	0.02	.	17.3314	0.87265	0.0:0.0:1.0:0.0	.	737	P51610	HCFC1_HUMAN	N	737;737;668	ENSP00000309555:T737N;ENSP00000359001:T737N;ENSP00000346174:T668N	ENSP00000309555:T737N	T	-	2	0	HCFC1	152876102	1.000000	0.71417	0.950000	0.38849	0.899000	0.52679	9.207000	0.95064	2.360000	0.80028	0.600000	0.82982	ACT			0.622	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000061099.4		NM_005334	
