#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TIE1	7075	broad.mit.edu	37	1	43779569	43779569	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:43779569T>C	ENST00000372476.3	+	14	2418	c.2339T>C	c.(2338-2340)cTt>cCt	p.L780P	TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Missense_Mutation_p.L425P	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	780					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTGGCTGCCCTTTTAACCCTG	0.647																																					p.L780P													.	TIE1	132		0			c.T2339C												77.0	71.0	73.0					1																	43779569		2203	4300	6503	SO:0001583	missense	7075	exon14			CTGCCCTTTTAAC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2339T>C	1.37:g.43779569T>C	ENSP00000361554:p.Leu780Pro		66	0	0		117	0.03	3	NM_005424	67	0.00	0	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	37	CCDS482.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711650	0.68730	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	T;T	0.79141	-1.2;-1.24	5.73	5.73	0.89815	.	0.000000	0.36167	N	0.002758	D	0.83774	0.5327	L	0.39898	1.24	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.998	D	0.85414	0.1139	10	0.72032	D	0.01	.	15.6798	0.77357	0.0:0.0:0.0:1.0	.	425;735;425;780	E9PG63;B4DTW8;B4DKW0;P35590	.;.;.;TIE1_HUMAN	P	780;183;63;425	ENSP00000361554:L780P;ENSP00000411728:L425P	ENSP00000361553:L183P	L	+	2	0	TIE1	43552156	1.000000	0.71417	0.276000	0.24689	0.200000	0.23975	7.594000	0.82698	2.187000	0.69744	0.533000	0.62120	CTT			0.647	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019011.1		NM_005424	
ZYG11A	440590	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	53343407	53343409	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	CTT	CTT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:53343407_53343409delCTT	ENST00000371528.1	+	9	1744_1746	c.1596_1598delCTT	c.(1594-1599)accttc>acc	p.F533del	ZYG11A_ENST00000371532.1_In_Frame_Del_p.F191del	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	533										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						ATGATGTCACCTTCTTGTTTACT	0.379																																					p.532_533del													.	ZYG11A	46		0			c.1595_1597del																																									SO:0001651	inframe_deletion	440590	exon9			TGTCACCTTCTTG		CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.1596_1598delCTT	1.37:g.53343410_53343412delCTT	ENSP00000360583:p.Phe533del		93	0	0		154	0.27	41	NM_001004339	4	0.00	0	A6NCK5	In_Frame_Del	DEL	ENST00000371528.1	37	CCDS44148.1																																																																																					0.379	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000024856.3		NM_001004339	
LRRC8B	23507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	90058405	90058405	+	Missense_Mutation	SNP	A	A	T	rs201504233		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:90058405A>T	ENST00000330947.2	+	6	2575	c.2215A>T	c.(2215-2217)Aat>Tat	p.N739Y	RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000358200.4_Missense_Mutation_p.N739Y|LRRC8B_ENST00000439853.1_Missense_Mutation_p.N739Y	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	739					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TAGCTTGATGAATTTGTCCCC	0.433																																					p.N739Y													.	.			0			c.A2215T												119.0	113.0	115.0					1																	90058405		2203	4300	6503	SO:0001583	missense	23507	exon6			TTGATGAATTTGT	AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.2215A>T	1.37:g.90058405A>T	ENSP00000332674:p.Asn739Tyr		70	0	0		138	0.23	32	NM_015350	26	0.31	8	D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	ENST00000330947.2	37	CCDS724.1	.	.	.	.	.	.	.	.	.	.	A	9.623	1.134476	0.21123	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.00986	5.47;5.47;5.47	5.94	3.7	0.42460	.	0.635976	0.15743	N	0.246829	T	0.00328	0.0010	L	0.38175	1.15	0.20873	N	0.999833	B	0.19583	0.037	B	0.16289	0.015	T	0.46884	-0.9159	9	.	.	.	.	5.1045	0.14777	0.5932:0.1447:0.2621:0.0	.	739	Q6P9F7	LRC8B_HUMAN	Y	739	ENSP00000332674:N739Y;ENSP00000350933:N739Y;ENSP00000400704:N739Y	.	N	+	1	0	LRRC8B	89830993	0.985000	0.35326	0.951000	0.38953	0.997000	0.91878	1.148000	0.31614	0.560000	0.29169	0.455000	0.32223	AAT	0.001		0.433	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000028008.1		NM_015350	
FLAD1	80308	broad.mit.edu	37	1	154962054	154962054	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:154962054A>G	ENST00000292180.3	+	3	1458	c.1136A>G	c.(1135-1137)aAg>aGg	p.K379R	FLAD1_ENST00000315144.10_Missense_Mutation_p.K282R|FLAD1_ENST00000295530.2_Intron|FLAD1_ENST00000368432.1_Missense_Mutation_p.K282R|FLAD1_ENST00000405236.2_Intron|FLAD1_ENST00000368433.1_Missense_Mutation_p.K379R|FLAD1_ENST00000368428.1_5'UTR	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	379					FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TTGGGGAAAAAGGTGGCAGGT	0.567																																					p.K379R													FLAD1,right_upper_lobe,carcinoma,0,1	FLAD1	52	1	0			c.A1136G												96.0	94.0	95.0					1																	154962054		2203	4300	6503	SO:0001583	missense	80308	exon3			GGAAAAAGGTGGC		CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.1136A>G	1.37:g.154962054A>G	ENSP00000292180:p.Lys379Arg		40	0	0		119	0.03	4	NM_025207	138	0.00	0	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Missense_Mutation	SNP	ENST00000292180.3	37	CCDS1078.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.721895	0.48728	.	.	ENSG00000160688	ENST00000368433;ENST00000315144;ENST00000368432;ENST00000292180	.	.	.	5.31	5.31	0.75309	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	L	0.49350	1.555	0.80722	D	1	B	0.27656	0.184	B	0.25506	0.061	T	0.39418	-0.9615	9	0.25751	T	0.34	-30.8648	15.1009	0.72276	1.0:0.0:0.0:0.0	.	379	Q8NFF5	FAD1_HUMAN	R	379;282;282;379	.	ENSP00000292180:K379R	K	+	2	0	FLAD1	153228678	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	6.953000	0.75995	2.236000	0.73375	0.533000	0.62120	AAG			0.567	FLAD1-001	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000091089.1		NM_025207	
ETV3	2117	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	1	157094985	157094985	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:157094985G>A	ENST00000368192.4	-	5	1251	c.1187C>T	c.(1186-1188)tCg>tTg	p.S396L		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	396					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CTCTCGTGCCGACTGCCTGAG	0.562																																					p.S396L													.	.			0			c.C1187T												119.0	101.0	106.0					1																	157094985		692	1591	2283	SO:0001583	missense	2117	exon5			CGTGCCGACTGCC	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.1187C>T	1.37:g.157094985G>A	ENSP00000357175:p.Ser396Leu		55	0	0		92	0.05	5	NM_001145312	45	0.00	0	B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	ENST00000368192.4	37	CCDS44250.1	.	.	.	.	.	.	.	.	.	.	G	5.399	0.258799	0.10239	.	.	ENSG00000117036	ENST00000368192	T	0.35048	1.33	3.84	2.89	0.33648	.	3.991400	0.00610	N	0.000413	T	0.15349	0.0370	L	0.38175	1.15	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13202	-1.0518	10	0.22706	T	0.39	.	10.4377	0.44445	0.106:0.0:0.894:0.0	.	396	P41162	ETV3_HUMAN	L	396	ENSP00000357175:S396L	ENSP00000357175:S396L	S	-	2	0	ETV3	155361609	0.001000	0.12720	0.018000	0.16275	0.163000	0.22366	1.080000	0.30779	1.133000	0.42147	0.561000	0.74099	TCG			0.562	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000082843.2		NM_005240	
ASTN1	460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	176853487	176853487	+	Nonsense_Mutation	SNP	T	T	A	rs558363072		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:176853487T>A	ENST00000367654.3	-	19	3449	c.3238A>T	c.(3238-3240)Aaa>Taa	p.K1080*	ASTN1_ENST00000367657.3_Nonsense_Mutation_p.K1072*|ASTN1_ENST00000424564.2_Nonsense_Mutation_p.K1072*|ASTN1_ENST00000361833.2_Nonsense_Mutation_p.K1072*	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1080	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						GTCTCCACTTTGGAGTGGTCC	0.493																																					p.K1072X													.	.			0			c.A3214T												154.0	128.0	137.0					1																	176853487		2203	4300	6503	SO:0001587	stop_gained	460	exon19			CCACTTTGGAGTG	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3238A>T	1.37:g.176853487T>A	ENSP00000356626:p.Lys1080*		84	0	0		167	0.25	42	NM_004319	28	0.00	0	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Nonsense_Mutation	SNP	ENST00000367654.3	37		.	.	.	.	.	.	.	.	.	.	T	42	9.271808	0.99120	.	.	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-24.0685	15.7969	0.78420	0.0:0.0:0.0:1.0	.	.	.	.	X	1072;1072;1080;1072;1072	.	ENSP00000354536:K1072X	K	-	1	0	ASTN1	175120110	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.427000	0.80284	2.207000	0.71202	0.533000	0.62120	AAA			0.493	ASTN1-201	KNOWN	basic	protein_coding	protein_coding				NM_004319	
PRG4	10216	bcgsc.ca	37	1	186276165	186276166	+	Missense_Mutation	DNP	CA	CA	TG			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	CA	CA					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:186276165_186276166CA>TG	ENST00000445192.2	+	7	1359_1360	c.1314_1315CA>TG	c.(1312-1317)acCAcc>acTGcc	p.T439A	PRG4_ENST00000367486.3_Missense_Mutation_p.T396A|PRG4_ENST00000367485.4_Missense_Mutation_p.T346A|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367483.4_Missense_Mutation_p.T398A	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	439	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						CTGCACCCACCACCCCCAAGAA	0.653																																					p.T439A													.	PRG4	259		0			c.A1315G																																									SO:0001583	missense	23572	exon7			ACCCACCACCCCC	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	Exception_encountered	1.37:g.186276165_186276166delinsTG	ENSP00000399679:p.Thr439Ala		51	0	0		76	0.11	8	NM_005807	6	0.00	0	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	DNP	ENST00000445192.2	37	CCDS1369.1																																																																																					0.653	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000086346.1		NM_005807	
SOX13	9580	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	204092277	204092277	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr1:204092277G>T	ENST00000367204.1	+	11	1281	c.1172G>T	c.(1171-1173)cGg>cTg	p.R391L		NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	391					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			GCCAAGGAGCGGCTGGAGGAC	0.637																																					p.R391L													.	.			0			c.G1172T												88.0	96.0	93.0					1																	204092277		2121	4245	6366	SO:0001583	missense	9580	exon11			AGGAGCGGCTGGA		CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.1172G>T	1.37:g.204092277G>T	ENSP00000356172:p.Arg391Leu		98	0	0		137	0.60	82	NM_005686	112	0.52	58	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	ENST00000367204.1	37	CCDS44299.1	.	.	.	.	.	.	.	.	.	.	G	16.41	3.114380	0.56505	.	.	ENSG00000143842	ENST00000367204	D	0.97906	-4.6	5.18	5.18	0.71444	.	0.526322	0.20155	N	0.098075	D	0.94394	0.8197	L	0.54323	1.7	0.33450	D	0.583601	B;P;B	0.44090	0.304;0.826;0.304	B;B;B	0.35278	0.1;0.199;0.1	D	0.94319	0.7552	10	0.26408	T	0.33	.	7.9084	0.29776	0.082:0.0:0.7568:0.1612	.	258;258;391	B4DX26;B4E3N9;Q9UN79	.;.;SOX13_HUMAN	L	391	ENSP00000356172:R391L	ENSP00000356172:R391L	R	+	2	0	SOX13	202358900	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	3.319000	0.51983	2.411000	0.81874	0.563000	0.77884	CGG			0.637	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000087881.2		NM_005686	
ZNF503	84858	mdanderson.org	37	10	77159542	77159542	+	Silent	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr10:77159542C>T	ENST00000372524.4	-	2	1392	c.906G>A	c.(904-906)ccG>ccA	p.P302P	RP11-399K21.11_ENST00000418818.2_lincRNA|ZNF503_ENST00000535216.1_Silent_p.P302P|ZNF503-AS2_ENST00000466942.2_RNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	302	Gly-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					CCTTGCCTCCCGGGCCCCCAT	0.716																																					p.P302P													.	.			0			c.G906A												11.0	15.0	13.0					10																	77159542		2192	4287	6479	SO:0001819	synonymous_variant	84858	exon2			GCCTCCCGGGCCC	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.906G>A	10.37:g.77159542C>T			25	0	0		18	0.11	2	NM_032772	150	0.00	0	Q8NAC5|Q96E25|Q96IJ0	Silent	SNP	ENST00000372524.4	37	CCDS7350.1																																																																																					0.716	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048826.1		NM_032772	
PIPSL	266971	broad.mit.edu	37	10	95718362	95718365	+	RNA	DEL	TTTC	TTTC	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	TTTC	TTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr10:95718362_95718365delTTTC	ENST00000480546.1	-	0	2932_2935					NR_002319.2		A2A3N6	PIPSL_HUMAN	PIP5K1A and PSMD4-like, pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol phosphate kinase activity (GO:0016307)										tttcttttcttttctttctttctt	0.333																																					.													.	.			0			.																																											0	.			TTTTCTTTTCTTT	BC068549		10q23.33	2010-10-27	2010-10-27	2007-07-06	ENSG00000180764	ENSG00000180764		"""Proteasome (prosome, macropain) subunits"""	23733	pseudogene	pseudogene			"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 4, pseudogene 2"", ""phosphatidylinositol-4-phosphate 5-kinase, type I-like 1"", ""PIP5K1A and PSMD4-like"""	PSMD4P2, PIP5K1L1		16344562	Standard	NR_002319		Approved	PIP5K1A-PSMD4, PIP5K1P3	uc009xuj.2	A2A3N6	OTTHUMG00000137480		10.37:g.95718370_95718373delTTTC			8	0	0		20	0.45	9	.	1	0.00	0	Q6NUK8	RNA	DEL	ENST00000480546.1	37																																																																																						0.333	PIPSL-002	PUTATIVE	basic	processed_transcript	pseudogene		OTTHUMT00000351483.1		NR_002319	
CRTAC1	55118	mdanderson.org	37	10	99655016	99655016	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr10:99655016G>T	ENST00000370597.3	-	11	1827	c.1472C>A	c.(1471-1473)gCa>gAa	p.A491E	CRTAC1_ENST00000298819.4_Missense_Mutation_p.A491E|CRTAC1_ENST00000370591.2_Missense_Mutation_p.A491E	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	491						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GCCAAAGTGTGCCACGGGCTC	0.617																																					p.A491E													.	.			0			c.C1472A												77.0	67.0	70.0					10																	99655016		2203	4300	6503	SO:0001583	missense	55118	exon11			AAGTGTGCCACGG	AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1472C>A	10.37:g.99655016G>T	ENSP00000359629:p.Ala491Glu		23	0	0		31	0.10	3	NM_001206528	14	0.00	0	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	37	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.725334	0.89298	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.75154	1.34;-0.91;1.33;-0.07;-0.07	5.06	5.06	0.68205	ASPIC/UnbV (1);	0.000000	0.85682	D	0.000000	D	0.88562	0.6470	M	0.89715	3.055	0.80722	D	1	D;D;D	0.67145	0.985;0.993;0.996	D;D;D	0.70935	0.923;0.955;0.971	D	0.90523	0.4490	10	0.56958	D	0.05	-9.5092	18.0162	0.89241	0.0:0.0:1.0:0.0	.	491;491;387	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	E	387;491;491;483;491	ENSP00000408445:A387E;ENSP00000359629:A491E;ENSP00000298819:A491E;ENSP00000310810:A483E;ENSP00000359623:A491E	ENSP00000298819:A491E	A	-	2	0	CRTAC1	99645006	1.000000	0.71417	0.991000	0.47740	0.816000	0.46133	9.691000	0.98679	2.339000	0.79563	0.462000	0.41574	GCA			0.617	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000049754.1		NM_018058	
MMP21	118856	mdanderson.org	37	10	127461212	127461212	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr10:127461212G>T	ENST00000368808.3	-	3	804	c.805C>A	c.(805-807)Ccc>Acc	p.P269T		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	269					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	TCACTGGTGGGAGGTGTGAAG	0.592																																					p.P269T													.	.			0			c.C805A												166.0	142.0	150.0					10																	127461212		2203	4300	6503	SO:0001583	missense	118856	exon3			TGGTGGGAGGTGT	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.805C>A	10.37:g.127461212G>T	ENSP00000357798:p.Pro269Thr		87	0	0		110	0.05	5	NM_147191	0		0	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	37	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.060230	0.76074	.	.	ENSG00000154485	ENST00000368808	T	0.16196	2.36	4.51	4.51	0.55191	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.123149	0.56097	D	0.000038	T	0.26810	0.0656	L	0.39692	1.235	0.47547	D	0.99945	D	0.59767	0.986	P	0.62184	0.899	T	0.01874	-1.1256	10	0.12766	T	0.61	-29.6032	14.7847	0.69793	0.0:0.0:1.0:0.0	.	269	Q8N119	MMP21_HUMAN	T	269	ENSP00000357798:P269T	ENSP00000357798:P269T	P	-	1	0	MMP21	127451202	1.000000	0.71417	0.981000	0.43875	0.857000	0.48899	7.523000	0.81856	2.350000	0.79820	0.561000	0.74099	CCC			0.592	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050928.1			
RRP8	23378	mdanderson.org	37	11	6622574	6622574	+	Missense_Mutation	SNP	C	C	T	rs142606127		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:6622574C>T	ENST00000254605.6	-	3	839	c.722G>A	c.(721-723)cGc>cAc	p.R241H	ILK_ENST00000396751.2_5'Flank|RRP8_ENST00000534343.1_Intron|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000420936.2_5'Flank|ILK_ENST00000299421.4_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000537806.1_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	241					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						CTGTGCCATGCGGGCTCGCAA	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17633	0.0		0.001	False		,,,				2504	0.0				p.R241H													RRP8,NS,carcinoma,0,1	RRP8	0	1	0			c.G722A							C	HIS/ARG	0,4402		0,0,2201	29.0	29.0	29.0		722	4.8	1.0	11	dbSNP_134	29	1,8591	1.2+/-3.3	0,1,4295	no	missense	RRP8	NM_015324.3	29	0,1,6496	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	241/457	6622574	1,12993	2201	4296	6497	SO:0001583	missense	23378	exon3			GCCATGCGGGCTC	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.722G>A	11.37:g.6622574C>T	ENSP00000254605:p.Arg241His		36	0	0		47	0.06	3	NM_015324	89	0.00	0	Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	37	CCDS31411.1	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128235	0.77549	0.0	1.16E-4	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.48201	0.82;0.82	5.85	4.75	0.60458	.	0.055575	0.64402	D	0.000002	T	0.50017	0.1591	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.52593	-0.8555	10	0.49607	T	0.09	-36.7229	14.5946	0.68395	0.0:0.9167:0.0:0.0833	.	241	O43159	RRP8_HUMAN	H	241	ENSP00000254605:R241H;ENSP00000436246:R241H	ENSP00000254605:R241H	R	-	2	0	RRP8	6579150	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	3.192000	0.50989	2.773000	0.95371	0.650000	0.86243	CGC	0		0.627	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384505.1		NM_015324	
MYRF	745	mdanderson.org	37	11	61545883	61545883	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:61545883G>T	ENST00000278836.5	+	14	2031	c.1935G>T	c.(1933-1935)ttG>ttT	p.L645F	MYRF_ENST00000265460.5_Missense_Mutation_p.L636F|TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000327797.1_Missense_Mutation_p.L270F|MYRF_ENST00000389602.4_Missense_Mutation_p.L36F	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	645	Peptidase S74.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AGGAGATCTTGCCTGAGGCTG	0.542																																					p.L645F													.	.			0			c.G1935T												139.0	129.0	132.0					11																	61545883		2202	4299	6501	SO:0001583	missense	745	exon14			GATCTTGCCTGAG		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.1935G>T	11.37:g.61545883G>T	ENSP00000278836:p.Leu645Phe		28	0	0		49	0.08	4	NM_001127392	62	0.00	0	O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.971887	0.74246	.	.	ENSG00000124920	ENST00000278836;ENST00000265460;ENST00000327797;ENST00000389602	T;T;T;T	0.55588	0.93;0.91;0.51;0.57	4.41	3.41	0.39046	.	0.000000	0.64402	D	0.000002	T	0.65698	0.2716	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.99	D;D;D	0.87578	0.998;0.996;0.965	T	0.67768	-0.5585	10	0.72032	D	0.01	-16.493	9.3821	0.38320	0.0:0.3006:0.582:0.1175	.	36;636;645	B4DHB2;Q9Y2G1-2;Q9Y2G1	.;.;MRF_HUMAN	F	645;636;270;36	ENSP00000278836:L645F;ENSP00000265460:L636F;ENSP00000333261:L270F;ENSP00000374253:L36F	ENSP00000265460:L636F	L	+	3	2	C11orf9	61302459	0.911000	0.30947	0.999000	0.59377	0.970000	0.65996	-0.008000	0.12788	2.191000	0.70037	0.561000	0.74099	TTG			0.542	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398519.2		NM_013279	
ATG2A	23130	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	64662855	64662855	+	Silent	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:64662855C>A	ENST00000377264.3	-	40	5599	c.5487G>T	c.(5485-5487)ctG>ctT	p.L1829L	ATG2A_ENST00000421419.2_Silent_p.L1831L	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1829					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GCTTATCCTGCAGGGAGCGGG	0.682																																					p.L1829L													.	.			0			c.G5487T												19.0	23.0	21.0					11																	64662855		2197	4289	6486	SO:0001819	synonymous_variant	23130	exon40			ATCCTGCAGGGAG		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.5487G>T	11.37:g.64662855C>A			55	0	0		62	0.44	27	NM_015104	85	0.45	38	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	C	7.379	0.628423	0.14257	.	.	ENSG00000110046	ENST00000418259	.	.	.	3.45	-2.17	0.07059	.	.	.	.	.	T	0.38401	0.1039	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.31613	-0.9937	4	.	.	.	.	0.8365	0.01141	0.1672:0.2517:0.1648:0.4162	.	.	.	.	S	1633	.	.	A	-	1	0	ATG2A	64419431	1.000000	0.71417	0.997000	0.53966	0.779000	0.44077	0.927000	0.28818	-0.177000	0.10690	-0.215000	0.12644	GCA			0.682	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000143224.1		NM_015104	
CLPB	81570	mdanderson.org	37	11	72145171	72145171	+	Silent	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:72145171G>A	ENST00000294053.3	-	1	521	c.348C>T	c.(346-348)tgC>tgT	p.C116C	CLPB_ENST00000542555.1_5'UTR|CLPB_ENST00000543042.1_Intron|CLPB_ENST00000437826.2_Missense_Mutation_p.R36C|CLPB_ENST00000445069.2_Intron|CLPB_ENST00000340729.5_Silent_p.C116C|CLPB_ENST00000538039.1_Silent_p.C116C	NM_001258394.1|NM_030813.4	NP_001245323.1|NP_110440.1	Q9H078	CLPB_HUMAN	ClpB caseinolytic peptidase B homolog (E. coli)	116					cellular response to heat (GO:0034605)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	19						CGGCCAGGGCGCACATGCCCA	0.617											OREG0021194	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R36C													.	.			0			c.C106T												74.0	76.0	75.0					11																	72145171		2200	4292	6492	SO:0001819	synonymous_variant	81570	exon1			CAGGGCGCACATG	BC006404	CCDS8215.1, CCDS58152.1, CCDS58153.1, CCDS58154.1	11q13.4	2013-01-10			ENSG00000162129	ENSG00000162129		"""Ankyrin repeat domain containing"""	30664	protein-coding gene	gene with protein product	"""suppressor of potassium transport defect 3"""					11230166, 7835694	Standard	NM_030813		Approved	HSP78, SKD3, FLJ13152	uc010rqy.3	Q9H078	OTTHUMG00000167902	ENST00000294053.3:c.348C>T	11.37:g.72145171G>A			29	0	0	1135	21	0.10	2	NM_001258394	28	0.00	0	B4DXJ7|B4DXP7|E7EWN6|F8W7P6|Q8ND11|Q9H8Y0	Missense_Mutation	SNP	ENST00000294053.3	37	CCDS8215.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.696870	0.30142	.	.	ENSG00000162129	ENST00000535990;ENST00000437826	T;T	0.17370	2.4;2.28	5.04	4.13	0.48395	.	.	.	.	.	T	0.10035	0.0246	.	.	.	0.35045	D	0.760096	P	0.44260	0.83	B	0.29942	0.109	T	0.28996	-1.0026	7	.	.	.	-3.6894	12.0035	0.53246	0.0:0.8248:0.1752:0.0	.	36	E7EWN6	.	C	86;36	ENSP00000443822:R86C;ENSP00000407296:R36C	.	R	-	1	0	CLPB	71822819	1.000000	0.71417	1.000000	0.80357	0.440000	0.31957	1.846000	0.39289	1.260000	0.44134	-0.128000	0.14901	CGC			0.617	CLPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000396889.1		NM_030813	
CNTN5	53942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	99715691	99715691	+	Missense_Mutation	SNP	C	C	T	rs201512506		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:99715691C>T	ENST00000524871.1	+	5	675	c.385C>T	c.(385-387)Cca>Tca	p.P129S	CNTN5_ENST00000528682.1_Missense_Mutation_p.P129S|CNTN5_ENST00000279463.3_Missense_Mutation_p.P129S|CNTN5_ENST00000527185.1_Missense_Mutation_p.P129S|CNTN5_ENST00000418526.2_Missense_Mutation_p.P55S	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	129	Ig-like C2-type 1.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TCGTGGCAATCCAGTTCCCAG	0.373																																					p.P129S													.	.			0			c.C385T												148.0	133.0	138.0					11																	99715691		1844	4097	5941	SO:0001583	missense	53942	exon4			GGCAATCCAGTTC	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.385C>T	11.37:g.99715691C>T	ENSP00000435637:p.Pro129Ser		94	0	0		126	0.21	27	NM_001243270	0		0	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	37	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800838	0.50315	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.73897	-0.79;-0.79;-0.79;-0.79;-0.79	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89378	0.6698	M	0.91717	3.235	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	D	0.91177	0.4973	10	0.66056	D	0.02	.	18.3699	0.90403	0.0:1.0:0.0:0.0	.	129;55;129	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	S	129;129;129;55;129	ENSP00000433575:P129S;ENSP00000436185:P129S;ENSP00000435637:P129S;ENSP00000393229:P55S;ENSP00000279463:P129S	ENSP00000279463:P129S	P	+	1	0	CNTN5	99220901	1.000000	0.71417	0.132000	0.22025	0.434000	0.31775	5.470000	0.66756	2.653000	0.90120	0.650000	0.86243	CCA			0.373	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000395148.2		NM_014361	
PGR	5241	mdanderson.org	37	11	100999245	100999245	+	Missense_Mutation	SNP	G	G	T	rs11571145	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr11:100999245G>T	ENST00000325455.5	-	1	2010	c.557C>A	c.(556-558)cCc>cAc	p.P186H	PGR_ENST00000263463.5_Missense_Mutation_p.P186H|PGR_ENST00000534013.1_Intron	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	186	Modulating, Pro-Rich.		P -> L (in dbSNP:rs11571145). {ECO:0000269|Ref.8}.		cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CAGGCCCCGGGGCAGCACTTT	0.721																																					p.P186H	Pancreas(124;2271 2354 21954 22882)												PGR,NS,carcinoma,0,1	PGR	0	1	0			c.C557A												5.0	7.0	6.0					11																	100999245		2039	4100	6139	SO:0001583	missense	5241	exon1			CCCCGGGGCAGCA	M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.557C>A	11.37:g.100999245G>T	ENSP00000325120:p.Pro186His		16	0	0		22	0.09	2	NM_000926	0		0	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	ENST00000325455.5	37	CCDS8310.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140205	0.37825	.	.	ENSG00000082175	ENST00000325455;ENST00000263463;ENST00000537623	T;T	0.19105	2.17;2.17	3.62	2.65	0.31530	.	1.295630	0.05245	N	0.512963	T	0.19287	0.0463	L	0.34521	1.04	0.33918	D	0.640482	B;B	0.10296	0.003;0.003	B;B	0.15052	0.012;0.012	T	0.18429	-1.0337	10	0.59425	D	0.04	.	8.4855	0.33069	0.0:0.0:0.5311:0.4689	.	186;186	Q8TDS3;P06401	.;PRGR_HUMAN	H	186	ENSP00000325120:P186H;ENSP00000263463:P186H	ENSP00000263463:P186H	P	-	2	0	PGR	100504455	1.000000	0.71417	0.840000	0.33206	0.780000	0.44128	3.317000	0.51968	0.788000	0.33755	0.561000	0.74099	CCC			0.721	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394934.1			
SCNN1A	6337	broad.mit.edu	37	12	6457129	6457129	+	Silent	SNP	A	A	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr12:6457129A>G	ENST00000228916.2	-	13	2018	c.1920T>C	c.(1918-1920)ccT>ccC	p.P640P	SCNN1A_ENST00000540037.1_Silent_p.P340P|SCNN1A_ENST00000360168.3_Silent_p.P699P|SCNN1A_ENST00000543768.1_Silent_p.P663P|SCNN1A_ENST00000358945.3_Silent_p.P662P|SCNN1A_ENST00000396966.2_3'UTR	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	640					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	aggcagggggaggggctgtca	0.692																																					p.P699P													.	SCNN1A	54		0			c.T2097C												8.0	8.0	8.0					12																	6457129		2147	4223	6370	SO:0001819	synonymous_variant	0	exon12			AGGGGGAGGGGCT	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1920T>C	12.37:g.6457129A>G			75	0.0266666667	2		247	0.04	10	NM_001159576	121	0.00	0	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	ENST00000228916.2	37	CCDS8543.1																																																																																					0.692	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000399055.1			
KRT85	3891	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	52758951	52758951	+	Missense_Mutation	SNP	G	G	A	rs148274330		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr12:52758951G>A	ENST00000257901.3	-	2	499	c.424C>T	c.(424-426)Cgc>Tgc	p.R142C	KRT85_ENST00000544265.1_5'Flank	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	142	Coil 1A.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TCCAGGAAGCGCACCTGCCAT	0.607													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17569	0.0		0.0	False		,,,				2504	0.0				p.R142C													.	.			0			c.C424T							G	CYS/ARG	0,4406		0,0,2203	28.0	28.0	28.0		424	4.2	1.0	12	dbSNP_134	28	1,8599		0,1,4299	no	missense	KRT85	NM_002283.3	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	142/508	52758951	1,13005	2203	4300	6503	SO:0001583	missense	3891	exon2			GGAAGCGCACCTG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.424C>T	12.37:g.52758951G>A	ENSP00000257901:p.Arg142Cys		65	0	0		92	0.18	17	NM_002283	0		0	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	37	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	G	19.96	3.924307	0.73213	0.0	1.16E-4	ENSG00000135443	ENST00000257901	D	0.92595	-3.07	4.21	4.21	0.49690	Filament (1);	0.000000	0.64402	D	0.000015	D	0.92938	0.7753	M	0.87827	2.91	0.80722	D	1	P	0.46578	0.88	B	0.40940	0.344	D	0.94739	0.7917	10	0.72032	D	0.01	.	17.0925	0.86626	0.0:0.0:1.0:0.0	.	142	P78386	KRT85_HUMAN	C	142	ENSP00000257901:R142C	ENSP00000257901:R142C	R	-	1	0	KRT85	51045218	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.597000	0.98273	2.335000	0.79485	0.491000	0.48974	CGC			0.607	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405184.1		NM_002283	
RITA1	84934	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	113629502	113629502	+	Silent	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr12:113629502G>A	ENST00000548278.1	+	4	1382	c.690G>A	c.(688-690)acG>acA	p.T230T	RP11-545P7.4_ENST00000552525.1_RNA|C12orf52_ENST00000549621.1_Silent_p.T230T|C12orf52_ENST00000552495.1_Silent_p.T254T	NM_032848.1	NP_116237.1	Q96K30	RITA1_HUMAN		230	Interaction with tubulin.				negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|Notch signaling pathway (GO:0007219)|nuclear export (GO:0051168)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	tubulin binding (GO:0015631)			large_intestine(2)|lung(1)|prostate(1)|urinary_tract(1)	5						GGCCTTCCACGTCAGGGGTGA	0.612																																					p.T230T													.	.			0			c.G690A												65.0	59.0	61.0					12																	113629502		2203	4300	6503	SO:0001819	synonymous_variant	84934	exon4			TTCCACGTCAGGG																												ENST00000548278.1:c.690G>A	12.37:g.113629502G>A			68	0	0		111	0.27	30	NM_032848	104	0.41	43	B3KVZ4|C9JIN1|F8VRG5|Q53GM3|Q96K25	Silent	SNP	ENST00000548278.1	37	CCDS9166.1	.	.	.	.	.	.	.	.	.	.	G	3.974	-0.007844	0.07773	.	.	ENSG00000139405	ENST00000299731	.	.	.	4.79	-9.59	0.00556	.	.	.	.	.	T	0.29945	0.0749	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.43048	-0.9415	5	0.87932	D	0	0.2448	3.4141	0.07369	0.4417:0.2516:0.2227:0.084	.	.	.	.	H	177	.	ENSP00000299731:R177H	R	+	2	0	C12orf52	112113885	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-3.140000	0.00586	-3.238000	0.00207	-0.946000	0.02672	CGT			0.612	C12orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405239.1			
GLT1D1	144423	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	129467613	129467613	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr12:129467613T>C	ENST00000442111.2	+	12	1107	c.1019T>C	c.(1018-1020)cTg>cCg	p.L340P	GLT1D1_ENST00000537468.1_Missense_Mutation_p.L345P|GLT1D1_ENST00000281703.6_Missense_Mutation_p.L260P|GLT1D1_ENST00000542193.1_Missense_Mutation_p.L257P			Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	340					biosynthetic process (GO:0009058)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		ATCAGGAAGCTGGAAGGAAGC	0.502																																					p.L260P													.	.			0			c.T779C												151.0	140.0	144.0					12																	129467613		2203	4300	6503	SO:0001583	missense	144423	exon8			GGAAGCTGGAAGG		CCDS9265.1	12q24.32	2013-02-22			ENSG00000151948	ENSG00000151948		"""Glycosyltransferase group 1 domain containing"""	26483	protein-coding gene	gene with protein product							Standard	NM_144669		Approved	FLJ31978	uc001uhx.1	Q96MS3	OTTHUMG00000168437	ENST00000442111.2:c.1019T>C	12.37:g.129467613T>C	ENSP00000394692:p.Leu340Pro		49	0	0		62	0.32	20	NM_144669	19	0.05	1	Q86XG8	Missense_Mutation	SNP	ENST00000442111.2	37		.	.	.	.	.	.	.	.	.	.	T	16.44	3.122545	0.56613	.	.	ENSG00000151948	ENST00000442111;ENST00000281703;ENST00000537468;ENST00000542193	D;D;D;D	0.83163	-1.69;-1.69;-1.69;-1.69	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000001	D	0.89494	0.6731	M	0.71581	2.175	0.53688	D	0.999971	D;D	0.89917	1.0;1.0	D;D	0.91635	0.992;0.999	D	0.89619	0.3847	10	0.49607	T	0.09	-30.346	12.7126	0.57098	0.0:0.0:0.0:1.0	.	345;260	F5H088;Q96MS3-2	.;.	P	340;260;345;257	ENSP00000394692:L340P;ENSP00000281703:L260P;ENSP00000438158:L345P;ENSP00000437500:L257P	ENSP00000281703:L260P	L	+	2	0	GLT1D1	128033566	0.498000	0.26075	0.036000	0.18154	0.004000	0.04260	4.062000	0.57492	1.949000	0.56562	0.460000	0.39030	CTG			0.502	GLT1D1-002	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000399740.1		NM_144669	
ULK1	8408	mdanderson.org	37	12	132401102	132401102	+	Missense_Mutation	SNP	C	C	T	rs147399196	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr12:132401102C>T	ENST00000321867.4	+	20	2389	c.2038C>T	c.(2038-2040)Cgg>Tgg	p.R680W	ULK1_ENST00000540647.1_5'Flank	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	680					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		CCCTGGCCTGCGGCCAGGCGA	0.687													C|||	13	0.00259585	0.0076	0.0	5008	,	,		15062	0.0		0.002	False		,,,				2504	0.001				p.R680W													.	.			0			c.C2038T							C	TRP/ARG	4,4368		0,4,2182	19.0	24.0	22.0		2038	2.4	0.9	12	dbSNP_134	22	3,8569		0,3,4283	yes	missense	ULK1	NM_003565.2	101	0,7,6465	TT,TC,CC		0.035,0.0915,0.0541	probably-damaging	680/1051	132401102	7,12937	2186	4286	6472	SO:0001583	missense	8408	exon20			GGCCTGCGGCCAG	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2038C>T	12.37:g.132401102C>T	ENSP00000324560:p.Arg680Trp		28	0	0		48	0.06	3	NM_003565	146	0.00	0	Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	37	CCDS9274.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	15.37	2.814833	0.50527	9.15E-4	3.5E-4	ENSG00000177169	ENST00000321867;ENST00000541761	T;T	0.56776	0.44;0.44	5.69	2.44	0.29823	.	0.089379	0.49305	D	0.000146	T	0.65260	0.2674	M	0.72118	2.19	0.80722	D	1	D	0.71674	0.998	P	0.56474	0.799	T	0.72037	-0.4411	10	0.72032	D	0.01	-39.8645	15.3796	0.74645	0.4307:0.5693:0.0:0.0	.	680	O75385	ULK1_HUMAN	W	680;28	ENSP00000324560:R680W;ENSP00000444298:R28W	ENSP00000324560:R680W	R	+	1	2	ULK1	130967055	0.950000	0.32346	0.856000	0.33681	0.063000	0.16089	1.354000	0.34056	0.706000	0.31912	0.655000	0.94253	CGG	0.001		0.687	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397769.3			
AKAP11	11215	hgsc.bcm.edu	37	13	42876257	42876257	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr13:42876257G>T	ENST00000025301.2	+	8	3550	c.3375G>T	c.(3373-3375)aaG>aaT	p.K1125N		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1125					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAAAGCTCAAGGGAGAATTAG	0.408																																					p.K1125N													.	.			0			c.G3375T												95.0	101.0	99.0					13																	42876257		2203	4300	6503	SO:0001583	missense	11215	exon8			GCTCAAGGGAGAA	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3375G>T	13.37:g.42876257G>T	ENSP00000025301:p.Lys1125Asn		136	0	0		91	0.04	4	NM_016248	5	0.00	0	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	37	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	G	14.09	2.430983	0.43122	.	.	ENSG00000023516	ENST00000025301	T	0.28895	1.59	5.41	-0.599	0.11645	.	0.000000	0.85682	D	0.000000	T	0.50684	0.1630	M	0.71581	2.175	0.46701	D	0.999161	D	0.89917	1.0	D	0.91635	0.999	T	0.51260	-0.8728	10	0.72032	D	0.01	.	13.4832	0.61348	0.4815:0.0:0.5185:0.0	.	1125	Q9UKA4	AKA11_HUMAN	N	1125	ENSP00000025301:K1125N	ENSP00000025301:K1125N	K	+	3	2	AKAP11	41774257	1.000000	0.71417	0.983000	0.44433	0.824000	0.46624	1.671000	0.37513	-0.372000	0.07992	-1.094000	0.02160	AAG			0.408	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044700.2		NM_016248	
MYCBP2	23077	mdanderson.org	37	13	77672103	77672103	+	Silent	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr13:77672103G>T	ENST00000544440.2	-	56	9089	c.9072C>A	c.(9070-9072)tcC>tcA	p.S3024S	MYCBP2_ENST00000357337.6_Silent_p.S3024S|MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000407578.2_Silent_p.S3062S|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CATGTTCTTTGGAAAGTTCAG	0.373																																					p.S3062S													MYCBP2_ENST00000407578,NS,NS,-1,15	MYCBP2_ENST00000407578	-1	15	0			c.C9186A												66.0	69.0	68.0					13																	77672103		2203	4300	6503	SO:0001819	synonymous_variant	23077	exon56			TTCTTTGGAAAGT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.9072C>A	13.37:g.77672103G>T			55	0	0		40	0.10	4	NM_015057	10	0.00	0		Silent	SNP	ENST00000544440.2	37																																																																																						0.373	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000045326.1		NM_015057	
FOS	2353	mdanderson.org	37	14	75748069	75748069	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr14:75748069G>T	ENST00000303562.4	+	4	1294	c.1085G>T	c.(1084-1086)aGc>aTc	p.S362I	FOS_ENST00000535987.1_Missense_Mutation_p.S326I|FOS_ENST00000555347.1_Missense_Mutation_p.S214I|FOS_ENST00000555686.1_Missense_Mutation_p.S248I	NM_005252.3	NP_005243.1	P01100	FOS_HUMAN	FBJ murine osteosarcoma viral oncogene homolog	362					aging (GO:0007568)|cellular response to calcium ion (GO:0071277)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hormone stimulus (GO:0032870)|cellular response to reactive oxygen species (GO:0034614)|conditioned taste aversion (GO:0001661)|DNA methylation (GO:0006306)|Fc-epsilon receptor signaling pathway (GO:0038095)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to cold (GO:0009409)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to gravity (GO:0009629)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|skeletal muscle cell differentiation (GO:0035914)|sleep (GO:0030431)|SMAD protein signal transduction (GO:0060395)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	double-stranded DNA binding (GO:0003690)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(585;0.0138)|all_epithelial(191;0.0263)|all_neural(303;0.112)		BRCA - Breast invasive adenocarcinoma(234;0.0117)	Nadroparin(DB08813)|Pseudoephedrine(DB00852)	CGCAAGGGCAGCAGCAGCAAT	0.642																																					p.S362I													.	.			0			c.G1085T												41.0	42.0	42.0					14																	75748069		2203	4300	6503	SO:0001583	missense	2353	exon4			AGGGCAGCAGCAG	K00650	CCDS9841.1	14q24.3	2013-01-10	2009-07-23			ENSG00000170345		"""basic leucine zipper proteins"""	3796	protein-coding gene	gene with protein product		164810	"""v-fos FBJ murine osteosarcoma viral oncogene homolog"""			16123044, 16055710, 15926923	Standard	NM_005252		Approved	c-fos, AP-1	uc001xrn.3	P01100		ENST00000303562.4:c.1085G>T	14.37:g.75748069G>T	ENSP00000306245:p.Ser362Ile		30	0	0		32	0.09	3	NM_005252	209	0.00	0	A8K4E2|B4DQ65|P18849	Missense_Mutation	SNP	ENST00000303562.4	37	CCDS9841.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963668	0.74016	.	.	ENSG00000170345	ENST00000303562;ENST00000535987;ENST00000555686;ENST00000555347	T;T;T	0.72725	-0.07;0.39;-0.68	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.85120	0.5624	M	0.79011	2.435	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.962;0.991	D	0.86308	0.1684	10	0.87932	D	0	-31.4476	19.3271	0.94267	0.0:0.0:1.0:0.0	.	326;362	B4DQ65;P01100	.;FOS_HUMAN	I	362;326;248;214	ENSP00000306245:S362I;ENSP00000442268:S326I;ENSP00000452590:S248I	ENSP00000306245:S362I	S	+	2	0	FOS	74817822	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.894000	0.87336	2.667000	0.90743	0.655000	0.94253	AGC			0.642	FOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415044.1		NM_005252	
PLA2G4D	283748	mdanderson.org	37	15	42362251	42362251	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr15:42362251G>A	ENST00000290472.3	-	19	2180	c.2086C>T	c.(2086-2088)Ccc>Tcc	p.P696S		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	696	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CGGGGGAAGGGCAGCCCCCGG	0.701																																					p.P696S													.	.			0			c.C2086T												23.0	18.0	19.0					15																	42362251		2067	3989	6056	SO:0001583	missense	283748	exon19			GGAAGGGCAGCCC	AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.2086C>T	15.37:g.42362251G>A	ENSP00000290472:p.Pro696Ser		30	0	0		25	0.12	3	NM_178034	1	0.00	0	Q8N176	Missense_Mutation	SNP	ENST00000290472.3	37	CCDS32203.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080911	0.76528	.	.	ENSG00000159337	ENST00000290472	T	0.18502	2.21	5.31	5.31	0.75309	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (2);	0.207467	0.32935	N	0.005462	T	0.22166	0.0534	M	0.67397	2.05	0.50632	D	0.999889	B	0.21381	0.055	B	0.20955	0.032	T	0.01652	-1.1303	10	0.54805	T	0.06	-27.5695	14.3482	0.66680	0.0:0.0:1.0:0.0	.	696	Q86XP0	PA24D_HUMAN	S	696	ENSP00000290472:P696S	ENSP00000290472:P696S	P	-	1	0	PLA2G4D	40149543	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	3.739000	0.55075	2.765000	0.95021	0.655000	0.94253	CCC			0.701	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000419317.1		NM_178034	
PKD1	5310	mdanderson.org	37	16	2153892	2153892	+	Missense_Mutation	SNP	G	G	T	rs542838331		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr16:2153892G>T	ENST00000262304.4	-	23	8374	c.8166C>A	c.(8164-8166)gaC>gaA	p.D2722E	PKD1_ENST00000423118.1_Missense_Mutation_p.D2722E|PKD1_ENST00000561991.1_5'UTR	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	2722	REJ. {ECO:0000255|PROSITE- ProRule:PRU00511}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGTGGATGAGGTCTCCTGCAG	0.652																																					p.D2722E													.	.			0			c.C8166A												11.0	10.0	10.0					16																	2153892		2145	4258	6403	SO:0001583	missense	5310	exon23			GATGAGGTCTCCT	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.8166C>A	16.37:g.2153892G>T	ENSP00000262304:p.Asp2722Glu		15	0	0		15	0.13	2	NM_001009944	45	0.00	0	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.776735	0.49786	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101;ENST00000382481	T;T	0.37584	1.19;1.19	4.29	4.29	0.51040	Egg jelly receptor, REJ-like (1);Polycystin cation channel (1);	0.000000	0.85682	D	0.000000	T	0.57373	0.2049	M	0.72894	2.215	0.44168	D	0.996971	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.982	T	0.61579	-0.7034	10	0.72032	D	0.01	.	12.5236	0.56073	0.0847:0.0:0.9153:0.0	.	2722;2722	P98161-3;P98161	.;PKD1_HUMAN	E	2722;2722;2057;1001	ENSP00000262304:D2722E;ENSP00000399501:D2722E	ENSP00000262304:D2722E	D	-	3	2	PKD1	2093893	1.000000	0.71417	1.000000	0.80357	0.172000	0.22775	3.447000	0.52936	2.207000	0.71202	0.484000	0.47621	GAC			0.652	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
ATP6V0D1	9114	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67473035	67473035	+	Missense_Mutation	SNP	G	G	A	rs529258503		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr16:67473035G>A	ENST00000290949.3	-	6	805	c.655C>T	c.(655-657)Cgc>Tgc	p.R219C	ATP6V0D1_ENST00000540149.1_Missense_Mutation_p.R260C|ATP6V0D1_ENST00000567694.1_5'UTR|ATP6V0D1_ENST00000602876.1_Missense_Mutation_p.R142C	NM_004691.4	NP_004682.2	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1	219					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP hydrolysis coupled proton transport (GO:0015991)|brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|cellular protein metabolic process (GO:0044267)|cilium assembly (GO:0042384)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|synaptic vesicle (GO:0008021)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)			large_intestine(3)|lung(3)|urinary_tract(2)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		ATGAAGGCGCGGCGGTCTGCT	0.587																																					p.R219C													.	.			0			c.C655T												85.0	90.0	88.0					16																	67473035		2198	4300	6498	SO:0001583	missense	9114	exon6			AGGCGCGGCGGTC	X71490	CCDS10838.1	16q22	2010-04-21	2006-01-20	2002-05-10	ENSG00000159720	ENSG00000159720		"""ATPases / V-type"""	13724	protein-coding gene	gene with protein product		607028	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D1"""	ATP6D		8250920	Standard	NM_004691		Approved	ATP6DV, VATX, VPATPD, P39, Vma6	uc002ete.1	P61421	OTTHUMG00000137515	ENST00000290949.3:c.655C>T	16.37:g.67473035G>A	ENSP00000290949:p.Arg219Cys		40	0	0		47	0.45	21	NM_004691	384	0.45	172	P12953|Q02547	Missense_Mutation	SNP	ENST00000290949.3	37	CCDS10838.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593837	0.46214	.	.	ENSG00000159720	ENST00000290949;ENST00000426604;ENST00000540149	T;T	0.36699	1.24;1.24	4.89	3.88	0.44766	.	0.048620	0.85682	D	0.000000	T	0.66509	0.2796	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.995;0.993	T	0.73477	-0.3970	10	0.66056	D	0.02	-17.8777	10.1576	0.42831	0.0:0.0:0.6681:0.3319	.	260;219	F5GYQ1;P61421	.;VA0D1_HUMAN	C	219;142;260	ENSP00000290949:R219C;ENSP00000441282:R260C	ENSP00000290949:R219C	R	-	1	0	ATP6V0D1	66030536	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	1.566000	0.36396	2.555000	0.86185	0.650000	0.86243	CGC			0.587	ATP6V0D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268835.1		NM_004691	
PAFAH1B1	5048	bcgsc.ca	37	17	2585079	2585080	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:2585079_2585080delGT	ENST00000397195.5	+	11	1667_1668	c.1216_1217delGT	c.(1216-1218)gtgfs	p.V406fs	RN7SL608P_ENST00000492377.2_RNA|PAFAH1B1_ENST00000572915.2_Intron|RP11-74E22.5_ENST00000610120.1_RNA|PAFAH1B1_ENST00000451360.2_Frame_Shift_Del_p.V201fs	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						AACAGTAAAAGTGTGGGAGTGC	0.46																																					p.406_406del													.	PAFAH1B1	26		0			c.1216_1217del																																									SO:0001589	frameshift_variant	5048	exon11			GTAAAAGTGTGGG	L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.1216_1217delGT	17.37:g.2585081_2585082delGT	ENSP00000380378:p.Val406fs		85	0	0		141	0.33	47	NM_000430	224	0.00	0		Frame_Shift_Del	DEL	ENST00000397195.5	37	CCDS32528.1																																																																																					0.460	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437797.2		NM_000430	
USP6	9098	broad.mit.edu	37	17	5050419	5050419	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:5050419C>A	ENST00000574788.1	+	29	4591	c.2361C>A	c.(2359-2361)agC>agA	p.S787R	USP6_ENST00000332776.4_Intron|USP6_ENST00000304328.5_Missense_Mutation_p.S470R|USP6_ENST00000250066.6_Missense_Mutation_p.S787R			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	787	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						TCTCAGTGAGCGGATTTTTGT	0.393			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.S787R				Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213		0			c.C2361A												177.0	161.0	167.0					17																	5050419		2203	4300	6503	SO:0001583	missense	9098	exon21			AGTGAGCGGATTT	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2361C>A	17.37:g.5050419C>A	ENSP00000460380:p.Ser787Arg		156	0	0		229	0.02	5	NM_004505	0		0	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	37	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	C	0.193	-1.051288	0.01981	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.13901	2.95;2.55	2.5	1.37	0.22104	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.160416	0.64402	D	0.000002	T	0.09598	0.0236	L	0.46741	1.465	0.41195	D	0.986332	P;B	0.47191	0.891;0.23	B;B	0.43331	0.416;0.06	T	0.35748	-0.9776	10	0.02654	T	1	.	5.9701	0.19346	0.0:0.1433:0.0:0.8567	.	470;787	P35125-2;P35125	.;UBP6_HUMAN	R	787;470	ENSP00000250066:S787R;ENSP00000305473:S470R	ENSP00000250066:S787R	S	+	3	2	USP6	4991143	1.000000	0.71417	1.000000	0.80357	0.190000	0.23558	0.667000	0.25112	0.190000	0.20209	-1.499000	0.00960	AGC			0.393	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438990.1		NM_004505	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274343	39274343	+	Silent	SNP	A	A	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:39274343A>G	ENST00000391413.2	-	1	263	c.225T>C	c.(223-225)tgT>tgC	p.C75C		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	75	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].		Missing (in allele KAP4.14). {ECO:0000269|PubMed:15955084}.			keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			AGCTGGGGCGACAGCAGCTGG	0.657																																					p.C75C													KRTAP4-11,NS,malignant_melanoma,0,2	KRTAP4-11	0	2	0			c.T225C																																									SO:0001819	synonymous_variant	653240	exon1			GGGGCGACAGCAG	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.225T>C	17.37:g.39274343A>G			48	0	0		52	0.06	3	NM_033059	0		0	A0AUY2	Silent	SNP	ENST00000391413.2	37	CCDS45675.1																																																																																					0.657	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257690.1			
LINC00854	100874261	broad.mit.edu	37	17	41382161	41382162	+	RNA	INS	-	-	G	rs11428305|rs11403916		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:41382161_41382162insG	ENST00000433702.2	-	0	14				LINC00854_ENST00000608223.1_RNA|LINC00854_ENST00000600764.1_RNA	NR_047479.1				long intergenic non-protein coding RNA 854																		ggatgagtaccgggggcagccc	0.554																																					.													.	.			0			.																																											0	.			GAGTACCGGGGGC			17q21.31	2013-02-13	2013-02-13	2013-02-13	ENSG00000236383	ENSG00000236383		"""Long non-coding RNAs"""	43658	non-coding RNA	RNA, long non-coding			"""TMEM106A antisense RNA 1 (non-protein coding)"", ""TMEM106A antisense RNA 1"", ""TMEM106A antisense RNA 1 (tail to tail)"""	TMEM106A-AS1		22196729	Standard	NR_047479		Approved		uc031ras.1		OTTHUMG00000132641		17.37:g.41382166_41382166dupG			3	0	0		6	0.67	4	.	11	0.00	0		RNA	INS	ENST00000433702.2	37																																																																																						0.554	LINC00854-001	KNOWN	basic	antisense	processed_transcript		OTTHUMT00000255889.2			
MAP3K3	4215	hgsc.bcm.edu;mdanderson.org	37	17	61767648	61767648	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:61767648G>T	ENST00000361733.3	+	12	1408	c.1088G>T	c.(1087-1089)cGc>cTc	p.R363L	MAP3K3_ENST00000361357.3_Missense_Mutation_p.R394L|MAP3K3_ENST00000584573.1_Missense_Mutation_p.R390L|MAP3K3_ENST00000579585.1_Missense_Mutation_p.R394L|MAP3K3_ENST00000577395.1_Missense_Mutation_p.R359L	NM_002401.3	NP_002392.2	Q99759	M3K3_HUMAN	mitogen-activated protein kinase kinase kinase 3	363	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)	p.R363L(2)		breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	28						ATCAACTGGCGCCGGGGAAAG	0.517																																					p.R394L													MAP3K3,NS,carcinoma,0,2	MAP3K3	0	2	2	Substitution - Missense(2)	lung(2)	c.G1181T												73.0	79.0	77.0					17																	61767648		2203	4300	6503	SO:0001583	missense	4215	exon13			ACTGGCGCCGGGG	U78876	CCDS32701.1, CCDS32702.1	17q	2011-06-09				ENSG00000198909		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6855	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 3"", ""MAPK/ERK kinase kinase 3"""	602539		MEKK3		9006902	Standard	NM_002401		Approved	MAPKKK3	uc002jbf.3	Q99759		ENST00000361733.3:c.1088G>T	17.37:g.61767648G>T	ENSP00000354485:p.Arg363Leu		44	0	0		48	0.06	3	NM_203351	54	0.00	0	B2RCW2|D3DU15|Q5BKZ6|Q8N3I9	Missense_Mutation	SNP	ENST00000361733.3	37	CCDS32702.1	.	.	.	.	.	.	.	.	.	.	G	33	5.290811	0.95546	.	.	ENSG00000198909	ENST00000361357;ENST00000361733	T;T	0.66460	-0.21;-0.21	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.79673	0.4486	L	0.53729	1.69	0.80722	D	1	D;D;P;P	0.76494	0.999;0.999;0.808;0.766	D;D;P;P	0.76575	0.988;0.982;0.474;0.493	T	0.81161	-0.1059	10	0.87932	D	0	.	19.1762	0.93603	0.0:0.0:1.0:0.0	.	359;331;363;394	Q1PBM3;Q96HN9;Q99759;Q99759-2	.;.;M3K3_HUMAN;.	L	394;363	ENSP00000354927:R394L;ENSP00000354485:R363L	ENSP00000354927:R394L	R	+	2	0	MAP3K3	59121380	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.062000	0.89475	2.608000	0.88229	0.561000	0.74099	CGC			0.517	MAP3K3-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000443867.1		NM_002401	
LRRC45	201255	mdanderson.org	37	17	79988001	79988001	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr17:79988001G>T	ENST00000306688.3	+	15	1897	c.1555G>T	c.(1555-1557)Gcg>Tcg	p.A519S	RAC3_ENST00000306897.4_5'Flank	NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	519						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			ACGGGACGAGGCGCAGGGCGC	0.697																																					p.A519S													.	.			0			c.G1555T												9.0	11.0	10.0					17																	79988001		2080	4076	6156	SO:0001583	missense	201255	exon15			GACGAGGCGCAGG	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1555G>T	17.37:g.79988001G>T	ENSP00000306760:p.Ala519Ser		22	0	0		25	0.12	3	NM_144999	115	0.00	0		Missense_Mutation	SNP	ENST00000306688.3	37	CCDS11797.1	.	.	.	.	.	.	.	.	.	.	G	7.309	0.614626	0.14129	.	.	ENSG00000169683	ENST00000306688	T	0.43294	0.95	4.41	4.41	0.53225	.	0.358447	0.25938	N	0.027323	T	0.37972	0.1023	L	0.48362	1.52	0.38873	D	0.956735	B	0.13594	0.008	B	0.11329	0.006	T	0.25641	-1.0126	9	.	.	.	-0.0971	17.1428	0.86758	0.0:0.0:1.0:0.0	.	519	Q96CN5	LRC45_HUMAN	S	519	ENSP00000306760:A519S	.	A	+	1	0	LRRC45	77581290	1.000000	0.71417	0.983000	0.44433	0.464000	0.32679	3.846000	0.55888	2.296000	0.77279	0.205000	0.17691	GCG			0.697	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442058.1		NM_144999	
RAB12	201475	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	18	8609900	8609900	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr18:8609900A>T	ENST00000329286.6	+	1	458	c.175A>T	c.(175-177)Atg>Ttg	p.M59L		NM_001025300.2	NP_001020471.2	Q6IQ22	RAB12_HUMAN	RAB12, member RAS oncogene family	59					autophagy (GO:0006914)|cellular protein catabolic process (GO:0044257)|endosome to lysosome transport (GO:0008333)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|recycling endosome membrane (GO:0055038)|secretory granule (GO:0030141)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			breast(1)|lung(4)|prostate(1)|urinary_tract(1)	7						GACCAGCCTGATGGAGCGCTT	0.716																																					p.M59L													.	.			0			c.A175T												16.0	21.0	20.0					18																	8609900		1989	4192	6181	SO:0001583	missense	201475	exon1			AGCCTGATGGAGC		CCDS42410.1	18p11.22	2006-12-18				ENSG00000206418		"""RAB, member RAS oncogene"""	31332	protein-coding gene	gene with protein product							Standard	NM_001025300		Approved		uc002knp.3	Q6IQ22		ENST00000329286.6:c.175A>T	18.37:g.8609900A>T	ENSP00000331748:p.Met59Leu		120	0	0		101	0.48	48	NM_001025300	40	0.40	16	A6NEF5|Q4KMQ3	Missense_Mutation	SNP	ENST00000329286.6	37	CCDS42410.1	.	.	.	.	.	.	.	.	.	.	A	9.596	1.127355	0.20959	.	.	ENSG00000206418	ENST00000329286	T	0.72615	-0.67	4.23	3.06	0.35304	Small GTP-binding protein domain (1);	0.115265	0.56097	U	0.000037	T	0.30792	0.0776	N	0.00525	-1.395	0.49798	D	0.999826	B	0.12013	0.005	B	0.12837	0.008	T	0.39333	-0.9619	10	0.02654	T	1	.	9.3659	0.38223	0.9131:0.0:0.0869:0.0	.	59	Q6IQ22	RAB12_HUMAN	L	59	ENSP00000331748:M59L	ENSP00000331748:M59L	M	+	1	0	RAB12	8599900	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.462000	0.73526	0.505000	0.28104	0.352000	0.21897	ATG			0.716	RAB12-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000444080.1		XM_113967	
OSBPL1A	114876	mdanderson.org	37	18	21914216	21914216	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr18:21914216G>T	ENST00000319481.3	-	6	679	c.473C>A	c.(472-474)aCa>aAa	p.T158K		NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	158	Interaction with RAB7A.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					TACCAGAGCTGTGAGTTCTGT	0.323																																					p.T158K													.	.			0			c.C473A												114.0	105.0	108.0					18																	21914216		2203	4297	6500	SO:0001583	missense	114876	exon6			AGAGCTGTGAGTT	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.473C>A	18.37:g.21914216G>T	ENSP00000320291:p.Thr158Lys		65	0	0		42	0.07	3	NM_080597	6	0.00	0	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	ENST00000319481.3	37	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947490	0.34377	.	.	ENSG00000141447	ENST00000319481	T	0.45276	0.9	4.81	2.79	0.32731	Ankyrin repeat-containing domain (4);	0.580106	0.17944	N	0.156756	T	0.32763	0.0840	L	0.40543	1.245	0.24991	N	0.991537	B	0.18741	0.03	B	0.18561	0.022	T	0.17837	-1.0356	10	0.27082	T	0.32	-1.9488	11.5017	0.50441	0.1106:0.0:0.8894:0.0	.	158	Q9BXW6	OSBL1_HUMAN	K	158	ENSP00000320291:T158K	ENSP00000320291:T158K	T	-	2	0	OSBPL1A	20168214	0.997000	0.39634	0.859000	0.33776	0.982000	0.71751	2.009000	0.40903	0.397000	0.25310	0.655000	0.94253	ACA			0.323	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254902.1		NM_080597	
SAFB	6294	broad.mit.edu	37	19	5667167	5667167	+	Silent	SNP	T	T	C			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:5667167T>C	ENST00000292123.5	+	18	2552	c.2445T>C	c.(2443-2445)ccT>ccC	p.P815P	SAFB_ENST00000433404.1_Silent_p.P645P|SAFB_ENST00000588852.1_Silent_p.P815P|SAFB_ENST00000538656.1_Silent_p.P657P|SAFB_ENST00000454510.1_Silent_p.P746P|SAFB_ENST00000592224.1_Silent_p.P814P	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	815	Arg-rich.|Gly-rich.|Interaction with SAFB2.				chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		GGCTGCCTCCTCCCCCCAGGT	0.697																																					p.P815P	Colon(88;338 1345 6184 8214 20897)												.	SAFB	74		0			c.T2445C												11.0	14.0	13.0					19																	5667167		2183	4260	6443	SO:0001819	synonymous_variant	6294	exon18			GCCTCCTCCCCCC	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.2445T>C	19.37:g.5667167T>C			85	0.1411764706	12		145	0.19	27	NM_002967	849	0.00	0	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Silent	SNP	ENST00000292123.5	37	CCDS12142.1																																																																																					0.697	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000451641.2			
DNM2	1785	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	10908073	10908073	+	Intron	SNP	C	C	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:10908073C>G	ENST00000355667.6	+	11	1415				DNM2_ENST00000408974.4_Missense_Mutation_p.P405R|DNM2_ENST00000359692.6_Intron|DNM2_ENST00000314646.5_Missense_Mutation_p.P405R|DNM2_ENST00000585892.1_Intron|DNM2_ENST00000389253.4_Missense_Mutation_p.P405R	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CTCTTCACCCCCGACATGGCC	0.552			"""F, N, Splice, Mis, O"""		ETP ALL																																p.P405R				Rec	yes		19	19p13.2	1785	dynamin 2		L	.	.			0			c.C1214G												47.0	46.0	46.0					19																	10908073		2203	4300	6503	SO:0001627	intron_variant	1785	exon10			TCACCCCCGACAT		CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.1336-1089C>G	19.37:g.10908073C>G			36	0	0		63	0.27	17	NM_001005361	80	0.34	27	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Missense_Mutation	SNP	ENST00000355667.6	37	CCDS45968.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.463168	0.84425	.	.	ENSG00000079805	ENST00000389252;ENST00000408974;ENST00000389253;ENST00000314646	T;T;T	0.75050	-0.9;-0.9;-0.9	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.90549	0.7038	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.996;1.0	D	0.93257	0.6640	10	0.87932	D	0	-6.8242	17.7233	0.88358	0.0:1.0:0.0:0.0	.	138;405;405	B4DJ53;A8K1B6;E9PEQ4	.;.;.	R	394;405;405;405	ENSP00000386192:P405R;ENSP00000373905:P405R;ENSP00000313164:P405R	ENSP00000313164:P405R	P	+	2	0	DNM2	10769073	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.664000	0.83830	2.488000	0.83962	0.561000	0.74099	CCC			0.552	DNM2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000452592.1		NM_004945	
ANKLE1	126549	broad.mit.edu	37	19	17397492	17397501	+	3'UTR	DEL	TGTGTGTGTT	TGTGTGTGTT	-	rs534658778|rs576892988|rs371454519|rs563327402|rs1465582|rs56209027|rs71180380	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	TGTGTGTGTT	TGTGTGTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:17397492_17397501delTGTGTGTGTT	ENST00000394458.3	+	0	2255_2264				ANKLE1_ENST00000598347.1_Frame_Shift_Del_p.CVCL588fs|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000594072.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtgtgtgtttgtgtgtgtg	0.519																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTGTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTGTGTGTT>-	19.37:g.17397492_17397501delTGTGTGTGTT			6	0	0		11	0.64	7	.	5	0.00	0	A8VU82|Q8N8J8	Frame_Shift_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.519	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
TMEM161A	54929	mdanderson.org	37	19	19232599	19232599	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:19232599G>A	ENST00000162044.9	-	7	689	c.625C>T	c.(625-627)Cca>Tca	p.P209S	TMEM161A_ENST00000587583.2_Missense_Mutation_p.P184S|TMEM161A_ENST00000450333.2_Missense_Mutation_p.P106S	NM_017814.2	NP_060284.1	Q9NX61	T161A_HUMAN	transmembrane protein 161A	209					cellular response to oxidative stress (GO:0034599)|cellular response to UV (GO:0034644)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of DNA repair (GO:0045739)|response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(5;1.19e-05)|Epithelial(12;0.0011)			TTCAGAAGTGGCTCTAAGTTC	0.607																																					p.P209S													.	.			0			c.C625T												70.0	67.0	68.0					19																	19232599		2203	4300	6503	SO:0001583	missense	54929	exon7			GAAGTGGCTCTAA	BC005210	CCDS12393.1, CCDS58656.1	19p13.11	2008-02-05				ENSG00000064545			26020	protein-coding gene	gene with protein product						12975309	Standard	NM_017814		Approved	FLJ39645, FLJ20422	uc002nlg.4	Q9NX61		ENST00000162044.9:c.625C>T	19.37:g.19232599G>A	ENSP00000162044:p.Pro209Ser		42	0	0		42	0.07	3	NM_017814	117	0.00	0	B3KUE0|G5E9M6|Q7L2Y1	Missense_Mutation	SNP	ENST00000162044.9	37	CCDS12393.1	.	.	.	.	.	.	.	.	.	.	G	8.340	0.828487	0.16749	.	.	ENSG00000064545	ENST00000450333;ENST00000162044	.	.	.	4.84	3.72	0.42706	.	0.368557	0.29424	N	0.012187	T	0.21427	0.0516	N	0.25647	0.755	0.33875	D	0.635417	B;P;B	0.39862	0.386;0.692;0.31	B;B;B	0.34242	0.178;0.138;0.134	T	0.16719	-1.0393	9	0.08599	T	0.76	.	7.4825	0.27413	0.0:0.1814:0.6314:0.1872	.	106;106;209	G5E9M6;B3KUE0;Q9NX61	.;.;T161A_HUMAN	S	106;209	.	ENSP00000162044:P209S	P	-	1	0	TMEM161A	19093599	0.990000	0.36364	1.000000	0.80357	0.995000	0.86356	1.468000	0.35332	2.257000	0.74773	0.591000	0.81541	CCA			0.607	TMEM161A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460089.2		NM_017814	
ZNF565	147929	broad.mit.edu;bcgsc.ca	37	19	36673726	36673728	+	In_Frame_Del	DEL	TGT	TGT	-	rs139214220		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:36673726_36673728delTGT	ENST00000355114.5	-	5	1986_1988	c.1260_1262delACA	c.(1258-1263)cgacat>cgt	p.H421del	ZNF565_ENST00000304116.5_In_Frame_Del_p.H381del|ZNF565_ENST00000392173.2_In_Frame_Del_p.H381del			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	421					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			GACTCTCTGATGTCGTGTGAGCT	0.463																																					p.380_381del													.	ZNF565	46		0			c.1140_1142del																																									SO:0001651	inframe_deletion	147929	exon5			CTCTGATGTCGTG	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.1260_1262delACA	19.37:g.36673726_36673728delTGT	ENSP00000347234:p.His421del		58	0	0		69	0.25	17	NM_001042474	39	0.00	0	B3KQ35|Q6NUS2	In_Frame_Del	DEL	ENST00000355114.5	37																																																																																						0.463	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000451697.1		NM_152477	
ZNF565	147929	broad.mit.edu;bcgsc.ca	37	19	36673730	36673734	+	Frame_Shift_Del	DEL	GTGTG	GTGTG	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	GTGTG	GTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:36673730_36673734delGTGTG	ENST00000355114.5	-	5	1980_1984	c.1254_1258delCACAC	c.(1252-1260)ctcacacgafs	p.TR419fs	ZNF565_ENST00000304116.5_Frame_Shift_Del_p.TR379fs|ZNF565_ENST00000392173.2_Frame_Shift_Del_p.TR379fs			Q8N9K5	ZN565_HUMAN	zinc finger protein 565	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(4)|lung(4)|ovary(1)|skin(2)	11	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			CTCTGATGTCGTGTGAGCTGTGCGT	0.463																																					p.378_380del													.	ZNF565	46		0			c.1134_1138del																																									SO:0001589	frameshift_variant	147929	exon5			GATGTCGTGTGAG	AK094310	CCDS12491.1	19q13.12	2013-09-20			ENSG00000196357	ENSG00000196357		"""Zinc fingers, C2H2-type"", ""-"""	26726	protein-coding gene	gene with protein product		614275					Standard	NM_001042474		Approved	FLJ36991	uc002odn.3	Q8N9K5	OTTHUMG00000180508	ENST00000355114.5:c.1254_1258delCACAC	19.37:g.36673730_36673734delGTGTG	ENSP00000347234:p.Thr419fs		60	0	0		67	0.25	17	NM_001042474	32	0.00	0	B3KQ35|Q6NUS2	Frame_Shift_Del	DEL	ENST00000355114.5	37																																																																																						0.463	ZNF565-003	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000451697.1		NM_152477	
PNMAL2	57469	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	19	46997528	46997528	+	Intron	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr19:46997528C>T	ENST00000377655.2	-	1	734				PNMAL2_ENST00000594749.1_Intron|AC011484.1_ENST00000377652.3_5'Flank|PNMAL2_ENST00000599531.1_Missense_Mutation_p.A399T			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2											central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		AGGACCACGGCGTCCACCTCG	0.667																																					p.A399T													.	.			0			c.G1195A												13.0	15.0	14.0					19																	46997528		1945	4108	6053	SO:0001627	intron_variant	57469	exon1			CCACGGCGTCCAC	AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.734+460G>A	19.37:g.46997528C>T			27	0	0		35	0.26	9	NM_020709	15	0.20	3	C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Missense_Mutation	SNP	ENST00000377655.2	37																																																																																						0.667	PNMAL2-201	KNOWN	basic	protein_coding	protein_coding				NM_020709	
MERTK	10461	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	2	112760766	112760766	+	Splice_Site	SNP	T	T	C			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:112760766T>C	ENST00000295408.4	+	12	2043		c.e12+2		MERTK_ENST00000409780.1_Splice_Site|MERTK_ENST00000421804.2_Splice_Site			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase						apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TGGGTGAAGGTAAGCAATTTA	0.308																																					.													.	.			0			c.1786+2T>C												69.0	78.0	75.0					2																	112760766		2203	4297	6500	SO:0001630	splice_region_variant	10461	exon12			TGAAGGTAAGCAA	U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.1786+2T>C	2.37:g.112760766T>C			114	0	0		160	0.26	42	NM_006343	6	0.00	0	Q9HBB4	Splice_Site	SNP	ENST00000295408.4	37	CCDS2094.1	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289365	0.40494	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3516	0.66705	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MERTK	112477237	1.000000	0.71417	0.998000	0.56505	0.396000	0.30629	6.221000	0.72243	2.027000	0.59764	0.523000	0.50628	.			0.308	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254046.2			Intron
NT5DC4	284958	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	113480334	113480334	+	Silent	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:113480334C>T	ENST00000327581.4	+	6	486	c.435C>T	c.(433-435)tgC>tgT	p.C145C				Q86YG4	NT5D4_HUMAN	5'-nucleotidase domain containing 4	145							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)										TCTCTGGCTGCTCCCGTTACA	0.602																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	284958	.			TGGCTGCTCCCGT	BC041437		2q13	2012-04-20			ENSG00000144130	ENSG00000144130			27678	protein-coding gene	gene with protein product							Standard	XM_001716359		Approved		uc002tid.3	Q86YG4	OTTHUMG00000153308	ENST00000327581.4:c.435C>T	2.37:g.113480334C>T			77	0	0		114	0.34	39	.	0		0		Silent	SNP	ENST00000327581.4	37																																																																																						0.602	NT5DC4-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000330647.1		XM_001716541	
WASH2P	375260	bcgsc.ca	37	2	114356239	114356239	+	RNA	SNP	T	T	C	rs11490622	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:114356239T>C	ENST00000538033.2	+	0	2419							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCTTTGCCCGTGTGTCAGACT	0.642													.|||	2373	0.473842	0.5174	0.4135	5008	,	,		16997	0.4256		0.4911	False		,,,				2504	0.4898				.													.	.			0			.																																											375260	.			TGCCCGTGTGTCA			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114356239T>C			41	0.3902439024	16		41	0.95	39	.	12	0.75	9		RNA	SNP	ENST00000538033.2	37																																																																																						0.642	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
RAB6C-AS1	100131320	broad.mit.edu	37	2	130726529	130726529	+	RNA	DEL	A	A	-	rs112755128		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:130726529delA	ENST00000412425.1	-	0	615					NR_036537.1																						AACGAAGTGCAAAAAAAAAAA	0.343																																					.													.	.			0			.																																											0	.			AAGTGCAAAAAAA																													2.37:g.130726529delA			6	0	0		8	0.38	3	.	0		0		RNA	DEL	ENST00000412425.1	37																																																																																						0.343	AC079776.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331383.1			
NFE2L2	4780	bcgsc.ca	37	2	178129282	178129282	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:178129282G>T	ENST00000397062.3	-	1	577	c.23C>A	c.(22-24)cCg>cAg	p.P8Q	NFE2L2_ENST00000423513.1_5'Flank|AC079305.10_ENST00000428541.1_RNA|NFE2L2_ENST00000446151.2_5'Flank|NFE2L2_ENST00000464747.1_Intron|NFE2L2_ENST00000397063.4_5'Flank	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	8					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGTCCCGGCGGCGGCAGCTC	0.761			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.P8Q				Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	.	NFE2L2	225		0			c.C23A												6.0	11.0	9.0					2																	178129282		1463	3360	4823	SO:0001583	missense	4780	exon1			CCCGGCGGCGGCA		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.23C>A	2.37:g.178129282G>T	ENSP00000380252:p.Pro8Gln		61	0	0		65	0.06	4	NM_006164	39	0.00	0	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	37	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	G	9.236	1.037082	0.19669	.	.	ENSG00000116044	ENST00000397062;ENST00000430047	T;T	0.63255	1.66;-0.03	3.85	2.95	0.34219	.	0.415950	0.18985	U	0.125775	T	0.48429	0.1499	L	0.51422	1.61	0.80722	D	1	P	0.39157	0.662	B	0.34138	0.176	T	0.49031	-0.8981	10	0.38643	T	0.18	.	6.3824	0.21542	0.1328:0.0:0.8672:0.0	.	8	Q16236	NF2L2_HUMAN	Q	8	ENSP00000380252:P8Q;ENSP00000391291:P8Q	ENSP00000380252:P8Q	P	-	2	0	NFE2L2	177837528	1.000000	0.71417	0.992000	0.48379	0.088000	0.18126	1.244000	0.32778	2.084000	0.62774	0.460000	0.39030	CCG			0.761	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000257752.4		NM_006164	
NEU4	129807	mdanderson.org	37	2	242757880	242757880	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr2:242757880G>A	ENST00000391969.2	+	5	1672	c.961G>A	c.(961-963)Gct>Act	p.A321T	NEU4_ENST00000407683.1_Missense_Mutation_p.A321T|NEU4_ENST00000325935.6_Missense_Mutation_p.A334T|NEU4_ENST00000404257.1_Missense_Mutation_p.A333T|NEU4_ENST00000405370.1_Missense_Mutation_p.A321T	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	321	Pro-rich.				ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		AGAGGAGGCTGCTGTAGACCC	0.711																																					p.A334T													.	.			0			c.G1000A												13.0	15.0	14.0					2																	242757880		2097	4116	6213	SO:0001583	missense	129807	exon4			GAGGCTGCTGTAG	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.961G>A	2.37:g.242757880G>A	ENSP00000375830:p.Ala321Thr		33	0	0		31	0.10	3	NM_001167599	1	0.00	0	A8K056|J3KNJ5|Q96D64	Missense_Mutation	SNP	ENST00000391969.2	37	CCDS54442.1	.	.	.	.	.	.	.	.	.	.	G	7.023	0.559074	0.13436	.	.	ENSG00000204099	ENST00000407683;ENST00000405370;ENST00000472793;ENST00000404257;ENST00000391969;ENST00000325935	T;T;T;T;T	0.75938	-0.97;-0.97;-0.97;-0.97;-0.98	3.61	-1.25	0.09405	Neuraminidase (1);	2.313250	0.01622	N	0.023051	T	0.49830	0.1580	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.41360	-0.9513	10	0.09338	T	0.73	-0.0014	4.0136	0.09634	0.5297:0.0:0.297:0.1733	.	333;333;321	A8K211;Q8WWR8-2;Q8WWR8	.;.;NEUR4_HUMAN	T	321;321;331;333;321;334	ENSP00000385402:A321T;ENSP00000384804:A321T;ENSP00000385149:A333T;ENSP00000375830:A321T;ENSP00000320318:A334T	ENSP00000320318:A334T	A	+	1	0	NEU4	242406553	.	.	0.000000	0.03702	0.003000	0.03518	.	.	-0.149000	0.11215	-0.529000	0.04317	GCT			0.711	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257270.2		NM_080741	
LAMA5	3911	broad.mit.edu;mdanderson.org	37	20	60887507	60887507	+	Silent	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr20:60887507G>A	ENST00000252999.3	-	68	9375	c.9309C>T	c.(9307-9309)ctC>ctT	p.L3103L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3103	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCAGCCGCTTGAGGTCCACAT	0.682																																					p.L3103L													.	LAMA5	268		0			c.C9309T												43.0	39.0	40.0					20																	60887507		2190	4296	6486	SO:0001819	synonymous_variant	3911	exon68			CCGCTTGAGGTCC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9309C>T	20.37:g.60887507G>A			9	0	0		8	0.50	4	NM_005560	279	0.47	131	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	ENST00000252999.3	37	CCDS33502.1																																																																																					0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
MX2	4600	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	42767524	42767524	+	Silent	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr21:42767524C>A	ENST00000330714.3	+	7	1066	c.882C>A	c.(880-882)acC>acA	p.T294T	MX2_ENST00000496774.1_3'UTR|MX2_ENST00000543692.1_3'UTR	NM_002463.1	NP_002454.1	P20592	MX2_HUMAN	MX dynamin-like GTPase 2	294	Dynamin-type G.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|GTP catabolic process (GO:0006184)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of nucleocytoplasmic transport (GO:0046822)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(2)|endometrium(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	34		Prostate(19;1.57e-07)|all_epithelial(19;0.0222)				GTATCCTGACCAAACCAGATC	0.493																																					p.T294T													.	MX2	84		0			c.C882A												105.0	87.0	94.0					21																	42767524		2203	4300	6503	SO:0001819	synonymous_variant	4600	exon7			CCTGACCAAACCA		CCDS13672.1	21q22.3	2014-07-15	2014-07-15		ENSG00000183486	ENSG00000183486			7533	protein-coding gene	gene with protein product	"""interferon-regulated resistance GTP-binding protein MXB"", ""second interferon-induced protein p78"""	147890	"""myxovirus (influenza) resistance 2, homolog of murine"", ""myxovirus (influenza virus) resistance 2 (mouse)"""			2481229, 8798556	Standard	NM_002463		Approved	MXB	uc002yzf.1	P20592	OTTHUMG00000086753	ENST00000330714.3:c.882C>A	21.37:g.42767524C>A			193	0	0		243	0.04	9	NM_002463	10	0.00	0	B7Z5D3|D3DSI7	Silent	SNP	ENST00000330714.3	37	CCDS13672.1																																																																																					0.493	MX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195147.1		NM_002463	
SCN10A	6336	mdanderson.org	37	3	38805080	38805080	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr3:38805080C>A	ENST00000449082.2	-	5	606	c.607G>T	c.(607-609)Ggc>Tgc	p.G203C		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	203					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	ATTGCTGTGCCAACATATCTG	0.463																																					p.G203C													.	.			0			c.G607T												120.0	115.0	117.0					3																	38805080		2203	4300	6503	SO:0001583	missense	6336	exon5			CTGTGCCAACATA	AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.607G>T	3.37:g.38805080C>A	ENSP00000390600:p.Gly203Cys		23	0	0		22	0.09	2	NM_006514	0		0	A6NDQ1	Missense_Mutation	SNP	ENST00000449082.2	37	CCDS33736.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769649	0.31320	.	.	ENSG00000185313	ENST00000449082	D	0.98550	-4.99	4.66	3.77	0.43336	Ion transport (1);	0.305459	0.29558	U	0.011809	D	0.98507	0.9502	M	0.80332	2.49	0.21527	N	0.999653	D	0.71674	0.998	D	0.70227	0.968	D	0.94701	0.7883	10	0.87932	D	0	.	8.1967	0.31400	0.158:0.7632:0.0:0.0787	.	203	Q9Y5Y9	SCNAA_HUMAN	C	203	ENSP00000390600:G203C	ENSP00000390600:G203C	G	-	1	0	SCN10A	38780084	0.058000	0.20735	0.004000	0.12327	0.083000	0.17756	1.685000	0.37659	1.287000	0.44583	0.650000	0.86243	GGC			0.463	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109745.3		NM_006514	
GNL3	26354	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	3	52721395	52721396	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	AG	AG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr3:52721395_52721396delAG	ENST00000418458.1	+	3	379_380	c.206_207delAG	c.(205-207)cagfs	p.Q69fs	SNORD19B_ENST00000516978.1_RNA|GNL3_ENST00000460073.1_3'UTR|SNORD19_ENST00000391191.1_RNA|GNL3_ENST00000394799.2_Frame_Shift_Del_p.Q57fs|PBRM1_ENST00000394830.3_5'Flank	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	69					cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		CTAAGGAAACAGAGGGTAAGTT	0.436																																					p.69_69del													.,1	GNL3	37		0			c.205_206del																																									SO:0001589	frameshift_variant	26354	exon3			GGAAACAGAGGGT	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.206_207delAG	3.37:g.52721397_52721398delAG	ENSP00000395772:p.Gln69fs		183	0	0		230	0.29	66	NM_014366	291	0.00	0	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Frame_Shift_Del	DEL	ENST00000418458.1	37	CCDS2861.1																																																																																					0.436	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352032.1		NM_014366	
CD96	10225	broad.mit.edu	37	3	111197863	111197878	+	lincRNA	DEL	CACACACACACACACA	CACACACACACACACA	-	rs61579002|rs398051454|rs7650195	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	CACACACACACACACA	CACACACACACACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr3:111197863_111197878delCACACACACACACACA	ENST00000497896.1	-	0	208																											CGAACAGCCTcacacacacacacacacacacacaca	0.556																																					.													.	.			0			.																																											0	.			CAGCCTCACACAC																													3.37:g.111197863_111197878delCACACACACACACACA			4	0	0		6	0.50	3	.	0		0		RNA	DEL	ENST00000497896.1	37																																																																																						0.556	RP11-615J4.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000354056.1			
SEMA5B	54437	broad.mit.edu;mdanderson.org	37	3	122631795	122631795	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr3:122631795G>A	ENST00000357599.3	-	18	3006	c.2620C>T	c.(2620-2622)Cgc>Tgc	p.R874C	SEMA5B_ENST00000451055.2_Missense_Mutation_p.R928C|SEMA5B_ENST00000195173.4_Missense_Mutation_p.R873C	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	874	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		TTGCGGACGCGGAAGCCCAGC	0.731																																					p.R928C													.	SEMA5B	303		0			c.C2782T												22.0	28.0	26.0					3																	122631795		2201	4297	6498	SO:0001583	missense	54437	exon18			GGACGCGGAAGCC	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.2620C>T	3.37:g.122631795G>A	ENSP00000350215:p.Arg874Cys		77	0	0		104	0.27	28	NM_001256347	57	0.30	17	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	ENST00000357599.3	37	CCDS35491.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577006	0.86645	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	5.01	5.01	0.66863	.	0.188742	0.46442	D	0.000297	T	0.78149	0.4238	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.981;0.992	T	0.83357	-0.0000	10	0.87932	D	0	.	13.0399	0.58893	0.0:0.0:0.8283:0.1717	.	816;874	D3YTI7;Q9P283	.;SEM5B_HUMAN	C	874;873;816;928;874	ENSP00000350215:R874C;ENSP00000195173:R873C;ENSP00000389588:R928C;ENSP00000377208:R874C	ENSP00000195173:R873C	R	-	1	0	SEMA5B	124114485	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.201000	0.58439	2.616000	0.88540	0.655000	0.94253	CGC			0.731	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000277165.1		NM_001031702	
MUC4	4585	mdanderson.org	37	3	195511417	195511417	+	Missense_Mutation	SNP	G	G	A	rs74839766	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr3:195511417G>A	ENST00000463781.3	-	2	7493	c.7034C>T	c.(7033-7035)gCa>gTa	p.A2345V	MUC4_ENST00000475231.1_Missense_Mutation_p.A2345V|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTGTGGATGCTGAGGAAGG	0.587																																					p.A2345V													.	.			0			c.C7034T												6.0	8.0	8.0					3																	195511417		569	1484	2053	SO:0001583	missense	4585	exon2			GTGGATGCTGAGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7034C>T	3.37:g.195511417G>A	ENSP00000417498:p.Ala2345Val		82	0.0365853659	3		98	0.06	6	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	A	3.659	-0.069992	0.07228	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.34472	1.36;1.38	.	.	.	.	.	.	.	.	T	0.15955	0.0384	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.15694	-1.0428	7	.	.	.	.	3.4536	0.07507	0.2476:0.2589:0.4935:0.0	.	2345	E7ESK3	.	V	2345	ENSP00000417498:A2345V;ENSP00000420243:A2345V	.	A	-	2	0	MUC4	196995812	0.024000	0.19004	0.001000	0.08648	0.020000	0.10135	-1.973000	0.01500	-2.622000	0.00439	-2.092000	0.00371	GCA	0.008		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
ZNF721	170960	hgsc.bcm.edu	37	4	466474	466474	+	Intron	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr4:466474C>T	ENST00000338977.5	-	1	47				ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000507078.1_5'UTR|ZNF721_ENST00000506646.1_Missense_Mutation_p.R7K|ZNF721_ENST00000511833.2_5'UTR			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						GGCCACATCCCTGAATGTTAA	0.413																																					.													.	.			0			.												49.0	42.0	44.0					4																	466474		692	1591	2283	SO:0001627	intron_variant	79963	.			ACATCCCTGAATG	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.1+26370G>A	4.37:g.466474C>T			113	0	0		119	0.06	7	.	31	0.03	1	Q69YG7	RNA	SNP	ENST00000338977.5	37		.	.	.	.	.	.	.	.	.	.	C	10.28	1.307175	0.23821	.	.	ENSG00000182903	ENST00000506646;ENST00000505900	T;T	0.01369	4.97;4.97	1.79	-0.175	0.13315	.	.	.	.	.	T	0.01835	0.0058	.	.	.	0.58432	D	0.999999	B	0.30068	0.267	B	0.38225	0.268	T	0.55933	-0.8062	8	0.59425	D	0.04	.	4.4819	0.11771	0.0:0.4123:0.0:0.5877	.	7	B4E159	.	K	7	ENSP00000423586:R7K;ENSP00000421325:R7K	ENSP00000421325:R7K	R	-	2	0	ZNF721	456474	0.991000	0.36638	0.056000	0.19401	0.108000	0.19459	0.040000	0.13905	0.089000	0.17243	0.603000	0.83216	AGG			0.413	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000357939.1		NM_133474	
OTUD4	54726	broad.mit.edu	37	4	146059041	146059041	+	Silent	SNP	A	A	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr4:146059041A>G	ENST00000447906.2	-	21	3073	c.2886T>C	c.(2884-2886)caT>caC	p.H962H	OTUD4_ENST00000455611.2_Intron|OTUD4_ENST00000454497.2_Silent_p.H897H			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	962					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GAGTGGGAGGATGAGCCTTTC	0.478																																					p.H897H													OTUD4,bladder,carcinoma,0,2	OTUD4	120	2	0			c.T2691C												118.0	118.0	118.0					4																	146059041		2203	4300	6503	SO:0001819	synonymous_variant	54726	exon21			GGGAGGATGAGCC		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2886T>C	4.37:g.146059041A>G			75	0.0266666667	2		84	0.05	4	NM_001102653	19	0.00	0	B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37																																																																																						0.478	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365117.2		NM_017493	
ANKH	56172	mdanderson.org	37	5	14746005	14746005	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr5:14746005G>T	ENST00000284268.6	-	7	1219	c.889C>A	c.(889-891)Cgt>Agt	p.R297S	ANKH_ENST00000535119.1_Missense_Mutation_p.R99S|ANKH_ENST00000503939.1_5'UTR	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	297					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						TACACAGCACGGATTTCCGTC	0.517																																					p.R297S													.	.			0			c.C889A												130.0	115.0	120.0					5																	14746005		2203	4300	6503	SO:0001583	missense	56172	exon7			CAGCACGGATTTC	AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.889C>A	5.37:g.14746005G>T	ENSP00000284268:p.Arg297Ser		61	0	0		52	0.06	3	NM_054027	31	0.00	0	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Missense_Mutation	SNP	ENST00000284268.6	37	CCDS3885.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451659	0.84209	.	.	ENSG00000154122	ENST00000535119;ENST00000284268	D;D	0.94497	-3.44;-3.44	5.65	4.73	0.59995	.	0.000000	0.85682	D	0.000000	D	0.96119	0.8735	L	0.56769	1.78	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.95813	0.8843	10	0.72032	D	0.01	-34.1112	13.8574	0.63537	0.0:0.0:0.7875:0.2125	.	297	Q9HCJ1	ANKH_HUMAN	S	99;297	ENSP00000442524:R99S;ENSP00000284268:R297S	ENSP00000284268:R297S	R	-	1	0	ANKH	14799005	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	3.736000	0.55052	2.824000	0.97209	0.655000	0.94253	CGT			0.517	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207063.1		NM_054027	
FTMT	94033	mdanderson.org	37	5	121187745	121187745	+	Silent	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr5:121187745G>T	ENST00000321339.1	+	1	96	c.87G>T	c.(85-87)ccG>ccT	p.P29P		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	29					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TCGCGCTCCCGCTGCGTTGGG	0.756																																					p.P29P													.	.			0			c.G87T												11.0	13.0	12.0					5																	121187745		2186	4268	6454	SO:0001819	synonymous_variant	94033	exon1			GCTCCCGCTGCGT	BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.87G>T	5.37:g.121187745G>T			15	0	0		17	0.18	3	NM_177478	0		0		Silent	SNP	ENST00000321339.1	37	CCDS4128.1																																																																																					0.756	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250884.1		NM_177478	
TCOF1	6949	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	149767638	149767638	+	Silent	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr5:149767638G>A	ENST00000504761.2	+	18	3033	c.3033G>A	c.(3031-3033)caG>caA	p.Q1011Q	TCOF1_ENST00000513346.1_Silent_p.Q1048Q|TCOF1_ENST00000377797.3_Silent_p.Q1011Q|TCOF1_ENST00000439160.2_Silent_p.Q1011Q|TCOF1_ENST00000323668.7_Silent_p.Q934Q|TCOF1_ENST00000445265.2_Silent_p.Q934Q|TCOF1_ENST00000451292.1_Silent_p.Q1048Q			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1011					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGCTACACAGTGCTTGACTC	0.652																																					p.Q1011Q													.	.			0			c.G3033A												49.0	46.0	47.0					5																	149767638		2203	4300	6503	SO:0001819	synonymous_variant	6949	exon18			TACACAGTGCTTG		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.3033G>A	5.37:g.149767638G>A			155	0	0		156	0.04	7	NM_001135243	116	0.09	10	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Silent	SNP	ENST00000504761.2	37	CCDS54936.1																																																																																					0.652	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000380552.1		NM_001008656	
DSP	1832	bcgsc.ca	37	6	7583862	7583862	+	Missense_Mutation	SNP	C	C	T	rs372242085		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr6:7583862C>T	ENST00000379802.3	+	24	6708	c.6367C>T	c.(6367-6369)Cgc>Tgc	p.R2123C	DSP_ENST00000418664.2_Missense_Mutation_p.R1524C	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2123	4.5 X 38 AA tandem repeats (Domain A).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AACCGGAATGCGCCTGCTGGA	0.458													C|||	0	0.0	0.0	0.0	5008	,	,		19716	0.0		0.0	False		,,,				2504	0.0				p.R2123C													DSP,colon,carcinoma,0,1	DSP	306	1	0			c.C6367T							C	CYS/ARG,CYS/ARG	2,4404	4.2+/-10.8	0,2,2201	60.0	67.0	65.0		4570,6367	5.2	1.0	6		65	0,8600		0,0,4300	no	missense,missense	DSP	NM_001008844.1,NM_004415.2	180,180	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging,probably-damaging	1524/2273,2123/2872	7583862	2,13004	2203	4300	6503	SO:0001583	missense	1832	exon24			GGAATGCGCCTGC	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.6367C>T	6.37:g.7583862C>T	ENSP00000369129:p.Arg2123Cys		42	0	0		47	0.09	4	NM_004415	98	0.00	0	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	37	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551168	0.86127	4.54E-4	0.0	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.80214	-1.35;-1.35	5.18	5.18	0.71444	.	0.000000	0.64402	D	0.000011	D	0.89949	0.6863	M	0.86740	2.835	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.89400	0.3695	10	0.44086	T	0.13	.	19.0722	0.93143	0.0:1.0:0.0:0.0	.	1571;2123	Q4LE79;P15924	.;DESP_HUMAN	C	2123;1524	ENSP00000369129:R2123C;ENSP00000396591:R1524C	ENSP00000369129:R2123C	R	+	1	0	DSP	7528861	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.776000	0.85560	2.595000	0.87683	0.655000	0.94253	CGC			0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039786.2		NM_004415	
CMAHP	8418	broad.mit.edu	37	6	25089567	25089568	+	RNA	INS	-	-	A	rs185289496|rs3838674|rs370650178	byFrequency	TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr6:25089567_25089568insA	ENST00000377989.4	-	0	1962							Q9Y471	CMAH_HUMAN	cytidine monophospho-N-acetylneuraminic acid hydroxylase, pseudogene						CMP-N-acetylneuraminate metabolic process (GO:0046381)	cytoplasm (GO:0005737)	2 iron, 2 sulfur cluster binding (GO:0051537)|oxidoreductase activity (GO:0016491)			NS(1)	1						ATGCAGTCTGCCCCAGCTTCAC	0.505													A|-|A|deletion	1250	0.249601	0.2065	0.3069	5008	,	,		17119	0.2837		0.2465	False		,,,				2504	0.2352				.													.	CMAHP	6		0			.																																											0	.			AGTCTGCCCCAGC			6p23-p22	2011-04-28	2011-04-28	2011-04-28	ENSG00000168405	ENSG00000168405			2098	pseudogene	pseudogene		603209	"""cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase)(pseudogene)"""	CMAH		7608218, 9624188	Standard	NR_002174		Approved		uc003ner.4	Q9Y471	OTTHUMG00000016099		6.37:g.25089567_25089568insA			4	0	0		11	0.55	6	.	0		0	O95250|Q5TD41|Q5TD42|Q5TD43|Q5TD44|Q68DC3|Q9UEE7	RNA	INS	ENST00000377989.4	37																																																																																						0.505	CMAHP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000043292.2		NR_002174	
SPACA1	81833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	88757823	88757823	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr6:88757823C>A	ENST00000237201.1	+	1	317	c.200C>A	c.(199-201)aCc>aAc	p.T67N		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	67					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		CCGCCTGAAACCGAGGATGGT	0.637																																					p.T67N													.	.			0			c.C200A												45.0	30.0	35.0					6																	88757823		2192	4287	6479	SO:0001583	missense	81833	exon1			CTGAAACCGAGGA	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.200C>A	6.37:g.88757823C>A	ENSP00000237201:p.Thr67Asn		96	0	0		107	0.29	31	NM_030960	0		0		Missense_Mutation	SNP	ENST00000237201.1	37	CCDS5014.1	.	.	.	.	.	.	.	.	.	.	C	4.421	0.077867	0.08485	.	.	ENSG00000118434	ENST00000237201	T	0.26518	1.73	3.79	2.03	0.26663	.	1.944940	0.02991	N	0.146816	T	0.03827	0.0108	N	0.08118	0	0.09310	N	1	B	0.32160	0.358	B	0.25291	0.059	T	0.22347	-1.0219	10	0.25106	T	0.35	15.4741	6.2772	0.20987	0.0:0.7736:0.0:0.2264	.	67	Q9HBV2	SACA1_HUMAN	N	67	ENSP00000237201:T67N	ENSP00000237201:T67N	T	+	2	0	SPACA1	88814542	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.028000	0.13644	0.605000	0.29947	-1.214000	0.01621	ACC			0.637	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041459.1			
CHST12	55501	broad.mit.edu;ucsc.edu;mdanderson.org	37	7	2472936	2472936	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:2472936G>T	ENST00000258711.6	+	2	797	c.662G>T	c.(661-663)cGc>cTc	p.R221L		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	221					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		AAGTTCTGGCGCCGCTACGGG	0.657																																					p.R221L													.	CHST12	39		0			c.G662T												50.0	40.0	43.0					7																	2472936		2203	4296	6499	SO:0001583	missense	55501	exon2			TCTGGCGCCGCTA	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.662G>T	7.37:g.2472936G>T	ENSP00000258711:p.Arg221Leu		28	0	0		42	0.10	4	NM_018641	62	0.00	0	A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	ENST00000258711.6	37	CCDS5333.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.011514	0.75046	.	.	ENSG00000136213	ENST00000258711;ENST00000432336	T;T	0.73681	-0.77;-0.77	5.1	5.1	0.69264	.	0.149152	0.41294	D	0.000917	T	0.78966	0.4367	L	0.52206	1.635	0.53005	D	0.999963	P	0.51351	0.944	P	0.53102	0.718	T	0.77910	-0.2411	10	0.37606	T	0.19	-0.6889	18.5015	0.90882	0.0:0.0:1.0:0.0	.	221	Q9NRB3	CHSTC_HUMAN	L	221	ENSP00000258711:R221L;ENSP00000411207:R221L	ENSP00000258711:R221L	R	+	2	0	CHST12	2439462	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.621000	0.61233	2.382000	0.81193	0.462000	0.41574	CGC			0.657	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060170.3		NM_018641	
GRID2IP	392862	broad.mit.edu	37	7	6547896	6547901	+	In_Frame_Del	DEL	CTGAGC	CTGAGC	-			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	CTGAGC	CTGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:6547896_6547901delCTGAGC	ENST00000457091.2	-	13	2258_2263	c.2259_2264delGCTCAG	c.(2257-2265)ccgctcagc>ccc	p.LS754del	GRID2IP_ENST00000435185.1_In_Frame_Del_p.LS570del|GRID2IP_ENST00000452113.1_In_Frame_Del_p.LS563del	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	754	Pro-rich.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						TGGTGGGGGGCTGAGCGGGGGTGGGG	0.66																																					p.753_755del													.	GRID2IP	82		0			c.2259_2264del																																									SO:0001651	inframe_deletion	392862	exon13			GGGGGGCTGAGCG		CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2259_2264delGCTCAG	7.37:g.6547896_6547901delCTGAGC	ENSP00000397351:p.Leu754_Ser755del		30	0	0		44	0.23	10	NM_001145118	0		0		In_Frame_Del	DEL	ENST00000457091.2	37	CCDS47537.1																																																																																					0.660	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340534.1		XM_294249	
FAM126A	84668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	23016321	23016321	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:23016321G>A	ENST00000432176.2	-	6	753	c.521C>T	c.(520-522)gCa>gTa	p.A174V	FAM126A_ENST00000409923.1_Missense_Mutation_p.A174V	NM_032581.3	NP_115970.2	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	174					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|urinary_tract(2)	23						CCGATTCTGTGCTGTCAGCAT	0.378																																					p.A174V													.	.			0			c.C521T												87.0	80.0	82.0					7																	23016321		2203	4300	6503	SO:0001583	missense	84668	exon6			TTCTGTGCTGTCA	BC018710	CCDS5377.1	7p15.3	2008-10-02			ENSG00000122591	ENSG00000122591			24587	protein-coding gene	gene with protein product	"""down regulated by Ctnnb1, a"""	610531				10910037, 16951682	Standard	NM_032581		Approved	DRCTNNB1A, HCC, HYCC1, hyccin	uc003svm.4	Q9BYI3	OTTHUMG00000128435	ENST00000432176.2:c.521C>T	7.37:g.23016321G>A	ENSP00000403396:p.Ala174Val		81	0	0		113	0.26	29	NM_032581	9	0.44	4	A4D145|Q6N010|Q75MR4|Q7LDZ4|Q96MX1|Q96NQ6	Missense_Mutation	SNP	ENST00000432176.2	37	CCDS5377.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.386374|5.386374	0.95967|0.95967	.|.	.|.	ENSG00000122591|ENSG00000122591	ENST00000432176;ENST00000409923|ENST00000440481	D;D|.	0.82167|.	-1.58;-1.58|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83487|0.83487	0.5265|0.5265	M|M	0.84846|0.84846	2.72|2.72	0.80722|0.80722	D|D	1|1	P;D|.	0.53151|.	0.73;0.958|.	P;P|.	0.54590|.	0.612;0.756|.	D|D	0.83927|0.83927	0.0304|0.0304	10|5	0.49607|.	T|.	0.09|.	-0.522|-0.522	20.1518|20.1518	0.98089|0.98089	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	174;174|.	B8ZZJ1;Q9BYI3|.	.;HYCCI_HUMAN|.	V|Y	174|226	ENSP00000403396:A174V;ENSP00000386246:A174V|.	ENSP00000386246:A174V|.	A|H	-|-	2|1	0|0	FAM126A|FAM126A	22982846|22982846	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.952000|0.952000	0.60782|0.60782	9.791000|9.791000	0.99081|0.99081	2.772000|2.772000	0.95346|0.95346	0.563000|0.563000	0.77884|0.77884	GCA|CAC			0.378	FAM126A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250230.1		NM_032581	
KPNA7	402569	broad.mit.edu	37	7	98790654	98790654	+	Silent	SNP	T	T	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:98790654T>G	ENST00000327442.6	-	5	663	c.624A>C	c.(622-624)tcA>tcC	p.S208S		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	208					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						GCAGGGTGGGTGAAATCAAGG	0.383																																					p.S208S													.	KPNA7	31		0			c.A624C												93.0	83.0	86.0					7																	98790654		692	1591	2283	SO:0001819	synonymous_variant	402569	exon5			GGTGGGTGAAATC		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.624A>C	7.37:g.98790654T>G			60	0.1333333333	8		82	0.17	14	NM_001145715	0		0	A4D277	Silent	SNP	ENST00000327442.6	37	CCDS47651.1																																																																																					0.383	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335118.1		NM_001145715	
MUC17	140453	mdanderson.org	37	7	100679429	100679429	+	Missense_Mutation	SNP	T	T	A	rs140211003		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:100679429T>A	ENST00000306151.4	+	3	4796	c.4732T>A	c.(4732-4734)Ttg>Atg	p.L1578M		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1578	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACTAACAAGTTTGCCTGTCAG	0.483																																					p.L1578M													.	.			0			c.T4732A												263.0	247.0	253.0					7																	100679429		2203	4300	6503	SO:0001583	missense	140453	exon3			ACAAGTTTGCCTG	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.4732T>A	7.37:g.100679429T>A	ENSP00000302716:p.Leu1578Met		81	0.012345679	1		119	0.08	10	NM_001040105	0		0	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	37	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	A	0.434	-0.902014	0.02453	.	.	ENSG00000169876	ENST00000306151	T	0.02395	4.31	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.01421	0.0046	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48843	-0.8999	8	0.39692	T	0.17	.	.	.	.	.	1578	Q685J3	MUC17_HUMAN	M	1578	ENSP00000302716:L1578M	ENSP00000302716:L1578M	L	+	1	2	MUC17	100466149	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.718000	0.00384	-1.589000	0.01625	-1.617000	0.00794	TTG			0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
ZNF425	155054	broad.mit.edu;bcgsc.ca	37	7	148801009	148801009	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:148801009G>A	ENST00000378061.2	-	4	2086	c.1954C>T	c.(1954-1956)Cgg>Tgg	p.R652W		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	652					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TCTGTGAGCCGGTACTGTTGA	0.537																																					p.R652W													.	ZNF425	99		0			c.C1954T												142.0	130.0	134.0					7																	148801009		2203	4300	6503	SO:0001583	missense	155054	exon4			TGAGCCGGTACTG	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1954C>T	7.37:g.148801009G>A	ENSP00000367300:p.Arg652Trp		81	0	0		105	0.05	5	NM_001001661	21	0.00	0	B3KPM1|Q08AG3	Missense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	G	14.23	2.472865	0.43942	.	.	ENSG00000204947	ENST00000378061	T	0.07800	3.16	3.34	0.982	0.19762	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17916	0.0430	L	0.56396	1.775	0.09310	N	1	D	0.76494	0.999	D	0.65773	0.938	T	0.09574	-1.0668	9	0.59425	D	0.04	.	4.3831	0.11304	0.0:0.1279:0.4576:0.4146	.	652	Q6IV72	ZN425_HUMAN	W	652	ENSP00000367300:R652W	ENSP00000367300:R652W	R	-	1	2	ZNF425	148431942	0.000000	0.05858	0.423000	0.26634	0.928000	0.56348	-3.551000	0.00433	0.480000	0.27534	-0.262000	0.10625	CGG			0.537	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352726.1		XM_088140	
SSPO	23145	mdanderson.org	37	7	149474749	149474749	+	RNA	SNP	A	A	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:149474749A>G	ENST00000378016.2	+	0	548							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCTGTGGGCCAGCTCTGGAGC	0.657																																					p.Q183R													.	.			0			c.A548G												22.0	26.0	25.0					7																	149474749		2026	4174	6200			23145	exon5			TGGGCCAGCTCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149474749A>G			21	0	0		28	0.11	3	NM_198455	4	0.00	0	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	37																																																																																						0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
ASIC3	9311	mdanderson.org	37	7	150746458	150746458	+	Silent	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:150746458G>T	ENST00000349064.5	+	1	684	c.486G>T	c.(484-486)ctG>ctT	p.L162L	ASIC3_ENST00000297512.8_Silent_p.L162L|ASIC3_ENST00000357922.4_Silent_p.L162L	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	162					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										ACATGCTGCTGGACTGTCGCT	0.642																																					p.L162L													.	.			0			c.G486T												75.0	75.0	75.0					7																	150746458		2203	4300	6503	SO:0001819	synonymous_variant	9311	exon1			GCTGCTGGACTGT	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.486G>T	7.37:g.150746458G>T			33	0	0		41	0.07	3	NM_020322	20	0.00	0	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Silent	SNP	ENST00000349064.5	37	CCDS5916.1																																																																																					0.642	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351725.1		NM_004769	
FASTK	10922	mdanderson.org	37	7	150774452	150774452	+	Silent	SNP	C	C	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr7:150774452C>A	ENST00000297532.6	-	7	1313	c.1236G>T	c.(1234-1236)ctG>ctT	p.L412L	FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000482571.1_Silent_p.L385L|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000353841.2_Silent_p.L271L|RP11-148K1.12_ENST00000485974.1_RNA	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	412					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		CCTCCCCCAGCAGCTGGCGCA	0.627																																					p.L412L													.	.			0			c.G1236T												45.0	50.0	48.0					7																	150774452		2203	4300	6503	SO:0001819	synonymous_variant	10922	exon7			CCCCAGCAGCTGG		CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1236G>T	7.37:g.150774452C>A			32	0	0		32	0.09	3	NM_006712	543	0.00	0	A8K867|F8VTW9|Q59EM8|Q8IVA0	Silent	SNP	ENST00000297532.6	37	CCDS5918.1																																																																																					0.627	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351832.2		NM_006712	
MTERF3	51001	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	97263294	97263294	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr8:97263294G>A	ENST00000287025.3	-	4	615	c.517C>T	c.(517-519)Cca>Tca	p.P173S	MTERFD1_ENST00000524341.1_5'UTR|MTERFD1_ENST00000523821.1_Missense_Mutation_p.P173S|MTERFD1_ENST00000522822.1_Missense_Mutation_p.P52S	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		173					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					GCTGCTTCTGGATGTTTTTCT	0.353																																					p.P173S													.	.			0			c.C517T												83.0	82.0	82.0					8																	97263294		2203	4300	6503	SO:0001583	missense	51001	exon4			CTTCTGGATGTTT																												ENST00000287025.3:c.517C>T	8.37:g.97263294G>A	ENSP00000287025:p.Pro173Ser		38	0	0		52	0.27	14	NM_015942	132	0.30	39	B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	ENST00000287025.3	37	CCDS6270.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835683	0.50951	.	.	ENSG00000156469	ENST00000523821;ENST00000522822;ENST00000287025	T;T;T	0.10668	2.85;2.85;2.85	5.55	0.434	0.16539	.	0.407066	0.29594	N	0.011712	T	0.12305	0.0299	M	0.66939	2.045	0.35106	D	0.765666	P;P	0.43412	0.806;0.806	B;B	0.44044	0.439;0.346	T	0.30119	-0.9989	10	0.21014	T	0.42	-9.2107	7.2249	0.26010	0.0632:0.3347:0.4869:0.1152	.	173;173	E5RIK9;Q96E29	.;MTER1_HUMAN	S	173;52;173	ENSP00000429400:P173S;ENSP00000430138:P52S;ENSP00000287025:P173S	ENSP00000287025:P173S	P	-	1	0	MTERFD1	97332470	0.984000	0.35163	0.699000	0.30290	0.892000	0.51952	2.146000	0.42216	-0.167000	0.10871	-2.871000	0.00099	CCA			0.353	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000379876.1			
CPSF1	29894	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145623257	145623257	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr8:145623257T>C	ENST00000349769.3	-	20	2079	c.1985A>G	c.(1984-1986)gAg>gGg	p.E662G	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	662					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GACGTGGCCCTCGGCACTCAT	0.652																																					p.E662G	NSCLC(133;1088 1848 27708 34777 35269)												.	CPSF1	92		0			c.A1985G												68.0	65.0	66.0					8																	145623257		2203	4298	6501	SO:0001583	missense	29894	exon20			TGGCCCTCGGCAC	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1985A>G	8.37:g.145623257T>C	ENSP00000339353:p.Glu662Gly		48	0	0		49	0.10	5	NM_013291	201	0.03	6	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	T	15.71	2.913874	0.52439	.	.	ENSG00000071894	ENST00000349769	T	0.33654	1.4	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.25938	0.0632	L	0.27053	0.805	0.58432	D	0.999994	B	0.23442	0.085	B	0.20577	0.03	T	0.05886	-1.0858	10	0.33141	T	0.24	-35.7814	11.8408	0.52353	0.0:0.0:0.0:1.0	.	662	Q10570	CPSF1_HUMAN	G	662	ENSP00000339353:E662G	ENSP00000339353:E662G	E	-	2	0	CPSF1	145594065	1.000000	0.71417	0.994000	0.49952	0.845000	0.48019	5.155000	0.64900	2.054000	0.61138	0.402000	0.26972	GAG			0.652	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382422.2		NM_013291	
ARHGAP39	80728	mdanderson.org	37	8	145830968	145830968	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr8:145830968C>T	ENST00000276826.5	-	1	233	c.32G>A	c.(31-33)aGc>aAc	p.S11N	ARHGAP39_ENST00000540274.1_Missense_Mutation_p.S11N|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.S11N			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	11					axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						GACATTATGGCTCCTGCACTC	0.632																																					p.S11N													.	.			0			c.G32A												105.0	86.0	92.0					8																	145830968		2203	4300	6503	SO:0001583	missense	80728	exon3			TTATGGCTCCTGC		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.32G>A	8.37:g.145830968C>T	ENSP00000276826:p.Ser11Asn		40	0	0		41	0.07	3	NM_025251	17	0.00	0	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	37		.	.	.	.	.	.	.	.	.	.	C	12.24	1.877658	0.33162	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.24908	1.83;1.83;1.83	4.89	4.02	0.46733	.	0.156567	0.30347	N	0.009827	T	0.19406	0.0466	L	0.36672	1.1	0.25133	N	0.990557	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.14980	-1.0453	10	0.48119	T	0.1	-3.5663	8.8392	0.35131	0.0:0.8955:0.0:0.1045	.	11;11	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	N	11	ENSP00000276826:S11N;ENSP00000366522:S11N;ENSP00000445075:S11N	ENSP00000276826:S11N	S	-	2	0	ARHGAP39	145801776	1.000000	0.71417	0.130000	0.21974	0.351000	0.29236	2.655000	0.46707	1.059000	0.40554	0.561000	0.74099	AGC			0.632	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000382509.1			
KANK1	23189	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	745199	745199	+	Silent	SNP	G	G	A	rs148157700		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:745199G>A	ENST00000382303.1	+	16	4675	c.4023G>A	c.(4021-4023)acG>acA	p.T1341T	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Silent_p.T1183T|KANK1_ENST00000382297.2_Silent_p.T1341T	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	1341					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		GAAGGAAGACGTCTCCTGGCC	0.478																																					p.T1341T													KANK1_ENST00000382303,NS,carcinoma,0,2	KANK1_ENST00000382303	0	2	0			c.G4023A							G	,	1,4405	2.1+/-5.4	0,1,2202	206.0	220.0	215.0		4023,3549	-6.3	0.8	9	dbSNP_134	215	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	KANK1	NM_015158.2,NM_153186.3	,	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	,	1341/1353,1183/1195	745199	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	23189	exon16			GAAGACGTCTCCT	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.4023G>A	9.37:g.745199G>A			158	0	0		124	0.44	54	NM_001256876	49	0.49	24	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	ENST00000382303.1	37	CCDS34976.1																																																																																			0		0.478	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051484.2		NM_015158	
GNAQ	2776	mdanderson.org	37	9	80430537	80430537	+	Silent	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:80430537G>T	ENST00000286548.4	-	3	693	c.471C>A	c.(469-471)acC>acA	p.T157T	GNAQ_ENST00000397476.3_5'UTR	NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	157					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)			NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						CTCACTATTTGGTAGAGTCAG	0.353			Mis		uveal melanoma																																p.T157T				Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	.	.			0			c.C471A												115.0	105.0	109.0					9																	80430537		2203	4300	6503	SO:0001819	synonymous_variant	2776	exon3			CTATTTGGTAGAG		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.471C>A	9.37:g.80430537G>T			62	0	0		48	0.06	3	NM_002072	17	0.00	0	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Silent	SNP	ENST00000286548.4	37	CCDS6658.1																																																																																					0.353	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052761.1		NM_002072	
C9orf47	286223	mdanderson.org	37	9	91606483	91606483	+	Silent	SNP	C	C	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:91606483C>T	ENST00000334490.5	+	2	413	c.345C>T	c.(343-345)gaC>gaT	p.D115D	C9orf47_ENST00000375851.2_Silent_p.D96D|S1PR3_ENST00000358157.2_5'UTR|C9orf47_ENST00000375850.3_Silent_p.D96D			Q6ZRZ4	CI047_HUMAN	chromosome 9 open reading frame 47	115						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|liver(1)|lung(1)	4						CCGGGAACGACGTCGCGAGCG	0.741																																					p.D115D													.	.			0			c.C345T												6.0	6.0	6.0					9																	91606483		1831	3546	5377	SO:0001819	synonymous_variant	286223	exon2			GAACGACGTCGCG	AK094842	CCDS35062.1, CCDS47989.1	9q22.1	2008-02-05	2004-11-04		ENSG00000186354	ENSG00000186354			23669	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 108"""	C9orf108			Standard	NM_001001938		Approved	FLJ37523, bA791O21.3	uc004aqc.2	Q6ZRZ4	OTTHUMG00000020172	ENST00000334490.5:c.345C>T	9.37:g.91606483C>T			14	0	0		15	0.13	2	NM_001001938	10	0.00	0	B7ZMC7|Q5SQD7|Q7Z568|Q8N1V4	Silent	SNP	ENST00000334490.5	37	CCDS35062.1																																																																																					0.741	C9orf47-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000355972.1		NM_182599	
NEK6	10783	broad.mit.edu	37	9	127089658	127089658	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:127089658G>T	ENST00000320246.5	+	7	701	c.556G>T	c.(556-558)Gtg>Ttg	p.V186L	NEK6_ENST00000540326.1_Missense_Mutation_p.V204L|NEK6_ENST00000545174.1_Missense_Mutation_p.V186L|NEK6_ENST00000546191.1_Missense_Mutation_p.V186L|NEK6_ENST00000394199.2_Missense_Mutation_p.V220L|NEK6_ENST00000373600.3_Missense_Mutation_p.V220L|NEK6_ENST00000373603.1_Missense_Mutation_p.V186L|NEK6_ENST00000539416.1_Missense_Mutation_p.V211L	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	186	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)	p.V179M(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						CACGGGCGTCGTGAAGCTCGG	0.637																																					p.V220L	NSCLC(122;934 1785 18647 44295 45571)												NEK6,NS,carcinoma,0,1	NEK6	47	1	1	Substitution - Missense(1)	prostate(1)	c.G658T												248.0	221.0	230.0					9																	127089658		2203	4300	6503	SO:0001583	missense	10783	exon8			GGCGTCGTGAAGC	AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.556G>T	9.37:g.127089658G>T	ENSP00000319734:p.Val186Leu		64	0	0		62	0.05	3	NM_001166171	78	0.00	0	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Missense_Mutation	SNP	ENST00000320246.5	37	CCDS6854.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261321	0.80246	.	.	ENSG00000119408	ENST00000373603;ENST00000540326;ENST00000373600;ENST00000320246;ENST00000373601;ENST00000545174;ENST00000444973;ENST00000454453;ENST00000373596;ENST00000425237;ENST00000394199;ENST00000546191;ENST00000422297;ENST00000539416	T;T;T;T;T;T;T;T;T;T;T;T;T	0.40476	3.09;3.09;3.09;3.09;3.09;1.77;1.03;3.09;1.77;3.09;3.09;1.77;3.09	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51975	0.1706	N	0.20986	0.625	0.80722	D	1	D;P;P;P	0.65815	0.995;0.794;0.705;0.794	D;P;B;B	0.65773	0.938;0.575;0.405;0.423	T	0.50457	-0.8826	10	0.51188	T	0.08	.	19.3735	0.94500	0.0:0.0:1.0:0.0	.	211;220;186;204	Q9HC98-4;Q9HC98-2;Q9HC98;Q9HC98-3	.;.;NEK6_HUMAN;.	L	186;204;220;186;118;186;186;118;186;186;220;186;186;211	ENSP00000362705:V186L;ENSP00000441469:V204L;ENSP00000362702:V220L;ENSP00000319734:V186L;ENSP00000442636:V186L;ENSP00000389517:V186L;ENSP00000405215:V118L;ENSP00000362698:V186L;ENSP00000403087:V186L;ENSP00000377749:V220L;ENSP00000441426:V186L;ENSP00000411401:V186L;ENSP00000439651:V211L	ENSP00000319734:V186L	V	+	1	0	NEK6	126129479	1.000000	0.71417	0.975000	0.42487	0.416000	0.31233	9.274000	0.95731	2.825000	0.97269	0.655000	0.94253	GTG			0.637	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054016.1		NM_014397	
COL5A1	1289	mdanderson.org	37	9	137593103	137593103	+	Missense_Mutation	SNP	G	G	A	rs142933609		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:137593103G>A	ENST00000371817.3	+	4	992	c.578G>A	c.(577-579)cGc>cAc	p.R193H	COL5A1_ENST00000464187.1_3'UTR	NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	193	Laminin G-like.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)	p.R193H(2)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		TTCCTCGACCGCAGCGACCAC	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20085	0.0		0.0	False		,,,				2504	0.0				p.R193H													COL5A1,bladder,carcinoma,+1,3	COL5A1	1	3	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G578A												170.0	124.0	140.0					9																	137593103		2203	4300	6503	SO:0001583	missense	1289	exon4			TCGACCGCAGCGA	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.578G>A	9.37:g.137593103G>A	ENSP00000360882:p.Arg193His		77	0	0		68	0.06	4	NM_000093	203	0.00	0	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	19.78	3.890497	0.72524	.	.	ENSG00000130635	ENST00000371817	T	0.78246	-1.16	5.07	5.07	0.68467	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.64402	U	0.000002	D	0.90817	0.7116	M	0.91038	3.17	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.92682	0.6159	10	0.72032	D	0.01	.	18.8039	0.92029	0.0:0.0:1.0:0.0	.	193	P20908	CO5A1_HUMAN	H	193	ENSP00000360882:R193H	ENSP00000360882:R193H	R	+	2	0	COL5A1	136732924	1.000000	0.71417	0.982000	0.44146	0.547000	0.35210	9.489000	0.97949	2.498000	0.84270	0.591000	0.81541	CGC	0		0.522	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054954.2		NM_000093	
CARD9	64170	mdanderson.org	37	9	139262259	139262259	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chr9:139262259G>T	ENST00000371732.5	-	8	1264	c.1099C>A	c.(1099-1101)Ctg>Atg	p.L367M	CARD9_ENST00000460290.1_5'Flank|CARD9_ENST00000371734.3_Missense_Mutation_p.L367M	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9	367					defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		TGTGCGTGCAGCTCCTCCCGC	0.706																																					p.L367M													.	.			0			c.C1099A												30.0	27.0	28.0					9																	139262259		2196	4291	6487	SO:0001583	missense	64170	exon8			CGTGCAGCTCCTC	AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1099C>A	9.37:g.139262259G>T	ENSP00000360797:p.Leu367Met		12	0	0		24	0.13	3	NM_052813	9	0.00	0	Q5SXM5|Q5SXM6|Q9H854	Missense_Mutation	SNP	ENST00000371732.5	37	CCDS6997.1	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089520	0.20390	.	.	ENSG00000187796	ENST00000371734;ENST00000371732	T;T	0.38722	1.12;1.12	3.51	2.59	0.31030	.	0.191988	0.34110	N	0.004251	T	0.33059	0.0850	L	0.47716	1.5	0.80722	D	1	P;P;P	0.48503	0.911;0.834;0.744	P;P;B	0.45474	0.482;0.482;0.288	T	0.07195	-1.0785	10	0.34782	T	0.22	-16.8889	3.7821	0.08684	0.3511:0.0:0.6489:0.0	.	263;367;367	B4DIK5;Q9H257-2;Q9H257	.;.;CARD9_HUMAN	M	367	ENSP00000360799:L367M;ENSP00000360797:L367M	ENSP00000360797:L367M	L	-	1	2	CARD9	138382080	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	1.328000	0.33758	1.964000	0.57103	0.561000	0.74099	CTG			0.706	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055053.1		NM_052813	
RBM10	8241	broad.mit.edu	37	X	47030582	47030582	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chrX:47030582G>T	ENST00000377604.3	+	4	1099	c.357G>T	c.(355-357)gaG>gaT	p.E119D	RBM10_ENST00000345781.6_Intron|RBM10_ENST00000329236.7_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	119	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						aggaggaggaggatgaggagg	0.662																																					p.E184D	Melanoma(171;120 2705 19495 39241)												.	RBM10	117		0			c.G552T												20.0	19.0	19.0					X																	47030582		2202	4294	6496	SO:0001583	missense	8241	exon4			GGAGGAGGATGAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.357G>T	X.37:g.47030582G>T	ENSP00000366829:p.Glu119Asp		46	0	0		77	0.05	4	NM_001204468	14	0.00	0	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	37	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	G	7.514	0.655267	0.14580	.	.	ENSG00000182872	ENST00000377604	T	0.11169	2.8	3.1	1.15	0.20763	Nucleotide-binding, alpha-beta plait (1);	0.859005	0.09469	N	0.797951	T	0.04815	0.0130	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38628	-0.9652	10	0.11182	T	0.66	-1.7872	6.9396	0.24486	0.0:0.0:0.4873:0.5127	.	184;119;119	Q7Z3D7;P98175-2;P98175	.;.;RBM10_HUMAN	D	119	ENSP00000366829:E119D	ENSP00000366829:E119D	E	+	3	2	RBM10	46915526	1.000000	0.71417	0.776000	0.31678	0.914000	0.54420	0.961000	0.29267	0.165000	0.19558	0.502000	0.49764	GAG			0.662	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056381.1		NM_005676	
NUDT10	170685	broad.mit.edu	37	X	51076024	51076024	+	Silent	SNP	G	G	A	rs143435240		TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chrX:51076024G>A	ENST00000376006.3	+	2	427	c.207G>A	c.(205-207)gaG>gaA	p.E69E	NUDT10_ENST00000356450.2_Silent_p.E69E	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	234					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)	p.E69E(8)		cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGTACGAAGAGGCGGGAGTCA	0.657																																					p.E69E	NSCLC(90;1817 2035 37909 38249)												.	NUDT10	28		8	Substitution - coding silent(8)	endometrium(5)|cervix(1)|prostate(1)|lung(1)	c.G207A												52.0	62.0	59.0					X																	51076024		2203	4300	6503	SO:0001819	synonymous_variant	170685	exon2			CGAAGAGGCGGGA	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.207G>A	X.37:g.51076024G>A			148	0.0135135135	2		256	0.02	6	NM_153183	47	0.00	0	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	ENST00000376006.3	37	CCDS35278.1																																																																																					0.657	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056578.1		NM_153183	
HMGB3	3149	mdanderson.org	37	X	150156360	150156360	+	Silent	SNP	G	G	A			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chrX:150156360G>A	ENST00000325307.7	+	5	672	c.576G>A	c.(574-576)gaG>gaA	p.E192E	HMGB3_ENST00000448905.2_Silent_p.E192E	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	192	Asp/Glu-rich (acidic).				DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)	p.E192E(1)		endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					aggaagaagaggaggaggagg	0.443																																					p.E192E													.	.			1	Substitution - coding silent(1)	large_intestine(1)	c.G576A												50.0	48.0	49.0					X																	150156360		2202	4299	6501	SO:0001819	synonymous_variant	3149	exon5			AGAAGAGGAGGAG	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.576G>A	X.37:g.150156360G>A			10	0	0		16	0.13	2	NM_005342	164	0.01	2	O95556|Q6NS40	Silent	SNP	ENST00000325307.7	37	CCDS35428.1																																																																																					0.443	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060867.1		NM_005342	
FLNA	2316	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	153583390	153583390	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AAL5-01A-11D-A42Y-10	TCGA-2G-AAL5-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	171689da-01a4-40f0-81f1-2e31c2e22def	89d0a1e3-1b77-413f-aa1f-f31cc665e959	g.chrX:153583390C>G	ENST00000369850.3	-	31	5256	c.5020G>C	c.(5020-5022)Gtg>Ctg	p.V1674L	FLNA_ENST00000422373.1_Missense_Mutation_p.V1666L|FLNA_ENST00000344736.4_Missense_Mutation_p.V1666L|FLNA_ENST00000360319.4_Missense_Mutation_p.V1666L|FLNA_ENST00000369856.3_5'UTR	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1674					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TTAGTGTCCACAGTGATCACC	0.637											OREG0003595	type=REGULATORY REGION|Gene=FLNA|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.V1674L													.	.			0			c.G5020C												63.0	63.0	63.0					X																	153583390		2157	4226	6383	SO:0001583	missense	2316	exon31			TGTCCACAGTGAT	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.5020G>C	X.37:g.153583390C>G	ENSP00000358866:p.Val1674Leu		90	0	0	1756	118	0.45	53	NM_001110556	1418	0.46	652	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	ENST00000369850.3	37	CCDS48194.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182738	0.78677	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37	5.53	5.53	0.82687	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000002	D	0.96540	0.8871	M	0.78801	2.425	0.80722	D	1	D;P	0.63880	0.993;0.926	D;P	0.66716	0.946;0.888	D	0.96852	0.9626	10	0.66056	D	0.02	.	18.4813	0.90812	0.0:1.0:0.0:0.0	.	1666;1674	P21333-2;P21333	.;FLNA_HUMAN	L	1666;1647;1666;1674;1666	ENSP00000353467:V1666L;ENSP00000416926:V1666L;ENSP00000358866:V1674L;ENSP00000358863:V1666L	ENSP00000358863:V1666L	V	-	1	0	FLNA	153236584	1.000000	0.71417	0.967000	0.41034	0.616000	0.37450	7.779000	0.85648	2.306000	0.77630	0.513000	0.50165	GTG			0.637	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000058942.3			
