#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TMEM88B	643965	mdanderson.org	37	1	1361691	1361691	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:1361691C>T	ENST00000378821.3	+	1	184	c.184C>T	c.(184-186)Ccc>Tcc	p.P62S		NM_001146685.1	NP_001140157.1	A6NKF7	TM88B_HUMAN	transmembrane protein 88B	62						integral component of membrane (GO:0016021)											CCTCCTGCTGCCCGCCGCAGC	0.756																																					p.P62S													.	.			0			c.C184T												2.0	4.0	4.0					1																	1361691		582	1434	2016	SO:0001583	missense	643965	exon1			CTGCTGCCCGCCG		CCDS57964.1	1p36.33	2013-01-16			ENSG00000205116	ENSG00000205116			37099	protein-coding gene	gene with protein product							Standard	NM_001146685		Approved		uc010nyp.2	A6NKF7	OTTHUMG00000153395	ENST00000378821.3:c.184C>T	1.37:g.1361691C>T	ENSP00000455099:p.Pro62Ser		25	0	0		15	0.13	2	NM_001146685	0		0		Missense_Mutation	SNP	ENST00000378821.3	37	CCDS57964.1																																																																																					0.756	TMEM88B-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331012.2		NM_001146685	
PRAMEF2	65122	mdanderson.org	37	1	12919682	12919682	+	Missense_Mutation	SNP	C	C	T	rs202143308	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:12919682C>T	ENST00000240189.2	+	3	509	c.422C>T	c.(421-423)aCg>aTg	p.T141M		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	141			T -> M (in dbSNP:rs17038667).		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TGTCCAAGGACGGGAGAGCAC	0.542													.|||	26	0.00519169	0.0015	0.013	5008	,	,		21797	0.004		0.005	False		,,,				2504	0.0061				p.T141M													.	.			0			c.C422T												147.0	159.0	155.0					1																	12919682		2202	4297	6499	SO:0001583	missense	65122	exon3			CAAGGACGGGAGA		CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.422C>T	1.37:g.12919682C>T	ENSP00000240189:p.Thr141Met		135	0.0074074074	1		74	0.07	5	NM_023014	0		0		Missense_Mutation	SNP	ENST00000240189.2	37	CCDS149.1	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.012579	0.00042	.	.	ENSG00000120952	ENST00000240189	T	0.04603	3.59	0.842	-1.68	0.08212	.	4.939980	0.00659	N	0.000592	T	0.03651	0.0104	N	0.16708	0.43	0.09310	N	1	B	0.12013	0.005	B	0.24541	0.054	T	0.41893	-0.9483	10	0.23891	T	0.37	.	2.6324	0.04948	0.2266:0.3763:0.0:0.3971	.	141	O60811	PRAM2_HUMAN	M	141	ENSP00000240189:T141M	ENSP00000240189:T141M	T	+	2	0	PRAMEF2	12842269	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.908000	0.00700	-2.798000	0.00353	-2.532000	0.00182	ACG			0.542	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005517.1		NM_023014	
BCL2L15	440603	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	114429213	114429213	+	Silent	SNP	G	G	A	rs75493886	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:114429213G>A	ENST00000393316.3	-	2	366	c.195C>T	c.(193-195)aaC>aaT	p.N65N	BCL2L15_ENST00000488450.1_Intron|BCL2L15_ENST00000393320.3_Intron|BCL2L15_ENST00000471267.1_Silent_p.N65N|AP4B1-AS1_ENST00000419536.1_RNA	NM_001010922.2	NP_001010922.1	Q5TBC7	B2L15_HUMAN	BCL2-like 15	65					apoptotic process (GO:0006915)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(3)|ovary(1)	9	Lung SC(450;0.184)	all_cancers(81;3.95e-08)|all_epithelial(167;9.95e-08)|all_lung(203;1.31e-05)|Lung NSC(69;2.46e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAATTCTCCGTTGAACTGGT	0.423													G|||	2	0.000399361	0.0	0.0	5008	,	,		18308	0.002		0.0	False		,,,				2504	0.0				p.N65N													BCL2L15,rectum,carcinoma,-1,2	BCL2L15	-1	2	0			c.C195T							G		0,4406		0,0,2203	129.0	112.0	117.0		195	-1.6	0.3	1	dbSNP_131	117	1,8599	1.2+/-3.3	0,1,4299	yes	coding-synonymous	BCL2L15	NM_001010922.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		65/164	114429213	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	440603	exon2			TTCTCCGTTGAAC		CCDS30809.1	1p13.2	2014-03-07			ENSG00000188761	ENSG00000188761			33624	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 178"""	C1orf178		12700646, 15961081, 16690252, 17412810	Standard	NM_001010922		Approved	Bfk, FLJ22588	uc001edw.3	Q5TBC7	OTTHUMG00000011940	ENST00000393316.3:c.195C>T	1.37:g.114429213G>A			81	0	0		72	0.08	6	NM_001010922	101	0.00	0	A0PJY6|A8K074|I6LA82	Silent	SNP	ENST00000393316.3	37	CCDS30809.1																																																																																			0		0.423	BCL2L15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033026.2		NM_001010922	
C2CD4D	100191040	mdanderson.org	37	1	151811350	151811350	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:151811350C>A	ENST00000454109.1	-	2	701	c.116G>T	c.(115-117)tGc>tTc	p.C39F	Y_RNA_ENST00000364264.1_RNA	NM_001136003.1	NP_001129475.1	B7Z1M9	C2D4D_HUMAN	C2 calcium-dependent domain containing 4D	39										skin(1)	1						GACGTTGGGGCAGGCGCTTGT	0.751																																					p.C39F													.	.			0			c.G116T												6.0	11.0	10.0					1																	151811350		675	1574	2249	SO:0001583	missense	100191040	exon2			TTGGGGCAGGCGC	BC171843	CCDS44224.1	1q21.3	2012-07-02			ENSG00000225556	ENSG00000225556			37210	protein-coding gene	gene with protein product	"""family with sequence similarity 148, member D"""						Standard	NM_001136003		Approved	FAM148D	uc010pdq.1	B7Z1M9	OTTHUMG00000167218	ENST00000454109.1:c.116G>T	1.37:g.151811350C>A	ENSP00000389554:p.Cys39Phe		34	0	0		31	0.10	3	NM_001136003	4	0.00	0	B2RXG8	Missense_Mutation	SNP	ENST00000454109.1	37	CCDS44224.1	.	.	.	.	.	.	.	.	.	.	C	0.306	-0.970895	0.02232	.	.	ENSG00000225556	ENST00000454109	T	0.23348	1.91	3.72	0.376	0.16193	.	.	.	.	.	T	0.02304	0.0071	N	0.10760	0.04	0.20074	N	0.999935	B	0.13145	0.007	B	0.06405	0.002	T	0.44952	-0.9294	9	0.10111	T	0.7	.	1.8519	0.03171	0.2053:0.4682:0.2007:0.1258	.	39	B7Z1M9	C2D4D_HUMAN	F	39	ENSP00000389554:C39F	ENSP00000389554:C39F	C	-	2	0	C2CD4D	150077974	1.000000	0.71417	0.898000	0.35279	0.128000	0.20619	1.393000	0.34497	0.218000	0.20820	0.313000	0.20887	TGC			0.751	C2CD4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393778.1		NM_001136003	
TRIM46	80128	mdanderson.org	37	1	155156381	155156381	+	Silent	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:155156381G>T	ENST00000334634.4	+	10	1995	c.1995G>T	c.(1993-1995)tcG>tcT	p.S665S	TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000545012.1_Silent_p.S539S|TRIM46_ENST00000392451.2_3'UTR|RP11-201K10.3_ENST00000473363.2_Intron|MUC1_ENST00000462215.1_5'Flank|TRIM46_ENST00000368382.1_Silent_p.S642S	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	665	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGCTGGGGTCGGGGGCAAGCT	0.672																																					p.S665S													.	.			0			c.G1995T												59.0	61.0	60.0					1																	155156381		2203	4300	6503	SO:0001819	synonymous_variant	80128	exon10			GGGGTCGGGGGCA		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1995G>T	1.37:g.155156381G>T			21	0	0		35	0.09	3	NM_025058	0		0	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Silent	SNP	ENST00000334634.4	37	CCDS1097.1																																																																																					0.672	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086728.1		NM_025058	
HMCN1	83872	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	186055461	186055461	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr1:186055461G>A	ENST00000271588.4	+	58	9197	c.8968G>A	c.(8968-8970)Ggt>Agt	p.G2990S	HMCN1_ENST00000367492.2_Missense_Mutation_p.G2990S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2990	Ig-like C2-type 28.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGAGGTCTCTGGTTTTCCACC	0.398																																					p.G2990S													HMCN1,NS,carcinoma,-2,1	HMCN1	-2	1	0			c.G8968A												120.0	114.0	116.0					1																	186055461		2203	4300	6503	SO:0001583	missense	83872	exon58			GTCTCTGGTTTTC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.8968G>A	1.37:g.186055461G>A	ENSP00000271588:p.Gly2990Ser		148	0	0		155	0.27	42	NM_031935	0		0	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	37	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	31	5.082106	0.94050	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.79653	-1.29;-1.29	5.59	5.59	0.84812	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.88926	0.6570	M	0.67517	2.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86680	0.1916	10	0.33940	T	0.23	.	19.6094	0.95599	0.0:0.0:1.0:0.0	.	2990	Q96RW7	HMCN1_HUMAN	S	2990	ENSP00000271588:G2990S;ENSP00000356462:G2990S	ENSP00000271588:G2990S	G	+	1	0	HMCN1	184322084	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.430000	0.97488	2.626000	0.88956	0.563000	0.77884	GGT			0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131848.1		NM_031935	
MCM10	55388	mdanderson.org	37	10	13239659	13239659	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:13239659G>T	ENST00000484800.2	+	15	2117	c.2014G>T	c.(2014-2016)Gtt>Ttt	p.V672F	MCM10_ENST00000378694.1_Missense_Mutation_p.V671F|MCM10_ENST00000378714.3_Missense_Mutation_p.V671F			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	672					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						AAAAGGCCAGGTTCTTACAAA	0.408																																					p.V672F													.	.			0			c.G2014T												91.0	85.0	87.0					10																	13239659		2203	4300	6503	SO:0001583	missense	55388	exon15			GGCCAGGTTCTTA	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2014G>T	10.37:g.13239659G>T	ENSP00000418268:p.Val672Phe		79	0	0		44	0.07	3	NM_182751	4	0.00	0	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	37	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157614	0.38119	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.15372	2.44;2.44;2.43	5.23	1.55	0.23275	Replication factor Mcm10 (1);	0.329739	0.36374	N	0.002633	T	0.10809	0.0264	L	0.34521	1.04	0.22629	N	0.998913	P;B;B	0.39480	0.675;0.173;0.208	B;B;B	0.33846	0.153;0.107;0.171	T	0.15464	-1.0436	10	0.51188	T	0.08	-7.5206	9.0428	0.36327	0.7625:0.0:0.2375:0.0	.	671;671;672	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	F	671;672;672;671	ENSP00000367986:V671F;ENSP00000418268:V672F;ENSP00000367966:V671F	ENSP00000354945:V672F	V	+	1	0	MCM10	13279665	1.000000	0.71417	0.997000	0.53966	0.810000	0.45777	1.473000	0.35387	0.398000	0.25338	-0.238000	0.12139	GTT			0.408	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000356853.1		NM_182751	
DNAJC1	64215	mdanderson.org	37	10	22207710	22207710	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:22207710G>T	ENST00000376980.3	-	6	1017	c.727C>A	c.(727-729)Cag>Aag	p.Q243K		NM_022365.3	NP_071760.2	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	243					negative regulation of proteolysis (GO:0045861)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)|regulation of protein secretion (GO:0050708)|regulation of translation (GO:0006417)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(13)|skin(2)|upper_aerodigestive_tract(2)	21		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)				CATTTTACCTGGATGAGGTGA	0.373																																					p.Q243K													.	.			0			c.C727A												91.0	78.0	82.0					10																	22207710		2203	4300	6503	SO:0001583	missense	64215	exon6			TTACCTGGATGAG	AK026062	CCDS7136.1	10p11.23	2011-09-02			ENSG00000136770	ENSG00000136770		"""Heat shock proteins / DNAJ (HSP40)"""	20090	protein-coding gene	gene with protein product		611207					Standard	NM_022365		Approved	DNAJL1, ERdj1, MTJ1	uc001irc.3	Q96KC8	OTTHUMG00000017800	ENST00000376980.3:c.727C>A	10.37:g.22207710G>T	ENSP00000366179:p.Gln243Lys		54	0	0		46	0.07	3	NM_022365	16	0.00	0	B0YIZ8|Q5VX89|Q9H6B8	Missense_Mutation	SNP	ENST00000376980.3	37	CCDS7136.1	.	.	.	.	.	.	.	.	.	.	G	18.66	3.670877	0.67814	.	.	ENSG00000136770	ENST00000376980	T	0.62639	0.01	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.61964	-0.6954	10	0.14252	T	0.57	-8.351	20.0856	0.97800	0.0:0.0:1.0:0.0	.	243	Q96KC8	DNJC1_HUMAN	K	243	ENSP00000366179:Q243K	ENSP00000366179:Q243K	Q	-	1	0	DNAJC1	22247716	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.811000	0.91954	2.734000	0.93682	0.655000	0.94253	CAG			0.373	DNAJC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047149.1		NM_022365	
SVILP1	645954	broad.mit.edu	37	10	30982853	30982854	+	RNA	INS	-	-	T	rs377123905|rs370458016	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:30982853_30982854insT	ENST00000435645.1	+	0	138									supervillin pseudogene 1																		CTTTTGttttattttttttttt	0.416													|||unknown(HR)	785	0.156749	0.1225	0.1282	5008	,	,		20068	0.1389		0.2187	False		,,,				2504	0.1779				.													.	.			0			.																																											0	.			TGTTTTATTTTTT			10p11.23	2012-12-20			ENSG00000234814	ENSG00000234814			44959	pseudogene	pseudogene							Standard	NR_036438		Approved				OTTHUMG00000017900		10.37:g.30982864_30982864dupT			4	0	0		6	0.33	2	.	0		0		RNA	INS	ENST00000435645.1	37																																																																																						0.416	SVILP1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331601.1			
HSD17B7P2	158160	broad.mit.edu	37	10	38652034	38652035	+	RNA	INS	-	-	TT	rs576865685|rs371516054		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:38652034_38652035insTT	ENST00000494540.1	+	0	413					NR_003086.1				hydroxysteroid (17-beta) dehydrogenase 7 pseudogene 2																		CTGTTTAACTCTTTTTTTGACA	0.347																																					.													.	.			0			.																																											0	.			TTAACTCTTTTTT			10p11.1	2011-06-29			ENSG00000099251	ENSG00000099251			28120	pseudogene	pseudogene						10544267	Standard	NR_003086		Approved	HSD17B7, bA291L22.1	uc010qex.1		OTTHUMG00000017993		10.37:g.38652039_38652040dupTT			3	0	0		7	0.43	3	.	0		0		RNA	INS	ENST00000494540.1	37																																																																																						0.347	HSD17B7P2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000047631.2		NR_003086	
CSGALNACT2	55454	hgsc.bcm.edu	37	10	43659372	43659372	+	Nonsense_Mutation	SNP	C	C	T	rs76607193	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:43659372C>T	ENST00000374466.3	+	5	1374	c.1039C>T	c.(1039-1041)Cga>Tga	p.R347*		NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	347					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)	p.R347*(1)		endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						TAATCGTGGACGAGGACTAAA	0.408																																					p.R347X													CSGALNACT2,trunk,malignant_melanoma,0,1	CSGALNACT2	0	1	1	Substitution - Nonsense(1)	skin(1)	c.C1039T												191.0	181.0	184.0					10																	43659372		2203	4300	6503	SO:0001587	stop_gained	55454	exon5			CGTGGACGAGGAC	AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.1039C>T	10.37:g.43659372C>T	ENSP00000363590:p.Arg347*		89	0	0		82	0.05	4	NM_018590	10	0.00	0	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Nonsense_Mutation	SNP	ENST00000374466.3	37	CCDS7201.1	.	.	.	.	.	.	.	.	.	.	C	41	8.712957	0.98925	.	.	ENSG00000169826	ENST00000374466	.	.	.	6.08	4.19	0.49359	.	0.110120	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-3.2438	15.5126	0.75795	0.253:0.747:0.0:0.0	.	.	.	.	X	347	.	ENSP00000363590:R347X	R	+	1	2	CSGALNACT2	42979378	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	1.226000	0.32563	0.852000	0.35287	0.591000	0.81541	CGA	0.003		0.408	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047693.1		NM_018590	
SLIT1	6585	mdanderson.org	37	10	98807466	98807466	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:98807466G>T	ENST00000266058.4	-	16	1860	c.1615C>A	c.(1615-1617)Ccc>Acc	p.P539T	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.P539T	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	539	LRRNT 3.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GTGGACTGGGGGATGCGCTCA	0.627																																					p.P539T													.	.			0			c.C1615A												80.0	83.0	82.0					10																	98807466		2203	4300	6503	SO:0001583	missense	6585	exon16			ACTGGGGGATGCG	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.1615C>A	10.37:g.98807466G>T	ENSP00000266058:p.Pro539Thr		43	0	0		27	0.11	3	NM_003061	0		0	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	37	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904730	0.52333	.	.	ENSG00000187122	ENST00000266058;ENST00000371057;ENST00000371070;ENST00000314867	D;D;D	0.99376	-5.79;-5.79;-5.79	4.54	3.63	0.41609	Leucine-rich repeat-containing N-terminal (2);	0.108090	0.64402	D	0.000004	D	0.99489	0.9818	M	0.94101	3.495	0.80722	D	1	D;P	0.69078	0.997;0.935	D;P	0.76071	0.987;0.471	D	0.98485	1.0607	10	0.87932	D	0	.	12.7028	0.57043	0.0798:0.0:0.9202:0.0	.	549;539	E7EWQ8;O75093	.;SLIT1_HUMAN	T	539;549;539;532	ENSP00000266058:P539T;ENSP00000360109:P539T;ENSP00000315005:P532T	ENSP00000266058:P539T	P	-	1	0	SLIT1	98797456	1.000000	0.71417	0.973000	0.42090	0.236000	0.25371	8.996000	0.93539	1.269000	0.44280	0.563000	0.77884	CCC			0.627	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049636.1		NM_003061	
FBXL15	79176	mdanderson.org	37	10	104181702	104181702	+	Silent	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:104181702C>T	ENST00000224862.3	+	3	1682	c.366C>T	c.(364-366)ggC>ggT	p.G122G	PSD_ENST00000492902.2_5'Flank|PSD_ENST00000406432.1_5'Flank|FBXL15_ENST00000369956.2_Silent_p.G118G|PSD_ENST00000020673.5_5'Flank|CUEDC2_ENST00000465409.1_5'Flank	NM_024326.3	NP_077302.3	Q9H469	FXL15_HUMAN	F-box and leucine-rich repeat protein 15	122	Interaction with SMURF1.				bone mineralization (GO:0030282)|dorsal/ventral pattern formation (GO:0009953)|G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of BMP signaling pathway (GO:0030513)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)				kidney(1)	1		Colorectal(252;0.207)		Epithelial(162;1.19e-08)|all cancers(201;2.65e-07)		TGGCGTTGGGCGGCTGCGGGC	0.711																																					p.G122G													.	.			0			c.C366T												11.0	13.0	13.0					10																	104181702		2155	4210	6365	SO:0001819	synonymous_variant	79176	exon3			GTTGGGCGGCTGC	BC036120	CCDS31273.1	10q24.32	2011-06-09	2004-06-15	2004-06-16	ENSG00000107872	ENSG00000107872		"""F-boxes / Leucine-rich repeats"""	28155	protein-coding gene	gene with protein product		610287	"""F-box only protein 37"""	FBXO37			Standard	NM_024326		Approved	MGC11279, Fbl15	uc001kvk.2	Q9H469	OTTHUMG00000018957	ENST00000224862.3:c.366C>T	10.37:g.104181702C>T			18	0	0		10	0.20	2	NM_024326	44	0.00	0	A1L4J8|B1AKX8|B1AKX9|B1AKY0|B1AKY1|C9JWA4|Q0D2Q3|Q49AL7|Q5JWA5	Silent	SNP	ENST00000224862.3	37	CCDS31273.1																																																																																					0.711	FBXL15-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding				XM_370575	
OBFC1	79991	mdanderson.org	37	10	105659887	105659887	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr10:105659887G>T	ENST00000224950.3	-	5	557	c.390C>A	c.(388-390)gaC>gaA	p.D130E	OBFC1_ENST00000369764.1_Missense_Mutation_p.D130E|OBFC1_ENST00000466828.1_5'UTR	NM_024928.4	NP_079204.2	Q9H668	STN1_HUMAN	oligonucleotide/oligosaccharide-binding fold containing 1	130					positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via telomere lengthening (GO:0010833)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromosome, telomeric region (GO:0000784)|nucleolus (GO:0005730)|nucleus (GO:0005634)|Stn1-Ten1 complex (GO:0070188)	single-stranded DNA binding (GO:0003697)|single-stranded telomeric DNA binding (GO:0043047)			large_intestine(3)|lung(7)|ovary(1)|pancreas(2)	13		Colorectal(252;0.178)		Epithelial(162;3.39e-10)|all cancers(201;1.32e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0151)		CTCGGATCGTGTCCCCGATCT	0.463																																					p.D130E													.	.			0			c.C390A												268.0	207.0	227.0					10																	105659887		2203	4300	6503	SO:0001583	missense	79991	exon5			GATCGTGTCCCCG	BC017400	CCDS7552.1	10q25.1	2011-06-14				ENSG00000107960			26200	protein-coding gene	gene with protein product		613128				12477932	Standard	NM_024928		Approved	FLJ22559, bA541N10.2	uc001kxm.3	Q9H668		ENST00000224950.3:c.390C>A	10.37:g.105659887G>T	ENSP00000224950:p.Asp130Glu		70	0	0		46	0.07	3	NM_024928	41	0.00	0	D3DR99|Q5TCZ0	Missense_Mutation	SNP	ENST00000224950.3	37	CCDS7552.1	.	.	.	.	.	.	.	.	.	.	G	11.63	1.695464	0.30052	.	.	ENSG00000107960	ENST00000224950;ENST00000369764	T;T	0.28454	1.61;1.61	5.95	1.53	0.23141	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);Nucleic acid binding, OB-fold, tRNA/helicase-type (1);	0.042775	0.85682	D	0.000000	T	0.45034	0.1322	M	0.67953	2.075	0.38960	D	0.958522	D	0.71674	0.998	D	0.70227	0.968	T	0.35919	-0.9769	10	0.42905	T	0.14	-26.1717	6.3142	0.21180	0.4708:0.0:0.5292:0.0	.	130	Q9H668	STN1_HUMAN	E	130	ENSP00000224950:D130E;ENSP00000358779:D130E	ENSP00000224950:D130E	D	-	3	2	OBFC1	105649877	0.319000	0.24607	0.425000	0.26659	0.009000	0.06853	0.539000	0.23175	0.410000	0.25675	-0.150000	0.13652	GAC			0.463	OBFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050174.1		NM_024928	
PGA3	643834	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	60971070	60971070	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr11:60971070C>A	ENST00000325558.6	+	1	219	c.34C>A	c.(34-36)Ctc>Atc	p.L12I		NM_001079807.1	NP_001073275.1	P0DJD8	PEPA3_HUMAN	pepsinogen 3, group I (pepsinogen A)	12					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(1)|lung(1)|ovary(1)|skin(2)	5						TCTGGTGGCACTCTCTGAGTG	0.577																																					p.L12I													.	.			0			c.C34A												185.0	144.0	158.0					11																	60971070		2193	4294	6487	SO:0001583	missense	643834	exon1			GTGGCACTCTCTG	AL832946	CCDS31574.1	11q13	2006-12-13			ENSG00000229859	ENSG00000229859	3.4.23.1		8885	protein-coding gene	gene with protein product		169710				6300126	Standard	NM_001079807		Approved		uc001nqx.3	P0DJD8	OTTHUMG00000168071	ENST00000325558.6:c.34C>A	11.37:g.60971070C>A	ENSP00000322192:p.Leu12Ile		239	0.0041841004	1		184	0.46	85	NM_001079807	0		0	A8K749|B2R7D6|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000325558.6	37	CCDS31574.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.129721	0.37630	.	.	ENSG00000229859	ENST00000325558;ENST00000439843	T	0.60424	0.19	3.49	2.47	0.30058	.	.	.	.	.	T	0.54240	0.1846	L	0.61387	1.9	0.80722	D	1	B;B	0.32245	0.361;0.343	B;B	0.34931	0.134;0.192	T	0.60727	-0.7206	9	0.48119	T	0.1	.	11.599	0.50990	0.1783:0.8217:0.0:0.0	.	12;12	E7EUP8;F8WAB4	.;.	I	12	ENSP00000322192:L12I	ENSP00000322192:L12I	L	+	1	0	PGA3	60727646	0.853000	0.29707	0.744000	0.31058	0.023000	0.10783	1.382000	0.34374	1.989000	0.58080	0.552000	0.68991	CTC			0.577	PGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397955.2		NM_001079807	
LRRC32	2615	broad.mit.edu;mdanderson.org	37	11	76370933	76370933	+	Silent	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr11:76370933C>T	ENST00000407242.2	-	3	1946	c.1704G>A	c.(1702-1704)ctG>ctA	p.L568L	LRRC32_ENST00000260061.5_Silent_p.L568L|LRRC32_ENST00000404995.1_Silent_p.L568L|LRRC32_ENST00000464145.1_Intron|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	568					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GATTCCCCTGCAGGTAGAGGC	0.662																																					p.L568L													.	LRRC32	74		0			c.G1704A												26.0	28.0	27.0					11																	76370933		2199	4292	6491	SO:0001819	synonymous_variant	2615	exon3			CCCCTGCAGGTAG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.1704G>A	11.37:g.76370933C>T			35	0	0		25	0.12	3	NM_005512	34	0.09	3	Q86V06	Silent	SNP	ENST00000407242.2	37	CCDS8245.1																																																																																					0.662	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257926.2		NM_005512	
GRIA4	2893	broad.mit.edu	37	11	105769101	105769101	+	Missense_Mutation	SNP	G	G	T	rs375247322		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr11:105769101G>T	ENST00000530497.1	+	6	833	c.833G>T	c.(832-834)cGc>cTc	p.R278L	GRIA4_ENST00000428631.2_Missense_Mutation_p.R278L|GRIA4_ENST00000282499.5_Missense_Mutation_p.R278L|GRIA4_ENST00000393125.2_Missense_Mutation_p.R278L|GRIA4_ENST00000525187.1_Missense_Mutation_p.R278L|GRIA4_ENST00000393127.2_Missense_Mutation_p.R278L			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	278					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		CTAATGGATCGCTGGAAGAAA	0.353																																					p.R278L													.	GRIA4	380		0			c.G833T												60.0	61.0	61.0					11																	105769101		2202	4299	6501	SO:0001583	missense	0	exon7			TGGATCGCTGGAA	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.833G>T	11.37:g.105769101G>T	ENSP00000435775:p.Arg278Leu		137	0	0		120	0.03	4	NM_001077244	0		0	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	37	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	33	5.235973	0.95240	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000530497;ENST00000525187	D;D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8	5.72	5.72	0.89469	Extracellular ligand-binding receptor (1);	0.000000	0.64402	D	0.000001	D	0.87297	0.6142	L	0.60455	1.87	0.80722	D	1	B;P;P	0.49358	0.434;0.923;0.683	B;P;B	0.52159	0.245;0.691;0.36	D	0.88004	0.2758	10	0.87932	D	0	.	19.8805	0.96895	0.0:0.0:1.0:0.0	.	278;278;278	P48058;G3V164;Q86XE8	GRIA4_HUMAN;.;.	L	278	ENSP00000376833:R278L;ENSP00000282499:R278L;ENSP00000376835:R278L;ENSP00000415551:R278L;ENSP00000435775:R278L;ENSP00000432180:R278L	ENSP00000282499:R278L	R	+	2	0	GRIA4	105274311	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.437000	0.97535	2.704000	0.92352	0.655000	0.94253	CGC			0.353	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000388593.1			
B3GAT1	27087	bcgsc.ca	37	11	134253610	134253610	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr11:134253610G>T	ENST00000524765.1	-	3	5129	c.585C>A	c.(583-585)gaC>gaA	p.D195E	B3GAT1_ENST00000392580.1_Missense_Mutation_p.D195E|B3GAT1_ENST00000312527.4_Missense_Mutation_p.D195E|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000537389.1_Missense_Mutation_p.D208E			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	195					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		TGTTGTCGTCGTCGGCGAAGT	0.692																																					p.D195E													.	B3GAT1	49		0			c.C585A												31.0	25.0	27.0					11																	134253610		2200	4296	6496	SO:0001583	missense	27087	exon3			GTCGTCGTCGGCG	AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.585C>A	11.37:g.134253610G>T	ENSP00000433847:p.Asp195Glu		57	0	0		46	0.09	4	NM_054025	0		0	Q96FS7	Missense_Mutation	SNP	ENST00000524765.1	37	CCDS8500.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874255	0.91664	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	5.7	-0.504	0.11997	.	0.000000	0.85682	D	0.000000	D	0.85991	0.5826	M	0.91717	3.235	0.80722	D	1	D;D	0.62365	0.991;0.982	D;D	0.65773	0.937;0.938	D	0.85923	0.1447	10	0.87932	D	0	-35.4349	12.0213	0.53344	0.7179:0.0:0.2821:0.0	.	208;195	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	E	195;195;195;208	ENSP00000376359:D195E;ENSP00000307875:D195E;ENSP00000433847:D195E;ENSP00000445983:D208E	ENSP00000307875:D195E	D	-	3	2	B3GAT1	133758820	0.800000	0.28916	0.887000	0.34795	0.991000	0.79684	0.037000	0.13840	-0.417000	0.07461	0.561000	0.74099	GAC			0.692	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393639.1		NM_018644	
GRIN2B	2904	broad.mit.edu	37	12	13761690	13761690	+	Silent	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr12:13761690A>G	ENST00000609686.1	-	9	2066	c.1857T>C	c.(1855-1857)ccT>ccC	p.P619P		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	619					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGTTCTGCACAGGTACGGAGT	0.527																																					p.P619P													.	GRIN2B	303		0			c.T1857C												130.0	115.0	120.0					12																	13761690		2203	4300	6503	SO:0001819	synonymous_variant	2904	exon9			CTGCACAGGTACG		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.1857T>C	12.37:g.13761690A>G			108	0	0		265	0.03	9	NM_000834	0		0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	ENST00000609686.1	37	CCDS8662.1																																																																																					0.527	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268014.2			
KIAA1551	55196	broad.mit.edu	37	12	32135279	32135279	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr12:32135279A>G	ENST00000312561.4	+	4	1804	c.1390A>G	c.(1390-1392)Aat>Gat	p.N464D	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	464																	AATGCCAGAGAATGCAGAGAG	0.383																																					p.N464D													.	.			0			c.A1390G												96.0	102.0	100.0					12																	32135279		2203	4300	6503	SO:0001583	missense	55196	exon4			CCAGAGAATGCAG	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1390A>G	12.37:g.32135279A>G	ENSP00000310338:p.Asn464Asp		75	0	0		213	0.02	4	NM_018169	41	0.00	0	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	37	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	A	5.017	0.188775	0.09547	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.05925	4.0;3.37	4.82	-2.62	0.06152	.	3.598240	0.00966	N	0.003176	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B	0.19817	0.039	B	0.19391	0.025	T	0.34204	-0.9838	9	.	.	.	.	1.396	0.02261	0.5008:0.1363:0.2315:0.1314	.	464	Q9HCM1	CL035_HUMAN	D	464	ENSP00000310338:N464D;ENSP00000370442:N464D	.	N	+	1	0	C12orf35	32026546	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.170000	0.09897	-0.840000	0.04206	0.482000	0.46254	AAT			0.383	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250307.2		NM_018169	
GJA3	2700	mdanderson.org	37	13	20717246	20717246	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr13:20717246C>A	ENST00000241125.3	-	2	358	c.182G>T	c.(181-183)tGc>tTc	p.C61F		NM_021954.3	NP_068773.2	Q9Y6H8	CXA3_HUMAN	gap junction protein, alpha 3, 46kDa	61					cell-cell signaling (GO:0007267)|transport (GO:0006810)|visual perception (GO:0007601)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			NS(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		all_cancers(29;1.4e-21)|all_epithelial(30;8.75e-19)|all_lung(29;1.28e-17)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;0.000554)|Epithelial(112;0.000872)|OV - Ovarian serous cystadenocarcinoma(117;0.0105)|Lung(94;0.0251)|LUSC - Lung squamous cell carcinoma(192;0.0784)		GACGTTCTCGCAGCCCGGCTG	0.637																																					p.C61F													.	.			0			c.G182T												91.0	76.0	81.0					13																	20717246		2203	4300	6503	SO:0001583	missense	2700	exon2			TTCTCGCAGCCCG	AF075290	CCDS9289.1	13q12.11	2008-02-05	2007-01-16		ENSG00000121743	ENSG00000121743		"""Ion channels / Gap junction proteins (connexins)"""	4277	protein-coding gene	gene with protein product	"""connexin 46"""	121015	"""gap junction protein, alpha 3, 46kD (connexin 46)"", ""gap junction protein, alpha 3, 46kDa (connexin 46)"""	CZP3		10205266, 7342922	Standard	NM_021954		Approved	CX46	uc001umx.1	Q9Y6H8	OTTHUMG00000016510	ENST00000241125.3:c.182G>T	13.37:g.20717246C>A	ENSP00000241125:p.Cys61Phe		68	0	0		38	0.08	3	NM_021954	0		0	Q0VAB7|Q9H537	Missense_Mutation	SNP	ENST00000241125.3	37	CCDS9289.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599670	0.87055	.	.	ENSG00000121743	ENST00000241125	D	0.99741	-6.6	5.36	5.36	0.76844	Connexin, conserved site (1);Connexin, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	H	0.97415	4	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96607	0.9449	10	0.87932	D	0	.	19.094	0.93242	0.0:1.0:0.0:0.0	.	61	Q9Y6H8	CXA3_HUMAN	F	61	ENSP00000241125:C61F	ENSP00000241125:C61F	C	-	2	0	GJA3	19615246	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.716000	0.84723	2.517000	0.84864	0.561000	0.74099	TGC			0.637	GJA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044059.3		NM_021954	
CAPN3	825	mdanderson.org	37	15	42702861	42702861	+	Missense_Mutation	SNP	G	G	T	rs137927542		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr15:42702861G>T	ENST00000397163.3	+	21	2479	c.2260G>T	c.(2260-2262)Gca>Tca	p.A754S	CAPN3_ENST00000318023.7_Missense_Mutation_p.A748S|CAPN3_ENST00000357568.3_Missense_Mutation_p.A748S|RP11-164J13.1_ENST00000495723.1_RNA|CAPN3_ENST00000337571.4_Missense_Mutation_p.A89S|CAPN3_ENST00000356316.3_Missense_Mutation_p.A661S|CAPN3_ENST00000397200.4_Missense_Mutation_p.A242S|CAPN3_ENST00000562199.1_3'UTR|CAPN3_ENST00000561817.1_Missense_Mutation_p.A89S|CAPN3_ENST00000397204.4_Missense_Mutation_p.A89S|CAPN3_ENST00000349748.3_Missense_Mutation_p.A662S|CAPN3_ENST00000569136.1_Missense_Mutation_p.A89S	NM_000070.2	NP_000061.1	P20807	CAN3_HUMAN	calpain 3, (p94)	754	Domain IV.|EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				apoptotic process (GO:0006915)|autolysis (GO:0001896)|cellular response to calcium ion (GO:0071277)|cellular response to salt stress (GO:0071472)|G1 to G0 transition involved in cell differentiation (GO:0070315)|muscle cell cellular homeostasis (GO:0046716)|muscle organ development (GO:0007517)|muscle structure development (GO:0061061)|myofibril assembly (GO:0030239)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of proteolysis (GO:0045862)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein localization to membrane (GO:0072657)|proteolysis (GO:0006508)|regulation of catalytic activity (GO:0050790)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of myoblast differentiation (GO:0045661)|response to calcium ion (GO:0051592)|response to muscle activity (GO:0014850)|sarcomere organization (GO:0045214)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|myofibril (GO:0030016)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)|ligase regulator activity (GO:0055103)|peptidase activity (GO:0008233)|protein complex scaffold (GO:0032947)|signal transducer activity (GO:0004871)|sodium ion binding (GO:0031402)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	47		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		AGTCAACGACGCAGGTGCTGA	0.532																																					p.A754S													.	.			0			c.G2260T												50.0	42.0	44.0					15																	42702861		2203	4299	6502	SO:0001583	missense	825	exon21			AACGACGCAGGTG	X85030	CCDS10085.1, CCDS10086.1, CCDS32207.1, CCDS45245.1, CCDS45246.1	15q15.1	2014-09-17			ENSG00000092529	ENSG00000092529	3.4.22.52	"""EF-hand domain containing"""	1480	protein-coding gene	gene with protein product		114240		LGMD2, LGMD2A		2555341, 7720071	Standard	NM_024344		Approved	CANP3, p94, nCL-1	uc001zpn.1	P20807	OTTHUMG00000130619	ENST00000397163.3:c.2260G>T	15.37:g.42702861G>T	ENSP00000380349:p.Ala754Ser		34	0	0		39	0.08	3	NM_000070	17	0.00	0	A6H8K6|Q7L4R0|Q9BQC8|Q9BTU4|Q9Y5S6|Q9Y5S7	Missense_Mutation	SNP	ENST00000397163.3	37	CCDS45245.1	.	.	.	.	.	.	.	.	.	.	G	32	5.176901	0.94846	.	.	ENSG00000092529	ENST00000356316;ENST00000337522;ENST00000397163;ENST00000357568;ENST00000349748;ENST00000318023;ENST00000397200;ENST00000337571;ENST00000397204	D;D;D;D;D;D;D;D	0.94793	-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52;-3.52	4.54	4.54	0.55810	EF-hand-like domain (1);	0.000000	0.85682	U	0.000000	D	0.96602	0.8891	M	0.64260	1.97	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;0.995	D	0.97096	0.9794	10	0.66056	D	0.02	.	17.5035	0.87738	0.0:0.0:1.0:0.0	.	619;667;89;662;748;754;661	C6EVS4;C6EVS3;A4FTZ9;P20807-2;P20807-3;P20807;Q762C8	.;.;.;.;.;CAN3_HUMAN;.	S	661;242;754;748;662;748;242;89;89	ENSP00000348667:A661S;ENSP00000380349:A754S;ENSP00000350181:A748S;ENSP00000183936:A662S;ENSP00000326281:A748S;ENSP00000380384:A242S;ENSP00000336840:A89S;ENSP00000380387:A89S	ENSP00000326281:A748S	A	+	1	0	CAPN3	40490153	1.000000	0.71417	0.955000	0.39395	0.818000	0.46254	9.612000	0.98347	2.356000	0.79943	0.563000	0.77884	GCA			0.532	CAPN3-009	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000421075.1			
ALPK3	57538	mdanderson.org	37	15	85400648	85400648	+	Silent	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr15:85400648C>T	ENST00000258888.5	+	6	3452	c.3285C>T	c.(3283-3285)agC>agT	p.S1095S		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1095					heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGCACGGGAGCACAGCCACCT	0.622																																					p.S1095S													.	.			0			c.C3285T												55.0	45.0	48.0					15																	85400648		2203	4299	6502	SO:0001819	synonymous_variant	57538	exon6			CGGGAGCACAGCC	AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.3285C>T	15.37:g.85400648C>T			54	0	0		33	0.09	3	NM_020778	4	0.00	0	Q9P2L6	Silent	SNP	ENST00000258888.5	37	CCDS10333.1																																																																																					0.622	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000308997.1		NM_020778	
CHD2	1106	mdanderson.org	37	15	93540280	93540280	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr15:93540280A>G	ENST00000394196.4	+	29	4757	c.3689A>G	c.(3688-3690)gAg>gGg	p.E1230G	CHD2_ENST00000557381.1_Missense_Mutation_p.E1230G	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1230					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GAGGAGTTTGAGATGCTGCAT	0.383																																					p.E1230G													.	.			0			c.A3689G												106.0	101.0	102.0					15																	93540280		2197	4298	6495	SO:0001583	missense	1106	exon29			AGTTTGAGATGCT	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.3689A>G	15.37:g.93540280A>G	ENSP00000377747:p.Glu1230Gly		66	0	0		35	0.09	3	NM_001271	14	0.00	0	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	37	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	13.92	2.380718	0.42207	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	T;T	0.77489	-1.1;-1.1	5.44	4.28	0.50868	.	0.000000	0.34484	U	0.003936	T	0.72382	0.3453	M	0.66939	2.045	0.80722	D	1	B;P	0.36048	0.295;0.534	B;B	0.35550	0.081;0.205	T	0.68265	-0.5454	10	0.34782	T	0.22	-32.3791	8.3989	0.32574	0.7324:0.1368:0.0:0.1308	.	1230;1230	O14647;O14647-2	CHD2_HUMAN;.	G	1230	ENSP00000377747:E1230G;ENSP00000451366:E1230G	ENSP00000377747:E1230G	E	+	2	0	CHD2	91341284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.796000	0.62496	0.953000	0.37825	0.528000	0.53228	GAG			0.383	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000313528.3		NM_001271	
ECI1	1632	mdanderson.org	37	16	2293048	2293048	+	Splice_Site	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:2293048T>C	ENST00000301729.4	-	6	788	c.741A>G	c.(739-741)ccA>ccG	p.P247P	RP11-304L19.11_ENST00000565709.1_RNA|ECI1_ENST00000562238.1_Splice_Site_p.P230P|ECI1_ENST00000570258.1_Splice_Site_p.P188P	NM_001919.3	NP_001910.2	P42126	ECI1_HUMAN	enoyl-CoA delta isomerase 1	247					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|intramolecular oxidoreductase activity (GO:0016860)			endometrium(1)|large_intestine(2)|lung(6)	9						GTGCCTCACCTGGAATGGCCA	0.637																																					p.P247P													.	.			0			c.A741G												22.0	22.0	22.0					16																	2293048		2192	4293	6485	SO:0001630	splice_region_variant	1632	exon6			CTCACCTGGAATG		CCDS10464.1, CCDS58410.1	16p13.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000167969	ENSG00000167969	5.3.3.8		2703	protein-coding gene	gene with protein product	"""3,2 trans-enoyl-CoA isomerase"""	600305	"""dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)"", ""dodecenoyl-CoA isomerase"""	DCI		7829074	Standard	NM_001178029		Approved		uc002cpr.3	P42126	OTTHUMG00000128830	ENST00000301729.4:c.742+1A>G	16.37:g.2293048T>C			16	0	0		25	0.12	3	NM_001919	235	0.00	0	A8K512|Q13290|Q7Z2L6|Q7Z2L7|Q9BUB8|Q9BW05|Q9UDG6	Silent	SNP	ENST00000301729.4	37	CCDS10464.1																																																																																					0.637	ECI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250768.1			Silent
PDXDC1	23042	hgsc.bcm.edu	37	16	15122751	15122751	+	Silent	SNP	C	C	T	rs117411702		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:15122751C>T	ENST00000396410.4	+	15	1318	c.1221C>T	c.(1219-1221)gcC>gcT	p.A407A	PDXDC1_ENST00000450288.2_Silent_p.A379A|PDXDC1_ENST00000325823.7_Silent_p.A392A|PDXDC1_ENST00000447912.2_Silent_p.A316A|PDXDC1_ENST00000569715.1_Silent_p.A380A|PDXDC1_ENST00000455313.2_Silent_p.A384A|PDXDC1_ENST00000563679.1_Silent_p.A425A|PDXDC1_ENST00000535621.2_Silent_p.A407A	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	407					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)	p.A407A(2)		central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TGTTTAAAGCCGTCCCAGTGC	0.552																																					p.A407A													PDXDC1,NS,carcinoma,0,3	PDXDC1	0	3	2	Substitution - coding silent(2)	prostate(1)|skin(1)	c.C1221T												95.0	85.0	88.0					16																	15122751		2197	4300	6497	SO:0001819	synonymous_variant	23042	exon15			TAAAGCCGTCCCA	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1221C>T	16.37:g.15122751C>T			60	0.0166666667	1		98	0.04	4	NM_015027	245	0.06	14	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																			0.002		0.552	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389065.2		NM_015027	
PHKB	5257	broad.mit.edu	37	16	47694447	47694447	+	Missense_Mutation	SNP	C	C	T	rs376951504		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:47694447C>T	ENST00000323584.5	+	21	2026	c.2002C>T	c.(2002-2004)Ctt>Ttt	p.L668F	PHKB_ENST00000455779.1_Missense_Mutation_p.L661F|PHKB_ENST00000299167.8_Missense_Mutation_p.L668F|PHKB_ENST00000566044.1_Missense_Mutation_p.L661F	NM_000293.2	NP_000284.1	Q93100	KPBB_HUMAN	phosphorylase kinase, beta	668					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|liver(1)|lung(18)|ovary(1)|skin(1)	41		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				GGTAGAACAACTTGATTTCCT	0.353																																					p.L668F													.	PHKB	298		0			c.C2002T							C	PHE/LEU,PHE/LEU	1,4401	2.1+/-5.4	0,1,2200	147.0	152.0	150.0		2002,1981	5.5	1.0	16		150	0,8600		0,0,4300	no	missense,missense	PHKB	NM_000293.2,NM_001031835.2	22,22	0,1,6500	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	668/1094,661/1087	47694447	1,13001	2201	4300	6501	SO:0001583	missense	5257	exon21			GAACAACTTGATT		CCDS10729.1, CCDS42161.1	16q12-q13	2009-07-10			ENSG00000102893	ENSG00000102893	2.7.11.19		8927	protein-coding gene	gene with protein product		172490					Standard	NM_000293		Approved		uc002eev.4	Q93100	OTTHUMG00000133102	ENST00000323584.5:c.2002C>T	16.37:g.47694447C>T	ENSP00000313504:p.Leu668Phe		127	0	0		95	0.04	4	NM_000293	33	0.03	1	Q8N4T5	Missense_Mutation	SNP	ENST00000323584.5	37	CCDS10729.1	.	.	.	.	.	.	.	.	.	.	C	15.98	2.993298	0.54041	2.27E-4	0.0	ENSG00000102893	ENST00000299167;ENST00000455779;ENST00000323584	D;D	0.93763	-3.28;-3.28	5.53	5.53	0.82687	Glycoside hydrolase 15-related (1);	0.068106	0.56097	D	0.000027	D	0.95984	0.8692	M	0.91140	3.18	0.80722	D	1	B;B	0.31054	0.306;0.178	B;B	0.39771	0.309;0.122	D	0.95671	0.8723	10	0.87932	D	0	-20.2577	19.4337	0.94781	0.0:1.0:0.0:0.0	.	668;661	Q93100;Q93100-4	KPBB_HUMAN;.	F	661;661;668	ENSP00000414345:L661F;ENSP00000313504:L668F	ENSP00000299167:L661F	L	+	1	0	PHKB	46251948	1.000000	0.71417	0.999000	0.59377	0.494000	0.33585	4.156000	0.58138	2.607000	0.88179	0.585000	0.79938	CTT			0.353	PHKB-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000430413.1			
SNX20	124460	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	50707856	50707856	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:50707856C>A	ENST00000330943.4	-	4	583	c.412G>T	c.(412-414)Gtg>Ttg	p.V138L	RP11-401P9.5_ENST00000570241.2_RNA|SNX20_ENST00000300590.3_Intron|RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	138	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						GGAAACTCCACGTCTTCGATC	0.587																																					p.V138L													SNX20,NS,carcinoma,+1,1	SNX20	1	1	0			c.G412T												80.0	73.0	75.0					16																	50707856		2198	4300	6498	SO:0001583	missense	124460	exon4			ACTCCACGTCTTC	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.412G>T	16.37:g.50707856C>A	ENSP00000332062:p.Val138Leu		30	0	0		40	0.20	8	NM_182854	3	0.00	0	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	37	CCDS10745.1	.	.	.	.	.	.	.	.	.	.	C	11.18	1.563365	0.27915	.	.	ENSG00000167208	ENST00000330943	T	0.38560	1.13	5.53	2.17	0.27698	Phox homologous domain (5);	0.272895	0.34725	N	0.003723	T	0.20455	0.0492	N	0.21194	0.64	0.35861	D	0.8275	B	0.31859	0.343	B	0.30782	0.12	T	0.15065	-1.0450	10	0.07175	T	0.84	-40.4695	5.465	0.16637	0.0:0.5519:0.1498:0.2984	.	138	Q7Z614	SNX20_HUMAN	L	138	ENSP00000332062:V138L	ENSP00000332062:V138L	V	-	1	0	SNX20	49265357	0.043000	0.20138	0.828000	0.32881	0.088000	0.18126	0.378000	0.20569	0.705000	0.31890	0.561000	0.74099	GTG			0.587	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256879.2		NM_153337	
AMFR	267	mdanderson.org	37	16	56401360	56401360	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:56401360G>T	ENST00000290649.5	-	12	1805	c.1595C>A	c.(1594-1596)gCt>gAt	p.A532D		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	532					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						TTTTACCTGAGCAGAAGTTTC	0.527																																					p.A532D	Pancreas(2;144 323 39528)												.	.			0			c.C1595A												388.0	350.0	363.0					16																	56401360		2198	4300	6498	SO:0001583	missense	267	exon12			ACCTGAGCAGAAG	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.1595C>A	16.37:g.56401360G>T	ENSP00000290649:p.Ala532Asp		39	0	0		38	0.08	3	NM_001144	111	0.00	0	P26442|Q8IZ70	Missense_Mutation	SNP	ENST00000290649.5	37	CCDS10758.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.245618	0.39697	.	.	ENSG00000159461	ENST00000290649	T	0.16457	2.34	5.8	2.71	0.32032	.	1.205980	0.05665	N	0.587635	T	0.18130	0.0435	L	0.51422	1.61	0.09310	N	1	B;B	0.19200	0.0;0.034	B;B	0.17433	0.001;0.018	T	0.37911	-0.9685	10	0.22706	T	0.39	0.9627	8.7085	0.34369	0.2439:0.0:0.7561:0.0	.	532;181	Q9UKV5;Q1RN03	AMFR2_HUMAN;.	D	532	ENSP00000290649:A532D	ENSP00000290649:A532D	A	-	2	0	AMFR	54958861	0.002000	0.14202	0.005000	0.12908	0.290000	0.27261	1.192000	0.32150	0.320000	0.23234	0.655000	0.94253	GCT			0.527	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256978.2			
ARL2BP	23568	mdanderson.org	37	16	57283743	57283743	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:57283743C>T	ENST00000219204.3	+	4	542	c.272C>T	c.(271-273)gCa>gTa	p.A91V	RP11-407G23.3_ENST00000564376.1_RNA|RP11-407G23.4_ENST00000562409.1_RNA|ARL2BP_ENST00000562023.1_Missense_Mutation_p.A51V	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	91					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						TTCAACATGGCAGCCTTCACC	0.418																																					p.A91V													.	.			0			c.C272T												164.0	155.0	158.0					16																	57283743		2198	4300	6498	SO:0001583	missense	23568	exon4			ACATGGCAGCCTT	AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.272C>T	16.37:g.57283743C>T	ENSP00000219204:p.Ala91Val		44	0	0		42	0.07	3	NM_012106	67	0.00	0	B3KQJ5|Q504R0	Missense_Mutation	SNP	ENST00000219204.3	37	CCDS10776.1	.	.	.	.	.	.	.	.	.	.	C	13.88	2.369225	0.42003	.	.	ENSG00000102931	ENST00000219204	T	0.43294	0.95	5.84	5.84	0.93424	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.412269	0.23714	U	0.045300	T	0.44350	0.1289	M	0.69823	2.125	0.35704	D	0.815815	B;B	0.23128	0.08;0.005	B;B	0.21151	0.033;0.004	T	0.48636	-0.9018	10	0.30078	T	0.28	-9.9255	15.2402	0.73465	0.0:0.9312:0.0:0.0688	.	59;91	B4DQD8;Q9Y2Y0	.;AR2BP_HUMAN	V	91	ENSP00000219204:A91V	ENSP00000219204:A91V	A	+	2	0	ARL2BP	55841244	0.857000	0.29778	0.999000	0.59377	0.751000	0.42716	1.523000	0.35932	2.765000	0.95021	0.655000	0.94253	GCA			0.418	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257334.2		NM_012106	
ZFHX3	463	mdanderson.org	37	16	72830446	72830446	+	Silent	SNP	T	T	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr16:72830446T>G	ENST00000268489.5	-	9	6807	c.6135A>C	c.(6133-6135)ccA>ccC	p.P2045P	ZFHX3_ENST00000397992.5_Silent_p.P1131P	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2045	Poly-Pro.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GTGGAGGGGGTGGAGGGGGAG	0.632																																					p.P2045P													ZFHX3,right_upper_lobe,carcinoma,0,2	ZFHX3	0	2	0			c.A6135C												23.0	32.0	29.0					16																	72830446		2158	4173	6331	SO:0001819	synonymous_variant	463	exon9			AGGGGGTGGAGGG	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6135A>C	16.37:g.72830446T>G			70	0.1571428571	11		40	0.40	16	NM_006885	0		0	D3DWS8|O15101|Q13719	Silent	SNP	ENST00000268489.5	37	CCDS10908.1																																																																																					0.632	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269008.1		NM_006885	
GP1BA	2811	mdanderson.org	37	17	4837171	4837171	+	Silent	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr17:4837171G>A	ENST00000329125.5	+	2	1347	c.1272G>A	c.(1270-1272)ccG>ccA	p.P424P		NM_000173.5	NP_000164.5	P07359	GP1BA_HUMAN	glycoprotein Ib (platelet), alpha polypeptide	424	Pro/Thr-rich.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|fibrinolysis (GO:0042730)|platelet activation (GO:0030168)|regulation of blood coagulation (GO:0030193)|thrombin receptor signaling pathway (GO:0070493)	anchored component of external side of plasma membrane (GO:0031362)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	thrombin receptor activity (GO:0015057)	p.E412_P424delEPTSEPAPSPTTP(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(5)|stomach(1)|urinary_tract(1)	20						cgaccaccccggagcccacct	0.751																																					p.P424P													.	.			1	Deletion - In frame(1)	stomach(1)	c.G1272A																																									SO:0001819	synonymous_variant	2811	exon2			CACCCCGGAGCCC		CCDS54068.1	17p13.2	2014-09-17			ENSG00000185245	ENSG00000185245		"""CD molecules"""	4439	protein-coding gene	gene with protein product		606672		GP1B		3353370	Standard	NM_000173		Approved	CD42b	uc021tnz.1	P07359	OTTHUMG00000177946	ENST00000329125.5:c.1272G>A	17.37:g.4837171G>A			17	0	0		22	0.14	3	NM_000173	1	0.00	0	E7ES66|Q14441|Q16469|Q8N1F3|Q8NG39|Q9HDC7|Q9UEK1|Q9UQS4	Silent	SNP	ENST00000329125.5	37	CCDS54068.1																																																																																					0.751	GP1BA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439889.1			
STX8	9482	mdanderson.org	37	17	9480015	9480015	+	5'Flank	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr17:9480015G>T	ENST00000306357.4	-	0	0				WDR16_ENST00000576499.1_Start_Codon_SNP_p.M1I|WDR16_ENST00000352665.5_Start_Codon_SNP_p.M1I|STX8_ENST00000573373.1_5'Flank|WDR16_ENST00000396219.3_Start_Codon_SNP_p.M1I|STX8_ENST00000574431.1_5'Flank	NM_004853.2	NP_004844.1	Q9UNK0	STX8_HUMAN	syntaxin 8						endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|transport (GO:0006810)|vesicle fusion (GO:0006906)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(1)	12						TCCCAAGGATGGATAACAAAA	0.572											OREG0024167	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1I													.	.			0			c.G3T												67.0	75.0	72.0					17																	9480015		1907	4143	6050	SO:0001631	upstream_gene_variant	146845	exon1			AAGGATGGATAAC	AF115323	CCDS32565.1	17p13.1	2012-05-25			ENSG00000170310	ENSG00000170310			11443	protein-coding gene	gene with protein product		604203				9852078, 10198254	Standard	NM_004853		Approved	CARB	uc002glx.3	Q9UNK0	OTTHUMG00000177844		17.37:g.9480015G>T	Exception_encountered		37	0	0	657	42	0.07	3	NM_001080556	0		0	O60712|Q53XT8	Missense_Mutation	SNP	ENST00000306357.4	37	CCDS32565.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674552	0.47781	.	.	ENSG00000166596	ENST00000352665;ENST00000396219	T;T	0.31510	1.71;1.49	5.85	5.85	0.93711	.	.	.	.	.	T	0.47619	0.1455	.	.	.	0.80722	D	1	D;B	0.58268	0.982;0.009	P;B	0.53146	0.719;0.004	T	0.46386	-0.9195	8	0.87932	D	0	.	17.0876	0.86615	0.0:0.0:1.0:0.0	.	1;1	Q8N1V2-3;Q8N1V2	.;WDR16_HUMAN	I	1	ENSP00000339449:M1I;ENSP00000379521:M1I	ENSP00000339449:M1I	M	+	3	0	WDR16	9420740	1.000000	0.71417	0.988000	0.46212	0.098000	0.18820	2.194000	0.42668	2.761000	0.94854	0.655000	0.94253	ATG			0.572	STX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439206.3		NM_004853	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		155	0.0322580645	5		164	0.04	7	NM_145301	16	0.69	11	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
ANKFN1	162282	mdanderson.org	37	17	54558038	54558038	+	Nonsense_Mutation	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr17:54558038G>A	ENST00000318698.2	+	16	1994	c.1959G>A	c.(1957-1959)tgG>tgA	p.W653*	ANKFN1_ENST00000566473.2_Nonsense_Mutation_p.W653*	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	653										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						GAGAGGAATGGGAATGGATCC	0.408																																					p.W653X													ANKFN1,right_upper_lobe,carcinoma,0,1	ANKFN1	0	1	0			c.G1959A												138.0	129.0	132.0					17																	54558038		2203	4300	6503	SO:0001587	stop_gained	162282	exon16			GGAATGGGAATGG	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1959G>A	17.37:g.54558038G>A	ENSP00000321627:p.Trp653*		42	0	0		41	0.07	3	NM_153228	0		0		Nonsense_Mutation	SNP	ENST00000318698.2	37	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	G	36	5.886012	0.97068	.	.	ENSG00000153930	ENST00000318698	.	.	.	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0995	19.3291	0.94278	0.0:0.0:1.0:0.0	.	.	.	.	X	653	.	ENSP00000321627:W653X	W	+	3	0	ANKFN1	51913037	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.072000	0.93986	2.553000	0.86117	0.655000	0.94253	TGG			0.408	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338043.1		NM_153228	
CLTC	1213	mdanderson.org	37	17	57733338	57733338	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr17:57733338G>A	ENST00000269122.3	+	6	1193	c.919G>A	c.(919-921)Gca>Aca	p.A307T	CLTC_ENST00000579456.1_Intron|CLTC_ENST00000393043.1_Missense_Mutation_p.A307T	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	307	Globular terminal domain.|WD40-like repeat 7.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TTTTGTTACTGCACCTCATGA	0.368			T	"""ALK, TFE3"""	"""ALCL, renal """																																p.A307T				Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	.	.			0			c.G919A												128.0	126.0	127.0					17																	57733338		2203	4300	6503	SO:0001583	missense	1213	exon6			GTTACTGCACCTC	X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.919G>A	17.37:g.57733338G>A	ENSP00000269122:p.Ala307Thr		42	0	0		41	0.07	3	NM_004859	78	0.00	0	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	ENST00000269122.3	37	CCDS32696.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.578651	0.65878	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.29397	1.57;1.57	5.73	5.73	0.89815	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.30541	0.0768	L	0.39566	1.225	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.24541	0.009;0.054	T	0.06320	-1.0833	10	0.20046	T	0.44	.	19.9019	0.96988	0.0:0.0:1.0:0.0	.	307;307	Q00610;Q00610-2	CLH1_HUMAN;.	T	307	ENSP00000269122:A307T;ENSP00000376763:A307T	ENSP00000269122:A307T	A	+	1	0	CLTC	55088120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.698000	0.92095	0.591000	0.81541	GCA			0.368	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258859.1		NM_004859	
KCTD1	284252	broad.mit.edu;mdanderson.org	37	18	24127403	24127403	+	Intron	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr18:24127403G>T	ENST00000408011.3	-	1	545				KCTD1_ENST00000579973.1_Intron|KCTD1_ENST00000580059.1_5'Flank|KCTD1_ENST00000417602.1_Silent_p.R366R|KCTD1_ENST00000317932.7_Intron	NM_001136205.2	NP_001129677.1	Q719H9	KCTD1_HUMAN	potassium channel tetramerization domain containing 1						negative regulation of transcription, DNA-templated (GO:0045892)|protein homooligomerization (GO:0051260)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(3)	12	all_cancers(21;0.00191)|Lung NSC(5;0.000698)|all_lung(6;0.0019)|Ovarian(20;0.0848)		Epithelial(2;7.8e-06)|OV - Ovarian serous cystadenocarcinoma(3;9.02e-06)|all cancers(3;3.37e-05)			TGCTCTCGGCGCGCTTCTTGC	0.612																																					p.R366R													.	KCTD1	76		0			c.C1098A												34.0	33.0	33.0					18																	24127403		692	1591	2283	SO:0001627	intron_variant	284252	exon1			CTCGGCGCGCTTC	AF542549	CCDS11888.1	18q11.2	2013-09-20	2013-06-20		ENSG00000134504	ENSG00000134504			18249	protein-coding gene	gene with protein product		613420	"""potassium channel tetramerisation domain containing 1"""	C18orf5			Standard	NM_001142730		Approved		uc010xbj.3	Q719H9	OTTHUMG00000131947	ENST00000408011.3:c.14+1451C>A	18.37:g.24127403G>T			55	0	0		46	0.07	3	NM_001142730	5	0.00	0	A8K1F5	Silent	SNP	ENST00000408011.3	37	CCDS11888.1																																																																																					0.612	KCTD1-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000446265.1		XM_209091	
SMAD4	4089	mdanderson.org	37	18	48586287	48586287	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr18:48586287G>T	ENST00000342988.3	+	8	1493		c.e8+1		SMAD4_ENST00000398417.2_Splice_Site|SMAD4_ENST00000588745.1_Intron	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4						atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AATCATCCTGGTAAGTGTATT	0.358																																					.													.	.			37	Whole gene deletion(36)|Unknown(1)	pancreas(26)|breast(3)|large_intestine(2)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)	c.955+1G>T												106.0	101.0	103.0					18																	48586287		2203	4300	6503	SO:0001630	splice_region_variant	4089	exon8			ATCCTGGTAAGTG	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.955+1G>T	18.37:g.48586287G>T			82	0	0		44	0.07	3	NM_005359	0		0	A8K405	Splice_Site	SNP	ENST00000342988.3	37	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986328	0.74589	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7261	0.88365	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMAD4	46840285	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.407000	0.97325	2.466000	0.83321	0.585000	0.79938	.			0.358	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255993.3		NM_005359	Intron
SERPINB10	5273	broad.mit.edu;bcgsc.ca	37	18	61587085	61587085	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr18:61587085G>T	ENST00000238508.3	+	5	495	c.436G>T	c.(436-438)Gct>Tct	p.A146S		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	146					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				CTTTGTGGAAGCTTCTGATCA	0.403																																					p.A146S													.	SERPINB10	53		0			c.G436T												69.0	79.0	76.0					18																	61587085		2203	4299	6502	SO:0001583	missense	5273	exon4			GTGGAAGCTTCTG	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.436G>T	18.37:g.61587085G>T	ENSP00000238508:p.Ala146Ser		111	0.009009009	1		83	0.07	6	NM_005024	0		0	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	ENST00000238508.3	37	CCDS11990.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528542	0.27299	.	.	ENSG00000242550	ENST00000238508	D	0.81996	-1.56	5.33	1.71	0.24356	Serpin domain (3);	0.725350	0.13688	N	0.369758	T	0.79052	0.4381	L	0.55481	1.735	0.09310	N	1	P	0.38617	0.64	B	0.40602	0.334	T	0.66440	-0.5923	10	0.38643	T	0.18	.	9.8754	0.41200	0.1844:0.0:0.8156:0.0	.	146	P48595	SPB10_HUMAN	S	146	ENSP00000238508:A146S	ENSP00000238508:A146S	A	+	1	0	SERPINB10	59738065	0.914000	0.31030	0.028000	0.17463	0.938000	0.57974	1.320000	0.33666	0.451000	0.26802	0.655000	0.94253	GCT			0.403	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000134012.3		NM_005024	
MCOLN1	57192	mdanderson.org	37	19	7595282	7595282	+	Silent	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr19:7595282G>T	ENST00000264079.6	+	12	1595	c.1470G>T	c.(1468-1470)gtG>gtT	p.V490V		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	490					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GCAGCCTGGTGTGGCTCTTCT	0.582																																					p.V490V													.	.			0			c.G1470T												253.0	236.0	242.0					19																	7595282		2203	4300	6503	SO:0001819	synonymous_variant	57192	exon12			CCTGGTGTGGCTC	AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.1470G>T	19.37:g.7595282G>T			46	0	0		21	0.14	3	NM_020533	35	0.00	0	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	ENST00000264079.6	37	CCDS12180.1																																																																																					0.582	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458974.2		NM_020533	
ZBTB32	27033	mdanderson.org	37	19	36205860	36205860	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr19:36205860G>T	ENST00000392197.2	+	3	650	c.332G>T	c.(331-333)aGg>aTg	p.R111M	ZBTB32_ENST00000262630.3_Missense_Mutation_p.R111M			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	111					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCATGCTGGAGGGCTCGAGGG	0.597																																					p.R111M													.	.			0			c.G332T												47.0	50.0	49.0					19																	36205860		2203	4300	6503	SO:0001583	missense	27033	exon2			GCTGGAGGGCTCG	AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.332G>T	19.37:g.36205860G>T	ENSP00000376035:p.Arg111Met		41	0	0		31	0.10	3	NM_014383	1	0.00	0	Q8WVP2	Missense_Mutation	SNP	ENST00000392197.2	37	CCDS12471.1	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020644	0.35606	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.23552	1.9;1.9	5.85	2.44	0.29823	BTB/POZ-like (1);BTB/POZ fold (2);	0.608999	0.14899	N	0.291920	T	0.34483	0.0899	M	0.64404	1.975	0.19945	N	0.999946	D	0.58620	0.983	P	0.52793	0.709	T	0.11131	-1.0600	10	0.49607	T	0.09	-2.448	7.441	0.27183	0.2885:0.0:0.7115:0.0	.	111	Q9Y2Y4	ZBT32_HUMAN	M	111	ENSP00000262630:R111M;ENSP00000376035:R111M	ENSP00000262630:R111M	R	+	2	0	ZBTB32	40897700	0.002000	0.14202	0.249000	0.24280	0.100000	0.18952	-0.051000	0.11885	0.313000	0.23062	0.655000	0.94253	AGG			0.597	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109491.3		NM_014383	
HKR1	284459	mdanderson.org	37	19	37853502	37853502	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr19:37853502G>T	ENST00000324411.4	+	6	1074	c.805G>T	c.(805-807)Ggg>Tgg	p.G269W	HKR1_ENST00000589392.1_Missense_Mutation_p.G251W|HKR1_ENST00000541583.2_Missense_Mutation_p.G208W|HKR1_ENST00000591471.1_5'UTR|HKR1_ENST00000544914.1_5'UTR|HKR1_ENST00000591134.1_Intron|HKR1_ENST00000392153.3_Missense_Mutation_p.G250W	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	269					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GACACAAACTGGGGAGACACC	0.463																																					p.G269W													HKR1,NS,carcinoma,0,1	HKR1	0	1	0			c.G805T												46.0	45.0	45.0					19																	37853502		2203	4300	6503	SO:0001583	missense	284459	exon6			CAAACTGGGGAGA	M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.805G>T	19.37:g.37853502G>T	ENSP00000315505:p.Gly269Trp		66	0	0		46	0.07	3	NM_181786	32	0.00	0	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	ENST00000324411.4	37	CCDS12502.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.264663	0.23136	.	.	ENSG00000181666	ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T	0.22134	1.97;1.97;1.97	2.49	-0.938	0.10412	.	.	.	.	.	T	0.31796	0.0808	L	0.49571	1.57	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.275	D;D;D;B	0.97110	0.999;1.0;0.999;0.041	T	0.22521	-1.0214	9	0.87932	D	0	-2.6739	4.4248	0.11498	0.2201:0.0:0.6025:0.1774	.	208;250;269;251	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	W	250;305;269;208	ENSP00000375994:G250W;ENSP00000315505:G269W;ENSP00000438261:G208W	ENSP00000315505:G269W	G	+	1	0	HKR1	42545342	0.926000	0.31397	0.001000	0.08648	0.131000	0.20780	1.643000	0.37217	-0.125000	0.11703	-0.188000	0.12872	GGG			0.463	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458375.1		NM_181786	
MARK4	57787	mdanderson.org	37	19	45762334	45762334	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr19:45762334G>T	ENST00000262891.4	+	2	470	c.139G>T	c.(139-141)Gcc>Tcc	p.A47S	MARK4_ENST00000300843.4_Missense_Mutation_p.A47S	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	47					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GAACTCCATCGCCTCCTGTCC	0.662																																					p.A47S													.	.			0			c.G139T												41.0	35.0	37.0					19																	45762334		2203	4300	6503	SO:0001583	missense	57787	exon2			TCCATCGCCTCCT	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.139G>T	19.37:g.45762334G>T	ENSP00000262891:p.Ala47Ser		59	0	0		38	0.08	3	NM_001199867	16	0.00	0	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	37	CCDS56097.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254857	0.59212	.	.	ENSG00000007047	ENST00000262893;ENST00000262891;ENST00000300843	T;T	0.70986	-0.52;-0.53	4.75	4.75	0.60458	Protein kinase-like domain (1);	0.074445	0.51477	D	0.000092	T	0.76744	0.4030	L	0.50333	1.59	0.51482	D	0.999926	B;D	0.67145	0.346;0.996	B;D	0.64877	0.068;0.93	T	0.72906	-0.4150	10	0.26408	T	0.33	.	13.1284	0.59368	0.0:0.0:1.0:0.0	.	47;47	Q96L34;Q96L34-2	MARK4_HUMAN;.	S	47	ENSP00000262891:A47S;ENSP00000300843:A47S	ENSP00000262891:A47S	A	+	1	0	MARK4	50454174	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.116000	0.77119	2.476000	0.83614	0.555000	0.69702	GCC			0.662	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457537.1		NM_031417	
ZNF264	9422	mdanderson.org	37	19	57723935	57723935	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr19:57723935G>T	ENST00000263095.6	+	4	1884	c.1470G>T	c.(1468-1470)aaG>aaT	p.K490N	ZNF264_ENST00000536056.1_Missense_Mutation_p.K490N	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		AGTGTGGAAAGGCCTTCACCC	0.532																																					p.K490N													.	.			0			c.G1470T												66.0	66.0	66.0					19																	57723935		2203	4300	6503	SO:0001583	missense	9422	exon4			TGGAAAGGCCTTC	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1470G>T	19.37:g.57723935G>T	ENSP00000263095:p.Lys490Asn		68	0	0		42	0.07	3	NM_003417	2	0.00	0	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	ENST00000263095.6	37	CCDS33127.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.739618	0.49045	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.27890	1.64;1.64	2.26	2.26	0.28386	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.51941	0.1704	M	0.83852	2.665	0.26922	N	0.96666	D	0.89917	1.0	D	0.87578	0.998	T	0.38045	-0.9679	9	0.87932	D	0	.	4.0625	0.09846	0.3125:0.0:0.6875:0.0	.	490	O43296	ZN264_HUMAN	N	490	ENSP00000263095:K490N;ENSP00000440376:K490N	ENSP00000263095:K490N	K	+	3	2	ZNF264	62415747	0.884000	0.30299	0.999000	0.59377	0.837000	0.47467	1.652000	0.37313	1.589000	0.49982	0.491000	0.48974	AAG			0.532	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465080.1			
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			113	0.0707964602	8		121	0.10	12	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
PROM2	150696	mdanderson.org	37	2	95953990	95953990	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:95953990T>C	ENST00000317620.9	+	21	2409	c.2276T>C	c.(2275-2277)cTc>cCc	p.L759P	PROM2_ENST00000403131.2_Missense_Mutation_p.L759P|PROM2_ENST00000317668.4_Missense_Mutation_p.L759P|PROM2_ENST00000542147.1_Missense_Mutation_p.L710P	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	759					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						TGCCAGCCCCTCTCCGGAGCC	0.612																																					p.L759P													.	.			0			c.T2276C												106.0	106.0	106.0					2																	95953990		2203	4300	6503	SO:0001583	missense	150696	exon21			AGCCCCTCTCCGG	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.2276T>C	2.37:g.95953990T>C	ENSP00000318270:p.Leu759Pro		42	0	0		43	0.07	3	NM_001165977	9	0.00	0	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	37	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.629909	0.67015	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.56275	0.47;0.47;0.47;0.47	5.58	5.58	0.84498	.	0.196847	0.35646	N	0.003066	T	0.68165	0.2971	M	0.67953	2.075	0.58432	D	0.999999	D	0.67145	0.996	D	0.66979	0.948	T	0.71781	-0.4489	10	0.87932	D	0	-14.2786	12.1502	0.54046	0.0:0.0:0.0:1.0	.	759	Q8N271	PROM2_HUMAN	P	759;759;759;710	ENSP00000385716:L759P;ENSP00000318520:L759P;ENSP00000318270:L759P;ENSP00000442542:L710P	ENSP00000318270:L759P	L	+	2	0	PROM2	95317717	0.990000	0.36364	0.997000	0.53966	0.704000	0.40688	4.762000	0.62250	2.135000	0.66039	0.533000	0.62120	CTC			0.612	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252771.1		NM_144707	
LOC401010	401010	bcgsc.ca	37	2	132201189	132201189	+	IGR	SNP	G	G	C	rs79072949	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:132201189G>C								AC073869.19 (34567 upstream) : RP11-109E12.1 (18204 downstream)																							GGAGGGCTTCGCTGGGGCCCA	0.572													.|||	1602	0.319888	0.1445	0.4395	5008	,	,		15858	0.6935		0.163	False		,,,				2504	0.2485				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGCTTCGCTGGGG																													2.37:g.132201189G>C			43	0.1395348837	6		27	0.44	12	.	0		0		RNA	SNP		37																																																																																					0	0.572										
ANKRD30BL	554226	broad.mit.edu	37	2	132919225	132919225	+	Silent	SNP	C	C	T	rs9750450		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:132919225C>T	ENST00000409867.1	-	1	303	c.54G>A	c.(52-54)ccG>ccA	p.P18P	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	18										endometrium(1)|kidney(3)	4						TGAAGGGGCTCGGGCGCTCTG	0.642																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			GGGGCTCGGGCGC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.54G>A	2.37:g.132919225C>T			120	0.0083333333	1		128	0.03	4	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.642	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
UBR3	130507	bcgsc.ca;mdanderson.org	37	2	170728847	170728847	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:170728847G>T	ENST00000272793.5	+	2	697	c.647G>T	c.(646-648)tGt>tTt	p.C216F	UBR3_ENST00000418381.1_Missense_Mutation_p.C216F			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	216					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTTATATTTTGTCTTATTCAG	0.284																																					p.C216F													.	UBR3	182		0			c.G647T												107.0	97.0	100.0					2																	170728847		692	1579	2271	SO:0001583	missense	130507	exon2			TATTTTGTCTTAT	AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.647G>T	2.37:g.170728847G>T	ENSP00000272793:p.Cys216Phe		91	0	0		88	0.06	5	NM_172070	5	0.00	0	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	ENST00000272793.5	37		.	.	.	.	.	.	.	.	.	.	G	7.544	0.661277	0.14645	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381	T;T	0.53423	0.62;0.62	5.59	5.59	0.84812	.	.	.	.	.	T	0.27241	0.0668	N	0.14661	0.345	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13656	-1.0501	9	0.10377	T	0.69	.	10.107	0.42539	0.1484:0.0:0.8516:0.0	.	216	Q6ZT12	UBR3_HUMAN	F	216	ENSP00000272793:C216F;ENSP00000396068:C216F	ENSP00000272793:C216F	C	+	2	0	UBR3	170437093	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.696000	0.54757	2.626000	0.88956	0.591000	0.81541	TGT			0.284	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000255290.2		NM_172070	
XRCC5	7520	mdanderson.org	37	2	216990649	216990649	+	Silent	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr2:216990649G>T	ENST00000392133.3	+	9	1154	c.693G>T	c.(691-693)ctG>ctT	p.L231L	XRCC5_ENST00000392132.2_Silent_p.L231L			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	231					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		GTGAGAGTCTGAGAAAACTGT	0.363								Non-homologous end-joining																													p.L231L													.	.			0			c.G693T												89.0	94.0	92.0					2																	216990649		2203	4300	6503	SO:0001819	synonymous_variant	7520	exon7			GAGTCTGAGAAAA	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.693G>T	2.37:g.216990649G>T			57	0	0		43	0.07	3	NM_021141	184	0.00	0	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Silent	SNP	ENST00000392133.3	37	CCDS2402.1																																																																																					0.363	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256675.3		NM_021141	
CHD6	84181	broad.mit.edu;mdanderson.org	37	20	40120435	40120435	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr20:40120435G>T	ENST00000373233.3	-	11	1516	c.1339C>A	c.(1339-1341)Cag>Aag	p.Q447K	CHD6_ENST00000309279.7_Missense_Mutation_p.Q447K	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	447	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TCAAGTTTCTGCCAGGAGTCT	0.458																																					p.Q447K													.	CHD6	312		0			c.C1339A												88.0	90.0	89.0					20																	40120435		2203	4300	6503	SO:0001583	missense	0	exon11			GTTTCTGCCAGGA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.1339C>A	20.37:g.40120435G>T	ENSP00000362330:p.Gln447Lys		53	0	0		72	0.06	4	NM_032221	6	0.00	0	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	37	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	G	7.860	0.725817	0.15439	.	.	ENSG00000124177	ENST00000373233;ENST00000309279	D;D	0.94280	-1.9;-3.39	4.67	4.67	0.58626	.	0.000000	0.52532	D	0.000065	D	0.86322	0.5905	N	0.17872	0.535	0.54753	D	0.999985	B	0.17038	0.02	B	0.11329	0.006	T	0.81256	-0.1015	10	0.02654	T	1	-15.4079	17.9265	0.88985	0.0:0.0:1.0:0.0	.	447	Q8TD26	CHD6_HUMAN	K	447	ENSP00000362330:Q447K;ENSP00000308684:Q447K	ENSP00000308684:Q447K	Q	-	1	0	CHD6	39553849	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.577000	0.74027	2.290000	0.77057	0.561000	0.74099	CAG			0.458	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079270.1			
NPEPL1	79716	hgsc.bcm.edu	37	20	57266755	57266755	+	5'Flank	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr20:57266755T>C	ENST00000356091.6	+	0	0				NPEPL1_ENST00000525967.1_Intron|STX16-NPEPL1_ENST00000530122.1_Intron|NPEPL1_ENST00000525817.1_Intron	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			ttttctttttttttttttttt	0.413																																					.													.	.			0			.																																									SO:0001631	upstream_gene_variant	100534593	.			CTTTTTTTTTTTT	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060		20.37:g.57266755T>C	Exception_encountered		30	0	0		45	0.13	6	.	0		0	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	RNA	SNP	ENST00000356091.6	37	CCDS46621.1																																																																																					0.413	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080402.6		NM_024663	
TEKT4P2	100132288	broad.mit.edu	37	21	9907310	9907310	+	RNA	SNP	G	G	T	rs567470363	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr21:9907310G>T	ENST00000416067.1	-	0	1482					NR_037872.1|NR_038327.1				tektin 4 pseudogene 2																		TGCACTTCTGGCGGTCGATGA	0.577													.|||	3	0.000599042	0.0	0.0	5008	,	,		35995	0.0		0.003	False		,,,				2504	0.0				.													.	.			0			.																																											0	.			CTTCTGGCGGTCG			21p11.2	2012-10-03	2011-06-14	2011-06-14	ENSG00000188681	ENSG00000188681			40046	pseudogene	pseudogene			"""MAFF interacting protein-like"""	MAFIPL			Standard	NR_038327		Approved		uc021wgx.1		OTTHUMG00000172149		21.37:g.9907310G>T			23	0	0		17	0.18	3	.	30	0.03	1		RNA	SNP	ENST00000416067.1	37																																																																																						0.577	TEKT4P2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000417115.1		NM_001033515	
MCM3AP	8888	broad.mit.edu;bcgsc.ca;mdanderson.org	37	21	47695160	47695160	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr21:47695160C>A	ENST00000397708.1	-	7	2192	c.1938G>T	c.(1936-1938)agG>agT	p.R646S	MCM3AP_ENST00000291688.1_Missense_Mutation_p.R646S			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	646	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CCCGCATGTACCTCTCCTTCT	0.567																																					p.R646S													.	MCM3AP	146		0			c.G1938T												101.0	81.0	88.0					21																	47695160		2203	4300	6503	SO:0001583	missense	8888	exon6			CATGTACCTCTCC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1938G>T	21.37:g.47695160C>A	ENSP00000380820:p.Arg646Ser		118	0.0084745763	1		135	0.07	10	NM_003906	39	0.05	2	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	ENST00000397708.1	37	CCDS13734.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.038055	0.75617	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.07567	3.18;3.18	5.73	-1.22	0.09494	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	M	0.92026	3.265	0.58432	D	0.999998	D	0.89917	1.0	D	0.87578	0.998	T	0.04294	-1.0962	10	0.87932	D	0	-29.2558	0.9872	0.01449	0.3802:0.2402:0.1906:0.1889	.	646	O60318	MCM3A_HUMAN	S	646	ENSP00000380820:R646S;ENSP00000291688:R646S	ENSP00000291688:R646S	R	-	3	2	MCM3AP	46519588	0.007000	0.16637	0.978000	0.43139	0.987000	0.75469	-1.042000	0.03539	-0.552000	0.06167	0.655000	0.94253	AGG			0.567	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207254.1		NM_003906	
SSTR3	6753	mdanderson.org	37	22	37602632	37602632	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr22:37602632G>T	ENST00000328544.3	-	2	1744	c.1211C>A	c.(1210-1212)gCt>gAt	p.A404D	SSTR3_ENST00000402501.1_Missense_Mutation_p.A404D	NM_001051.3	NP_001042.1	P32745	SSR3_HUMAN	somatostatin receptor 3	404					cell-cell signaling (GO:0007267)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucocorticoid stimulus (GO:0071385)|cerebellum development (GO:0021549)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hormone-mediated apoptotic signaling pathway (GO:0008628)|negative regulation of cell proliferation (GO:0008285)|response to starvation (GO:0042594)|somatostatin signaling pathway (GO:0038170)|spermatogenesis (GO:0007283)	ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	14					Pasireotide(DB06663)	CCCAGTGGAAGCCTCTTGGGG	0.667																																					p.A404D													.	.			0			c.C1211A												58.0	60.0	59.0					22																	37602632		2203	4300	6503	SO:0001583	missense	6753	exon2			GTGGAAGCCTCTT		CCDS13944.1	22q13.1	2012-08-08			ENSG00000183473	ENSG00000278195		"""GPCR / Class A : Somatostatin receptors"""	11332	protein-coding gene	gene with protein product		182453				8449518	Standard	XM_006724311		Approved		uc003arb.3	P32745	OTTHUMG00000150537	ENST00000328544.3:c.1211C>A	22.37:g.37602632G>T	ENSP00000330138:p.Ala404Asp		25	0	0		31	0.10	3	NM_001051	0		0	A8K550|Q53ZR7	Missense_Mutation	SNP	ENST00000328544.3	37	CCDS13944.1	.	.	.	.	.	.	.	.	.	.	G	7.375	0.627563	0.14257	.	.	ENSG00000183473	ENST00000328544;ENST00000402501	T;T	0.72942	-0.7;-0.7	5.48	4.26	0.50523	.	2.167080	0.01889	N	0.038408	T	0.66218	0.2767	L	0.36672	1.1	0.30055	N	0.811429	B	0.19817	0.039	B	0.14023	0.01	T	0.51403	-0.8710	10	0.44086	T	0.13	.	11.6437	0.51249	0.1529:0.0:0.8471:0.0	.	404	P32745	SSR3_HUMAN	D	404	ENSP00000330138:A404D;ENSP00000384904:A404D	ENSP00000330138:A404D	A	-	2	0	SSTR3	35932578	0.999000	0.42202	0.530000	0.27963	0.116000	0.19942	3.228000	0.51270	2.572000	0.86782	0.491000	0.48974	GCT			0.667	SSTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318802.1			
MAPK8IP2	23542	broad.mit.edu;mdanderson.org	37	22	51045123	51045123	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr22:51045123C>A	ENST00000399908.2	+	7	2080	c.1364C>A	c.(1363-1365)cCt>cAt	p.P455H	MAPK8IP2_ENST00000442429.2_Missense_Mutation_p.P443H|MAPK8IP2_ENST00000008876.5_Missense_Mutation_p.P426H|MAPK8IP2_ENST00000341339.4_Missense_Mutation_p.P341H|MAPK8IP2_ENST00000329492.3_Missense_Mutation_p.P720H|MAPK8IP2_ENST00000399912.1_Missense_Mutation_p.P455H	NM_016431.3	NP_057515.1	Q13387	JIP2_HUMAN	mitogen-activated protein kinase 8 interacting protein 2	721	Necessary for interaction with FGF13.				behavioral fear response (GO:0001662)|dendrite morphogenesis (GO:0048813)|MAPK cascade (GO:0000165)|nonassociative learning (GO:0046958)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of signal transduction (GO:0009967)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of JNK cascade (GO:0046328)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of receptor activity (GO:0010469)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal complex assembly (GO:0007172)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|neuronal postsynaptic density (GO:0097481)	beta-amyloid binding (GO:0001540)|kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	7		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		OV - Ovarian serous cystadenocarcinoma(4;1.28e-70)|Epithelial(4;3.46e-65)|GBM - Glioblastoma multiforme(4;4.83e-06)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CACCTGCGCCCTCCTGCCTCC	0.627																																					.													.	MAPK8IP2	78		0			.												26.0	29.0	28.0					22																	51045123		2000	4169	6169	SO:0001583	missense	23542	.			TGCGCCCTCCTGC	AL021708	CCDS74886.1	22q13.33	2010-04-06			ENSG00000008735	ENSG00000008735			6883	protein-coding gene	gene with protein product	"""islet-brain 2"", ""JNK-interacting protein 2"""	607755	"""PRKM8 interacting protein-like"""	PRKM8IPL		10490659	Standard	NM_012324		Approved	IB2, JIP2	uc003bmy.3	Q13387	OTTHUMG00000150181	ENST00000399908.2:c.1364C>A	22.37:g.51045123C>A	ENSP00000382792:p.Pro455His		70	0	0		52	0.08	4	.	1	1.00	1	Q96G62|Q99771|Q9NZ59|Q9UKQ4	Missense_Mutation	SNP	ENST00000399908.2	37		.	.	.	.	.	.	.	.	.	.	C	25.0	4.591052	0.86851	.	.	ENSG00000008735	ENST00000399912;ENST00000329492;ENST00000442429;ENST00000341339;ENST00000399908;ENST00000008876	T;T;T;T;T;T	0.20069	2.48;2.48;2.48;2.48;2.48;2.1	4.69	4.69	0.59074	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.47967	0.1474	.	.	.	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.52442	-0.8575	9	0.87932	D	0	-6.1339	15.1613	0.72788	0.0:1.0:0.0:0.0	.	693;721	E7EQG6;Q13387	.;JIP2_HUMAN	H	455;720;443;341;455;426	ENSP00000382796:P455H;ENSP00000330572:P720H;ENSP00000404914:P443H;ENSP00000340015:P341H;ENSP00000382792:P455H;ENSP00000008876:P426H	ENSP00000008876:P426H	P	+	2	0	MAPK8IP2	49391989	0.999000	0.42202	1.000000	0.80357	0.902000	0.53008	4.565000	0.60836	2.434000	0.82447	0.561000	0.74099	CCT			0.627	MAPK8IP2-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000316731.2		NM_012324	
LAMB2	3913	mdanderson.org	37	3	49161062	49161062	+	Missense_Mutation	SNP	C	C	T	rs141988617		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr3:49161062C>T	ENST00000418109.1	-	26	3964	c.3800G>A	c.(3799-3801)cGt>cAt	p.R1267H	USP19_ENST00000434032.2_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.R1267H|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000417901.1_5'Flank|USP19_ENST00000398892.3_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000398888.2_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1267	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCCAATTTCACGCCTGCAATG	0.567																																					p.R1267H													.	.			0			c.G3800A							C	HIS/ARG	0,4406		0,0,2203	99.0	97.0	98.0		3800	1.3	1.0	3	dbSNP_134	98	2,8598	2.2+/-6.3	0,2,4298	no	missense	LAMB2	NM_002292.3	29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign	1267/1799	49161062	2,13004	2203	4300	6503	SO:0001583	missense	3913	exon25			ATTTCACGCCTGC		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3800G>A	3.37:g.49161062C>T	ENSP00000388325:p.Arg1267His		91	0	0		47	0.06	3	NM_002292	134	0.00	0	Q16321	Missense_Mutation	SNP	ENST00000418109.1	37	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	C	6.946	0.544301	0.13312	0.0	2.33E-4	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	T;T	0.35236	1.32;1.32	5.69	1.32	0.21799	.	0.746815	0.13265	N	0.400967	T	0.14527	0.0351	N	0.02011	-0.69	0.23483	N	0.997586	B	0.02656	0.0	B	0.01281	0.0	T	0.23655	-1.0182	10	0.38643	T	0.18	.	10.0479	0.42197	0.0:0.5494:0.0:0.4506	.	1267	P55268	LAMB2_HUMAN	H	1267;1267;34	ENSP00000388325:R1267H;ENSP00000307156:R1267H	ENSP00000307156:R1267H	R	-	2	0	LAMB2	49136066	0.009000	0.17119	1.000000	0.80357	0.455000	0.32408	-0.844000	0.04345	0.328000	0.23435	0.561000	0.74099	CGT	0		0.567	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345939.1		NM_002292	
GSX2	170825	mdanderson.org	37	4	54966519	54966519	+	Missense_Mutation	SNP	G	G	T	rs377377329		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr4:54966519G>T	ENST00000326902.2	+	1	322	c.8G>T	c.(7-9)cGc>cTc	p.R3L	GSX2_ENST00000503800.1_Missense_Mutation_p.R3L|FIP1L1_ENST00000507166.1_Intron	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	3					forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			GACATGTCGCGCTCCTTCTAT	0.652																																					p.R3L													.	.			0			c.G8T							G	LEU/ARG	0,4406		0,0,2203	52.0	39.0	43.0		8	4.7	1.0	4		43	1,8599	1.2+/-3.3	0,1,4299	no	missense	GSX2	NM_133267.2	102	0,1,6502	TT,TG,GG		0.0116,0.0,0.0077	possibly-damaging	3/305	54966519	1,13005	2203	4300	6503	SO:0001583	missense	170825	exon1			TGTCGCGCTCCTT		CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.8G>T	4.37:g.54966519G>T	ENSP00000319118:p.Arg3Leu		33	0	0		50	0.06	3	NM_133267	0		0		Missense_Mutation	SNP	ENST00000326902.2	37	CCDS3494.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.068620	0.76301	0.0	1.16E-4	ENSG00000180613	ENST00000326902;ENST00000503800	T;T	0.78816	-1.21;-1.21	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.88537	0.6463	M	0.79926	2.475	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	D	0.90293	0.4324	10	0.87932	D	0	.	17.811	0.88616	0.0:0.0:1.0:0.0	.	3	Q9BZM3	GSX2_HUMAN	L	3	ENSP00000319118:R3L;ENSP00000422213:R3L	ENSP00000319118:R3L	R	+	2	0	GSX2	54661276	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.113000	0.94321	2.436000	0.82500	0.491000	0.48974	CGC			0.652	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250595.1		NM_133267	
PABPC4L	132430	mdanderson.org	37	4	135122332	135122332	+	5'UTR	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr4:135122332T>C	ENST00000421491.3	-	0	99				PABPC4L_ENST00000529122.2_Missense_Mutation_p.E6G			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like								nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						CTCCCCCAGCTCAGGCAACAC	0.552																																					p.E6G													.	.			0			c.A17G																																									SO:0001623	5_prime_UTR_variant	132430	exon2			CCCAGCTCAGGCA	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.-158A>G	4.37:g.135122332T>C			75	0	0		42	0.07	3	NM_001114734	4	0.00	0		Missense_Mutation	SNP	ENST00000421491.3	37																																																																																						0.552	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000364399.2		NM_001114734	
CASP3	836	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	185550512	185550512	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr4:185550512A>G	ENST00000308394.4	-	8	1010	c.748T>C	c.(748-750)Ttt>Ctt	p.F250L	CASP3_ENST00000523916.1_Missense_Mutation_p.F250L|CASP3_ENST00000517513.1_3'UTR|CASP3_ENST00000393585.2_3'UTR	NM_004346.3	NP_004337.2	P42574	CASP3_HUMAN	caspase 3, apoptosis-related cysteine peptidase	250					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell homeostasis (GO:0001782)|cell fate commitment (GO:0045165)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte differentiation (GO:0030218)|execution phase of apoptosis (GO:0097194)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|heart development (GO:0007507)|hippo signaling (GO:0035329)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|keratinocyte differentiation (GO:0030216)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|proteolysis (GO:0006508)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|release of cytochrome c from mitochondria (GO:0001836)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in execution phase of apoptosis (GO:0097200)|peptidase activity (GO:0008233)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	12		all_lung(41;7.57e-14)|Lung NSC(41;1.81e-13)|Colorectal(36;0.00139)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.0235)|all_neural(102;0.057)|all_hematologic(60;0.0592)		all cancers(43;2.05e-27)|Epithelial(43;4.27e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.04e-11)|Colorectal(24;2e-05)|STAD - Stomach adenocarcinoma(60;2.35e-05)|GBM - Glioblastoma multiforme(59;4.94e-05)|COAD - Colon adenocarcinoma(29;0.00017)|BRCA - Breast invasive adenocarcinoma(30;0.000218)|LUSC - Lung squamous cell carcinoma(40;0.00904)|READ - Rectum adenocarcinoma(43;0.161)	Minocycline(DB01017)	TCAAAGGAAAAGGACTCAAAT	0.398																																					p.F250L													.	CASP3	27		0			c.T748C												132.0	133.0	133.0					4																	185550512		2203	4300	6503	SO:0001583	missense	836	exon8			AGGAAAAGGACTC	BC016926	CCDS3836.1	4q34	2008-02-05	2005-08-17		ENSG00000164305	ENSG00000164305		"""Caspases"""	1504	protein-coding gene	gene with protein product		600636	"""caspase 3, apoptosis-related cysteine protease"""			8780721	Standard	NM_004346		Approved	CPP32, CPP32B, Yama, apopain	uc003iwi.3	P42574	OTTHUMG00000133681	ENST00000308394.4:c.748T>C	4.37:g.185550512A>G	ENSP00000311032:p.Phe250Leu		102	0	0		59	0.07	4	NM_004346	65	0.00	0	A8K5M2|D3DP53|Q96AN1|Q96KP2	Missense_Mutation	SNP	ENST00000308394.4	37	CCDS3836.1	.	.	.	.	.	.	.	.	.	.	A	7.658	0.684405	0.14907	.	.	ENSG00000164305	ENST00000308394;ENST00000523916	T;T	0.39406	1.08;1.08	5.69	5.69	0.88448	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	0.514908	0.23030	N	0.052757	T	0.40979	0.1139	M	0.64260	1.97	0.18873	N	0.999985	B	0.11235	0.004	B	0.15870	0.014	T	0.33727	-0.9857	10	0.11485	T	0.65	.	15.9626	0.79941	1.0:0.0:0.0:0.0	.	250	P42574	CASP3_HUMAN	L	250	ENSP00000311032:F250L;ENSP00000428929:F250L	ENSP00000311032:F250L	F	-	1	0	CASP3	185787506	0.011000	0.17503	0.825000	0.32803	0.676000	0.39594	2.087000	0.41653	2.165000	0.68154	0.528000	0.53228	TTT			0.398	CASP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257885.2		NM_004346	
PDGFRB	5159	mdanderson.org	37	5	149512314	149512314	+	Splice_Site	SNP	G	G	T	rs142621427		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr5:149512314G>T	ENST00000261799.4	-	7	1595	c.1126C>A	c.(1126-1128)Cgg>Agg	p.R376R		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	376	Ig-like C2-type 4.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTGCTCACCGGGTCTCCGAC	0.602			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.R376R				Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	.			0			c.C1126A												29.0	28.0	28.0					5																	149512314		2203	4300	6503	SO:0001630	splice_region_variant	5159	exon7			CTCACCGGGTCTC	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1127+1C>A	5.37:g.149512314G>T			56	0	0		48	0.06	3	NM_002609	71	0.00	0	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	37	CCDS4303.1																																																																																					0.602	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252332.1		NM_002609	Silent
HMMR	3161	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	162901165	162901165	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr5:162901165T>C	ENST00000358715.3	+	10	1040	c.1004T>C	c.(1003-1005)cTt>cCt	p.L335P	HMMR_ENST00000393915.4_Missense_Mutation_p.L336P|HMMR_ENST00000353866.3_Missense_Mutation_p.L320P|HMMR_ENST00000432118.2_Missense_Mutation_p.L249P			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	335					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	CGTGAAAAGCTTCAACAAAAA	0.318																																					p.L336P													.	.			0			c.T1007C												77.0	77.0	77.0					5																	162901165		2203	4299	6502	SO:0001583	missense	3161	exon10			AAAAGCTTCAACA	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1004T>C	5.37:g.162901165T>C	ENSP00000351554:p.Leu335Pro		298	0	0		241	0.06	15	NM_001142556	10	0.20	2	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	37	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	T	15.32	2.797360	0.50208	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000434157;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000001	T	0.32376	0.0827	M	0.72894	2.215	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.02208	-1.1195	10	0.72032	D	0.01	-7.1266	13.7757	0.63053	0.0:0.0:0.0:1.0	.	249;336;320;335	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	P	221;320;320;336;312;249;335	ENSP00000400527:L221P;ENSP00000185942:L320P;ENSP00000377492:L336P;ENSP00000402673:L249P;ENSP00000351554:L335P	ENSP00000185942:L320P	L	+	2	0	HMMR	162833743	0.483000	0.25956	0.497000	0.27552	0.374000	0.29953	4.610000	0.61155	2.326000	0.78906	0.533000	0.62120	CTT			0.318	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000252752.1		NM_012484	
CUL9	23113	mdanderson.org	37	6	43182824	43182824	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr6:43182824A>G	ENST00000252050.4	+	30	5780	c.5696A>G	c.(5695-5697)gAg>gGg	p.E1899G	RP3-330M21.5_ENST00000500590.1_RNA|CUL9_ENST00000372647.2_Missense_Mutation_p.E1871G|CUL9_ENST00000354495.3_Missense_Mutation_p.E1789G	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	1899					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CAGGTGCTGGAGGCCTGGCAG	0.562																																					p.E1899G													.	.			0			c.A5696G												81.0	85.0	83.0					6																	43182824		2203	4300	6503	SO:0001583	missense	23113	exon30			TGCTGGAGGCCTG	AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.5696A>G	6.37:g.43182824A>G	ENSP00000252050:p.Glu1899Gly		30	0	0		32	0.13	4	NM_015089	13	0.00	0	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	ENST00000252050.4	37	CCDS4890.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.609408	0.87258	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.76968	-1.05;-1.06;-0.96	5.33	5.33	0.75918	Cullin protein, neddylation domain (1);	0.385654	0.31041	N	0.008366	T	0.81997	0.4941	M	0.63843	1.955	0.48696	D	0.999695	D;D;D	0.67145	0.993;0.996;0.996	D;P;P	0.63033	0.91;0.874;0.874	D	0.84935	0.0862	10	0.87932	D	0	-24.9636	15.3157	0.74074	1.0:0.0:0.0:0.0	.	1789;1871;1899	Q8IWT3-3;E9PEZ1;Q8IWT3	.;.;CUL9_HUMAN	G	1899;1789;1871	ENSP00000252050:E1899G;ENSP00000346490:E1789G;ENSP00000361730:E1871G	ENSP00000252050:E1899G	E	+	2	0	CUL9	43290802	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.398000	0.66308	2.017000	0.59298	0.533000	0.62120	GAG			0.562	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040582.2		NM_015089	
RBAK-RBAKDN	100533952	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	7	5024702	5024702	+	5'UTR	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:5024702G>A	ENST00000407184.1	+	0	218									RBAK-RBAKDN readthrough																		GCAATCACCCGAAAGGTACTC	0.493																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	441191	.			TCACCCGAAAGGT		CCDS56463.1	7p22.1	2013-05-20				ENSG00000272968			42971	other	readthrough							Standard	NM_001204513		Approved				OTTHUMG00000186010	ENST00000407184.1:c.-49G>A	7.37:g.5024702G>A			83	0	0		87	0.16	14	.	16	0.06	1		RNA	SNP	ENST00000407184.1	37																																																																																						0.493	RBAK-RBAKDN-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding		OTTHUMT00000472007.1			
SP8	221833	broad.mit.edu;mdanderson.org	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S													.	SP8	43		0			c.G466A																																									SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	7.37:g.20824970C>T	ENSP00000354482:p.Gly138Ser		37	0	0		39	0.08	3	NM_182700	0		0	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	37	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC			0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326904.2			
SP4	6671	broad.mit.edu;mdanderson.org	37	7	21468306	21468306	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:21468306G>A	ENST00000222584.3	+	2	237	c.19G>A	c.(19-21)Gag>Aag	p.E7K		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	7	Poly-Glu.				regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						TCAGAAGAAGGAGGAGGAGGA	0.512																																					p.E7K													SP4,colon,carcinoma,0,1	SP4	91	1	0			c.G19A												20.0	20.0	20.0					7																	21468306		2171	4251	6422	SO:0001583	missense	6671	exon2			AAGAAGGAGGAGG		CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.19G>A	7.37:g.21468306G>A	ENSP00000222584:p.Glu7Lys		47	0	0		50	0.06	3	NM_003112	1	0.00	0	O60402|Q32M52	Missense_Mutation	SNP	ENST00000222584.3	37	CCDS5373.1	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318989	0.41096	.	.	ENSG00000105866	ENST00000222584;ENST00000446800	T	0.09911	2.93	4.5	4.5	0.54988	.	0.061123	0.64402	N	0.000005	T	0.10937	0.0267	L	0.36672	1.1	0.44142	D	0.996934	P	0.34587	0.458	B	0.39152	0.292	T	0.20907	-1.0261	10	0.23891	T	0.37	.	12.5742	0.56355	0.0:0.0:1.0:0.0	.	7	Q02446	SP4_HUMAN	K	7	ENSP00000222584:E7K	ENSP00000222584:E7K	E	+	1	0	SP4	21434831	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.555000	0.73928	2.345000	0.79718	0.563000	0.77884	GAG			0.512	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211617.2		NM_003112	
MTERF1	7978	mdanderson.org	37	7	91503479	91503479	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:91503479A>G	ENST00000351870.3	-	3	722	c.629T>C	c.(628-630)cTg>cCg	p.L210P	MTERF_ENST00000419292.1_Missense_Mutation_p.L190P|MTERF_ENST00000481516.1_5'Flank|MTERF_ENST00000406735.2_Missense_Mutation_p.L190P	NM_006980.3	NP_008911.1	Q99551	MTEF1_HUMAN		210					DNA geometric change (GO:0032392)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of mitochondrial transcription (GO:0006393)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|skin(1)	14	all_cancers(62;2.28e-09)|all_epithelial(64;1.07e-07)|Breast(17;0.00371)|all_hematologic(106;0.091)|all_lung(186;0.178)|Lung NSC(181;0.235)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.0993)|Kidney(17;0.118)|Epithelial(20;0.136)|LUSC - Lung squamous cell carcinoma(200;0.176)			CTGTTTATTCAGATCAAGACT	0.393																																					p.L210P													.	.			0			c.T629C												57.0	58.0	58.0					7																	91503479		2203	4300	6503	SO:0001583	missense	7978	exon3			TTATTCAGATCAA																												ENST00000351870.3:c.629T>C	7.37:g.91503479A>G	ENSP00000248643:p.Leu210Pro		61	0	0		81	0.05	4	NM_006980	13	0.00	0	A4D1E3|Q32NF8|Q53H51|Q9BVR7	Missense_Mutation	SNP	ENST00000351870.3	37	CCDS5621.1	.	.	.	.	.	.	.	.	.	.	A	17.86	3.491674	0.64074	.	.	ENSG00000127989	ENST00000419292;ENST00000351870;ENST00000406735	T;T;T	0.19532	2.16;2.14;2.16	4.88	4.88	0.63580	.	0.000000	0.64402	D	0.000010	T	0.43344	0.1243	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.20874	-1.0262	10	0.34782	T	0.22	-4.7784	14.1498	0.65375	1.0:0.0:0.0:0.0	.	210	Q99551	MTERF_HUMAN	P	190;210;190	ENSP00000414116:L190P;ENSP00000248643:L210P;ENSP00000384986:L190P	ENSP00000248643:L210P	L	-	2	0	MTERF	91341415	1.000000	0.71417	0.968000	0.41197	0.739000	0.42172	6.250000	0.72435	2.139000	0.66308	0.477000	0.44152	CTG			0.393	MTERF-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000342896.1			
MUC17	140453	mdanderson.org	37	7	100685848	100685848	+	Silent	SNP	T	T	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:100685848T>A	ENST00000306151.4	+	3	11215	c.11151T>A	c.(11149-11151)ccT>ccA	p.P3717P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3717	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTTCAACACCTTCTGTTGTCA	0.502																																					p.P3717P													MUC17,NS,carcinoma,+2,1	MUC17	2	1	0			c.T11151A												224.0	204.0	211.0					7																	100685848		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			AACACCTTCTGTT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.11151T>A	7.37:g.100685848T>A			45	0	0		42	0.07	3	NM_001040105	133	0.00	0	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	37	CCDS34711.1																																																																																					0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347161.1		NM_001040105	
PRRT4	401399	mdanderson.org	37	7	127992594	127992594	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:127992594G>T	ENST00000446477.2	-	6	1329	c.1016C>A	c.(1015-1017)gCg>gAg	p.A339E	PRRT4_ENST00000535159.1_Missense_Mutation_p.A339E|PRRT4_ENST00000435512.1_Missense_Mutation_p.A339E|PRRT4_ENST00000489835.2_Missense_Mutation_p.A339E	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	339						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						GGGCCTCGGCGCCTCGGGAGG	0.721																																					p.A339E													PRRT4,NS,carcinoma,+1,1	PRRT4	1	1	0			c.C1016A												45.0	55.0	52.0					7																	127992594		692	1591	2283	SO:0001583	missense	401399	exon6			CTCGGCGCCTCGG	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.1016C>A	7.37:g.127992594G>T	ENSP00000415026:p.Ala339Glu		13	0	0		17	0.12	2	NM_001174164	1	0.00	0	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	37	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217547	0.58560	.	.	ENSG00000224940	ENST00000489835;ENST00000446477;ENST00000535159;ENST00000435512;ENST00000489517	.	.	.	4.1	4.1	0.47936	.	.	.	.	.	T	0.28764	0.0713	N	0.08118	0	0.30189	N	0.799676	D	0.55800	0.973	P	0.50231	0.635	T	0.15435	-1.0437	8	0.87932	D	0	-18.3674	12.0831	0.53682	0.0:0.0:1.0:0.0	.	339	C9JH25	PRRT4_HUMAN	E	339	.	ENSP00000410779:A339E	A	-	2	0	PRRT4	127779830	0.988000	0.35896	0.062000	0.19696	0.041000	0.13682	2.595000	0.46197	2.306000	0.77630	0.505000	0.49811	GCG			0.721	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001114726	
HIPK2	28996	mdanderson.org	37	7	139257993	139257993	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr7:139257993C>T	ENST00000406875.3	-	15	3371	c.3277G>A	c.(3277-3279)Gct>Act	p.A1093T	HIPK2_ENST00000428878.2_Missense_Mutation_p.A1066T	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	1093	Autoinhibitory domain (AID).|Poly-Ala.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					AGGTGGGCAGCGGCAGCGGCT	0.711																																					p.A1093T													.	.			0			c.G3277A												27.0	39.0	35.0					7																	139257993		2076	4194	6270	SO:0001583	missense	28996	exon15			GGGCAGCGGCAGC	AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.3277G>A	7.37:g.139257993C>T	ENSP00000385571:p.Ala1093Thr		15	0	0		16	0.13	2	NM_022740	0		0	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	ENST00000406875.3	37		.	.	.	.	.	.	.	.	.	.	C	10.56	1.384353	0.25031	.	.	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.53206	0.63;0.64	3.55	3.55	0.40652	.	.	.	.	.	T	0.34803	0.0910	.	.	.	0.43394	D	0.995516	B;B	0.18310	0.027;0.025	B;B	0.13407	0.004;0.009	T	0.12451	-1.0547	8	0.23302	T	0.38	.	13.6739	0.62443	0.0:1.0:0.0:0.0	.	1093;1066	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	T	1093;1066	ENSP00000385571:A1093T;ENSP00000413724:A1066T	ENSP00000385571:A1093T	A	-	1	0	HIPK2	138908533	0.999000	0.42202	0.778000	0.31720	0.771000	0.43674	4.166000	0.58203	1.707000	0.51288	0.591000	0.81541	GCT			0.711	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000349430.3		NM_022740	
XKR5	389610	broad.mit.edu;bcgsc.ca;mdanderson.org	37	8	6679483	6679483	+	RNA	SNP	G	G	T			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr8:6679483G>T	ENST00000518724.1	-	0	865							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		AGGTTGAACAGCCTCCAGTGG	0.577																																					p.L239M													.	XKR5	20		0			c.C715A												37.0	42.0	40.0					8																	6679483		2075	4215	6290			389610	exon5			TGAACAGCCTCCA	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6679483G>T			59	0	0		60	0.08	5	NM_207411	0		0	Q5GH74	RNA	SNP	ENST00000518724.1	37																																																																																						0.577	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000331969.2		NM_207411	
TNKS	8658	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	8	9623905	9623905	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr8:9623905delA	ENST00000310430.6	+	25	3736	c.3710delA	c.(3709-3711)cacfs	p.H1237fs	TNKS_ENST00000518281.1_Frame_Shift_Del_p.H1000fs	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	1237	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		TGCCCTACACACAAGGACAGG	0.418																																					p.H1237fs													.	TNKS	198		0			c.3709delC												107.0	94.0	98.0					8																	9623905		2203	4300	6503	SO:0001589	frameshift_variant	8658	exon25			CTACACACAAGGA	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.3710delA	8.37:g.9623905delA	ENSP00000311579:p.His1237fs		101	0	0		73	0.16	12	NM_003747	5	0.00	0	O95272|Q4G0F2	Frame_Shift_Del	DEL	ENST00000310430.6	37	CCDS5974.1																																																																																					0.418	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206935.1		NM_003747	
SPIDR	23514	ucsc.edu	37	8	48508458	48508458	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr8:48508458G>A	ENST00000297423.4	+	9	1567	c.1183G>A	c.(1183-1185)Gaa>Aaa	p.E395K	SPIDR_ENST00000518074.1_Missense_Mutation_p.E335K|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.E325K	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	395	Necessary for interaction with RAD51.				cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGAAGATTCAGAAAAAACTTG	0.383																																					p.E395K													.	KIAA0146	64		0			c.G1183A												99.0	92.0	94.0					8																	48508458		1822	4087	5909	SO:0001583	missense	0	exon9			GATTCAGAAAAAA	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1183G>A	8.37:g.48508458G>A	ENSP00000297423:p.Glu395Lys		108	0.0092592593	1		147	0.01	1	NM_001080394	38	0.26	10	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	37	CCDS43737.1	.	.	.	.	.	.	.	.	.	.	G	1.602	-0.526182	0.04141	.	.	ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000524006	.	.	.	5.3	-1.8	0.07907	.	1.562700	0.03548	N	0.225029	T	0.24005	0.0581	N	0.11106	0.095	0.09310	N	1	B;B;B;B	0.06786	0.001;0.001;0.001;0.001	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.15925	-1.0420	9	0.27082	T	0.32	.	7.942	0.29963	0.4484:0.112:0.4396:0.0	.	335;325;395;395	B4E0Y6;B4DFV2;B4DEV5;Q14159	.;.;.;K0146_HUMAN	K	395;335;325;84	.	ENSP00000297423:E395K	E	+	1	0	KIAA0146	48671011	1.000000	0.71417	0.001000	0.08648	0.121000	0.20230	1.537000	0.36083	-0.575000	0.05982	-0.797000	0.03246	GAA			0.383	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000377611.1		NM_001080394	
ESRP1	54845	ucsc.edu	37	8	95686610	95686610	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr8:95686610T>A	ENST00000433389.2	+	12	1717	c.1527T>A	c.(1525-1527)caT>caA	p.H509Q	ESRP1_ENST00000358397.5_Missense_Mutation_p.H509Q|ESRP1_ENST00000423620.2_Missense_Mutation_p.H509Q|ESRP1_ENST00000454170.2_Missense_Mutation_p.H509Q	NM_001034915.2|NM_017697.3	NP_001030087.2|NP_060167.2	Q6NXG1	ESRP1_HUMAN	epithelial splicing regulatory protein 1	509	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)	p.N512fs*8(2)	ESRP1/RAF1(4)	NS(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(2)	20						AGAAGTGTCATAAAAAAAACA	0.433																																					p.H509Q													.	ESRP1	148		2	Insertion - Frameshift(2)	large_intestine(2)	c.T1527A												86.0	88.0	87.0					8																	95686610		1885	4113	5998	SO:0001583	missense	54845	exon12			GTGTCATAAAAAA	AK000178	CCDS47895.1, CCDS47896.1, CCDS47897.1, CCDS47898.1	8q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000104413	ENSG00000104413		"""RNA binding motif (RRM) containing"""	25966	protein-coding gene	gene with protein product		612959	"""RNA binding motif protein 35A"""	RBM35A		12477932	Standard	NM_017697		Approved	FLJ20171	uc003ygq.4	Q6NXG1	OTTHUMG00000164587	ENST00000433389.2:c.1527T>A	8.37:g.95686610T>A	ENSP00000405738:p.His509Gln		128	0.015625	2		140	0.01	1	NM_001122827	40	0.13	5	A6NHA8|A8MPX1|E9PB47|Q2M2B0|Q499G3|Q6PJ86|Q9NXL8	Missense_Mutation	SNP	ENST00000433389.2	37	CCDS47897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.71|19.71	3.877501|3.877501	0.72294|0.72294	.|.	.|.	ENSG00000104413|ENSG00000104413	ENST00000423620;ENST00000433389;ENST00000358397;ENST00000454170;ENST00000517610|ENST00000519505	T;T;T;T;T|.	0.30981|.	1.51;1.51;1.51;3.36;1.51|.	5.54|5.54	5.54|5.54	0.83059|0.83059	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.73931|.	0.3650|.	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;0.999;0.999;1.0|.	T|.	0.75808|.	-0.3187|.	10|.	0.87932|.	D|.	0|.	-20.4582|-20.4582	10.3538|10.3538	0.43952|0.43952	0.0:0.0733:0.0:0.9267|0.0:0.0733:0.0:0.9267	.|.	509;509;509;509;509;509|.	D7PBN3;Q6NXG1-4;Q6NXG1-2;E9PB47;Q6NXG1-3;Q6NXG1|.	.;.;.;.;.;ESRP1_HUMAN|.	Q|K	509;509;509;509;368|375	ENSP00000407349:H509Q;ENSP00000405738:H509Q;ENSP00000351168:H509Q;ENSP00000402766:H509Q;ENSP00000429125:H368Q|.	ENSP00000351168:H509Q|.	H|X	+|+	3|1	2|0	ESRP1|ESRP1	95755786|95755786	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.225000|2.225000	0.42954|0.42954	2.228000|2.228000	0.72767|0.72767	0.533000|0.533000	0.62120|0.62120	CAT|TAA			0.433	ESRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379326.1		NM_017697	
NFIB	4781	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	14116325	14116325	+	Intron	SNP	T	T	A			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr9:14116325T>A	ENST00000380959.3	-	8	1719				NFIB_ENST00000380934.4_Intron|NFIB_ENST00000380924.1_Intron|NFIB_ENST00000543693.1_Silent_p.V170V|NFIB_ENST00000397579.2_Intron|NFIB_ENST00000380953.1_Silent_p.V422V|NFIB_ENST00000397581.2_Silent_p.V422V|NFIB_ENST00000397575.3_Silent_p.V422V	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		CTTTCCCTACTACTTGACCAC	0.512			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.V422V	Esophageal Squamous(132;921 1730 14828 40753 46471)			Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	NFIB	91		0			c.A1266T																																									SO:0001627	intron_variant	4781	exon9			CCCTACTACTTGA	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.1245+4113A>T	9.37:g.14116325T>A			74	0.0135135135	1		46	0.30	14	NM_001190737	2	0.50	1	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Silent	SNP	ENST00000380959.3	37	CCDS6474.1																																																																																					0.512	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000055468.1		NM_005596	
PRSS3	5646	broad.mit.edu	37	9	33794809	33794809	+	Intron	SNP	G	G	A	rs201061108		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr9:33794809G>A	ENST00000361005.5	+	2	211				PRSS3_ENST00000342836.4_Missense_Mutation_p.S7N|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_5'Flank|PRSS3_ENST00000429677.3_Intron	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AGAGAGACAAGTGGCTTCACA	0.502																																					p.S7N													.	PRSS3	79		0			c.G20A																																									SO:0001627	intron_variant	5646	exon2			AGACAAGTGGCTT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1832G>A	9.37:g.33794809G>A			74	0.027027027	2		48	0.19	9	NM_001197097	1	0.00	0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.932356	0.00488	.	.	ENSG00000010438	ENST00000457896;ENST00000342836	D;D	0.88741	-2.29;-2.42	1.75	-2.5	0.06384	.	.	.	.	.	T	0.69260	0.3091	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59096	-0.7518	9	0.02654	T	1	.	5.9988	0.19509	0.4674:0.0:0.5326:0.0	.	7	P35030-4	.	N	5;7	ENSP00000401249:S5N;ENSP00000340889:S7N	ENSP00000340889:S7N	S	+	2	0	PRSS3	33784809	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-1.129000	0.03244	-0.673000	0.05259	-1.096000	0.02151	AGT			0.502	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1		NM_002771	
PRSS3	5646	broad.mit.edu	37	9	33794812	33794812	+	Intron	SNP	G	G	T	rs199873220		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr9:33794812G>T	ENST00000361005.5	+	2	211				PRSS3_ENST00000342836.4_Missense_Mutation_p.G8V|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000379405.3_5'Flank|PRSS3_ENST00000429677.3_Intron	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GAGACAAGTGGCTTCACATTG	0.498																																					p.G8V													.	PRSS3	79		0			c.G23T																																									SO:0001627	intron_variant	5646	exon2			CAAGTGGCTTCAC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1829G>T	9.37:g.33794812G>T			80	0.025	2		50	0.18	9	NM_001197097	1	0.00	0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	G	0.033	-1.320550	0.01320	.	.	ENSG00000010438	ENST00000457896;ENST00000342836	D;D	0.88509	-2.3;-2.39	2.24	-2.08	0.07254	.	.	.	.	.	T	0.72028	0.3410	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56986	-0.7888	9	0.30854	T	0.27	.	3.8571	0.08981	0.0:0.1534:0.4698:0.3769	.	8	P35030-4	.	V	6;8	ENSP00000401249:G6V;ENSP00000340889:G8V	ENSP00000340889:G8V	G	+	2	0	PRSS3	33784812	0.000000	0.05858	0.000000	0.03702	0.199000	0.23934	-0.474000	0.06607	-0.454000	0.07066	-0.886000	0.02939	GGC			0.498	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1		NM_002771	
RP11-435O5.2	0	broad.mit.edu	37	9	98180678	98180679	+	lincRNA	DEL	GT	GT	-	rs575031246|rs376542879	byFrequency	TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chr9:98180678_98180679delGT	ENST00000433644.2	-	0	73																											tatgggtgtggtgtgtgtgtgt	0.401																																					.													.	.			0			.																																											0	.			GGTGTGGTGTGTG																													9.37:g.98180688_98180689delGT			4	0	0		8	0.38	3	.	0		0		RNA	DEL	ENST00000433644.2	37																																																																																						0.401	RP11-435O5.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000053234.2			
BCOR	54880	broad.mit.edu	37	X	39916463	39916463	+	Nonsense_Mutation	SNP	G	G	A	rs199676230		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chrX:39916463G>A	ENST00000378444.4	-	11	4768	c.4540C>T	c.(4540-4542)Cga>Tga	p.R1514*	BCOR_ENST00000378463.1_Nonsense_Mutation_p.R357*|BCOR_ENST00000378455.4_Nonsense_Mutation_p.R1462*|BCOR_ENST00000342274.4_Nonsense_Mutation_p.R1480*|BCOR_ENST00000397354.3_Nonsense_Mutation_p.R1480*	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1514					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						AGGAGGTGTCGCACAATGTTG	0.512			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.R1514X				Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351		0			c.C4540T												154.0	104.0	121.0					X																	39916463		2202	4300	6502	SO:0001587	stop_gained	54880	exon11			GGTGTCGCACAAT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4540C>T	X.37:g.39916463G>A	ENSP00000367705:p.Arg1514*		119	0	0		183	0.02	4	NM_001123385	26	0.00	0	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Nonsense_Mutation	SNP	ENST00000378444.4	37	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	46	12.577683	0.99679	.	.	ENSG00000183337	ENST00000413905;ENST00000378463;ENST00000378455;ENST00000397354;ENST00000378444;ENST00000342274;ENST00000442018	.	.	.	5.46	3.67	0.42095	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.8224	10.3036	0.43667	0.0:0.2697:0.5875:0.1428	.	.	.	.	X	384;357;1462;1480;1514;1480;187	.	ENSP00000345923:R1480X	R	-	1	2	BCOR	39801407	1.000000	0.71417	0.702000	0.30337	0.988000	0.76386	4.473000	0.60196	0.479000	0.27511	0.600000	0.82982	CGA			0.512	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000060666.2		NM_017745	
STARD8	9754	broad.mit.edu	37	X	67940201	67940201	+	Missense_Mutation	SNP	G	G	C	rs201883068|rs373427165		TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chrX:67940201G>C	ENST00000252336.6	+	7	2117	c.1745G>C	c.(1744-1746)gGc>gCc	p.G582A	STARD8_ENST00000374597.3_Missense_Mutation_p.G582A|STARD8_ENST00000374599.3_Missense_Mutation_p.G662A	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	582	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CAGCGCACGGGCCAGCCACTG	0.617																																					p.G662A													.	STARD8	282		0			c.G1985C												34.0	24.0	28.0					X																	67940201		2202	4298	6500	SO:0001583	missense	9754	exon8			GCACGGGCCAGCC	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1745G>C	X.37:g.67940201G>C	ENSP00000252336:p.Gly582Ala		87	0.1609195402	14		172	0.21	36	NM_001142503	2	0.00	0	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	CCDS14390.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671428	0.88348	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.25250	1.81;1.81;1.81	4.45	4.45	0.53987	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.50871	0.1641	M	0.87269	2.87	0.80722	D	1	P;P	0.52170	0.854;0.951	P;P	0.58721	0.844;0.806	T	0.60198	-0.7310	10	0.66056	D	0.02	.	13.5176	0.61549	0.0:0.0:1.0:0.0	.	662;582	Q92502-2;Q92502	.;STAR8_HUMAN	A	582;662;582	ENSP00000252336:G582A;ENSP00000363727:G662A;ENSP00000363725:G582A	ENSP00000252336:G582A	G	+	2	0	STARD8	67856926	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.112000	0.94314	2.050000	0.60909	0.600000	0.82982	GGC			0.617	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057026.2		NM_014725	
BRWD3	254065	broad.mit.edu	37	X	79932398	79932398	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALO-01A-12D-A42Y-10	TCGA-2G-AALO-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	f1e9dc7f-1736-448c-b749-3382f1c9ec34	c3b27ff2-b769-4ef1-bb6c-7faccf2a04ec	g.chrX:79932398T>C	ENST00000373275.4	-	41	5335	c.5119A>G	c.(5119-5121)Agg>Ggg	p.R1707G	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1707	Gly-rich.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						cctcttcccctccccctagtg	0.557																																					p.R1707G													.	BRWD3	251		0			c.A5119G												133.0	104.0	114.0					X																	79932398		2203	4300	6503	SO:0001583	missense	254065	exon41			TTCCCCTCCCCCT		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.5119A>G	X.37:g.79932398T>C	ENSP00000362372:p.Arg1707Gly		72	0.0277777778	2		136	0.03	4	NM_153252	1	0.00	0	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	37	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	t	4.709	0.131871	0.08981	.	.	ENSG00000165288	ENST00000373275	T	0.75154	-0.91	4.88	-0.56	0.11789	.	0.421330	0.24594	N	0.037183	T	0.45617	0.1351	N	0.08118	0	0.22292	N	0.999222	B	0.09022	0.002	B	0.08055	0.003	T	0.22906	-1.0203	9	.	.	.	-9.9704	5.6556	0.17640	0.0:0.1554:0.4508:0.3939	.	1707	Q6RI45	BRWD3_HUMAN	G	1707	ENSP00000362372:R1707G	.	R	-	1	2	BRWD3	79819054	0.469000	0.25846	0.537000	0.28052	0.328000	0.28507	0.196000	0.17176	-0.192000	0.10432	-1.708000	0.00717	AGG			0.557	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057344.1		NM_153252	
