#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
NPHP4	261734	mdanderson.org	37	1	5969244	5969244	+	Missense_Mutation	SNP	C	C	T	rs200462413		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:5969244C>T	ENST00000378156.4	-	12	1736	c.1471G>A	c.(1471-1473)Gct>Act	p.A491T	NPHP4_ENST00000478423.2_Intron	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	491					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		TGCGGGGCAGCGAGAACTCGA	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18029	0.0		0.0	False		,,,				2504	0.0				p.A491T													.	.			0			c.G1471A												29.0	35.0	33.0					1																	5969244		1955	4136	6091	SO:0001583	missense	261734	exon12			GGGCAGCGAGAAC	AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.1471G>A	1.37:g.5969244C>T	ENSP00000367398:p.Ala491Thr		41	0	0		44	0.07	3	NM_015102	3	0.00	0	Q8IWC0	Missense_Mutation	SNP	ENST00000378156.4	37	CCDS44052.1	2	9.157509157509158E-4	0	0.0	2	0.0055248618784530384	0	0.0	0	0.0	C	3.748	-0.052112	0.07362	.	.	ENSG00000131697	ENST00000378156	D	0.87179	-2.22	3.45	-0.483	0.12075	.	0.452378	0.19756	N	0.106781	T	0.59838	0.2223	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.08055	0.003	T	0.51124	-0.8745	10	0.15499	T	0.54	.	6.3851	0.21556	0.0:0.5493:0.0:0.4507	.	491	O75161	NPHP4_HUMAN	T	491	ENSP00000367398:A491T	ENSP00000367398:A491T	A	-	1	0	NPHP4	5891831	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.091000	0.15046	-0.084000	0.12595	-1.406000	0.01132	GCT	0.001		0.612	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000001715.2			
GRIK3	2899	broad.mit.edu	37	1	37271834	37271834	+	Missense_Mutation	SNP	C	C	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:37271834C>A	ENST00000373091.3	-	14	2201	c.2185G>T	c.(2185-2187)Gcc>Tcc	p.A729S	GRIK3_ENST00000373093.4_Missense_Mutation_p.A729S	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	729					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				GCCGTCAGGGCCCTCTGGATG	0.597																																					p.A729S													.	GRIK3	195		0			c.G2185T												154.0	125.0	135.0					1																	37271834		2203	4300	6503	SO:0001583	missense	2899	exon14			TCAGGGCCCTCTG	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2185G>T	1.37:g.37271834C>A	ENSP00000362183:p.Ala729Ser		115	0	0		121	0.03	4	NM_000831	0		0	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	ENST00000373091.3	37	CCDS416.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291932	0.59976	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.11495	2.77;2.77	5.48	0.377	0.16198	Ionotropic glutamate receptor (2);	0.550760	0.19678	N	0.108595	T	0.12646	0.0307	L	0.45352	1.415	0.22610	N	0.998933	B;B	0.19073	0.033;0.033	B;B	0.36092	0.217;0.142	T	0.34675	-0.9819	10	0.87932	D	0	.	9.8676	0.41154	0.0:0.45:0.0:0.55	.	729;729	A9Z1Z8;Q13003	.;GRIK3_HUMAN	S	729	ENSP00000362183:A729S;ENSP00000362185:A729S	ENSP00000362183:A729S	A	-	1	0	GRIK3	37044421	0.992000	0.36948	0.884000	0.34674	0.877000	0.50540	1.265000	0.33027	0.065000	0.16485	-0.390000	0.06520	GCC			0.597	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012053.1		NM_000831	
PTPRF	5792	mdanderson.org	37	1	44057152	44057152	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:44057152C>T	ENST00000359947.4	+	9	1799	c.1459C>T	c.(1459-1461)Cgc>Tgc	p.R487C	PTPRF_ENST00000372413.3_Missense_Mutation_p.R487C|PTPRF_ENST00000372414.3_Missense_Mutation_p.R487C|PTPRF_ENST00000422171.2_5'UTR|PTPRF_ENST00000438120.1_Missense_Mutation_p.R487C	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	487	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTACAGCCTGCGCGTGCTTGC	0.711																																					p.R487C													.	.			0			c.C1459T												10.0	12.0	11.0					1																	44057152		2186	4259	6445	SO:0001583	missense	5792	exon9			AGCCTGCGCGTGC	Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.1459C>T	1.37:g.44057152C>T	ENSP00000353030:p.Arg487Cys		35	0	0		30	0.10	3	NM_002840	32	0.00	0	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	ENST00000359947.4	37	CCDS489.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.82|14.82	2.648953|2.648953	0.47362|0.47362	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413	.|T;T;T;T	.|0.60920	.|0.15;0.15;0.15;0.15	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.34555	.|N	.|0.003868	D|D	0.82618|0.82618	0.5076|0.5076	M|M	0.93062|0.93062	3.375|3.375	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.85130	.|0.997;0.996;0.988	D|D	0.86567|0.86567	0.1845|0.1845	5|10	.|0.87932	.|D	.|0	.|.	19.4657|19.4657	0.94939|0.94939	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|143;487;487	.|Q59FI2;P10586-2;P10586	.|.;.;PTPRF_HUMAN	V|C	154;11|487	.|ENSP00000353030:R487C;ENSP00000398822:R487C;ENSP00000361491:R487C;ENSP00000361490:R487C	.|ENSP00000353030:R487C	A|R	+|+	2|1	0|0	PTPRF|PTPRF	43829739|43829739	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.636000|0.636000	0.38137|0.38137	2.961000|2.961000	0.49168|0.49168	2.677000|2.677000	0.91161|0.91161	0.563000|0.563000	0.77884|0.77884	GCG|CGC			0.711	PTPRF-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000019710.1			
LRRC41	10489	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	1	46768994	46768994	+	Start_Codon_SNP	SNP	T	T	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:46768994T>A	ENST00000343304.6	-	1	286	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	UQCRH_ENST00000311672.5_5'Flank	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	1					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GGCGCCGCCATCTTGGGGAGG	0.667																																					p.M1L													.	.			0			c.A1T												1.0	2.0	2.0					1																	46768994		1369	2900	4269	SO:0001582	initiator_codon_variant	10489	exon1			CCGCCATCTTGGG	AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.1A>T	1.37:g.46768994T>A	ENSP00000343298:p.Met1Leu		32	0	0		40	0.35	14	NM_006369	2	0.00	0	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	ENST00000343304.6	37	CCDS533.1	.	.	.	.	.	.	.	.	.	.	T	18.30	3.593892	0.66219	.	.	ENSG00000132128	ENST00000343304	T	0.40476	1.03	5.51	5.51	0.81932	.	.	.	.	.	T	0.38772	0.1053	.	.	.	0.32088	N	0.592251	P;P	0.40660	0.726;0.534	B;B	0.40636	0.335;0.181	T	0.55872	-0.8072	8	0.87932	D	0	.	9.434	0.38628	0.0:0.082:0.0:0.918	.	1;1	Q15345-3;Q15345	.;LRC41_HUMAN	L	1	ENSP00000343298:M1L	ENSP00000343298:M1L	M	-	1	0	LRRC41	46541581	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.339000	0.59322	2.093000	0.63338	0.482000	0.46254	ATG			0.667	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000021438.1		NM_006369	Missense_Mutation
SLAMF8	56833	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	159799841	159799841	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:159799841T>G	ENST00000289707.5	+	2	375	c.226T>G	c.(226-228)Ttc>Gtc	p.F76V	SLAMF8_ENST00000368104.4_Intron|SLAMF8_ENST00000471286.1_3'UTR	NM_020125.2	NP_064510.1	Q9P0V8	SLAF8_HUMAN	SLAM family member 8	76					cellular response to drug (GO:0035690)|defense response to bacterium (GO:0042742)|phagosome acidification (GO:0090383)|regulation of kinase activity (GO:0043549)|regulation of NAD(P)H oxidase activity (GO:0033860)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|large_intestine(4)|lung(6)	12	all_hematologic(112;0.0597)					CCATTCCCGCTTCCTGGGCCG	0.602																																					p.F76V													.	.			0			c.T226G												85.0	92.0	90.0					1																	159799841		2203	4300	6503	SO:0001583	missense	56833	exon2			TCCCGCTTCCTGG	AF146761	CCDS1188.1	1q23.1	2013-01-11			ENSG00000158714	ENSG00000158714		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21391	protein-coding gene	gene with protein product		606620				11313408	Standard	NM_020125		Approved	BLAME, SBBI42, CD353	uc001fue.4	Q9P0V8	OTTHUMG00000035433	ENST00000289707.5:c.226T>G	1.37:g.159799841T>G	ENSP00000289707:p.Phe76Val		89	0	0		113	0.41	46	NM_020125	22	0.00	0	Q32MC6|Q5VU15	Missense_Mutation	SNP	ENST00000289707.5	37	CCDS1188.1	.	.	.	.	.	.	.	.	.	.	T	18.62	3.662583	0.67700	.	.	ENSG00000158714	ENST00000289707	T	0.23348	1.91	4.44	4.44	0.53790	.	0.056654	0.64402	D	0.000001	T	0.25044	0.0608	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.02588	-1.1137	10	0.44086	T	0.13	-21.2609	10.0044	0.41949	0.0:0.0:0.0:1.0	.	76	Q9P0V8	SLAF8_HUMAN	V	76	ENSP00000289707:F76V	ENSP00000289707:F76V	F	+	1	0	SLAMF8	158066465	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	3.714000	0.54889	1.861000	0.53984	0.260000	0.18958	TTC			0.602	SLAMF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085983.1		NM_020125	
IL19	29949	hgsc.bcm.edu;mdanderson.org	37	1	207010078	207010078	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:207010078G>T	ENST00000270218.6	+	3	1010	c.71G>T	c.(70-72)gGt>gTt	p.G24V	IL19_ENST00000340758.2_Missense_Mutation_p.G62V	NM_013371.3	NP_037503.2	Q9UHD0	IL19_HUMAN	interleukin 19	24					apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			GACAACCACGGTCTCAGGAGA	0.458																																					p.G62V													.	.			0			c.G185T												191.0	180.0	184.0					1																	207010078		2203	4300	6503	SO:0001583	missense	29949	exon2			ACCACGGTCTCAG	AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000270218.6:c.71G>T	1.37:g.207010078G>T	ENSP00000270218:p.Gly24Val		84	0	0		88	0.05	4	NM_153758	0		0	B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Missense_Mutation	SNP	ENST00000270218.6	37	CCDS1469.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522179	0.27211	.	.	ENSG00000142224	ENST00000340758;ENST00000270218	T;T	0.16457	2.34;2.34	5.4	2.2	0.27929	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.510109	0.22228	N	0.062853	T	0.20455	0.0492	M	0.73962	2.25	0.09310	N	0.999998	P;P;P	0.44006	0.789;0.648;0.824	B;B;B	0.40782	0.229;0.2;0.34	T	0.11518	-1.0584	10	0.87932	D	0	.	8.5509	0.33451	0.0895:0.31:0.6005:0.0	.	24;24;62	B6VEV9;Q9UHD0;Q5VUT3	.;IL19_HUMAN;.	V	62;24	ENSP00000343000:G62V;ENSP00000270218:G24V	ENSP00000270218:G24V	G	+	2	0	IL19	205076701	0.001000	0.12720	0.020000	0.16555	0.020000	0.10135	0.501000	0.22578	0.633000	0.30452	0.561000	0.74099	GGT			0.458	IL19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088567.2		NM_153758	
FMN2	56776	broad.mit.edu	37	1	240371580	240371580	+	Silent	SNP	A	A	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:240371580A>T	ENST00000319653.9	+	5	3698	c.3468A>T	c.(3466-3468)ccA>ccT	p.P1156P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1156	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTCCGCCCCCACTTCCCGGAG	0.706																																					p.P1156P													FMN2,NS,carcinoma,+2,1	FMN2	451	1	0			c.A3468T												3.0	4.0	4.0					1																	240371580		1744	3609	5353	SO:0001819	synonymous_variant	56776	exon5			GCCCCCACTTCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3468A>T	1.37:g.240371580A>T			65	0.0461538462	3		76	0.09	7	NM_020066	0		0	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	ENST00000319653.9	37	CCDS31069.2																																																																																					0.706	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096217.2		XM_371352	
OR2L3	391192	hgsc.bcm.edu	37	1	248224864	248224864	+	Missense_Mutation	SNP	A	A	G	rs543066146		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr1:248224864A>G	ENST00000359959.3	+	1	881	c.881A>G	c.(880-882)aAg>aGg	p.K294R	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			CTGAGGAACAAGGAGGTGATG	0.502													a|||	1	0.000199681	0.0	0.0	5008	,	,		18589	0.001		0.0	False		,,,				2504	0.0				p.K294R													OR2L3,NS,carcinoma,+1,1	OR2L3	1	1	0			c.A881G												56.0	57.0	57.0					1																	248224864		2203	4300	6503	SO:0001583	missense	391192	exon1			GGAACAAGGAGGT	AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.881A>G	1.37:g.248224864A>G	ENSP00000353044:p.Lys294Arg		88	0.0113636364	1		81	0.06	5	NM_001004687	0		0	B9EH44	Missense_Mutation	SNP	ENST00000359959.3	37	CCDS31104.1	.	.	.	.	.	.	.	.	.	.	A	9.463	1.093601	0.20471	.	.	ENSG00000198128	ENST00000359959	T	0.41065	1.01	2.01	-0.867	0.10655	.	.	.	.	.	T	0.36054	0.0953	M	0.63169	1.94	0.23762	N	0.996914	B	0.21821	0.061	B	0.23852	0.049	T	0.32348	-0.9910	9	0.37606	T	0.19	.	6.329	0.21259	0.7597:0.0:0.2403:0.0	.	294	Q8NG85	OR2L3_HUMAN	R	294	ENSP00000353044:K294R	ENSP00000353044:K294R	K	+	2	0	OR2L3	246291487	0.000000	0.05858	0.908000	0.35775	0.606000	0.37113	0.414000	0.21164	-0.373000	0.07979	-0.475000	0.04921	AAG			0.502	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096852.1		NM_001004687	
SKIDA1	387640	mdanderson.org	37	10	21806056	21806056	+	Silent	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr10:21806056G>A	ENST00000449193.2	-	4	2948	c.696C>T	c.(694-696)gcC>gcT	p.A232A	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_Intron	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	232	Ala-rich.			Missing (in Ref. 2; BAD18601). {ECO:0000305}.		nucleus (GO:0005634)											cggcagcagcggcggcggcgg	0.766																																					p.A232A													.	.			0			c.C696T												1.0	1.0	1.0					10																	21806056		64	241	305	SO:0001819	synonymous_variant	387640	exon4			AGCAGCGGCGGCG	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.696C>T	10.37:g.21806056G>A			17	0	0		14	0.21	3	NM_207371	0		0	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	ENST00000449193.2	37	CCDS44363.1																																																																																					0.766	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286950.2		NM_207371	
ECD	11319	broad.mit.edu;mdanderson.org	37	10	74899094	74899094	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr10:74899094G>T	ENST00000372979.4	-	11	1600	c.1394C>A	c.(1393-1395)tCa>tAa	p.S465*	ECD_ENST00000454759.2_Nonsense_Mutation_p.S422*|ECD_ENST00000430082.2_Nonsense_Mutation_p.S498*	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	465					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					CTTGTGGGTTGAGACTTTGGA	0.403																																					p.S498X													.	ECD	50		0			c.C1493A												106.0	106.0	106.0					10																	74899094		2203	4300	6503	SO:0001587	stop_gained	11319	exon12			TGGGTTGAGACTT	BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.1394C>A	10.37:g.74899094G>T	ENSP00000362070:p.Ser465*		67	0	0		66	0.08	5	NM_001135752	39	0.00	0	C9JX46|E9PAW8	Nonsense_Mutation	SNP	ENST00000372979.4	37	CCDS7321.1	.	.	.	.	.	.	.	.	.	.	G	38	7.263567	0.98171	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759	.	.	.	5.39	5.39	0.77823	.	0.127023	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.4195	16.6303	0.85032	0.0:0.0:1.0:0.0	.	.	.	.	X	465;498;422	.	ENSP00000362070:S465X	S	-	2	0	ECD	74569100	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.481000	0.81124	2.514000	0.84764	0.460000	0.39030	TCA			0.403	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048606.1		NM_007265	
IFIT5	24138	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	91178125	91178125	+	Missense_Mutation	SNP	G	G	C	rs564765939		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr10:91178125G>C	ENST00000371795.4	+	2	1382	c.1169G>C	c.(1168-1170)cGt>cCt	p.R390P	IFIT5_ENST00000416601.1_Missense_Mutation_p.R342P	NM_012420.2	NP_036552.1	Q13325	IFIT5_HUMAN	interferon-induced protein with tetratricopeptide repeats 5	390					defense response to virus (GO:0051607)|innate immune response (GO:0045087)	actin cytoskeleton (GO:0015629)|apical part of cell (GO:0045177)|ruffle membrane (GO:0032587)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)|tRNA binding (GO:0000049)			endometrium(1)|large_intestine(4)|lung(4)	9						GAATTTCACCGTAAATCAGAA	0.428																																					p.R390P													.	.			0			c.G1169C												74.0	68.0	70.0					10																	91178125		2203	4300	6503	SO:0001583	missense	24138	exon2			TTCACCGTAAATC	U34605	CCDS7403.1	10q23.31	2013-01-10			ENSG00000152778	ENSG00000152778		"""Tetratricopeptide (TTC) repeat domain containing"""	13328	protein-coding gene	gene with protein product	"""retinoic acid- and interferon-inducible protein (58kD)"""					9398535	Standard	NM_012420		Approved	RI58	uc010qnh.2	Q13325	OTTHUMG00000018713	ENST00000371795.4:c.1169G>C	10.37:g.91178125G>C	ENSP00000360860:p.Arg390Pro		157	0	0		115	0.37	43	NM_012420	25	0.40	10	B2R5X9|B4DDV1|Q5T7I9|Q6IAX3	Missense_Mutation	SNP	ENST00000371795.4	37	CCDS7403.1	.	.	.	.	.	.	.	.	.	.	G	14.02	2.412269	0.42817	.	.	ENSG00000152778	ENST00000371795;ENST00000416601	T;T	0.60040	0.22;0.22	6.17	4.32	0.51571	.	0.670521	0.15342	N	0.267439	T	0.58495	0.2126	L	0.55481	1.735	0.09310	N	1	P;P	0.46512	0.879;0.879	P;P	0.52267	0.694;0.694	T	0.50127	-0.8864	10	0.37606	T	0.19	0.2252	4.3315	0.11066	0.2048:0.0:0.5095:0.2858	.	390;342	Q13325;B4DDV1	IFIT5_HUMAN;.	P	390;342	ENSP00000360860:R390P;ENSP00000414042:R342P	ENSP00000360860:R390P	R	+	2	0	IFIT5	91168105	0.003000	0.15002	0.002000	0.10522	0.981000	0.71138	1.168000	0.31859	0.924000	0.37069	0.655000	0.94253	CGT			0.428	IFIT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049303.1		NM_012420	
LOXL4	84171	hgsc.bcm.edu;mdanderson.org	37	10	100017443	100017443	+	Silent	SNP	G	G	T	rs372088253		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr10:100017443G>T	ENST00000260702.3	-	8	1374	c.1224C>A	c.(1222-1224)gtC>gtA	p.V408V	RP11-34A14.3_ENST00000433374.1_RNA	NM_032211.6	NP_115587.6	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4	408	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|receptor complex (GO:0043235)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(8)|ovary(4)|prostate(1)|skin(2)	26		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		CATTGCACCTGACAGCAGCAT	0.597																																					p.V408V													.	.			0			c.C1224A												163.0	134.0	144.0					10																	100017443		2203	4300	6503	SO:0001819	synonymous_variant	84171	exon8			GCACCTGACAGCA	AF338441	CCDS7473.1	10q24	2008-08-01			ENSG00000138131	ENSG00000138131			17171	protein-coding gene	gene with protein product		607318				11292829	Standard	XM_005270216		Approved	FLJ21889, LOXC	uc001kpa.1	Q96JB6	OTTHUMG00000018874	ENST00000260702.3:c.1224C>A	10.37:g.100017443G>T			55	0	0		66	0.06	4	NM_032211	12	0.00	0	Q5W0B3|Q96DY1|Q96PC0|Q9H6T5	Silent	SNP	ENST00000260702.3	37	CCDS7473.1																																																																																					0.597	LOXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049766.1		NM_032211	
CFAP46	54777	broad.mit.edu	37	10	134755171	134755171	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr10:134755171G>T	ENST00000368586.5	-	3	330	c.230C>A	c.(229-231)gCg>gAg	p.A77E	TTC40_ENST00000368582.2_Missense_Mutation_p.A77E|RP13-137A17.4_ENST00000443633.1_lincRNA|TTC40_ENST00000368585.3_Missense_Mutation_p.A77E	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GGTGATGGGCGCCTTCACCTT	0.597																																					p.A77E													.	TTC40	100		0			c.C230A												83.0	78.0	79.0					10																	134755171		2202	4300	6502	SO:0001583	missense	54777	exon3			ATGGGCGCCTTCA																												ENST00000368586.5:c.230C>A	10.37:g.134755171G>T	ENSP00000357575:p.Ala77Glu		146	0	0		130	0.04	5	NM_001200049	1	0.00	0		Missense_Mutation	SNP	ENST00000368586.5	37	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364464	0.61513	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	T;T;T	0.80480	-1.38;-1.38;-1.38	4.45	1.08	0.20341	.	1.078920	0.07196	N	0.856687	T	0.78947	0.4364	L	0.46157	1.445	0.26408	N	0.976304	P;P	0.46621	0.881;0.881	B;B	0.43103	0.318;0.408	T	0.69247	-0.5195	10	0.51188	T	0.08	.	15.5285	0.75932	0.0:0.2649:0.7351:0.0	.	77;77	Q5SR76-2;Q5SR76-1	.;.	E	77	ENSP00000357575:A77E;ENSP00000357571:A77E;ENSP00000357574:A77E	ENSP00000357571:A77E	A	-	2	0	C10orf93	134605161	0.142000	0.22610	0.781000	0.31783	0.950000	0.60333	0.127000	0.15790	0.492000	0.27815	-0.219000	0.12488	GCG			0.597	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000051095.3			
RPS6KA4	8986	mdanderson.org	37	11	64136051	64136051	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr11:64136051G>T	ENST00000334205.4	+	11	1377	c.1312G>T	c.(1312-1314)Gca>Tca	p.A438S	RPS6KA4_ENST00000294261.4_Intron|MIR1237_ENST00000408346.1_RNA|RPS6KA4_ENST00000528057.1_Missense_Mutation_p.A431S	NM_003942.2	NP_003933.1	O75676	KS6A4_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 4	438	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|negative regulation of cytokine production (GO:0001818)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|mitogen-activated protein kinase p38 binding (GO:0048273)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|endometrium(3)|lung(7)|ovary(1)|prostate(1)	13						CCAGGAGTTCGCAGTCAAGAT	0.726																																					p.A438S													.	.			0			c.G1312T												10.0	12.0	11.0					11																	64136051		2183	4273	6456	SO:0001583	missense	8986	exon11			GAGTTCGCAGTCA	AJ010119	CCDS8073.1, CCDS73313.1	11q11-q13	2011-04-05	2002-08-29		ENSG00000162302	ENSG00000162302			10433	protein-coding gene	gene with protein product		603606	"""ribosomal protein S6 kinase, 90kD, polypeptide 4"""			9792677, 9687510	Standard	XM_005274379		Approved	RSK-B, MSK2	uc001oae.3	O75676	OTTHUMG00000046094	ENST00000334205.4:c.1312G>T	11.37:g.64136051G>T	ENSP00000333896:p.Ala438Ser		33	0	0		25	0.12	3	NM_003942	29	0.00	0	A8K7Z8|O75585|Q53ES8	Missense_Mutation	SNP	ENST00000334205.4	37	CCDS8073.1	.	.	.	.	.	.	.	.	.	.	g	29.8	5.037476	0.93630	.	.	ENSG00000162302	ENST00000528057;ENST00000334205;ENST00000530504	T;T;T	0.72051	-0.62;-0.62;-0.62	4.49	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.056560	0.64402	D	0.000001	D	0.86623	0.5977	M	0.91196	3.185	0.80722	D	1	P;D;D	0.76494	0.927;0.999;0.999	P;D;D	0.78314	0.566;0.991;0.963	D	0.89930	0.4065	10	0.87932	D	0	.	14.6625	0.68882	0.0:0.0:1.0:0.0	.	431;438;432	E9PJN1;O75676;O75676-2	.;KS6A4_HUMAN;.	S	431;438;416	ENSP00000435580:A431S;ENSP00000333896:A438S;ENSP00000432945:A416S	ENSP00000333896:A438S	A	+	1	0	RPS6KA4	63892627	1.000000	0.71417	0.926000	0.36857	0.915000	0.54546	9.116000	0.94341	2.055000	0.61198	0.455000	0.32223	GCA			0.726	RPS6KA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106246.2		NM_003942	
CARD17	440068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	11	104971361	104971361	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr11:104971361C>T	ENST00000375707.1	-	2	169	c.153G>A	c.(151-153)atG>atA	p.M51I	CARD16_ENST00000525374.1_Intron|CASP1_ENST00000415981.2_Intron|CASP1_ENST00000598974.1_Intron|CASP1_ENST00000594519.1_Intron|CASP1_ENST00000593315.1_Intron	NM_001007232.1	NP_001007233.1	Q5XLA6	CAR17_HUMAN	caspase recruitment domain family, member 17	51	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	6						GGGCCTTATCCATAACTGTAG	0.443																																					p.M51I													CARD17,bladder,carcinoma,0,1	CARD17	0	1	0			c.G153A												173.0	163.0	167.0					11																	104971361		2202	4299	6501	SO:0001583	missense	440068	exon2			CTTATCCATAACT		CCDS31662.1	11q22.3	2009-01-13				ENSG00000255221			33827	protein-coding gene	gene with protein product	"""Inhibitory CARD"""	609490				15383541	Standard	NM_001007232		Approved	INCA	uc001pir.1	Q5XLA6		ENST00000375707.1:c.153G>A	11.37:g.104971361C>T	ENSP00000364859:p.Met51Ile		151	0.0066225166	1		124	0.35	44	NM_001007232	0		0		Missense_Mutation	SNP	ENST00000375707.1	37	CCDS31662.1	.	.	.	.	.	.	.	.	.	.	.	12.73	2.026062	0.35701	.	.	ENSG00000255221	ENST00000375707	T	0.20738	2.05	2.92	1.97	0.26223	DEATH-like (2);Caspase Recruitment (3);	.	.	.	.	T	0.36826	0.0981	M	0.79805	2.47	0.09310	N	1	P	0.47604	0.898	P	0.53722	0.733	T	0.11567	-1.0582	9	0.51188	T	0.08	.	7.8073	0.29211	0.0:0.7409:0.2591:0.0	.	51	Q5XLA6	CAR17_HUMAN	I	51	ENSP00000364859:M51I	ENSP00000364859:M51I	M	-	3	0	CARD17	104476571	0.010000	0.17322	0.022000	0.16811	0.059000	0.15707	0.736000	0.26130	0.516000	0.28340	0.511000	0.50034	ATG			0.443	CARD17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388181.1		NM_001007232	
KMT2D	8085	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49444817	49444817	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr12:49444817G>T	ENST00000301067.7	-	10	2648	c.2649C>A	c.(2647-2649)ttC>ttA	p.F883L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	883	Pro-rich.			Missing (in Ref. 1; AAC51734). {ECO:0000305}.	chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CAGGGGGAGGGAACAAGGGCA	0.642																																					p.F883L													.	.			0			c.C2649A												50.0	56.0	54.0					12																	49444817		2014	4176	6190	SO:0001583	missense	8085	exon10			GGGAGGGAACAAG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.2649C>A	12.37:g.49444817G>T	ENSP00000301067:p.Phe883Leu		135	0	0		170	0.25	43	NM_003482	3	0.00	0	O14687	Missense_Mutation	SNP	ENST00000301067.7	37	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	G	5.439	0.266086	0.10294	.	.	ENSG00000167548	ENST00000301067	T	0.78481	-1.18	3.51	0.458	0.16670	.	.	.	.	.	T	0.59636	0.2208	N	0.19112	0.55	0.22911	N	0.998573	B	0.02656	0.0	B	0.01281	0.0	T	0.51100	-0.8748	9	0.87932	D	0	.	4.0353	0.09727	0.2338:0.0:0.5672:0.199	.	883	O14686	MLL2_HUMAN	L	883	ENSP00000301067:F883L	ENSP00000301067:F883L	F	-	3	2	MLL2	47731084	0.093000	0.21703	0.260000	0.24451	0.549000	0.35272	-0.024000	0.12435	0.091000	0.17302	0.563000	0.77884	TTC			0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390183.2			
KRT5	3852	bcgsc.ca	37	12	52912805	52912805	+	Missense_Mutation	SNP	C	C	T	rs200333163	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr12:52912805C>T	ENST00000252242.4	-	2	1085	c.695G>A	c.(694-696)aGc>aAc	p.S232N		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	232	Coil 1B.|Rod.		S -> N (in dbSNP:rs3194286).		cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		CCCCACGATGCTGTCCAGCTG	0.587																																					p.S232N													.	KRT5	88		0			c.G695A												173.0	159.0	164.0					12																	52912805		2203	4300	6503	SO:0001583	missense	3852	exon2			ACGATGCTGTCCA		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.695G>A	12.37:g.52912805C>T	ENSP00000252242:p.Ser232Asn		192	0.0729166667	14		237	0.13	30	NM_000424	1	0.00	0	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	37	CCDS8830.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.596|3.596	-0.082580|-0.082580	0.07141|0.07141	.|.	.|.	ENSG00000186081|ENSG00000186081	ENST00000551188|ENST00000252242;ENST00000456000;ENST00000549420	.|D;D	.|0.88431	.|-2.38;-2.35	5.22|5.22	2.35|2.35	0.29111|0.29111	.|Filament (1);	.|1.042650	.|0.07529	.|N	.|0.911826	T|T	0.82010|0.82010	0.4944|0.4944	N|N	0.25332|0.25332	0.735|0.735	0.09310|0.09310	N|N	1|1	.|B	.|0.24092	.|0.097	.|B	.|0.25140	.|0.058	T|T	0.67313|0.67313	-0.5702|-0.5702	5|10	.|0.34782	.|T	.|0.22	.|.	8.0486|8.0486	0.30564|0.30564	0.0:0.4939:0.368:0.1381|0.0:0.4939:0.368:0.1381	.|.	.|232	.|P13647	.|K2C5_HUMAN	T|N	33|232;197;122	.|ENSP00000252242:S232N;ENSP00000447209:S122N	.|ENSP00000252242:S232N	A|S	-|-	1|2	0|0	KRT5|KRT5	51199072|51199072	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.063000|0.063000	0.16089|0.16089	-0.018000|-0.018000	0.12568|0.12568	0.336000|0.336000	0.23639|0.23639	0.655000|0.655000	0.94253|0.94253	GCA|AGC			0.587	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405312.1			
ATF7	11016	mdanderson.org	37	12	53918385	53918385	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr12:53918385T>A	ENST00000548446.2	-	10	1233	c.1121A>T	c.(1120-1122)aAg>aTg	p.K374M	RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.K363M|ATF7_ENST00000415113.1_Missense_Mutation_p.K342M|ATF7_ENST00000328463.7_Missense_Mutation_p.K374M|ATF7_ENST00000456903.4_Missense_Mutation_p.K363M|ATF7_ENST00000546661.1_5'UTR|ATF7_ENST00000420353.2_Missense_Mutation_p.K363M			P17544	ATF7_HUMAN	activating transcription factor 7	374	Essential for binding adenovirus 2 E1A.|Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	TTCTTCGGCCTTCTTCTCTAG	0.537																																					p.K363M													.	.			0			c.A1088T												68.0	66.0	67.0					12																	53918385		1880	4100	5980	SO:0001583	missense	11016	exon10			TCGGCCTTCTTCT	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.1121A>T	12.37:g.53918385T>A	ENSP00000449938:p.Lys374Met		69	0	0		59	0.05	3	NM_006856	15	0.00	0	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	T	22.2	4.252131	0.80135	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000306727;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.61392	0.11;0.11;0.11;0.11;0.11	5.32	5.32	0.75619	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.80681	0.4669	M	0.90870	3.155	0.54753	D	0.999988	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.995;0.992	D	0.85132	0.0975	10	0.87932	D	0	-14.3655	14.7093	0.69215	0.0:0.0:0.0:1.0	.	342;363;374	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	M	374;374;187;342;363;363	ENSP00000449938:K374M;ENSP00000329212:K374M;ENSP00000404880:K342M;ENSP00000399465:K363M;ENSP00000387406:K363M	ENSP00000304187:K187M	K	-	2	0	ATF7	52204652	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.082000	0.71318	2.371000	0.80710	0.533000	0.62120	AAG			0.537	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000406302.2		NM_001130059	
OAS3	4940	mdanderson.org	37	12	113376380	113376380	+	Silent	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr12:113376380G>T	ENST00000228928.7	+	1	224	c.45G>T	c.(43-45)gtG>gtT	p.V15V	OAS3_ENST00000548514.1_Silent_p.V15V|OAS3_ENST00000546638.1_3'UTR|RP1-71H24.1_ENST00000552784.1_RNA|OAS3_ENST00000551007.1_Silent_p.V15V	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	15	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						ACAGGTTCGTGGCCAGAAGGC	0.726																																					p.V15V													.	.			0			c.G45T												12.0	14.0	13.0					12																	113376380		1783	3985	5768	SO:0001819	synonymous_variant	4940	exon1			GTTCGTGGCCAGA	AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.45G>T	12.37:g.113376380G>T			27	0	0		36	0.08	3	NM_006187	18	0.00	0	Q2HJ14|Q9H3P5	Silent	SNP	ENST00000228928.7	37	CCDS44981.1																																																																																					0.726	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405920.1			
RIMBP2	23504	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	130919365	130919365	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr12:130919365C>T	ENST00000261655.4	-	11	2279	c.2116G>A	c.(2116-2118)Gag>Aag	p.E706K	RIMBP2_ENST00000536002.1_Missense_Mutation_p.E614K|RIMBP2_ENST00000535703.1_Missense_Mutation_p.E614K	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	706					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCGTCCTCCTCGTCTGAGGCG	0.597																																					p.E706K													.	.			0			c.G2116A												68.0	74.0	72.0					12																	130919365		2203	4300	6503	SO:0001583	missense	23504	exon11			CCTCCTCGTCTGA	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2116G>A	12.37:g.130919365C>T	ENSP00000261655:p.Glu706Lys		58	0	0		81	0.33	27	NM_015347	1	1.00	1	Q96ID2	Missense_Mutation	SNP	ENST00000261655.4	37	CCDS31925.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335112	0.81801	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.20738	2.05;2.42;2.42	5.0	5.0	0.66597	.	0.261592	0.36519	N	0.002547	T	0.42787	0.1218	M	0.63843	1.955	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;0.983	D;D;P	0.87578	0.986;0.998;0.532	T	0.18493	-1.0335	10	0.13853	T	0.58	-19.4244	18.3226	0.90243	0.0:1.0:0.0:0.0	.	614;614;706	C9JWN3;O15034-2;O15034	.;.;RIMB2_HUMAN	K	706;614;614;614	ENSP00000261655:E706K;ENSP00000440347:E614K;ENSP00000439159:E614K	ENSP00000261655:E706K	E	-	1	0	RIMBP2	129485318	1.000000	0.71417	0.998000	0.56505	0.089000	0.18198	7.740000	0.84986	2.309000	0.77851	0.561000	0.74099	GAG			0.597	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000399520.1		NM_015347	
KLHL1	57626	hgsc.bcm.edu;ucsc.edu	37	13	70681838	70681838	+	5'UTR	SNP	C	C	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr13:70681838C>G	ENST00000377844.4	-	0	753				ATXN8OS_ENST00000414504.2_RNA|ATXN8OS_ENST00000424524.1_RNA|KLHL1_ENST00000545028.1_5'Flank	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1						actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		ACATGCTTTACGCACAGAAGG	0.637																																					.													.	.			0			.												14.0	15.0	15.0					13																	70681838		2188	4275	6463	SO:0001623	5_prime_UTR_variant	6315	.			GCTTTACGCACAG	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.-7G>C	13.37:g.70681838C>G			23	0	0		30	0.30	9	.	0		0	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	RNA	SNP	ENST00000377844.4	37	CCDS9445.1																																																																																					0.637	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045231.3		NM_020866	
ERCC5	2073	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	103520594	103520594	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr13:103520594C>G	ENST00000355739.4	+	12	4088	c.2665C>G	c.(2665-2667)Ctc>Gtc	p.L889V	ERCC5_ENST00000375954.1_Missense_Mutation_p.L122V|BIVM-ERCC5_ENST00000602836.1_Missense_Mutation_p.S1314C	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	889					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CCTGGAACCTCTCCTAAAATT	0.363			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																												p.L1343V			yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	ERCC5,NS,malignant_melanoma,0,1	ERCC5	0	1	0			c.C4027G												75.0	81.0	79.0					13																	103520594		2203	4300	6503	SO:0001583	missense	0	exon20	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	GAACCTCTCCTAA	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.2665C>G	13.37:g.103520594C>G	ENSP00000347978:p.Leu889Val		226	0.0088495575	2		157	0.47	74	NM_001204425	48	0.33	16	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	ENST00000355739.4	37	CCDS32004.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.543120	0.86022	.	.	ENSG00000134899	ENST00000418659;ENST00000355739;ENST00000375955;ENST00000375954	T;T	0.10960	2.98;2.82	4.71	4.71	0.59529	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.131035	0.52532	D	0.000068	T	0.41282	0.1152	M	0.92026	3.265	0.80722	D	1	D;D	0.65815	0.968;0.995	P;D	0.65443	0.773;0.935	T	0.54689	-0.8256	10	0.56958	D	0.05	-3.336	17.6425	0.88140	0.0:1.0:0.0:0.0	.	889;1314	P28715;Q59FZ7	ERCC5_HUMAN;.	V	1314;889;721;122	ENSP00000347978:L889V;ENSP00000365121:L122V	ENSP00000347978:L889V	L	+	1	0	ERCC5	102318595	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.920000	0.70017	2.185000	0.69588	0.491000	0.48974	CTC			0.363	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045708.1			
RP11-597A11.1	0	broad.mit.edu	37	14	20086381	20086382	+	RNA	INS	-	-	T	rs202177940		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr14:20086381_20086382insT	ENST00000548261.1	+	0	135																											GTCTTACAAGGTAAAAAAAATG	0.312																																					.													.	.			0			.																																											0	.			TACAAGGTAAAAA																													14.37:g.20086382_20086382dupT			10	0	0		15	0.27	4	.	0		0		RNA	INS	ENST00000548261.1	37																																																																																						0.312	RP11-597A11.1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409571.1			
RP11-597A11.6	0	broad.mit.edu	37	14	20146543	20146544	+	lincRNA	INS	-	-	GTCCC	rs60511353|rs536110028	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr14:20146543_20146544insGTCCC	ENST00000555580.1	-	0	225				RP11-597A11.1_ENST00000548261.1_RNA																							CCAACTCAGCAGAACAGTGTCA	0.505														1248	0.249201	0.3147	0.3775	5008	,	,		16134	0.1438		0.2396	False		,,,				2504	0.1881				.													.	.			0			.																																											0	.			CTCAGCAGAACAG																													14.37:g.20146543_20146544insGTCCC			4	0	0		8	0.88	7	.	0		0		RNA	INS	ENST00000555580.1	37																																																																																						0.505	RP11-597A11.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000409767.1			
IRF9	10379	mdanderson.org	37	14	24634055	24634055	+	Silent	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr14:24634055C>T	ENST00000396864.3	+	7	1169	c.882C>T	c.(880-882)tgC>tgT	p.C294C	IRF9_ENST00000557894.1_Silent_p.C192C|RP11-468E2.4_ENST00000558468.1_3'UTR	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	294					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		AGCGCCTTTGCCCCATCCCCA	0.667																																					p.C294C													.	.			0			c.C882T												65.0	65.0	65.0					14																	24634055		2203	4300	6503	SO:0001819	synonymous_variant	10379	exon7			CCTTTGCCCCATC	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.882C>T	14.37:g.24634055C>T			29	0	0		31	0.10	3	NM_006084	118	0.00	0	D3DS61	Silent	SNP	ENST00000396864.3	37	CCDS9615.1																																																																																					0.667	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071927.2			
PKD1	5310	hgsc.bcm.edu	37	16	2164211	2164211	+	Missense_Mutation	SNP	G	G	A	rs148709380	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr16:2164211G>A	ENST00000262304.4	-	11	3021	c.2813C>T	c.(2812-2814)aCg>aTg	p.T938M	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.T938M	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	938	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)	p.T938M(2)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GGGGCTGGGCGTGGCGCGGAG	0.701																																					p.T938M													PKD1,NS,haematopoietic_neoplasm,0,4	PKD1	0	4	2	Substitution - Missense(2)	skin(2)	c.C2813T												14.0	15.0	15.0					16																	2164211		2170	4245	6415	SO:0001583	missense	5310	exon11			CTGGGCGTGGCGC	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.2813C>T	16.37:g.2164211G>A	ENSP00000262304:p.Thr938Met		28	0	0		51	0.12	6	NM_000296	19	0.11	2	Q15140|Q15141	Missense_Mutation	SNP	ENST00000262304.4	37	CCDS32369.1	101	0.04624542124542125	21	0.042682926829268296	18	0.049723756906077346	27	0.0472027972027972	35	0.04617414248021108	g	6.053	0.378196	0.11466	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.70282	-0.47;-0.47	4.96	-4.69	0.03299	PKD/Chitinase domain (1);Polycystin cation channel (1);	0.997630	0.08121	N	0.994748	T	0.11665	0.0284	L	0.36672	1.1	0.09310	N	1	P;P	0.48589	0.912;0.765	B;B	0.34093	0.161;0.175	T	0.25222	-1.0138	10	0.38643	T	0.18	.	2.9045	0.05716	0.3995:0.1065:0.386:0.1081	.	938;938	P98161-3;P98161	.;PKD1_HUMAN	M	938;938;653	ENSP00000262304:T938M;ENSP00000399501:T938M	ENSP00000262304:T938M	T	-	2	0	PKD1	2104212	0.006000	0.16342	0.001000	0.08648	0.327000	0.28475	0.089000	0.15002	-0.869000	0.04052	-0.711000	0.03637	ACG			0.701	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
E4F1	1877	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2284682	2284682	+	Silent	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr16:2284682G>A	ENST00000301727.4	+	11	1740	c.1692G>A	c.(1690-1692)cgG>cgA	p.R564R	DNASE1L2_ENST00000320700.5_5'Flank|RP11-304L19.12_ENST00000564055.1_lincRNA|E4F1_ENST00000565090.1_Silent_p.R387R|DNASE1L2_ENST00000564065.1_5'Flank|E4F1_ENST00000564139.1_Silent_p.R564R|DNASE1L2_ENST00000382437.4_5'Flank|DNASE1L2_ENST00000567494.1_5'Flank	NM_004424.3	NP_004415.2	Q66K89	E4F1_HUMAN	E4F transcription factor 1	564	Interaction with BMI1.|Mediates interaction with CDKN2A.|Mediates interaction with TP53.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|mitotic cell cycle arrest (GO:0071850)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell cycle process (GO:0010564)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle, embryonic (GO:0009794)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	cAMP response element binding (GO:0035497)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			ovary(1)	1						CACTGGTGCGGCACGTGCGAC	0.637																																					p.R564R													.	.			0			c.G1692A												21.0	17.0	18.0					16																	2284682		2181	4292	6473	SO:0001819	synonymous_variant	1877	exon11			GGTGCGGCACGTG	U87269	CCDS32370.1, CCDS73809.1, CCDS73810.1	16p13.3	2013-01-08				ENSG00000167967		"""Zinc fingers, C2H2-type"""	3121	protein-coding gene	gene with protein product		603022				9763670, 8828041	Standard	XM_005255155		Approved	E4F	uc002cpm.3	Q66K89		ENST00000301727.4:c.1692G>A	16.37:g.2284682G>A			104	0	0		168	0.24	40	NM_004424	36	0.19	7	A8K2R4|O00146	Silent	SNP	ENST00000301727.4	37	CCDS32370.1																																																																																					0.637	E4F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000435225.1		NM_004424	
MEFV	4210	mdanderson.org	37	16	3304520	3304520	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr16:3304520G>A	ENST00000219596.1	-	2	587	c.548C>T	c.(547-549)cCg>cTg	p.P183L	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	183					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TCTCCCGCCCGGCAGGGCCGG	0.756																																					p.P183L													.	.			0			c.C548T												3.0	4.0	3.0					16																	3304520		1639	3365	5004	SO:0001583	missense	4210	exon2			CCGCCCGGCAGGG	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.548C>T	16.37:g.3304520G>A	ENSP00000219596:p.Pro183Leu		24	0	0		42	0.07	3	NM_000243	1	0.00	0	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	37	CCDS10498.1	.	.	.	.	.	.	.	.	.	.	G	8.793	0.930991	0.18131	.	.	ENSG00000103313	ENST00000545159;ENST00000219596	T	0.61742	0.08	4.07	-6.27	0.02026	.	1.765980	0.02905	N	0.135918	T	0.28566	0.0707	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09314	-1.0680	10	0.46703	T	0.11	.	1.7545	0.02979	0.4388:0.2484:0.187:0.1258	.	183	O15553	MEFV_HUMAN	L	183	ENSP00000219596:P183L	ENSP00000219596:P183L	P	-	2	0	MEFV	3244521	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.046000	0.03525	-1.353000	0.02191	-0.806000	0.03193	CCG			0.756	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251464.1		NM_000243	
RP11-67H24.2	0	broad.mit.edu	37	16	32827440	32827440	+	lincRNA	DEL	T	T	-			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr16:32827440delT	ENST00000569859.1	+	0	373																											tactcttaaatccctctggtg	0.289																																					.													.	.			0			.																																											0	.			CTTAAATCCCTCT																													16.37:g.32827440delT			4	0	0		6	0.33	2	.	7	0.00	0		RNA	DEL	ENST00000569859.1	37																																																																																						0.289	RP11-67H24.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000432377.1			
NKD1	85407	mdanderson.org	37	16	50659443	50659443	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr16:50659443G>T	ENST00000268459.3	+	6	638	c.414G>T	c.(412-414)tgG>tgT	p.W138C		NM_033119.4	NP_149110.1	Q969G9	NKD1_HUMAN	naked cuticle homolog 1 (Drosophila)	138	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Interaction with DVL1, DVL2 and DVL3. {ECO:0000250}.				eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of convergent extension involved in axis elongation (GO:1901233)|positive regulation of non-canonical Wnt signaling pathway via JNK cascade (GO:1901231)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(9)|prostate(1)|urinary_tract(2)	23		all_cancers(37;0.229)		GBM - Glioblastoma multiforme(240;0.243)		GGCAGGAGTGGACCTTCACCC	0.607																																					p.W138C													.	.			0			c.G414T												102.0	87.0	92.0					16																	50659443		2198	4300	6498	SO:0001583	missense	85407	exon6			GGAGTGGACCTTC	AF358135	CCDS10743.1	16q12.1	2013-01-10			ENSG00000140807	ENSG00000140807		"""EF-hand domain containing"""	17045	protein-coding gene	gene with protein product		607851				11356022	Standard	NM_033119		Approved		uc002egg.2	Q969G9	OTTHUMG00000133169	ENST00000268459.3:c.414G>T	16.37:g.50659443G>T	ENSP00000268459:p.Trp138Cys		42	0	0		48	0.06	3	NM_033119	2	0.00	0	B2RC39|Q8WZ08	Missense_Mutation	SNP	ENST00000268459.3	37	CCDS10743.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.729685	0.89390	.	.	ENSG00000140807	ENST00000268459	T	0.00605	6.27	5.46	5.46	0.80206	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.03651	0.0104	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.32851	-0.9891	10	0.87932	D	0	-13.8489	18.9261	0.92546	0.0:0.0:1.0:0.0	.	138	Q969G9	NKD1_HUMAN	C	138	ENSP00000268459:W138C	ENSP00000268459:W138C	W	+	3	0	NKD1	49216944	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.775000	0.98995	2.551000	0.86045	0.655000	0.94253	TGG			0.607	NKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256873.1			
VPS53	55275	mdanderson.org	37	17	531342	531342	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr17:531342G>T	ENST00000571805.1	-	9	953	c.817C>A	c.(817-819)Caa>Aaa	p.Q273K	VPS53_ENST00000576149.1_5'UTR|VPS53_ENST00000401468.3_Intron|VPS53_ENST00000446250.2_Missense_Mutation_p.Q75K|VPS53_ENST00000574029.1_Intron|VPS53_ENST00000291074.5_Missense_Mutation_p.Q244K|VPS53_ENST00000437048.2_Missense_Mutation_p.Q273K			Q5VIR6	VPS53_HUMAN	vacuolar protein sorting 53 homolog (S. cerevisiae)	273					protein transport (GO:0015031)	endosome (GO:0005768)|GARP complex (GO:0000938)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(5)|lung(8)|prostate(1)	19				UCEC - Uterine corpus endometrioid carcinoma (25;0.0265)		TGGTTTTCTTGAAAAAGTACC	0.343																																					p.Q273K													.	.			0			c.C817A												136.0	127.0	130.0					17																	531342		2203	4300	6503	SO:0001583	missense	55275	exon9			TTTCTTGAAAAAG		CCDS10995.1, CCDS45558.1	17p13.3	2007-07-13	2006-12-19			ENSG00000141252			25608	protein-coding gene	gene with protein product		615850	"""vacuolar protein sorting 53 (yeast)"""			15878329	Standard	NM_018289		Approved	FLJ10979, HCCS1	uc010cjo.2	Q5VIR6		ENST00000571805.1:c.817C>A	17.37:g.531342G>T	ENSP00000459312:p.Gln273Lys		49	0	0		92	0.04	4	NM_001128159	17	0.00	0	A8K2S8|B3FH42|Q8WYW3|Q9BRR2|Q9BY02|Q9NV25	Missense_Mutation	SNP	ENST00000571805.1	37		.	.	.	.	.	.	.	.	.	.	G	16.59	3.166880	0.57476	.	.	ENSG00000141252	ENST00000437048;ENST00000446250;ENST00000291074	T;T;T	0.28454	1.61;1.61;1.61	5.9	5.9	0.94986	Vps53-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40570	0.1122	M	0.66939	2.045	0.80722	D	1	B;B;B;B	0.31274	0.317;0.202;0.24;0.202	B;B;B;B	0.36030	0.164;0.138;0.216;0.138	T	0.14227	-1.0480	10	0.41790	T	0.15	-17.9231	19.2604	0.93966	0.0:0.0:1.0:0.0	.	273;75;273;244	Q5VIR6-4;G3V0H8;Q5VIR6;Q5VIR6-2	.;.;VPS53_HUMAN;.	K	273;75;244	ENSP00000401435:Q273K;ENSP00000394386:Q75K;ENSP00000291074:Q244K	ENSP00000291074:Q244K	Q	-	1	0	VPS53	478092	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.793000	0.96121	0.563000	0.77884	CAA			0.343	VPS53-006	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000436940.2		NM_018289	
TAOK1	57551	mdanderson.org	37	17	27844489	27844489	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr17:27844489A>G	ENST00000261716.3	+	16	2242	c.1723A>G	c.(1723-1725)Agt>Ggt	p.S575G	TAOK1_ENST00000536202.1_Intron	NM_020791.2	NP_065842.1	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	575					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|execution phase of apoptosis (GO:0097194)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein phosphorylation (GO:0006468)|regulation of cytoskeleton organization (GO:0051493)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28			Colorectal(6;0.198)			TGAAAACCAGAGTACCCCCAA	0.463																																					p.S575G													.	.			0			c.A1723G												95.0	100.0	99.0					17																	27844489		2203	4300	6503	SO:0001583	missense	57551	exon16			AACCAGAGTACCC	AB037782	CCDS32601.1, CCDS56024.1	17q11.2	2014-01-28				ENSG00000160551			29259	protein-coding gene	gene with protein product		610266				10718198, 14517247	Standard	NM_020791		Approved	KIAA1361, MARKK, PSK2, MAP3K16, FLJ14314, TAO1	uc002hdz.2	Q7L7X3		ENST00000261716.3:c.1723A>G	17.37:g.27844489A>G	ENSP00000261716:p.Ser575Gly		57	0	0		61	0.05	3	NM_020791	7	0.00	0	A2RUT8|B7ZLV6|Q96L75|Q9H2K7|Q9H7S5|Q9P2I6	Missense_Mutation	SNP	ENST00000261716.3	37	CCDS32601.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040740	0.75732	.	.	ENSG00000160551	ENST00000261716	T	0.49139	0.79	5.9	5.9	0.94986	Protein kinase-like domain (1);	0.091433	0.85682	D	0.000000	T	0.59878	0.2226	M	0.73598	2.24	0.80722	D	1	P	0.45474	0.859	P	0.48873	0.593	T	0.63646	-0.6590	10	0.56958	D	0.05	.	16.378	0.83412	1.0:0.0:0.0:0.0	.	575	Q7L7X3	TAOK1_HUMAN	G	575	ENSP00000261716:S575G	ENSP00000261716:S575G	S	+	1	0	TAOK1	24868615	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.413000	0.66399	2.277000	0.76020	0.529000	0.55759	AGT			0.463	TAOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000447790.1		NM_020791	
MYCBPAP	84073	broad.mit.edu	37	17	48585969	48585969	+	Silent	SNP	T	T	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr17:48585969T>G	ENST00000323776.5	+	1	225	c.63T>G	c.(61-63)ggT>ggG	p.G21G	RP11-94C24.6_ENST00000502300.1_lincRNA|MYCBPAP_ENST00000419930.1_Silent_p.G21G|MYCBPAP_ENST00000436259.2_5'Flank	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GGCTGGCGGGTGCGGCGCAGC	0.677																																					p.G21G													.	MYCBPAP	135		0			c.T63G												4.0	6.0	5.0					17																	48585969		2028	4011	6039	SO:0001819	synonymous_variant	84073	exon1			GGCGGGTGCGGCG	BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.63T>G	17.37:g.48585969T>G			120	0.2666666667	32		168	0.30	50	NM_032133	2	0.00	0		Silent	SNP	ENST00000323776.5	37	CCDS32680.2																																																																																					0.677	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000347814.1		NM_032133	
LINGO3	645191	mdanderson.org	37	19	2291582	2291582	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr19:2291582C>T	ENST00000585527.1	-	1	441	c.194G>A	c.(193-195)cGc>cAc	p.R65H	LINGO3_ENST00000404279.1_Missense_Mutation_p.R65H			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	65						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						GCAGCGGATGCGGTTGCGGCT	0.761																																					p.R65H													.	.			0			c.G194A												5.0	6.0	6.0					19																	2291582		2018	4041	6059	SO:0001583	missense	645191	exon2			CGGATGCGGTTGC	AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.194G>A	19.37:g.2291582C>T	ENSP00000467753:p.Arg65His		13	0	0		17	0.12	2	NM_001101391	2	0.00	0		Missense_Mutation	SNP	ENST00000585527.1	37	CCDS45905.1	.	.	.	.	.	.	.	.	.	.	c	16.37	3.105564	0.56291	.	.	ENSG00000220008	ENST00000404279	T	0.33865	1.39	3.89	3.89	0.44902	.	.	.	.	.	T	0.33673	0.0871	L	0.49126	1.545	0.58432	D	0.999996	P	0.43885	0.82	B	0.38985	0.287	T	0.26608	-1.0098	9	0.41790	T	0.15	.	15.2339	0.73413	0.0:1.0:0.0:0.0	.	65	P0C6S8	LIGO3_HUMAN	H	65	ENSP00000384979:R65H	ENSP00000384979:R65H	R	-	2	0	LINGO3	2242582	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.999000	0.49473	1.875000	0.54330	0.462000	0.41574	CGC			0.761	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000451291.2		NM_001101391	
DOCK6	57572	mdanderson.org	37	19	11353781	11353781	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr19:11353781G>T	ENST00000294618.7	-	13	1445	c.1434C>A	c.(1432-1434)gaC>gaA	p.D478E		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	478					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GGCGCCTCATGTCAGCCAGGA	0.622											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D478E													.	.			0			c.C1434A												75.0	83.0	80.0					19																	11353781		2096	4229	6325	SO:0001583	missense	57572	exon13			CCTCATGTCAGCC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1434C>A	19.37:g.11353781G>T	ENSP00000294618:p.Asp478Glu		73	0	0	671	48	0.06	3	NM_020812	15	0.00	0	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	ENST00000294618.7	37	CCDS45975.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.663551	0.29515	.	.	ENSG00000130158	ENST00000294618	T	0.75367	-0.93	4.32	3.28	0.37604	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	L	0.37897	1.145	0.80722	D	1	P	0.51147	0.942	P	0.54346	0.749	T	0.62918	-0.6752	10	0.18710	T	0.47	-32.4209	6.2463	0.20820	0.3048:0.0:0.6952:0.0	.	478	Q96HP0	DOCK6_HUMAN	E	478	ENSP00000294618:D478E	ENSP00000294618:D478E	D	-	3	2	DOCK6	11214781	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.733000	0.26087	0.804000	0.34136	0.462000	0.41574	GAC			0.622	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453155.1		NM_020812	
KLK5	25818	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	51453209	51453209	+	Silent	SNP	C	C	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr19:51453209C>A	ENST00000336334.3	-	3	589	c.237G>T	c.(235-237)ccG>ccT	p.P79P	CTB-147C22.8_ENST00000594939.1_RNA|KLK5_ENST00000593428.1_Silent_p.P79P|CTB-147C22.8_ENST00000601506.1_RNA|KLK5_ENST00000391809.2_Silent_p.P79P	NM_012427.4	NP_036559	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5	79	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis development (GO:0008544)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	epidermal lamellar body (GO:0097209)|extracellular space (GO:0005615)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		CGGCCTGCCACGGCTGGGTGT	0.652																																					p.P79P													.	.			0			c.G237T												48.0	39.0	42.0					19																	51453209		2203	4300	6503	SO:0001819	synonymous_variant	25818	exon3			CTGCCACGGCTGG	AF135028	CCDS12810.1	19q13.33	2008-02-05	2006-10-27			ENSG00000167754		"""Kallikreins"""	6366	protein-coding gene	gene with protein product		605643	"""kallikrein 5"""			10514489, 10608802, 1680072, 4, 16800723, 17012259	Standard	NM_012427		Approved	SCTE, KLK-L2	uc002puf.3	Q9Y337		ENST00000336334.3:c.237G>T	19.37:g.51453209C>A			68	0	0		47	0.45	21	NM_012427	0		0	Q53ZR3|Q9HBG8	Silent	SNP	ENST00000336334.3	37	CCDS12810.1																																																																																					0.652	KLK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465057.1		NM_012427	
EPAS1	2034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	46603853	46603853	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:46603853G>A	ENST00000263734.3	+	9	1720	c.1210G>A	c.(1210-1212)Gct>Act	p.A404T		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	404					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			GGCCCAGCTGGCTCCCACCCC	0.567																																					p.A404T													.	.			0			c.G1210A												62.0	68.0	66.0					2																	46603853		2203	4300	6503	SO:0001583	missense	2034	exon9			CAGCTGGCTCCCA	U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1210G>A	2.37:g.46603853G>A	ENSP00000263734:p.Ala404Thr		70	0	0		96	0.22	21	NM_001430	52	0.15	8	Q86VA2|Q99630	Missense_Mutation	SNP	ENST00000263734.3	37	CCDS1825.1	.	.	.	.	.	.	.	.	.	.	G	35	5.577246	0.96565	.	.	ENSG00000116016	ENST00000263734	T	0.60299	0.2	5.38	5.38	0.77491	.	0.376492	0.29692	N	0.011456	T	0.80586	0.4651	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83901	0.0290	10	0.87932	D	0	.	19.1396	0.93443	0.0:0.0:1.0:0.0	.	404	Q99814	EPAS1_HUMAN	T	404	ENSP00000263734:A404T	ENSP00000263734:A404T	A	+	1	0	EPAS1	46457357	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.751000	0.98889	2.521000	0.84997	0.462000	0.41574	GCT			0.567	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250752.2		NM_001430	
ANKRD36C	400986	broad.mit.edu	37	2	96646519	96646519	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:96646519T>A	ENST00000456556.1	-	5	692	c.608A>T	c.(607-609)cAt>cTt	p.H203L				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	203							ion channel inhibitor activity (GO:0008200)	p.H203L(2)		breast(1)|endometrium(8)|kidney(5)|lung(4)	18						AGTAACAGCATGTATGAGGGC	0.313																																					.													ENSG00000174501,NS,carcinoma,0,2	.		2	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																									SO:0001583	missense	400986	.			ACAGCATGTATGA	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.608A>T	2.37:g.96646519T>A	ENSP00000403302:p.His203Leu		185	0	0		231	0.02	5	.	0		0	C9JZ08|Q15694|Q53S06|Q658V2	Missense_Mutation	SNP	ENST00000456556.1	37		.	.	.	.	.	.	.	.	.	.	t	0.018	-1.473154	0.01044	.	.	ENSG00000174501	ENST00000456556	T	0.60920	0.15	0.845	0.845	0.18950	.	0.746432	0.10173	N	0.706819	T	0.18257	0.0438	N	0.00771	-1.2	0.20489	N	0.999892	.	.	.	.	.	.	T	0.27938	-1.0059	8	0.02654	T	1	.	2.9617	0.05895	0.6006:0.0:0.0:0.3994	.	.	.	.	L	203	ENSP00000403302:H203L	ENSP00000403302:H203L	H	-	2	0	AC073995.2	96010246	0.995000	0.38212	0.906000	0.35671	0.376000	0.30014	0.366000	0.20365	-0.138000	0.11434	-1.957000	0.00481	CAT			0.313	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000338799.2		NM_001010914	
BIN1	274	mdanderson.org	37	2	127825793	127825793	+	Nonsense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:127825793G>T	ENST00000316724.5	-	7	969	c.558C>A	c.(556-558)tgC>tgA	p.C186*	BIN1_ENST00000409400.1_Intron|BIN1_ENST00000259238.4_Intron|BIN1_ENST00000346226.3_Intron|BIN1_ENST00000352848.3_Intron|BIN1_ENST00000351659.3_Nonsense_Mutation_p.C186*|BIN1_ENST00000393041.3_Intron|BIN1_ENST00000348750.4_Intron|BIN1_ENST00000376113.2_Intron|BIN1_ENST00000393040.3_Intron|BIN1_ENST00000357970.3_Nonsense_Mutation_p.C186*	NM_139343.2	NP_647593.1	O00499	BIN1_HUMAN	bridging integrator 1	186	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|lipid tube assembly (GO:0060988)|muscle cell differentiation (GO:0042692)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of endocytosis (GO:0045807)|positive regulation of GTPase activity (GO:0043547)|regulation of cell cycle arrest (GO:0071156)|regulation of neuron differentiation (GO:0045664)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|axon initial segment (GO:0043194)|axon terminus (GO:0043679)|cerebellar mossy fiber (GO:0044300)|cytoplasm (GO:0005737)|I band (GO:0031674)|lipid tube (GO:0060987)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)|T-tubule (GO:0030315)|varicosity (GO:0043196)|Z disc (GO:0030018)	identical protein binding (GO:0042802)|tau protein binding (GO:0048156)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(3)|skin(3)	24	Colorectal(110;0.0831)			BRCA - Breast invasive adenocarcinoma(221;0.073)		GTTTGCCTTGGCACCACTGGG	0.592											OREG0014963	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C186X													.	.			0			c.C558A												85.0	68.0	74.0					2																	127825793		2203	4300	6503	SO:0001587	stop_gained	274	exon7			GCCTTGGCACCAC	U68485	CCDS2137.1, CCDS2138.1, CCDS2139.1, CCDS2140.1, CCDS2141.1, CCDS2142.1, CCDS2143.1, CCDS42743.1, CCDS42744.1, CCDS46403.1	2q14	2014-09-17			ENSG00000136717	ENSG00000136717			1052	protein-coding gene	gene with protein product	"""amphiphysin II"""	601248		AMPHL		8725406, 8782822, 17676042	Standard	NM_004305		Approved	SH3P9, AMPH2	uc002tns.2	O00499	OTTHUMG00000131465	ENST00000316724.5:c.558C>A	2.37:g.127825793G>T	ENSP00000316779:p.Cys186*		35	0	0	1560	42	0.07	3	NM_139343	22	0.00	0	O00297|O00545|O43867|O60552|O60553|O60554|O60555|O75514|O75515|O75516|O75517|O75518|Q659B7|Q92944|Q99688	Nonsense_Mutation	SNP	ENST00000316724.5	37	CCDS2138.1	.	.	.	.	.	.	.	.	.	.	.	39	7.536251	0.98345	.	.	ENSG00000136717	ENST00000357970;ENST00000351659;ENST00000316724	.	.	.	4.87	2.13	0.27403	.	0.236798	0.36338	N	0.002644	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.1438	8.8992	0.35484	0.2471:0.0:0.7529:0.0	.	.	.	.	X	186	.	ENSP00000316779:C186X	C	-	3	2	BIN1	127542263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.331000	0.43894	0.277000	0.22141	0.549000	0.68633	TGC			0.592	BIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254298.2		NM_139343	
POTEE	445582	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	131975985	131975985	+	Missense_Mutation	SNP	G	G	C			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:131975985G>C	ENST00000356920.5	+	1	104	c.10G>C	c.(10-12)Gag>Cag	p.E4Q	POTEE_ENST00000358087.5_Missense_Mutation_p.E4Q|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	4					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GATGGTGGTTGAGGTTGATTC	0.532																																					p.E4Q													.	.			0			c.G10C												17.0	21.0	20.0					2																	131975985		1952	4121	6073	SO:0001583	missense	445582	exon1			GTGGTTGAGGTTG	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.10G>C	2.37:g.131975985G>C	ENSP00000439189:p.Glu4Gln		406	0	0		456	0.22	102	NM_001083538	0		0	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	37	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	6.316	0.426409	0.11987	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.81247	-1.47;0.92	.	.	.	.	.	.	.	.	T	0.70193	0.3196	L	0.27053	0.805	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.61491	-0.7052	7	0.87932	D	0	.	.	.	.	.	4	Q6S8J3	POTEE_HUMAN	Q	4	ENSP00000439189:E4Q;ENSP00000443049:E4Q	ENSP00000439189:E4Q	E	+	1	0	AC131180.1	131692455	0.009000	0.17119	0.033000	0.17914	0.033000	0.12548	0.711000	0.25764	0.159000	0.19401	0.162000	0.16502	GAG			0.532	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_001083538	
ANKRD30BL	554226	broad.mit.edu	37	2	132919192	132919192	+	Silent	SNP	G	G	A	rs111295191		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:132919192G>A	ENST00000409867.1	-	1	336	c.87C>T	c.(85-87)aaC>aaT	p.N29N	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	29										endometrium(1)|kidney(3)	4						CGTAAGAGTCGTTGTTGGTGT	0.602																																					.													.	ANKRD30BL	36		0			.																																									SO:0001819	synonymous_variant	554226	.			AGAGTCGTTGTTG			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.87C>T	2.37:g.132919192G>A			146	0.0068493151	1		181	0.02	4	.	0		0	B8ZZL7	Silent	SNP	ENST00000409867.1	37																																																																																						0.602	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
KCNH7	90134	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	163374508	163374508	+	Silent	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:163374508G>A	ENST00000332142.5	-	4	723	c.624C>T	c.(622-624)tgC>tgT	p.C208C	KCNH7_ENST00000328032.4_Silent_p.C208C|KCNH7_ENST00000477019.1_5'UTR	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	208					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CAGAGGGGCTGCAGCTTTCTT	0.448																																					p.C208C	GBM(196;1492 2208 17507 24132 45496)												.	KCNH7	378		0			c.C624T												135.0	132.0	133.0					2																	163374508		2203	4300	6503	SO:0001819	synonymous_variant	90134	exon4			GGGGCTGCAGCTT	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.624C>T	2.37:g.163374508G>A			225	0	0		230	0.04	9	NM_033272	0		0	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Silent	SNP	ENST00000332142.5	37	CCDS2219.1																																																																																					0.448	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255093.1		NM_033272	
ABCA12	26154	broad.mit.edu	37	2	215840567	215840567	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr2:215840567G>T	ENST00000272895.7	-	34	5542	c.5323C>A	c.(5323-5325)Cca>Aca	p.P1775T	ABCA12_ENST00000389661.4_Missense_Mutation_p.P1457T	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	1775					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGAATCTCTGGATAACTGTTG	0.453																																					p.P1775T	Ovarian(66;664 1488 5121 34295)												.	ABCA12	368		0			c.C5323A												146.0	141.0	143.0					2																	215840567		2203	4300	6503	SO:0001583	missense	26154	exon34			TCTCTGGATAACT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.5323C>A	2.37:g.215840567G>T	ENSP00000272895:p.Pro1775Thr		145	0	0		189	0.03	5	NM_173076	0		0	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	37	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843679	0.91197	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.93859	-2.22;-3.3	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000002	D	0.97340	0.9130	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.97234	0.9886	10	0.87932	D	0	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	1775;1457	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	T	1775;1457	ENSP00000272895:P1775T;ENSP00000374312:P1457T	ENSP00000272895:P1775T	P	-	1	0	ABCA12	215548812	1.000000	0.71417	0.877000	0.34402	0.956000	0.61745	9.420000	0.97426	2.941000	0.99782	0.655000	0.94253	CCA			0.453	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337111.1		NM_173076	
NCAM2	4685	broad.mit.edu;ucsc.edu;bcgsc.ca	37	21	22664454	22664454	+	Missense_Mutation	SNP	T	T	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr21:22664454T>A	ENST00000400546.1	+	5	761	c.512T>A	c.(511-513)cTg>cAg	p.L171Q	NCAM2_ENST00000535285.1_Missense_Mutation_p.L196Q|NCAM2_ENST00000486367.1_3'UTR|NCAM2_ENST00000284894.7_Missense_Mutation_p.L29Q	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	171	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AACAATAACCTGCAGATTCTC	0.393																																					p.L171Q													.	NCAM2	220		0			c.T512A												148.0	137.0	140.0					21																	22664454		1833	4101	5934	SO:0001583	missense	4685	exon5			ATAACCTGCAGAT		CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.512T>A	21.37:g.22664454T>A	ENSP00000383392:p.Leu171Gln		125	0.008	1		159	0.18	28	NM_004540	0		0	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	ENST00000400546.1	37	CCDS42910.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.483996	0.84854	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;D;T	0.92397	-0.33;-3.03;-0.33	5.48	5.48	0.80851	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97892	0.9307	H	0.99090	4.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.99;1.0;1.0	D	0.99334	1.0910	10	0.87932	D	0	-8.2878	14.6778	0.68993	0.0:0.0:0.0:1.0	.	196;29;171	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	Q	171;29;196	ENSP00000383392:L171Q;ENSP00000284894:L29Q;ENSP00000441887:L196Q	ENSP00000284894:L29Q	L	+	2	0	NCAM2	21586325	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.636000	0.83301	2.206000	0.71126	0.533000	0.62120	CTG			0.393	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000170915.1		NM_004540	
SON	6651	hgsc.bcm.edu	37	21	34927489	34927489	+	Silent	SNP	G	G	C	rs545015873	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr21:34927489G>C	ENST00000356577.4	+	3	6427	c.5952G>C	c.(5950-5952)cgG>cgC	p.R1984R	SON_ENST00000381679.4_Silent_p.R1984R|SON_ENST00000290239.6_Silent_p.R1984R|SON_ENST00000300278.4_Silent_p.R1984R|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1984	2 X 19 AA repeats of P-S-R-R-R-R-S-R-S-V- V-R-R-R-S-F-S-I-S.|7 X 7 AA repeats of P-S-R-R-S-R-[TS].				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.R1984R(2)		breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						ccagccgccggagccgcaccc	0.701													g|||	4	0.000798722	0.0023	0.0	5008	,	,		5843	0.0		0.001	False		,,,				2504	0.0				p.R1984R													SON_ENST00000300278,NS,carcinoma,0,2	SON_ENST00000300278	0	2	2	Substitution - coding silent(2)	endometrium(2)	c.G5952C												20.0	22.0	21.0					21																	34927489		2199	4293	6492	SO:0001819	synonymous_variant	6651	exon3			CCGCCGGAGCCGC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5952G>C	21.37:g.34927489G>C			11	0.0909090909	1		22	0.23	5	NM_032195	38	0.05	2	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	g	3.291	-0.145003	0.06627	.	.	ENSG00000159140	ENST00000436227	.	.	.	4.22	-0.891	0.10573	.	.	.	.	.	T	0.57519	0.2059	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53222	-0.8469	4	.	.	.	.	10.594	0.45327	0.0789:0.5195:0.4016:0.0	.	.	.	.	A	979	.	.	G	+	2	0	SON	33849359	0.998000	0.40836	0.805000	0.32314	0.728000	0.41692	0.803000	0.27083	-0.153000	0.11137	-0.126000	0.14955	GGA			0.701	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140978.2		NM_138927	
COL18A1	80781	broad.mit.edu	37	21	46876429	46876430	+	Frame_Shift_Ins	INS	-	-	C			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr21:46876429_46876430insC	ENST00000359759.4	+	1	1006_1007	c.985_986insC	c.(985-987)gccfs	p.A329fs	COL18A1_ENST00000355480.5_Intron|COL18A1_ENST00000400337.2_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	329	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		TGACCCCGAGGCCCCCGCCGGT	0.673																																					.													.	COL18A1	129		0			.																																									SO:0001589	frameshift_variant	80781	.			CCCGAGGCCCCCG		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.990dupC	21.37:g.46876434_46876434dupC	ENSP00000352798:p.Ala329fs		37	0	0		74	0.05	4	.	1	0.00	0	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Frame_Shift_Ins	INS	ENST00000359759.4	37																																																																																						0.673	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000206827.1			
MORC2	22880	mdanderson.org	37	22	31337530	31337530	+	Silent	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr22:31337530G>T	ENST00000397641.3	-	9	1122	c.714C>A	c.(712-714)cgC>cgA	p.R238R	MORC2_ENST00000469915.1_5'UTR|MORC2_ENST00000215862.4_Silent_p.R176R			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	238						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						CACGGAACGAGCGCCGCTCTG	0.577																																					p.R176R													.	.			0			c.C528A												58.0	49.0	52.0					22																	31337530		2203	4300	6503	SO:0001819	synonymous_variant	22880	exon10			GAACGAGCGCCGC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.714C>A	22.37:g.31337530G>T			59	0	0		53	0.06	3	NM_014941	37	0.00	0	B2RNB1|Q9UF28|Q9Y6V2	Silent	SNP	ENST00000397641.3	37																																																																																						0.577	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000321710.2		NM_014941	
BAIAP2L2	80115	mdanderson.org	37	22	38503888	38503888	+	Silent	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr22:38503888G>T	ENST00000381669.3	-	4	391	c.247C>A	c.(247-249)Cgg>Agg	p.R83R	BAIAP2L2_ENST00000332536.5_Silent_p.R83R	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	83	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					TTCAAGTGCCGCTGGGTGTCA	0.622																																					p.R83R													.	.			0			c.C247A												103.0	109.0	107.0					22																	38503888		2061	4206	6267	SO:0001819	synonymous_variant	80115	exon4			AGTGCCGCTGGGT	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.247C>A	22.37:g.38503888G>T			65	0	0		51	0.06	3	NM_025045	38	0.00	0	B0QYE2|Q96BG7	Silent	SNP	ENST00000381669.3	37	CCDS43018.1																																																																																					0.622	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321727.1		NM_025045	
MFSD1	64747	broad.mit.edu;mdanderson.org	37	3	158538116	158538116	+	Splice_Site	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr3:158538116G>T	ENST00000264266.8	+	9	925		c.e9+1		MFSD1_ENST00000415822.2_Splice_Site|MFSD1_ENST00000392813.4_Splice_Site			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			GACTTGGGAAGTGAGTATTCT	0.338																																					.	Pancreas(62;1186 1654 36636 37908)												MFSD1,NS,carcinoma,0,1	MFSD1	88	1	0			c.893+1G>T												158.0	140.0	146.0					3																	158538116		2203	4299	6502	SO:0001630	splice_region_variant	64747	exon8			TGGGAAGTGAGTA	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.863+1G>T	3.37:g.158538116G>T			105	0	0		146	0.03	5	NM_001167903	0		0	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Splice_Site	SNP	ENST00000264266.8	37		.	.	.	.	.	.	.	.	.	.	G	16.31	3.087755	0.55968	.	.	ENSG00000118855	ENST00000415822;ENST00000392813;ENST00000264266;ENST00000361159;ENST00000477743	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1193	0.93355	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MFSD1	160020810	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	9.155000	0.94700	2.511000	0.84671	0.573000	0.79308	.			0.338	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000470730.1		NM_022736	Intron
CHRD	8646	mdanderson.org	37	3	184104344	184104344	+	Missense_Mutation	SNP	T	T	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr3:184104344T>G	ENST00000204604.1	+	16	2243	c.1997T>G	c.(1996-1998)gTg>gGg	p.V666G	EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000545352.1_Intron|CHRD_ENST00000450923.1_Missense_Mutation_p.V666G|CHRD_ENST00000348986.3_Missense_Mutation_p.V626G	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	666					BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCGAGGGGGTGCGGGCGCTG	0.726																																					p.V666G													.	.			0			c.T1997G												3.0	4.0	3.0					3																	184104344		1677	3445	5122	SO:0001583	missense	8646	exon16			AGGGGGTGCGGGC	AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1997T>G	3.37:g.184104344T>G	ENSP00000204604:p.Val666Gly		54	0.2962962963	16		70	0.29	20	NM_003741	7	0.00	0	O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	ENST00000204604.1	37	CCDS3266.1	.	.	.	.	.	.	.	.	.	.	T	11.39	1.625293	0.28889	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000342610	T;T;T	0.14266	2.75;2.53;2.52	4.58	-6.5	0.01884	.	1.936180	0.02212	N	0.063242	T	0.10252	0.0251	L	0.27053	0.805	0.09310	N	0.999999	B;B;B	0.26845	0.161;0.032;0.025	B;B;B	0.24394	0.053;0.021;0.024	T	0.15492	-1.0435	10	0.17832	T	0.49	0.1754	14.5119	0.67794	0.0:0.1738:0.0:0.8262	.	626;666;666	Q9H2X0-5;E7ESX1;Q9H2X0	.;.;CHRD_HUMAN	G	666;666;626;379	ENSP00000204604:V666G;ENSP00000408972:V666G;ENSP00000334036:V626G	ENSP00000204604:V666G	V	+	2	0	CHRD	185587038	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.285000	0.01153	-1.320000	0.02283	-0.479000	0.04858	GTG			0.726	CHRD-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000280432.1		NM_003741	
LINC00969	440993	broad.mit.edu	37	3	195412436	195412440	+	lincRNA	DEL	AAAGC	AAAGC	-	rs200034737|rs201662460		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	AAAGC	AAAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr3:195412436_195412440delAAAGC	ENST00000445430.1	+	0	3633_3637									long intergenic non-protein coding RNA 969																		gcatttttgtaaagcaaagcactga	0.4																																					.													.	.			0			.																																											0	.			TTTTGTAAAGCAA	AK128346		3q29	2013-06-07			ENSG00000242086	ENSG00000242086		"""Long non-coding RNAs"""	48729	non-coding RNA	RNA, long non-coding							Standard	XR_427455		Approved				OTTHUMG00000155834		3.37:g.195412441_195412445delAAAGC			10	0	0		9	0.22	2	.	6	0.00	0		RNA	DEL	ENST00000445430.1	37																																																																																						0.400	LINC00969-038	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000341951.1			
GSX2	170825	broad.mit.edu	37	4	54966900	54966900	+	Missense_Mutation	SNP	A	A	C			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:54966900A>C	ENST00000326902.2	+	1	703	c.389A>C	c.(388-390)cAc>cCc	p.H130P	FIP1L1_ENST00000507166.1_Intron|AC110298.1_ENST00000408292.1_RNA|GSX2_ENST00000503800.1_Intron	NM_133267.2	NP_573574.1	Q9BZM3	GSX2_HUMAN	GS homeobox 2	130	Poly-His.				forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|hindbrain morphogenesis (GO:0021575)|neuron fate specification (GO:0048665)|olfactory bulb interneuron differentiation (GO:0021889)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of cell migration (GO:0030334)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|spinal cord association neuron differentiation (GO:0021527)|subpallium neuron fate commitment (GO:0060163)|telencephalon regionalization (GO:0021978)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(2)|lung(2)	6	all_cancers(7;0.00671)|Lung NSC(11;0.0154)|all_neural(26;0.0209)|Glioma(25;0.08)|all_epithelial(27;0.147)		LUSC - Lung squamous cell carcinoma(32;0.00216)			catcaccaccacccgccgcag	0.721																																					p.H130P													.	GSX2	27		0			c.A389C												7.0	6.0	6.0					4																	54966900		1603	2993	4596	SO:0001583	missense	170825	exon1			ACCACCACCCGCC		CCDS3494.1	4q12	2012-03-09			ENSG00000180613	ENSG00000180613		"""Homeoboxes / ANTP class : HOXL subclass"""	24959	protein-coding gene	gene with protein product						11861295, 12205114	Standard	NM_133267		Approved	Gsh2	uc010igp.1	Q9BZM3	OTTHUMG00000128696	ENST00000326902.2:c.389A>C	4.37:g.54966900A>C	ENSP00000319118:p.His130Pro		68	0.2941176471	20		71	0.25	18	NM_133267	0		0		Missense_Mutation	SNP	ENST00000326902.2	37	CCDS3494.1	.	.	.	.	.	.	.	.	.	.	A	13.61	2.287372	0.40494	.	.	ENSG00000180613	ENST00000326902	D	0.91351	-2.83	3.58	2.34	0.29019	.	0.963572	0.08465	N	0.941848	T	0.79741	0.4498	N	0.14661	0.345	0.80722	D	1	B	0.30361	0.277	B	0.23018	0.043	T	0.67476	-0.5661	10	0.25751	T	0.34	.	6.8113	0.23807	0.7598:0.2402:0.0:0.0	.	130	Q9BZM3	GSX2_HUMAN	P	130	ENSP00000319118:H130P	ENSP00000319118:H130P	H	+	2	0	GSX2	54661657	0.780000	0.28664	0.829000	0.32907	0.972000	0.66771	-0.440000	0.06888	0.538000	0.28769	0.402000	0.26972	CAC			0.721	GSX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250595.1		NM_133267	
CLOCK	9575	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	56319847	56319847	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:56319847A>G	ENST00000309964.4	-	13	1377	c.1127T>C	c.(1126-1128)gTa>gCa	p.V376A	CLOCK_ENST00000381322.1_Missense_Mutation_p.V376A|CLOCK_ENST00000513440.1_Missense_Mutation_p.V376A	NM_004898.3	NP_004889.1	O15516	CLOCK_HUMAN	clock circadian regulator	376	Interaction with NR3C1. {ECO:0000250|UniProtKB:O08785}.|PAC.				cellular response to ionizing radiation (GO:0071479)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA damage checkpoint (GO:0000077)|histone acetylation (GO:0016573)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of transcription, DNA-templated (GO:0045892)|photoperiodism (GO:0009648)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of hair cycle (GO:0042634)|regulation of insulin secretion (GO:0050796)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of type B pancreatic cell development (GO:2000074)|response to redox state (GO:0051775)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|chromosome (GO:0005694)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone acetyltransferase activity (GO:0004402)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(8)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(11;0.00335)|Glioma(25;0.08)|all_epithelial(27;0.0992)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0107)			TTATTACCTTACTACAGTGTG	0.343																																					p.V376A													.	.			0			c.T1127C												66.0	66.0	66.0					4																	56319847		2203	4300	6503	SO:0001583	missense	9575	exon14			TACCTTACTACAG	AF011568	CCDS3500.1	4q12	2012-12-07	2012-12-07		ENSG00000134852	ENSG00000134852		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	2082	protein-coding gene	gene with protein product		601851	"""clock (mouse) homolog"", ""clock homolog (mouse)"""			10198158	Standard	NM_001267843		Approved	KIAA0334, KAT13D, bHLHe8	uc003hba.2	O15516	OTTHUMG00000102141	ENST00000309964.4:c.1127T>C	4.37:g.56319847A>G	ENSP00000308741:p.Val376Ala		207	0	0		157	0.38	59	NM_004898	2	0.50	1	A0AV01|A2I2N9|O14516|Q9UIT8	Missense_Mutation	SNP	ENST00000309964.4	37	CCDS3500.1	.	.	.	.	.	.	.	.	.	.	A	31	5.069250	0.93950	.	.	ENSG00000134852	ENST00000309964;ENST00000381322;ENST00000513440	T;T;T	0.20069	2.1;2.1;2.1	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.38134	0.1029	L	0.49350	1.555	0.80722	D	1	P	0.51653	0.947	P	0.58577	0.841	T	0.09185	-1.0686	10	0.87932	D	0	.	16.2826	0.82703	1.0:0.0:0.0:0.0	.	376	O15516	CLOCK_HUMAN	A	376	ENSP00000308741:V376A;ENSP00000370723:V376A;ENSP00000426983:V376A	ENSP00000308741:V376A	V	-	2	0	CLOCK	56014604	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.307000	0.77673	0.528000	0.53228	GTA			0.343	CLOCK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000361993.2		NM_004898	
PF4V1	5197	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	74719119	74719119	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:74719119C>G	ENST00000226524.3	+	1	214	c.40C>G	c.(40-42)Cgc>Ggc	p.R14G		NM_002620.2	NP_002611.1	P10720	PF4V_HUMAN	platelet factor 4 variant 1	14					cell chemotaxis (GO:0060326)|immune response (GO:0006955)	extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|liver(2)	3	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			CCGCGCCACCCGCCAGGAGAT	0.657																																					p.R14G													.	PF4V1	8		0			c.C40G												27.0	28.0	28.0					4																	74719119		2203	4299	6502	SO:0001583	missense	5197	exon1			GCCACCCGCCAGG	M26167	CCDS3561.1	4q12-q21	2008-08-15			ENSG00000109272	ENSG00000109272			8862	protein-coding gene	gene with protein product		173461				2725510	Standard	NM_002620		Approved	SCYB4V1, CXCL4V1, CXCL4L1	uc003hhg.1	P10720	OTTHUMG00000130177	ENST00000226524.3:c.40C>G	4.37:g.74719119C>G	ENSP00000226524:p.Arg14Gly		213	0.0046948357	1		151	0.42	64	NM_002620	0		0	A1L4S0	Missense_Mutation	SNP	ENST00000226524.3	37	CCDS3561.1	.	.	.	.	.	.	.	.	.	.	C	4.956	0.177585	0.09443	.	.	ENSG00000109272	ENST00000226524	.	.	.	3.29	-6.58	0.01836	.	5.764040	0.00166	N	0.000009	T	0.15219	0.0367	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.09400	-1.0676	9	0.26408	T	0.33	.	2.2191	0.03968	0.2168:0.2754:0.3735:0.1343	.	14	P10720	PF4V_HUMAN	G	14	.	ENSP00000226524:R14G	R	+	1	0	PF4V1	74937983	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.229000	0.02945	-1.829000	0.01201	-1.290000	0.01357	CGC			0.657	PF4V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252495.1			
TRPC3	7222	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	122831506	122831506	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:122831506T>C	ENST00000379645.3	-	6	1668	c.1595A>G	c.(1594-1596)gAa>gGa	p.E532G	TRPC3_ENST00000513531.1_Missense_Mutation_p.E404G|TRPC3_ENST00000264811.5_Missense_Mutation_p.E459G	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	447					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CCTAGGTCCTTCCAGCCAGAG	0.453																																					p.E532G													.	.			0			c.A1595G												168.0	151.0	157.0					4																	122831506		2203	4300	6503	SO:0001583	missense	7222	exon6			GGTCCTTCCAGCC	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1595A>G	4.37:g.122831506T>C	ENSP00000368966:p.Glu532Gly		61	0	0		57	0.33	19	NM_001130698	0		0	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	37	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.180117	0.78564	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.98455	-4.94;-4.94;-4.94	5.57	5.57	0.84162	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97353	0.9134	L	0.46614	1.455	0.58432	D	0.999992	B;P;P	0.41569	0.389;0.755;0.578	B;P;P	0.48873	0.314;0.593;0.593	D	0.96933	0.9682	10	0.25751	T	0.34	-9.4668	15.7186	0.77688	0.0:0.0:0.0:1.0	.	447;404;532	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	G	459;532;404	ENSP00000264811:E459G;ENSP00000368966:E532G;ENSP00000426899:E404G	ENSP00000264811:E459G	E	-	2	0	TRPC3	123050956	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	6.084000	0.71335	2.119000	0.64992	0.459000	0.35465	GAA			0.453	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000364252.1		NM_003305	
SMARCA5	8467	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	4	144471183	144471186	+	Frame_Shift_Del	DEL	TTGA	TTGA	-			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	TTGA	TTGA					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:144471183_144471186delTTGA	ENST00000283131.3	+	23	3481_3484	c.3019_3022delTTGA	c.(3019-3024)ttgattfs	p.LI1007fs		NM_003601.3	NP_003592.3	O60264	SMCA5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5	1007	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA-templated transcription, initiation (GO:0006352)|double-strand break repair (GO:0006302)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromatin silencing complex (GO:0005677)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NURF complex (GO:0016589)|RSF complex (GO:0031213)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)		EWSR1/SMARCA5(2)	endometrium(2)|kidney(2)|large_intestine(9)|lung(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_hematologic(180;0.158)					CTTAATTACTTTGATTGAAAGAGA	0.338																																					p.1006_1007del													.	SMARCA5	73		0			c.3018_3021del																																									SO:0001589	frameshift_variant	8467	exon23			ATTACTTTGATTG	AB010882	CCDS3761.1	4q31.1-q31.2	2011-04-20			ENSG00000153147	ENSG00000153147			11101	protein-coding gene	gene with protein product		603375				9730600	Standard	NM_003601		Approved	hSNF2H, hISWI, ISWI	uc003ijg.3	O60264	OTTHUMG00000161474	ENST00000283131.3:c.3019_3022delTTGA	4.37:g.144471187_144471190delTTGA	ENSP00000283131:p.Leu1007fs		101	0	0		90	0.34	31	NM_003601	142	0.00	0		Frame_Shift_Del	DEL	ENST00000283131.3	37	CCDS3761.1																																																																																					0.338	SMARCA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000365077.3			
GLRB	2743	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	158057651	158057651	+	Missense_Mutation	SNP	A	A	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:158057651A>G	ENST00000264428.4	+	5	598	c.328A>G	c.(328-330)Aaa>Gaa	p.K110E	GLRB_ENST00000509282.1_Missense_Mutation_p.K110E|GLRB_ENST00000541722.1_Missense_Mutation_p.K110E|GLRB_ENST00000512619.1_Intron	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	110					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	CCTGAGACAAAAATGGAATGA	0.403																																					p.K110E													.	.			0			c.A328G												53.0	54.0	54.0					4																	158057651		2203	4300	6503	SO:0001583	missense	2743	exon5			AGACAAAAATGGA	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.328A>G	4.37:g.158057651A>G	ENSP00000264428:p.Lys110Glu		175	0	0		151	0.42	63	NM_000824	3	0.33	1	A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	ENST00000264428.4	37	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	A	17.50	3.406391	0.62399	.	.	ENSG00000109738	ENST00000264428;ENST00000541722;ENST00000509282	T;T;T	0.78816	-1.21;-1.21;-1.21	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052700	0.64402	D	0.000001	T	0.65913	0.2737	N	0.20445	0.575	0.39330	D	0.965408	B	0.16396	0.017	B	0.19391	0.025	T	0.62353	-0.6872	10	0.29301	T	0.29	.	15.3155	0.74074	1.0:0.0:0.0:0.0	.	110	P48167	GLRB_HUMAN	E	110	ENSP00000264428:K110E;ENSP00000441873:K110E;ENSP00000427186:K110E	ENSP00000264428:K110E	K	+	1	0	GLRB	158277101	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	5.312000	0.65792	2.012000	0.59069	0.455000	0.32223	AAA			0.403	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366507.1		NM_000824	
Unknown	0	bcgsc.ca	37	4	189659658	189659658	+	IGR	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr4:189659658G>A								RNU7-192P (21779 upstream) : RP11-756P10.4 (19174 downstream)																							AGCGCCAGGCGGGGTCTGAAG	0.682																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CCAGGCGGGGTCT																													4.37:g.189659658G>A			297	0	0		250	0.08	21	.	7	0.00	0		RNA	SNP		37																																																																																					0	0.682										
FLJ33360	401172	broad.mit.edu	37	5	6337066	6337067	+	lincRNA	DEL	AC	AC	-	rs371668571		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr5:6337066_6337067delAC	ENST00000507444.1	-	0	143					NR_028351.1																						acacatacatacacacacacac	0.475																																					.													.	.			0			.																																											0	.			ATACATACACACA																													5.37:g.6337076_6337077delAC			9	0	0		11	0.36	4	.	0		0		RNA	DEL	ENST00000507444.1	37																																																																																						0.475	CTD-2324F15.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000365707.1			
CTC-551A13.1	0	bcgsc.ca	37	5	110320031	110320031	+	lincRNA	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr5:110320031C>T	ENST00000507627.1	-	0	482																											CTCCAGCAACCACTTCTTGAG	0.562																																					.													.	.			0			.																																											0	.			AGCAACCACTTCT																													5.37:g.110320031C>T			31	0	0		30	0.33	10	.	0		0		RNA	SNP	ENST00000507627.1	37																																																																																						0.562	CTC-551A13.1-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000372487.1			
FCHSD1	89848	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	5	141026222	141026223	+	Missense_Mutation	DNP	CG	CG	AT	rs372866853		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	CG	CG					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr5:141026222_141026223CG>AT	ENST00000435817.2	-	11	1041_1042	c.991_992CG>AT	c.(991-993)CGc>ATc	p.R331I	FCHSD1_ENST00000523856.1_5'UTR|FCHSD1_ENST00000522126.1_Missense_Mutation_p.R255I|FCHSD1_ENST00000522783.1_Missense_Mutation_p.R329I	NM_033449.2	NP_258260.1	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	331									FCHSD1/BRAF(2)	central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGTCAAGCGCTGAACCTCT	0.604																																					p.R331I													.	.			0			c.C991A																																									SO:0001583	missense	89848	exon11			GTCAAGCGCTGAA	AK027281	CCDS47295.1	5q31.3	2008-02-05			ENSG00000197948	ENSG00000197948			25463	protein-coding gene	gene with protein product						11214971, 15067381	Standard	NM_033449		Approved	FLJ00007	uc003llk.3	Q86WN1	OTTHUMG00000163762	ENST00000435817.2:c.991_992delinsAT	5.37:g.141026222_141026223delinsAT	ENSP00000399259:p.Arg331Ile		32	0	0		40	0.25	10	NM_033449	15	0.00	0	Q6UX75|Q86Y77|Q9NXX8	Missense_Mutation	DNP	ENST00000435817.2	37	CCDS47295.1																																																																																					0.604	FCHSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375282.2		NM_033449	
TFAP2A	7020	broad.mit.edu;mdanderson.org	37	6	10402739	10402739	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:10402739G>T	ENST00000482890.1	-	6	1221	c.869C>A	c.(868-870)aCa>aAa	p.T290K	TFAP2A_ENST00000379608.3_Missense_Mutation_p.T284K|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379613.3_Missense_Mutation_p.T292K|TFAP2A_ENST00000379604.2_Missense_Mutation_p.T290K|TFAP2A_ENST00000319516.4_Missense_Mutation_p.T286K			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	290	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				TACTAGTGATGTGAGCAGGGT	0.398																																					p.T290K													.	TFAP2A	129		0			c.C869A												166.0	142.0	150.0					6																	10402739		2203	4300	6503	SO:0001583	missense	7020	exon5			AGTGATGTGAGCA	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.869C>A	6.37:g.10402739G>T	ENSP00000418541:p.Thr290Lys		129	0	0		85	0.05	4	NM_003220	0		0	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	37	CCDS4510.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	19.87|19.87|19.87	3.906698|3.906698|3.906698	0.72868|0.72868|0.72868	.|.|.	.|.|.	ENSG00000137203|ENSG00000137203|ENSG00000137203	ENST00000475264|ENST00000461628|ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890;ENST00000466073	.|.|D;D;D;D;D;D	.|.|0.97279	.|.|-4.32;-4.32;-4.32;-4.32;-4.32;-4.32	5.91|5.91|5.91	5.91|5.91|5.91	0.95273|0.95273|0.95273	.|.|Transcription factor AP-2, C-terminal (2);	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	D|D|D	0.98994|0.98994|0.98994	0.9657|0.9657|0.9657	M|M|M	0.93375|0.93375|0.93375	3.41|3.41|3.41	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D;D	.|.|0.89917	.|.|0.997;0.996;0.997;1.0;1.0	.|.|D;D;D;D;D	.|.|0.91635	.|.|0.994;0.997;0.994;0.998;0.999	D|D|D	0.99353|0.99353|0.99353	1.0915|1.0915|1.0915	5|5|10	.|.|0.87932	.|.|D	.|.|0	-5.4102|-5.4102|-5.4102	20.2985|20.2985|20.2985	0.98592|0.98592|0.98592	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|290;292;286;290;284	.|.|C1K3N0;Q96SH0;Q5TAV5;P05549;Q8N1C6	.|.|.;.;.;AP2A_HUMAN;.	N|Q|K	195|64|292;290;286;284;290;290	.|.|ENSP00000368933:T292K;ENSP00000368924:T290K;ENSP00000316516:T286K;ENSP00000368928:T284K;ENSP00000418541:T290K;ENSP00000417495:T290K	.|.|ENSP00000316516:T286K	H|H|T	-|-|-	1|3|2	0|2|0	TFAP2A|TFAP2A|TFAP2A	10510725|10510725|10510725	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.968000|0.968000|0.968000	0.65278|0.65278|0.65278	9.869000|9.869000|9.869000	0.99810|0.99810|0.99810	2.793000|2.793000|2.793000	0.96121|0.96121|0.96121	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	CAT|CAC|ACA			0.398	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000353619.2		NM_003220	
HIVEP1	3096	broad.mit.edu;mdanderson.org	37	6	12121061	12121061	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:12121061G>T	ENST00000379388.2	+	4	1365	c.1033G>T	c.(1033-1035)Gtt>Ttt	p.V345F		NM_002114.2	NP_002105.2	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer binding protein 1	345					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(11)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	90	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				TAGATCTCAGGTTACTCCTCA	0.413																																					p.V345F													.	HIVEP1	242		0			c.G1033T												137.0	129.0	131.0					6																	12121061		2022	4189	6211	SO:0001583	missense	3096	exon4			TCTCAGGTTACTC	J05011	CCDS43426.1	6p24-p22.3	2012-10-05	2001-11-28		ENSG00000095951	ENSG00000095951		"""Zinc fingers, C2H2-type"""	4920	protein-coding gene	gene with protein product		194540	"""human immunodeficiency virus type I enhancer-binding protein 1"", ""zinc finger protein 40"""	ZNF40		2037300	Standard	XR_241895		Approved	CIRIP, MBP-1, CRYBP1, PRDII-BF1, ZAS1, Schnurri-1, ZNF40A	uc003nac.3	P15822	OTTHUMG00000014265	ENST00000379388.2:c.1033G>T	6.37:g.12121061G>T	ENSP00000368698:p.Val345Phe		137	0	0		90	0.06	5	NM_002114	6	0.00	0	B2RTU3|Q14122|Q5MPB1|Q5VW60	Missense_Mutation	SNP	ENST00000379388.2	37	CCDS43426.1	.	.	.	.	.	.	.	.	.	.	G	19.53	3.844235	0.71488	.	.	ENSG00000095951	ENST00000379388	T	0.10005	2.92	5.35	5.35	0.76521	.	0.000000	0.31347	N	0.007813	T	0.18759	0.0450	M	0.69823	2.125	0.80722	D	1	D	0.61697	0.99	P	0.54706	0.759	T	0.00768	-1.1574	9	.	.	.	-19.6446	19.0704	0.93134	0.0:0.0:1.0:0.0	.	345	P15822	ZEP1_HUMAN	F	345	ENSP00000368698:V345F	.	V	+	1	0	HIVEP1	12229047	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.893000	0.69798	2.482000	0.83794	0.650000	0.86243	GTT			0.413	HIVEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039870.2		NM_002114	
TJAP1	93643	mdanderson.org	37	6	43473144	43473144	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:43473144G>T	ENST00000372445.5	+	11	1601	c.1225G>T	c.(1225-1227)Gac>Tac	p.D409Y	TJAP1_ENST00000259751.1_Missense_Mutation_p.D399Y|TJAP1_ENST00000438588.2_Missense_Mutation_p.D409Y|TJAP1_ENST00000372444.2_Missense_Mutation_p.D399Y|TJAP1_ENST00000372452.1_Missense_Mutation_p.D399Y|TJAP1_ENST00000372449.1_Missense_Mutation_p.D409Y|TJAP1_ENST00000436109.2_Missense_Mutation_p.D399Y|TJAP1_ENST00000483640.1_3'UTR	NM_001146016.1	NP_001139488.1	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 (peripheral)	409					Golgi organization (GO:0007030)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|urinary_tract(2)	21	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			CTCTGAAGAGGACCTGCTGGT	0.667																																					p.D409Y													.	.			0			c.G1225T												39.0	40.0	40.0					6																	43473144		2203	4300	6503	SO:0001583	missense	93643	exon10			GAAGAGGACCTGC	AK024269	CCDS4898.1, CCDS55004.1	6p21.1	2008-02-05	2005-07-05	2005-07-05	ENSG00000137221	ENSG00000137221			17949	protein-coding gene	gene with protein product		612658	"""tight junction protein 4 (peripheral)"""	TJP4		11602598	Standard	NM_001146016		Approved	PILT	uc011dvh.1	Q5JTD0	OTTHUMG00000014736	ENST00000372445.5:c.1225G>T	6.37:g.43473144G>T	ENSP00000361522:p.Asp409Tyr		33	0	0		48	0.06	3	NM_001146017	65	0.00	0	Q05BH9|Q5JTD1|Q5JWW1|Q68DB2|Q6P2P3|Q9H7V7	Missense_Mutation	SNP	ENST00000372445.5	37	CCDS55004.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.591625	0.86953	.	.	ENSG00000137221	ENST00000372444;ENST00000372445;ENST00000436109;ENST00000259751;ENST00000372454;ENST00000372452;ENST00000372449;ENST00000438588	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.75273	0.3827	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.77302	-0.2638	9	0.87932	D	0	-50.0106	19.5343	0.95242	0.0:0.0:1.0:0.0	.	409;399	Q5JTD0;Q5JTD0-2	TJAP1_HUMAN;.	Y	399;409;399;399;399;399;409;409	.	ENSP00000259751:D399Y	D	+	1	0	TJAP1	43581122	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.429000	0.80309	2.601000	0.87937	0.655000	0.94253	GAC			0.667	TJAP1-202	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000040629.1		NM_080604	
PRIM2	5558	bcgsc.ca	37	6	57398202	57398202	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:57398202G>A	ENST00000607273.1	+	10	992	c.905G>A	c.(904-906)tGt>tAt	p.C302Y	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	302					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CACCATCTTTGTCATGGAGGC	0.388																																					.													.	PRIM2	95		0			.												272.0	248.0	256.0					6																	57398202		1957	4157	6114	SO:0001583	missense	5558	.			ATCTTTGTCATGG		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.905G>A	6.37:g.57398202G>A	ENSP00000475738:p.Cys302Tyr		219	0.00456621	1		237	0.07	16	.	27	0.30	8	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	ENST00000607273.1	37																																																																																						0.388	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_000947	
MTRF1L	54516	broad.mit.edu;mdanderson.org	37	6	153323668	153323668	+	Silent	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:153323668C>T	ENST00000367233.5	-	1	152	c.153G>A	c.(151-153)gcG>gcA	p.A51A	MTRF1L_ENST00000367230.1_Silent_p.A51A|MTRF1L_ENST00000367231.5_Silent_p.A51A|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	51						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		CTTCAGACCCCGCCTGGCGCT	0.687																																					p.A51A													.	MTRF1L	21		0			c.G153A												9.0	11.0	10.0					6																	153323668		2185	4265	6450	SO:0001819	synonymous_variant	54516	exon1			AGACCCCGCCTGG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.153G>A	6.37:g.153323668C>T			126	0.0079365079	1		220	0.24	52	NM_019041	4	0.50	2	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Silent	SNP	ENST00000367233.5	37	CCDS5243.1																																																																																					0.687	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042764.1		NM_019041	
TCP10	6953	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	167789494	167789494	+	Silent	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:167789494G>T	ENST00000397829.4	-	6	815	c.648C>A	c.(646-648)gcC>gcA	p.A216A	TCP10_ENST00000366827.2_Silent_p.A216A	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	243						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		GCAGCGTGGTGGCCTGGGAAG	0.587																																					p.A216A													.	.			0			c.C648A												25.0	29.0	28.0					6																	167789494		1975	4167	6142	SO:0001819	synonymous_variant	6953	exon6			CGTGGTGGCCTGG	U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.648C>A	6.37:g.167789494G>T			85	0	0		111	0.37	41	NM_004610	0		0	Q5JR60|Q6P4F4	Silent	SNP	ENST00000397829.4	37	CCDS43527.1																																																																																					0.587	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000365570.1		NM_004610	
MLLT4	4301	broad.mit.edu	37	6	168366528	168366541	+	Frame_Shift_Del	DEL	CGCCCGGTCTGTGC	CGCCCGGTCTGTGC	-	rs529754750|rs377617992	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	CGCCCGGTCTGTGC	CGCCCGGTCTGTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr6:168366528_168366541delCGCCCGGTCTGTGC	ENST00000447894.2	+	31	5039_5052	c.5039_5052delCGCCCGGTCTGTGC	c.(5038-5052)gcgcccggtctgtgcfs	p.APGLC1680fs	MLLT4_ENST00000400822.3_Frame_Shift_Del_p.APGLC1690fs|MLLT4_ENST00000351017.4_Frame_Shift_Del_p.APGLC1687fs|MLLT4_ENST00000392112.1_Splice_Site_p.AP1663fs|MLLT4_ENST00000366806.2_Frame_Shift_Del_p.APGLC1680fs			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1680	Pro-rich.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GAGCCCGAGGCGCCCGGTCTGTGCCGCCCTCCGC	0.724			T	MLL	AL																																p.1663_1665del				Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	351		0			c.4988_4993del																																									SO:0001589	frameshift_variant	4301	exon30			CCGAGGCGCCCGG	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.5039_5052delCGCCCGGTCTGTGC	6.37:g.168366528_168366541delCGCCCGGTCTGTGC	ENSP00000404595:p.Ala1680fs		27	0	0		38	0.21	8	NM_001207008	24	0.00	0	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Frame_Shift_Del	DEL	ENST00000447894.2	37																																																																																						0.724	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000372077.1		NM_005936	
C7orf26	79034	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6631350	6631350	+	Missense_Mutation	SNP	C	C	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr7:6631350C>G	ENST00000344417.5	+	2	533	c.266C>G	c.(265-267)tCt>tGt	p.S89C	AC079742.4_ENST00000434951.1_RNA|C7orf26_ENST00000359073.5_Missense_Mutation_p.S70C	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	89										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		ACCAAGGACTCTGTTCGGCAG	0.463																																					p.S89C													.	.			0			c.C266G												160.0	173.0	168.0					7																	6631350		2203	4300	6503	SO:0001583	missense	79034	exon2			AGGACTCTGTTCG	BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.266C>G	7.37:g.6631350C>G	ENSP00000340220:p.Ser89Cys		177	0	0		251	0.29	74	NM_024067	45	0.18	8	Q9BQ43	Missense_Mutation	SNP	ENST00000344417.5	37	CCDS5353.1	.	.	.	.	.	.	.	.	.	.	c	18.69	3.678011	0.68042	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	T;T	0.44881	0.91;0.91	5.24	5.24	0.73138	.	0.112642	0.64402	D	0.000005	T	0.45256	0.1333	L	0.36672	1.1	0.49213	D	0.999764	P;D	0.54207	0.899;0.965	P;P	0.50378	0.54;0.639	T	0.35992	-0.9766	10	0.49607	T	0.09	-15.4437	16.766	0.85524	0.0:1.0:0.0:0.0	.	70;89	Q96N11-2;Q96N11	.;CG026_HUMAN	C	89;70	ENSP00000340220:S89C;ENSP00000351974:S70C	ENSP00000340220:S89C	S	+	2	0	C7orf26	6597875	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.760000	0.85248	2.627000	0.88993	0.632000	0.83419	TCT			0.463	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246844.2		NM_024067	
URGCP	55665	mdanderson.org	37	7	43917157	43917157	+	Silent	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr7:43917157C>T	ENST00000453200.1	-	6	2398	c.1905G>A	c.(1903-1905)agG>agA	p.R635R	URGCP_ENST00000443736.1_Silent_p.R592R|URGCP_ENST00000223341.7_Silent_p.R592R|URGCP_ENST00000447717.3_Silent_p.R592R|URGCP_ENST00000336086.6_Silent_p.R592R|URGCP-MRPS24_ENST00000603700.1_Intron|URGCP_ENST00000497914.1_5'UTR|URGCP_ENST00000402306.3_Silent_p.R626R			Q8TCY9	URGCP_HUMAN	upregulator of cell proliferation	635					cell cycle (GO:0007049)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|liver(1)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CTGCCGGCAGCCTCCCTGCCT	0.632																																					p.R635R													.	.			0			c.G1905A												34.0	41.0	39.0					7																	43917157		2088	4216	6304	SO:0001819	synonymous_variant	55665	exon6			CGGCAGCCTCCCT		CCDS43572.1, CCDS47577.1, CCDS47578.1	7p13	2010-02-17			ENSG00000106608	ENSG00000106608			30890	protein-coding gene	gene with protein product	"""up-regulated gene 4"""	610337				10819331, 12082552	Standard	NM_017920		Approved	URG4, KIAA1507, FLJ20654, DKFZp666G166, DKFZp686O0457	uc003tiw.3	Q8TCY9	OTTHUMG00000155245	ENST00000453200.1:c.1905G>A	7.37:g.43917157C>T			39	0	0		47	0.06	3	NM_001077663	29	0.00	0	E9PFF6|Q658M4|Q68DH6|Q6MZZ5|Q8WV98|Q9NWR7|Q9P221	Silent	SNP	ENST00000453200.1	37	CCDS47578.1																																																																																					0.632	URGCP-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000338995.1		NM_001077664	
EPHB6	2051	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_Silent_p.S172S	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S													.	.			0			c.C516T												83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	7.37:g.142562074C>T			70	0	0		103	0.05	5	NM_004445	8	0.00	0	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	37	CCDS5873.2																																																																																					0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341329.1			
SPAG11B	10407	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	7308297	7308297	+	3'UTR	SNP	C	C	G	rs370915382		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:7308297C>G	ENST00000297498.2	-	0	582				SPAG11B_ENST00000458665.1_Missense_Mutation_p.V61L|SPAG11B_ENST00000398462.2_Missense_Mutation_p.V114L|SPAG11B_ENST00000361111.2_Intron|SPAG11B_ENST00000359758.5_Intron|SPAG11B_ENST00000528168.1_3'UTR	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B						spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		GTATTTGATACGCAACACCTA	0.443																																					p.V114L													SPAG11B_ENST00000398462,NS,carcinoma,0,2	SPAG11B_ENST00000398462	0	2	0			c.G340C												85.0	91.0	89.0					8																	7308297		2202	4300	6502	SO:0001624	3_prime_UTR_variant	10407	exon3			TTGATACGCAACA	AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.*104G>C	8.37:g.7308297C>G			355	0	0		250	0.24	59	NM_058201	0		0	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	ENST00000297498.2	37	CCDS5966.1	.	.	.	.	.	.	.	.	.	.	C	9.640	1.138785	0.21123	.	.	ENSG00000164871	ENST00000458665;ENST00000398462	T;T	0.21361	2.01;2.01	3.44	-6.89	0.01660	.	.	.	.	.	T	0.06600	0.0169	N	0.14661	0.345	0.09310	N	1	B;B	0.15930	0.015;0.005	B;B	0.14023	0.01;0.006	T	0.37454	-0.9705	9	0.02654	T	1	-2.381	1.9445	0.03354	0.1207:0.2535:0.3604:0.2654	.	114;61	A8MZA0;E9PFH0	.;.	L	61;114	ENSP00000398550:V61L;ENSP00000381480:V114L	ENSP00000381480:V114L	V	-	1	0	SPAG11B	7295707	0.000000	0.05858	0.000000	0.03702	0.309000	0.27889	-3.947000	0.00328	-2.076000	0.00875	0.454000	0.30748	GTA			0.443	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251390.2		NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	
LGI3	203190	mdanderson.org	37	8	22005965	22005965	+	Missense_Mutation	SNP	T	T	C			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:22005965T>C	ENST00000306317.2	-	8	1644	c.1355A>G	c.(1354-1356)gAg>gGg	p.E452G	LGI3_ENST00000424267.2_Missense_Mutation_p.E428G	NM_139278.2	NP_644807.1	Q8N145	LGI3_HUMAN	leucine-rich repeat LGI family, member 3	452					exocytosis (GO:0006887)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|extracellular region (GO:0005576)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)	catalytic activity (GO:0003824)			endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(2)	17				Colorectal(74;0.00189)|COAD - Colon adenocarcinoma(73;0.0612)|READ - Rectum adenocarcinoma(644;0.0999)		GCGGGTACCCTCCCAGCGCAG	0.672																																					p.E452G													.	.			0			c.A1355G												31.0	31.0	31.0					8																	22005965		2202	4300	6502	SO:0001583	missense	203190	exon8			GTACCCTCCCAGC	AJ487518	CCDS6025.1	8p21.2	2008-07-28			ENSG00000168481	ENSG00000168481			18711	protein-coding gene	gene with protein product		608302				12023020, 18628660	Standard	NM_139278		Approved		uc003xav.3	Q8N145	OTTHUMG00000131599	ENST00000306317.2:c.1355A>G	8.37:g.22005965T>C	ENSP00000302297:p.Glu452Gly		62	0.0161290323	1		46	0.07	3	NM_139278	0		0	A5PLP2|Q86TL4|Q8N296	Missense_Mutation	SNP	ENST00000306317.2	37	CCDS6025.1	.	.	.	.	.	.	.	.	.	.	T	13.92	2.382444	0.42207	.	.	ENSG00000168481	ENST00000306317;ENST00000424267	T;T	0.80824	-1.42;-1.42	5.19	5.19	0.71726	Six-bladed beta-propeller, TolB-like (1);	0.061993	0.64402	D	0.000005	T	0.77418	0.4127	N	0.16368	0.405	0.50467	D	0.999874	D;D	0.59767	0.986;0.986	P;P	0.59012	0.85;0.85	T	0.74575	-0.3620	10	0.20519	T	0.43	-43.1005	13.0123	0.58737	0.0:0.0:0.0:1.0	.	428;452	A5PLP2;Q8N145	.;LGI3_HUMAN	G	452;428	ENSP00000302297:E452G;ENSP00000399121:E428G	ENSP00000302297:E452G	E	-	2	0	LGI3	22061910	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.164000	0.64954	1.941000	0.56285	0.459000	0.35465	GAG			0.672	LGI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254482.1			
LRRCC1	85444	broad.mit.edu	37	8	86019547	86019547	+	Missense_Mutation	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:86019547C>T	ENST00000360375.3	+	1	166	c.17C>T	c.(16-18)gCg>gTg	p.A6V	LRRCC1_ENST00000414626.2_5'Flank	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	6					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						gcggcggcggcggtggtggcg	0.657																																					p.A6V													LRRCC1,colon,carcinoma,0,2	LRRCC1	212	2	0			c.C17T												14.0	25.0	22.0					8																	86019547		1814	4022	5836	SO:0001583	missense	85444	exon1			CGGCGGCGGTGGT	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.17C>T	8.37:g.86019547C>T	ENSP00000353538:p.Ala6Val		54	0.0185185185	1		67	0.06	4	NM_033402	3	0.00	0	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Missense_Mutation	SNP	ENST00000360375.3	37	CCDS43750.1	.	.	.	.	.	.	.	.	.	.	C	11.20	1.569227	0.28003	.	.	ENSG00000133739	ENST00000360375	T	0.32272	1.46	1.53	-1.48	0.08745	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	0.999995	D	0.53312	0.959	P	0.45971	0.499	T	0.18116	-1.0347	9	0.56958	D	0.05	.	6.716	0.23304	0.3338:0.6662:0.0:0.0	.	6	Q9C099	LRCC1_HUMAN	V	6	ENSP00000353538:A6V	ENSP00000353538:A6V	A	+	2	0	LRRCC1	86206799	0.117000	0.22190	0.000000	0.03702	0.473000	0.32948	0.725000	0.25970	-0.322000	0.08615	-0.410000	0.06199	GCG			0.657	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380267.1		NM_033402	
PHF20L1	51105	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	133849987	133849987	+	Missense_Mutation	SNP	G	G	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:133849987G>A	ENST00000395386.2	+	17	2421	c.2122G>A	c.(2122-2124)Gtg>Atg	p.V708M	AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000220847.7_Missense_Mutation_p.V95M|AF230666.2_ENST00000608375.1_RNA|PHF20L1_ENST00000395390.2_Missense_Mutation_p.V683M	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	708							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GCAACACAGCGTGTGCATGGG	0.512																																					p.V708M													.	.			0			c.G2122A												120.0	123.0	122.0					8																	133849987		2127	4246	6373	SO:0001583	missense	51105	exon17			CACAGCGTGTGCA	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2122G>A	8.37:g.133849987G>A	ENSP00000378784:p.Val708Met		67	0	0		49	0.31	15	NM_016018	13	0.23	3	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	ENST00000395386.2	37	CCDS6367.2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444273	0.83993	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T;T	0.42131	0.98;0.98;0.98	5.64	4.75	0.60458	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.516121	0.16113	U	0.229003	T	0.43166	0.1235	M	0.62016	1.91	0.38340	D	0.944057	P;P	0.40602	0.676;0.723	B;B	0.37346	0.212;0.247	T	0.51244	-0.8730	10	0.54805	T	0.06	-9.1737	14.8906	0.70606	0.0:0.0:0.8557:0.1443	.	683;708	F8W9L8;A8MW92	.;P20L1_HUMAN	M	708;95;683	ENSP00000378784:V708M;ENSP00000220847:V95M;ENSP00000378788:V683M	ENSP00000220847:V95M	V	+	1	0	PHF20L1	133919169	1.000000	0.71417	0.982000	0.44146	0.994000	0.84299	5.078000	0.64425	1.331000	0.45412	0.637000	0.83480	GTG			0.512	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000308949.3		NM_016018	
PLEC	5339	mdanderson.org	37	8	144992599	144992599	+	Missense_Mutation	SNP	A	A	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:144992599A>T	ENST00000322810.4	-	32	11970	c.11801T>A	c.(11800-11802)cTg>cAg	p.L3934Q	PLEC_ENST00000354589.3_Missense_Mutation_p.L3797Q|PLEC_ENST00000527096.1_Missense_Mutation_p.L3820Q|PLEC_ENST00000436759.2_Missense_Mutation_p.L3824Q|PLEC_ENST00000345136.3_Missense_Mutation_p.L3797Q|PLEC_ENST00000398774.2_Missense_Mutation_p.L3765Q|PLEC_ENST00000354958.2_Missense_Mutation_p.L3775Q|PLEC_ENST00000357649.2_Missense_Mutation_p.L3801Q|PLEC_ENST00000356346.3_Missense_Mutation_p.L3783Q	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3934	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CAGCAGCCGCAGGGCCTCCTC	0.667																																					p.L3934Q													.	.			0			c.T11801A												7.0	11.0	10.0					8																	144992599		2054	4177	6231	SO:0001583	missense	5339	exon32			AGCCGCAGGGCCT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11801T>A	8.37:g.144992599A>T	ENSP00000323856:p.Leu3934Gln		18	0	0		31	0.10	3	NM_201380	72	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486820	0.26686	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.08	4.08	0.47627	.	0.139770	0.29653	U	0.011552	D	0.83982	0.5372	M	0.61703	1.905	0.54753	D	0.999985	D;D;D;D;D;D;D;D	0.63046	0.99;0.99;0.99;0.992;0.99;0.99;0.99;0.99	P;P;P;D;P;P;P;P	0.65987	0.901;0.901;0.901;0.94;0.901;0.901;0.901;0.901	D	0.83981	0.0332	10	0.45353	T	0.12	.	12.1622	0.54110	1.0:0.0:0.0:0.0	.	3824;3783;3775;3934;3765;3797;3801;3797	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	Q	3797;3801;3797;3765;3934;3775;3783;3824;3820	ENSP00000344848:L3797Q;ENSP00000350277:L3801Q;ENSP00000346602:L3797Q;ENSP00000381756:L3765Q;ENSP00000323856:L3934Q;ENSP00000347044:L3775Q;ENSP00000348702:L3783Q;ENSP00000388180:L3824Q;ENSP00000434583:L3820Q	ENSP00000323856:L3934Q	L	-	2	0	PLEC	145064587	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.269000	0.78482	1.708000	0.51301	0.247000	0.18012	CTG			0.667	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
PARP10	84875	mdanderson.org	37	8	145058391	145058391	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr8:145058391G>T	ENST00000313028.7	-	6	1761	c.1667C>A	c.(1666-1668)aCa>aAa	p.T556K	PARP10_ENST00000524918.1_Missense_Mutation_p.T556K|PARP10_ENST00000533665.1_5'Flank|PARP10_ENST00000525773.1_Missense_Mutation_p.T568K	NM_032789.3	NP_116178.2	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	556					negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of protein K63-linked ubiquitination (GO:1900045)|negative regulation of viral genome replication (GO:0045071)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein poly-ADP-ribosylation (GO:0070212)|regulation of chromatin assembly (GO:0010847)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(2)	27	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTCAAGGCCTGTGTCCAACGT	0.632																																					p.T556K													.	.			0			c.C1667A												60.0	66.0	64.0					8																	145058391		2203	4300	6503	SO:0001583	missense	84875	exon6			AGGCCTGTGTCCA	AK027370	CCDS34960.1	8q24	2010-02-16				ENSG00000178685		"""Poly (ADP-ribose) polymerases"""	25895	protein-coding gene	gene with protein product		609564				15273990	Standard	NM_032789		Approved	FLJ14464	uc003zal.4	Q53GL7		ENST00000313028.7:c.1667C>A	8.37:g.145058391G>T	ENSP00000325618:p.Thr556Lys		65	0	0		51	0.06	3	NM_032789	59	0.00	0	Q8N2I0|Q8WV05|Q96CH7|Q96K72	Missense_Mutation	SNP	ENST00000313028.7	37	CCDS34960.1	.	.	.	.	.	.	.	.	.	.	G	5.855	0.342013	0.11069	.	.	ENSG00000178685	ENST00000524918;ENST00000534861;ENST00000313028;ENST00000525773	T;T;T	0.09723	2.95;2.95;2.95	4.21	0.129	0.14739	.	1.300580	0.05485	N	0.555534	T	0.07593	0.0191	N	0.24115	0.695	0.09310	N	1	B;B	0.19331	0.035;0.023	B;B	0.14578	0.011;0.006	T	0.39941	-0.9589	10	0.54805	T	0.06	.	3.742	0.08533	0.4125:0.0:0.4216:0.1659	.	568;556	E9PNI7;Q53GL7	.;PAR10_HUMAN	K	556;262;556;568	ENSP00000431620:T556K;ENSP00000325618:T556K;ENSP00000434776:T568K	ENSP00000325618:T556K	T	-	2	0	PARP10	145130379	0.000000	0.05858	0.074000	0.20217	0.425000	0.31504	0.403000	0.20982	-0.344000	0.08338	0.550000	0.68814	ACA			0.632	PARP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000383866.1		NM_032789	
BMS1P10	728611	bcgsc.ca	37	9	67334944	67334944	+	IGR	SNP	C	C	T	rs56215557		TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr9:67334944C>T								RP11-236F9.2 (36312 upstream) : RP11-38P6.1 (244862 downstream)																							CCCTTGTGCACGTCCTGTTTC	0.532																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			TGTGCACGTCCTG																													9.37:g.67334944C>T			18	0	0		29	0.28	8	.	13	0.00	0		RNA	SNP		37																																																																																					0	0.532										
NUTM2G	441457	mdanderson.org	37	9	99699464	99699464	+	Silent	SNP	A	A	G	rs2986890	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr9:99699464A>G	ENST00000372322.3	+	5	1122	c.1101A>G	c.(1099-1101)gcA>gcG	p.A367A	NUTM2G_ENST00000354649.3_Silent_p.A367A|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	367	Pro-rich.																CGAGGCCAGCAGAGACCAAGG	0.682													.|||	2	0.000399361	0.0	0.0029	5008	,	,		16549	0.0		0.0	False		,,,				2504	0.0				p.A367A													.	.			0			c.A1101G												50.0	59.0	56.0					9																	99699464		1943	4139	6082	SO:0001819	synonymous_variant	441457	exon5			GCCAGCAGAGACC		CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.1101A>G	9.37:g.99699464A>G			89	0.0224719101	2		101	0.05	5	NM_001045477	0		0	A6NNI5|Q5VZR3	Silent	SNP	ENST00000372322.3	37	CCDS55329.1																																																																																					0.682	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000053291.2		NM_001170741	
PKN3	29941	hgsc.bcm.edu;mdanderson.org	37	9	131469216	131469216	+	Missense_Mutation	SNP	G	G	T	rs564975981	byFrequency	TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr9:131469216G>T	ENST00000291906.4	+	5	958	c.565G>T	c.(565-567)Gtt>Ttt	p.V189F	RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	189					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCGACTGCACGTTGAGGCAGC	0.652																																					p.V189F													.	.			0			c.G565T												59.0	62.0	61.0					9																	131469216		2203	4300	6503	SO:0001583	missense	29941	exon5			CTGCACGTTGAGG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.565G>T	9.37:g.131469216G>T	ENSP00000291906:p.Val189Phe		41	0	0		60	0.07	4	NM_013355	7	0.00	0	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	37	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755306	0.31046	.	.	ENSG00000160447	ENST00000291906	T	0.20881	2.04	5.17	-1.63	0.08345	.	.	.	.	.	T	0.32704	0.0838	M	0.73598	2.24	0.09310	N	1	P;P	0.47841	0.844;0.901	P;P	0.50860	0.652;0.574	T	0.28235	-1.0050	9	0.87932	D	0	.	10.368	0.44035	0.604:0.0:0.396:0.0	.	189;189	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	F	189	ENSP00000291906:V189F	ENSP00000291906:V189F	V	+	1	0	PKN3	130509037	0.614000	0.27017	0.001000	0.08648	0.064000	0.16182	1.448000	0.35112	-0.587000	0.05890	-1.030000	0.02411	GTT			0.652	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054487.1		NM_013355	
NUP188	23511	broad.mit.edu;mdanderson.org	37	9	131763859	131763859	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chr9:131763859G>T	ENST00000372577.2	+	35	3916	c.3895G>T	c.(3895-3897)Gat>Tat	p.D1299Y	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1299					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						GGTAGACGAGGATGGTGACTC	0.582																																					p.D1299Y													.	NUP188	140		0			c.G3895T												69.0	60.0	63.0					9																	131763859		2203	4300	6503	SO:0001583	missense	23511	exon35			GACGAGGATGGTG	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3895G>T	9.37:g.131763859G>T	ENSP00000361658:p.Asp1299Tyr		87	0	0		102	0.05	5	NM_015354	65	0.02	1	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	37	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.008697	0.54361	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.35236	1.32	5.39	5.39	0.77823	.	0.095366	0.64402	D	0.000001	T	0.37433	0.1003	L	0.59436	1.845	0.80722	D	1	B;B	0.11235	0.004;0.001	B;B	0.06405	0.002;0.002	T	0.18777	-1.0326	10	0.62326	D	0.03	-8.306	14.6489	0.68780	0.0:0.0:0.8542:0.1458	.	632;1299	E9PET9;Q5SRE5	.;NU188_HUMAN	Y	1188;1299	ENSP00000361658:D1299Y	ENSP00000349125:D1188Y	D	+	1	0	NUP188	130803680	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.636000	0.83301	2.537000	0.85549	0.462000	0.41574	GAT			0.582	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054529.2			
TLR7	51284	broad.mit.edu;bcgsc.ca	37	X	12903721	12903721	+	Frame_Shift_Del	DEL	A	A	-			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrX:12903721delA	ENST00000380659.3	+	3	233	c.94delA	c.(94-96)aaafs	p.K32fs		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	32					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	ATGGTTTCCTAAAACTCTGCC	0.418																																					p.K32fs													.	TLR7	125		0			c.94delA												143.0	134.0	137.0					X																	12903721		2203	4300	6503	SO:0001589	frameshift_variant	51284	exon3			TTTCCTAAAACTC	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.94delA	X.37:g.12903721delA	ENSP00000370034:p.Lys32fs		272	0	0		369	0.18	67	NM_016562	7	0.00	0	D1CS69|Q9NR98	Frame_Shift_Del	DEL	ENST00000380659.3	37	CCDS14151.1																																																																																					0.418	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055769.1		NM_016562	
CYLC1	1538	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	83128817	83128817	+	Silent	SNP	A	A	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrX:83128817A>G	ENST00000329312.4	+	4	1138	c.1101A>G	c.(1099-1101)ccA>ccG	p.P367P		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	367					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						agaaGTACCCAGAGTCTACTG	0.343																																					p.P367P													.	.			0			c.A1101G												34.0	30.0	32.0					X																	83128817		2189	4291	6480	SO:0001819	synonymous_variant	1538	exon4			GTACCCAGAGTCT	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1101A>G	X.37:g.83128817A>G			80	0	0		136	0.47	64	NM_021118	0		0	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	37	CCDS35341.1																																																																																					0.343	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057371.1		NM_021118	
Unknown	0	bcgsc.ca	37	X	100793480	100793480	+	IGR	SNP	C	C	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrX:100793480C>T								ARMCX4 (42686 upstream) : ARMCX1 (12033 downstream)																							GCTTAACTTCCTCTTCCTATT	0.353																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			AACTTCCTCTTCC																													X.37:g.100793480C>T			61	0.0163934426	1		65	0.20	13	.	0		0		RNA	SNP		37																																																																																					0	0.353										
RHOXF1	158800	mdanderson.org	37	X	119249677	119249677	+	Missense_Mutation	SNP	G	G	T			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrX:119249677G>T	ENST00000217999.2	-	1	170	c.96C>A	c.(94-96)agC>agA	p.S32R	GS1-421I3.4_ENST00000422226.1_lincRNA|RP4-755D9.1_ENST00000553843.1_RNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	32					gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						GGCCTTCTGCGCTTGATGCTG	0.587																																					p.S32R													.	.			0			c.C96A												49.0	45.0	47.0					X																	119249677		2201	4298	6499	SO:0001583	missense	158800	exon1			TTCTGCGCTTGAT		CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.96C>A	X.37:g.119249677G>T	ENSP00000217999:p.Ser32Arg		38	0	0		46	0.07	3	NM_139282	4	0.00	0	O95030|Q3SYE0	Missense_Mutation	SNP	ENST00000217999.2	37	CCDS14593.1	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.840188	0.00573	.	.	ENSG00000101883	ENST00000217999	D	0.90504	-2.68	1.5	-3.0	0.05480	.	.	.	.	.	T	0.68842	0.3045	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.57136	-0.7863	9	0.14656	T	0.56	.	1.5163	0.02506	0.1616:0.1815:0.4391:0.2178	.	32	Q8NHV9	RHXF1_HUMAN	R	32	ENSP00000217999:S32R	ENSP00000217999:S32R	S	-	3	2	RHOXF1	119133705	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.532000	0.02217	-1.886000	0.01116	-1.476000	0.00998	AGC			0.587	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058083.2		NM_139282	
GPC3	2719	broad.mit.edu	37	X	133119396	133119396	+	Silent	SNP	C	C	G			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrX:133119396C>G	ENST00000370818.3	-	1	526	c.81G>C	c.(79-81)ccG>ccC	p.P27P	GPC3_ENST00000543339.1_Silent_p.P27P|GPC3_ENST00000394299.2_Silent_p.P27P	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	27					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					GCGGCGGCGGCGGGGGCTGCG	0.687			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																												p.P27P			yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	.	GPC3	88		0			c.G81C												14.0	14.0	14.0					X																	133119396		2189	4277	6466	SO:0001819	synonymous_variant	2719	exon1	Familial Cancer Database	SGBS	CGGCGGCGGGGGC	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.81G>C	X.37:g.133119396C>G			135	0.0074074074	1		250	0.02	5	NM_001164617	673	0.01	5	C9JLE3|G3V1R0|Q2L880|Q2L882	Silent	SNP	ENST00000370818.3	37	CCDS14638.1																																																																																					0.687	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058356.1		NM_004484	
UTY	7404	mdanderson.org	37	Y	15478190	15478190	+	Nonsense_Mutation	SNP	C	C	A			TCGA-2G-AALW-01A-11D-A42Y-10	TCGA-2G-AALW-10A-01D-A433-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	413dad16-996e-44ad-9776-24e1903940a6	4f4f8383-263b-44c7-b5f1-c4c9e594f26c	g.chrY:15478190C>A	ENST00000331397.4	-	10	1830	c.823G>T	c.(823-825)Gag>Tag	p.E275*	UTY_ENST00000382896.4_Nonsense_Mutation_p.E275*|UTY_ENST00000329134.5_Nonsense_Mutation_p.E275*|UTY_ENST00000540140.1_Nonsense_Mutation_p.E275*|UTY_ENST00000362096.4_Nonsense_Mutation_p.E275*|UTY_ENST00000538878.1_Nonsense_Mutation_p.E275*|UTY_ENST00000545955.1_Nonsense_Mutation_p.E275*|UTY_ENST00000537580.1_Nonsense_Mutation_p.E275*	NM_001258267.1|NM_007125.4	NP_001245196.1|NP_009056.3	O14607	UTY_HUMAN	ubiquitously transcribed tetratricopeptide repeat containing, Y-linked	275					regulation of gene expression (GO:0010468)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)			kidney(1)|lung(6)	7						GGATCTGCCTCCAAAGACTTT	0.358																																					p.E275X	Colon(103;1740 2135 40732 45171)												.	.			0			c.G823T												64.0	68.0	67.0					Y																	15478190		598	1946	2544	SO:0001587	stop_gained	7404	exon10			CTGCCTCCAAAGA	AF000994	CCDS14783.1, CCDS14784.1, CCDS14785.1, CCDS59184.1, CCDS76073.1, CCDS76074.1, CCDS76075.1, CCDS76076.1, CCDS76077.1, CCDS76078.1, CCDS76079.1	Yq11.221	2013-11-04	2012-11-15		ENSG00000183878	ENSG00000183878		"""Tetratricopeptide (TTC) repeat domain containing"""	12638	protein-coding gene	gene with protein product		400009	"""ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome"", ""ubiquitously transcribed tetratricopeptide repeat gene, Y-linked"""			8944031, 9499428	Standard	NM_182659		Approved	KDM6AL	uc022ckf.2	O14607	OTTHUMG00000036319	ENST00000331397.4:c.823G>T	Y.37:g.15478190C>A	ENSP00000328939:p.Glu275*		253	0.0039525692	1		43	0.07	3	NM_001258259	4	0.00	0	A8K9Z3|E1U199|E1U1A0|F5H4V7|F8W8R7|O14608	Nonsense_Mutation	SNP	ENST00000331397.4	37	CCDS14783.1																																																																																					0.358	UTY-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000088394.1		NM_182660	
