#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
FBXO2	26232	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	1	11709267	11709267	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:11709267G>C	ENST00000354287.4	-	5	974	c.633C>G	c.(631-633)agC>agG	p.S211R	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	211	Carbohydrate binding. {ECO:0000250}.|FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		AACCAGCGTCGCTGCGGCCCG	0.667																																					p.S211R													.	.			0			c.C633G												12.0	11.0	11.0					1																	11709267		2135	4159	6294	SO:0001583	missense	26232	exon5			AGCGTCGCTGCGG	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.633C>G	1.37:g.11709267G>C	ENSP00000346240:p.Ser211Arg		84	0	0		72	0.19	14	NM_012168	21	0.38	8	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Missense_Mutation	SNP	ENST00000354287.4	37	CCDS130.1	.	.	.	.	.	.	.	.	.	.	G	8.958	0.969935	0.18659	.	.	ENSG00000116661	ENST00000354287	T	0.30448	1.53	4.29	-2.06	0.07298	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	0.670995	0.15642	N	0.251853	T	0.13329	0.0323	N	0.20986	0.625	0.26875	N	0.967658	B;B	0.15719	0.006;0.014	B;B	0.13407	0.009;0.008	T	0.18304	-1.0341	10	0.20519	T	0.43	.	1.6015	0.02675	0.2431:0.2366:0.3885:0.1318	.	179;211	A6NNP0;Q9UK22	.;FBX2_HUMAN	R	211	ENSP00000346240:S211R	ENSP00000346240:S211R	S	-	3	2	FBXO2	11631854	0.009000	0.17119	0.972000	0.41901	0.692000	0.40212	-1.488000	0.02308	-0.216000	0.10048	0.485000	0.47835	AGC			0.667	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005764.1		NM_012168	
AKIRIN1	79647	mdanderson.org	37	1	39469060	39469060	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:39469060A>G	ENST00000432648.3	+	4	696	c.538A>G	c.(538-540)Atg>Gtg	p.M180V	AKIRIN1_ENST00000372984.4_Missense_Mutation_p.M133V|AKIRIN1_ENST00000446189.2_Missense_Mutation_p.M135V	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	180						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						TGATCAGATTATGCGACGGTA	0.353																																					p.M180V													.	.			0			c.A538G												140.0	118.0	126.0					1																	39469060		2203	4300	6503	SO:0001583	missense	79647	exon4			CAGATTATGCGAC	AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.538A>G	1.37:g.39469060A>G	ENSP00000392678:p.Met180Val		57	0	0		48	0.06	3	NM_024595	232	0.00	0	B4DZU6|Q0VDB3|Q53FK8	Missense_Mutation	SNP	ENST00000432648.3	37	CCDS433.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.861476	0.71949	.	.	ENSG00000174574	ENST00000432648;ENST00000446189;ENST00000372984	T	0.62105	0.05	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.78610	0.4310	M	0.82517	2.595	0.44061	D	0.996803	P;P;D	0.58268	0.679;0.566;0.982	P;B;D	0.68943	0.65;0.208;0.961	T	0.78718	-0.2095	10	0.34782	T	0.22	-8.9737	13.571	0.61847	1.0:0.0:0.0:0.0	.	133;135;180	B4DQP0;B4DZU6;Q9H9L7	.;.;AKIR1_HUMAN	V	180;135;133	ENSP00000392678:M180V	ENSP00000362075:M133V	M	+	1	0	AKIRIN1	39241647	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.486000	0.66856	2.147000	0.66899	0.455000	0.32223	ATG			0.353	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019687.2		NM_024595	
PABPC4	8761	mdanderson.org	37	1	40030789	40030789	+	Missense_Mutation	SNP	C	C	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:40030789C>A	ENST00000372857.3	-	8	2026	c.1234G>T	c.(1234-1236)Gca>Tca	p.A412S	PABPC4_ENST00000372856.3_Missense_Mutation_p.A412S|RP11-69E11.8_ENST00000415255.1_RNA|PABPC4_ENST00000372862.3_Missense_Mutation_p.A412S|PABPC4_ENST00000372858.3_Missense_Mutation_p.A412S|SNORA55_ENST00000364587.1_RNA	NM_003819.3	NP_003810.1	Q13310	PABP4_HUMAN	poly(A) binding protein, cytoplasmic 4 (inducible form)	412					blood coagulation (GO:0007596)|RNA catabolic process (GO:0006401)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(3)	21	Lung NSC(20;1.55e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.89e-18)|Epithelial(16;6.17e-17)|all cancers(16;1.18e-15)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TGTGGGACTGCTGGCACAAAG	0.532																																					p.A412S													.	.			0			c.G1234T												50.0	48.0	49.0					1																	40030789		2203	4300	6503	SO:0001583	missense	8761	exon8			GGACTGCTGGCAC	U33818	CCDS438.1, CCDS44114.1, CCDS44115.1	1p34.2	2013-02-12	2001-11-28		ENSG00000090621	ENSG00000090621		"""RNA binding motif (RRM) containing"""	8557	protein-coding gene	gene with protein product		603407	"""poly(A)-binding protein, cytoplasmic 4 (inducible form)"""			10543404	Standard	NM_001135653		Approved	iPABP, APP-1	uc001cdl.2	Q13310	OTTHUMG00000009097	ENST00000372857.3:c.1234G>T	1.37:g.40030789C>A	ENSP00000361948:p.Ala412Ser		62	0	0		40	0.08	3	NM_003819	360	0.00	0	B1ANQ8|Q4VC03|Q6P0N3	Missense_Mutation	SNP	ENST00000372857.3	37	CCDS438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.4|21.4	4.137295|4.137295	0.77775|0.77775	.|.	.|.	ENSG00000090621|ENSG00000090621	ENST00000372862;ENST00000372858;ENST00000372857;ENST00000372856|ENST00000421687;ENST00000527718	T;T;T;T|.	0.15256|.	2.52;2.54;2.49;2.44|.	5.97|5.97	5.97|5.97	0.96955|0.96955	.|.	0.047358|.	0.85682|.	D|.	0.000000|.	T|T	0.70500|0.70500	0.3231|0.3231	L|L	0.46670|0.46670	1.46|1.46	0.80722|0.80722	D|D	1|1	D;B;B|.	0.63880|.	0.993;0.014;0.007|.	D;B;B|.	0.72625|.	0.978;0.036;0.011|.	T|T	0.63998|0.63998	-0.6510|-0.6510	10|5	0.45353|.	T|.	0.12|.	.|.	20.4239|20.4239	0.99064|0.99064	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	412;412;412|.	Q13310;Q13310-2;Q4VC03|.	PABP4_HUMAN;.;.|.	S|H	412|313;138	ENSP00000361953:A412S;ENSP00000361949:A412S;ENSP00000361948:A412S;ENSP00000361947:A412S|.	ENSP00000361947:A412S|.	A|Q	-|-	1|3	0|2	PABPC4|PABPC4	39803376|39803376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.792000|7.792000	0.85828|0.85828	2.828000|2.828000	0.97474|0.97474	0.655000|0.655000	0.94253|0.94253	GCA|CAG			0.532	PABPC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000025220.1		NM_001135653	
DPH2	1802	mdanderson.org	37	1	44438207	44438207	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:44438207G>T	ENST00000255108.3	+	6	1638	c.1466G>T	c.(1465-1467)gGc>gTc	p.G489V	DPH2_ENST00000396758.2_Missense_Mutation_p.G261V|ATP6V0B_ENST00000236067.4_5'Flank|ATP6V0B_ENST00000471859.2_5'Flank|ATP6V0B_ENST00000532642.1_5'Flank|DPH2_ENST00000412950.2_Missense_Mutation_p.G354V|ATP6V0B_ENST00000472174.2_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	489					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GAGGGAAGCGGCTGATACCAT	0.582																																					p.G489V													.	.			0			c.G1466T												120.0	99.0	106.0					1																	44438207		2203	4300	6503	SO:0001583	missense	1802	exon6			GAAGCGGCTGATA	AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.1466G>T	1.37:g.44438207G>T	ENSP00000255108:p.Gly489Val		83	0	0		49	0.06	3	NM_001384	115	0.00	0	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	ENST00000255108.3	37	CCDS504.1	.	.	.	.	.	.	.	.	.	.	G	9.976	1.226775	0.22542	.	.	ENSG00000132768	ENST00000255108;ENST00000412950;ENST00000396758;ENST00000459879	.	.	.	5.12	3.25	0.37280	.	0.545938	0.20754	N	0.086289	T	0.22820	0.0551	N	0.08118	0	0.20196	N	0.999927	B;B;B	0.23058	0.01;0.079;0.01	B;B;B	0.23716	0.01;0.048;0.01	T	0.18587	-1.0332	9	0.59425	D	0.04	.	8.6657	0.34118	0.2525:0.0:0.7475:0.0	.	354;261;489	B4DNI8;A8MVC9;Q9BQC3	.;.;DPH2_HUMAN	V	489;354;261;262	.	ENSP00000255108:G489V	G	+	2	0	DPH2	44210794	0.746000	0.28272	0.815000	0.32552	0.071000	0.16799	1.584000	0.36589	0.559000	0.29153	0.484000	0.47621	GGC			0.582	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022832.1		NM_001384	
PLK3	1263	mdanderson.org	37	1	45266604	45266604	+	Silent	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:45266604G>A	ENST00000372201.4	+	2	542	c.303G>A	c.(301-303)ccG>ccA	p.P101P	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	101	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					TCGCCAAGCCGCATCAGCGCG	0.672																																					p.P101P													.	.			0			c.G303A												26.0	29.0	28.0					1																	45266604		2202	4298	6500	SO:0001819	synonymous_variant	1263	exon2			CAAGCCGCATCAG	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.303G>A	1.37:g.45266604G>A			94	0	0		67	0.06	4	NM_004073	7	0.00	0	Q15767|Q5JR99|Q96CV1	Silent	SNP	ENST00000372201.4	37	CCDS515.1																																																																																					0.672	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000023429.1		NM_004073	
FGGY	55277	broad.mit.edu	37	1	59811958	59811958	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:59811958G>T	ENST00000303721.7	+	4	527	c.353G>T	c.(352-354)cGa>cTa	p.R118L	FGGY_ENST00000371218.4_Missense_Mutation_p.R118L|FGGY_ENST00000474476.1_3'UTR|FGGY_ENST00000371212.1_Intron	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	118					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					CTGGACCATCGAGCAGTCAGT	0.512																																					p.R118L													FGGY_ENST00000303721,colon,carcinoma,+1,2	FGGY	99	2	0			c.G353T												156.0	127.0	136.0					1																	59811958		2203	4300	6503	SO:0001583	missense	55277	exon4			ACCATCGAGCAGT		CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.353G>T	1.37:g.59811958G>T	ENSP00000305922:p.Arg118Leu		154	0	0		100	0.03	3	NM_001113411	16	0.00	0	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	Missense_Mutation	SNP	ENST00000303721.7	37	CCDS611.2	.	.	.	.	.	.	.	.	.	.	G	20.9	4.065050	0.76187	.	.	ENSG00000172456	ENST00000413489;ENST00000371218;ENST00000303721	T;T;T	0.74421	-0.84;-0.84;-0.84	5.49	5.49	0.81192	Carbohydrate kinase, FGGY, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.91402	0.7287	H	0.97051	3.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93609	0.6937	9	.	.	.	-12.6464	19.1799	0.93619	0.0:0.0:1.0:0.0	.	118;118;118	Q96C11-3;F2Z2V1;Q96C11	.;.;FGGY_HUMAN	L	118	ENSP00000406607:R118L;ENSP00000360262:R118L;ENSP00000305922:R118L	.	R	+	2	0	FGGY	59584546	1.000000	0.71417	0.998000	0.56505	0.239000	0.25481	8.580000	0.90784	2.857000	0.98124	0.650000	0.86243	CGA			0.512	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000023210.2		NM_001113411	
LMO4	8543	broad.mit.edu;mdanderson.org	37	1	87797776	87797776	+	Silent	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:87797776C>T	ENST00000370544.5	+	2	858	c.78C>T	c.(76-78)tgC>tgT	p.C26C	LMO4_ENST00000489303.1_3'UTR|LMO4_ENST00000370542.1_Silent_p.C26C	NM_006769.3	NP_006760.1	P61968	LMO4_HUMAN	LIM domain only 4	26	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of protein complex assembly (GO:0031333)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell activation (GO:0050865)|regulation of cell fate specification (GO:0042659)|spinal cord association neuron differentiation (GO:0021527)|spinal cord motor neuron differentiation (GO:0021522)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)|ventral spinal cord interneuron differentiation (GO:0021514)|ventricular septum development (GO:0003281)	transcription factor complex (GO:0005667)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(1)	9		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)		GCGCAGGCTGCGGGGGCAAGA	0.682																																					p.C26C													.	LMO4	21		0			c.C78T												31.0	34.0	33.0					1																	87797776		2201	4299	6500	SO:0001819	synonymous_variant	8543	exon2			AGGCTGCGGGGGC	U24576	CCDS713.1	1p22.3	2008-02-05			ENSG00000143013	ENSG00000143013			6644	protein-coding gene	gene with protein product		603129					Standard	NM_006769		Approved		uc001dmi.3	P61968	OTTHUMG00000010248	ENST00000370544.5:c.78C>T	1.37:g.87797776C>T			109	0	0		74	0.05	4	NM_006769	172	0.00	0	D3DT23|O00158|O88894	Silent	SNP	ENST00000370544.5	37	CCDS713.1																																																																																					0.682	LMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000028264.2		NM_006769	
CD46	4179	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	207941164	207941164	+	Silent	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr1:207941164C>T	ENST00000358170.2	+	8	1098	c.942C>T	c.(940-942)gcC>gcT	p.A314A	CD46_ENST00000367047.1_Silent_p.A251A|CD46_ENST00000361067.1_Silent_p.A314A|CD46_ENST00000322918.5_Intron|CD46_ENST00000357714.1_Intron|CD46_ENST00000354848.1_Silent_p.A299A|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000480003.1_Silent_p.A299A|CD46_ENST00000360212.2_Intron|CD46_ENST00000441839.2_Silent_p.A299A|CD46_ENST00000322875.4_Silent_p.A314A|CD46_ENST00000367041.1_Intron|CD46_ENST00000367042.1_Silent_p.A299A	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	314	Ser/Thr-rich.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						CGTCCAGTGCCTCAGGTTTAG	0.343																																					p.A314A													.	.			0			c.C942T												99.0	101.0	100.0					1																	207941164		2203	4300	6503	SO:0001819	synonymous_variant	4179	exon8			CAGTGCCTCAGGT	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.942C>T	1.37:g.207941164C>T			110	0	0		109	0.28	31	NM_172359	74	0.26	19	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Silent	SNP	ENST00000358170.2	37	CCDS1485.1																																																																																					0.343	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000088588.3		NM_172361	
NCOA4	8031	mdanderson.org	37	10	51585077	51585077	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr10:51585077G>T	ENST00000443446.1	+	8	1405	c.1176G>T	c.(1174-1176)caG>caT	p.Q392H	NCOA4_ENST00000430396.2_Missense_Mutation_p.Q292H|NCOA4_ENST00000374087.4_Missense_Mutation_p.Q392H|NCOA4_ENST00000414907.2_Missense_Mutation_p.Q226H|NCOA4_ENST00000344348.6_Missense_Mutation_p.Q392H|NCOA4_ENST00000438493.1_Missense_Mutation_p.Q408H|NCOA4_ENST00000452682.1_Missense_Mutation_p.Q408H|NCOA4_ENST00000374082.1_Missense_Mutation_p.Q392H	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	392					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GGCTTGTCCAGAACCATCAGG	0.507			T	RET	papillary thyroid																																p.Q408H				Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	.			0			c.G1224T												46.0	45.0	45.0					10																	51585077		2203	4300	6503	SO:0001583	missense	8031	exon9			TGTCCAGAACCAT	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1176G>T	10.37:g.51585077G>T	ENSP00000390713:p.Gln392His		50	0	0		33	0.09	3	NM_001145260	151	0.01	1	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	37	CCDS7237.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584394	0.65992	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62;0.62;0.62	5.6	5.6	0.85130	.	0.093712	0.47455	D	0.000225	T	0.65080	0.2657	M	0.74258	2.255	0.38245	D	0.941444	D;D;D;D	0.65815	0.981;0.964;0.966;0.995	P;P;P;P	0.57371	0.819;0.754;0.751;0.819	T	0.68372	-0.5426	9	.	.	.	-10.4158	17.7885	0.88546	0.0:0.0:1.0:0.0	.	292;408;408;392	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	H	408;408;292;392;226;392;392;392	ENSP00000405146:Q408H;ENSP00000395465:Q408H;ENSP00000393053:Q292H;ENSP00000363200:Q392H;ENSP00000411018:Q226H;ENSP00000344552:Q392H;ENSP00000363195:Q392H;ENSP00000390713:Q392H	.	Q	+	3	2	NCOA4	51255083	1.000000	0.71417	0.998000	0.56505	0.770000	0.43624	4.052000	0.57420	2.647000	0.89833	0.650000	0.86243	CAG			0.507	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048052.1		NM_005437	
ALDH18A1	5832	mdanderson.org	37	10	97397134	97397134	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr10:97397134G>T	ENST00000371224.2	-	4	500	c.363C>A	c.(361-363)gcC>gcA	p.A121A	ALDH18A1_ENST00000483788.1_5'UTR|ALDH18A1_ENST00000371221.3_Silent_p.A121A	NM_002860.3	NP_002851.2	P54886	P5CS_HUMAN	aldehyde dehydrogenase 18 family, member A1	121	Glutamate 5-kinase.				cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|citrulline biosynthetic process (GO:0019240)|glutamate metabolic process (GO:0006536)|L-proline biosynthetic process (GO:0055129)|ornithine biosynthetic process (GO:0006592)|proline biosynthetic process (GO:0006561)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate 5-kinase activity (GO:0004349)|glutamate-5-semialdehyde dehydrogenase activity (GO:0004350)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(9)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Colorectal(252;0.0402)		Epithelial(162;9.1e-07)|all cancers(201;2.55e-05)		GTTTGCCAAAGGCTACGGCTC	0.552																																					p.A121A													.	.			0			c.C363A												129.0	107.0	115.0					10																	97397134		2203	4300	6503	SO:0001819	synonymous_variant	5832	exon4			GCCAAAGGCTACG	X94453	CCDS7443.1, CCDS31257.1	10q24.3-q24.6	2004-08-12	2004-08-12	2004-08-12	ENSG00000059573	ENSG00000059573		"""Aldehyde dehydrogenases"""	9722	protein-coding gene	gene with protein product		138250	"""pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase)"""	GSAS, PYCS		8921385	Standard	XM_006717933		Approved	P5CS	uc001kkz.3	P54886	OTTHUMG00000018815	ENST00000371224.2:c.363C>A	10.37:g.97397134G>T			61	0	0		44	0.07	3	NM_001017423	34	0.00	0	B2R5Q4|B7Z350|B7Z5X8|B7ZLP1|D3DR44|O95952|Q3KQU2|Q5T566|Q5T567|Q9UM72	Silent	SNP	ENST00000371224.2	37	CCDS7443.1																																																																																					0.552	ALDH18A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049552.1		NM_002860	
PI4K2A	55361	mdanderson.org	37	10	99400600	99400600	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr10:99400600G>T	ENST00000370631.3	+	1	158	c.101G>T	c.(100-102)gGc>gTc	p.G34V	PI4K2A_ENST00000370649.3_Intron|PI4K2A_ENST00000555577.1_Intron	NM_018425.2	NP_060895.1	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha	34					basophil degranulation (GO:0002561)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endosome (GO:0005768)|exocytic vesicle (GO:0070382)|Golgi apparatus (GO:0005794)|growing cell tip (GO:0035838)|host cell presynaptic membrane (GO:0044231)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|presynaptic membrane (GO:0042734)|protein complex (GO:0043234)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|AP-3 adaptor complex binding (GO:0035651)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)			endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	12		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		GTGCCCGGGGGCGCGGTCCGA	0.771																																					p.G34V													.	.			0			c.G101T												4.0	5.0	5.0					10																	99400600		1956	3974	5930	SO:0001583	missense	55361	exon1			CCGGGGGCGCGGT	AF070611	CCDS7469.1	10q24	2011-02-09			ENSG00000155252	ENSG00000155252			30031	protein-coding gene	gene with protein product		609763				11244087, 11279162	Standard	NM_018425		Approved	PI4KII, DKFZP761G1923, PIK42A	uc001kog.1	Q9BTU6	OTTHUMG00000018863	ENST00000370631.3:c.101G>T	10.37:g.99400600G>T	ENSP00000359665:p.Gly34Val		46	0	0		34	0.09	3	NM_018425	12	0.00	0	D3DR59|Q9NSG8	Missense_Mutation	SNP	ENST00000370631.3	37	CCDS7469.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256768	0.22965	.	.	ENSG00000155252	ENST00000370631	.	.	.	3.59	2.62	0.31277	.	0.267337	0.37095	N	0.002244	T	0.25082	0.0609	N	0.04508	-0.205	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07424	-1.0773	9	0.36615	T	0.2	-11.0786	6.0465	0.19762	0.0:0.3365:0.5023:0.1612	.	34	Q9BTU6	P4K2A_HUMAN	V	34	.	ENSP00000359665:G34V	G	+	2	0	PI4K2A	99390590	0.998000	0.40836	1.000000	0.80357	0.444000	0.32077	1.071000	0.30666	1.838000	0.53458	0.407000	0.27541	GGC			0.771	PI4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049735.1		NM_018425	
MUC2	4583	mdanderson.org	37	11	1093295	1093295	+	Missense_Mutation	SNP	C	C	T	rs200837746|rs200145328		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:1093295C>T	ENST00000441003.2	+	30	5141	c.5114C>T	c.(5113-5115)aCt>aTt	p.T1705I	MUC2_ENST00000359061.5_Missense_Mutation_p.T1672I|MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)		p.T1705I(1)|p.T1672I(1)		NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	accaccaccactacggtgacc	0.642																																					p.T1705I													MUC2_ENST00000441003,rectum,carcinoma,0,2	MUC2_ENST00000441003	0	2	2	Substitution - Missense(2)	large_intestine(2)	c.C5114T												113.0	161.0	144.0					11																	1093295		1882	3466	5348	SO:0001583	missense	4583	exon30			CCACCACTACGGT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5114C>T	11.37:g.1093295C>T	ENSP00000415183:p.Thr1705Ile		33	0	0		18	0.11	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.775	-0.764347	0.02996	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.11277	3.02;2.79	1.6	-0.698	0.11280	.	0.547305	0.11728	U	0.535177	T	0.05868	0.0153	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.38457	-0.9660	9	0.34782	T	0.22	.	3.0673	0.06219	0.0:0.5189:0.2842:0.1969	.	1705	E7EUV1	.	I	1705;1672	ENSP00000415183:T1705I;ENSP00000351956:T1672I	ENSP00000351956:T1672I	T	+	2	0	MUC2	1083295	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.065000	0.14466	-0.392000	0.07751	-1.238000	0.01547	ACT			0.642	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
KRTAP5-3	387266	broad.mit.edu	37	11	1629385	1629385	+	Silent	SNP	A	A	G			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:1629385A>G	ENST00000399685.1	-	1	308	c.231T>C	c.(229-231)tgT>tgC	p.C77C		NM_001012708.2	NP_001012726.1	Q6L8H2	KRA53_HUMAN	keratin associated protein 5-3	77	11 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	8		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000618)|Lung(200;0.0684)|LUSC - Lung squamous cell carcinoma(625;0.0822)		CACAGGAGCCACAGCCCCCCT	0.677																																					p.C77C													.	KRTAP5-3	33		0			c.T231C												41.0	60.0	54.0					11																	1629385		2183	4283	6466	SO:0001819	synonymous_variant	387266	exon1			GGAGCCACAGCCC	AB126072	CCDS41591.1	11p15.5	2008-02-05			ENSG00000196224	ENSG00000196224		"""Keratin associated proteins"""	23598	protein-coding gene	gene with protein product						15144888	Standard	NM_001012708		Approved	KRTAP5.3, KRTAP5-9	uc001ltw.1	Q6L8H2	OTTHUMG00000057559	ENST00000399685.1:c.231T>C	11.37:g.1629385A>G			132	0.0151515152	2		102	0.08	8	NM_001012708	0		0	Q6PL44|Q701N3	Silent	SNP	ENST00000399685.1	37	CCDS41591.1																																																																																					0.677	KRTAP5-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000127924.1			
FAM160A2	84067	mdanderson.org	37	11	6239143	6239143	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:6239143G>T	ENST00000449352.2	-	9	1936	c.1673C>A	c.(1672-1674)gCa>gAa	p.A558E	FAM160A2_ENST00000529360.1_5'Flank|FAM160A2_ENST00000265978.4_Missense_Mutation_p.A572E|FAM160A2_ENST00000524416.1_Missense_Mutation_p.A558E			Q8N612	F16A2_HUMAN	family with sequence similarity 160, member A2	558					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	FHF complex (GO:0070695)				NS(1)|endometrium(3)|kidney(2)|large_intestine(7)|liver(1)|lung(14)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACCACGACGTGCCTCACGCAG	0.657																																					p.A572E													.	.			0			c.C1715A												67.0	62.0	64.0					11																	6239143		2201	4296	6497	SO:0001583	missense	84067	exon9			CGACGTGCCTCAC		CCDS7760.1, CCDS44530.1	11p15.4	2008-06-05	2008-06-05	2008-06-05	ENSG00000051009	ENSG00000051009			25378	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 56"""	C11orf56		11230166, 11214970	Standard	NM_001098794		Approved	FLJ22665, KIAA1759, DKFZP566M1046	uc001mck.4	Q8N612	OTTHUMG00000133379	ENST00000449352.2:c.1673C>A	11.37:g.6239143G>T	ENSP00000416918:p.Ala558Glu		24	0	0		20	0.10	2	NM_032127	21	0.00	0	Q9C0A4|Q9H0N3|Q9H624	Missense_Mutation	SNP	ENST00000449352.2	37	CCDS44530.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.196322	0.78902	.	.	ENSG00000051009	ENST00000449352;ENST00000442917;ENST00000265978;ENST00000524416	T;T;T	0.39229	1.77;1.7;1.09	4.97	4.97	0.65823	.	0.052276	0.85682	D	0.000000	T	0.66297	0.2775	M	0.80332	2.49	0.49798	D	0.999823	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71184	0.972;0.941;0.964	T	0.69844	-0.5035	10	0.56958	D	0.05	-33.5936	16.9638	0.86280	0.0:0.0:1.0:0.0	.	558;558;572	E9PJK5;Q8N612;Q8N612-2	.;F16A2_HUMAN;.	E	558;483;572;558	ENSP00000416918:A558E;ENSP00000265978:A572E;ENSP00000431773:A558E	ENSP00000265978:A572E	A	-	2	0	FAM160A2	6195719	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	8.747000	0.91610	2.590000	0.87494	0.561000	0.74099	GCA			0.657	FAM160A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000383759.1		NM_032127	
PIK3C2A	5286	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	17121444	17121444	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:17121444G>C	ENST00000265970.7	-	25	4080	c.4081C>G	c.(4081-4083)Caa>Gaa	p.Q1361E	PIK3C2A_ENST00000540361.1_Missense_Mutation_p.Q981E|PIK3C2A_ENST00000531428.1_5'UTR	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1361	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TCTGTAGTTTGGGGTTGAAGT	0.328																																					p.Q1361E													.	.			0			c.C4081G												128.0	130.0	129.0					11																	17121444		2200	4293	6493	SO:0001583	missense	5286	exon25			TAGTTTGGGGTTG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.4081C>G	11.37:g.17121444G>C	ENSP00000265970:p.Gln1361Glu		104	0	0		70	0.30	21	NM_002645	40	0.58	23	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	ENST00000265970.7	37	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073177	0.36566	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.80214	-1.35;-1.35	5.43	5.43	0.79202	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.097905	0.64402	D	0.000001	T	0.62563	0.2438	N	0.02697	-0.525	0.54753	D	0.999988	P	0.44006	0.824	B	0.39465	0.3	T	0.66228	-0.5976	10	0.22706	T	0.39	-4.4652	19.6092	0.95599	0.0:0.0:1.0:0.0	.	1361	O00443	P3C2A_HUMAN	E	1361;981	ENSP00000265970:Q1361E;ENSP00000438687:Q981E	ENSP00000265970:Q1361E	Q	-	1	0	PIK3C2A	17078020	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.816000	0.86201	2.711000	0.92665	0.655000	0.94253	CAA			0.328	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387553.1		NM_002645	
SIAE	54414	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	124517336	124517336	+	Silent	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:124517336G>A	ENST00000263593.3	-	7	1063	c.891C>T	c.(889-891)atC>atT	p.I297I	SIAE_ENST00000545756.1_Silent_p.I262I			Q9HAT2	SIAE_HUMAN	sialic acid acetylesterase	297					carbohydrate metabolic process (GO:0005975)|regulation of immune system process (GO:0002682)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	sialate O-acetylesterase activity (GO:0001681)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	15	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0243)		GCCAGTCTTCGATGAGTGCAG	0.473																																					p.I297I													.	.			0			c.C891T												161.0	138.0	146.0					11																	124517336		2201	4299	6500	SO:0001819	synonymous_variant	54414	exon7			GTCTTCGATGAGT	AF300796	CCDS8449.1, CCDS55795.1	11q24	2005-12-15	2005-12-15	2005-12-15		ENSG00000110013			18187	protein-coding gene	gene with protein product	"""sialic acid-specific acetylesterase II"""	610079	"""Ysg2 homolog (mouse)"""	YSG2		10464298	Standard	NM_001199922		Approved	CSE-C, MGC87009, LSE	uc001qan.3	Q9HAT2		ENST00000263593.3:c.891C>T	11.37:g.124517336G>A			64	0	0		39	0.44	17	NM_170601	38	0.95	36	B3KPB0|Q8IUT9|Q9HAU7|Q9NT71	Silent	SNP	ENST00000263593.3	37	CCDS8449.1																																																																																					0.473	SIAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387070.1		NM_170601	
PRDM10	56980	mdanderson.org	37	11	129772250	129772250	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr11:129772250G>T	ENST00000360871.3	-	21	3660	c.3429C>A	c.(3427-3429)acC>acA	p.T1143T	PRDM10_ENST00000526082.1_Silent_p.T1061T|PRDM10_ENST00000358825.5_Silent_p.T1147T|PRDM10_ENST00000528746.1_Silent_p.T1104T|PRDM10_ENST00000423662.2_Silent_p.T1048T|PRDM10_ENST00000304538.6_Silent_p.T1010T	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	1134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CGTTCCCGTTGGTGGTGGTGG	0.552																																					p.T1147T													.	.			0			c.C3441A												334.0	289.0	304.0					11																	129772250		2201	4297	6498	SO:0001819	synonymous_variant	56980	exon22			CCCGTTGGTGGTG	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.3429C>A	11.37:g.129772250G>T			88	0	0		35	0.09	3	NM_020228	9	0.00	0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Silent	SNP	ENST00000360871.3	37	CCDS8484.1																																																																																					0.552	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386076.1		NM_199437	
MRPS35	60488	broad.mit.edu	37	12	27863571	27863572	+	5'Flank	INS	-	-	T	rs11324548|rs398076525	byFrequency	TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr12:27863571_27863572insT	ENST00000081029.3	+	0	0				RP11-1060J15.4_ENST00000542660.1_RNA|RP11-1060J15.7_ENST00000538640.1_lincRNA|RP11-1060J15.4_ENST00000536317.1_RNA|MRPS35_ENST00000538315.1_5'Flank	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35							mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					ATTTTTAAGGATTTTTTTTGTT	0.465																																					.													.	MRPS35	26		0			.																																									SO:0001631	upstream_gene_variant	0	.			TTAAGGATTTTTT	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215		12.37:g.27863579_27863579dupT	Exception_encountered		9	0	0		6	0.33	2	.	0		0	B2RDZ7|Q96Q21	RNA	INS	ENST00000081029.3	37	CCDS8714.1																																																																																					0.465	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402897.1		NM_021821	
KCNH3	23416	ucsc.edu	37	12	49937278	49937278	+	Missense_Mutation	SNP	C	C	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr12:49937278C>A	ENST00000257981.6	+	5	1060	c.800C>A	c.(799-801)gCc>gAc	p.A267D	KCNH3_ENST00000550434.1_3'UTR	NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	267					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						TGTGACCTGGCCGTGGAGGTC	0.667																																					p.A267D													.	KCNH3	88		0			c.C800A												46.0	43.0	44.0					12																	49937278		2203	4300	6503	SO:0001583	missense	23416	exon5			ACCTGGCCGTGGA	AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.800C>A	12.37:g.49937278C>A	ENSP00000257981:p.Ala267Asp		14	0	0		13	0.31	4	NM_012284	20	0.00	0	Q9UQ06	Missense_Mutation	SNP	ENST00000257981.6	37	CCDS8786.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.443368	0.83993	.	.	ENSG00000135519	ENST00000257981	D	0.94497	-3.44	4.56	4.56	0.56223	Ion transport (1);	0.000000	0.46758	D	0.000276	D	0.93785	0.8013	M	0.67700	2.07	0.33940	D	0.643154	B	0.25772	0.134	B	0.38755	0.281	D	0.94795	0.7965	10	0.72032	D	0.01	.	8.7519	0.34620	0.0:0.8987:0.0:0.1013	.	267	Q9ULD8	KCNH3_HUMAN	D	267	ENSP00000257981:A267D	ENSP00000257981:A267D	A	+	2	0	KCNH3	48223545	0.000000	0.05858	0.958000	0.39756	0.980000	0.70556	0.555000	0.23422	2.559000	0.86315	0.655000	0.94253	GCC			0.667	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404571.2		NM_012284	
SLC35E3	55508	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	69140302	69140302	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr12:69140302G>C	ENST00000398004.2	+	1	417	c.145G>C	c.(145-147)Gtg>Ctg	p.V49L		NM_018656.2	NP_061126.2	Q7Z769	S35E3_HUMAN	solute carrier family 35, member E3	49						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12	Breast(13;2.31e-06)|Renal(347;0.0684)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00372)			CCTGACCCTGGTGCACTTCGT	0.572																																					p.V49L													.	.			0			c.G145C												74.0	80.0	78.0					12																	69140302		2013	4171	6184	SO:0001583	missense	55508	exon1			ACCCTGGTGCACT	AF148713, AY358943	CCDS41808.1	12q15	2014-09-04			ENSG00000175782	ENSG00000175782		"""Solute carriers"""	20864	protein-coding gene	gene with protein product						12975309	Standard	XM_005269006		Approved	BLOV1	uc001suh.3	Q7Z769	OTTHUMG00000169282	ENST00000398004.2:c.145G>C	12.37:g.69140302G>C	ENSP00000381089:p.Val49Leu		120	0	0		139	0.27	37	NM_018656	31	0.35	11	A8K0T0|Q0P5Y5|Q9P0V1	Missense_Mutation	SNP	ENST00000398004.2	37	CCDS41808.1	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150630	0.37923	.	.	ENSG00000175782	ENST00000398004	T	0.54279	0.58	5.17	5.17	0.71159	.	0.133787	0.50627	D	0.000113	T	0.36386	0.0965	N	0.16233	0.39	0.47547	D	0.999458	B	0.02656	0.0	B	0.04013	0.001	T	0.14364	-1.0475	9	.	.	.	-5.9609	15.4134	0.74945	0.0:0.1394:0.8606:0.0	.	49	Q7Z769	S35E3_HUMAN	L	49	ENSP00000381089:V49L	.	V	+	1	0	SLC35E3	67426569	1.000000	0.71417	1.000000	0.80357	0.620000	0.37586	3.408000	0.52651	2.569000	0.86673	0.591000	0.81541	GTG			0.572	SLC35E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403241.1		NM_018656	
CAPS2	84698	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	75716837	75716837	+	Missense_Mutation	SNP	C	C	G			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr12:75716837C>G	ENST00000409445.3	-	5	461	c.265G>C	c.(265-267)Gca>Cca	p.A89P	CAPS2_ENST00000393284.3_5'UTR|CAPS2_ENST00000442339.2_Intron|CAPS2_ENST00000409799.1_Intron	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	89							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						GGCAGGTTTGCTGTACTAAGT	0.279																																					p.A89P													.	CAPS2	96		0			c.G265C												38.0	35.0	36.0					12																	75716837		692	1585	2277	SO:0001583	missense	84698	exon5			GGTTTGCTGTACT	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.265G>C	12.37:g.75716837C>G	ENSP00000386959:p.Ala89Pro		332	0.0030120482	1		421	0.18	77	NM_032606	0		0	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	37	CCDS9008.2	.	.	.	.	.	.	.	.	.	.	C	8.507	0.865607	0.17250	.	.	ENSG00000180881	ENST00000409445	T	0.55234	0.53	4.84	2.97	0.34412	.	0.739208	0.12552	N	0.458967	T	0.34308	0.0893	N	0.19112	0.55	0.09310	N	0.999997	B	0.33073	0.396	B	0.31614	0.133	T	0.14448	-1.0472	10	0.36615	T	0.2	-0.1012	8.1854	0.31335	0.0:0.7453:0.1639:0.0907	.	89	Q9BXY5	CAYP2_HUMAN	P	89	ENSP00000386959:A89P	ENSP00000386959:A89P	A	-	1	0	CAPS2	74003104	0.000000	0.05858	0.015000	0.15790	0.065000	0.16274	-0.352000	0.07701	1.370000	0.46153	0.561000	0.74099	GCA			0.279	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000327880.2			
HVCN1	84329	broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	111099034	111099034	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr12:111099034C>T	ENST00000356742.5	-	3	994	c.241G>A	c.(241-243)Gca>Aca	p.A81T	HVCN1_ENST00000242607.8_Missense_Mutation_p.A81T|HVCN1_ENST00000439744.2_Missense_Mutation_p.A61T|HVCN1_ENST00000548312.1_Missense_Mutation_p.A81T			Q96D96	HVCN1_HUMAN	hydrogen voltage-gated channel 1	81					cellular response to pH (GO:0071467)|cellular response to zinc ion (GO:0071294)|multicellular organism reproduction (GO:0032504)|proton transport (GO:0015992)|response to pH (GO:0009268)|response to zinc ion (GO:0010043)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	voltage-gated cation channel activity (GO:0022843)|voltage-gated proton channel activity (GO:0030171)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	19						GCCCTGGGTGCGGGGCCAGGG	0.647																																					p.A81T													.	HVCN1	38		0			c.G241A												42.0	49.0	47.0					12																	111099034		2203	4300	6503	SO:0001583	missense	84329	exon4			TGGGTGCGGGGCC	BC007277	CCDS31900.1, CCDS58278.1	12q24.11	2011-12-09	2006-03-24	2006-03-24	ENSG00000122986	ENSG00000122986		"""Voltage-gated ion channels / Hydrogen voltage-gated channel"""	28240	protein-coding gene	gene with protein product	"""voltage sensor domain-only protein"""	611227				20961760, 16556803, 18356202, 22020278	Standard	NM_032369		Approved	MGC15619, Hv1, VSOP	uc001trs.2	Q96D96		ENST00000356742.5:c.241G>A	12.37:g.111099034C>T	ENSP00000349181:p.Ala81Thr		226	0	0		215	0.04	8	NM_032369	111	0.00	0	A8MQ37|B4DEB3|F8WCH5|Q6UW11|Q96IS5	Missense_Mutation	SNP	ENST00000356742.5	37	CCDS31900.1	.	.	.	.	.	.	.	.	.	.	c	4.411	0.075996	0.08485	.	.	ENSG00000122986	ENST00000548312;ENST00000242607;ENST00000356742;ENST00000439744	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.31	-7.03	0.01584	.	1.369320	0.04527	N	0.385774	T	0.14356	0.0347	N	0.03177	-0.4	0.09310	N	1	B;B	0.11235	0.004;0.001	B;B	0.04013	0.001;0.001	T	0.12066	-1.0562	10	0.15499	T	0.54	-2.1976	3.0508	0.06168	0.1078:0.1599:0.2297:0.5026	.	81;81	Q96D96;Q96D96-3	HVCN1_HUMAN;.	T	81;81;81;61	ENSP00000449601:A81T;ENSP00000242607:A81T;ENSP00000349181:A81T;ENSP00000412052:A61T	ENSP00000242607:A81T	A	-	1	0	HVCN1	109583417	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.849000	0.04322	-1.213000	0.02617	-1.138000	0.01928	GCA			0.647	HVCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404653.1		NM_032369	
IRG1	730249	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	13	77531565	77531565	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr13:77531565G>C	ENST00000377462.1	+	5	953	c.891G>C	c.(889-891)gaG>gaC	p.E297D	IRG1_ENST00000449753.1_Missense_Mutation_p.E297D	NM_001258406.1	NP_001245335.1	A6NK06	IRG1_HUMAN	immunoresponsive 1 homolog (mouse)	297					cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to progesterone stimulus (GO:0071393)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of type I interferon production (GO:0032480)|positive regulation of antimicrobial humoral response (GO:0002760)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|propionate catabolic process (GO:0019543)|tolerance induction to lipopolysaccharide (GO:0072573)	mitochondrion (GO:0005739)	2-methylcitrate dehydratase activity (GO:0047547)|aconitate decarboxylase activity (GO:0047613)										TTGTAGCAGAGAGAGCCCTGC	0.502																																					p.E293D													.	.			0			c.G879C																																									SO:0001583	missense	730249	exon4			AGCAGAGAGAGCC		CCDS58299.1	13q22.3	2013-04-29			ENSG00000102794	ENSG00000102794			33904	protein-coding gene	gene with protein product		615275				23610393	Standard	NM_001258406		Approved		uc031qmi.1	A6NK06	OTTHUMG00000017098	ENST00000377462.1:c.891G>C	13.37:g.77531565G>C	ENSP00000366682:p.Glu297Asp		146	0	0		89	0.29	26	NM_001258406	0		0		Missense_Mutation	SNP	ENST00000377462.1	37	CCDS58299.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.766117	0.00651	.	.	ENSG00000102794	ENST00000377462;ENST00000449753	.	.	.	5.18	0.594	0.17485	.	0.760457	0.13141	N	0.410656	T	0.10121	0.0248	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.25779	-1.0122	7	0.11794	T	0.64	-7.5403	1.5515	0.02576	0.1311:0.3171:0.3039:0.2478	.	.	.	.	D	297	.	ENSP00000366682:E297D	E	+	3	2	IRG1	76429566	0.000000	0.05858	0.015000	0.15790	0.018000	0.09664	-0.557000	0.05985	0.264000	0.21851	0.655000	0.94253	GAG			0.502	IRG1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045311.1		XM_001133269	
RBM23	55147	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	23374412	23374412	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr14:23374412G>T	ENST00000359890.3	-	8	812	c.617C>A	c.(616-618)tCt>tAt	p.S206Y	RBM23_ENST00000555209.1_5'UTR|RBM23_ENST00000542016.2_Missense_Mutation_p.S36Y|RBM23_ENST00000556984.1_5'Flank|RBM23_ENST00000346528.5_Missense_Mutation_p.S172Y|RBM23_ENST00000399922.2_Missense_Mutation_p.S190Y	NM_001077351.1	NP_001070819.1	Q86U06	RBM23_HUMAN	RNA binding motif protein 23	206	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|lung(3)|prostate(1)|skin(1)	10	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.0128)		AATGCCCTTAGAACGACGTGA	0.502																																					p.S206Y													.	.			0			c.C617A												75.0	70.0	72.0					14																	23374412		2036	4185	6221	SO:0001583	missense	55147	exon8			CCCTTAGAACGAC	AF275678	CCDS41919.1, CCDS41920.1, CCDS41921.1	14q11.1	2014-07-03	2004-04-23	2004-04-23		ENSG00000100461		"""RNA binding motif (RRM) containing"""	20155	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen recep- tors beta"""		"""RNA-binding region (RNP1, RRM) containing 4"""	RNPC4		15694343	Standard	NM_018107		Approved	FLJ10482, CAPERbeta	uc001whg.3	Q86U06		ENST00000359890.3:c.617C>A	14.37:g.23374412G>T	ENSP00000352956:p.Ser206Tyr		109	0	0		95	0.18	17	NM_001077351	132	0.35	46	D3DS32|Q8ND16|Q8TB88|Q8WY40|Q9BUJ1|Q9NVV7	Missense_Mutation	SNP	ENST00000359890.3	37	CCDS41921.1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.913747	0.92178	.	.	ENSG00000100461	ENST00000359890;ENST00000338980;ENST00000399922;ENST00000346528;ENST00000542016;ENST00000557403;ENST00000555722	T;T;T;T;T;T	0.79352	0.88;0.88;0.59;-1.26;2.94;-1.26	5.28	5.28	0.74379	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.189186	0.36703	N	0.002460	D	0.93151	0.7819	H	0.98980	4.39	0.58432	D	0.999999	D;D;D;D	0.65815	0.983;0.995;0.992;0.994	D;D;D;D	0.72982	0.964;0.96;0.971;0.979	D	0.95312	0.8413	10	0.62326	D	0.03	-15.8635	17.8393	0.88710	0.0:0.0:1.0:0.0	.	206;172;190;206	Q86U06-3;Q86U06-4;Q86U06-2;Q86U06	.;.;.;RBM23_HUMAN	Y	206;183;190;172;36;36;36	ENSP00000352956:S206Y;ENSP00000382806:S190Y;ENSP00000339220:S172Y;ENSP00000438504:S36Y;ENSP00000452171:S36Y;ENSP00000450556:S36Y	ENSP00000305783:S206Y	S	-	2	0	RBM23	22444252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.839000	0.92120	2.745000	0.94114	0.655000	0.94253	TCT			0.502	RBM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000413545.3			
NRL	4901	mdanderson.org	37	14	24550449	24550449	+	Missense_Mutation	SNP	A	A	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr14:24550449A>T	ENST00000561028.1	-	3	1029	c.710T>A	c.(709-711)cTc>cAc	p.L237H	NRL_ENST00000396995.1_Missense_Mutation_p.L98H|NRL_ENST00000396997.1_Missense_Mutation_p.L237H|NRL_ENST00000560550.1_Missense_Mutation_p.L98H|NRL_ENST00000397002.2_Missense_Mutation_p.L237H			P54845	NRL_HUMAN	neural retina leucine zipper	237					positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of rhodopsin gene expression (GO:0007468)|response to stimulus (GO:0050896)|retinal rod cell development (GO:0046548)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(2)	2				GBM - Glioblastoma multiforme(265;0.0181)		AACGGCTCAGAGGAAGAGGTG	0.692																																					p.L237H													.	.			0			c.T710A												4.0	5.0	4.0					14																	24550449		2008	4011	6019	SO:0001583	missense	4901	exon3			GCTCAGAGGAAGA		CCDS9608.1	14q11.1-q11.2	2013-01-08			ENSG00000129535	ENSG00000129535			8002	protein-coding gene	gene with protein product		162080				1427865, 10192380	Standard	NM_006177		Approved	D14S46E, RP27, NRL-MAF	uc021rrk.1	P54845	OTTHUMG00000028789	ENST00000561028.1:c.710T>A	14.37:g.24550449A>T	ENSP00000454062:p.Leu237His		49	0	0		29	0.10	3	NM_006177	3	0.00	0	A8MX14|Q53XD0	Missense_Mutation	SNP	ENST00000561028.1	37	CCDS9608.1	.	.	.	.	.	.	.	.	.	.	A	15.58	2.876879	0.51801	.	.	ENSG00000129535	ENST00000397002;ENST00000396997;ENST00000396995	D;D;D	0.97959	-4.63;-4.63;-1.86	4.58	4.58	0.56647	.	0.612905	0.13635	N	0.373379	D	0.93523	0.7933	L	0.29908	0.895	0.24927	N	0.991947	P	0.46327	0.876	B	0.36959	0.237	D	0.89250	0.3590	10	0.87932	D	0	.	7.3294	0.26573	0.8983:0.0:0.1017:0.0	.	237	P54845	NRL_HUMAN	H	237;237;98	ENSP00000380197:L237H;ENSP00000380193:L237H;ENSP00000380191:L98H	ENSP00000337023:L237H	L	-	2	0	NRL	23620289	0.988000	0.35896	1.000000	0.80357	0.024000	0.10985	0.353000	0.20130	2.016000	0.59253	0.334000	0.21626	CTC			0.692	NRL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415595.1			
CEP170B	283638	mdanderson.org	37	14	105353263	105353263	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr14:105353263C>T	ENST00000414716.3	+	12	2915	c.2687C>T	c.(2686-2688)gCc>gTc	p.A896V	CEP170B_ENST00000418279.1_Missense_Mutation_p.A826V|CEP170B_ENST00000453495.1_Missense_Mutation_p.A897V|CEP170B_ENST00000556508.1_Missense_Mutation_p.A826V	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	896						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CAGGACCTGGCCGCTACCCGG	0.672																																					p.A896V													.	.			0			c.C2687T												21.0	28.0	26.0					14																	105353263		1948	4126	6074	SO:0001583	missense	283638	exon12			ACCTGGCCGCTAC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2687C>T	14.37:g.105353263C>T	ENSP00000404151:p.Ala896Val		30	0	0		17	0.12	2	NM_001112726	12	0.00	0	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.631855	0.29068	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.45668	0.9;0.89;0.91;0.9	4.48	3.49	0.39957	.	0.667552	0.14790	N	0.298294	T	0.35566	0.0936	L	0.54323	1.7	0.29136	N	0.879354	P;P;P	0.39282	0.666;0.666;0.617	B;B;B	0.39840	0.311;0.141;0.173	T	0.19582	-1.0301	10	0.30078	T	0.28	-13.2061	6.1698	0.20410	0.3657:0.5014:0.1329:0.0	.	896;896;826	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	V	826;896;897;826	ENSP00000451249:A826V;ENSP00000404151:A896V;ENSP00000407238:A897V;ENSP00000415006:A826V	ENSP00000404151:A896V	A	+	2	0	KIAA0284	104424308	0.409000	0.25368	0.884000	0.34674	0.144000	0.21451	1.056000	0.30480	2.032000	0.59987	0.491000	0.48974	GCC			0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000410289.2		NM_001112726	
NR2E3	10002	mdanderson.org	37	15	72106456	72106456	+	RNA	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr15:72106456G>T	ENST00000398840.2	+	0	1288							Q9Y5X4	NR2E3_HUMAN	nuclear receptor subfamily 2, group E, member 3						eye photoreceptor cell development (GO:0042462)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction (GO:0007602)|positive regulation of rhodopsin gene expression (GO:0045872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(1)	3						GCCAGCCCGTGAGGTGACCTG	0.612																																					p.V366V													NR2E3_ENST00000398840,NS,carcinoma,+2,3	NR2E3_ENST00000398840	2	3	0			c.G1098T												28.0	35.0	33.0					15																	72106456		2167	4260	6427			10002	exon8			GCCCGTGAGGTGA		CCDS73750.1, CCDS73751.1	15q23	2013-01-16			ENSG00000031544	ENSG00000278570		"""Nuclear hormone receptors"""	7974	protein-coding gene	gene with protein product		604485				10220376	Standard	NM_016346		Approved	PNR, rd7, RP37	uc002ath.1	Q9Y5X4	OTTHUMG00000172841		15.37:g.72106456G>T			23	0	0		27	0.11	3	NM_014249	0		0	B6ZGU0|Q9UHM4	Silent	SNP	ENST00000398840.2	37																																																																																						0.612	NR2E3-202	KNOWN	basic	processed_transcript	processed_transcript				NM_014249	
SETD1A	9739	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	30974776	30974776	+	Silent	SNP	T	T	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr16:30974776T>C	ENST00000262519.8	+	5	1226	c.540T>C	c.(538-540)taT>taC	p.Y180Y		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	180					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						TGAAATACTATGAACTAATTG	0.512																																					p.Y180Y													.	.			0			c.T540C												190.0	180.0	183.0					16																	30974776		2197	4300	6497	SO:0001819	synonymous_variant	9739	exon5			ATACTATGAACTA	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.540T>C	16.37:g.30974776T>C			103	0	0		75	0.20	15	NM_014712	67	0.28	19	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	ENST00000262519.8	37	CCDS32435.1																																																																																					0.512	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318244.2		NM_014712	
E2F4	1874	mdanderson.org	37	16	67235503	67235503	+	IGR	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr16:67235503G>A	ENST00000379378.3	+	0	2096				ELMO3_ENST00000477898.1_Silent_p.L179L|MIR328_ENST00000385213.1_RNA|ELMO3_ENST00000360833.1_Silent_p.L328L|ELMO3_ENST00000393997.2_Silent_p.L345L	NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding						blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		TGCTGGGGCTGCTGGAGCCGC	0.602																																					p.L345L													.	.			0			c.G1035A												55.0	60.0	58.0					16																	67235503		2115	4228	6343	SO:0001628	intergenic_variant	79767	exon10			GGGGCTGCTGGAG	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975		16.37:g.67235503G>A			55	0	0		31	0.10	3	NM_024712	5	0.00	0	A6NGR8|B5BU56|Q12991|Q15328	Silent	SNP	ENST00000379378.3	37	CCDS32464.1																																																																																					0.602	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421565.1		NM_001950	
CNTNAP4	85445	mdanderson.org	37	16	76496003	76496003	+	Splice_Site	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr16:76496003G>T	ENST00000476707.1	+	8	1631		c.e8+1		CNTNAP4_ENST00000377504.4_Splice_Site|CNTNAP4_ENST00000478060.1_Splice_Site|CNTNAP4_ENST00000469589.1_Splice_Site|CNTNAP4_ENST00000307431.8_Splice_Site			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4						cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TATTTTGGAGGTAAGAATAGG	0.473																																					.													.	.			0			c.1482+1G>T												34.0	34.0	34.0					16																	76496003		2197	4300	6497	SO:0001630	splice_region_variant	85445	exon9			TTGGAGGTAAGAA	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.1492+1G>T	16.37:g.76496003G>T			90	0	0		41	0.07	3	NM_033401	0		0	E9PFZ6|Q86YZ7	Splice_Site	SNP	ENST00000476707.1	37		.	.	.	.	.	.	.	.	.	.	G	20.9	4.064494	0.76187	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0696	0.89402	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP4	75053504	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.044000	0.89434	2.570000	0.86706	0.650000	0.86243	.			0.473	CNTNAP4-005	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000348216.1		NM_033401	Intron
KRT18P55	284085	broad.mit.edu	37	17	26633347	26633348	+	RNA	INS	-	-	G	rs35679432|rs6505076	byFrequency	TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr17:26633347_26633348insG	ENST00000577198.1	-	0	407					NR_028334.1				keratin 18 pseudogene 55																		ttgttgttgttttttttttttt	0.262													|||unknown(HR)	1257	0.250998	0.1861	0.3343	5008	,	,		18973	0.0665		0.4294	False		,,,				2504	0.2863				.													.	.			0			.																																											0	.			TGTTGTTTTTTTT			17q11.2	2013-06-25			ENSG00000265480	ENSG00000265480			26874	pseudogene	pseudogene							Standard	NR_028334		Approved		uc002has.3		OTTHUMG00000179422		17.37:g.26633347_26633348insG			6	0	0		8	0.63	5	.	0		0		RNA	INS	ENST00000577198.1	37																																																																																						0.262	KRT18P55-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000446194.1		NR_028334	
YWHAEP7	284100	broad.mit.edu	37	17	36214141	36214141	+	RNA	DEL	A	A	-	rs76035088		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr17:36214141delA	ENST00000590732.1	-	0	325					NR_024178.1																						CAGCaaaattaaaaaaaaaaa	0.328																																					.													.	LOC284100	14		0			.																																											0	.			AAAATTAAAAAAA																													17.37:g.36214141delA			9	0	0		8	0.50	4	.	0		0		RNA	DEL	ENST00000590732.1	37																																																																																						0.328	RP11-115K3.2-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000451947.1			
RPL19	6143	hgsc.bcm.edu	37	17	37360424	37360424	+	Missense_Mutation	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr17:37360424C>T	ENST00000225430.4	+	5	513	c.451C>T	c.(451-453)Cgc>Tgc	p.R151C	RPL19_ENST00000579260.1_Missense_Mutation_p.R149C|RPL19_ENST00000582193.1_Missense_Mutation_p.R149C|RPL19_ENST00000579374.1_Missense_Mutation_p.R148C	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	151					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						AGACAAGGCCCGCAAGAAGCT	0.453																																					p.R151C													RPL19,NS,carcinoma,-1,1	RPL19	-1	1	0			c.C451T												62.0	65.0	64.0					17																	37360424		1909	4127	6036	SO:0001583	missense	6143	exon5			AAGGCCCGCAAGA		CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.451C>T	17.37:g.37360424C>T	ENSP00000225430:p.Arg151Cys		42	0.0238095238	1		27	0.11	3	NM_000981	6239	0.00	7	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	37	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	c	19.04	3.750092	0.69533	.	.	ENSG00000108298	ENST00000225430	.	.	.	5.43	5.43	0.79202	.	0.056541	0.64402	N	0.000001	T	0.81597	0.4856	H	0.96208	3.785	0.80722	D	1	B	0.16166	0.016	B	0.08055	0.003	T	0.81957	-0.0695	9	0.62326	D	0.03	.	18.8481	0.92215	0.0:1.0:0.0:0.0	.	151	P84098	RL19_HUMAN	C	151	.	ENSP00000225430:R151C	R	+	1	0	RPL19	34613950	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.627000	0.83176	2.551000	0.86045	0.563000	0.77884	CGC			0.453	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000444190.1		NM_000981	
SRP68	6730	mdanderson.org	37	17	74037023	74037023	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr17:74037023G>T	ENST00000307877.2	-	14	1722	c.1561C>A	c.(1561-1563)Cgg>Agg	p.R521R	SRP68_ENST00000539137.1_Silent_p.R483R|SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000355113.5_Silent_p.R420R|SRP68_ENST00000602720.1_Silent_p.R182R	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	521					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						TTCTCTGACCGCACTTGAGTG	0.577																																					p.R521R													SRP68,caecum,carcinoma,0,3	SRP68	0	3	0			c.C1561A												83.0	83.0	83.0					17																	74037023		2203	4300	6503	SO:0001819	synonymous_variant	6730	exon14			CTGACCGCACTTG	AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.1561C>A	17.37:g.74037023G>T			42	0	0		52	0.06	3	NM_014230	164	0.00	0	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Silent	SNP	ENST00000307877.2	37	CCDS11738.1																																																																																					0.577	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449487.1		NM_014230	
ENDOV	284131	mdanderson.org	37	17	78395647	78395647	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr17:78395647G>A	ENST00000518137.1	+	3	276	c.248G>A	c.(247-249)cGc>cAc	p.R83H	ENDOV_ENST00000518644.1_5'UTR|MIR4730_ENST00000584535.1_RNA|ENDOV_ENST00000522751.1_Intron|ENDOV_ENST00000518901.1_Intron|ENDOV_ENST00000520367.1_Intron|ENDOV_ENST00000518907.1_Intron|ENDOV_ENST00000323854.5_Intron|ENDOV_ENST00000517295.2_5'UTR|ENDOV_ENST00000520284.1_Intron|ENDOV_ENST00000517795.1_Intron	NM_173627.3	NP_775898.2	Q8N8Q3	ENDOV_HUMAN	endonuclease V	83					DNA repair (GO:0006281)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|endoribonuclease activity, producing 5'-phosphomonoesters (GO:0016891)|magnesium ion binding (GO:0000287)|single-stranded RNA binding (GO:0003727)|structure-specific DNA binding (GO:0043566)			endometrium(1)|lung(1)|pancreas(1)|prostate(1)	4						GAGGAGAGCCGCATGGTCAGC	0.662								Direct reversal of damage																													p.R83H													.	.			0			c.G248A												39.0	45.0	43.0					17																	78395647		2184	4272	6456	SO:0001583	missense	284131	exon3			AGAGCCGCATGGT		CCDS54172.1, CCDS54173.1, CCDS54174.1	17q25.3	2011-05-05			ENSG00000173818	ENSG00000173818			26640	protein-coding gene	gene with protein product						12853604	Standard	NM_001164638		Approved	FLJ35220	uc021ueo.1	Q8N8Q3	OTTHUMG00000164638	ENST00000518137.1:c.248G>A	17.37:g.78395647G>A	ENSP00000429190:p.Arg83His		33	0	0		14	0.21	3	NM_173627	18	0.00	0	I3L3S4|Q6P2G2|Q86X99|Q8NAK0	Missense_Mutation	SNP	ENST00000518137.1	37	CCDS54172.1	.	.	.	.	.	.	.	.	.	.	G	12.88	2.071336	0.36566	.	.	ENSG00000173818	ENST00000518137;ENST00000517295	T	0.17528	2.27	4.63	3.66	0.41972	.	0.401225	0.26176	N	0.025886	T	0.09468	0.0233	N	0.11651	0.15	0.80722	D	1	B	0.12630	0.006	B	0.16289	0.015	T	0.12041	-1.0563	10	0.45353	T	0.12	-11.6847	10.4517	0.44526	0.0917:0.0:0.9083:0.0	.	83	Q8N8Q3	ENDOV_HUMAN	H	83;58	ENSP00000429190:R83H	ENSP00000428283:R58H	R	+	2	0	ENDOV	76010242	1.000000	0.71417	0.175000	0.22980	0.908000	0.53690	1.748000	0.38308	1.162000	0.42619	0.591000	0.81541	CGC			0.662	ENDOV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000379487.1		NM_173627	
NDUFS7	374291	mdanderson.org	37	19	1393300	1393300	+	Missense_Mutation	SNP	G	G	A	rs536671984		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:1393300G>A	ENST00000233627.9	+	7	811	c.515G>A	c.(514-516)cGc>cAc	p.R172H	NDUFS7_ENST00000414651.2_Missense_Mutation_p.R202H|NDUFS7_ENST00000313408.7_Missense_Mutation_p.R172H|NDUFS7_ENST00000546283.1_Missense_Mutation_p.R172H|AC005329.7_ENST00000501448.1_RNA|AC005329.7_ENST00000589734.1_RNA|NDUFS7_ENST00000539480.1_Missense_Mutation_p.R172H|AC005329.7_ENST00000585596.1_RNA|NDUFS7_ENST00000540530.1_3'UTR	NM_024407.4	NP_077718.3	O75251	NDUS7_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 7, 20kDa (NADH-coenzyme Q reductase)	172					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|synaptic membrane (GO:0097060)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|quinone binding (GO:0048038)			ovary(1)	1		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)|Breast(49;0.00186)|Lung NSC(49;0.00292)|all_lung(49;0.00419)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Doxorubicin(DB00997)	GGCTGCGACCGCATCGTGCCC	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		14888	0.0		0.0	False		,,,				2504	0.001				p.R172H													.	.			0			c.G515A												105.0	59.0	74.0					19																	1393300		2187	4288	6475	SO:0001583	missense	374291	exon7			GCGACCGCATCGT	AF115969	CCDS12063.1	19p13	2011-07-04	2002-08-29		ENSG00000115286	ENSG00000115286		"""Mitochondrial respiratory chain complex / Complex I"""	7714	protein-coding gene	gene with protein product	"""complex I 20kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 7, mitochondrial"""	601825	"""NADH dehydrogenase (ubiquinone) Fe-S protein 7 (20kD) (NADH-coenzyme Q reductase)"""			8938450	Standard	NM_024407		Approved	PSST, FLJ46880, FLJ45860, CI-20	uc002lse.4	O75251	OTTHUMG00000168077	ENST00000233627.9:c.515G>A	19.37:g.1393300G>A	ENSP00000233627:p.Arg172His		35	0	0		45	0.07	3	NM_024407	151	0.00	0	B3KRI2|Q2T9H7|Q9BV17	Missense_Mutation	SNP	ENST00000233627.9	37	CCDS12063.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.958814	0.74016	.	.	ENSG00000115286	ENST00000546283;ENST00000233627;ENST00000539480;ENST00000313408;ENST00000414651;ENST00000538929;ENST00000538523;ENST00000540530;ENST00000535382	T;T;T;T;T	0.77229	-1.08;-1.01;-1.08;-1.08;-1.08	4.57	4.57	0.56435	NADH:ubiquinone oxidoreductase-like, 20kDa subunit (2);	.	.	.	.	D	0.86372	0.5917	M	0.66506	2.035	0.80722	D	1	D;D;D;D	0.89917	1.0;0.99;1.0;1.0	D;P;D;D	0.97110	0.999;0.869;1.0;0.998	D	0.88129	0.2837	9	0.87932	D	0	.	14.8684	0.70434	0.0:0.0:1.0:0.0	.	172;179;172;172	F5H5N1;Q8NAS7;B3KRI2;O75251	.;.;.;NDUS7_HUMAN	H	172;172;172;172;202;91;91;91;91	ENSP00000440348:R172H;ENSP00000233627:R172H;ENSP00000443273:R172H;ENSP00000364262:R172H;ENSP00000406630:R202H	ENSP00000233627:R172H	R	+	2	0	NDUFS7	1344300	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.364000	0.73086	2.096000	0.63516	0.655000	0.94253	CGC			0.692	NDUFS7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397984.1		NM_024407	
ONECUT3	390874	mdanderson.org	37	19	1754743	1754743	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:1754743G>A	ENST00000382349.4	+	1	2372	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H		NM_001080488.1	NP_001073957.1	O60422	ONEC3_HUMAN	one cut homeobox 3	361					endocrine pancreas development (GO:0031018)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)						Acute lymphoblastic leukemia(61;4.66e-11)|all_hematologic(61;4.59e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACCTGCTGCGCAACCCCAAG	0.652																																					p.R361H													.	.			0			c.G1082A												22.0	19.0	20.0					19																	1754743		2190	4275	6465	SO:0001583	missense	390874	exon1			TGCTGCGCAACCC	AC004755	CCDS45900.1	19p13.3	2012-03-09	2007-07-16			ENSG00000205922		"""Homeoboxes / CUT class"""	13399	protein-coding gene	gene with protein product		611294	"""one cut domain, family member 3"""			9915796	Standard	NM_001080488		Approved		uc010xgr.2	O60422		ENST00000382349.4:c.1082G>A	19.37:g.1754743G>A	ENSP00000371786:p.Arg361His		41	0	0		34	0.09	3	NM_001080488	0		0	A8MZM7	Missense_Mutation	SNP	ENST00000382349.4	37	CCDS45900.1	.	.	.	.	.	.	.	.	.	.	G	32	5.156513	0.94686	.	.	ENSG00000205922	ENST00000382349	D	0.86562	-2.14	3.43	3.43	0.39272	Homeodomain protein CUT (2);Lambda repressor-like, DNA-binding (2);	0.092099	0.41823	U	0.000811	D	0.93556	0.7943	M	0.89601	3.045	0.80722	D	1	D	0.55385	0.971	D	0.64042	0.921	D	0.94711	0.7892	10	0.87932	D	0	.	13.4317	0.61059	0.0:0.0:1.0:0.0	.	361	O60422	ONEC3_HUMAN	H	361	ENSP00000371786:R361H	ENSP00000371786:R361H	R	+	2	0	ONECUT3	1705743	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.461000	0.80834	1.450000	0.47717	0.462000	0.41574	CGC			0.652	ONECUT3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418499.1			
TJP3	27134	mdanderson.org	37	19	3747807	3747807	+	Nonsense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:3747807G>T	ENST00000541714.2	+	19	2800	c.2338G>T	c.(2338-2340)Gag>Tag	p.E780*	TJP3_ENST00000262968.9_Nonsense_Mutation_p.E813*|TJP3_ENST00000589378.1_Nonsense_Mutation_p.E789*|TJP3_ENST00000587686.1_Nonsense_Mutation_p.E799*|TJP3_ENST00000382008.3_Nonsense_Mutation_p.E794*|TJP3_ENST00000539908.2_Nonsense_Mutation_p.E744*	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	780					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCTCCTTGGAGGACAACCT	0.667																																					p.E789X													.	.			0			c.G2365T												30.0	25.0	27.0					19																	3747807		2200	4298	6498	SO:0001587	stop_gained	27134	exon19			TCCTTGGAGGACA	AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.2338G>T	19.37:g.3747807G>T	ENSP00000439278:p.Glu780*		11	0	0		13	0.15	2	NM_001267561	210	0.00	0	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Nonsense_Mutation	SNP	ENST00000541714.2	37	CCDS32873.2	.	.	.	.	.	.	.	.	.	.	G	36	5.831698	0.97003	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	.	.	.	4.54	4.54	0.55810	.	0.338684	0.30446	N	0.009613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	14.4302	0.67243	0.0:0.0:1.0:0.0	.	.	.	.	X	780;744;794;813	.	ENSP00000262968:E813X	E	+	1	0	TJP3	3698807	1.000000	0.71417	0.862000	0.33874	0.015000	0.08874	5.935000	0.70145	2.062000	0.61559	0.561000	0.74099	GAG			0.667	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000453434.1			
LDLR	3949	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11210902	11210902	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:11210902G>T	ENST00000558518.1	+	2	258	c.71G>T	c.(70-72)gGc>gTc	p.G24V	LDLR_ENST00000545707.1_Missense_Mutation_p.G24V|LDLR_ENST00000558013.1_Missense_Mutation_p.G24V|LDLR_ENST00000455727.2_Missense_Mutation_p.G24V|LDLR_ENST00000535915.1_Missense_Mutation_p.G24V|LDLR_ENST00000557933.1_Missense_Mutation_p.G24V	NM_000527.4|NM_001195798.1	NP_000518.1|NP_001182727.1	P01130	LDLR_HUMAN	low density lipoprotein receptor	24					cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|intestinal cholesterol absorption (GO:0030299)|lipid metabolic process (GO:0006629)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|phototransduction, visible light (GO:0007603)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol homeostasis (GO:2000188)|regulation of phosphatidylcholine catabolic process (GO:0010899)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|low-density lipoprotein particle (GO:0034362)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|glycoprotein binding (GO:0001948)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|very-low-density lipoprotein particle receptor activity (GO:0030229)	p.?(1)		breast(2)|endometrium(2)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Lung NSC(9;0.000245)|Renal(1328;0.0007)|Hepatocellular(1079;0.0524)		GBM - Glioblastoma multiforme(1328;1.36e-05)|STAD - Stomach adenocarcinoma(1328;0.000766)|Lung(535;0.197)	Porfimer(DB00707)	CTCTCAGTGGGCGACAGATGC	0.502																																					p.G24V	GBM(18;201 575 7820 21545)												.	LDLR	72		1	Unknown(1)	lung(1)	c.G71T												114.0	100.0	105.0					19																	11210902		2203	4300	6503	SO:0001583	missense	3949	exon2			CAGTGGGCGACAG	AY114155	CCDS12254.1, CCDS56083.1, CCDS56084.1, CCDS56085.1, CCDS58651.1	19p13.2	2014-09-17	2008-08-01		ENSG00000130164	ENSG00000130164		"""Low density lipoprotein receptors"""	6547	protein-coding gene	gene with protein product	"""familial hypercholesterolemia"""	606945					Standard	NM_000527		Approved	LDLCQ2	uc002mqk.4	P01130		ENST00000558518.1:c.71G>T	19.37:g.11210902G>T	ENSP00000454071:p.Gly24Val		52	0	0		41	0.12	5	NM_001195800	4	0.00	0	B4DII3|B4DJZ8|B4DR00|B4DTQ3|C0JYY8|H0YLU8|H0YNT7|Q53ZD9|Q59FQ1|Q9UDH7	Missense_Mutation	SNP	ENST00000558518.1	37	CCDS12254.1	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632674	0.29068	.	.	ENSG00000130164	ENST00000252444;ENST00000545707;ENST00000535915;ENST00000455727	D;D;D	0.90620	-2.65;-2.57;-2.7	5.51	-5.04	0.02964	.	0.599365	0.13730	N	0.366776	T	0.78336	0.4267	L	0.39467	1.215	0.09310	N	0.999999	B;B;B;B;B	0.29716	0.001;0.255;0.006;0.003;0.003	B;B;B;B;B	0.22152	0.001;0.038;0.002;0.003;0.005	T	0.65425	-0.6171	10	0.28530	T	0.3	.	1.7609	0.02992	0.2028:0.2429:0.3884:0.166	.	24;24;24;36;24	B4DR00;B4DJZ8;B4DTQ3;Q59FQ1;P01130	.;.;.;.;LDLR_HUMAN	V	24	ENSP00000437639:G24V;ENSP00000440520:G24V;ENSP00000397829:G24V	ENSP00000252444:G24V	G	+	2	0	LDLR	11071902	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.207000	0.09384	-0.740000	0.04803	-0.225000	0.12378	GGC			0.502	LDLR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000415973.2			
CILP2	148113	mdanderson.org	37	19	19656103	19656103	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:19656103G>T	ENST00000291495.5	+	8	2834	c.2749G>T	c.(2749-2751)Ggc>Tgc	p.G917C	CILP2_ENST00000586018.1_Missense_Mutation_p.G923C	NM_153221.2	NP_694953.2	Q8IUL8	CILP2_HUMAN	cartilage intermediate layer protein 2	917						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	32						CTTCCGAGAGGGCACACCTGC	0.667																																					p.G917C													.	.			0			c.G2749T												38.0	28.0	32.0					19																	19656103		2203	4299	6502	SO:0001583	missense	148113	exon8			CGAGAGGGCACAC	AF542080	CCDS12405.1	19p13.11	2013-01-14				ENSG00000160161		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24213	protein-coding gene	gene with protein product		612419				12477932	Standard	NM_153221		Approved	MGC45771	uc002nmv.4	Q8IUL8		ENST00000291495.5:c.2749G>T	19.37:g.19656103G>T	ENSP00000291495:p.Gly917Cys		86	0	0		45	0.07	3	NM_153221	8	0.00	0	Q6NV88|Q8N4A6|Q8WV21	Missense_Mutation	SNP	ENST00000291495.5	37	CCDS12405.1	.	.	.	.	.	.	.	.	.	.	G	16.85	3.235628	0.58886	.	.	ENSG00000160161	ENST00000291495	T	0.09723	2.95	5.79	4.56	0.56223	.	0.246622	0.41823	D	0.000818	T	0.15696	0.0378	L	0.36672	1.1	0.39587	D	0.969521	D;D	0.58620	0.983;0.983	P;P	0.55785	0.784;0.784	T	0.00276	-1.1855	10	0.62326	D	0.03	-17.3311	8.8939	0.35451	0.1726:0.0:0.8274:0.0	.	917;917	B2RAJ0;Q8IUL8	.;CILP2_HUMAN	C	917	ENSP00000291495:G917C	ENSP00000291495:G917C	G	+	1	0	CILP2	19517103	0.998000	0.40836	0.969000	0.41365	0.565000	0.35776	2.155000	0.42301	2.757000	0.94681	0.555000	0.69702	GGC			0.667	CILP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000459738.3		NM_153221	
FAM187B	148109	bcgsc.ca	37	19	35715837	35715837	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:35715837A>G	ENST00000324675.3	-	2	1049	c.1001T>C	c.(1000-1002)cTg>cCg	p.L334P		NM_152481.1	NP_689694.1	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	334						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	9						CACCAGCTTCAGCCCCTTGAG	0.672																																					p.L334P													.	FAM187B	28		0			c.T1001C												36.0	37.0	36.0					19																	35715837		2203	4300	6503	SO:0001583	missense	148109	exon2			AGCTTCAGCCCCT	AK098526	CCDS12448.1	19q13.12	2008-10-16	2008-10-16	2008-10-16	ENSG00000177558	ENSG00000177558			26366	protein-coding gene	gene with protein product			"""transmembrane protein 162"""	TMEM162			Standard	NM_152481		Approved	FLJ25660	uc002nyk.1	Q17R55	OTTHUMG00000164450	ENST00000324675.3:c.1001T>C	19.37:g.35715837A>G	ENSP00000323355:p.Leu334Pro		57	0.0175438596	1		45	0.09	4	NM_152481	0		0	Q8N7G6	Missense_Mutation	SNP	ENST00000324675.3	37	CCDS12448.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661746	0.47572	.	.	ENSG00000177558	ENST00000324675	T	0.48201	0.82	4.28	3.26	0.37387	.	0.493329	0.15054	N	0.283160	T	0.53158	0.1779	L	0.36672	1.1	0.23806	N	0.996799	D	0.89917	1.0	D	0.79108	0.992	T	0.33777	-0.9855	10	0.87932	D	0	-18.5825	5.8655	0.18773	0.8818:0.0:0.1182:0.0	.	334	Q17R55	F187B_HUMAN	P	334	ENSP00000323355:L334P	ENSP00000323355:L334P	L	-	2	0	FAM187B	40407677	0.007000	0.16637	0.101000	0.21167	0.011000	0.07611	2.400000	0.44504	1.924000	0.55735	0.460000	0.39030	CTG			0.672	FAM187B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378854.1		NM_152481	
GAPDHS	26330	broad.mit.edu	37	19	36033899	36033899	+	Nonsense_Mutation	SNP	G	G	T	rs150710154	byFrequency	TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:36033899G>T	ENST00000222286.4	+	7	828	c.712G>T	c.(712-714)Gag>Tag	p.E238*	AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000589137.1_RNA|TMEM147_ENST00000222284.5_5'Flank|AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000588286.1_RNA|TMEM147_ENST00000392205.1_5'Flank|TMEM147_ENST00000392204.2_5'Flank|AD000090.2_ENST00000444728.1_RNA	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	238					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			AGTCATCCACGAGCGATTTGG	0.582																																					p.E238X													.	GAPDHS	34		0			c.G712T												139.0	100.0	113.0					19																	36033899		2203	4300	6503	SO:0001587	stop_gained	26330	exon7			ATCCACGAGCGAT	AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.712G>T	19.37:g.36033899G>T	ENSP00000222286:p.Glu238*		129	0	0		94	0.03	3	NM_014364	6	0.00	0	B2RC82|O60823|Q6JTT9|Q9HCU6	Nonsense_Mutation	SNP	ENST00000222286.4	37	CCDS12465.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284610	0.80803	.	.	ENSG00000105679	ENST00000222286	.	.	.	5.42	5.42	0.78866	.	0.056530	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-39.6251	17.076	0.86586	0.0:0.0:1.0:0.0	.	.	.	.	X	238	.	ENSP00000222286:E238X	E	+	1	0	GAPDHS	40725739	1.000000	0.71417	0.817000	0.32601	0.075000	0.17131	9.869000	0.99810	2.705000	0.92388	0.555000	0.69702	GAG			0.582	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460423.1		NM_014364	
ZNF234	10780	broad.mit.edu	37	19	44661286	44661286	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:44661286G>T	ENST00000426739.2	+	6	1375	c.1117G>T	c.(1117-1119)Gta>Tta	p.V373L	ZNF234_ENST00000592437.1_Missense_Mutation_p.V373L	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				GAAACCATACGTATGTAAAGT	0.443																																					p.V373L													.	ZNF234	132		0			c.G1117T												56.0	60.0	59.0					19																	44661286		2133	4273	6406	SO:0001583	missense	10780	exon6			CCATACGTATGTA	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1117G>T	19.37:g.44661286G>T	ENSP00000400878:p.Val373Leu		103	0	0		78	0.04	3	NM_006630	6	0.00	0	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Missense_Mutation	SNP	ENST00000426739.2	37	CCDS46101.1	.	.	.	.	.	.	.	.	.	.	G	9.851	1.193772	0.22037	.	.	ENSG00000167380	ENST00000426739	T	0.27890	1.64	3.48	-2.9	0.05648	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17023	0.0409	N	0.20445	0.575	0.09310	N	1	B	0.15473	0.013	B	0.17722	0.019	T	0.27673	-1.0067	9	0.66056	D	0.02	.	5.9871	0.19440	0.6454:0.0:0.2134:0.1412	.	373	Q14588	ZN234_HUMAN	L	373	ENSP00000400878:V373L	ENSP00000400878:V373L	V	+	1	0	ZNF226	49353126	0.000000	0.05858	0.000000	0.03702	0.981000	0.71138	-3.859000	0.00348	-0.506000	0.06558	0.591000	0.81541	GTA			0.443	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460586.2			
GYS1	2997	mdanderson.org	37	19	49473877	49473877	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:49473877G>T	ENST00000323798.3	-	14	1931	c.1735C>A	c.(1735-1737)Cgg>Agg	p.R579R	GYS1_ENST00000263276.6_Silent_p.R515R|GYS1_ENST00000541188.1_Silent_p.R499R|GYS1_ENST00000544287.1_Silent_p.R212R	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	579					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CGCTGCCGCCGGCTCTGCTGA	0.597											OREG0025611	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R579R													.	.			0			c.C1735A												34.0	38.0	37.0					19																	49473877		2203	4300	6503	SO:0001819	synonymous_variant	2997	exon14			GCCGCCGGCTCTG		CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.1735C>A	19.37:g.49473877G>T			54	0	0	962	55	0.05	3	NM_002103	36	0.00	0	Q9BTT9	Silent	SNP	ENST00000323798.3	37	CCDS12747.1																																																																																					0.597	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319791.1		NM_002103	
CACNG8	59283	mdanderson.org	37	19	54466566	54466566	+	Missense_Mutation	SNP	T	T	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:54466566T>C	ENST00000270458.2	+	1	273	c.170T>C	c.(169-171)cTc>cCc	p.L57P		NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	57					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		ACCACCAACCTCACGGCCGGC	0.711																																					p.L57P													.	.			0			c.T170C												27.0	26.0	26.0					19																	54466566		2202	4299	6501	SO:0001583	missense	59283	exon1			CCAACCTCACGGC	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.170T>C	19.37:g.54466566T>C	ENSP00000270458:p.Leu57Pro		42	0	0		20	0.10	2	NM_031895	0		0	Q9BXT0|Q9BY23	Missense_Mutation	SNP	ENST00000270458.2	37	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.137252	0.56936	.	.	ENSG00000142408	ENST00000270458	T	0.47869	0.83	3.52	3.52	0.40303	.	0.158752	0.38720	U	0.001587	T	0.48786	0.1519	L	0.34521	1.04	0.23304	N	0.997949	D	0.62365	0.991	P	0.57620	0.824	T	0.61307	-0.7089	9	0.48119	T	0.1	-18.2547	10.3066	0.43685	0.0:0.0:0.0:1.0	.	57	Q8WXS5	CCG8_HUMAN	P	57	ENSP00000270458:L57P	ENSP00000270458:L57P	L	+	2	0	CACNG8	59158378	0.561000	0.26578	0.998000	0.56505	0.914000	0.54420	1.159000	0.31749	1.379000	0.46325	0.247000	0.18012	CTC			0.711	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000139361.3			
ZNF8	7554	broad.mit.edu	37	19	58805784	58805784	+	Missense_Mutation	SNP	G	G	T	rs147895869		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr19:58805784G>T	ENST00000196548.5	+	4	741	c.610G>T	c.(610-612)Gac>Tac	p.D204Y	AC010642.1_ENST00000591325.1_3'UTR|ZNF8_ENST00000608843.1_Missense_Mutation_p.D204Y			P17098	ZNF8_HUMAN	zinc finger protein 8	204					BMP signaling pathway (GO:0030509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	19		all_cancers(17;6.46e-05)|Lung NSC(17;0.0233)|all_neural(62;0.0381)|all_epithelial(17;0.0427)|all_lung(17;0.057)|Ovarian(87;0.17)|Colorectal(82;0.227)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.00619)		GTATACTTACGACTCACAGAT	0.473																																					p.D204Y													.	ZNF8	60		0			c.G610T												42.0	40.0	41.0					19																	58805784		2203	4300	6503	SO:0001583	missense	7554	exon4			ACTTACGACTCAC	M29581	CCDS12974.1	19q13.43	2013-01-08	2006-05-09					"""Zinc fingers, C2H2-type"", ""-"""	13154	protein-coding gene	gene with protein product		194532	"""zinc finger protein 8 (clone HF.18)"""			2106481	Standard	NM_021089		Approved	HF.18, Zfp128	uc002qry.1	P17098		ENST00000196548.5:c.610G>T	19.37:g.58805784G>T	ENSP00000196548:p.Asp204Tyr		180	0	0		148	0.03	4	NM_021089	14	0.00	0	Q6PI99	Missense_Mutation	SNP	ENST00000196548.5	37	CCDS12974.1	.	.	.	.	.	.	.	.	.	.	g	11.54	1.669241	0.29604	.	.	ENSG00000083842	ENST00000196548	T	0.07216	3.21	4.8	-1.03	0.10102	.	0.699395	0.13039	N	0.418713	T	0.13756	0.0333	L	0.50333	1.59	0.09310	N	1	D	0.57257	0.979	P	0.54431	0.752	T	0.12811	-1.0533	10	0.72032	D	0.01	-10.2126	8.5601	0.33505	0.4934:0.0:0.5066:0.0	.	204	P17098	ZNF8_HUMAN	Y	204	ENSP00000196548:D204Y	ENSP00000196548:D204Y	D	+	1	0	ZNF8	63497596	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.104000	0.15313	-0.110000	0.12022	-0.727000	0.03589	GAC			0.473	ZNF8-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding		OTTHUMT00000459135.1		NM_021089	
EPT1	85465	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26596369	26596369	+	Missense_Mutation	SNP	A	A	G			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr2:26596369A>G	ENST00000260585.7	+	5	564	c.445A>G	c.(445-447)Act>Gct	p.T149A		NM_033505.2	NP_277040.1	Q9C0D9	EPT1_HUMAN	ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific)	149					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)										AAGAGGATCAACTGGTGTCAG	0.408																																					.													.	.			0			.												176.0	176.0	176.0					2																	26596369		1915	4124	6039	SO:0001583	missense	85465	.			GGATCAACTGGTG		CCDS46240.1	2p23.3	2012-03-01			ENSG00000138018	ENSG00000138018	2.7.8.1		29361	protein-coding gene	gene with protein product	"""selenoprotein I"""	607915				11214970, 17132865	Standard	NM_033505		Approved	KIAA1724, SELI, SEPI	uc021veu.1	Q9C0D9	OTTHUMG00000151931	ENST00000260585.7:c.445A>G	2.37:g.26596369A>G	ENSP00000260585:p.Thr149Ala		162	0.0061728395	1		167	0.23	39	.	23	0.43	10	Q63ZE3	Missense_Mutation	SNP	ENST00000260585.7	37	CCDS46240.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096461	0.56075	.	.	ENSG00000138018	ENST00000442141;ENST00000260585	T	0.42900	0.96	5.97	4.82	0.62117	.	0.085714	0.85682	D	0.000000	T	0.35828	0.0945	L	0.55481	1.735	0.48452	D	0.999658	B	0.13594	0.008	B	0.17722	0.019	T	0.12243	-1.0555	10	0.18710	T	0.47	-29.5837	9.8149	0.40846	0.797:0.0:0.0:0.203	.	149	Q9C0D9	EPT1_HUMAN	A	117;149	ENSP00000260585:T149A	ENSP00000260585:T149A	T	+	1	0	EPT1	26449873	1.000000	0.71417	0.807000	0.32361	0.988000	0.76386	5.754000	0.68743	1.073000	0.40885	0.528000	0.53228	ACT			0.408	EPT1-001	KNOWN	basic|appris_principal|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000324484.3		NM_033505.2	
TLX2	3196	mdanderson.org	37	2	74743244	74743244	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr2:74743244G>T	ENST00000233638.7	+	3	1106	c.783G>T	c.(781-783)gcG>gcT	p.A261A		NM_016170.4	NP_057254.1	O43763	TLX2_HUMAN	T-cell leukemia homeobox 2	261					enteric nervous system development (GO:0048484)|mesoderm formation (GO:0001707)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			kidney(1)|ovary(1)	2						CGCTCTTCGCGCTGCAGAACC	0.706																																					p.A261A	Esophageal Squamous(7;240 533 18610 24312)												.	.			0			c.G783T												15.0	15.0	15.0					2																	74743244		2117	4111	6228	SO:0001819	synonymous_variant	3196	exon3			CTTCGCGCTGCAG	AJ002607	CCDS1947.1	2p13.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000115297	ENSG00000115297		"""Homeoboxes / ANTP class : NKL subclass"""	5057	protein-coding gene	gene with protein product		604240	"""homeo box 11-like 1"", ""T-cell leukemia, homeobox 2"""	HOX11L1		10343123	Standard	NM_016170		Approved	Enx, Tlx2, NCX	uc002sma.2	O43763	OTTHUMG00000129960	ENST00000233638.7:c.783G>T	2.37:g.74743244G>T			66	0	0		50	0.06	3	NM_016170	4	0.00	0	Q9UD56|Q9UQ48	Silent	SNP	ENST00000233638.7	37	CCDS1947.1																																																																																					0.706	TLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252224.3			
AC027612.3	0	broad.mit.edu	37	2	91887904	91887905	+	RNA	INS	-	-	T	rs374250838|rs373336109|rs369805878|rs199562278	byFrequency	TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr2:91887904_91887905insT	ENST00000436174.1	-	0	540																											AGCTATTTTCCATTTTTTTTTT	0.292																																					.													.	.			0			.																																											0	.			ATTTTCCATTTTT																													2.37:g.91887904_91887905insT			160	0.01875	3		164	0.14	23	.	0		0		RNA	INS	ENST00000436174.1	37																																																																																						0.292	AC027612.3-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000338339.1			
GLS	2744	mdanderson.org	37	2	191746158	191746158	+	Silent	SNP	C	C	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr2:191746158C>T	ENST00000320717.3	+	1	606	c.348C>T	c.(346-348)ggC>ggT	p.G116G	AC005540.3_ENST00000413911.1_RNA|GLS_ENST00000338435.4_Silent_p.G116G	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	ACGCGTTTGGCAACAGCGAGG	0.716																																					p.G116G													.	.			0			c.C348T												13.0	18.0	16.0					2																	191746158		1502	2538	4040	SO:0001819	synonymous_variant	2744	exon1			GTTTGGCAACAGC	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.348C>T	2.37:g.191746158C>T			61	0	0		55	0.07	4	NM_014905	8	0.00	0	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Silent	SNP	ENST00000320717.3	37	CCDS2308.1																																																																																					0.716	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255999.2			
ATRN	8455	mdanderson.org	37	20	3557613	3557613	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr20:3557613G>T	ENST00000262919.5	+	14	2390	c.2322G>T	c.(2320-2322)gaG>gaT	p.E774D	ATRN_ENST00000446916.2_Missense_Mutation_p.E774D	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	774	PSI 2.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						GCCAGTGGGAGCCCCGGAATC	0.552																																					p.E774D													.	.			0			c.G2322T												97.0	93.0	95.0					20																	3557613		2203	4300	6503	SO:0001583	missense	8455	exon14			GTGGGAGCCCCGG	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.2322G>T	20.37:g.3557613G>T	ENSP00000262919:p.Glu774Asp		61	0	0		37	0.08	3	NM_139322	112	0.00	0	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	ENST00000262919.5	37	CCDS13053.1	.	.	.	.	.	.	.	.	.	.	G	3.413	-0.119787	0.06838	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.05717	3.4;3.47	5.81	3.51	0.40186	.	0.110120	0.64402	D	0.000005	T	0.04952	0.0133	L	0.29908	0.895	0.50313	D	0.99986	B;B	0.16166	0.001;0.016	B;B	0.19148	0.003;0.024	T	0.38478	-0.9659	10	0.16896	T	0.51	-19.0257	10.0175	0.42022	0.2417:0.0:0.7583:0.0	.	774;774	O75882;O75882-2	ATRN_HUMAN;.	D	774;774;700	ENSP00000262919:E774D;ENSP00000416587:E774D	ENSP00000262919:E774D	E	+	3	2	ATRN	3505613	0.463000	0.25799	1.000000	0.80357	0.998000	0.95712	0.528000	0.23002	1.441000	0.47550	0.561000	0.74099	GAG			0.552	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000077740.2		NM_139321	
CNBD2	140894	mdanderson.org	37	20	34572642	34572642	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr20:34572642G>T	ENST00000373973.3	+	6	831	c.658G>T	c.(658-660)Gct>Tct	p.A220S	CNBD2_ENST00000538900.1_Missense_Mutation_p.A220S|CNBD2_ENST00000349339.1_Missense_Mutation_p.A220S			Q96M20	CNBD2_HUMAN	cyclic nucleotide binding domain containing 2	220																	GGACTTCTTTGCTAATAAGCT	0.453																																					p.A220S													.	.			0			c.G658T												194.0	174.0	181.0					20																	34572642		2203	4300	6503	SO:0001583	missense	140894	exon6			TTCTTTGCTAATA	AL359828	CCDS13270.1, CCDS56189.1	20q11.23	2012-11-15	2012-11-15	2012-11-15	ENSG00000149646	ENSG00000149646			16145	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 152"", ""cyclic nucleotide (cNMP) binding domain containing 1"""	C20orf152, CNMPD1		11780052	Standard	NM_080834		Approved	dJ954P9.1	uc002xer.1	Q96M20	OTTHUMG00000032371	ENST00000373973.3:c.658G>T	20.37:g.34572642G>T	ENSP00000363084:p.Ala220Ser		130	0.0076923077	1		110	0.05	5	NM_001207076	0		0	Q14C79|Q5JWY7|Q5T3S1|Q9BR36|Q9BWY5	Missense_Mutation	SNP	ENST00000373973.3	37		.	.	.	.	.	.	.	.	.	.	G	6.335	0.429855	0.11987	.	.	ENSG00000149646	ENST00000373973;ENST00000349339;ENST00000538900	T;T;T	0.12255	2.7;2.7;2.7	4.98	2.93	0.34026	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (1);	0.840844	0.10432	N	0.675380	T	0.10121	0.0248	L	0.29908	0.895	0.09310	N	1	B;P	0.35575	0.362;0.51	B;B	0.36567	0.173;0.228	T	0.34825	-0.9813	10	0.17369	T	0.5	-0.0051	7.5562	0.27824	0.0998:0.1658:0.7345:0.0	.	220;220	Q96M20;Q96M20-2	CT152_HUMAN;.	S	220	ENSP00000363084:A220S;ENSP00000340954:A220S;ENSP00000442729:A220S	ENSP00000340954:A220S	A	+	1	0	C20orf152	34036056	0.066000	0.20996	0.000000	0.03702	0.078000	0.17371	1.747000	0.38298	0.536000	0.28733	-0.176000	0.13171	GCT			0.453	CNBD2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000078960.2		NM_080834	
XBP1	7494	mdanderson.org	37	22	29192120	29192120	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr22:29192120G>T	ENST00000216037.6	-	4	586	c.514C>A	c.(514-516)Cct>Act	p.P172T	XBP1_ENST00000344347.5_Intron|XBP1_ENST00000405219.3_Missense_Mutation_p.P122T|XBP1_ENST00000403532.3_Missense_Mutation_p.P177T	NM_001079539.1|NM_005080.3	NP_001073007.1|NP_005071.2	P17861	XBP1_HUMAN	X-box binding protein 1	172					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial cell maturation involved in salivary gland development (GO:0060691)|exocrine pancreas development (GO:0031017)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|positive regulation of endoplasmic reticulum unfolded protein response (GO:1900103)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|serotonin secretion, neurotransmission (GO:0060096)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(1)|lung(1)	5						TGCTGCAGAGGTGCACGTAGT	0.547																																					p.P172T													.	.			0			c.C514A												106.0	112.0	110.0					22																	29192120		2203	4300	6503	SO:0001583	missense	7494	exon4			GCAGAGGTGCACG	M31627	CCDS13847.1	22q12.1	2013-01-10			ENSG00000100219	ENSG00000100219		"""basic leucine zipper proteins"""	12801	protein-coding gene	gene with protein product		194355		XBP2		1718857, 2196176	Standard	NM_001079539		Approved		uc003aec.3	P17861	OTTHUMG00000151094	ENST00000216037.6:c.514C>A	22.37:g.29192120G>T	ENSP00000216037:p.Pro172Thr		48	0	0		28	0.11	3	NM_005080	326	0.00	0	Q8WYK6|Q969P1|Q96BD7	Missense_Mutation	SNP	ENST00000216037.6	37	CCDS13847.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675560	0.88445	.	.	ENSG00000100219	ENST00000216037;ENST00000403532;ENST00000405219	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	T	0.74764	0.3759	L	0.45285	1.41	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75150	-0.3419	8	0.62326	D	0.03	.	18.9431	0.92611	0.0:0.0:1.0:0.0	.	122	B1AHH1	.	T	172;177;122	.	ENSP00000216037:P172T	P	-	1	0	XBP1	27522120	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.083000	0.94067	2.725000	0.93324	0.655000	0.94253	CCT			0.547	XBP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000321274.1		NM_005080	
COLQ	8292	mdanderson.org	37	3	15516961	15516961	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr3:15516961G>T	ENST00000383788.5	-	7	624	c.499C>A	c.(499-501)Cca>Aca	p.P167T	COLQ_ENST00000383786.5_Missense_Mutation_p.P133T|COLQ_ENST00000603808.1_Missense_Mutation_p.P167T|COLQ_ENST00000383785.2_Missense_Mutation_p.P167T|COLQ_ENST00000383787.2_Missense_Mutation_p.P158T|COLQ_ENST00000435459.2_Missense_Mutation_p.P157T|COLQ_ENST00000383781.4_Missense_Mutation_p.P157T	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	167	Collagen-like 1.				acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						CTTGACCCTGGCAAGCCCATC	0.498																																					p.P167T													.	.			0			c.C499A												67.0	47.0	54.0					3																	15516961		2203	4300	6503	SO:0001583	missense	8292	exon7			ACCCTGGCAAGCC	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.499C>A	3.37:g.15516961G>T	ENSP00000373298:p.Pro167Thr		103	0	0		48	0.06	3	NM_005677	0		0	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	ENST00000383788.5	37	CCDS33709.1	.	.	.	.	.	.	.	.	.	.	G	18.92	3.724694	0.68959	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383785;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786;ENST00000430319	D;D;D;D;D;D	0.98666	-5.06;-5.06;-4.22;-5.06;-5.06;-5.06	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.98651	0.9548	L	0.48218	1.51	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.997;0.999	D	0.99887	1.1125	10	0.87932	D	0	-4.8169	16.5134	0.84293	0.0:0.0:1.0:0.0	.	133;158;167;157	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	T	158;157;157;167;167;157;167;133;110	ENSP00000373297:P158T;ENSP00000373291:P157T;ENSP00000402511:P157T;ENSP00000373295:P167T;ENSP00000373298:P167T;ENSP00000373296:P133T	ENSP00000373291:P157T	P	-	1	0	COLQ	15491965	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.742000	0.85008	2.622000	0.88805	0.561000	0.74099	CCA			0.498	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000343575.1		NM_005677	
DYNC1LI1	51143	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	3	32578558	32578558	+	Nonsense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr3:32578558G>C	ENST00000273130.4	-	6	880	c.777C>G	c.(775-777)taC>taG	p.Y259*	DYNC1LI1_ENST00000432458.2_Nonsense_Mutation_p.Y143*	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	259					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						GTTCATCTCTGTAGTCATGTT	0.254																																					p.Y259X													.	.			0			c.C777G												95.0	89.0	91.0					3																	32578558		2202	4290	6492	SO:0001587	stop_gained	51143	exon6			ATCTCTGTAGTCA	AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.777C>G	3.37:g.32578558G>C	ENSP00000273130:p.Tyr259*		300	0	0		249	0.22	54	NM_016141	103	0.03	3	A2RRG7|Q53HC8|Q53HK7	Nonsense_Mutation	SNP	ENST00000273130.4	37	CCDS2654.1	.	.	.	.	.	.	.	.	.	.	G	37	6.541413	0.97650	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	.	.	.	5.66	1.86	0.25419	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.7288	10.4968	0.44783	0.2557:0.0:0.7443:0.0	.	.	.	.	X	259;143	.	ENSP00000273130:Y259X	Y	-	3	2	DYNC1LI1	32553562	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.484000	0.53201	0.053000	0.16036	0.467000	0.42956	TAC			0.254	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253250.1		NM_016141	
DLEC1	9940	mdanderson.org	37	3	38103775	38103775	+	Missense_Mutation	SNP	C	C	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr3:38103775C>A	ENST00000308059.6	+	4	810	c.789C>A	c.(787-789)ttC>ttA	p.F263L	DLEC1_ENST00000346219.3_Missense_Mutation_p.F263L|DLEC1_ENST00000452631.2_Missense_Mutation_p.F263L					deleted in lung and esophageal cancer 1									p.F263F(2)		NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TTGCTGAGTTCGAAGATGAGT	0.453																																					p.F263L													DLEC1_ENST00000346219,NS,carcinoma,0,6	DLEC1_ENST00000346219	0	6	2	Substitution - coding silent(2)	large_intestine(2)	c.C789A												88.0	82.0	84.0					3																	38103775		1977	4171	6148	SO:0001583	missense	9940	exon4			TGAGTTCGAAGAT	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.789C>A	3.37:g.38103775C>A	ENSP00000308597:p.Phe263Leu		65	0	0		29	0.10	3	NM_007335	0		0		Missense_Mutation	SNP	ENST00000308059.6	37	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	C	2.360	-0.346917	0.05208	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.04454	3.64;3.62;3.87	3.92	-1.29	0.09288	.	3.348110	0.00357	N	0.000026	T	0.02888	0.0086	N	0.11560	0.145	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.04013	0.001;0.001;0.001	T	0.40739	-0.9547	10	0.08599	T	0.76	3.0603	7.4842	0.27423	0.0:0.3129:0.0:0.6871	.	263;263;263	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	L	263	ENSP00000308597:F263L;ENSP00000315914:F263L;ENSP00000410427:F263L	ENSP00000308597:F263L	F	+	3	2	DLEC1	38078779	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.483000	0.06536	-0.189000	0.10482	-1.119000	0.02030	TTC			0.453	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000253745.3		NM_007337	
MUC13	56667	mdanderson.org	37	3	124646755	124646755	+	Silent	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr3:124646755G>T	ENST00000311075.3	-	2	173	c.135C>A	c.(133-135)acC>acA	p.T45T	MUC13_ENST00000497378.1_5'UTR	NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	45	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						TAGTTTCAGTGGTATCAGCTG	0.473																																					p.T45T													.	.			0			c.C135A												200.0	184.0	189.0					3																	124646755		2203	4300	6503	SO:0001819	synonymous_variant	56667	exon2			TTCAGTGGTATCA	AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.135C>A	3.37:g.124646755G>T			37	0	0		24	0.08	2	NM_033049	0		0	Q6UWD9|Q9NXT5	Silent	SNP	ENST00000311075.3	37																																																																																						0.473	MUC13-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000355714.1		NM_033049	
MUC4	4585	hgsc.bcm.edu	37	3	195505828	195505828	+	Missense_Mutation	SNP	G	G	C			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr3:195505828G>C	ENST00000463781.3	-	2	13082	c.12623C>G	c.(12622-12624)cCt>cGt	p.P4208R	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P4208R|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAGGAAGAGGGGTGGCGTG	0.592																																					p.P4208R													MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4_ENST00000463781	-1	3	0			c.C12623G												17.0	16.0	16.0					3																	195505828		688	1570	2258	SO:0001583	missense	4585	exon2			GGAAGAGGGGTGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12623C>G	3.37:g.195505828G>C	ENSP00000417498:p.Pro4208Arg		103	0	0		101	0.05	5	NM_018406	1	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	4.396	0.073210	0.08485	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.35789	1.49;1.29	.	.	.	.	.	.	.	.	T	0.23766	0.0575	N	0.19112	0.55	0.23754	N	0.996932	P	0.49185	0.92	P	0.47299	0.543	T	0.09907	-1.0653	7	.	.	.	.	3.6132	0.08067	2.0E-4:0.4969:0.5026:2.0E-4	.	4080	E7ESK3	.	R	4208	ENSP00000417498:P4208R;ENSP00000420243:P4208R	.	P	-	2	0	MUC4	196990607	.	.	0.019000	0.16419	0.029000	0.11900	.	.	0.088000	0.17205	0.089000	0.15464	CCT			0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	C	rs121913506		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr4:55599320G>C	ENST00000288135.5	+	17	2543	c.2446G>C	c.(2446-2448)Gac>Cac	p.D816H		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816H			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446C												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>C	4.37:g.55599320G>C	ENSP00000288135:p.Asp816His		74	0	0		55	0.71	39	NM_000222	242	1.00	241	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721319	0.68959	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83837	-1.77;-1.77	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.80732	0.4679	L	0.49699	1.58	0.80722	D	1	P;B	0.44734	0.842;0.353	B;B	0.38156	0.266;0.154	D	0.83488	0.0068	10	0.72032	D	0.01	.	19.6484	0.95791	0.0:0.0:1.0:0.0	rs28933969	812;816	P10721-2;P10721	.;KIT_HUMAN	H	816;812	ENSP00000288135:D816H;ENSP00000390987:D812H	ENSP00000288135:D816H	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
RP11-269F21.3	0	broad.mit.edu	37	4	112747976	112747976	+	lincRNA	DEL	T	T	-			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr4:112747976delT	ENST00000511219.1	-	0	1166				RP11-269F21.1_ENST00000506068.1_lincRNA																							aaaacgacgattttttttatt	0.368																																					.													.	.			0			.																																											0	.			CGACGATTTTTTT																													4.37:g.112747976delT			5	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000511219.1	37																																																																																						0.368	RP11-269F21.3-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000366004.1			
NPY1R	4886	mdanderson.org	37	4	164247178	164247178	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr4:164247178G>T	ENST00000296533.2	-	2	1060	c.529C>A	c.(529-531)Caa>Aaa	p.Q177K	NPY1R_ENST00000509586.1_Intron	NM_000909.5	NP_000900.1	P25929	NPY1R_HUMAN	neuropeptide Y receptor Y1	177					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|feeding behavior (GO:0007631)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose metabolic process (GO:0006006)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|regulation of blood pressure (GO:0008217)|regulation of multicellular organism growth (GO:0040014)|sensory perception of pain (GO:0019233)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)	p.Q177K(1)		breast(1)|cervix(1)|large_intestine(4)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)	30	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GTCATTACTTGGTAGATCAGG	0.433																																					p.Q177K													NPY1R,colon,carcinoma,+2,2	NPY1R	2	2	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C529A												120.0	111.0	114.0					4																	164247178		2203	4300	6503	SO:0001583	missense	4886	exon2			TTACTTGGTAGAT		CCDS34089.1	4q31.3-q32	2012-08-08				ENSG00000164128		"""GPCR / Class A : Neuropeptide receptors : Y"""	7956	protein-coding gene	gene with protein product		162641		NPYR		8095935	Standard	NM_000909		Approved		uc003iqm.2	P25929		ENST00000296533.2:c.529C>A	4.37:g.164247178G>T	ENSP00000354652:p.Gln177Lys		148	0	0		92	0.05	5	NM_000909	3	0.00	0	B2R6H5	Missense_Mutation	SNP	ENST00000296533.2	37	CCDS34089.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.623761	0.28889	.	.	ENSG00000164128	ENST00000296533	T	0.71934	-0.61	5.84	5.84	0.93424	GPCR, rhodopsin-like superfamily (1);	0.377447	0.28388	N	0.015533	T	0.64907	0.2641	L	0.48218	1.51	0.80722	D	1	B	0.30068	0.267	B	0.31101	0.124	T	0.60576	-0.7236	10	0.29301	T	0.29	.	14.9312	0.70916	0.0:0.0:0.857:0.143	.	177	P25929	NPY1R_HUMAN	K	177	ENSP00000354652:Q177K	ENSP00000354652:Q177K	Q	-	1	0	NPY1R	164466628	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	2.844000	0.48246	2.771000	0.95319	0.655000	0.94253	CAA			0.433	NPY1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000364685.1			
PCDHGB2	56103	mdanderson.org	37	5	140740430	140740430	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr5:140740430G>T	ENST00000522605.1	+	1	728	c.728G>T	c.(727-729)aGc>aTc	p.S243I	PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	243	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGTGTTCAGCCAGGACGTG	0.577																																					p.S243I													.	.			0			c.G728T												81.0	82.0	81.0					5																	140740430		2028	4192	6220	SO:0001583	missense	56103	exon1			TGTTCAGCCAGGA	AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.728G>T	5.37:g.140740430G>T	ENSP00000429018:p.Ser243Ile		99	0	0		49	0.06	3	NM_032096	3	0.00	0	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	ENST00000522605.1	37	CCDS54924.1	.	.	.	.	.	.	.	.	.	.	.	7.133	0.580265	0.13686	.	.	ENSG00000253910	ENST00000522605	T	0.20463	2.07	5.54	2.7	0.31948	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.33789	0.0875	M	0.87617	2.895	0.21579	N	0.999636	B;B	0.21147	0.052;0.047	B;B	0.28709	0.093;0.046	T	0.31081	-0.9956	9	0.56958	D	0.05	.	12.5794	0.56381	0.0:0.4496:0.4242:0.1262	.	243;243	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	I	243	ENSP00000429018:S243I	ENSP00000429018:S243I	S	+	2	0	PCDHGB2	140720614	0.000000	0.05858	1.000000	0.80357	0.208000	0.24298	-1.467000	0.02352	0.330000	0.23485	0.655000	0.94253	AGC			0.577	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374741.1		NM_018923	
GLRA1	2741	mdanderson.org	37	5	151239421	151239421	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr5:151239421G>A	ENST00000455880.2	-	4	687	c.401C>T	c.(400-402)gCc>gTc	p.A134V	GLRA1_ENST00000274576.4_Missense_Mutation_p.A134V|GLRA1_ENST00000545569.1_Missense_Mutation_p.A51V|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	134					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	ATGGAAGTGGGCCCCCTTCTC	0.522																																					p.A134V													.	.			0			c.C401T												184.0	164.0	171.0					5																	151239421		2203	4300	6503	SO:0001583	missense	2741	exon4			AAGTGGGCCCCCT		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.401C>T	5.37:g.151239421G>A	ENSP00000411593:p.Ala134Val		122	0	0		75	0.05	4	NM_000171	0		0	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	ENST00000455880.2	37	CCDS54942.1	.	.	.	.	.	.	.	.	.	.	G	36	5.773277	0.96922	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	T;T;T	0.79940	-1.32;-1.32;-1.32	5.51	5.51	0.81932	Neurotransmitter-gated ion-channel ligand-binding (3);	0.103704	0.64402	D	0.000003	D	0.88837	0.6545	M	0.73753	2.245	0.80722	D	1	P;D;P	0.55385	0.948;0.971;0.936	P;P;P	0.60068	0.868;0.868;0.792	D	0.89330	0.3646	10	0.72032	D	0.01	.	19.7859	0.96437	0.0:0.0:1.0:0.0	.	134;51;134	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	V	134;134;51	ENSP00000274576:A134V;ENSP00000411593:A134V;ENSP00000445913:A51V	ENSP00000274576:A134V	A	-	2	0	GLRA1	151219614	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.606000	0.98325	2.746000	0.94184	0.655000	0.94253	GCC			0.522	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000373959.1			
ADAMTS2	9509	mdanderson.org	37	5	178581103	178581103	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr5:178581103G>T	ENST00000251582.7	-	8	1430	c.1329C>A	c.(1327-1329)ttC>ttA	p.F443L	ADAMTS2_ENST00000274609.5_Missense_Mutation_p.F443L	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	443	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGAAGCGGTGGAAGGCGGCCT	0.711																																					p.F443L													.	.			0			c.C1329A												20.0	20.0	20.0					5																	178581103		2200	4297	6497	SO:0001583	missense	9509	exon8			GCGGTGGAAGGCG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1329C>A	5.37:g.178581103G>T	ENSP00000251582:p.Phe443Leu		29	0	0		23	0.13	3	NM_014244	5	0.00	0		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.764288	0.89932	.	.	ENSG00000087116	ENST00000251582;ENST00000274609	D;D	0.86097	-2.07;-2.07	4.54	4.54	0.55810	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.56097	D	0.000026	D	0.85124	0.5625	L	0.39566	1.225	0.58432	D	0.999995	P;P	0.52170	0.792;0.951	B;P	0.56216	0.415;0.794	D	0.84932	0.0860	10	0.49607	T	0.09	.	10.3325	0.43831	0.0908:0.0:0.9092:0.0	.	443;443	O95450-2;O95450	.;ATS2_HUMAN	L	443	ENSP00000251582:F443L;ENSP00000274609:F443L	ENSP00000251582:F443L	F	-	3	2	ADAMTS2	178513709	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.309000	0.51903	2.226000	0.72624	0.655000	0.94253	TTC			0.711	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253507.1		NM_014244	
LRRC61	65999	mdanderson.org	37	7	150034292	150034292	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr7:150034292G>T	ENST00000359623.4	+	3	930	c.342G>T	c.(340-342)caG>caT	p.Q114H	LRRC61_ENST00000493307.1_Missense_Mutation_p.Q114H|LRRC61_ENST00000323078.7_Missense_Mutation_p.Q114H	NM_001142928.1	NP_001136400.1	Q9BV99	LRC61_HUMAN	leucine rich repeat containing 61	114										endometrium(2)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(82;0.011)			CCCCGGGCCAGCTGCAGTGTC	0.647																																					p.Q114H													.	.			0			c.G342T												27.0	29.0	28.0					7																	150034292		2203	4299	6502	SO:0001583	missense	65999	exon2			GGGCCAGCTGCAG	BC001354	CCDS5901.1	7q31-q35	2006-02-07			ENSG00000127399	ENSG00000127399			21704	protein-coding gene	gene with protein product							Standard	NM_023942		Approved	MGC3036, FLJ31392, HSPC295	uc003wgv.4	Q9BV99	OTTHUMG00000158326	ENST00000359623.4:c.342G>T	7.37:g.150034292G>T	ENSP00000352642:p.Gln114His		28	0	0		20	0.15	3	NM_023942	28	0.00	0	B3KUW0|D3DWY8	Missense_Mutation	SNP	ENST00000359623.4	37	CCDS5901.1	.	.	.	.	.	.	.	.	.	.	G	8.439	0.850353	0.17034	.	.	ENSG00000127399	ENST00000323078;ENST00000359623;ENST00000493307	T;T;T	0.23950	1.88;1.88;1.88	4.66	3.55	0.40652	.	0.206668	0.41294	D	0.000910	T	0.29783	0.0744	L	0.33668	1.02	0.38133	D	0.938212	D	0.61080	0.989	P	0.56042	0.79	T	0.06356	-1.0831	10	0.39692	T	0.17	-27.1609	11.0117	0.47667	0.1113:0.0:0.8887:0.0	.	114	Q9BV99	LRC61_HUMAN	H	114	ENSP00000339047:Q114H;ENSP00000352642:Q114H;ENSP00000420560:Q114H	ENSP00000339047:Q114H	Q	+	3	2	LRRC61	149665225	0.999000	0.42202	1.000000	0.80357	0.311000	0.27955	1.254000	0.32897	2.151000	0.67156	0.485000	0.47835	CAG			0.647	LRRC61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350696.1		NM_023942	
LINCR-0001	101929191	broad.mit.edu	37	8	10335889	10335903	+	lincRNA	DEL	GGCTGCAGTGGTTGT	GGCTGCAGTGGTTGT	-	rs149123714|rs55641852	byFrequency	TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	GGCTGCAGTGGTTGT	GGCTGCAGTGGTTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr8:10335889_10335903delGGCTGCAGTGGTTGT	ENST00000517732.1	+	0	223				RNU6-729P_ENST00000384399.1_RNA|RP11-981G7.3_ENST00000520494.1_lincRNA																							GTGGTTGTCAGGCTGCAGTGGTTGTGGCTGCAGTG	0.586														257	0.0513179	0.0643	0.0576	5008	,	,		16018	0.001		0.0984	False		,,,				2504	0.0327				.													.	.			0			.																																											0	.			TTGTCAGGCTGCA																													8.37:g.10335889_10335903delGGCTGCAGTGGTTGT			6	0	0		6	0.50	3	.	0		0		RNA	DEL	ENST00000517732.1	37																																																																																						0.586	RP11-981G7.2-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000375446.1			
FBXO16	157574	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	28304723	28304723	+	Nonsense_Mutation	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr8:28304723G>A	ENST00000380254.2	-	7	956	c.808C>T	c.(808-810)Cag>Tag	p.Q270*	FBXO16_ENST00000518734.1_Nonsense_Mutation_p.Q258*|RP11-181B11.2_ENST00000523935.1_RNA|RP11-181B11.2_ENST00000518819.1_RNA|FBXO16_ENST00000346498.2_Nonsense_Mutation_p.Q258*	NM_001258211.1|NM_172366.3	NP_001245140.1|NP_758954.1	Q8IX29	FBX16_HUMAN	F-box protein 16	270										large_intestine(2)|ovary(1)	3		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.121)|Kidney(114;0.144)|Colorectal(74;0.249)		GTTCTGTCCTGCAATTTATTT	0.343																																					p.Q270X													.	.			0			c.C808T												230.0	219.0	223.0					8																	28304723		2203	4300	6503	SO:0001587	stop_gained	157574	exon7			TGTCCTGCAATTT	AF453435	CCDS6068.1, CCDS59099.1	8p21.1	2008-02-05	2004-06-15		ENSG00000214050	ENSG00000214050		"""F-boxes /  ""other"""""	13618	protein-coding gene	gene with protein product		608519	"""F-box only protein 16"""			12243353	Standard	NM_172366		Approved	FBX16	uc003xgu.4	Q8IX29	OTTHUMG00000102147	ENST00000380254.2:c.808C>T	8.37:g.28304723G>A	ENSP00000369604:p.Gln270*		59	0	0		60	0.20	12	NM_172366	13	0.23	3	Q3T1B2|Q3T1B3|Q3T1B4	Nonsense_Mutation	SNP	ENST00000380254.2	37	CCDS6068.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044399	0.93685	.	.	ENSG00000214050	ENST00000380254;ENST00000346498;ENST00000518734	.	.	.	4.87	1.75	0.24633	.	0.740232	0.11785	U	0.529759	.	.	.	.	.	.	0.34002	D	0.650448	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-8.9162	7.8205	0.29284	0.0:0.3386:0.4871:0.1743	.	.	.	.	X	270;258;258	.	ENSP00000341416:Q258X	Q	-	1	0	FBXO16	28360642	0.046000	0.20272	0.595000	0.28798	0.958000	0.62258	1.208000	0.32345	0.531000	0.28639	0.591000	0.81541	CAG			0.343	FBXO16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000219988.2		NM_172366	
ZBTB10	65986	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	81426189	81426189	+	Missense_Mutation	SNP	G	G	A			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr8:81426189G>A	ENST00000430430.1	+	4	2685	c.1906G>A	c.(1906-1908)Gtg>Atg	p.V636M	ZBTB10_ENST00000426744.2_Missense_Mutation_p.V636M|ZBTB10_ENST00000455036.3_Missense_Mutation_p.V636M|ZBTB10_ENST00000379091.4_Missense_Mutation_p.V344M	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	636					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TGATAGGAATGTGAATGCAAA	0.413																																					p.V636M													.	.			0			c.G1906A												130.0	126.0	127.0					8																	81426189		1962	4151	6113	SO:0001583	missense	65986	exon3			AGGAATGTGAATG	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1906G>A	8.37:g.81426189G>A	ENSP00000387462:p.Val636Met		100	0	0		92	0.18	17	NM_023929	48	0.42	20	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	ENST00000430430.1	37	CCDS47880.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708119	0.30322	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.10192	2.9;2.97;2.97;2.97	5.04	0.0219	0.14131	.	1.078730	0.07133	N	0.845957	T	0.03959	0.0111	N	0.02539	-0.55	0.20703	N	0.999863	B;B;B;B	0.14438	0.01;0.007;0.0;0.003	B;B;B;B	0.12837	0.004;0.004;0.002;0.008	T	0.40905	-0.9538	10	0.38643	T	0.18	.	3.4941	0.07649	0.4667:0.206:0.3273:0.0	.	490;636;636;344	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	M	344;636;636;636;462	ENSP00000368384:V344M;ENSP00000387462:V636M;ENSP00000412036:V636M;ENSP00000416134:V636M	ENSP00000368384:V344M	V	+	1	0	ZBTB10	81588744	0.948000	0.32251	0.992000	0.48379	0.990000	0.78478	0.165000	0.16564	0.386000	0.24997	0.561000	0.74099	GTG			0.413	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000338055.2		NM_023929	
NDRG1	10397	mdanderson.org	37	8	134274318	134274318	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr8:134274318G>T	ENST00000414097.2	-	5	1165	c.298C>A	c.(298-300)Cag>Aag	p.Q100K	NDRG1_ENST00000522476.1_Missense_Mutation_p.Q34K|NDRG1_ENST00000323851.7_Missense_Mutation_p.Q100K|NDRG1_ENST00000518176.1_Intron|NDRG1_ENST00000518066.1_Intron|NDRG1_ENST00000537882.1_Missense_Mutation_p.Q19K|NDRG1_ENST00000354944.5_Intron	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	100					cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GCGCCGTCCTGCTGGCCAGGG	0.607			T	ERG	prostate																																p.Q100K				Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	.	.			0			c.C298A												75.0	69.0	71.0					8																	134274318		2203	4300	6503	SO:0001583	missense	10397	exon5			CGTCCTGCTGGCC	X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.298C>A	8.37:g.134274318G>T	ENSP00000404854:p.Gln100Lys		81	0	0		31	0.10	3	NM_001135242	33	0.00	0	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	Missense_Mutation	SNP	ENST00000414097.2	37	CCDS34945.1	.	.	.	.	.	.	.	.	.	.	G	32	5.106989	0.94292	.	.	ENSG00000104419	ENST00000323851;ENST00000414097;ENST00000537882;ENST00000522476;ENST00000520230;ENST00000518480;ENST00000519228;ENST00000519580;ENST00000522890;ENST00000520943;ENST00000521544;ENST00000522738;ENST00000523892	T;T;T;T;T;T;T;T;T;T;T;T;T	0.29142	1.58;1.58;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.09	5.09	0.68999	.	0.102551	0.64402	D	0.000001	T	0.43523	0.1251	M	0.82517	2.595	0.80722	D	1	P	0.40332	0.713	B	0.40444	0.329	T	0.54655	-0.8261	10	0.87932	D	0	-24.0231	17.0654	0.86557	0.0:0.0:1.0:0.0	.	100	Q92597	NDRG1_HUMAN	K	100;100;19;34;117;34;100;100;100;111;100;154;34	ENSP00000319977:Q100K;ENSP00000404854:Q100K;ENSP00000437443:Q19K;ENSP00000427894:Q34K;ENSP00000428345:Q117K;ENSP00000428802:Q34K;ENSP00000429994:Q100K;ENSP00000429272:Q100K;ENSP00000428384:Q100K;ENSP00000429840:Q111K;ENSP00000429524:Q100K;ENSP00000428991:Q154K;ENSP00000430171:Q34K	ENSP00000319977:Q100K	Q	-	1	0	NDRG1	134343500	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.468000	0.97676	2.359000	0.80004	0.561000	0.74099	CAG			0.607	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378805.1			
RUSC2	9853	mdanderson.org	37	9	35548378	35548378	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr9:35548378G>T	ENST00000455600.1	+	2	2429	c.1860G>T	c.(1858-1860)caG>caT	p.Q620H		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	620						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GGTCCACCCAGGTCTGTCAGG	0.637																																					p.Q620H													.	.			0			c.G1860T												54.0	48.0	50.0					9																	35548378		2203	4300	6503	SO:0001583	missense	9853	exon2			CACCCAGGTCTGT	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.1860G>T	9.37:g.35548378G>T	ENSP00000393922:p.Gln620His		40	0	0		34	0.09	3	NM_014806	41	0.00	0	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Missense_Mutation	SNP	ENST00000455600.1	37	CCDS35008.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.319002	0.23994	.	.	ENSG00000198853	ENST00000361226;ENST00000455600;ENST00000543478	T;T	0.23754	1.89;1.89	5.33	2.5	0.30297	.	0.910295	0.09536	N	0.788886	T	0.16471	0.0396	N	0.14661	0.345	0.23972	N	0.996307	P	0.49447	0.924	B	0.43155	0.41	T	0.11966	-1.0566	10	0.46703	T	0.11	-8.3386	7.3722	0.26808	0.1444:0.0:0.719:0.1366	.	620	Q8N2Y8	RUSC2_HUMAN	H	620	ENSP00000355177:Q620H;ENSP00000393922:Q620H	ENSP00000355177:Q620H	Q	+	3	2	RUSC2	35538378	0.994000	0.37717	0.658000	0.29665	0.281000	0.26958	0.959000	0.29240	0.383000	0.24910	0.655000	0.94253	CAG			0.637	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052309.1		XM_048462	
TJP2	9414	mdanderson.org	37	9	71840238	71840238	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr9:71840238G>T	ENST00000377245.4	+	6	1179	c.971G>T	c.(970-972)gGg>gTg	p.G324V	TJP2_ENST00000453658.2_Missense_Mutation_p.G301V|TJP2_ENST00000539225.1_Missense_Mutation_p.G355V|TJP2_ENST00000265384.7_Missense_Mutation_p.G324V|TJP2_ENST00000348208.4_Missense_Mutation_p.G324V|TJP2_ENST00000535702.1_Missense_Mutation_p.G328V	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	324	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						CTCCGGCTTGGGAGTCAGATC	0.413																																					p.G355V													.	.			0			c.G1064T												72.0	63.0	66.0					9																	71840238		2203	4300	6503	SO:0001583	missense	9414	exon6			GGCTTGGGAGTCA	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.971G>T	9.37:g.71840238G>T	ENSP00000366453:p.Gly324Val		45	0	0		46	0.07	3	NM_001170416	24	0.00	0	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	ENST00000377245.4	37	CCDS6627.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288696	0.59976	.	.	ENSG00000119139	ENST00000453658;ENST00000377245;ENST00000348208;ENST00000265384;ENST00000535702;ENST00000539225	T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0	5.68	4.77	0.60923	PDZ/DHR/GLGF (4);	0.048340	0.85682	D	0.000000	T	0.58694	0.2140	L	0.60904	1.88	0.80722	D	1	P;B;D;B;P	0.64830	0.701;0.392;0.994;0.254;0.569	B;B;P;B;B	0.60886	0.356;0.422;0.88;0.309;0.356	T	0.63800	-0.6555	10	0.87932	D	0	.	16.7015	0.85350	0.0:0.1297:0.8703:0.0	.	355;328;324;324;324	F5H301;F5H886;Q9UDY2-2;Q9UDY2;Q9UDY2-5	.;.;.;ZO2_HUMAN;.	V	301;324;324;324;328;355	ENSP00000392178:G301V;ENSP00000366453:G324V;ENSP00000345893:G324V;ENSP00000265384:G324V;ENSP00000442090:G328V;ENSP00000438262:G355V	ENSP00000265384:G324V	G	+	2	0	TJP2	71030058	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	7.869000	0.87170	1.380000	0.46344	0.561000	0.74099	GGG			0.413	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000052572.2		NM_201629	
MRPS2	51116	broad.mit.edu	37	9	138398057	138398057	+	IGR	DEL	G	G	-			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chr9:138398057delG	ENST00000371785.1	+	0	1640				RP11-426A6.5_ENST00000415062.1_RNA			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2						translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		TCTGCCAGGAGGGGCCCTCCA	0.602																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CCAGGAGGGGCCC	AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910		9.37:g.138398057delG			8	0	0		6	0.33	2	.	0		0	Q5T899|Q9BSQ4	RNA	DEL	ENST00000371785.1	37	CCDS6990.1																																																																																					0.602	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000054998.1			
STARD8	9754	bcgsc.ca	37	X	67940201	67940201	+	Missense_Mutation	SNP	G	G	C	rs201883068|rs373427165		TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chrX:67940201G>C	ENST00000252336.6	+	7	2117	c.1745G>C	c.(1744-1746)gGc>gCc	p.G582A	STARD8_ENST00000374599.3_Missense_Mutation_p.G662A|STARD8_ENST00000374597.3_Missense_Mutation_p.G582A	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	582	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CAGCGCACGGGCCAGCCACTG	0.617																																					p.G662A													.	STARD8	282		0			c.G1985C												34.0	24.0	28.0					X																	67940201		2202	4298	6500	SO:0001583	missense	9754	exon8			GCACGGGCCAGCC	D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.1745G>C	X.37:g.67940201G>C	ENSP00000252336:p.Gly582Ala		123	0.1056910569	13		105	0.32	34	NM_001142503	81	0.00	0	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	ENST00000252336.6	37	CCDS14390.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671428	0.88348	.	.	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.25250	1.81;1.81;1.81	4.45	4.45	0.53987	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.000000	0.64402	D	0.000001	T	0.50871	0.1641	M	0.87269	2.87	0.80722	D	1	P;P	0.52170	0.854;0.951	P;P	0.58721	0.844;0.806	T	0.60198	-0.7310	10	0.66056	D	0.02	.	13.5176	0.61549	0.0:0.0:1.0:0.0	.	662;582	Q92502-2;Q92502	.;STAR8_HUMAN	A	582;662;582	ENSP00000252336:G582A;ENSP00000363727:G662A;ENSP00000363725:G582A	ENSP00000252336:G582A	G	+	2	0	STARD8	67856926	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	9.112000	0.94314	2.050000	0.60909	0.600000	0.82982	GGC			0.617	STARD8-201	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057026.2		NM_014725	
BTK	695	mdanderson.org	37	X	100625019	100625019	+	Missense_Mutation	SNP	G	G	T			TCGA-4K-AA1G-01A-11D-A435-10	TCGA-4K-AA1G-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	14124f8f-2370-40de-94e3-012ff511bac1	3644a980-951f-4811-b56c-4d02e52f5252	g.chrX:100625019G>T	ENST00000308731.7	-	5	521	c.358C>A	c.(358-360)Cta>Ata	p.L120I	BTK_ENST00000372880.1_Missense_Mutation_p.L120I	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	120	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CGCTTCCTTAGTTCTTCAGTT	0.423									Agammaglobulinemia, X-linked																												p.L120I													.	.			0			c.C358A												108.0	99.0	102.0					X																	100625019		2203	4300	6503	SO:0001583	missense	695	exon5	Familial Cancer Database	Bruton Type Agammaglobulinemia	TCCTTAGTTCTTC	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.358C>A	X.37:g.100625019G>T	ENSP00000308176:p.Leu120Ile		62	0	0		42	0.07	3	NM_000061	3	0.00	0	B2RAW1|Q32ML5	Missense_Mutation	SNP	ENST00000308731.7	37	CCDS14482.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.088804	0.55968	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.75477	-0.94;-0.94	5.03	4.16	0.48862	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.322422	0.30869	N	0.008705	T	0.60508	0.2274	N	0.12182	0.205	0.37618	D	0.921206	B;B;B	0.24186	0.099;0.043;0.059	B;B;B	0.35073	0.195;0.066;0.036	T	0.61158	-0.7119	10	0.46703	T	0.11	.	10.2251	0.43220	0.1657:0.0:0.8343:0.0	.	120;120;120	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	I	120	ENSP00000361971:L120I;ENSP00000308176:L120I	ENSP00000308176:L120I	L	-	1	2	BTK	100511675	0.981000	0.34729	1.000000	0.80357	0.989000	0.77384	0.796000	0.26986	1.016000	0.39470	0.544000	0.68410	CTA			0.423	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057532.2		NM_000061	
