#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MACF1	23499	broad.mit.edu	37	1	39801169	39801169	+	Missense_Mutation	SNP	G	G	T	rs530899566		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:39801169G>T	ENST00000372915.3	+	36	9011	c.8924G>T	c.(8923-8925)cGg>cTg	p.R2975L	MACF1_ENST00000567887.1_Missense_Mutation_p.R3007L|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000564288.1_Missense_Mutation_p.R2970L|MACF1_ENST00000289893.4_Missense_Mutation_p.R1410L|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	2975					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGAATGCTCGGGTGAAAAGT	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		18948	0.001		0.0	False		,,,				2504	0.0				.													.	MACF1	909		0			.												58.0	60.0	59.0					1																	39801169		2203	4300	6503	SO:0001583	missense	23499	.			ATGCTCGGGTGAA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.8924G>T	1.37:g.39801169G>T	ENSP00000362006:p.Arg2975Leu		370	0.0027027027	1		377	0.02	7	.	0		0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	37		.	.	.	.	.	.	.	.	.	.	G	2.225	-0.377522	0.05000	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.62941	-0.01;1.06	5.2	-4.53	0.03462	.	1.893250	0.02523	N	0.092793	T	0.44829	0.1312	N	0.24115	0.695	0.09310	N	1	B	0.17038	0.02	B	0.15484	0.013	T	0.31503	-0.9941	10	0.42905	T	0.14	.	6.0973	0.20027	0.5452:0.2675:0.1873:0.0	.	2975	Q9UPN3	MACF1_HUMAN	L	2975;1410	ENSP00000362006:R2975L;ENSP00000289893:R1410L	ENSP00000289893:R1410L	R	+	2	0	MACF1	39573756	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.156000	0.10100	-0.577000	0.05967	-0.373000	0.07131	CGG			0.403	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000392096.1		NM_033044	
CYP4Z1	199974	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	47533216	47533216	+	Silent	SNP	C	C	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:47533216C>A	ENST00000334194.3	+	1	57	c.54C>A	c.(52-54)atC>atA	p.I18I		NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	18						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						TGCTGCTGATCCTCCTCTGCA	0.562																																					p.I18I													.	.			0			c.C54A												71.0	64.0	66.0					1																	47533216		2203	4297	6500	SO:0001819	synonymous_variant	199974	exon1			GCTGATCCTCCTC	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.54C>A	1.37:g.47533216C>A			110	0	0		117	0.32	37	NM_178134	0		0	Q5VVE4	Silent	SNP	ENST00000334194.3	37	CCDS545.1																																																																																					0.562	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000022020.1		NM_178134	
ANKRD13C	81573	broad.mit.edu	37	1	70820000	70820000	+	Missense_Mutation	SNP	G	G	A	rs541837487		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:70820000G>A	ENST00000370944.4	-	1	405	c.92C>T	c.(91-93)gCg>gTg	p.A31V	HHLA3_ENST00000361764.4_5'Flank|HHLA3_ENST00000432224.1_5'Flank|HHLA3_ENST00000531950.1_5'Flank|HHLA3_ENST00000359875.5_5'Flank|HHLA3_ENST00000370940.5_5'Flank|ANKRD13C_ENST00000262346.6_Missense_Mutation_p.A31V	NM_030816.4	NP_110443.3	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	31	Poly-Ala.				protein retention in ER lumen (GO:0006621)|regulation of anoikis (GO:2000209)|regulation of receptor biosynthetic process (GO:0010869)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	receptor binding (GO:0005102)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	19						GAGGGCAGCCGCCGCTTCCTC	0.612																																					p.A31V													.	ANKRD13C	36		0			c.C92T												34.0	42.0	39.0					1																	70820000		2197	4292	6489	SO:0001583	missense	81573	exon1			GCAGCCGCCGCTT		CCDS648.2	1p32.3-p31.3	2013-01-10			ENSG00000118454	ENSG00000118454		"""Ankyrin repeat domain containing"""	25374	protein-coding gene	gene with protein product		615125				11230166	Standard	NM_030816		Approved	DKFZP566D1346, dJ677H15.3	uc001dex.4	Q8N6S4	OTTHUMG00000009343	ENST00000370944.4:c.92C>T	1.37:g.70820000G>A	ENSP00000359982:p.Ala31Val		75	0	0		77	0.05	4	NM_030816	15	0.00	0	B3KQ97|Q5VYH4|Q5VYH5|Q6PJE4|Q9H0N9	Missense_Mutation	SNP	ENST00000370944.4	37	CCDS648.2	.	.	.	.	.	.	.	.	.	.	G	18.31	3.594978	0.66219	.	.	ENSG00000118454	ENST00000370944;ENST00000262346	T;T	0.51071	0.9;0.72	3.93	2.98	0.34508	.	0.141128	0.49305	D	0.000156	T	0.17746	0.0426	L	0.29908	0.895	0.35487	D	0.798625	P;P;B	0.50066	0.516;0.931;0.043	B;B;B	0.38880	0.039;0.284;0.01	T	0.02431	-1.1160	10	0.34782	T	0.22	-6.9754	11.8367	0.52327	0.0:0.0:0.823:0.177	.	31;31;31	Q8N6S4-2;Q8N6S4-3;Q8N6S4	.;.;AN13C_HUMAN	V	31	ENSP00000359982:A31V;ENSP00000262346:A31V	ENSP00000262346:A31V	A	-	2	0	ANKRD13C	70592588	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.498000	0.73679	0.941000	0.37499	0.462000	0.41574	GCG			0.612	ANKRD13C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025903.1		NM_030816	
WDR63	126820	mdanderson.org	37	1	85573731	85573731	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:85573731G>T	ENST00000294664.6	+	15	1749	c.1569G>T	c.(1567-1569)tgG>tgT	p.W523C	WDR63_ENST00000370596.1_Missense_Mutation_p.W484C|WDR63_ENST00000326813.8_Missense_Mutation_p.W484C	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	523										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TATGTTTTTGGGATATTAGAC	0.328																																					p.W523C													.	.			0			c.G1569T												53.0	51.0	52.0					1																	85573731		2202	4299	6501	SO:0001583	missense	126820	exon15			TTTTTGGGATATT		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1569G>T	1.37:g.85573731G>T	ENSP00000294664:p.Trp523Cys		63	0	0		40	0.08	3	NM_145172	0		0	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	37	CCDS702.1	.	.	.	.	.	.	.	.	.	.	G	17.43	3.386585	0.61956	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	D;D;D	0.83506	-1.73;-1.73;-1.73	5.59	5.59	0.84812	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.120190	0.64402	D	0.000008	D	0.91885	0.7431	M	0.89968	3.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93108	0.6514	10	0.87932	D	0	-13.3607	16.5041	0.84264	0.0:0.0:1.0:0.0	.	484;523	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	C	484;484;523	ENSP00000359628:W484C;ENSP00000317463:W484C;ENSP00000294664:W523C	ENSP00000294664:W523C	W	+	3	0	WDR63	85346319	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.790000	0.69038	2.610000	0.88304	0.650000	0.86243	TGG			0.328	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000027565.2		NM_145172	
SEC22B	9554	broad.mit.edu	37	1	145109975	145109976	+	RNA	INS	-	-	C	rs376446977|rs11458983		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:145109975_145109976insC	ENST00000453618.1	+	0	673							O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B (S. cerevisiae) (gene/pseudogene)						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											CAGGAACTTTGCTAAAGATCTA	0.386																																					.													.	.			0			.																																											9554	.			AACTTTGCTAAAG	AF047442		1q21.1	2012-04-20	2010-03-12	2006-04-25	ENSG00000223380				10700	protein-coding gene	gene with protein product		604029	"""SEC22, vesicle trafficking protein (S. cerevisiae)-like 1"", ""SEC22 vesicle trafficking protein-like 1 (S. cerevisiae)"", ""SEC22 vesicle trafficking protein homolog B (S. cerevisiae)"""	SEC22L1		9094723, 16354670	Standard	NM_004892		Approved	sec22b, ERS-24	uc031poa.1	O75396	OTTHUMG00000013745		1.37:g.145109976_145109976dupC			6	0	0		9	0.44	4	.	0		0	A8K1G0	RNA	INS	ENST00000453618.1	37																																																																																						0.386	SEC22B-001	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000038523.5		NM_004892	
SLC27A3	11000	broad.mit.edu	37	1	153750946	153750946	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:153750946T>C	ENST00000368661.3	+	6	1570	c.1505T>C	c.(1504-1506)tTc>tCc	p.F502S	SLC27A3_ENST00000271857.2_Missense_Mutation_p.F583S|SLC27A3_ENST00000484014.1_Intron	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	502					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CAGCATATCTTCCCCTTCTCC	0.562																																					p.F502S													.	SLC27A3	42		0			c.T1505C												123.0	119.0	120.0					1																	153750946		2203	4300	6503	SO:0001583	missense	11000	exon6			ATATCTTCCCCTT	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.1505T>C	1.37:g.153750946T>C	ENSP00000357650:p.Phe502Ser		197	0	0		236	0.02	5	NM_024330	68	0.00	0	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	37	CCDS1053.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.922|8.922	0.961355|0.961355	0.18583|0.18583	.|.	.|.	ENSG00000143554|ENSG00000143554	ENST00000271857;ENST00000368661;ENST00000532853|ENST00000458027	T;T;T|.	0.48522|.	1.08;1.08;0.81|.	5.28|5.28	4.13|4.13	0.48395|0.48395	AMP-dependent synthetase/ligase (1);|.	0.219350|.	0.41605|.	D|.	0.000854|.	T|T	0.20700|0.20700	0.0498|0.0498	L|L	0.39326|0.39326	1.205|1.205	0.29878|0.29878	N|N	0.82628|0.82628	B|.	0.25048|.	0.117|.	B|.	0.32393|.	0.145|.	T|T	0.09662|0.09662	-1.0664|-1.0664	10|5	0.33141|.	T|.	0.24|.	-23.0409|-23.0409	6.3314|6.3314	0.21272|0.21272	0.0:0.1111:0.0:0.8889|0.0:0.1111:0.0:0.8889	.|.	502|.	Q5K4L6|.	S27A3_HUMAN|.	S|P	583;502;56|207	ENSP00000271857:F583S;ENSP00000357650:F502S;ENSP00000433959:F56S|.	ENSP00000271857:F583S|.	F|S	+|+	2|1	0|0	SLC27A3|SLC27A3	152017570|152017570	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.658000|0.658000	0.38924|0.38924	3.263000|3.263000	0.51546|0.51546	2.217000|2.217000	0.71921|0.71921	0.379000|0.379000	0.24179|0.24179	TTC|TCC			0.562	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_024330	
IRF6	3664	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	1	209968742	209968742	+	Nonsense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:209968742C>T	ENST00000367021.3	-	5	573	c.401G>A	c.(400-402)tGg>tAg	p.W134*	IRF6_ENST00000542854.1_Nonsense_Mutation_p.W39*	NM_006147.3	NP_006138.1	O14896	IRF6_HUMAN	interferon regulatory factor 6	134					cell cycle arrest (GO:0007050)|cell development (GO:0048468)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mammary gland epithelial cell differentiation (GO:0060644)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	28				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		CTTCTCATCCCAGGGAGCAGA	0.537										HNSCC(57;0.16)																											p.W134X													.	.			0			c.G401A												222.0	168.0	186.0					1																	209968742		2203	4300	6503	SO:0001587	stop_gained	3664	exon5			TCATCCCAGGGAG	AL022398	CCDS1492.1, CCDS55681.1	1q32.2-q32.3	2011-02-10			ENSG00000117595	ENSG00000117595			6121	protein-coding gene	gene with protein product		607199	"""Van der Woude syndrome"""	VWS, LPS		12219090	Standard	NM_006147		Approved	OFC6, VWS1	uc001hhq.2	O14896	OTTHUMG00000036521	ENST00000367021.3:c.401G>A	1.37:g.209968742C>T	ENSP00000355988:p.Trp134*		83	0	0		90	0.14	13	NM_006147	18	0.06	1	B4DLE2|D3DT90|F5GWX8|G0ZTL0	Nonsense_Mutation	SNP	ENST00000367021.3	37	CCDS1492.1	.	.	.	.	.	.	.	.	.	.	C	38	7.000538	0.97994	.	.	ENSG00000117595	ENST00000367021;ENST00000542854;ENST00000456314	.	.	.	5.4	5.4	0.78164	.	0.235456	0.47093	D	0.000251	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1858	0.93644	0.0:1.0:0.0:0.0	.	.	.	.	X	134;39;134	.	.	W	-	2	0	IRF6	208035365	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.451000	0.66632	2.531000	0.85337	0.655000	0.94253	TGG			0.537	IRF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000088827.1		NM_006147	
ERO1LB	56605	broad.mit.edu	37	1	236416763	236416763	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:236416763G>T	ENST00000354619.5	-	3	466	c.265C>A	c.(265-267)Cac>Aac	p.H89N	ERO1LB_ENST00000327333.8_Missense_Mutation_p.H89N	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	89					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	ATTGAACAGTGGCCATCTTCT	0.383																																					p.H89N													.	ERO1LB	48		0			c.C265A												61.0	56.0	58.0					1																	236416763		2203	4300	6503	SO:0001583	missense	56605	exon3			AACAGTGGCCATC	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.265C>A	1.37:g.236416763G>T	ENSP00000346635:p.His89Asn		204	0	0		263	0.02	6	NM_019891	4	0.00	0	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	ENST00000354619.5	37	CCDS31064.1	.	.	.	.	.	.	.	.	.	.	G	18.01	3.527480	0.64860	.	.	ENSG00000086619	ENST00000354619;ENST00000327333	T;T	0.42131	0.98;0.98	5.65	5.65	0.86999	.	0.163685	0.53938	D	0.000055	T	0.48409	0.1498	M	0.70595	2.14	0.80722	D	1	P;B	0.43231	0.801;0.076	B;B	0.40741	0.339;0.102	T	0.52924	-0.8510	10	0.52906	T	0.07	-6.4565	18.4833	0.90819	0.0:0.0:1.0:0.0	.	89;89	B4DF57;Q86YB8	.;ERO1B_HUMAN	N	89	ENSP00000346635:H89N;ENSP00000377574:H89N	ENSP00000377574:H89N	H	-	1	0	ERO1LB	234483386	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.009000	0.93606	2.662000	0.90505	0.561000	0.74099	CAC			0.383	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096371.1		NM_019891	
SDCCAG8	10806	mdanderson.org	37	1	243471336	243471336	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr1:243471336G>T	ENST00000366541.3	+	8	904	c.786G>T	c.(784-786)gaG>gaT	p.E262D	SDCCAG8_ENST00000355875.4_Missense_Mutation_p.E219D|SDCCAG8_ENST00000391846.1_Missense_Mutation_p.E262D|SDCCAG8_ENST00000343783.6_Missense_Mutation_p.E117D	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	262	Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		ATCTTAAAGAGCAACTAAAGC	0.363																																					p.E262D													SDCCAG8,NS,carcinoma,0,2	SDCCAG8	0	2	0			c.G786T												157.0	144.0	149.0					1																	243471336		2203	4300	6503	SO:0001583	missense	10806	exon8			TAAAGAGCAACTA	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.786G>T	1.37:g.243471336G>T	ENSP00000355499:p.Glu262Asp		124	0	0		119	0.04	5	NM_006642	14	0.00	0	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	37	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318805	0.23994	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541;ENST00000343783;ENST00000435549	T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83	5.6	1.58	0.23477	.	0.914449	0.09629	N	0.776466	T	0.20373	0.0490	L	0.60455	1.87	0.19300	N	0.99998	P;B	0.36837	0.571;0.288	B;B	0.28139	0.085;0.086	T	0.17167	-1.0378	10	0.19590	T	0.45	-0.1213	8.3062	0.32045	0.4686:0.0:0.5314:0.0	.	219;262	E9PFS7;Q86SQ7	.;SDCG8_HUMAN	D	219;262;262;117;42	ENSP00000348137:E219D;ENSP00000375721:E262D;ENSP00000355499:E262D;ENSP00000341260:E117D;ENSP00000410200:E42D	ENSP00000341260:E117D	E	+	3	2	SDCCAG8	241537959	0.965000	0.33210	0.269000	0.24586	0.971000	0.66376	0.676000	0.25247	0.107000	0.17824	-0.145000	0.13849	GAG			0.363	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096485.1		NM_006642	
C10orf40	283025	hgsc.bcm.edu;ucsc.edu;mdanderson.org	37	10	61718595	61718595	+	5'UTR	SNP	T	T	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr10:61718595T>A	ENST00000521074.1	-	0	921				C10orf40_ENST00000444900.1_5'UTR|C10orf40_ENST00000430888.1_5'Flank					chromosome 10 open reading frame 40																		GTCATAAAATTGATTTTAAAA	0.418																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	283025	.			TAAAATTGATTTT	BC038741		10q21.3	2013-01-15			ENSG00000235931	ENSG00000235931			23524	other	unknown						12477932	Standard	NR_024340		Approved	AC023904.2	uc021prf.1	A4QN01	OTTHUMG00000018285	ENST00000521074.1:c.-166A>T	10.37:g.61718595T>A			186	0	0		197	0.18	36	.	0		0		RNA	SNP	ENST00000521074.1	37																																																																																						0.418	C10orf40-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000379562.1		NR_024340	
TRPM5	29850	bcgsc.ca;mdanderson.org	37	11	2429028	2429028	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:2429028G>A	ENST00000155858.6	-	19	2905	c.2897C>T	c.(2896-2898)aCc>aTc	p.T966I	AC124057.5_ENST00000433035.1_RNA|TRPM5_ENST00000452833.1_Missense_Mutation_p.T968I|TRPM5_ENST00000528453.1_Missense_Mutation_p.T966I|TRPM5_ENST00000533060.1_Missense_Mutation_p.T966I	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGCACATTGGTGACCAACAG	0.607																																					p.T966I	NSCLC(1;49 61 17205 18850 43201)												.	TRPM5	86		0			c.C2897T												168.0	134.0	146.0					11																	2429028		2202	4299	6501	SO:0001583	missense	29850	exon19			ACATTGGTGACCA	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.2897C>T	11.37:g.2429028G>A	ENSP00000155858:p.Thr966Ile		115	0	0		100	0.05	5	NM_014555	0		0		Missense_Mutation	SNP	ENST00000155858.6	37	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.999599	0.74818	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453	T;T;T;T;T	0.73469	-0.75;-0.75;-0.75;-0.75;-0.75	3.16	3.16	0.36331	Ion transport (1);	0.000000	0.85682	U	0.000000	D	0.85435	0.5696	M	0.81341	2.54	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79108	0.992;0.992;0.991	D	0.88148	0.2849	10	0.87932	D	0	-31.212	14.1564	0.65419	0.0:0.0:1.0:0.0	.	966;968;966	E9PRW0;Q9NZQ8-2;Q9NZQ8	.;.;TRPM5_HUMAN	I	960;966;968;966;966	ENSP00000434383:T960I;ENSP00000155858:T966I;ENSP00000387965:T968I;ENSP00000434121:T966I;ENSP00000436809:T966I	ENSP00000155858:T966I	T	-	2	0	TRPM5	2385604	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	7.324000	0.79115	1.734000	0.51633	0.462000	0.41574	ACC			0.607	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000027378.1		NM_014555	
OR52N4	390072	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	5776663	5776663	+	Silent	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:5776663C>T	ENST00000317254.3	+	1	741	c.693C>T	c.(691-693)tcC>tcT	p.S231S	TRIM5_ENST00000380027.1_Intron	NM_001005175.2	NP_001005175.3	Q8NGI2	O52N4_HUMAN	olfactory receptor, family 52, subfamily N, member 4 (gene/pseudogene)	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;1.87e-10)|LUSC - Lung squamous cell carcinoma(625;0.114)|BRCA - Breast invasive adenocarcinoma(625;0.135)|Lung(200;0.197)		TCAGCCTCTCCTCAGCAGATG	0.498																																					p.S231S													OR52N4,NS,carcinoma,0,1	OR52N4	0	1	0			c.C693T												179.0	172.0	174.0					11																	5776663		2132	4270	6402	SO:0001819	synonymous_variant	390072	exon1			CCTCTCCTCAGCA	AB065813	CCDS44528.1	11p15.4	2013-10-10	2013-10-10		ENSG00000181074	ENSG00000181074		"""GPCR / Class A : Olfactory receptors"""	15230	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily N, member 4"""				Standard	NM_001005175		Approved		uc001mbu.3	Q8NGI2	OTTHUMG00000066887	ENST00000317254.3:c.693C>T	11.37:g.5776663C>T			152	0	0		173	0.14	25	NM_001005175	1	0.00	0	B2RNP8|Q6IF77	Silent	SNP	ENST00000317254.3	37	CCDS44528.1																																																																																					0.498	OR52N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143350.1		NM_001005175	
INCENP	3619	mdanderson.org	37	11	61897743	61897743	+	Silent	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:61897743C>T	ENST00000394818.3	+	4	946	c.744C>T	c.(742-744)gtC>gtT	p.V248V	INCENP_ENST00000278849.4_Silent_p.V248V	NM_001040694.1	NP_001035784.1	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	248					chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	central element (GO:0000801)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lateral element (GO:0000800)|microtubule (GO:0005874)|midbody (GO:0030496)|pericentric heterochromatin (GO:0005721)|protein complex (GO:0043234)|spindle (GO:0005819)				breast(1)|endometrium(1)|kidney(6)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						GTCAAGGGGTCGGGACGGGGC	0.617																																					p.V248V													.	.			0			c.C744T												61.0	60.0	61.0					11																	61897743		2202	4299	6501	SO:0001819	synonymous_variant	3619	exon4			AGGGGTCGGGACG	AF282265	CCDS31582.1, CCDS44624.1	11q12.3	2013-01-17	2002-08-29		ENSG00000149503	ENSG00000149503			6058	protein-coding gene	gene with protein product		604411	"""inner centromere protein antigens (135kD, 155kD)"""			1860899, 11453556	Standard	NM_001040694		Approved	FLJ31633	uc001nsw.1	Q9NQS7	OTTHUMG00000167470	ENST00000394818.3:c.744C>T	11.37:g.61897743C>T			44	0	0		48	0.06	3	NM_020238	31	0.00	0	A8MQD2|Q5Y192	Silent	SNP	ENST00000394818.3	37	CCDS44624.1																																																																																					0.617	INCENP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000394723.2		NM_020238	
CABP2	51475	mdanderson.org	37	11	67290111	67290111	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:67290111T>C	ENST00000294288.4	-	2	188	c.119A>G	c.(118-120)gAc>gGc	p.D40G	CABP2_ENST00000353903.5_Intron	NM_016366.2	NP_057450.2	Q9NPB3	CABP2_HUMAN	calcium binding protein 2	40					signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	9						TGGCGCGGGGTCCCCCTGCTC	0.701																																					p.D40G													.	.			0			c.A119G												9.0	9.0	9.0					11																	67290111		2079	3995	6074	SO:0001583	missense	51475	exon2			GCGGGGTCCCCCT	AF169154	CCDS8170.1	11q13.1	2013-01-10			ENSG00000167791	ENSG00000167791		"""EF-hand domain containing"""	1385	protein-coding gene	gene with protein product		607314				10625670	Standard	NM_016366		Approved		uc001omc.1	Q9NPB3	OTTHUMG00000168014	ENST00000294288.4:c.119A>G	11.37:g.67290111T>C	ENSP00000294288:p.Asp40Gly		75	0.0133333333	1		64	0.06	4	NM_016366	0		0		Missense_Mutation	SNP	ENST00000294288.4	37	CCDS8170.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.032729	0.00041	.	.	ENSG00000167791	ENST00000294288	T	0.71817	-0.6	4.65	-3.8	0.04307	.	5.515310	0.00610	N	0.000415	T	0.44644	0.1303	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27971	-1.0058	10	0.14252	T	0.57	.	3.8088	0.08788	0.0988:0.2975:0.3926:0.2111	.	40	Q9NPB3	CABP2_HUMAN	G	40	ENSP00000294288:D40G	ENSP00000294288:D40G	D	-	2	0	CABP2	67046687	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-2.287000	0.01151	-0.607000	0.05738	-4.066000	0.00012	GAC			0.701	CABP2-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000397516.1			
SYTL2	54843	broad.mit.edu	37	11	85437269	85437269	+	Intron	DEL	T	T	-			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:85437269delT	ENST00000528231.1	-	7	1737				SYTL2_ENST00000354566.3_Frame_Shift_Del_p.K77fs|SYTL2_ENST00000524452.1_Intron|SYTL2_ENST00000389960.4_Intron|SYTL2_ENST00000359152.5_Frame_Shift_Del_p.K601fs|SYTL2_ENST00000316356.4_Intron|SYTL2_ENST00000525423.1_Frame_Shift_Del_p.K77fs|SYTL2_ENST00000527523.1_Intron	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2						exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TTGCCATAACTTTTTTTGGGC	0.373																																					p.K77fs													.	SYTL2	231		0			c.231delA												185.0	180.0	182.0					11																	85437269		2203	4299	6502	SO:0001627	intron_variant	54843	exon1			CATAACTTTTTTT	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1459+1669A>-	11.37:g.85437269delT			190	0	0		485	0.01	7	NM_206927	0		0	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Frame_Shift_Del	DEL	ENST00000528231.1	37	CCDS53688.1																																																																																					0.373	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000392192.1		NM_206927	
HYOU1	10525	mdanderson.org	37	11	118925755	118925755	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:118925755G>T	ENST00000404233.3	-	6	561	c.437C>A	c.(436-438)cCt>cAt	p.P146H	HYOU1_ENST00000525859.1_Missense_Mutation_p.P146H|HYOU1_ENST00000543287.1_Missense_Mutation_p.P59H|HYOU1_ENST00000529972.1_Missense_Mutation_p.P146H	NM_001130991.1|NM_006389.3	NP_001124463.1|NP_006380.1	Q9Y4L1	HYOU1_HUMAN	hypoxia up-regulated 1	146					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|response to ischemia (GO:0002931)|response to stress (GO:0006950)	endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(10)|prostate(1)|skin(2)	33	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.78e-05)		CACTTCCTCAGGTGAGAACTG	0.542																																					p.P146H													.	.			0			c.C437A												112.0	94.0	100.0					11																	118925755		2200	4295	6495	SO:0001583	missense	10525	exon6			TCCTCAGGTGAGA	U65785	CCDS8408.1	11q23.1-q23.3	2011-09-02			ENSG00000149428	ENSG00000149428		"""Heat shock proteins / HSP70"""	16931	protein-coding gene	gene with protein product	"""glucose-regulated protein 170"""	601746				9020069, 10037731	Standard	XM_005271390		Approved	ORP150, HSP12A, Grp170	uc001pux.3	Q9Y4L1	OTTHUMG00000166354	ENST00000404233.3:c.437C>A	11.37:g.118925755G>T	ENSP00000384144:p.Pro146His		69	0	0		49	0.06	3	NM_001130991	103	0.00	0	A8C1Z0|B7Z909|Q2I204|Q53H25	Missense_Mutation	SNP	ENST00000404233.3	37	CCDS8408.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.1|24.1	4.494902|4.494902	0.85069|0.85069	.|.	.|.	ENSG00000149428|ENSG00000149428	ENST00000541069|ENST00000404233;ENST00000353883;ENST00000529972;ENST00000536103;ENST00000525859;ENST00000544701;ENST00000543287;ENST00000530473	.|T;T;T;T;T	.|0.01359	.|4.98;4.98;4.98;4.98;4.98	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	.|0.101842	.|0.64402	.|D	.|0.000002	.|T	.|0.14787	.|0.0357	H|H	0.96430|0.96430	3.82|3.82	0.58432|0.58432	D|D	0.999998|0.999998	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.85130	.|0.995;0.991;0.997;0.997	.|T	.|0.04930	.|-1.0917	.|10	.|0.72032	.|D	.|0.01	.|-12.6033	16.1064|16.1064	0.81225|0.81225	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|137;190;146;146	.|B3KXH0;B7Z2N4;Q9Y4L1;A8C1Z0	.|.;.;HYOU1_HUMAN;.	.|H	-1|146;137;146;146;146;189;59;146	.|ENSP00000384144:P146H;ENSP00000437313:P146H;ENSP00000433397:P146H;ENSP00000442727:P59H;ENSP00000431874:P146H	.|ENSP00000278752:P137H	.|P	-|-	.|2	.|0	HYOU1|HYOU1	118430965|118430965	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.925000|0.925000	0.55904|0.55904	6.925000|6.925000	0.75829|0.75829	2.445000|2.445000	0.82738|0.82738	0.491000|0.491000	0.48974|0.48974	.|CCT			0.542	HYOU1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000389353.1		NM_006389	
C2CD2L	9854	broad.mit.edu;mdanderson.org	37	11	118983227	118983227	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr11:118983227T>C	ENST00000528586.1	+	5	434	c.364T>C	c.(364-366)Tcc>Ccc	p.S122P	C2CD2L_ENST00000336702.3_Missense_Mutation_p.S374P			O14523	C2C2L_HUMAN	C2CD2-like	374						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						GCCTGTGGGCTCCCCCTCCAG	0.652																																					p.S374P													C2CD2L,left_upper_lobe,carcinoma,-1,1	C2CD2L	39	1	0			c.T1120C												58.0	59.0	58.0					11																	118983227		2200	4295	6495	SO:0001583	missense	9854	exon9			GTGGGCTCCCCCT	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.364T>C	11.37:g.118983227T>C	ENSP00000433600:p.Ser122Pro		83	0	0		68	0.06	4	NM_014807	13	0.00	0	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	37		.	.	.	.	.	.	.	.	.	.	T	12.19	1.863431	0.32884	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.41065	1.01;1.01	5.08	2.73	0.32206	C2 calcium/lipid-binding domain, CaLB (1);	0.243264	0.42964	N	0.000633	T	0.23688	0.0573	N	0.19112	0.55	0.35809	D	0.823718	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11421	-1.0588	10	0.30854	T	0.27	-25.9378	6.3282	0.21255	0.1408:0.0768:0.0:0.7824	.	374;374	O14523;O14523-2	C2C2L_HUMAN;.	P	374;122	ENSP00000338885:S374P;ENSP00000433600:S122P	ENSP00000338885:S374P	S	+	1	0	C2CD2L	118488437	0.372000	0.25064	1.000000	0.80357	0.985000	0.73830	0.157000	0.16402	0.405000	0.25532	0.533000	0.62120	TCC			0.652	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000388199.2		NM_014807	
FOXM1	2305	hgsc.bcm.edu	37	12	2968602	2968644	+	Frame_Shift_Del	DEL	TGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC	TGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC	-	rs537910596|rs138809142|rs371830965|rs556126385	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	TGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC	TGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr12:2968602_2968644delTGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC	ENST00000359843.3	-	9	1520_1562	c.1452_1494delGGAAGAGTGGCCCTCCCCGGCCCCATCTTTCAAAGAGGAATCA	c.(1450-1494)ttggaagagtggccctccccggccccatctttcaaagaggaatcafs	p.LEEWPSPAPSFKEES484fs	FOXM1_ENST00000342628.2_Frame_Shift_Del_p.LEEWPSPAPSFKEES522fs|AC005841.1_ENST00000382678.3_5'Flank|Y_RNA_ENST00000410561.1_RNA|FOXM1_ENST00000361953.3_Frame_Shift_Del_p.LEEWPSPAPSFKEES469fs|ITFG2_ENST00000545509.1_Intron	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	484	Glu/Pro/Ser/Thr-rich.				cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.S536*(1)		breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			AGGAGTGAGATGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCCAAGGGAGGGC	0.551																																					p.523_537del													.	FOXM1	62		1	Substitution - Nonsense(1)	large_intestine(1)	c.1567_1609del																																									SO:0001589	frameshift_variant	2305	exon10			GTGAGATGATTCC	Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1452_1494delGGAAGAGTGGCCCTCCCCGGCCCCATCTTTCAAAGAGGAATCA	12.37:g.2968602_2968644delTGATTCCTCTTTGAAAGATGGGGCCGGGGAGGGCCACTCTTCC	ENSP00000352901:p.Leu484fs		53	0	0		83	0.00	0	NM_202002	283	0.00	0	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Frame_Shift_Del	DEL	ENST00000359843.3	37	CCDS8515.1																																																																																					0.551	FOXM1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000398272.1		NM_021953	
ACACB	32	broad.mit.edu	37	12	109629568	109629568	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr12:109629568G>T	ENST00000338432.7	+	14	2414	c.2295G>T	c.(2293-2295)caG>caT	p.Q765H	ACACB_ENST00000377854.5_Splice_Site_p.Q765H|ACACB_ENST00000377848.3_Splice_Site_p.Q765H			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	765					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGAAAGTGCAGGTAGGGAGTG	0.542																																					p.Q765H													.	ACACB	330		0			c.G2295T												100.0	87.0	92.0					12																	109629568		2203	4300	6503	SO:0001630	splice_region_variant	32	exon13			AGTGCAGGTAGGG	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.2295+1G>T	12.37:g.109629568G>T			203	0	0		225	0.02	4	NM_001093	1	0.00	0	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Splice_Site	SNP	ENST00000338432.7	37	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.689922	0.88735	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.95788	-3.8;-3.8;-3.81	5.16	5.16	0.70880	ATP-grasp fold, subdomain 2 (1);	0.000000	0.85682	D	0.000000	D	0.97136	0.9064	L	0.58428	1.81	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97461	1.0034	10	0.56958	D	0.05	.	18.7107	0.91655	0.0:0.0:1.0:0.0	.	765	O00763	ACACB_HUMAN	H	765	ENSP00000341044:Q765H;ENSP00000367079:Q765H;ENSP00000367085:Q765H	ENSP00000341044:Q765H	Q	+	3	2	ACACB	108113951	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	9.868000	0.99621	2.428000	0.82296	0.644000	0.83932	CAG			0.542	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403077.1		NM_001093	Missense_Mutation
TBX5	6910	broad.mit.edu	37	12	114836479	114836479	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr12:114836479C>T	ENST00000310346.4	-	5	1075	c.409G>A	c.(409-411)Gtg>Atg	p.V137M	TBX5_ENST00000349716.5_Missense_Mutation_p.V87M|TBX5_ENST00000552726.1_5'UTR|TBX5_ENST00000405440.2_Missense_Mutation_p.V137M|TBX5_ENST00000526441.1_Missense_Mutation_p.V137M	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	137					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		TCTGGGTGCACGTACAGGCGG	0.612																																					p.V137M	NSCLC(152;1358 1980 4050 23898 40356)												.	TBX5	188		0			c.G409A												55.0	46.0	49.0					12																	114836479		2203	4300	6503	SO:0001583	missense	6910	exon5			GGTGCACGTACAG	U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.409G>A	12.37:g.114836479C>T	ENSP00000309913:p.Val137Met		151	0	0		163	0.03	5	NM_000192	2	0.00	0	A6ND77|O15301|Q96TB0|Q9Y4I2	Missense_Mutation	SNP	ENST00000310346.4	37	CCDS9173.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.205553	0.79127	.	.	ENSG00000089225	ENST00000349716;ENST00000310346;ENST00000448888;ENST00000405440;ENST00000526441	D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42	4.41	4.41	0.53225	Transcription factor, T-box, conserved site (1);p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93128	0.7812	L	0.59912	1.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.909;0.994	D	0.93879	0.7169	10	0.72032	D	0.01	.	17.5478	0.87867	0.0:1.0:0.0:0.0	.	137;137	Q99593-2;Q99593	.;TBX5_HUMAN	M	87;137;34;137;137	ENSP00000337723:V87M;ENSP00000309913:V137M;ENSP00000384152:V137M;ENSP00000433292:V137M	ENSP00000309913:V137M	V	-	1	0	TBX5	113320862	1.000000	0.71417	0.994000	0.49952	0.468000	0.32798	7.597000	0.82733	2.425000	0.82216	0.655000	0.94253	GTG			0.612	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000388297.1		NM_080717	
NCOR2	9612	mdanderson.org	37	12	124825195	124825195	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr12:124825195G>A	ENST00000405201.1	-	35	5291	c.5291C>T	c.(5290-5292)gCg>gTg	p.A1764V	NCOR2_ENST00000404621.1_Missense_Mutation_p.A1754V|NCOR2_ENST00000397355.1_Missense_Mutation_p.A1755V|NCOR2_ENST00000429285.2_Missense_Mutation_p.A1754V|NCOR2_ENST00000404121.2_Missense_Mutation_p.A1325V|NCOR2_ENST00000356219.3_Missense_Mutation_p.A1771V			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1772					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GGGCTGGGGCGCGGTGGGGAG	0.706																																					p.A1764V													.	.			0			c.C5291T												14.0	22.0	19.0					12																	124825195		2028	4161	6189	SO:0001583	missense	9612	exon37			TGGGGCGCGGTGG	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5291C>T	12.37:g.124825195G>A	ENSP00000384018:p.Ala1764Val		30	0	0		30	0.13	4	NM_006312	83	0.13	11	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	37	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	G	13.76	2.334342	0.41297	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	4.13	4.13	0.48395	.	0.529823	0.18564	U	0.137525	T	0.41949	0.1181	L	0.47716	1.5	0.09310	N	1	D;D;D	0.62365	0.975;0.968;0.991	B;B;P	0.44518	0.265;0.206;0.452	T	0.39742	-0.9599	10	0.54805	T	0.06	-4.7805	16.3743	0.83379	0.0:0.0:1.0:0.0	.	1754;1755;1764	C9J0Q5;C9J239;C9JFD3	.;.;.	V	1764;1754;1771;1755;1763;1325;1754	ENSP00000384018:A1764V;ENSP00000384202:A1754V;ENSP00000348551:A1771V;ENSP00000380513:A1755V;ENSP00000385618:A1325V;ENSP00000400281:A1754V	ENSP00000348551:A1771V	A	-	2	0	NCOR2	123391148	0.845000	0.29573	0.197000	0.23402	0.939000	0.58152	4.457000	0.60088	1.854000	0.53819	0.491000	0.48974	GCG			0.706	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
IGHV3-53	28420	broad.mit.edu;bcgsc.ca	37	14	107049074	107049074	+	RNA	SNP	C	C	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr14:107049074C>A	ENST00000390627.2	-	0	267									immunoglobulin heavy variable 3-53																		CCATGAATCACCTTTTAAAAT	0.448																																					.													.	.			0			.												176.0	184.0	181.0					14																	107049074		1163	2499	3662			0	.			GAATCACCTTTTA	M99679		14q32.33	2012-02-08			ENSG00000211967	ENSG00000211967		"""Immunoglobulins / IGH locus"""	5610	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151966		14.37:g.107049074C>A			140	0	0		138	0.16	22	.	3	0.00	0		RNA	SNP	ENST00000390627.2	37																																																																																						0.448	IGHV3-53-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IG_V_gene		OTTHUMT00000324612.1		NG_001019	
MRPS11	64963	bcgsc.ca	37	15	89010689	89010689	+	5'UTR	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr15:89010689C>T	ENST00000325844.4	+	0	6				MRPL46_ENST00000559538.1_5'Flank|MRPL46_ENST00000312475.4_5'Flank|MRPS11_ENST00000353598.6_5'Flank	NM_022839.3	NP_073750.2	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11						DNA damage response, detection of DNA damage (GO:0042769)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(3)	3	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			AGCTCAGTCCCGGAACTGCTA	0.567																																					.													.	MRPS11	14		0			.																																									SO:0001623	5_prime_UTR_variant	64963	.			CAGTCCCGGAACT	AB051349	CCDS10342.1, CCDS10343.1	15q25	2012-09-13			ENSG00000181991	ENSG00000181991		"""Mitochondrial ribosomal proteins / small subunits"""	14050	protein-coding gene	gene with protein product	"""cervical cancer proto-oncogene 2"""	611977				11402041	Standard	NM_022839		Approved	FLJ23406, HCC-2, FLJ22512	uc002bml.3	P82912	OTTHUMG00000148678	ENST00000325844.4:c.-260C>T	15.37:g.89010689C>T			24	0	0		12	0.25	3	.	0		0	B2RD52|Q969D7|Q96GI3|Q9BYC3	Missense_Mutation	SNP	ENST00000325844.4	37	CCDS10342.1																																																																																					0.567	MRPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309067.2		NM_022839	
FAM173A	65990	mdanderson.org	37	16	771841	771841	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr16:771841G>T	ENST00000569529.1	+	3	608	c.308G>T	c.(307-309)gGc>gTc	p.G103V	FAM173A_ENST00000219535.3_Missense_Mutation_p.G103V|FAM173A_ENST00000564000.1_Missense_Mutation_p.G103V	NM_023933.2	NP_076422.1	Q9BQD7	F173A_HUMAN	family with sequence similarity 173, member A	103						integral component of membrane (GO:0016021)				pancreas(1)	1						CCGGCCGTGGGCTACGAGCTG	0.731																																					p.G103V													.	.			0			c.G308T												4.0	7.0	6.0					16																	771841		1977	3971	5948	SO:0001583	missense	65990	exon3			CCGTGGGCTACGA	BC002624	CCDS10423.1, CCDS59254.1	16p13.3	2008-06-19	2008-06-19	2008-06-19	ENSG00000103254	ENSG00000103254			14152	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 24"""	C16orf24			Standard	NM_023933		Approved	MGC2494	uc002cje.4	Q9BQD7	OTTHUMG00000121177	ENST00000569529.1:c.308G>T	16.37:g.771841G>T	ENSP00000454380:p.Gly103Val		34	0	0		14	0.14	2	NM_023933	66	0.00	0	A2IDD4	Missense_Mutation	SNP	ENST00000569529.1	37	CCDS10423.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.007788	0.93287	.	.	ENSG00000103254	ENST00000219535	T	0.53423	0.62	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.79747	0.4499	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87106	0.2182	10	0.87932	D	0	-26.6381	17.0755	0.86585	0.0:0.0:1.0:0.0	.	103	Q9BQD7	F173A_HUMAN	V	103	ENSP00000219535:G103V	ENSP00000219535:G103V	G	+	2	0	FAM173A	711842	1.000000	0.71417	0.985000	0.45067	0.792000	0.44763	9.582000	0.98214	2.368000	0.80403	0.561000	0.74099	GGC			0.731	FAM173A-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000241667.2		NM_023933	
GRIN2A	2903	hgsc.bcm.edu	37	16	9862936	9862936	+	Silent	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr16:9862936C>T	ENST00000396573.2	-	13	2676	c.2367G>A	c.(2365-2367)gaG>gaA	p.E789E	GRIN2A_ENST00000330684.3_Silent_p.E789E|GRIN2A_ENST00000562109.1_Silent_p.E789E|GRIN2A_ENST00000535259.1_Silent_p.E632E|GRIN2A_ENST00000396575.2_Silent_p.E789E|GRIN2A_ENST00000404927.2_Silent_p.E789E	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	789					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCTCCAGCTCCTCCATCTCAC	0.542																																					p.E789E													.	.			0			c.G2367A												97.0	82.0	87.0					16																	9862936		2197	4300	6497	SO:0001819	synonymous_variant	2903	exon13			CAGCTCCTCCATC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2367G>A	16.37:g.9862936C>T			80	0	0		85	0.05	4	NM_000833	0		0	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	37	CCDS10539.1																																																																																					0.542	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251930.3			
GRIN2A	2903	mdanderson.org	37	16	9916124	9916124	+	Missense_Mutation	SNP	G	G	T	rs376029542		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr16:9916124G>T	ENST00000396573.2	-	11	2474	c.2165C>A	c.(2164-2166)aCg>aAg	p.T722K	GRIN2A_ENST00000330684.3_Missense_Mutation_p.T722K|GRIN2A_ENST00000562109.1_Missense_Mutation_p.T722K|GRIN2A_ENST00000535259.1_Missense_Mutation_p.T565K|GRIN2A_ENST00000396575.2_Missense_Mutation_p.T722K|GRIN2A_ENST00000404927.2_Missense_Mutation_p.T722K	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	722					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCCTTACCCCGTTTTCAGGCT	0.468																																					p.T722K													.	.			0			c.C2165A												155.0	138.0	144.0					16																	9916124		2197	4300	6497	SO:0001583	missense	2903	exon10			TACCCCGTTTTCA		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2165C>A	16.37:g.9916124G>T	ENSP00000379818:p.Thr722Lys		109	0	0		99	0.05	5	NM_001134407	0		0	O00669|Q17RZ6	Missense_Mutation	SNP	ENST00000396573.2	37	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.717945	0.89205	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.65	5.65	0.86999	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.045738	0.85682	D	0.000000	T	0.29684	0.0741	N	0.11818	0.18	0.58432	D	0.999991	B;P;B	0.35656	0.298;0.514;0.407	B;B;B	0.28011	0.075;0.085;0.035	T	0.09729	-1.0661	9	.	.	.	.	18.7287	0.91726	0.0:0.0:1.0:0.0	.	565;722;722	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	K	722;722;565;722;722	ENSP00000379818:T722K;ENSP00000385872:T722K;ENSP00000441572:T565K;ENSP00000332549:T722K;ENSP00000379820:T722K	.	T	-	2	0	GRIN2A	9823625	1.000000	0.71417	0.853000	0.33588	0.902000	0.53008	5.408000	0.66368	2.655000	0.90218	0.655000	0.94253	ACG			0.468	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251930.3			
RBL2	5934	mdanderson.org	37	16	53495691	53495691	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr16:53495691G>T	ENST00000262133.6	+	10	1522	c.1385G>T	c.(1384-1386)aGa>aTa	p.R462I	RBL2_ENST00000544545.1_Missense_Mutation_p.R246I|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	462	Domain A.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						ATTGCTAACAGACTGAAAGAA	0.348																																					p.R462I													RBL2,NS,carcinoma,-1,2	RBL2	-1	2	0			c.G1385T												120.0	114.0	116.0					16																	53495691		2198	4299	6497	SO:0001583	missense	5934	exon10			CTAACAGACTGAA	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.1385G>T	16.37:g.53495691G>T	ENSP00000262133:p.Arg462Ile		90	0	0		96	0.05	5	NM_005611	6	0.00	0	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	37	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	G	12.92	2.082720	0.36758	.	.	ENSG00000103479	ENST00000262133;ENST00000544405;ENST00000379935;ENST00000544545	D;D;D	0.89343	-2.5;-2.5;-2.5	6.07	6.07	0.98685	Retinoblastoma-associated protein, A-box (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	D	0.93406	0.7897	L	0.56280	1.765	0.80722	D	1	D;P;P;D	0.89917	1.0;0.846;0.877;1.0	D;P;P;D	0.91635	0.999;0.679;0.678;0.999	D	0.91334	0.5092	10	0.36615	T	0.2	-20.3453	20.6593	0.99626	0.0:0.0:1.0:0.0	.	246;462;172;462	B7Z913;Q8NE70;E9PG04;Q08999	.;.;.;RBL2_HUMAN	I	462;388;172;246	ENSP00000262133:R462I;ENSP00000443744:R388I;ENSP00000444685:R246I	ENSP00000262133:R462I	R	+	2	0	RBL2	52053192	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.810000	0.91950	2.885000	0.99019	0.655000	0.94253	AGA			0.348	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256908.3		NM_005611	
NLGN2	57555	mdanderson.org	37	17	7320871	7320871	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:7320871G>T	ENST00000302926.2	+	7	2334	c.2261G>T	c.(2260-2262)gGg>gTg	p.G754V	NLGN2_ENST00000575301.1_Missense_Mutation_p.G754V|RP11-104H15.7_ENST00000575310.1_RNA|SPEM1_ENST00000323675.3_5'Flank	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	754					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GGTGGCGTCGGGGCGGACCCT	0.766																																					p.G754V													.	.			0			c.G2261T												5.0	5.0	5.0					17																	7320871		1960	3904	5864	SO:0001583	missense	57555	exon7			GCGTCGGGGCGGA	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.2261G>T	17.37:g.7320871G>T	ENSP00000305288:p.Gly754Val		11	0	0		18	0.11	2	NM_020795	14	0.00	0	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	37	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	G	12.09	1.832898	0.32421	.	.	ENSG00000169992	ENST00000302926	T	0.66099	-0.19	3.42	3.42	0.39159	.	0.000000	0.39687	U	0.001291	T	0.47154	0.1430	L	0.29908	0.895	0.54753	D	0.99998	B	0.28552	0.215	B	0.25987	0.065	T	0.49331	-0.8951	10	0.44086	T	0.13	.	10.5035	0.44819	0.0:0.0:1.0:0.0	.	754	Q8NFZ4	NLGN2_HUMAN	V	754	ENSP00000305288:G754V	ENSP00000305288:G754V	G	+	2	0	NLGN2	7261595	0.999000	0.42202	0.985000	0.45067	0.822000	0.46500	2.546000	0.45778	1.904000	0.55121	0.448000	0.29417	GGG			0.766	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226941.2		NM_020795	
WRAP53	55135	mdanderson.org	37	17	7606607	7606607	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:7606607G>T	ENST00000316024.5	+	10	3798	c.1450G>T	c.(1450-1452)Gtg>Ttg	p.V484L	EFNB3_ENST00000226091.2_5'Flank|WRAP53_ENST00000534050.1_Missense_Mutation_p.V451L|WRAP53_ENST00000457584.2_Missense_Mutation_p.V484L|WRAP53_ENST00000396463.2_Missense_Mutation_p.V484L|WRAP53_ENST00000431639.2_Missense_Mutation_p.V484L			Q9BUR4	WAP53_HUMAN	WD repeat containing, antisense to TP53	484					positive regulation of telomerase activity (GO:0051973)|telomere formation via telomerase (GO:0032203)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(2)	18						CGGTCAGCGTGTGTTTCCTGA	0.622																																					p.V484L													.	.			0			c.G1450T												77.0	68.0	71.0					17																	7606607		2203	4300	6503	SO:0001583	missense	55135	exon11			CAGCGTGTGTTTC	AK001247, DQ431240	CCDS11119.1	17p13.1	2014-09-17	2009-02-16	2009-02-16	ENSG00000141499	ENSG00000141499		"""WD repeat domain containing"""	25522	protein-coding gene	gene with protein product	"""telomerase cajal body protein 1"", ""WD-encoding RNA antisense to p53"""	612661	"""WD repeat domain 79"""	WDR79		19179534, 19250907, 19571673, 19342896, 20494116, 21441950	Standard	NM_018081		Approved	FLJ10385, TCAB1	uc010vuh.2	Q9BUR4	OTTHUMG00000134323	ENST00000316024.5:c.1450G>T	17.37:g.7606607G>T	ENSP00000324203:p.Val484Leu		33	0	0		41	0.07	3	NM_001143991	258	0.00	0	B3KPR9|D3DTQ4|Q08ET9|Q9NW09	Missense_Mutation	SNP	ENST00000316024.5	37	CCDS11119.1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545682	0.45280	.	.	ENSG00000141499	ENST00000431639;ENST00000316024;ENST00000457584;ENST00000396463;ENST00000534050	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.79	5.45	3.45	0.39498	.	0.537635	0.18456	N	0.140692	T	0.38321	0.1036	L	0.52364	1.645	0.32685	N	0.515003	B;B	0.14805	0.011;0.011	B;B	0.10450	0.005;0.003	T	0.41484	-0.9506	10	0.26408	T	0.33	-7.0949	8.0196	0.30402	0.2519:0.0:0.7481:0.0	.	451;484	E9PMG4;Q9BUR4	.;WAP53_HUMAN	L	484;484;484;484;451	ENSP00000397219:V484L;ENSP00000324203:V484L;ENSP00000411061:V484L;ENSP00000379727:V484L;ENSP00000434999:V451L	ENSP00000324203:V484L	V	+	1	0	WRAP53	7547332	0.867000	0.29959	0.986000	0.45419	0.989000	0.77384	0.973000	0.29422	0.789000	0.33779	0.549000	0.68633	GTG			0.622	WRAP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000259385.2		NM_018081	
LRRC48	83450	broad.mit.edu	37	17	17897710	17897710	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:17897710G>T	ENST00000399187.1	+	7	907	c.689G>T	c.(688-690)cGg>cTg	p.R230L	LRRC48_ENST00000584166.1_Missense_Mutation_p.R230L|LRRC48_ENST00000399182.1_Missense_Mutation_p.R230L|LRRC48_ENST00000411504.2_Missense_Mutation_p.R230L|LRRC48_ENST00000313838.8_Missense_Mutation_p.R230L	NM_031294.3	NP_112584.3	Q9H069	LRC48_HUMAN	leucine rich repeat containing 48	230						cytoplasm (GO:0005737)				breast(1)|large_intestine(2)|lung(2)|pancreas(1)|urinary_tract(1)	7	all_neural(463;0.228)					CAGGCGCAGCGGGAGGAGCTA	0.607											OREG0024221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R230L													.	LRRC48	49		0			c.G689T												31.0	47.0	41.0					17																	17897710		2081	4141	6222	SO:0001583	missense	83450	exon7			CGCAGCGGGAGGA	AK093317	CCDS45622.1, CCDS45623.1	17p11.2	2014-07-18			ENSG00000171962	ENSG00000171962			25384	protein-coding gene	gene with protein product						11997338, 23354437	Standard	NM_001130090		Approved	DKFZP586M1120	uc021trk.1	Q9H069	OTTHUMG00000059355	ENST00000399187.1:c.689G>T	17.37:g.17897710G>T	ENSP00000382140:p.Arg230Leu		38	0	0	721	63	0.05	3	NM_031294	0		0	A8KAE6|Q86SF9|Q86W73|Q8IWG0	Missense_Mutation	SNP	ENST00000399187.1	37	CCDS45622.1	.	.	.	.	.	.	.	.	.	.	G	9.447	1.089467	0.20390	.	.	ENSG00000171962	ENST00000313838;ENST00000448396;ENST00000411504;ENST00000399184;ENST00000399187;ENST00000399182;ENST00000399185	T;T;T;T	0.52754	0.65;0.77;0.65;0.77	4.31	-8.41	0.00961	.	1.135860	0.06425	N	0.723025	T	0.30947	0.0781	L	0.33485	1.01	0.09310	N	1	B;B	0.21753	0.023;0.06	B;B	0.20955	0.009;0.032	T	0.20338	-1.0278	10	0.20519	T	0.43	-4.7332	11.2475	0.49006	0.6991:0.0:0.207:0.0938	.	230;230	Q9H069;Q9H069-2	LRC48_HUMAN;.	L	230	ENSP00000326870:R230L;ENSP00000394020:R230L;ENSP00000382140:R230L;ENSP00000382136:R230L	ENSP00000326870:R230L	R	+	2	0	LRRC48	17838435	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.681000	0.05191	-1.792000	0.01259	-1.598000	0.00824	CGG			0.607	LRRC48-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131945.3		NM_031294	
KRTAP4-3	85290	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	39323995	39323995	+	Missense_Mutation	SNP	A	A	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:39323995A>C	ENST00000391356.2	-	1	429	c.430T>G	c.(430-432)Tgc>Ggc	p.C144G		NM_033187.1	NP_149443.1	Q9BYR4	KRA43_HUMAN	keratin associated protein 4-3	144	29 X 5 AA repeats of C-C-[GIKRQVH]-[SPT]- [STA].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	12		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			GGCTGGCAGCACTGGGGCCTG	0.632																																					p.C144G													.	KRTAP4-3	40		0			c.T430G												16.0	20.0	19.0					17																	39323995		2122	4254	6376	SO:0001583	missense	85290	exon1			GGCAGCACTGGGG	AJ406935	CCDS42331.1	17q21.2	2013-06-25			ENSG00000196156	ENSG00000196156		"""Keratin associated proteins"""	18908	protein-coding gene	gene with protein product							Standard	NM_033187		Approved	KAP4.3	uc010cxl.3	Q9BYR4	OTTHUMG00000133639	ENST00000391356.2:c.430T>G	17.37:g.39323995A>C	ENSP00000375151:p.Cys144Gly		157	0.0063694268	1		177	0.05	9	NM_033187	0		0		Missense_Mutation	SNP	ENST00000391356.2	37	CCDS42331.1	.	.	.	.	.	.	.	.	.	.	.	11.26	1.586221	0.28268	.	.	ENSG00000196156	ENST00000391356	T	0.02552	4.25	2.86	2.86	0.33363	.	.	.	.	.	T	0.18045	0.0433	H	0.94886	3.595	0.24556	N	0.993995	D	0.69078	0.997	D	0.63113	0.911	T	0.04767	-1.0928	9	0.72032	D	0.01	.	9.4336	0.38626	1.0:0.0:0.0:0.0	.	144	Q9BYR4	KRA43_HUMAN	G	144	ENSP00000375151:C144G	ENSP00000375151:C144G	C	-	1	0	KRTAP4-3	36577521	0.979000	0.34478	0.036000	0.18154	0.007000	0.05969	3.542000	0.53625	1.233000	0.43693	0.383000	0.25322	TGC			0.632	KRTAP4-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257784.1			
DNAH17	8632	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	76556825	76556825	+	Silent	SNP	T	T	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:76556825T>C	ENST00000585328.1	-	13	2152	c.2028A>G	c.(2026-2028)aaA>aaG	p.K676K	DNAH17_ENST00000389840.5_Silent_p.K676K	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	676	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CACCCACCGCTTTGCTGAAGT	0.632																																					p.K676K													.	DNAH17	347		0			c.A2028G												41.0	29.0	33.0					17																	76556825		2109	4092	6201	SO:0001819	synonymous_variant	8632	exon13			CACCGCTTTGCTG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.2028A>G	17.37:g.76556825T>C			68	0.0588235294	4		80	0.06	5	NM_173628	0		0	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	37																																																																																						0.632	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000318962.2		NM_173628	
FN3KRP	79672	broad.mit.edu	37	17	80680735	80680735	+	Silent	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr17:80680735G>T	ENST00000269373.6	+	4	514	c.441G>T	c.(439-441)gtG>gtT	p.V147V	FN3KRP_ENST00000535965.1_Silent_p.V97V	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	147							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			GATTTGACGTGGTGACGTGCT	0.542																																					p.V147V													FN3KRP,NS,carcinoma,+2,1	FN3KRP	31	1	0			c.G441T												219.0	183.0	195.0					17																	80680735		2203	4300	6503	SO:0001819	synonymous_variant	79672	exon4			TGACGTGGTGACG	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.441G>T	17.37:g.80680735G>T			246	0	0		324	0.02	6	NM_024619	172	0.00	0	Q969F4|Q9H0U7	Silent	SNP	ENST00000269373.6	37	CCDS11817.1																																																																																					0.542	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000439219.1		NM_024619	
OR7G3	390883	mdanderson.org	37	19	9237191	9237191	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:9237191G>T	ENST00000305444.2	-	1	435	c.436C>A	c.(436-438)Ctg>Atg	p.L146M		NM_001001958.1	NP_001001958.1	Q8NG95	OR7G3_HUMAN	olfactory receptor, family 7, subfamily G, member 3	146						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	15						AAGGACAGCAGAAGCAGCAGC	0.498																																					p.L146M													.	.			0			c.C436A												75.0	72.0	73.0					19																	9237191		2203	4300	6503	SO:0001583	missense	390883	exon1			ACAGCAGAAGCAG		CCDS32899.1	19p13.2	2013-09-24			ENSG00000170920	ENSG00000170920		"""GPCR / Class A : Olfactory receptors"""	8467	protein-coding gene	gene with protein product							Standard	NM_001001958		Approved	OST085	uc010xkl.2	Q8NG95	OTTHUMG00000165520	ENST00000305444.2:c.436C>A	19.37:g.9237191G>T	ENSP00000302867:p.Leu146Met		113	0.0088495575	1		89	0.04	4	NM_001001958	0		0	Q6IFJ6|Q96R99	Missense_Mutation	SNP	ENST00000305444.2	37	CCDS32899.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.072380	0.36566	.	.	ENSG00000170920	ENST00000305444	T	0.41758	0.99	3.84	1.61	0.23674	GPCR, rhodopsin-like superfamily (1);	0.873437	0.09263	U	0.826162	T	0.60573	0.2279	M	0.78223	2.4	0.09310	N	1	D	0.89917	1.0	D	0.67900	0.954	T	0.43410	-0.9393	10	0.72032	D	0.01	.	7.3387	0.26625	0.0991:0.3265:0.5744:0.0	.	146	Q8NG95	OR7G3_HUMAN	M	146	ENSP00000302867:L146M	ENSP00000302867:L146M	L	-	1	2	OR7G3	9098191	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.846000	0.04336	0.948000	0.37687	0.551000	0.68910	CTG			0.498	OR7G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384611.1			
CCDC151	115948	mdanderson.org	37	19	11532404	11532404	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:11532404G>T	ENST00000356392.4	-	11	1618	c.1531C>A	c.(1531-1533)Cag>Aag	p.Q511K	CCDC151_ENST00000545100.1_Missense_Mutation_p.Q457K|CCDC151_ENST00000591179.1_Missense_Mutation_p.Q451K|RGL3_ENST00000393423.3_5'Flank|RGL3_ENST00000380456.3_5'Flank|CCDC151_ENST00000586836.1_Missense_Mutation_p.Q320K	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	511										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						AGCTGCGCCTGCAGTTTCAGC	0.627																																					p.Q511K													.	.			0			c.C1531A												76.0	81.0	79.0					19																	11532404		2010	4171	6181	SO:0001583	missense	115948	exon11			GCGCCTGCAGTTT		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.1531C>A	19.37:g.11532404G>T	ENSP00000348757:p.Gln511Lys		157	0	0		133	0.04	5	NM_145045	7	0.00	0	B4DXT0|Q96CG5	Missense_Mutation	SNP	ENST00000356392.4	37	CCDS42501.1	.	.	.	.	.	.	.	.	.	.	G	1.359	-0.589197	0.03799	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	T;T	0.14391	2.51;2.72	3.94	3.94	0.45596	.	0.493295	0.18915	N	0.127650	T	0.11239	0.0274	L	0.48362	1.52	0.26939	N	0.966283	P;P;P	0.41848	0.763;0.763;0.763	B;B;B	0.39840	0.311;0.311;0.311	T	0.07195	-1.0785	10	0.06099	T	0.92	-20.6107	11.3439	0.49548	0.0:0.0:1.0:0.0	.	511;511;491	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	K	457;511;490	ENSP00000442987:Q457K;ENSP00000348757:Q511K	ENSP00000348757:Q511K	Q	-	1	0	CCDC151	11393404	0.788000	0.28762	0.972000	0.41901	0.113000	0.19764	2.546000	0.45778	2.043000	0.60533	0.561000	0.74099	CAG			0.627	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458800.1		NM_145045	
ZNF439	90594	hgsc.bcm.edu	37	19	11978338	11978338	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:11978338G>T	ENST00000304030.2	+	3	654	c.454G>T	c.(454-456)Gaa>Taa	p.E152*	ZNF439_ENST00000592534.1_Intron|ZNF439_ENST00000455282.1_Nonsense_Mutation_p.E16*	NM_152262.2	NP_689475.1	Q8NDP4	ZN439_HUMAN	zinc finger protein 439	152					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(7)|pancreas(1)|skin(2)	27						TGAATGTCAGGAATATGGACC	0.428																																					p.E152X													.	.			0			c.G454T												192.0	180.0	184.0					19																	11978338		2203	4300	6503	SO:0001587	stop_gained	90594	exon3			TGTCAGGAATATG	AL833935	CCDS12268.1	19p13.13	2013-01-08			ENSG00000171291	ENSG00000171291		"""Zinc fingers, C2H2-type"", ""-"""	20873	protein-coding gene	gene with protein product							Standard	NM_152262		Approved	DKFZp571K0837	uc002mss.3	Q8NDP4	OTTHUMG00000156527	ENST00000304030.2:c.454G>T	19.37:g.11978338G>T	ENSP00000305077:p.Glu152*		109	0	0		123	0.04	5	NM_152262	6	0.00	0	Q8IYZ7|Q96SU1	Nonsense_Mutation	SNP	ENST00000304030.2	37	CCDS12268.1	.	.	.	.	.	.	.	.	.	.	g	12.82	2.053313	0.36181	.	.	ENSG00000171291	ENST00000455282;ENST00000304030	.	.	.	0.457	-0.786	0.10946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.7549	0.13078	0.4834:0.0:0.5166:0.0	.	.	.	.	X	16;152	.	ENSP00000305077:E152X	E	+	1	0	ZNF439	11839338	0.065000	0.20965	0.003000	0.11579	0.029000	0.11900	-1.552000	0.02176	-0.378000	0.07918	0.194000	0.17425	GAA			0.428	ZNF439-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000344513.1			
ANO8	57719	mdanderson.org	37	19	17435612	17435612	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:17435612C>T	ENST00000159087.4	-	17	3403	c.3245G>A	c.(3244-3246)gGc>gAc	p.G1082D		NM_020959.2	NP_066010.1	Q9HCE9	ANO8_HUMAN	anoctamin 8	1082					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			autonomic_ganglia(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(3)	27						CCGGCTGCTGCCACTGCTGGG	0.687																																					p.G1082D													.	.			0			c.G3245A												22.0	29.0	27.0					19																	17435612		2179	4259	6438	SO:0001583	missense	57719	exon17			CTGCTGCCACTGC	AB046843	CCDS32949.1	19p13.12	2014-04-09	2008-08-28	2008-08-28		ENSG00000074855		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	29329	protein-coding gene	gene with protein product		610216	"""KIAA1623"", ""transmembrane protein 16H"""	KIAA1623, TMEM16H		10997877, 24692353	Standard	NM_020959		Approved		uc002ngf.2	Q9HCE9		ENST00000159087.4:c.3245G>A	19.37:g.17435612C>T	ENSP00000159087:p.Gly1082Asp		67	0	0		52	0.08	4	NM_020959	8	0.00	0	A6NIJ0	Missense_Mutation	SNP	ENST00000159087.4	37	CCDS32949.1	.	.	.	.	.	.	.	.	.	.	C	7.563	0.665185	0.14710	.	.	ENSG00000074855	ENST00000159087	T	0.64618	-0.11	2.01	2.01	0.26516	.	0.777035	0.10805	U	0.632245	T	0.39145	0.1067	N	0.14661	0.345	0.09310	N	1	B	0.30482	0.281	B	0.22753	0.041	T	0.11591	-1.0581	10	0.15952	T	0.53	.	10.0497	0.42208	0.0:1.0:0.0:0.0	.	1082	Q9HCE9	ANO8_HUMAN	D	1082	ENSP00000159087:G1082D	ENSP00000159087:G1082D	G	-	2	0	ANO8	17296612	0.000000	0.05858	0.012000	0.15200	0.358000	0.29455	0.272000	0.18644	1.445000	0.47624	0.297000	0.19635	GGC			0.687	ANO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462943.1		XM_050644	
JAK3	3718	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	17945938	17945938	+	Silent	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:17945938G>A	ENST00000527670.1	-	14	2030	c.2001C>T	c.(1999-2001)atC>atT	p.I667I	JAK3_ENST00000458235.1_Silent_p.I667I|JAK3_ENST00000534444.1_Silent_p.I667I			P52333	JAK3_HUMAN	Janus kinase 3	667	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CACTCAGCTTGATGAAGGGCG	0.637		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.I667I				Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	.			0			c.C2001T												54.0	52.0	53.0					19																	17945938		2203	4300	6503	SO:0001819	synonymous_variant	3718	exon15			CAGCTTGATGAAG	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2001C>T	19.37:g.17945938G>A			132	0	0		112	0.16	18	NM_000215	9	0.00	0	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Silent	SNP	ENST00000527670.1	37	CCDS12366.1																																																																																					0.637	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385549.1		NM_000215	
ZNF792	126375	broad.mit.edu	37	19	35454540	35454540	+	Silent	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:35454540G>T	ENST00000404801.1	-	1	413	c.27C>A	c.(25-27)ccC>ccA	p.P9P	ZNF792_ENST00000605484.1_5'Flank	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	9					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TCACCTGCGCGGGGTCCCGCA	0.652																																					p.P9P	GBM(1;7 183 21053 22581 22847)												.	ZNF792	46		0			c.C27A												12.0	18.0	16.0					19																	35454540		1980	4141	6121	SO:0001819	synonymous_variant	126375	exon1			CTGCGCGGGGTCC	AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.27C>A	19.37:g.35454540G>T			228	0.0043859649	1		224	0.02	5	NM_175872	0		0	B4E333|Q495L1|Q495L3|Q8N932	Silent	SNP	ENST00000404801.1	37	CCDS12440.2																																																																																					0.652	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317673.1		NM_175872	
FFAR1	2864	mdanderson.org	37	19	35842505	35842505	+	Silent	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:35842505G>T	ENST00000246553.2	+	1	61	c.51G>T	c.(49-51)gcG>gcT	p.A17A		NM_005303.2	NP_005294.1	O14842	FFAR1_HUMAN	free fatty acid receptor 1	17					energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|insulin secretion (GO:0030073)|positive regulation of GTPase activity (GO:0043547)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;4.58e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.67e-19)|all cancers(14;2.01e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)		Icosapent(DB00159)	CCGCCTTTGCGCTGGGCTTCC	0.706																																					p.A17A													.	.			0			c.G51T												15.0	11.0	12.0					19																	35842505		2118	4148	6266	SO:0001819	synonymous_variant	2864	exon1			CTTTGCGCTGGGC	AF024687	CCDS12458.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000126266	ENSG00000126266		"""GPCR / Class A : Fatty acid receptors"""	4498	protein-coding gene	gene with protein product		603820	"""G protein-coupled receptor 40"""	GPR40		15684720	Standard	NM_005303		Approved	FFA1R	uc002nzc.2	O14842		ENST00000246553.2:c.51G>T	19.37:g.35842505G>T			29	0	0		22	0.09	2	NM_005303	0		0	Q0VAS2|Q4VBL4	Silent	SNP	ENST00000246553.2	37	CCDS12458.1																																																																																					0.706	FFAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466112.2		NM_005303	
SCAF1	58506	mdanderson.org	37	19	50161566	50161566	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr19:50161566G>T	ENST00000360565.3	+	11	3973	c.3849G>T	c.(3847-3849)aaG>aaT	p.K1283N	IRF3_ENST00000599680.1_5'Flank	NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	1283	Necessary for interaction with the CTD domain of POLR2A.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		ACGGTCGCAAGCCAGGGGACC	0.692																																					p.K1283N													.	.			0			c.G3849T												14.0	14.0	14.0					19																	50161566		2197	4294	6491	SO:0001583	missense	58506	exon11			TCGCAAGCCAGGG	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.3849G>T	19.37:g.50161566G>T	ENSP00000353769:p.Lys1283Asn		31	0	0		34	0.09	3	NM_021228	271	0.00	0	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	37	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.089051	0.36855	.	.	ENSG00000126461	ENST00000360565	T	0.35973	1.28	4.7	2.51	0.30379	.	0.000000	0.40908	D	0.000995	T	0.42359	0.1199	L	0.27053	0.805	0.33977	D	0.647491	D	0.89917	1.0	D	0.74348	0.983	T	0.56038	-0.8045	10	0.62326	D	0.03	-24.6167	10.2851	0.43562	0.1702:0.0:0.8298:0.0	.	1283	Q9H7N4	SFR19_HUMAN	N	1283	ENSP00000353769:K1283N	ENSP00000353769:K1283N	K	+	3	2	SCAF1	54853378	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.186000	0.32078	1.204000	0.43247	0.655000	0.94253	AAG			0.692	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465764.1		NM_021228	
KCNK3	3777	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	26950833	26950833	+	Silent	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr2:26950833C>T	ENST00000302909.3	+	2	707	c.582C>T	c.(580-582)ttC>ttT	p.F194F		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	194					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	ACTACTGCTTCATCACCCTCA	0.612																																					p.F194F	GBM(80;1457 1631 27100 45946)												.	.			0			c.C582T												71.0	63.0	66.0					2																	26950833		2203	4300	6503	SO:0001819	synonymous_variant	3777	exon2			CTGCTTCATCACC	AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.582C>T	2.37:g.26950833C>T			150	0	0		184	0.19	35	NM_002246	5	0.40	2	Q53SU2	Silent	SNP	ENST00000302909.3	37	CCDS1727.1																																																																																					0.612	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000246861.2		NM_002246	
C2orf81	388963	broad.mit.edu	37	2	74641573	74641573	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr2:74641573G>T	ENST00000517883.1	-	1	2137	c.1446C>A	c.(1444-1446)aaC>aaA	p.N482K	C2orf81_ENST00000290390.5_Missense_Mutation_p.N550K			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	543										endometrium(3)|kidney(1)	4						GGGTGCTCCGGTTCCACATGC	0.587																																					p.N550K													.	C2orf81	23		0			c.C1650A												79.0	77.0	77.0					2																	74641573		692	1591	2283	SO:0001583	missense	388963	exon4			GCTCCGGTTCCAC	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.1446C>A	2.37:g.74641573G>T	ENSP00000431103:p.Asn482Lys		225	0.0044444444	1		201	0.02	5	NM_001145054	19	0.00	0		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	G	13.02	2.113584	0.37339	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	4.97	0.73	0.18271	.	0.468858	0.19817	N	0.105407	T	0.35248	0.0925	M	0.64997	1.995	0.09310	N	1	B	0.32031	0.352	B	0.33750	0.169	T	0.29488	-1.0010	9	0.59425	D	0.04	-6.8347	4.6354	0.12521	0.1849:0.0:0.5111:0.304	.	550	G3XAA6	.	K	482;550	.	ENSP00000290390:N550K	N	-	3	2	C2orf81	74495081	0.558000	0.26554	0.093000	0.20910	0.152000	0.21847	1.226000	0.32563	0.264000	0.21851	0.655000	0.94253	AAC			0.587	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000377683.1		NM_001145054	
FER1L5	90342	broad.mit.edu;bcgsc.ca;mdanderson.org	37	2	97363297	97363297	+	RNA	SNP	A	A	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr2:97363297A>T	ENST00000457909.1	+	0	3621							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						TTCTGGTTCAAGTCCAGTAAA	0.552																																					p.K1400M													.	FER1L5	113		0			c.A4199T												48.0	49.0	49.0					2																	97363297		1952	4134	6086			90342	exon37			GGTTCAAGTCCAG	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		2.37:g.97363297A>T			285	0	0		287	0.03	9	NM_001113382	0		0	Q17RH2|Q6ZU24	RNA	SNP	ENST00000457909.1	37		.	.	.	.	.	.	.	.	.	.	A	4.670	0.124622	0.08931	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	3.5	2.35	0.29111	C2 calcium/lipid-binding domain, CaLB (1);	1947.010000	0.00531	U	0.000218	T	0.46190	0.1380	L	0.57536	1.79	.	.	.	B;B;B	0.18166	0.015;0.017;0.026	B;B;B	0.14023	0.004;0.003;0.01	T	0.21965	-1.0230	8	0.44086	T	0.13	4.8603	5.4845	0.16741	0.8722:0.0:0.1278:0.0	.	117;1400;118	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	M	1400;1414;118	.	ENSP00000442027:K118M	K	+	2	0	FER1L5	96727024	0.428000	0.25522	0.504000	0.27639	0.207000	0.24258	1.034000	0.30204	0.715000	0.32103	0.460000	0.39030	AAG			0.552	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene		OTTHUMT00000339030.1		NM_001077400	
RGPD4	285190	hgsc.bcm.edu	37	2	108443536	108443536	+	Missense_Mutation	SNP	C	C	G			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr2:108443536C>G	ENST00000408999.3	+	1	144	c.67C>G	c.(67-69)Cga>Gga	p.R23G	RGPD4_ENST00000354986.4_Missense_Mutation_p.R23G|AC096655.2_ENST00000457647.2_lincRNA	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	23					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						CCCGTCGCCTCGAAAGGTGAG	0.701																																					p.R23G													RGPD4,caecum,carcinoma,-1,1	RGPD4	-1	1	0			c.C67G												44.0	61.0	56.0					2																	108443536		692	1591	2283	SO:0001583	missense	285190	exon1			TCGCCTCGAAAGG	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.67C>G	2.37:g.108443536C>G	ENSP00000386810:p.Arg23Gly		133	0	0		116	0.03	4	NM_182588	0		0	B9A029	Missense_Mutation	SNP	ENST00000408999.3	37	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	-	0.319	-0.963323	0.02249	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.41065	1.01;1.01	2.33	1.42	0.22433	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.22666	0.0547	L	0.33485	1.01	0.09310	N	1	D	0.52996	0.957	B	0.30251	0.113	T	0.10109	-1.0644	9	0.51188	T	0.08	-2.4203	7.0687	0.25167	0.4799:0.5201:0.0:0.0	.	23	Q7Z3J3	RGPD4_HUMAN	G	23	ENSP00000347081:R23G;ENSP00000386810:R23G	ENSP00000347081:R23G	R	+	1	2	RGPD4	107809968	0.670000	0.27512	0.021000	0.16686	0.002000	0.02628	0.784000	0.26816	0.094000	0.17404	-1.276000	0.01395	CGA			0.701	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000330096.2		XM_496581	
WASH2P	375260	broad.mit.edu;bcgsc.ca	37	2	114355129	114355129	+	RNA	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr2:114355129G>A	ENST00000538033.2	+	0	2068							Q6VEQ5	WASH2_HUMAN	WAS protein family homolog 2 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										GAGTCCATCCGCCAAGCTGGG	0.657																																					.													.	.			0			.																																											0	.			CCATCCGCCAAGC			2q13	2010-07-08	2008-01-16	2008-01-16	ENSG00000146556	ENSG00000146556		"""WAS protein homologs"""	33145	pseudogene	pseudogene			"""family with sequence similarity 39, member B"""	FAM39B		18159949	Standard	NR_024077		Approved	MGC52000	uc002tkh.3	Q6VEQ5	OTTHUMG00000047822		2.37:g.114355129G>A			168	0.005952381	1		195	0.09	17	.	437	0.03	11		RNA	SNP	ENST00000538033.2	37																																																																																						0.657	WASH2P-002	KNOWN	mRNA_end_NF|basic	retained_intron	pseudogene		OTTHUMT00000467782.1		NM_198943	
TMX4	56255	broad.mit.edu	37	20	8000252	8000252	+	Silent	SNP	A	A	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr20:8000252A>C	ENST00000246024.2	-	1	224	c.9T>G	c.(7-9)ggT>ggG	p.G3G	RP5-971N18.3_ENST00000607924.1_RNA|RP5-971N18.3_ENST00000457707.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	3					cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CGCAGCGCCCACCCGCCATGT	0.761																																					p.G3G													.	TMX4	39		0			c.T9G												1.0	1.0	1.0					20																	8000252		958	2169	3127	SO:0001819	synonymous_variant	56255	exon1			GCGCCCACCCGCC		CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.9T>G	20.37:g.8000252A>C			39	0.4102564103	16		35	0.31	11	NM_021156	5	0.00	0	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Silent	SNP	ENST00000246024.2	37	CCDS13101.1																																																																																					0.761	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000077928.2		NM_021156	
FRG1B	284802	broad.mit.edu	37	20	29632635	29632635	+	Missense_Mutation	SNP	C	C	G	rs375238322		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr20:29632635C>G	ENST00000278882.3	+	8	830	c.450C>G	c.(448-450)gaC>gaG	p.D150E	FRG1B_ENST00000358464.4_Missense_Mutation_p.D150E			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B	150										endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						GCTTCCAAGACCACAAACTTA	0.294																																					.													.	FRG1B	181		0			.																																									SO:0001583	missense	0	.			CCAAGACCACAAA			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.450C>G	20.37:g.29632635C>G	ENSP00000278882:p.Asp150Glu		731	0	0		871	0.01	6	.	114	0.06	7	C4AME5	Missense_Mutation	SNP	ENST00000278882.3	37		.	.	.	.	.	.	.	.	.	.	c	14.68	2.606729	0.46527	.	.	ENSG00000149531	ENST00000278882;ENST00000358464	.	.	.	1.44	-0.392	0.12442	.	0.054733	0.64402	U	0.000001	T	0.48995	0.1531	.	.	.	0.40619	D	0.981745	P	0.47302	0.893	P	0.49085	0.6	T	0.42682	-0.9437	8	0.46703	T	0.11	.	5.1111	0.14809	0.0:0.6492:0.0:0.3508	.	150	Q9BZ01	FRG1B_HUMAN	E	150	.	ENSP00000278882:D150E	D	+	3	2	FRG1B	28246296	1.000000	0.71417	0.994000	0.49952	0.944000	0.59088	0.699000	0.25586	-0.105000	0.12132	0.398000	0.26397	GAC			0.294	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000078494.2	rescued with RNA-seq	NR_003579	
ELMO2	63916	hgsc.bcm.edu	37	20	45014804	45014804	+	Silent	SNP	G	G	A	rs201990540	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr20:45014804G>A	ENST00000290246.6	-	9	830	c.636C>T	c.(634-636)gcC>gcT	p.A212A	ELMO2_ENST00000439931.2_Silent_p.A212A|ELMO2_ENST00000352077.2_Silent_p.A210A|ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000396391.1_Silent_p.A212A|ELMO2_ENST00000372176.1_Silent_p.A124A|ELMO2_ENST00000445496.2_Silent_p.A29A	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	212					apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				TGATTTCCTCGGCTATCTTCT	0.527													g|||	3	0.000599042	0.0015	0.0014	5008	,	,		19968	0.0		0.0	False		,,,				2504	0.0				p.A212A													ELMO2,NS,carcinoma,-1,1	ELMO2	-1	1	0			c.C636T												135.0	124.0	128.0					20																	45014804		2203	4300	6503	SO:0001819	synonymous_variant	63916	exon8			TTCCTCGGCTATC	AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.636C>T	20.37:g.45014804G>A			77	0.025974026	2		79	0.08	6	NM_182764	16	0.00	0	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Silent	SNP	ENST00000290246.6	37	CCDS13398.1																																																																																			0.002		0.527	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080466.1		NM_022086	
HELZ2	85441	mdanderson.org	37	20	62191976	62191976	+	Silent	SNP	C	C	T	rs573860047		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr20:62191976C>T	ENST00000467148.1	-	16	7425	c.7356G>A	c.(7354-7356)agG>agA	p.R2452R	HELZ2_ENST00000427522.2_Silent_p.R1883R	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	2452	Interaction with THRAP3.				cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CACTGGGCGGCCTCCTCAGGC	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		15934	0.0		0.0	False		,,,				2504	0.001				p.R2452R													.	.			0			c.G7356A												64.0	67.0	66.0					20																	62191976		2203	4299	6502	SO:0001819	synonymous_variant	85441	exon17			GGGCGGCCTCCTC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.7356G>A	20.37:g.62191976C>T			43	0	0		44	0.09	4	NM_001037335	103	0.00	0	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	ENST00000467148.1	37	CCDS33508.1																																																																																					0.642	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000354127.1		NM_001037335	
KRTAP13-1	140258	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	21	31768921	31768921	+	Nonstop_Mutation	SNP	T	T	C	rs141793094		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr21:31768921T>C	ENST00000355459.2	+	1	530	c.517T>C	c.(517-519)Tga>Cga	p.*173R		NM_181599.2	NP_853630.2	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	0						intermediate filament (GO:0005882)				endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTCTACTATTGATCATCTTG	0.438																																					p.X173R													.	.			0			c.T517C							T	ARG/stop	0,4406		0,0,2203	37.0	36.0	36.0		517	1.2	0.0	21	dbSNP_134	36	1,8599	1.2+/-3.3	0,1,4299	yes	stop-lost	KRTAP13-1	NM_181599.2		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		173/173	31768921	1,13005	2203	4300	6503	SO:0001578	stop_lost	140258	exon1			TACTATTGATCAT	AJ457066	CCDS13590.2	21q22.11	2013-06-20			ENSG00000198390	ENSG00000198390		"""Keratin associated proteins"""	18924	protein-coding gene	gene with protein product		608718				12359730	Standard	NM_181599		Approved	KAP13.1	uc002yoa.3	Q8IUC0	OTTHUMG00000057800	ENST00000355459.2:c.517T>C	21.37:g.31768921T>C	ENSP00000347635:p.*173Argext*4		164	0	0		170	0.28	47	NM_181599	0		0	Q14D20|Q3LI79	Missense_Mutation	SNP	ENST00000355459.2	37	CCDS13590.2	.	.	.	.	.	.	.	.	.	.	T	9.393	1.076040	0.20227	0.0	1.16E-4	ENSG00000198390	ENST00000355459	.	.	.	5.2	1.2	0.21068	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.0449	0.03558	0.1529:0.0879:0.3163:0.4429	.	.	.	.	R	173	.	.	X	+	1	0	KRTAP13-1	30690792	0.000000	0.05858	0.024000	0.17045	0.348000	0.29142	0.145000	0.16157	0.469000	0.27268	0.528000	0.53228	TGA	0		0.438	KRTAP13-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128252.3			
HIRA	7290	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	19348846	19348846	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:19348846C>T	ENST00000263208.5	-	17	2255	c.1999G>A	c.(1999-2001)Gca>Aca	p.A667T	HIRA_ENST00000541063.1_Missense_Mutation_p.A623T|HIRA_ENST00000340170.4_Intron|HIRA_ENST00000546308.1_Missense_Mutation_p.A623T	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	667	Interaction with CCNA1.|Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					TCCTTCTCTGCGGTTAGGGCA	0.547																																					p.A667T													HIRA,NS,carcinoma,0,1	HIRA	0	1	0			c.G1999A												113.0	104.0	107.0					22																	19348846		2203	4300	6503	SO:0001583	missense	7290	exon17			TCTCTGCGGTTAG	X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.1999G>A	22.37:g.19348846C>T	ENSP00000263208:p.Ala667Thr		108	0	0		143	0.04	6	NM_003325	56	0.00	0	Q05BU9|Q8IXN2	Missense_Mutation	SNP	ENST00000263208.5	37	CCDS13759.1	.	.	.	.	.	.	.	.	.	.	C	4.020	0.001125	0.07819	.	.	ENSG00000100084	ENST00000263208;ENST00000541063;ENST00000539600;ENST00000546308	T;T;T	0.71341	-0.56;-0.41;-0.37	5.13	-2.35	0.06684	.	0.497292	0.21458	N	0.074206	T	0.36799	0.0980	N	0.24115	0.695	0.21878	N	0.999492	B;P	0.37997	0.007;0.614	B;B	0.25614	0.003;0.062	T	0.42275	-0.9461	10	0.13108	T	0.6	-0.0095	0.8245	0.01118	0.3467:0.2619:0.0989:0.2925	.	623;667	F5H4M2;P54198	.;HIRA_HUMAN	T	667;623;176;623	ENSP00000263208:A667T;ENSP00000446073:A623T;ENSP00000441870:A623T	ENSP00000263208:A667T	A	-	1	0	HIRA	17728846	0.012000	0.17670	0.037000	0.18230	0.146000	0.21551	0.101000	0.15251	-0.454000	0.07066	-0.266000	0.10368	GCA			0.547	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316488.2		NM_003325	
BMS1P20	96610	broad.mit.edu	37	22	22661474	22661474	+	RNA	SNP	C	C	T	rs537933406	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:22661474C>T	ENST00000426066.1	+	0	364					NR_027293.1				BMS1 pseudogene 20																		CCCTCAGATGCGTCTGAAGAA	0.493													.|||	30	0.00599042	0.0136	0.0029	5008	,	,		25183	0.0		0.002	False		,,,				2504	0.0082				.													.	.			0			.																																											0	.			CAGATGCGTCTGA			22q11.22	2013-09-20			ENSG00000236850	ENSG00000236850			49153	pseudogene	pseudogene							Standard	XR_430414		Approved				OTTHUMG00000151046		22.37:g.22661474C>T			77	0.012987013	1		118	0.05	6	.	96	0.00	0		RNA	SNP	ENST00000426066.1	37																																																																																						0.493	BMS1P20-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000473090.1			
ZNF280B	140883	mdanderson.org	37	22	22842206	22842206	+	Silent	SNP	T	T	A	rs11109	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:22842206T>A	ENST00000406426.1	-	4	2260	c.1518A>T	c.(1516-1518)tcA>tcT	p.S506S	ZNF280B_ENST00000360412.2_Silent_p.S506S			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	506					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GAGGTTCCAGTGACACTTGAA	0.423																																					p.S506S													.	.			0			c.A1518T												146.0	131.0	136.0					22																	22842206		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			TTCCAGTGACACT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1518A>T	22.37:g.22842206T>A			104	0	0		117	0.21	24	NM_080764	6	0.67	4		Silent	SNP	ENST00000406426.1	37	CCDS13799.1																																																																																					0.423	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000321170.2		NM_080764	
MTMR3	8897	broad.mit.edu;bcgsc.ca;mdanderson.org	37	22	30416630	30416630	+	Silent	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:30416630G>A	ENST00000401950.2	+	17	3324	c.2982G>A	c.(2980-2982)ctG>ctA	p.L994L	CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000351488.3_Silent_p.L994L|MTMR3_ENST00000323630.5_Silent_p.L858L|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000406629.1_Silent_p.L994L|MTMR3_ENST00000333027.3_Silent_p.L994L	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	994					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ACAAGTGGCTGCATAGCCACT	0.587																																					p.L994L													.	MTMR3	106		0			c.G2982A												68.0	53.0	58.0					22																	30416630		2203	4300	6503	SO:0001819	synonymous_variant	8897	exon17			GTGGCTGCATAGC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2982G>A	22.37:g.30416630G>A			123	0	0		135	0.04	6	NM_021090	34	0.00	0	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Silent	SNP	ENST00000401950.2	37	CCDS13870.1																																																																																					0.587	MTMR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000322066.1		NM_021090	
TNRC6B	23112	broad.mit.edu	37	22	40658045	40658045	+	Missense_Mutation	SNP	C	C	A	rs541448431	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:40658045C>A	ENST00000454349.2	+	4	536	c.325C>A	c.(325-327)Cag>Aag	p.Q109K	TNRC6B_ENST00000301923.9_Missense_Mutation_p.Q145K|TNRC6B_ENST00000402203.1_Missense_Mutation_p.Q145K|TNRC6B_ENST00000335727.9_Missense_Mutation_p.Q109K	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	109	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						AAAACGTGGGCAGCCCCCTCC	0.647													C|||	13	0.00259585	0.0008	0.0	5008	,	,		14723	0.0089		0.001	False		,,,				2504	0.002				p.Q145K													.	TNRC6B	195		0			c.C433A												18.0	22.0	21.0					22																	40658045		2059	4162	6221	SO:0001583	missense	23112	exon7			CGTGGGCAGCCCC	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.325C>A	22.37:g.40658045C>A	ENSP00000401946:p.Gln109Lys		219	0.0091324201	2		175	0.03	6	NM_001024843	3	0.00	0	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	ENST00000454349.2	37	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	C	35	5.587389	0.96590	.	.	ENSG00000100354	ENST00000301923;ENST00000402203;ENST00000454349;ENST00000400140;ENST00000335727	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.48660	0.1512	L	0.56199	1.76	0.58432	D	0.999999	D;D;P	0.63880	0.993;0.99;0.901	P;P;B	0.56216	0.714;0.794;0.399	T	0.35251	-0.9796	10	0.62326	D	0.03	-0.4627	20.5373	0.99239	0.0:1.0:0.0:0.0	.	109;109;145	Q9UPQ9;Q9UPQ9-1;Q9UPQ9-2	TNR6B_HUMAN;.;.	K	145;145;109;109;109	ENSP00000306759:Q145K;ENSP00000384795:Q145K;ENSP00000401946:Q109K;ENSP00000338371:Q109K	ENSP00000306759:Q145K	Q	+	1	0	TNRC6B	38987991	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.857000	0.98124	0.650000	0.86243	CAG			0.647	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding					
DENND6B	414918	mdanderson.org	37	22	50752284	50752284	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr22:50752284G>T	ENST00000413817.3	-	14	1233	c.1162C>A	c.(1162-1164)Cac>Aac	p.H388N	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	388					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										CGGTGGAGGTGGGCCGTGTAA	0.672																																					p.H388N													.	.			0			c.C1162A												33.0	38.0	37.0					22																	50752284		2069	4202	6271	SO:0001583	missense	414918	exon14			GGAGGTGGGCCGT	AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1162C>A	22.37:g.50752284G>T	ENSP00000391524:p.His388Asn		66	0	0		43	0.07	3	NM_001001794	31	0.00	0	A6X8I5	Missense_Mutation	SNP	ENST00000413817.3	37	CCDS46732.1	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452810	0.43531	.	.	ENSG00000205593	ENST00000413817	.	.	.	4.85	-1.9	0.07665	.	0.272209	0.41001	D	0.000971	T	0.16385	0.0394	N	0.14661	0.345	0.23943	N	0.996398	P;P	0.34909	0.475;0.475	B;B	0.29176	0.099;0.099	T	0.16541	-1.0399	9	0.48119	T	0.1	-11.564	9.4529	0.38736	0.5513:0.0:0.4487:0.0	.	388;388	Q8NEG7;C9JIV6	F116B_HUMAN;.	N	388	.	ENSP00000391524:H388N	H	-	1	0	FAM116B	49094856	0.996000	0.38824	0.980000	0.43619	0.587000	0.36485	1.086000	0.30853	-0.121000	0.11787	0.462000	0.41574	CAC			0.672	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316845.3		NM_001001794	
TPRXL	348825	broad.mit.edu	37	3	14105964	14105965	+	In_Frame_Ins	INS	-	-	AGC	rs138518200|rs142895893	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr3:14105964_14105965insAGC	ENST00000424053.1	+	3	835_836	c.288_289insAGC	c.(289-291)agc>AGCagc	p.97_97S>SS	TPRXL_ENST00000532753.1_Intron|TPRXL_ENST00000429201.1_In_Frame_Ins_p.97_97S>SS|TPRXL_ENST00000326972.8_In_Frame_Ins_p.97_97S>SS			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like	0	Ser-rich.									endometrium(1)	1						gtagcagctctagcagcagcag	0.678														1496	0.298722	0.1505	0.3473	5008	,	,		10201	0.4385		0.2982	False		,,,				2504	0.3211				.													.	TPRXL	10		0			.																																									SO:0001652	inframe_insertion	0	.			CAGCTCTAGCAGC	AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509	ENST00000424053.1:c.304_306dupAGC	3.37:g.14105971_14105973dupAGC	ENSP00000400448:p.Ser102dup		7	0	0		7	0.43	3	.	0		0	Q8NAM5	In_Frame_Ins	INS	ENST00000424053.1	37																																																																																						0.678	TPRXL-003	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000340436.1		NR_002223	
APEH	327	hgsc.bcm.edu;broad.mit.edu	37	3	49723603	49723603	+	IGR	SNP	G	G	A	rs199969873	byFrequency	TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr3:49723603G>A	ENST00000296456.5	+	0	3220				MST1_ENST00000494828.2_5'Flank|AC099668.5_ENST00000563780.1_RNA|MST1_ENST00000383728.3_3'UTR|MST1_ENST00000449682.2_Missense_Mutation_p.R347W	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase						beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)	p.R333W(5)		endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TCGGGGTTCCGGCAGAAGTTC	0.662													G|||	4	0.000798722	0.0008	0.0	5008	,	,		14102	0.001		0.001	False		,,,				2504	0.001				p.R347W													MST1,NS,carcinoma,0,5	MST1	0	5	5	Substitution - Missense(5)	endometrium(4)|skin(1)	c.C1039T																																									SO:0001628	intergenic_variant	4485	exon9			GGTTCCGGCAGAA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882		3.37:g.49723603G>A			75	0.0133333333	1		49	0.12	6	NM_020998	8	0.00	0	Q9BQ33|Q9P0Y2	Missense_Mutation	SNP	ENST00000296456.5	37	CCDS2801.1	11	0.005036630036630037	4	0.008130081300813009	3	0.008287292817679558	0	0.0	4	0.005277044854881266	G	28.4	4.921307	0.92249	.	.	ENSG00000173531	ENST00000449682	D	0.93953	-3.32	5.47	2.53	0.30540	.	0.000000	0.38005	N	0.001857	D	0.96321	0.8800	H	0.97186	3.955	0.80722	D	1	D	0.56521	0.976	P	0.60609	0.877	D	0.95291	0.8395	10	0.66056	D	0.02	.	13.6859	0.62515	0.0:0.0:0.4634:0.5366	.	347	G3XAK1	.	W	347	ENSP00000414287:R347W	ENSP00000414287:R347W	R	-	1	2	MST1	49698607	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	3.194000	0.51005	0.213000	0.20722	0.655000	0.94253	CGG	0.005		0.662	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346415.2			
TLR9	54106	mdanderson.org	37	3	52256987	52256987	+	Missense_Mutation	SNP	G	G	T	rs373748615		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr3:52256987G>T	ENST00000360658.2	-	2	1978	c.1345C>A	c.(1345-1347)Cag>Aag	p.Q449K	TLR9_ENST00000597542.1_Missense_Mutation_p.Q473K|TLR9_ENST00000494383.1_Missense_Mutation_p.A602E	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	449					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	TCCCCAGGCTGCAGCCAGACC	0.627																																					p.Q449K													.	.			0			c.C1345A												69.0	70.0	69.0					3																	52256987		2203	4300	6503	SO:0001583	missense	54106	exon2			CAGGCTGCAGCCA	AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1345C>A	3.37:g.52256987G>T	ENSP00000353874:p.Gln449Lys		81	0	0		44	0.07	3	NM_017442	3	0.00	0	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Missense_Mutation	SNP	ENST00000360658.2	37	CCDS2848.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.79|11.79	1.742378|1.742378	0.30865|0.30865	.|.	.|.	ENSG00000173366|ENSG00000239732	ENST00000494383|ENST00000360658	.|T	.|0.26810	.|1.71	5.23|5.23	-0.621|-0.621	0.11564|0.11564	.|.	.|2.137540	.|0.02527	.|N	.|0.093234	T|T	0.17831|0.17831	0.0428|0.0428	L|L	0.33339|0.33339	1.005|1.005	0.09310|0.09310	N|N	1|1	.|B;B	.|0.18610	.|0.029;0.003	.|B;B	.|0.14023	.|0.01;0.006	T|T	0.11690|0.11690	-1.0577|-1.0577	5|10	.|0.29301	.|T	.|0.29	.|.	2.0246|2.0246	0.03516|0.03516	0.2072:0.2263:0.436:0.1306|0.2072:0.2263:0.436:0.1306	.|.	.|546;449	.|B4E0A1;Q9NR96	.|.;TLR9_HUMAN	E|K	602|449	.|ENSP00000353874:Q449K	.|ENSP00000353874:Q449K	A|Q	-|-	2|1	0|0	RP11-330H6.5|TLR9	52232027|52232027	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.287000|0.287000	0.27160|0.27160	-0.087000|-0.087000	0.11215|0.11215	-0.348000|-0.348000	0.08286|0.08286	0.655000|0.655000	0.94253|0.94253	GCA|CAG			0.627	TLR9-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000350203.1			
DPPA4	55211	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	109047903	109047903	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr3:109047903G>A	ENST00000335658.6	-	6	766	c.712C>T	c.(712-714)Ctc>Ttc	p.L238F	DPPA4_ENST00000478791.1_5'Flank	NM_018189.3	NP_060659.3	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	238					lung-associated mesenchyme development (GO:0060484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(17)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25						TCTGCAGGGAGACTTTTCCCA	0.512																																					p.L238F													.	DPPA4	56		0			c.C712T												61.0	57.0	59.0					3																	109047903		2203	4300	6503	SO:0001583	missense	55211	exon6			CAGGGAGACTTTT	AK001575	CCDS33814.1	3q13.13	2014-01-28			ENSG00000121570	ENSG00000121570			19200	protein-coding gene	gene with protein product		614125					Standard	NM_018189		Approved	FLJ10713	uc003dxq.4	Q7L190	OTTHUMG00000159222	ENST00000335658.6:c.712C>T	3.37:g.109047903G>A	ENSP00000335306:p.Leu238Phe		362	0	0		348	0.03	10	NM_018189	1072	0.06	67	A8K4M7|Q9H9N5|Q9NVI6	Missense_Mutation	SNP	ENST00000335658.6	37	CCDS33814.1	.	.	.	.	.	.	.	.	.	.	G	17.73	3.461392	0.63513	.	.	ENSG00000121570	ENST00000335658	T	0.28454	1.61	4.91	2.11	0.27256	.	0.251277	0.28683	N	0.014493	T	0.36826	0.0981	L	0.43152	1.355	0.28188	N	0.927863	D	0.58268	0.982	P	0.62740	0.906	T	0.12243	-1.0555	10	0.72032	D	0.01	-13.666	3.905	0.09178	0.1954:0.0:0.6134:0.1912	.	238	Q7L190	DPPA4_HUMAN	F	238	ENSP00000335306:L238F	ENSP00000335306:L238F	L	-	1	0	DPPA4	110530593	0.972000	0.33761	0.959000	0.39883	0.976000	0.68499	0.662000	0.25038	0.755000	0.32990	0.467000	0.42956	CTC			0.512	DPPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353897.1	rescued with RNA-seq	NM_018189	
CPZ	8532	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	8621216	8621216	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr4:8621216G>C	ENST00000360986.4	+	11	2005	c.1831G>C	c.(1831-1833)Ggg>Cgg	p.G611R	CPZ_ENST00000429646.2_Missense_Mutation_p.G219R|CPZ_ENST00000382480.2_Missense_Mutation_p.G474R|CPZ_ENST00000315782.6_Missense_Mutation_p.G600R	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	611					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						CAGCTCTTTGGGGGAGGCCAC	0.657																																					p.G611R													.	.			0			c.G1831C												36.0	39.0	38.0					4																	8621216		2203	4300	6503	SO:0001583	missense	8532	exon11			TCTTTGGGGGAGG	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1831G>C	4.37:g.8621216G>C	ENSP00000354255:p.Gly611Arg		136	0	0		127	0.24	30	NM_001014447	12	0.00	0	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	37	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	G	5.993	0.367225	0.11352	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782;ENST00000429646	T;T;T;T	0.56941	0.76;2.14;0.43;2.03	4.66	-0.271	0.12922	.	7.547470	0.01092	N	0.005208	T	0.30479	0.0766	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.0	T	0.09100	-1.0690	10	0.18710	T	0.47	.	4.6872	0.12764	0.3631:0.1511:0.4858:0.0	.	600;611	Q66K79-2;Q66K79	.;CBPZ_HUMAN	R	611;474;600;219	ENSP00000354255:G611R;ENSP00000371920:G474R;ENSP00000315074:G600R;ENSP00000403981:G219R	ENSP00000315074:G600R	G	+	1	0	CPZ	8672116	0.469000	0.25846	0.000000	0.03702	0.043000	0.13939	2.726000	0.47302	-0.482000	0.06782	0.456000	0.33151	GGG			0.657	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000207001.4		NM_003652	
UGT2B10	7365	broad.mit.edu;bcgsc.ca;mdanderson.org	37	4	69682264	69682264	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr4:69682264G>C	ENST00000265403.7	+	1	554	c.527G>C	c.(526-528)gGc>gCc	p.G176A	UGT2B10_ENST00000458688.2_Intron	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	176					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						TTCAGTCCTGGCTACTCATTT	0.418																																					.	Melanoma(133;755 1763 25578 26334 46021)												.	UGT2B10	134		0			.												139.0	136.0	137.0					4																	69682264		2202	4298	6500	SO:0001583	missense	7365	.			GTCCTGGCTACTC	X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.527G>C	4.37:g.69682264G>C	ENSP00000265403:p.Gly176Ala		357	0	0		264	0.03	8	.	0		0	A8K9M3|B4DPP1|Q14CR8	Missense_Mutation	SNP	ENST00000265403.7	37		.	.	.	.	.	.	.	.	.	.	g	9.141	1.013927	0.19277	.	.	ENSG00000109181	ENST00000265403	T	0.60797	0.16	2.63	2.63	0.31362	.	0.193851	0.33040	U	0.005348	T	0.49898	0.1584	L	0.35414	1.06	0.58432	D	0.999995	P	0.48503	0.911	P	0.51297	0.665	T	0.39742	-0.9599	10	0.09590	T	0.72	.	10.7026	0.45937	0.0:0.0:1.0:0.0	.	176	P36537	UDB10_HUMAN	A	176	ENSP00000265403:G176A	ENSP00000265403:G176A	G	+	2	0	UGT2B10	69716853	1.000000	0.71417	0.006000	0.13384	0.008000	0.06430	3.717000	0.54911	1.309000	0.44985	0.184000	0.17185	GGC			0.418	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000365169.1		NM_001075	
FAT4	79633	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	4	126240963	126240963	+	Nonsense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr4:126240963G>T	ENST00000394329.3	+	1	3410	c.3397G>T	c.(3397-3399)Gga>Tga	p.G1133*		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1133	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TGGGCCAAATGGAGAAGTAAG	0.413																																					p.G1133X													.	.			0			c.G3397T												175.0	173.0	173.0					4																	126240963		1877	4113	5990	SO:0001587	stop_gained	79633	exon1			CCAAATGGAGAAG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3397G>T	4.37:g.126240963G>T	ENSP00000377862:p.Gly1133*		96	0	0		114	0.21	24	NM_024582	0		0	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Nonsense_Mutation	SNP	ENST00000394329.3	37	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	42	9.526279	0.99195	.	.	ENSG00000196159	ENST00000394329	.	.	.	4.87	4.87	0.63330	.	0.000000	0.34200	U	0.004164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.1824	0.89782	0.0:0.0:1.0:0.0	.	.	.	.	X	1133	.	ENSP00000377862:G1133X	G	+	1	0	FAT4	126460413	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.899000	0.75682	2.525000	0.85131	0.462000	0.41574	GGA			0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256765.2		NM_024582	
PPID	5481	mdanderson.org	37	4	159632000	159632000	+	Splice_Site	SNP	C	C	T	rs574999524		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr4:159632000C>T	ENST00000307720.3	-	8	1002	c.895G>A	c.(895-897)Gct>Act	p.A299T		NM_005038.2	NP_005029.1	Q08752	PPID_HUMAN	peptidylprolyl isomerase D	299	Interaction with HSP90AB1. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to UV-A (GO:0071492)|chaperone-mediated protein folding (GO:0061077)|lipid particle organization (GO:0034389)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|protein transport (GO:0015031)|viral release from host cell (GO:0019076)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|estrogen receptor binding (GO:0030331)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|transcription factor binding (GO:0008134)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		AGTTCAAGAGCCTACAAAAAA	0.358																																					p.A299T													.	.			0			c.G895A												107.0	115.0	113.0					4																	159632000		2202	4300	6502	SO:0001630	splice_region_variant	5481	exon8			CAAGAGCCTACAA		CCDS3801.1	4q31.3	2013-01-10	2008-10-24		ENSG00000171497	ENSG00000171497		"""Tetratricopeptide (TTC) repeat domain containing"""	9257	protein-coding gene	gene with protein product	"""cyclophilin 40"""	601753	"""peptidylprolyl isomerase D (cyclophilin D)"""			8509368	Standard	NM_005038		Approved	CYP-40	uc003iqc.3	Q08752	OTTHUMG00000161927	ENST00000307720.3:c.895-1G>A	4.37:g.159632000C>T			103	0	0		82	0.05	4	NM_005038	123	0.00	0	B2R9V2	Missense_Mutation	SNP	ENST00000307720.3	37	CCDS3801.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.026150	0.93518	.	.	ENSG00000171497	ENST00000307720	T	0.74106	-0.81	4.4	4.4	0.53042	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.39615	N	0.001319	D	0.87063	0.6084	M	0.85041	2.73	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.89738	0.3931	10	0.87932	D	0	-10.7797	17.8682	0.88803	0.0:1.0:0.0:0.0	.	299	Q08752	PPID_HUMAN	T	299	ENSP00000303754:A299T	ENSP00000303754:A299T	A	-	1	0	PPID	159851450	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	6.657000	0.74402	2.375000	0.81037	0.585000	0.79938	GCT			0.358	PPID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366436.1		NM_005038	Missense_Mutation
SEMA5A	9037	broad.mit.edu	37	5	9202166	9202166	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr5:9202166C>T	ENST00000382496.5	-	9	1498	c.833G>A	c.(832-834)tGc>tAc	p.C278Y		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	278	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						AGGACGGGAGCAGTTCAGGCG	0.522																																					p.C278Y													.	SEMA5A	236		0			c.G833A												86.0	80.0	82.0					5																	9202166		2203	4300	6503	SO:0001583	missense	9037	exon9			CGGGAGCAGTTCA	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.833G>A	5.37:g.9202166C>T	ENSP00000371936:p.Cys278Tyr		429	0.0023310023	1		371	0.02	8	NM_003966	0		0	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	ENST00000382496.5	37	CCDS3875.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795306	0.90453	.	.	ENSG00000112902	ENST00000382496	D	0.94046	-3.34	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.045211	0.85682	D	0.000000	D	0.98012	0.9345	H	0.97315	3.98	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	D	0.99044	1.0825	10	0.87932	D	0	.	17.6206	0.88080	0.0:1.0:0.0:0.0	.	278	Q13591	SEM5A_HUMAN	Y	278	ENSP00000371936:C278Y	ENSP00000371936:C278Y	C	-	2	0	SEMA5A	9255166	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.290000	0.78711	2.760000	0.94817	0.655000	0.94253	TGC			0.522	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206989.2			
SPEF2	79925	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	35753823	35753823	+	Missense_Mutation	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr5:35753823C>T	ENST00000356031.3	+	24	3582	c.3428C>T	c.(3427-3429)aCt>aTt	p.T1143I	CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000440995.2_Missense_Mutation_p.T1138I	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	1143					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTACAGGACACTCTTGGAATG	0.522																																					p.T1143I													.	.			0			c.C3428T												130.0	134.0	133.0					5																	35753823		1970	4153	6123	SO:0001583	missense	79925	exon24			AGGACACTCTTGG	AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.3428C>T	5.37:g.35753823C>T	ENSP00000348314:p.Thr1143Ile		110	0	0		85	0.20	17	NM_024867	1	0.00	0	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	ENST00000356031.3	37	CCDS43309.1	.	.	.	.	.	.	.	.	.	.	C	6.442	0.449637	0.12223	.	.	ENSG00000152582	ENST00000356031;ENST00000440995	T;T	0.29917	1.55;1.55	5.35	-7.05	0.01573	.	0.789213	0.11682	N	0.539714	T	0.10465	0.0256	N	0.14661	0.345	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.002	T	0.23048	-1.0199	10	0.23302	T	0.38	.	0.5663	0.00687	0.392:0.1426:0.1599:0.3055	.	1138;1143	Q9C093-2;Q9C093	.;SPEF2_HUMAN	I	1143;1138	ENSP00000348314:T1143I;ENSP00000412125:T1138I	ENSP00000348314:T1143I	T	+	2	0	SPEF2	35789580	0.003000	0.15002	0.000000	0.03702	0.044000	0.14063	0.021000	0.13489	-1.023000	0.03342	0.491000	0.48974	ACT			0.522	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367199.1		NM_144722	
SLCO4C1	353189	mdanderson.org	37	5	101631956	101631956	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr5:101631956G>T	ENST00000310954.6	-	1	297	c.11C>A	c.(10-12)gCc>gAc	p.A4D		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AATACCTTTGGCGCTCTTCAT	0.607																																					p.A4D													.	.			0			c.C11A												63.0	74.0	70.0					5																	101631956		2203	4300	6503	SO:0001583	missense	353189	exon1			CCTTTGGCGCTCT	AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.11C>A	5.37:g.101631956G>T	ENSP00000309741:p.Ala4Asp		99	0	0		55	0.05	3	NM_180991	3	0.00	0		Missense_Mutation	SNP	ENST00000310954.6	37	CCDS34205.1	.	.	.	.	.	.	.	.	.	.	G	9.189	1.025506	0.19512	.	.	ENSG00000173930	ENST00000310954	T	0.39056	1.1	4.11	-0.0782	0.13716	.	1.860880	0.03347	N	0.195607	T	0.24812	0.0602	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.11012	-1.0605	10	0.30078	T	0.28	.	0.6684	0.00854	0.2108:0.1777:0.3641:0.2474	.	4	Q6ZQN7	SO4C1_HUMAN	D	4	ENSP00000309741:A4D	ENSP00000309741:A4D	A	-	2	0	SLCO4C1	101659855	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.066000	0.11598	0.051000	0.15978	0.591000	0.81541	GCC			0.607	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370332.1		NM_180991	
ANKHD1	54882	hgsc.bcm.edu	37	5	139781730	139781730	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr5:139781730G>A	ENST00000360839.2	+	1	332	c.178G>A	c.(178-180)Ggc>Agc	p.G60S	ANKHD1_ENST00000297183.6_Missense_Mutation_p.G60S|ANKHD1_ENST00000394723.3_Missense_Mutation_p.G60S|ANKHD1_ENST00000394722.3_Missense_Mutation_p.G60S|CTC-329D1.2_ENST00000507521.1_RNA|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.G60S	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	60	Gly-rich.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cggcagcagcggcggcggcgg	0.756																																					p.G60S													ANKHD1-EIF4EBP3,NS,carcinoma,0,2	ANKHD1-EIF4EBP3	0	2	0			c.G178A																																									SO:0001583	missense	54882	exon1			AGCAGCGGCGGCG	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.178G>A	5.37:g.139781730G>A	ENSP00000354085:p.Gly60Ser		28	0.0357142857	1		29	0.10	3	NM_017978	11	0.00	0	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	37	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663652	0.47572	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000421134;ENST00000394723;ENST00000511151;ENST00000394722;ENST00000532219	T;T;T;T;T;T;T	0.66815	-0.12;-0.17;-0.14;-0.1;-0.23;-0.01;-0.17	4.8	1.98	0.26296	.	0.127893	0.34555	N	0.003870	T	0.61451	0.2348	N	0.24115	0.695	0.22366	N	0.999162	D;D;D;D;P	0.71674	0.998;0.996;0.996;0.998;0.836	D;P;P;D;B	0.65443	0.935;0.862;0.862;0.935;0.038	T	0.52586	-0.8556	10	0.17369	T	0.5	.	6.4517	0.21908	0.4177:0.0:0.5823:0.0	.	60;60;60;60;60	Q8IWZ3-5;Q8IWZ2;Q8IWZ3;Q8IWZ3-3;Q8IWZ3-2	.;.;ANKH1_HUMAN;.;.	S	60;74;60;60;60;60;60;60;60	ENSP00000354085:G60S;ENSP00000297183:G60S;ENSP00000394489:G60S;ENSP00000378212:G60S;ENSP00000421069:G60S;ENSP00000378211:G60S;ENSP00000432016:G60S	ENSP00000432016:G60S	G	+	1	0	ANKHD1-EIF4EBP3;ANKHD1	139761914	0.926000	0.31397	0.971000	0.41717	0.367000	0.29736	0.608000	0.24223	0.224000	0.20940	0.505000	0.49811	GGC			0.756	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000251672.1		NM_017747	
SLC6A7	6534	hgsc.bcm.edu	37	5	149578888	149578888	+	Missense_Mutation	SNP	G	G	T	rs564660890		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr5:149578888G>T	ENST00000230671.2	+	5	1053	c.682G>T	c.(682-684)Gtg>Ttg	p.V228L	SLC6A7_ENST00000524041.1_Missense_Mutation_p.V228L	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	228					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	CTGGGTCATCGTGTTCCTCTG	0.647																																					p.V228L													.	.			0			c.G682T												106.0	98.0	100.0					5																	149578888		2203	4300	6503	SO:0001583	missense	6534	exon5			GTCATCGTGTTCC	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.682G>T	5.37:g.149578888G>T	ENSP00000230671:p.Val228Leu		78	0	0		71	0.06	4	NM_014228	1	0.00	0	Q0VG81|Q52LU6	Missense_Mutation	SNP	ENST00000230671.2	37	CCDS4305.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.933866	0.73442	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.76060	-0.99;-0.99	5.21	5.21	0.72293	.	0.056815	0.64402	D	0.000001	D	0.82802	0.5116	L	0.54908	1.71	0.52501	D	0.999951	D	0.56035	0.974	P	0.61800	0.894	D	0.84460	0.0593	10	0.72032	D	0.01	.	18.7809	0.91932	0.0:0.0:1.0:0.0	.	228	Q99884	SC6A7_HUMAN	L	228	ENSP00000230671:V228L;ENSP00000428200:V228L	ENSP00000230671:V228L	V	+	1	0	SLC6A7	149559081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.674000	0.68117	2.414000	0.81942	0.655000	0.94253	GTG			0.647	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252325.1		NM_014228	
ZNF165	7718	mdanderson.org	37	6	28053615	28053615	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr6:28053615G>T	ENST00000377325.1	+	2	913	c.357G>T	c.(355-357)gaG>gaT	p.E119D		NM_003447.3	NP_003438.1	P49910	ZN165_HUMAN	zinc finger protein 165	119	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GTGGAGAGGAGGCAGTGACCA	0.498																																					p.E119D													.	.			0			c.G357T												69.0	70.0	69.0					6																	28053615		2203	4300	6503	SO:0001583	missense	7718	exon2			AGAGGAGGCAGTG	U78722	CCDS4643.1	6p21	2013-01-09			ENSG00000197279	ENSG00000197279		"""-"", ""Zinc fingers, C2H2-type"""	12953	protein-coding gene	gene with protein product	"""cancer/testis antigen 53"""	600834				7490084	Standard	NM_003447		Approved	ZSCAN7, CT53	uc021yro.1	P49910	OTTHUMG00000014505	ENST00000377325.1:c.357G>T	6.37:g.28053615G>T	ENSP00000366542:p.Glu119Asp		41	0	0		52	0.06	3	NM_003447	12	0.00	0		Missense_Mutation	SNP	ENST00000377325.1	37	CCDS4643.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.651742	0.29336	.	.	ENSG00000197279	ENST00000377325	T	0.08546	3.08	2.96	-0.958	0.10347	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.03136	0.0092	M	0.70108	2.13	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.40590	-0.9555	9	0.59425	D	0.04	.	4.0408	0.09750	0.3389:0.179:0.4821:0.0	.	119	P49910	ZN165_HUMAN	D	119	ENSP00000366542:E119D	ENSP00000366542:E119D	E	+	3	2	ZNF165	28161594	0.242000	0.23868	0.112000	0.21494	0.996000	0.88848	-0.254000	0.08781	-0.251000	0.09542	0.655000	0.94253	GAG			0.498	ZNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040173.1		NM_003447	
KCNQ5	56479	broad.mit.edu	37	6	73843232	73843232	+	Missense_Mutation	SNP	A	A	G			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr6:73843232A>G	ENST00000370398.1	+	10	1445	c.1336A>G	c.(1336-1338)Agg>Ggg	p.R446G	KCNQ5_ENST00000414165.2_Intron|KCNQ5-AS1_ENST00000429832.1_RNA|KCNQ5_ENST00000342056.2_Missense_Mutation_p.R465G|KCNQ5_ENST00000403813.2_Missense_Mutation_p.R437G|KCNQ5_ENST00000402622.2_Missense_Mutation_p.R456G|KCNQ5_ENST00000355635.3_Missense_Mutation_p.R447G|KCNQ5_ENST00000355194.4_Missense_Mutation_p.R446G	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	446					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	AGGTGACAGGAGGTCCCCAAG	0.592																																					p.R465G	GBM(142;1375 1859 14391 23261 44706)												.	KCNQ5	153		0			c.A1393G												95.0	95.0	95.0					6																	73843232		2203	4300	6503	SO:0001583	missense	56479	exon11			GACAGGAGGTCCC	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1336A>G	6.37:g.73843232A>G	ENSP00000359425:p.Arg446Gly		190	0	0		252	0.02	5	NM_001160133	1	0.00	0	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	ENST00000370398.1	37	CCDS4976.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.77|19.77	3.889061|3.889061	0.72524|0.72524	.|.	.|.	ENSG00000185760|ENSG00000185760	ENST00000427928|ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813	.|D;D;D;D;D;D	.|0.99698	.|-6.44;-6.44;-6.44;-6.44;-6.44;-6.44	5.59|5.59	3.05|3.05	0.35203|0.35203	.|Potassium channel, voltage dependent, KCNQ, C-terminal (1);	.|0.053445	.|0.85682	.|D	.|0.000000	D|D	0.98194|0.98194	0.9403|0.9403	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.19817	.|0.039;0.007;0.017;0.002	.|B;B;B;B	.|0.25405	.|0.06;0.021;0.054;0.012	D|D	0.99969|0.99969	1.1954|1.1954	5|10	.|0.29301	.|T	.|0.29	.|.	12.3513|12.3513	0.55151|0.55151	0.6084:0.3916:0.0:0.0|0.6084:0.3916:0.0:0.0	.|.	.|456;465;437;446	.|Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.|.;.;.;KCNQ5_HUMAN	G|G	37|465;465;446;446;456;447;437	.|ENSP00000345055:R465G;ENSP00000347326:R446G;ENSP00000359425:R446G;ENSP00000385501:R456G;ENSP00000347853:R447G;ENSP00000384453:R437G	.|ENSP00000345055:R465G	E|R	+|+	2|1	0|2	KCNQ5|KCNQ5	73899953|73899953	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.699000|2.699000	0.47077|0.47077	1.037000|1.037000	0.40024|0.40024	0.460000|0.460000	0.39030|0.39030	GAG|AGG			0.592	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000041198.3		NM_019842	
SEC63	11231	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	6	108214783	108214783	+	Nonsense_Mutation	SNP	G	G	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr6:108214783G>C	ENST00000369002.4	-	16	1756	c.1577C>G	c.(1576-1578)tCa>tGa	p.S526*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	526	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		CTTTTTTTTTGATTTAGCAGT	0.388																																					p.S526X													.	.			0			c.C1577G	GRCh37	CM063124	SEC63	M								128.0	133.0	132.0					6																	108214783		2203	4300	6503	SO:0001587	stop_gained	11231	exon16			TTTTTTGATTTAG	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1577C>G	6.37:g.108214783G>C	ENSP00000357998:p.Ser526*		102	0	0		89	0.18	16	NM_007214	212	0.03	6	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.440289|6.440289	0.97568|0.97568	.|.	.|.	ENSG00000025796|ENSG00000025796	ENST00000423697|ENST00000369002;ENST00000437345	.|.	.|.	.|.	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|0.32370	.|T	.|0.25	.|-11.931	19.497|19.497	0.95077|0.95077	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|X	-1|526;177	.|.	.|ENSP00000357998:S526X	.|S	-|-	.|2	.|0	SEC63|SEC63	108321476|108321476	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.292000|7.292000	0.78731|0.78731	2.677000|2.677000	0.91161|0.91161	0.563000|0.563000	0.77884|0.77884	.|TCA			0.388	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041705.4		NM_007214	
FIG4	9896	mdanderson.org	37	6	110064975	110064975	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr6:110064975G>T	ENST00000230124.3	+	10	1261	c.1137G>T	c.(1135-1137)aaG>aaT	p.K379N	FIG4_ENST00000441478.2_Splice_Site_p.K102N	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	379	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		ATTTAGTGAAGGTATGATGTG	0.478																																					p.K379N													.	.			0			c.G1137T												126.0	111.0	116.0					6																	110064975		2203	4300	6503	SO:0001630	splice_region_variant	9896	exon10			AGTGAAGGTATGA	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1137+1G>T	6.37:g.110064975G>T			68	0	0		69	0.07	5	NM_014845	18	0.00	0	Q53H49|Q5TCS6	Missense_Mutation	SNP	ENST00000230124.3	37	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732113	0.89390	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.55052	1.06;0.54	4.66	4.66	0.58398	Synaptojanin, N-terminal (2);	0.128969	0.52532	D	0.000074	T	0.58552	0.2130	L	0.49350	1.555	0.80722	D	1	B;D	0.89917	0.288;1.0	B;D	0.81914	0.168;0.995	T	0.53380	-0.8447	10	0.26408	T	0.33	-14.2328	17.9106	0.88932	0.0:0.0:1.0:0.0	.	102;379	F5H8L9;Q92562	.;FIG4_HUMAN	N	102;379	ENSP00000399443:K102N;ENSP00000230124:K379N	ENSP00000230124:K379N	K	+	3	2	FIG4	110171668	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.352000	0.97076	2.302000	0.77476	0.650000	0.86243	AAG			0.478	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041768.1		NM_014845	Missense_Mutation
GPER1	2852	mdanderson.org	37	7	1132183	1132183	+	Silent	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr7:1132183G>T	ENST00000297469.3	+	2	1510	c.819G>T	c.(817-819)ctG>ctT	p.L273L	C7orf50_ENST00000488073.1_Intron|GPER1_ENST00000397088.3_Silent_p.L273L|GPER1_ENST00000397092.1_Silent_p.L273L|C7orf50_ENST00000397098.3_Intron|GPER1_ENST00000401670.1_Silent_p.L273L|C7orf50_ENST00000397100.2_Intron|C7orf50_ENST00000357429.6_Intron	NM_001505.2	NP_001496.1	Q99527	GPER1_HUMAN	G protein-coupled estrogen receptor 1	273					apoptotic chromosome condensation (GO:0030263)|cell cycle (GO:0007049)|cellular response to estradiol stimulus (GO:0071392)|cellular response to glucose stimulus (GO:0071333)|cellular response to mineralocorticoid stimulus (GO:0071389)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytosolic calcium ion homeostasis (GO:0051480)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mineralocorticoid receptor signaling pathway (GO:0031959)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA metabolic process (GO:0051053)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte activation (GO:0002695)|negative regulation of lipid biosynthetic process (GO:0051055)|neuronal action potential (GO:0019228)|nuclear fragmentation involved in apoptotic nuclear change (GO:0030264)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of gene expression (GO:0010628)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of insulin secretion (GO:0032024)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vasodilation (GO:0045909)|steroid hormone mediated signaling pathway (GO:0043401)	axon (GO:0030424)|axon terminus (GO:0043679)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine head (GO:0044327)|dendritic spine membrane (GO:0032591)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|keratin filament (GO:0045095)|mitochondrial membrane (GO:0031966)|neuronal postsynaptic density (GO:0097481)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	chromatin binding (GO:0003682)|estrogen receptor activity (GO:0030284)|G-protein coupled receptor activity (GO:0004930)|mineralocorticoid receptor activity (GO:0017082)|steroid binding (GO:0005496)										TCTGCTGGCTGCCGGAGAACG	0.701																																					p.L273L													.	.			0			c.G819T												57.0	58.0	58.0					7																	1132183		2203	4300	6503	SO:0001819	synonymous_variant	2852	exon2			CTGGCTGCCGGAG	U63917	CCDS5322.1	7p22	2013-08-14	2007-07-03	2013-08-14	ENSG00000164850	ENSG00000164850			4485	protein-coding gene	gene with protein product		601805	"""G protein-coupled receptor 30"""	CMKRL2, GPR30, GPER		9479505, 17655271	Standard	NM_001098201		Approved	FEG-1, GPCR-Br, LERGU, LERGU2, DRY12, LyGPR, CEPR	uc003skb.2	Q99527	OTTHUMG00000023680	ENST00000297469.3:c.819G>T	7.37:g.1132183G>T			36	0	0		45	0.07	3	NM_001505	0		0	A8K6C5|B5BUJ1|O00143|O43494|Q13631|Q6FHL1|Q96F42|Q99981	Silent	SNP	ENST00000297469.3	37	CCDS5322.1																																																																																					0.701	GPER1-030	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060001.1		NM_001039966	
RADIL	55698	ucsc.edu	37	7	4874814	4874814	+	Silent	SNP	G	G	T	rs13232656		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr7:4874814G>T	ENST00000399583.3	-	4	1027	c.840C>A	c.(838-840)ccC>ccA	p.P280P	RADIL_ENST00000536091.1_Silent_p.P280P|RADIL_ENST00000538469.1_Silent_p.P40P	NM_018059.4	NP_060529.4	Q96JH8	RADIL_HUMAN	Ras association and DIL domains	280					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|substrate adhesion-dependent cell spreading (GO:0034446)	microtubule (GO:0005874)				NS(1)|biliary_tract(2)|breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(22)|pancreas(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)		GCTTGCTGGAGGGGGTCCGCT	0.682																																					p.P280P													.	RADIL	110		0			c.C840A												19.0	27.0	24.0					7																	4874814		2173	4252	6425	SO:0001819	synonymous_variant	55698	exon4			GCTGGAGGGGGTC	AB058752	CCDS43544.1	7p22.1	2010-08-27			ENSG00000157927	ENSG00000157927			22226	protein-coding gene	gene with protein product		611491				16051602, 17704304	Standard	NM_018059		Approved	FLJ10324, KIAA1849, RASIP2	uc003snj.1	Q96JH8	OTTHUMG00000151753	ENST00000399583.3:c.840C>A	7.37:g.4874814G>T			35	0	0		39	0.10	4	NM_018059	19	0.00	0	A4D1Z5|A5YM49|B7ZL20|Q0VFZ9|Q75LH3|Q9BSP5|Q9H0M6|Q9NW43|Q9NWC4	Silent	SNP	ENST00000399583.3	37	CCDS43544.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.192|5.192	0.220932|0.220932	0.09863|0.09863	.|.	.|.	ENSG00000157927|ENSG00000157927	ENST00000316919|ENST00000544486	.|.	.|.	.|.	4.75|4.75	-6.29|-6.29	0.02013|0.02013	.|.	.|1.754590	.|0.02840	.|N	.|0.127826	.|T	.|0.30572	.|0.0769	.|.	.|.	.|.	0.29145|0.29145	N|N	0.878787|0.878787	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.18555	.|-1.0333	.|6	.|0.72032	.|D	.|0.01	.|-6.9366	0.9329|0.9329	0.01339|0.01339	0.2739:0.3345:0.1844:0.2072|0.2739:0.3345:0.1844:0.2072	.|.	.|.	.|.	.|.	.|H	-1|15	.|.	.|ENSP00000437686:P15H	.|P	-|-	.|2	.|0	RADIL|RADIL	4841340|4841340	0.000000|0.000000	0.05858|0.05858	0.084000|0.084000	0.20598|0.20598	0.101000|0.101000	0.19017|0.19017	-2.190000|-2.190000	0.01247|0.01247	-1.919000|-1.919000	0.01071|0.01071	-1.251000|-1.251000	0.01509|0.01509	.|CCT			0.682	RADIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323769.2		NM_018059	
CCDC146	57639	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	76889506	76889506	+	Silent	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr7:76889506G>A	ENST00000285871.4	+	8	1066	c.939G>A	c.(937-939)aaG>aaA	p.K313K	AC073635.5_ENST00000476561.2_RNA|CCDC146_ENST00000415740.2_3'UTR|CCDC146_ENST00000431197.1_Silent_p.K59K	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	313										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AATTGGTCAAGCTATTGGAAT	0.323																																					p.K313K													.	.			0			c.G939A												97.0	95.0	95.0					7																	76889506		2203	4300	6503	SO:0001819	synonymous_variant	57639	exon8			GGTCAAGCTATTG	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.939G>A	7.37:g.76889506G>A			260	0	0		294	0.15	44	NM_020879	2	0.00	0	A8K8X6|Q9P223	Silent	SNP	ENST00000285871.4	37	CCDS34671.1																																																																																					0.323	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341449.1		NM_020879	
EZH2	2146	broad.mit.edu	37	7	148512600	148512600	+	Missense_Mutation	SNP	T	T	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr7:148512600T>C	ENST00000460911.1	-	13	1617	c.1529A>G	c.(1528-1530)aAg>aGg	p.K510R	EZH2_ENST00000483967.1_Missense_Mutation_p.K501R|EZH2_ENST00000476773.1_Missense_Mutation_p.K501R|EZH2_ENST00000320356.2_Missense_Mutation_p.K515R|EZH2_ENST00000541220.1_Missense_Mutation_p.K501R|EZH2_ENST00000350995.2_Missense_Mutation_p.K471R|EZH2_ENST00000478654.1_Missense_Mutation_p.K501R			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	510	CXC. {ECO:0000255|PROSITE- ProRule:PRU00970}.|Interaction with CDYL.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			ATGCTAACCCTTTTTCAGCTG	0.368			Mis		DLBCL																																p.K515R				Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	.	EZH2	823		0			c.A1544G												150.0	144.0	146.0					7																	148512600		2203	4300	6503	SO:0001583	missense	0	exon13			TAACCCTTTTTCA		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1529A>G	7.37:g.148512600T>C	ENSP00000419711:p.Lys510Arg		302	0	0		397	0.01	5	NM_004456	88	0.00	0	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Missense_Mutation	SNP	ENST00000460911.1	37	CCDS56516.1	.	.	.	.	.	.	.	.	.	.	t	27.5	4.839567	0.91117	.	.	ENSG00000106462	ENST00000478654;ENST00000320356;ENST00000460911;ENST00000350995;ENST00000541220;ENST00000476773;ENST00000483967	D;D;D;D;D;D;D	0.94687	-3.44;-3.49;-3.49;-3.48;-3.44;-3.44;-3.49	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.96244	0.8775	L	0.60455	1.87	0.80722	D	1	P;P;D;P;D	0.76494	0.635;0.799;0.992;0.635;0.999	B;P;P;B;D	0.80764	0.347;0.465;0.765;0.347;0.994	D	0.95704	0.8752	10	0.38643	T	0.18	.	15.542	0.76057	0.0:0.0:0.0:1.0	.	501;501;510;471;515	Q15910-4;Q15910-5;Q15910;Q15910-3;Q15910-2	.;.;EZH2_HUMAN;.;.	R	501;515;510;471;501;501;501	ENSP00000417062:K501R;ENSP00000320147:K515R;ENSP00000419711:K510R;ENSP00000223193:K471R;ENSP00000443219:K501R;ENSP00000419050:K501R;ENSP00000419856:K501R	ENSP00000320147:K515R	K	-	2	0	EZH2	148143533	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.351000	0.79395	2.064000	0.61679	0.533000	0.62120	AAG			0.368	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000352744.1		NM_004456	
MFHAS1	9258	mdanderson.org	37	8	8750295	8750295	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr8:8750295G>T	ENST00000276282.6	-	1	860	c.274C>A	c.(274-276)Ctg>Atg	p.L92M		NM_004225.2	NP_004216.2	Q9Y4C4	MFHA1_HUMAN	malignant fibrous histiocytoma amplified sequence 1	92										endometrium(1)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|stomach(1)	21		Hepatocellular(245;0.217)		COAD - Colon adenocarcinoma(149;0.124)		CGCAGGACCAGGACGCGCAGG	0.726																																					p.L92M	Melanoma(103;1201 2045 17515 28966)												.	.			0			c.C274A												9.0	12.0	11.0					8																	8750295		2165	4266	6431	SO:0001583	missense	9258	exon1			GGACCAGGACGCG	AB016816	CCDS34844.1	8p23.1	2014-03-07			ENSG00000147324	ENSG00000147324			16982	protein-coding gene	gene with protein product	"""leucine rich repeat containing 65"", ""malignant fibrous histiocytoma-amplified sequences with leucine-rich tandem repeats 1"""	605352				9973190	Standard	NM_004225		Approved	MASL1, LRRC65	uc003wsj.1	Q9Y4C4	OTTHUMG00000163676	ENST00000276282.6:c.274C>A	8.37:g.8750295G>T	ENSP00000276282:p.Leu92Met		85	0	0		54	0.07	4	NM_004225	0		0	Q96CI0	Missense_Mutation	SNP	ENST00000276282.6	37	CCDS34844.1	.	.	.	.	.	.	.	.	.	.	G	15.63	2.890522	0.52014	.	.	ENSG00000147324	ENST00000276282	T	0.80393	-1.37	4.75	2.92	0.33932	.	0.102108	0.40469	N	0.001085	D	0.88709	0.6510	M	0.89840	3.065	0.39722	D	0.971484	D	0.63046	0.992	D	0.64877	0.93	D	0.87603	0.2498	10	0.87932	D	0	.	7.0842	0.25247	0.2909:0.0:0.7091:0.0	.	92	Q9Y4C4	MFHA1_HUMAN	M	92	ENSP00000276282:L92M	ENSP00000276282:L92M	L	-	1	2	MFHAS1	8787705	1.000000	0.71417	0.997000	0.53966	0.972000	0.66771	2.081000	0.41596	0.412000	0.25729	-0.259000	0.10710	CTG			0.726	MFHAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374724.2		NM_004225	
RP1L1	94137	mdanderson.org	37	8	10470155	10470155	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr8:10470155G>T	ENST00000382483.3	-	4	1676	c.1453C>A	c.(1453-1455)Ccc>Acc	p.P485T		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	485					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TGGGCAGAGGGGCTGGCACTG	0.706																																					p.P485T													.	.			0			c.C1453A												25.0	29.0	28.0					8																	10470155		1924	4115	6039	SO:0001583	missense	94137	exon4			CAGAGGGGCTGGC	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.1453C>A	8.37:g.10470155G>T	ENSP00000371923:p.Pro485Thr		26	0	0		24	0.13	3	NM_178857	0		0	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	37	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	G	5.255	0.232514	0.09969	.	.	ENSG00000183638	ENST00000382483	T	0.04275	3.66	4.66	1.66	0.24008	.	1.745140	0.03963	N	0.290429	T	0.03520	0.0101	N	0.14661	0.345	0.09310	N	1	P	0.49185	0.92	B	0.40782	0.34	T	0.26883	-1.0090	10	0.54805	T	0.06	4.5613	2.5872	0.04833	0.1137:0.3705:0.3556:0.1602	.	485	A6NKC6	.	T	485	ENSP00000371923:P485T	ENSP00000371923:P485T	P	-	1	0	RP1L1	10507565	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.671000	0.25172	0.495000	0.27882	0.561000	0.74099	CCC			0.706	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375673.1			
PTK2B	2185	broad.mit.edu	37	8	27315955	27315955	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr8:27315955G>T	ENST00000397501.1	+	36	3767	c.2959G>T	c.(2959-2961)Gcc>Tcc	p.A987S	PTK2B_ENST00000517339.1_Missense_Mutation_p.A945S|PTK2B_ENST00000420218.2_Missense_Mutation_p.A945S|PTK2B_ENST00000544172.1_Missense_Mutation_p.A987S|PTK2B_ENST00000338238.4_Missense_Mutation_p.A945S|PTK2B_ENST00000346049.5_Missense_Mutation_p.A987S	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta	987	Focal adhesion targeting (FAT).|Interaction with TGFB1I1. {ECO:0000250}.				activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	GGCTGTGGACGCCAAGAACCT	0.627																																					p.A987S													.	PTK2B	304		0			c.G2959T												62.0	42.0	49.0					8																	27315955		2203	4300	6503	SO:0001583	missense	2185	exon36			GTGGACGCCAAGA	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.2959G>T	8.37:g.27315955G>T	ENSP00000380638:p.Ala987Ser		139	0.0071942446	1		95	0.03	3	NM_173174	54	0.00	0	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	ENST00000397501.1	37	CCDS6057.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.235144	0.58886	.	.	ENSG00000120899	ENST00000397501;ENST00000338238;ENST00000544172;ENST00000346049;ENST00000420218;ENST00000517339	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	4.91	4.91	0.64330	Focal adhesion kinase, targeting (FAT) domain (3);	0.162633	0.53938	D	0.000043	T	0.44180	0.1281	L	0.35414	1.06	0.53688	D	0.999978	P;P	0.52061	0.906;0.95	B;P	0.51415	0.354;0.669	T	0.31916	-0.9926	10	0.45353	T	0.12	.	15.6329	0.76926	0.0:0.0:1.0:0.0	.	945;987	Q14289-2;Q14289	.;FAK2_HUMAN	S	987;945;987;987;945;945	ENSP00000380638:A987S;ENSP00000342242:A945S;ENSP00000440926:A987S;ENSP00000332816:A987S;ENSP00000391995:A945S;ENSP00000427931:A945S	ENSP00000342242:A945S	A	+	1	0	PTK2B	27371872	1.000000	0.71417	0.995000	0.50966	0.975000	0.68041	4.058000	0.57463	2.532000	0.85374	0.563000	0.77884	GCC			0.627	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219916.1		NM_004103	
BAI1	575	mdanderson.org	37	8	143566121	143566121	+	Silent	SNP	C	C	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr8:143566121C>T	ENST00000517894.1	+	13	3198	c.2304C>T	c.(2302-2304)aaC>aaT	p.N768N	BAI1_ENST00000323289.5_Silent_p.N768N			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	768					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					tgacagacaacctgggtaagc	0.617																																					p.N768N													.	.			0			c.C2304T												31.0	41.0	38.0					8																	143566121		2028	4180	6208	SO:0001819	synonymous_variant	575	exon12			AGACAACCTGGGT	AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.2304C>T	8.37:g.143566121C>T			37	0	0		40	0.08	3	NM_001702	0		0		Silent	SNP	ENST00000517894.1	37																																																																																						0.617	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000379963.3		NM_001702	
TYRP1	7306	broad.mit.edu	37	9	12702271	12702271	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr9:12702271G>T	ENST00000388918.5	+	5	1043	c.914G>T	c.(913-915)aGc>aTc	p.S305I	RP11-3L8.3_ENST00000417638.1_RNA|TYRP1_ENST00000381137.2_Splice_Site_p.G15V|TYRP1_ENST00000381136.2_Splice_Site_p.G15V	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	305					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TTTTCTGCAGGCACCGAGGAT	0.423									Oculocutaneous Albinism																												p.S305I													.	TYRP1	60		0			c.G914T												87.0	82.0	84.0					9																	12702271		2203	4300	6503	SO:0001630	splice_region_variant	7306	exon5	Familial Cancer Database		CTGCAGGCACCGA	L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.914-1G>T	9.37:g.12702271G>T			221	0.0045248869	1		202	0.03	6	NM_000550	0		0	P78468|P78469|Q13721|Q15679	Splice_Site	SNP	ENST00000388918.5	37	CCDS34990.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.43|15.43	2.830531|2.830531	0.50845|0.50845	.|.	.|.	ENSG00000107165|ENSG00000107165	ENST00000381137;ENST00000381136|ENST00000388918	D;D|D	0.99143|0.98381	-5.48;-5.48|-4.9	5.97|5.97	5.97|5.97	0.96955|0.96955	.|Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	.|0.033858	.|0.85682	.|D	.|0.000000	D|D	0.98551|0.98551	0.9516|0.9516	L|L	0.54323|0.54323	1.7|1.7	0.54753|0.54753	D|D	0.999984|0.999984	.|D	.|0.67145	.|0.996	.|D	.|0.71414	.|0.973	D|D	0.98474|0.98474	1.0602|1.0602	6|9	.|.	.|.	.|.	.|.	20.4238|20.4238	0.99064|0.99064	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|305	.|P17643	.|TYRP1_HUMAN	V|I	15|305	ENSP00000370529:G15V;ENSP00000370528:G15V|ENSP00000373570:S305I	.|.	G|S	+|+	2|2	0|0	TYRP1|TYRP1	12692271|12692271	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.094000|0.094000	0.18550|0.18550	7.610000|7.610000	0.82949|0.82949	2.834000|2.834000	0.97654|0.97654	0.650000|0.650000	0.86243|0.86243	GGC|AGC			0.423	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055502.3		NM_000550	Missense_Mutation
NPR2	4882	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	35802591	35802591	+	Missense_Mutation	SNP	G	G	A	rs180950551		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr9:35802591G>A	ENST00000342694.2	+	11	2057	c.1802G>A	c.(1801-1803)cGt>cAt	p.R601H		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	601	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TACTGTCCTCGTGGGAGTTTA	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		20827	0.0		0.001	False		,,,				2504	0.0				p.R601H													.	.			0			c.G1802A												101.0	91.0	94.0					9																	35802591		2203	4300	6503	SO:0001583	missense	4882	exon11			GTCCTCGTGGGAG	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.1802G>A	9.37:g.35802591G>A	ENSP00000341083:p.Arg601His		210	0	0		235	0.05	12	NM_003995	13	0.00	0	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	ENST00000342694.2	37	CCDS6590.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	33	5.279268	0.95489	.	.	ENSG00000159899	ENST00000342694	T	0.46451	0.87	5.43	5.43	0.79202	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44902	D	0.000403	T	0.59810	0.2221	L	0.48218	1.51	0.80722	D	1	D;D	0.89917	1.0;0.996	D;P	0.79784	0.993;0.883	T	0.60850	-0.7181	10	0.87932	D	0	.	18.1831	0.89785	0.0:0.0:1.0:0.0	.	601;601	P20594-2;P20594	.;ANPRB_HUMAN	H	601	ENSP00000341083:R601H	ENSP00000341083:R601H	R	+	2	0	NPR2	35792591	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.922000	0.87538	2.722000	0.93159	0.655000	0.94253	CGT	0.001		0.493	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052345.1			
SPATA31D1	389763	broad.mit.edu	37	9	84607496	84607496	+	Missense_Mutation	SNP	G	G	A	rs374319352		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr9:84607496G>A	ENST00000344803.2	+	4	2158	c.2111G>A	c.(2110-2112)cGc>cAc	p.R704H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	704					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGCCTGCCCCGCAGAATCCAT	0.473													G|||	1	0.000199681	0.0	0.0	5008	,	,		19063	0.0		0.0	False		,,,				2504	0.001				p.R704H													FAM75D4,colon,carcinoma,0,4	.		4	0			c.G2111A							G	HIS/ARG	0,3666		0,0,1833	54.0	53.0	54.0		2111	-0.2	0.0	9		54	1,8149		0,1,4074	no	missense	FAM75D1	NM_001001670.2	29	0,1,5907	AA,AG,GG		0.0123,0.0,0.0085	probably-damaging	704/1577	84607496	1,11815	1833	4075	5908	SO:0001583	missense	389763	exon4			TGCCCCGCAGAAT		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2111G>A	9.37:g.84607496G>A	ENSP00000341988:p.Arg704His		251	0	0		331	0.02	5	NM_001001670	0		0		Missense_Mutation	SNP	ENST00000344803.2	37	CCDS47986.1	.	.	.	.	.	.	.	.	.	.	G	9.886	1.203023	0.22121	0.0	1.23E-4	ENSG00000214929	ENST00000344803	T	0.07114	3.22	3.51	-0.228	0.13098	.	1.632710	0.03228	N	0.178529	T	0.05686	0.0149	L	0.27053	0.805	0.09310	N	1	B	0.33549	0.417	B	0.27715	0.082	T	0.36359	-0.9751	10	0.15952	T	0.53	-6.0E-4	6.1571	0.20344	0.4497:0.0:0.5503:0.0	.	704	Q6ZQQ2	F75D1_HUMAN	H	704	ENSP00000341988:R704H	ENSP00000341988:R704H	R	+	2	0	FAM75D1	83797316	0.057000	0.20700	0.003000	0.11579	0.002000	0.02628	0.395000	0.20850	-0.152000	0.11156	-0.459000	0.05422	CGC			0.473	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402325.1		NM_001001670	
BICD2	23299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	95482926	95482926	+	Missense_Mutation	SNP	G	G	C			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr9:95482926G>C	ENST00000375512.3	-	4	785	c.718C>G	c.(718-720)Ctg>Gtg	p.L240V	BICD2_ENST00000356884.6_Missense_Mutation_p.L240V	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	240					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCCTCCTCCAGCTGCCGCTCT	0.582																																					p.L240V													.	.			0			c.C718G												73.0	79.0	77.0					9																	95482926		2203	4300	6503	SO:0001583	missense	23299	exon4			CCTCCAGCTGCCG	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.718C>G	9.37:g.95482926G>C	ENSP00000364662:p.Leu240Val		179	0	0		181	0.10	19	NM_001003800	11	0.18	2	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129259	0.77549	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.61040	0.14;0.14	5.36	3.5	0.40072	.	0.000000	0.64402	D	0.000001	T	0.64114	0.2569	M	0.73962	2.25	0.48975	D	0.999733	P;D	0.54047	0.956;0.964	P;P	0.54856	0.65;0.762	T	0.63404	-0.6645	10	0.54805	T	0.06	-12.8856	4.9189	0.13860	0.1806:0.0:0.6512:0.1682	.	240;240	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	V	240	ENSP00000349351:L240V;ENSP00000364662:L240V	ENSP00000349351:L240V	L	-	1	2	BICD2	94522747	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.671000	0.61590	0.738000	0.32606	0.655000	0.94253	CTG			0.582	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055508.1		NM_015250	
STKLD1	169436	mdanderson.org	37	9	136269921	136269921	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chr9:136269921G>T	ENST00000371957.3	+	17	1848	c.1741G>T	c.(1741-1743)Gcc>Tcc	p.A581S	C9orf96_ENST00000371955.1_Missense_Mutation_p.A114S	NM_153710.3	NP_714921.4	Q8NE28	STKL1_HUMAN		581							ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			autonomic_ganglia(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|stomach(2)	25				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		AGAGCTGGCGGCCTTCAAGGT	0.637																																					p.A581S													.	.			0			c.G1741T												92.0	90.0	91.0					9																	136269921		2203	4300	6503	SO:0001583	missense	169436	exon17			CTGGCGGCCTTCA																												ENST00000371957.3:c.1741G>T	9.37:g.136269921G>T	ENSP00000361025:p.Ala581Ser		39	0	0		48	0.06	3	NM_153710	1	0.00	0	Q5T8U8|Q6ZMP6|Q6ZMQ5	Missense_Mutation	SNP	ENST00000371957.3	37	CCDS35169.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.858368	0.51376	.	.	ENSG00000198870	ENST00000371957;ENST00000371955	T;T	0.51817	0.69;0.77	5.26	4.35	0.52113	Armadillo-like helical (1);Armadillo-type fold (1);	0.179643	0.38959	N	0.001518	T	0.60261	0.2255	L	0.58101	1.795	0.20074	N	0.999932	D	0.89917	1.0	D	0.74674	0.984	T	0.51325	-0.8720	10	0.59425	D	0.04	-29.723	9.115	0.36753	0.0795:0.145:0.7755:0.0	.	581	Q8NE28	SGK71_HUMAN	S	581;114	ENSP00000361025:A581S;ENSP00000361023:A114S	ENSP00000361023:A114S	A	+	1	0	C9orf96	135259742	1.000000	0.71417	0.127000	0.21898	0.375000	0.29983	3.471000	0.53107	2.433000	0.82419	0.655000	0.94253	GCC			0.637	C9orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054855.1			
MT-ND2	4536	hgsc.bcm.edu	37	M	4920	4920	+	Missense_Mutation	SNP	G	G	A			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chrM:4920G>A	ENST00000361453.3	+	1	451	c.451G>A	c.(451-453)Gta>Ata	p.V151I	MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO1_ENST00000361624.2_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA			P03891	NU2M_HUMAN	mitochondrially encoded NADH dehydrogenase 2	151					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|lung(1)	3						CCTCACTAAACGTAAGCCTTC	0.463																																					p.V151M													.	.			0			c.G451A																																									SO:0001583	missense	0	exon1			CTAAACGTAAGCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198763	ENSG00000198763	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7456	protein-coding gene	gene with protein product	"""complex I ND2 subunit"", ""NADH-ubiquinone oxidoreductase chain 2"""	516001	"""NADH dehydrogenase 2"""	MTND2			Standard			Approved	ND2, NAD2		P03891		ENST00000361453.3:c.451G>A	M.37:g.4920G>A	ENSP00000355046:p.Val151Ile		7	0	0		11	0.73	8	ENST00000361453	0		0	Q34769|Q9TGI0|Q9TGI1|Q9TGI2|Q9TGI3|Q9TGI4	Missense_Mutation	SNP	ENST00000361453.3	37																																																																																						0.463	MT-ND2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				YP_003024027	
RIBC1	158787	broad.mit.edu	37	X	53455230	53455230	+	Splice_Site	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chrX:53455230G>T	ENST00000375327.3	+	5	352		c.e5-1		RIBC1_ENST00000414955.2_Intron|RIBC1_ENST00000457095.1_Splice_Site	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1											lung(2)	2						ACCACCCCCAGGTACCAGCCA	0.527																																					.													.	RIBC1	20		0			c.200-1G>T												73.0	64.0	67.0					X																	53455230		2203	4300	6503	SO:0001630	splice_region_variant	158787	exon5			CCCCCAGGTACCA	AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.200-1G>T	X.37:g.53455230G>T			101	0	0		106	0.04	4	NM_144968	0		0	B4E297|E9PDU2|Q5H931|Q96A80	Splice_Site	SNP	ENST00000375327.3	37	CCDS35299.1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624164	0.46840	.	.	ENSG00000158423	ENST00000329209;ENST00000457095;ENST00000375327	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4798	0.84155	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RIBC1	53471955	1.000000	0.71417	0.583000	0.28640	0.705000	0.40729	5.369000	0.66138	2.147000	0.66899	0.513000	0.50165	.			0.527	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056762.1		NM_144968	Intron
EDA2R	60401	broad.mit.edu	37	X	65819573	65819573	+	Missense_Mutation	SNP	G	G	T			TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chrX:65819573G>T	ENST00000374719.3	-	6	703	c.647C>A	c.(646-648)cCt>cAt	p.P216H	EDA2R_ENST00000456230.2_Missense_Mutation_p.P216H|EDA2R_ENST00000450752.1_Missense_Mutation_p.P237H|EDA2R_ENST00000253392.5_Missense_Mutation_p.P237H|EDA2R_ENST00000451436.2_Missense_Mutation_p.P92H|EDA2R_ENST00000396050.1_Missense_Mutation_p.P216H	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	216					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						CTCGAGGATAGGGTTAAGTGG	0.572																																					p.P237H													.	EDA2R	30		0			c.C710A												85.0	51.0	63.0					X																	65819573		2203	4300	6503	SO:0001583	missense	60401	exon6			AGGATAGGGTTAA	AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.647C>A	X.37:g.65819573G>T	ENSP00000363851:p.Pro216His		147	0	0		170	0.03	5	NM_001242310	4	0.00	0	Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	ENST00000374719.3	37	CCDS14386.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392787	0.42410	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000451436;ENST00000253392;ENST00000456230;ENST00000450752	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	3.45	2.51	0.30379	.	0.458353	0.15915	N	0.238415	T	0.29458	0.0734	N	0.24115	0.695	0.19775	N	0.999959	D;D;P	0.89917	1.0;0.998;0.926	D;P;B	0.68353	0.957;0.847;0.423	T	0.03139	-1.1068	10	0.56958	D	0.05	-4.6581	5.5956	0.17325	0.0:0.2122:0.568:0.2198	.	92;237;216	E7EUS4;Q9HAV5-2;Q9HAV5	.;.;TNR27_HUMAN	H	216;216;92;237;216;237	ENSP00000363851:P216H;ENSP00000379365:P216H;ENSP00000253392:P237H;ENSP00000393935:P216H;ENSP00000402929:P237H	ENSP00000253392:P237H	P	-	2	0	EDA2R	65736298	0.457000	0.25752	0.942000	0.38095	0.821000	0.46438	1.385000	0.34408	1.573000	0.49748	0.523000	0.50628	CCT			0.572	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057002.1		NM_021783	
EDA	1896	broad.mit.edu	37	X	69176947	69176947	+	Missense_Mutation	SNP	G	G	A	rs132630314		TCGA-VF-A8AD-01A-11D-A435-10	TCGA-VF-A8AD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	feefbc56-4b2f-46b6-a16f-6b43fd128cb8	435363f1-972b-4055-bf34-528f12078dab	g.chrX:69176947G>A	ENST00000374552.4	+	2	709	c.467G>A	c.(466-468)cGc>cAc	p.R156H	EDA_ENST00000524573.1_Missense_Mutation_p.R156H|EDA_ENST00000374553.2_Missense_Mutation_p.R156H|EDA_ENST00000502251.1_3'UTR	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	156			R -> C (in XHED; abolishes proteolytic processing). {ECO:0000269|PubMed:11279189, ECO:0000269|PubMed:11295832, ECO:0000269|PubMed:18231121}.|R -> G (in XHED). {ECO:0000269|PubMed:20979233}.|R -> H (in XHED; abolishes proteolytic processing). {ECO:0000269|PubMed:11279189, ECO:0000269|PubMed:11295832, ECO:0000269|PubMed:18231121}.|R -> S (in XHED). {ECO:0000269|PubMed:10951256}.		cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						CGTGTTCGCCGCAATAAAAGA	0.358																																					p.R156H													.	EDA	61		0			c.G467A	GRCh37	CM980584	EDA	M	rs132630314							106.0	100.0	102.0					X																	69176947		2203	4300	6503	SO:0001583	missense	1896	exon2			TTCGCCGCAATAA	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.467G>A	X.37:g.69176947G>A	ENSP00000363680:p.Arg156His		347	0	0		398	0.02	6	NM_001399	1	0.00	0	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	37	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451287	0.63290	.	.	ENSG00000158813	ENST00000513754;ENST00000374552;ENST00000374553;ENST00000524573;ENST00000503592	T;T;T;D	0.92397	-0.56;-0.56;-0.56;-3.03	4.97	4.97	0.65823	.	0.305432	0.32473	N	0.006056	D	0.92270	0.7548	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;P;D	0.65573	0.936;0.865;0.936	D	0.92498	0.6006	10	0.59425	D	0.04	-10.4176	12.4634	0.55745	0.0:0.0:1.0:0.0	.	156;156;156	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	H	156;156;156;156;24	ENSP00000363680:R156H;ENSP00000363681:R156H;ENSP00000432585:R156H;ENSP00000423037:R24H	ENSP00000363680:R156H	R	+	2	0	EDA	69093672	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.022000	0.64078	2.434000	0.82447	0.594000	0.82650	CGC			0.358	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000057048.2		NM_001399	
