#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
TAS1R1	80835	mdanderson.org	37	1	6615594	6615594	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:6615594G>T	ENST00000333172.6	+	1	354	c.161G>T	c.(160-162)aGg>aTg	p.R54M	TAS1R1_ENST00000351136.3_Missense_Mutation_p.R54M|TAS1R1_ENST00000328191.4_Missense_Mutation_p.R54M|NOL9_ENST00000377705.5_5'Flank	NM_138697.3	NP_619642.2	Q7RTX1	TS1R1_HUMAN	taste receptor, type 1, member 1	54					detection of chemical stimulus involved in sensory perception of taste (GO:0050912)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(13)|ovary(1)|skin(1)|urinary_tract(2)	29	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;8.73e-34)|all_epithelial(116;9.26e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Breast(487;0.000353)|Renal(390;0.0007)|Colorectal(325;0.00104)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00108)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CTGCAGGTGAGGCACAGACCC	0.612																																					p.R54M													.	.			0			c.G161T												43.0	40.0	41.0					1																	6615594		2182	4270	6452	SO:0001583	missense	80835	exon1			AGGTGAGGCACAG		CCDS81.1, CCDS82.1	1p36.23	2012-08-22	2003-03-24		ENSG00000173662	ENSG00000173662		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14448	protein-coding gene	gene with protein product		606225	"""G protein-coupled receptor 70"""	GPR70			Standard	NM_138697		Approved	T1R1, TR1	uc001ant.3	Q7RTX1	OTTHUMG00000001441	ENST00000333172.6:c.161G>T	1.37:g.6615594G>T	ENSP00000331867:p.Arg54Met		41	0	0		32	0.09	3	NM_177540	1	0.00	0	B2RMX0|Q5SY22|Q5SY24|Q8NGZ7|Q8TDJ7|Q8TDJ8|Q8TDJ9|Q8TDK0	Missense_Mutation	SNP	ENST00000333172.6	37	CCDS81.1	.	.	.	.	.	.	.	.	.	.	G	14.51	2.556590	0.45487	.	.	ENSG00000173662	ENST00000333172;ENST00000328191;ENST00000351136	D;D;D	0.86497	-2.13;-2.13;-2.13	4.28	3.34	0.38264	.	1.714430	0.02952	N	0.141916	D	0.91710	0.7379	L	0.50333	1.59	0.09310	N	1	D;D;D;D	0.76494	0.999;0.994;0.997;0.993	D;D;P;P	0.71414	0.967;0.973;0.873;0.884	T	0.76168	-0.3058	10	0.46703	T	0.11	.	9.8365	0.40973	0.0:0.2087:0.7913:0.0	.	54;54;54;54	Q7RTX1-3;Q7RTX1-4;Q7RTX1-2;Q7RTX1	.;.;.;TS1R1_HUMAN	M	54	ENSP00000331867:R54M;ENSP00000327705:R54M;ENSP00000312558:R54M	ENSP00000327705:R54M	R	+	2	0	TAS1R1	6538181	0.953000	0.32496	0.005000	0.12908	0.061000	0.15899	1.947000	0.40293	0.965000	0.38133	0.455000	0.32223	AGG			0.612	TAS1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000004211.1			
FBXO2	26232	mdanderson.org	37	1	11710791	11710791	+	Silent	SNP	C	C	G	rs61749273		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:11710791C>G	ENST00000354287.4	-	2	464	c.123G>C	c.(121-123)gcG>gcC	p.A41A	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	41					cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CGGCGGCGGccgccgcctcct	0.756																																					p.A41A													.	.			0			c.G123C												2.0	2.0	2.0					1																	11710791		1408	2892	4300	SO:0001819	synonymous_variant	26232	exon2			GGCGGCCGCCGCC	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.123G>C	1.37:g.11710791C>G			17	0	0		9	0.22	2	NM_012168	17	0.29	5	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Silent	SNP	ENST00000354287.4	37	CCDS130.1																																																																																					0.756	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005764.1		NM_012168	
KAZN	23254	hgsc.bcm.edu	37	1	15439098	15439098	+	Intron	SNP	C	C	T	rs114844404		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:15439098C>T	ENST00000376030.2	+	14	2457					NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein						keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						CTTTTTTTCTCCTCCCGGGAG	0.587																																					.													.	.			0			.																																									SO:0001627	intron_variant	200197	.			TTTTCTCCTCCCG	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2163+61C>T	1.37:g.15439098C>T			85	0	0		107	0.18	19	.	10	0.00	0	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	RNA	SNP	ENST00000376030.2	37	CCDS152.2																																																																																					0.587	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000005690.2		NM_001017999	
MYOM3	127294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	24406587	24406587	+	Silent	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:24406587G>A	ENST00000374434.3	-	20	2667	c.2505C>T	c.(2503-2505)ggC>ggT	p.G835G	MYOM3_ENST00000329601.7_Silent_p.G835G|MYOM3_ENST00000330966.7_Silent_p.G836G|RP11-293P20.2_ENST00000439239.2_RNA|MYOM3_ENST00000475306.1_5'Flank|RP11-293P20.4_ENST00000429191.1_RNA	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	835	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.					M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		TGACGTGATAGCCTGTGACAG	0.622																																					p.G835G													.	.			0			c.C2505T												59.0	66.0	63.0					1																	24406587		1954	4148	6102	SO:0001819	synonymous_variant	127294	exon20			GTGATAGCCTGTG	AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2505C>T	1.37:g.24406587G>A			150	0	0		105	0.25	26	NM_152372	0		0	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Silent	SNP	ENST00000374434.3	37	CCDS41281.1																																																																																					0.622	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000008272.2		NM_152372	
SLC9A1	6548	broad.mit.edu	37	1	27436115	27436115	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:27436115T>G	ENST00000263980.3	-	3	1542	c.967A>C	c.(967-969)Acc>Ccc	p.T323P	SLC9A1_ENST00000374086.3_Missense_Mutation_p.T323P|SLC9A1_ENST00000545949.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	323					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	ATGTGGGAGGTAAATCGGGAG	0.607																																					p.T323P													.	SLC9A1	68		0			c.A967C												158.0	147.0	151.0					1																	27436115		2203	4300	6503	SO:0001583	missense	6548	exon3			GGGAGGTAAATCG	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.967A>C	1.37:g.27436115T>G	ENSP00000263980:p.Thr323Pro		79	0.164556962	13		103	0.22	23	NM_003047	82	0.06	5	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	37	CCDS295.1	.	.	.	.	.	.	.	.	.	.	T	32	5.117445	0.94385	.	.	ENSG00000090020	ENST00000263980;ENST00000374086	T;T	0.16897	2.31;2.31	5.96	5.96	0.96718	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	M	0.89715	3.055	0.80722	D	1	D;P	0.63880	0.993;0.91	D;P	0.66351	0.943;0.865	T	0.58736	-0.7584	10	0.87932	D	0	.	15.2621	0.73631	0.0:0.0:0.0:1.0	.	323;323	P19634-2;P19634	.;SL9A1_HUMAN	P	323	ENSP00000263980:T323P;ENSP00000363199:T323P	ENSP00000263980:T323P	T	-	1	0	SLC9A1	27308702	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	8.037000	0.88933	2.285000	0.76669	0.529000	0.55759	ACC			0.607	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012336.2		NM_003047	
COL24A1	255631	mdanderson.org	37	1	86246917	86246917	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:86246917G>T	ENST00000370571.2	-	52	4690	c.4324C>A	c.(4324-4326)Cca>Aca	p.P1442T	COL24A1_ENST00000436319.1_Missense_Mutation_p.P1442T	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	1442	Collagen-like 17.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		CTACCTGTTGGGCCTATTATA	0.328																																					p.P1442T													.	.			0			c.C4324A												120.0	123.0	122.0					1																	86246917		1809	4069	5878	SO:0001583	missense	255631	exon52			CTGTTGGGCCTAT	AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.4324C>A	1.37:g.86246917G>T	ENSP00000359603:p.Pro1442Thr		24	0	0		40	0.08	3	NM_152890	2	0.00	0	C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	ENST00000370571.2	37	CCDS41353.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.089407	0.55968	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.96651	-4.08;-4.08	6.03	6.03	0.97812	.	0.000000	0.41001	N	0.000980	D	0.97353	0.9134	L	0.54323	1.7	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.96022	0.9010	10	0.38643	T	0.18	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	1442;1442	Q17RW2;Q17RW2-2	COOA1_HUMAN;.	T	1442	ENSP00000359603:P1442T;ENSP00000392531:P1442T	ENSP00000359603:P1442T	P	-	1	0	COL24A1	86019505	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	3.965000	0.56788	2.861000	0.98227	0.655000	0.94253	CCA			0.328	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000029335.4		NM_152890	
RORC	6097	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	151783858	151783858	+	Silent	SNP	C	C	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:151783858C>A	ENST00000318247.6	-	10	1445	c.1338G>T	c.(1336-1338)ctG>ctT	p.L446L	RORC_ENST00000480719.1_5'UTR|RORC_ENST00000392697.3_Silent_p.L500L|RORC_ENST00000356728.6_Silent_p.L425L	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	446	Ligand-binding.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGGCCAGCTCCAGATTGTACT	0.532																																					p.L446L													RORC,NS,neuroblastoma,-2,1	RORC	-2	1	0			c.G1338T												160.0	135.0	143.0					1																	151783858		2203	4300	6503	SO:0001819	synonymous_variant	6097	exon10			CAGCTCCAGATTG	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1338G>T	1.37:g.151783858C>A			112	0	0		108	0.19	20	NM_005060	1	0.00	0	Q5SZR9|Q8N5V7|Q8NCY8	Silent	SNP	ENST00000318247.6	37	CCDS1004.1																																																																																					0.532	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036626.1			
RFWD2	64326	broad.mit.edu	37	1	176105674	176105674	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr1:176105674G>T	ENST00000367669.3	-	7	1355	c.841C>A	c.(841-843)Cag>Aag	p.Q281K	RFWD2_ENST00000308769.8_Intron	NM_022457.5	NP_071902.2	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2, E3 ubiquitin protein ligase	281					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin protein ligase activity (GO:0061630)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(17)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						TTCTGGATCTGTTCCAGTTGC	0.333																																					p.Q281K	Ovarian(134;1413 1765 5706 35534 51541)												.	RFWD2	67		0			c.C841A												84.0	79.0	80.0					1																	176105674		2203	4300	6503	SO:0001583	missense	64326	exon7			GGATCTGTTCCAG	AK001278	CCDS30944.1, CCDS44279.1	1q25.1-q25.2	2013-01-09	2012-02-23		ENSG00000143207	ENSG00000143207		"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	17440	protein-coding gene	gene with protein product		608067	"""ring finger and WD repeat domain 2"""			10395541	Standard	XM_005245447		Approved	FLJ10416, COP1, RNF200	uc001gku.1	Q8NHY2	OTTHUMG00000034986	ENST00000367669.3:c.841C>A	1.37:g.176105674G>T	ENSP00000356641:p.Gln281Lys		150	0.0066666667	1		215	0.07	15	NM_022457	112	0.00	0	E9PKI0|Q504W6|Q6H103|Q9H6L7|X5D9B4	Missense_Mutation	SNP	ENST00000367669.3	37	CCDS30944.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653051	0.47362	.	.	ENSG00000143207	ENST00000367665;ENST00000367669	T	0.10668	2.85	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.16385	0.0394	L	0.39147	1.195	0.80722	D	1	P;B;P	0.50819	0.939;0.14;0.713	P;B;P	0.51742	0.578;0.184;0.678	T	0.04481	-1.0948	10	0.08837	T	0.75	-8.8824	18.7791	0.91924	0.0:0.0:1.0:0.0	.	17;41;281	Q8NHY2-3;B1AMD2;Q8NHY2	.;.;RFWD2_HUMAN	K	17;281	ENSP00000356641:Q281K	ENSP00000356637:Q17K	Q	-	1	0	RFWD2	174372297	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.422000	0.80217	2.547000	0.85894	0.650000	0.86243	CAG			0.333	RFWD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084672.2		NM_022457	
DIP2C	22982	mdanderson.org	37	10	395386	395386	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr10:395386T>C	ENST00000280886.6	-	25	3081	c.2994A>G	c.(2992-2994)atA>atG	p.I998M		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	998						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GCGAGTTCGCTATCGCACCCT	0.602																																					p.I998M													.	.			0			c.A2994G												105.0	83.0	91.0					10																	395386		2203	4300	6503	SO:0001583	missense	22982	exon25			GTTCGCTATCGCA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.2994A>G	10.37:g.395386T>C	ENSP00000280886:p.Ile998Met		42	0	0		49	0.08	4	NM_014974	24	0.00	0	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	37	CCDS7054.1	.	.	.	.	.	.	.	.	.	.	T	10.72	1.430871	0.25726	.	.	ENSG00000151240	ENST00000280886	T	0.40756	1.02	5.03	-2.01	0.07410	.	0.051609	0.64402	D	0.000001	T	0.28200	0.0696	N	0.14661	0.345	0.80722	D	1	B	0.25772	0.134	B	0.33392	0.163	T	0.13710	-1.0499	10	0.56958	D	0.05	-27.8585	15.3917	0.74751	0.0:0.0:0.4383:0.5617	.	998	Q9Y2E4	DIP2C_HUMAN	M	998	ENSP00000280886:I998M	ENSP00000280886:I998M	I	-	3	3	DIP2C	385386	0.647000	0.27304	0.846000	0.33378	0.302000	0.27658	-0.245000	0.08890	-0.285000	0.09089	-0.970000	0.02610	ATA			0.602	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046389.1		NM_014974	
ATOH7	220202	mdanderson.org	37	10	69991089	69991089	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr10:69991089A>G	ENST00000373673.3	-	1	782	c.346T>C	c.(346-348)Ttc>Ctc	p.F116L	RP11-153K11.3_ENST00000444086.1_lincRNA	NM_145178.3	NP_660161.1	Q8N100	ATOH7_HUMAN	atonal homolog 7 (Drosophila)	116					cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|neural retina development (GO:0003407)|optic nerve development (GO:0021554)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)										TCGCGGCCGAAGTGCTCACAG	0.672																																					p.F116L													ATOH7,NS,carcinoma,+2,1	ATOH7	2	1	0			c.T346C												30.0	32.0	32.0					10																	69991089		2202	4299	6501	SO:0001583	missense	220202	exon1			GGCCGAAGTGCTC	AF418922	CCDS7276.1	10q22.2	2013-05-21			ENSG00000179774	ENSG00000179774		"""Basic helix-loop-helix proteins"""	13907	protein-coding gene	gene with protein product		609875				11889557	Standard	NM_145178		Approved	Math5, bHLHa13	uc001jnq.3	Q8N100	OTTHUMG00000018346	ENST00000373673.3:c.346T>C	10.37:g.69991089A>G	ENSP00000362777:p.Phe116Leu		28	0	0		48	0.06	3	NM_145178	3	0.00	0		Missense_Mutation	SNP	ENST00000373673.3	37	CCDS7276.1	.	.	.	.	.	.	.	.	.	.	A	15.80	2.940252	0.52972	.	.	ENSG00000179774	ENST00000373673	D	0.97352	-4.35	4.75	3.63	0.41609	Helix-loop-helix DNA-binding (1);	0.716241	0.14171	N	0.336705	D	0.92551	0.7634	L	0.27053	0.805	0.31733	N	0.636769	B	0.02656	0.0	B	0.04013	0.001	D	0.87845	0.2654	9	.	.	.	-10.4922	9.3222	0.37971	0.9135:0.0:0.0865:0.0	.	116	Q8N100	ATOH7_HUMAN	L	116	ENSP00000362777:F116L	.	F	-	1	0	ATOH7	69661095	1.000000	0.71417	0.975000	0.42487	0.966000	0.64601	3.713000	0.54882	0.685000	0.31468	0.459000	0.35465	TTC			0.672	ATOH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048312.1			
NEUROG3	50674	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	10	71332771	71332771	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr10:71332771G>C	ENST00000242462.4	-	2	58	c.29C>G	c.(28-30)aCt>aGt	p.T10S	RP11-343J3.2_ENST00000428753.1_RNA	NM_020999.3	NP_066279.2	Q9Y4Z2	NGN3_HUMAN	neurogenin 3	10					central nervous system development (GO:0007417)|endocrine pancreas development (GO:0031018)|epithelial cell differentiation (GO:0030855)|forebrain development (GO:0030900)|hindbrain development (GO:0030902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|peripheral nervous system development (GO:0007422)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of dendrite morphogenesis (GO:0048814)|spinal cord development (GO:0021510)|transdifferentiation (GO:0060290)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription coactivator activity (GO:0003713)			endometrium(4)|large_intestine(2)|lung(6)|prostate(1)	13						CACTTGGACAGTGGGCGCACC	0.672																																					p.T10S													.	.			0			c.C29G												46.0	51.0	49.0					10																	71332771		2200	4299	6499	SO:0001583	missense	50674	exon2			TGGACAGTGGGCG	AJ133776	CCDS31212.1	10q21.3	2013-05-21			ENSG00000122859	ENSG00000122859		"""Basic helix-loop-helix proteins"""	13806	protein-coding gene	gene with protein product		604882				9000438, 10677506	Standard	NM_020999		Approved	Atoh5, Math4B, ngn3, bHLHa7	uc001jpp.3	Q9Y4Z2	OTTHUMG00000018391	ENST00000242462.4:c.29C>G	10.37:g.71332771G>C	ENSP00000242462:p.Thr10Ser		46	0	0		31	0.23	7	NM_020999	0		0	Q5VVI0|Q6DJX6|Q9BY24	Missense_Mutation	SNP	ENST00000242462.4	37	CCDS31212.1	.	.	.	.	.	.	.	.	.	.	G	5.078	0.200030	0.09652	.	.	ENSG00000122859	ENST00000242462	D	0.94184	-3.37	3.68	1.71	0.24356	.	0.871271	0.09503	U	0.793302	D	0.86887	0.6041	L	0.29908	0.895	0.09310	N	0.999998	B	0.11235	0.004	B	0.08055	0.003	T	0.71823	-0.4476	10	0.17832	T	0.49	4.4535	8.1767	0.31285	0.0:0.1717:0.6511:0.1771	.	10	Q9Y4Z2	NGN3_HUMAN	S	10	ENSP00000242462:T10S	ENSP00000242462:T10S	T	-	2	0	NEUROG3	71002777	0.001000	0.12720	0.005000	0.12908	0.058000	0.15608	0.847000	0.27696	0.471000	0.27319	0.655000	0.94253	ACT			0.672	NEUROG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048464.1		NM_020999	
C10orf76	79591	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	103766354	103766354	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr10:103766354T>C	ENST00000370033.4	-	14	1110	c.991A>G	c.(991-993)Agt>Ggt	p.S331G		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	331						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		GGAGCAGGACTGACAGGGGTC	0.483																																					p.S331G													.	.			0			c.A991G												129.0	138.0	135.0					10																	103766354		1967	4161	6128	SO:0001583	missense	79591	exon14			CAGGACTGACAGG	AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.991A>G	10.37:g.103766354T>C	ENSP00000359050:p.Ser331Gly		66	0	0		70	0.21	15	NM_024541	82	0.40	33	Q2TB87|Q9H8Z9	Missense_Mutation	SNP	ENST00000370033.4	37	CCDS41563.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.189778	0.57909	.	.	ENSG00000120029	ENST00000370033	.	.	.	5.92	4.78	0.61160	.	0.082122	0.85682	D	0.000000	T	0.52757	0.1754	L	0.42245	1.32	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44651	-0.9314	9	0.29301	T	0.29	-2.2685	12.1567	0.54081	0.0:0.0669:0.0:0.9331	.	331	Q5T2E6	CJ076_HUMAN	G	331	.	ENSP00000359050:S331G	S	-	1	0	C10orf76	103756344	0.999000	0.42202	1.000000	0.80357	0.932000	0.56968	3.172000	0.50832	1.059000	0.40554	0.533000	0.62120	AGT			0.483	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050007.1		NM_024541	
FANK1	92565	mdanderson.org	37	10	127585221	127585221	+	Nonsense_Mutation	SNP	C	C	T	rs202109621		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr10:127585221C>T	ENST00000368693.1	+	1	114	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	FANK1_ENST00000368695.1_5'UTR|FANK1_ENST00000449042.2_5'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	4						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				CATGGAGCCCCAGAGTAAGGg	0.756																																					p.Q4X													.	.			0			c.C10T												8.0	12.0	11.0					10																	127585221		2169	4258	6427	SO:0001587	stop_gained	92565	exon1			GAGCCCCAGAGTA	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.10C>T	10.37:g.127585221C>T	ENSP00000357682:p.Gln4*		17	0	0		17	0.12	2	NM_145235	31	0.00	0	Q6UXY9|Q6X7T6	Nonsense_Mutation	SNP	ENST00000368693.1	37	CCDS31309.1	.	.	.	.	.	.	.	.	.	.	C	32	5.122908	0.94429	.	.	ENSG00000203780	ENST00000368693	.	.	.	2.62	1.68	0.24146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11485	T	0.65	.	6.8436	0.23977	0.274:0.726:0.0:0.0	.	.	.	.	X	4	.	ENSP00000357682:Q4X	Q	+	1	0	FANK1	127575211	1.000000	0.71417	0.999000	0.59377	0.552000	0.35366	1.578000	0.36525	0.621000	0.30232	0.462000	0.41574	CAG			0.756	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_145235	
ANO9	338440	mdanderson.org	37	11	431763	431763	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:431763T>C	ENST00000332826.6	-	7	554	c.470A>G	c.(469-471)gAg>gGg	p.E157G		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	157					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						CAGGCGTCCCTCCCCCTGGCT	0.647																																					p.E157G													ANO9,bladder,carcinoma,0,1	ANO9	0	1	0			c.A470G												58.0	58.0	58.0					11																	431763		2203	4298	6501	SO:0001583	missense	338440	exon7			CGTCCCTCCCCCT	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.470A>G	11.37:g.431763T>C	ENSP00000332788:p.Glu157Gly		67	0	0		42	0.07	3	NM_001012302	3	0.00	0	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	37	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.167925	0.57476	.	.	ENSG00000185101	ENST00000332826	T	0.69435	-0.4	4.25	4.25	0.50352	.	1.072170	0.07407	U	0.891802	T	0.56337	0.1978	L	0.29908	0.895	0.23889	N	0.996556	B	0.26577	0.153	B	0.19391	0.025	T	0.41016	-0.9532	10	0.28530	T	0.3	.	12.9873	0.58598	0.0:0.0:0.0:1.0	.	157	A1A5B4	ANO9_HUMAN	G	157	ENSP00000332788:E157G	ENSP00000332788:E157G	E	-	2	0	ANO9	421763	0.078000	0.21339	0.025000	0.17156	0.030000	0.12068	2.690000	0.47001	1.930000	0.55929	0.397000	0.26171	GAG			0.647	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384116.1		NM_001012302	
PIDD1	55367	ucsc.edu;bcgsc.ca	37	11	802246	802246	+	Silent	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:802246G>T	ENST00000347755.5	-	6	1266	c.1125C>A	c.(1123-1125)gcC>gcA	p.A375A	PIDD_ENST00000534649.1_5'Flank|PIDD_ENST00000411829.2_Silent_p.A375A	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					GGCTGAGCAGGGCGTCATGAG	0.706																																					p.A375A													.	PIDD	76		0			c.C1125A												19.0	23.0	22.0					11																	802246		2195	4295	6490	SO:0001819	synonymous_variant	55367	exon6			GAGCAGGGCGTCA																												ENST00000347755.5:c.1125C>A	11.37:g.802246G>T			62	0	0		43	0.09	4	NM_145887	34	0.00	0		Silent	SNP	ENST00000347755.5	37	CCDS7716.1																																																																																					0.706	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257103.1			
MUC6	4588	bcgsc.ca	37	11	1017092	1017092	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:1017092G>C	ENST00000421673.2	-	31	5759	c.5709C>G	c.(5707-5709)agC>agG	p.S1903R		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1903	Approximate repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGGGGATTGGCTGGTCCCAC	0.552																																					p.S1903R													.	MUC6	408		0			c.C5709G												631.0	666.0	654.0					11																	1017092		2201	4280	6481	SO:0001583	missense	4588	exon31			GGATTGGCTGGTC	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5709C>G	11.37:g.1017092G>C	ENSP00000406861:p.Ser1903Arg		246	0.0325203252	8		133	0.09	12	NM_005961	1	0.00	0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	ENST00000421673.2	37	CCDS44513.1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743763	0.30865	.	.	ENSG00000184956	ENST00000421673	T	0.19669	2.13	2.94	-2.72	0.05968	.	.	.	.	.	T	0.30510	0.0767	L	0.55481	1.735	0.09310	N	1	D	0.71674	0.998	D	0.79784	0.993	T	0.15723	-1.0427	9	0.46703	T	0.11	.	1.8545	0.03176	0.2124:0.1539:0.4769:0.1568	.	1903	Q6W4X9	MUC6_HUMAN	R	1903	ENSP00000406861:S1903R	ENSP00000406861:S1903R	S	-	3	2	MUC6	1007092	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.080000	0.11339	-0.740000	0.04803	0.313000	0.20887	AGC			0.552	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
MUC5B	727897	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	1271284	1271284	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:1271284C>T	ENST00000529681.1	+	31	13232	c.13174C>T	c.(13174-13176)Ctc>Ttc	p.L4392F	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.L4395F	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4392	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GACCTGGATCCTCACAGAGCT	0.657																																					p.L4392F													.	.			0			c.C13174T												66.0	80.0	75.0					11																	1271284		2012	4169	6181	SO:0001583	missense	727897	exon31			TGGATCCTCACAG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13174C>T	11.37:g.1271284C>T	ENSP00000436812:p.Leu4392Phe		196	0	0		109	0.30	33	NM_002458	0		0	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	37	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	-	4.142	0.024625	0.08054	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.18016	2.24;2.42	2.12	-3.09	0.05331	.	.	.	.	.	T	0.09202	0.0227	L	0.46157	1.445	0.09310	N	1	P;P	0.40144	0.704;0.561	B;B	0.23419	0.046;0.032	T	0.15378	-1.0439	9	0.87932	D	0	.	2.8115	0.05443	0.2189:0.2668:0.0:0.5144	.	4865;4395	A7Y9J9;E9PBJ0	.;.	F	4392;4395;4336;4242;171	ENSP00000436812:L4392F;ENSP00000415793:L4395F	ENSP00000343037:L4336F	L	+	1	0	MUC5B	1227860	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-0.105000	0.10907	-0.651000	0.05415	0.186000	0.17326	CTC			0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000390041.2		XM_001126093	
ZNF195	7748	mdanderson.org	37	11	3383000	3383000	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:3383000G>T	ENST00000399602.4	-	4	472	c.346C>A	c.(346-348)Ctc>Atc	p.L116I	ZNF195_ENST00000343338.7_Intron|ZNF195_ENST00000429541.2_Intron|ZNF195_ENST00000438262.2_Intron|ZNF195_ENST00000354599.6_Intron|ZNF195_ENST00000005082.9_Missense_Mutation_p.L116I|ZNF195_ENST00000526601.1_Missense_Mutation_p.L120I|ZNF195_ENST00000528796.1_Intron	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	116	Spacer.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		gaaacattgaggcctggctgg	0.493																																					p.L120I													.	.			0			c.C358A												242.0	231.0	235.0					11																	3383000		692	1591	2283	SO:0001583	missense	7748	exon5			CATTGAGGCCTGG		CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.346C>A	11.37:g.3383000G>T	ENSP00000382511:p.Leu116Ile		63	0	0		34	0.09	3	NM_001242841	23	0.00	0	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Missense_Mutation	SNP	ENST00000399602.4	37	CCDS44522.1	.	.	.	.	.	.	.	.	.	.	g	1.558	-0.537352	0.04082	.	.	ENSG00000005801	ENST00000399602;ENST00000005082;ENST00000526601;ENST00000533036	T;T;T;T	0.46063	3.32;3.34;3.34;0.88	0.225	0.225	0.15325	.	.	.	.	.	T	0.40522	0.1120	L	0.41356	1.27	0.09310	N	1	P;P;P	0.37398	0.593;0.593;0.458	P;P;B	0.48114	0.567;0.567;0.364	T	0.36648	-0.9739	8	0.34782	T	0.22	.	.	.	.	.	120;116;116	O14628-6;O14628-5;O14628	.;.;ZN195_HUMAN	I	116;116;120;135	ENSP00000382511:L116I;ENSP00000005082:L116I;ENSP00000435828:L120I;ENSP00000433911:L135I	ENSP00000005082:L116I	L	-	1	0	ZNF195	3339576	0.002000	0.14202	0.003000	0.11579	0.003000	0.03518	0.364000	0.20325	0.300000	0.22699	0.305000	0.20034	CTC			0.493	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000032321.2			
RRP8	23378	mdanderson.org	37	11	6623111	6623111	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:6623111G>A	ENST00000254605.6	-	2	551	c.434C>T	c.(433-435)gCc>gTc	p.A145V	ILK_ENST00000420936.2_5'Flank|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000299421.4_5'Flank|ILK_ENST00000537806.1_5'Flank|RRP8_ENST00000534343.1_Intron|ILK_ENST00000528995.1_5'Flank|ILK_ENST00000396751.2_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	145			A -> P (in dbSNP:rs11040934).		cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						CAGGTGCTGGGCTGAATTTAT	0.463																																					p.A145V													.	.			0			c.C434T												135.0	120.0	125.0					11																	6623111		2201	4296	6497	SO:0001583	missense	23378	exon2			TGCTGGGCTGAAT	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.434C>T	11.37:g.6623111G>A	ENSP00000254605:p.Ala145Val		112	0	0		52	0.06	3	NM_015324	86	0.00	0	Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	37	CCDS31411.1	.	.	.	.	.	.	.	.	.	.	G	7.824	0.718373	0.15372	.	.	ENSG00000132275	ENST00000254605;ENST00000533907	T;T	0.45276	1.51;0.9	4.47	2.62	0.31277	.	0.715551	0.13485	N	0.384408	T	0.26448	0.0646	L	0.27053	0.805	0.09310	N	0.999994	B	0.12013	0.005	B	0.06405	0.002	T	0.15665	-1.0429	10	0.28530	T	0.3	-12.5409	6.6059	0.22726	0.2091:0.0:0.7909:0.0	.	145	O43159	RRP8_HUMAN	V	145	ENSP00000254605:A145V;ENSP00000436246:A145V	ENSP00000254605:A145V	A	-	2	0	RRP8	6579687	0.958000	0.32768	0.089000	0.20774	0.046000	0.14306	1.557000	0.36299	0.835000	0.34877	-0.136000	0.14681	GCC			0.463	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384505.1		NM_015324	
DCHS1	8642	mdanderson.org	37	11	6644407	6644407	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:6644407G>T	ENST00000299441.3	-	21	8911	c.8500C>A	c.(8500-8502)Cac>Aac	p.H2834N	RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	2834	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCCTGCACGTGACCCAAGCTG	0.567																																					p.H2834N													.	.			0			c.C8500A												33.0	29.0	30.0					11																	6644407		2200	4293	6493	SO:0001583	missense	8642	exon21			GCACGTGACCCAA	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.8500C>A	11.37:g.6644407G>T	ENSP00000299441:p.His2834Asn		43	0	0		52	0.08	4	NM_003737	96	0.00	0	O15098	Missense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.527577	0.27299	.	.	ENSG00000166341	ENST00000299441	T	0.60040	0.22	4.97	4.97	0.65823	Cadherin (2);Cadherin-like (1);	0.000000	0.40469	N	0.001088	T	0.46927	0.1418	L	0.38838	1.175	0.30208	N	0.797951	P	0.43231	0.801	B	0.37780	0.258	T	0.49051	-0.8979	10	0.22109	T	0.4	.	16.9706	0.86298	0.0:0.0:1.0:0.0	.	2834	Q96JQ0	PCD16_HUMAN	N	2834	ENSP00000299441:H2834N	ENSP00000299441:H2834N	H	-	1	0	DCHS1	6600983	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	2.918000	0.48829	2.587000	0.87381	0.655000	0.94253	CAC			0.567	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257258.1		NM_003737	
RCN1	5954	mdanderson.org	37	11	32119923	32119923	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:32119923C>A	ENST00000054950.3	+	3	769	c.476C>A	c.(475-477)tCa>tAa	p.S159*	RCN1_ENST00000532942.1_Nonsense_Mutation_p.S108*|RP1-65P5.3_ENST00000533009.1_RNA	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	159					camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					CATGATTCTTCAGATCATCAC	0.463																																					p.S159X													.	.			0			c.C476A												62.0	58.0	59.0					11																	32119923		2202	4299	6501	SO:0001587	stop_gained	5954	exon3			ATTCTTCAGATCA	D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.476C>A	11.37:g.32119923C>A	ENSP00000054950:p.Ser159*		91	0	0		45	0.07	3	NM_002901	116	0.00	0	B7Z1M1|D3DR00	Nonsense_Mutation	SNP	ENST00000054950.3	37	CCDS7876.1	.	.	.	.	.	.	.	.	.	.	c	35	5.562097	0.96527	.	.	ENSG00000049449	ENST00000532942;ENST00000054950	.	.	.	5.72	4.78	0.61160	.	0.287341	0.38326	N	0.001739	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-1.3493	13.8833	0.63693	0.0:0.9242:0.0:0.0758	.	.	.	.	X	108;159	.	ENSP00000054950:S159X	S	+	2	0	RCN1	32076499	0.667000	0.27484	0.234000	0.24042	0.440000	0.31957	2.382000	0.44345	1.370000	0.46153	0.591000	0.81541	TCA			0.463	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388510.1		NM_002901	
SLC15A3	51296	mdanderson.org	37	11	60718930	60718930	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:60718930G>A	ENST00000227880.3	-	1	327	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W		NM_016582.2	NP_057666.1	Q8IY34	S15A3_HUMAN	solute carrier family 15 (oligopeptide transporter), member 3	32					ion transport (GO:0006811)|peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	symporter activity (GO:0015293)			central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(9)|prostate(2)	17						cccgccgcccgccgccaccgt	0.766																																					p.R32W													.	.			0			c.C94T												1.0	1.0	1.0					11																	60718930		882	1792	2674	SO:0001583	missense	51296	exon1			CCGCCCGCCGCCA	AB020598	CCDS7998.1	11q12.2	2013-07-18	2013-07-18		ENSG00000110446	ENSG00000110446		"""Solute carriers"""	18068	protein-coding gene	gene with protein product		610408	"""solute carrier family 15, member 3"""			11336635, 11741232	Standard	NM_016582		Approved	PHT2, hPTR3	uc001nqn.2	Q8IY34	OTTHUMG00000167804	ENST00000227880.3:c.94C>T	11.37:g.60718930G>A	ENSP00000227880:p.Arg32Trp		20	0	0		25	0.12	3	NM_016582	2	0.00	0	Q9P2X9	Missense_Mutation	SNP	ENST00000227880.3	37	CCDS7998.1	.	.	.	.	.	.	.	.	.	.	g	23.6	4.437102	0.83885	.	.	ENSG00000110446	ENST00000227880;ENST00000442626	T	0.56941	0.43	3.33	2.29	0.28610	Major facilitator superfamily domain, general substrate transporter (1);	.	.	.	.	T	0.27384	0.0672	N	0.05592	-0.015	0.32065	N	0.595153	B;B	0.18310	0.027;0.009	B;B	0.10450	0.005;0.002	T	0.24941	-1.0146	9	0.29301	T	0.29	-5.9983	5.5114	0.16882	0.0:0.1821:0.4881:0.3298	.	32;32	F5H1C8;Q8IY34	.;S15A3_HUMAN	W	32	ENSP00000227880:R32W	ENSP00000227880:R32W	R	-	1	2	SLC15A3	60475506	0.370000	0.25047	0.450000	0.26969	0.864000	0.49448	1.333000	0.33816	1.593000	0.50029	0.479000	0.44913	CGG			0.766	SLC15A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396366.1		NM_016582	
SIPA1	6494	mdanderson.org	37	11	65408903	65408903	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:65408903G>T	ENST00000394224.3	+	2	807	c.511G>T	c.(511-513)Ggt>Tgt	p.G171C	SIPA1_ENST00000534313.1_Missense_Mutation_p.G171C|SIPA1_ENST00000394227.3_Missense_Mutation_p.G171C|SIPA1_ENST00000527525.1_Missense_Mutation_p.G171C	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	171					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						TGAGCTCGGGGGTGAGGGTGA	0.672																																					p.G171C													.	.			0			c.G511T												57.0	62.0	60.0					11																	65408903		2201	4297	6498	SO:0001583	missense	6494	exon2			CTCGGGGGTGAGG	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.511G>T	11.37:g.65408903G>T	ENSP00000377771:p.Gly171Cys		44	0	0		21	0.10	2	NM_006747	29	0.00	0	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	ENST00000394224.3	37	CCDS8108.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072343	0.76415	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.88664	-2.41;-2.39;-2.41;-2.39	5.04	5.04	0.67666	.	0.214559	0.26915	U	0.021855	D	0.94062	0.8097	M	0.79011	2.435	0.46631	D	0.99913	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.936	D	0.94659	0.7846	10	0.87932	D	0	-11.2781	16.2454	0.82441	0.0:0.0:1.0:0.0	.	171;171	F6RY50;Q96FS4	.;SIPA1_HUMAN	C	171	ENSP00000436269:G171C;ENSP00000433686:G171C;ENSP00000377771:G171C;ENSP00000377774:G171C	ENSP00000377771:G171C	G	+	1	0	SIPA1	65165479	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.811000	0.62606	2.515000	0.84797	0.555000	0.69702	GGT			0.672	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390356.1		NM_006747	
CPT1A	1374	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	11	68527806	68527806	+	Splice_Site	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:68527806C>T	ENST00000265641.5	-	17	2183	c.2029G>A	c.(2029-2031)Gtt>Att	p.V677I	CPT1A_ENST00000540367.1_Splice_Site_p.V677I|CPT1A_ENST00000376618.2_Splice_Site_p.V677I|CPT1A_ENST00000539743.1_Splice_Site_p.V677I|CPT1A_ENST00000537756.2_5'Flank	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	677					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	TCAGATAAAACCTATTGAGTG	0.493																																					p.V677I													.	.			0			c.G2029A												58.0	51.0	54.0					11																	68527806		2200	4294	6494	SO:0001630	splice_region_variant	1374	exon17			ATAAAACCTATTG	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.2029-1G>A	11.37:g.68527806C>T			182	0	0		95	0.09	9	NM_001876	90	0.03	3	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	37	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404696	0.83230	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89270	-2.49;-2.49;-2.49;-2.49	4.25	4.25	0.50352	.	0.061993	0.64402	N	0.000004	D	0.93138	0.7815	M	0.70275	2.135	0.80722	D	1	D;D	0.69078	0.99;0.997	D;D	0.65987	0.94;0.94	D	0.92414	0.5940	10	0.36615	T	0.2	.	17.2414	0.87014	0.0:1.0:0.0:0.0	.	677;677	P50416;P50416-2	CPT1A_HUMAN;.	I	677	ENSP00000439084:V677I;ENSP00000365803:V677I;ENSP00000265641:V677I;ENSP00000446108:V677I	ENSP00000265641:V677I	V	-	1	0	CPT1A	68284382	1.000000	0.71417	0.901000	0.35422	0.855000	0.48748	7.308000	0.78929	2.369000	0.80426	0.655000	0.94253	GTT			0.493	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000397457.2		NM_001876	Missense_Mutation
IL18BP	10068	mdanderson.org	37	11	71711470	71711470	+	Silent	SNP	G	G	A	rs202132601	byFrequency	TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:71711470G>A	ENST00000393703.4	+	3	639	c.102G>A	c.(100-102)tcG>tcA	p.S34S	IL18BP_ENST00000337131.5_Silent_p.S34S|IL18BP_ENST00000497194.2_Silent_p.S34S|IL18BP_ENST00000531053.1_Silent_p.S34S|IL18BP_ENST00000393705.4_Silent_p.S34S|IL18BP_ENST00000404792.1_Silent_p.S34S|IL18BP_ENST00000260049.5_Silent_p.S34S|IL18BP_ENST00000393707.4_Silent_p.S34S	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein	34					cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						CACCTGTCTCGCAGACCACCA	0.602													G|||	2	0.000399361	0.0	0.0029	5008	,	,		15967	0.0		0.0	False		,,,				2504	0.0				p.S34S													.	.			0			c.G102A							G	,,,,,,	0,4262		0,0,2131	80.0	93.0	88.0		102,102,102,102,102,102,102	-0.9	0.0	11		88	3,8487		0,3,4242	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	IL18BP	NM_001039659.1,NM_001039660.1,NM_001145055.1,NM_001145057.1,NM_005699.3,NM_173042.2,NM_173044.2	,,,,,,	0,3,6373	AA,AG,GG		0.0353,0.0,0.0235	,,,,,,	34/195,34/195,34/116,34/195,34/200,34/195,34/164	71711470	3,12749	2131	4245	6376	SO:0001819	synonymous_variant	10068	exon3			TGTCTCGCAGACC	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	ENST00000393703.4:c.102G>A	11.37:g.71711470G>A			64	0	0		37	0.08	3	NM_001039660	156	0.00	0	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Silent	SNP	ENST00000393703.4	37	CCDS8206.2																																																																																			0.001		0.602	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000258012.2		NM_173042	
INTS4	92105	broad.mit.edu	37	11	77635932	77635932	+	Missense_Mutation	SNP	A	A	C	rs148749715		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:77635932A>C	ENST00000534064.1	-	12	1412	c.1378T>G	c.(1378-1380)Tcc>Gcc	p.S460A	INTS4_ENST00000529807.1_Missense_Mutation_p.S460A|INTS4_ENST00000525931.1_5'UTR	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	460					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ATATCTCTGGATGAATCCTTT	0.398																																					p.S460A													.	INTS4	89		0			c.T1378G							A	ALA/SER	2,4376		0,2,2187	21.0	22.0	22.0		1378	4.5	1.0	11	dbSNP_134	22	0,8568		0,0,4284	no	missense	INTS4	NM_033547.3	99	0,2,6471	CC,CA,AA		0.0,0.0457,0.0154	benign	460/964	77635932	2,12944	2189	4284	6473	SO:0001583	missense	92105	exon12			CTCTGGATGAATC	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1378T>G	11.37:g.77635932A>C	ENSP00000434466:p.Ser460Ala		285	0.0070175439	2		202	0.01	3	NM_033547	66	0.00	0	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119484	0.77323	4.57E-4	0.0	ENSG00000149262	ENST00000534064;ENST00000354849;ENST00000529807	T;T	0.43294	0.95;1.52	4.51	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.66297	2.02	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	T	0.65709	-0.6102	10	0.66056	D	0.02	-2.9581	14.2909	0.66278	1.0:0.0:0.0:0.0	.	460	Q96HW7	INT4_HUMAN	A	460;311;460	ENSP00000434466:S460A;ENSP00000433644:S460A	ENSP00000346913:S311A	S	-	1	0	INTS4	77313580	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.579000	0.90781	2.015000	0.59207	0.397000	0.26171	TCC			0.398	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390927.1		NM_033547	
TTC12	54970	mdanderson.org	37	11	113233143	113233143	+	Silent	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:113233143C>T	ENST00000529221.1	+	19	1740	c.1635C>T	c.(1633-1635)agC>agT	p.S545S	TTC12_ENST00000314756.3_Silent_p.S545S|TTC12_ENST00000483239.2_Silent_p.S551S|TTC12_ENST00000393020.1_Silent_p.S545S	NM_017868.3	NP_060338.3	Q9H892	TTC12_HUMAN	tetratricopeptide repeat domain 12	545										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		all_cancers(61;2.73e-16)|all_epithelial(67;8.64e-10)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.183)|Renal(330;0.187)		BRCA - Breast invasive adenocarcinoma(274;5.3e-06)|Epithelial(105;8.37e-05)|all cancers(92;0.000694)		GTGTTCTGAGCCGGACCCTTT	0.428																																					p.S545S													.	.			0			c.C1635T												94.0	98.0	97.0					11																	113233143		2201	4296	6497	SO:0001819	synonymous_variant	54970	exon19			TCTGAGCCGGACC	AK000542	CCDS8360.2	11q23.2	2013-01-10			ENSG00000149292	ENSG00000149292		"""Tetratricopeptide (TTC) repeat domain containing"""	23700	protein-coding gene	gene with protein product		610732				12964006	Standard	XM_005271607		Approved	FLJ13859, FLJ20535, TPARM	uc001pnu.3	Q9H892	OTTHUMG00000142832	ENST00000529221.1:c.1635C>T	11.37:g.113233143C>T			49	0	0		41	0.07	3	NM_017868	28	0.00	0	Q8N5H9|Q9NWY3	Silent	SNP	ENST00000529221.1	37	CCDS8360.2																																																																																					0.428	TTC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286455.2		NM_017868	
C2CD2L	9854	broad.mit.edu	37	11	118984835	118984835	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:118984835G>A	ENST00000528586.1	+	9	983	c.913G>A	c.(913-915)Gca>Aca	p.A305T	C2CD2L_ENST00000336702.3_Missense_Mutation_p.A558T			O14523	C2C2L_HUMAN	C2CD2-like	557						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)	13						GGGCTATGCGGCATCCCTGGA	0.617																																					p.A558T													.	C2CD2L	39		0			c.G1672A												111.0	111.0	111.0					11																	118984835		2200	4295	6495	SO:0001583	missense	9854	exon13			TATGCGGCATCCC	AK025223	CCDS8413.1	11q23.3	2008-04-22	2008-04-22	2008-04-22		ENSG00000172375			29000	protein-coding gene	gene with protein product			"""transmembrane protein 24"""	TMEM24		15289880	Standard	XM_005271738		Approved	KIAA0285	uc001pvn.3	O14523		ENST00000528586.1:c.913G>A	11.37:g.118984835G>A	ENSP00000433600:p.Ala305Thr		60	0	0		45	0.07	3	NM_014807	18	0.00	0	Q86UT7|Q86V04|Q8N522|Q8TBN4|Q96G10	Missense_Mutation	SNP	ENST00000528586.1	37		.	.	.	.	.	.	.	.	.	.	G	33	5.232485	0.95207	.	.	ENSG00000172375	ENST00000336702;ENST00000528586	T;T	0.44083	0.93;0.93	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.60676	0.2287	L	0.49350	1.555	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.61554	-0.7039	10	0.72032	D	0.01	2.3648	18.0563	0.89365	0.0:0.0:1.0:0.0	.	557;558	O14523;O14523-2	C2C2L_HUMAN;.	T	558;305	ENSP00000338885:A558T;ENSP00000433600:A305T	ENSP00000338885:A558T	A	+	1	0	C2CD2L	118490045	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.735000	0.91549	2.798000	0.96311	0.655000	0.94253	GCA			0.617	C2CD2L-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000388199.2		NM_014807	
PRDM10	56980	mdanderson.org	37	11	129785738	129785738	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr11:129785738G>T	ENST00000360871.3	-	16	2574	c.2343C>A	c.(2341-2343)agC>agA	p.S781R	PRDM10_ENST00000528746.1_Missense_Mutation_p.S755R|PRDM10_ENST00000423662.2_Missense_Mutation_p.S699R|PRDM10_ENST00000358825.5_Missense_Mutation_p.S785R|PRDM10_ENST00000526082.1_Missense_Mutation_p.S699R|PRDM10_ENST00000304538.6_Missense_Mutation_p.S695R	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	785					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CTTTGCGCTTGCTGGCACTTT	0.493																																					p.S785R													.	.			0			c.C2355A												91.0	90.0	90.0					11																	129785738		2201	4297	6498	SO:0001583	missense	56980	exon17			GCGCTTGCTGGCA	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.2343C>A	11.37:g.129785738G>T	ENSP00000354118:p.Ser781Arg		71	0	0		39	0.08	3	NM_020228	17	0.00	0	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	37	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682978	0.68157	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;2.8;1.47;2.8;1.47	5.97	2.11	0.27256	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);	0.038650	0.85682	D	0.000000	T	0.39545	0.1082	L	0.29908	0.895	0.54753	D	0.99998	D;D;D;D;D;D	0.76494	0.97;0.963;0.97;0.963;0.999;0.963	P;P;P;P;D;P	0.79108	0.8;0.698;0.8;0.698;0.992;0.698	T	0.12993	-1.0526	10	0.87932	D	0	-26.5601	10.4623	0.44587	0.2569:0.0:0.7431:0.0	.	695;781;785;699;695;699	B7ZL72;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;PRD10_HUMAN;.;.;.	R	785;695;781;699;755;699;498	ENSP00000351686:S785R;ENSP00000302669:S695R;ENSP00000354118:S781R;ENSP00000398431:S699R;ENSP00000431262:S755R;ENSP00000432237:S699R;ENSP00000435940:S498R	ENSP00000302669:S695R	S	-	3	2	PRDM10	129290948	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.937000	0.40193	0.150000	0.19136	0.655000	0.94253	AGC			0.493	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386076.1		NM_199437	
WNK1	65125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	968427	968427	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:968427C>T	ENST00000315939.6	+	6	2060	c.1417C>T	c.(1417-1419)Ctt>Ttt	p.L473F	WNK1_ENST00000535572.1_Missense_Mutation_p.L473F|WNK1_ENST00000530271.2_Missense_Mutation_p.L473F|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000340908.4_Missense_Mutation_p.L66F|WNK1_ENST00000537687.1_Missense_Mutation_p.L473F	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	473	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CATCAAAGACCTTTTGAACCA	0.338																																					p.L473F	Colon(19;451 567 6672 12618 28860)												.	.			0			c.C1417T												62.0	66.0	64.0					12																	968427		2203	4299	6502	SO:0001583	missense	65125	exon6			AAAGACCTTTTGA	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1417C>T	12.37:g.968427C>T	ENSP00000313059:p.Leu473Phe		217	0	0		556	0.08	44	NM_001184985	282	0.06	18	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	37	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.874622	0.91664	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000530271;ENST00000340908	T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;1.53	5.94	5.04	0.67666	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000017	D	0.82710	0.5096	M	0.84326	2.69	0.47621	D	0.999471	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84857	0.0817	10	0.87932	D	0	-16.6442	15.5425	0.76066	0.0:0.9329:0.0:0.0671	.	473;473	F5GWT4;Q9H4A3	.;WNK1_HUMAN	F	473;473;473;473;66	ENSP00000441972:L473F;ENSP00000313059:L473F;ENSP00000444465:L473F;ENSP00000433548:L473F;ENSP00000341292:L66F	ENSP00000313059:L473F	L	+	1	0	WNK1	838688	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.807000	0.96579	0.591000	0.81541	CTT			0.338	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206683.1		NM_018979	
RHNO1	83695	broad.mit.edu	37	12	2997087	2997087	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:2997087A>T	ENST00000489288.2	+	3	331	c.179A>T	c.(178-180)gAt>gTt	p.D60V	TULP3_ENST00000397132.2_5'Flank|RHNO1_ENST00000461997.2_Missense_Mutation_p.D46V|RHNO1_ENST00000464682.2_3'UTR|TULP3_ENST00000448120.2_5'Flank	NM_001252499.2|NM_001257097.1|NM_001257098.1	NP_001239428.1|NP_001244026.1|NP_001244027.1	Q9BSD3	RHNO1_HUMAN	RAD9-HUS1-RAD1 interacting nuclear orphan 1	60					cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|positive regulation of G0 to G1 transition (GO:0070318)|recombinational repair (GO:0000725)	chromosome (GO:0005694)|nucleus (GO:0005634)											GTATCACCTGATTTTGATACA	0.433																																					p.D60V													.	.			0			c.A179T												45.0	42.0	43.0					12																	2997087		2203	4300	6503	SO:0001583	missense	83695	exon3			CACCTGATTTTGA	AK021945	CCDS8518.1, CCDS58199.1	12p13.33	2012-08-23	2012-08-23	2012-08-23	ENSG00000171792	ENSG00000171792			28206	protein-coding gene	gene with protein product	"""Rad9, Rad1, Hus1 interacting nuclear orphan"""	614085	"""chromosome 12 open reading frame 32"""	C12orf32		20811708, 21659603	Standard	NM_001252499		Approved	HKMT1188, MGC13204, RHINO	uc031qfq.1	Q9BSD3	OTTHUMG00000158557	ENST00000489288.2:c.179A>T	12.37:g.2997087A>T	ENSP00000438590:p.Asp60Val		99	0.0808080808	8		254	0.11	27	NM_001257098	487	0.00	1	B7Z989	Missense_Mutation	SNP	ENST00000489288.2	37	CCDS8518.1	.	.	.	.	.	.	.	.	.	.	A	13.14	2.149132	0.37923	.	.	ENSG00000171792	ENST00000538636;ENST00000461997;ENST00000489288;ENST00000366285;ENST00000538700	.	.	.	5.42	5.42	0.78866	.	0.340042	0.28420	N	0.015408	T	0.56262	0.1973	.	.	.	0.80722	D	1	B;B	0.25169	0.119;0.119	B;B	0.26416	0.069;0.069	T	0.58053	-0.7704	8	0.72032	D	0.01	0.0038	11.8673	0.52501	1.0:0.0:0.0:0.0	.	46;60	B7Z989;Q9BSD3	.;RHINO_HUMAN	V	60;46;60;60;60	.	ENSP00000444654:D60V	D	+	2	0	C12orf32	2867348	1.000000	0.71417	1.000000	0.80357	0.489000	0.33432	4.549000	0.60726	2.050000	0.60909	0.482000	0.46254	GAT			0.433	RHNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351286.2		NM_031465	
WBP11	51729	broad.mit.edu	37	12	14941901	14941901	+	Silent	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:14941901A>G	ENST00000261167.2	-	11	1709	c.1476T>C	c.(1474-1476)ccT>ccC	p.P492P		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	492	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GTGCAGGGGGAGGTAGCCTTG	0.542																																					p.P492P													.	WBP11	66		0			c.T1476C												12.0	15.0	14.0					12																	14941901		2201	4295	6496	SO:0001819	synonymous_variant	51729	exon11			AGGGGGAGGTAGC	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1476T>C	12.37:g.14941901A>G			113	0.017699115	2		279	0.02	6	NM_016312	1037	0.01	9	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.542	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
WBP11	51729	broad.mit.edu	37	12	14941934	14941934	+	Silent	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:14941934A>G	ENST00000261167.2	-	11	1676	c.1443T>C	c.(1441-1443)ggT>ggC	p.G481G		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	481	Pro-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						GAGGAGGGGGACCAGGAGGCA	0.582																																					p.G481G													.	WBP11	66		0			c.T1443C												18.0	21.0	20.0					12																	14941934		2203	4300	6503	SO:0001819	synonymous_variant	51729	exon11			AGGGGGACCAGGA	AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.1443T>C	12.37:g.14941934A>G			93	0	0		246	0.02	4	NM_016312	1043	0.01	10	Q96AY8	Silent	SNP	ENST00000261167.2	37	CCDS8666.1																																																																																					0.582	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400850.1		NM_016312	
RP11-405A12.2	0	broad.mit.edu	37	12	20096041	20096042	+	lincRNA	INS	-	-	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:20096041_20096042insA	ENST00000535764.1	+	0	212																											AACAAGCTGTTAAAAAAAAAAT	0.307																																					.													.	.			0			.																																											0	.			AGCTGTTAAAAAA																													12.37:g.20096051_20096051dupA			32	0	0		87	0.09	8	.	0		0		RNA	INS	ENST00000535764.1	37																																																																																						0.307	RP11-405A12.2-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000401672.1			
KRAS	3845	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	25398285	25398285	+	Missense_Mutation	SNP	C	C	G	rs121913530		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:25398285C>G	ENST00000256078.4	-	2	97	c.34G>C	c.(34-36)Ggt>Cgt	p.G12R	KRAS_ENST00000556131.1_Missense_Mutation_p.G12R|KRAS_ENST00000557334.1_Missense_Mutation_p.G12R|KRAS_ENST00000311936.3_Missense_Mutation_p.G12R	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12C(3001)|p.G12S(1288)|p.G12R(789)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12W(3)|p.A11_G12insGA(2)|p.G12Y(2)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			CCTACGCCACCAGCTCCAACT	0.348	G12C(CALU1_LUNG)|G12C(HCC44_LUNG)|G12C(IALM_LUNG)|G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(KYSE410_OESOPHAGUS)|G12C(LU65_LUNG)|G12C(LU99_LUNG)|G12C(MIAPACA2_PANCREAS)|G12C(NCIH1373_LUNG)|G12C(NCIH1792_LUNG)|G12C(NCIH2030_LUNG)|G12C(NCIH2122_LUNG)|G12C(NCIH23_LUNG)|G12C(NCIH358_LUNG)|G12C(OV56_OVARY)|G12C(SW1463_LARGE_INTESTINE)|G12C(SW1573_LUNG)|G12C(SW837_LARGE_INTESTINE)|G12C(UMUC3_URINARY_TRACT)|G12R(CAL62_THYROID)|G12R(HS274T_BREAST)|G12R(HUPT3_PANCREAS)|G12R(KP2_PANCREAS)|G12R(PSN1_PANCREAS)|G12R(TCCPAN2_PANCREAS)|G12S(A549_LUNG)|G12S(KMS20_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(LS123_LARGE_INTESTINE)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12R	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)			Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,+1,25136	KRAS_ENST00000256078	1	25136	5144	Substitution - Missense(5142)|Insertion - In frame(2)	large_intestine(2360)|lung(1649)|pancreas(656)|biliary_tract(125)|ovary(56)|endometrium(54)|haematopoietic_and_lymphoid_tissue(49)|thyroid(42)|stomach(21)|cervix(19)|upper_aerodigestive_tract(17)|urinary_tract(17)|soft_tissue(15)|small_intestine(13)|prostate(11)|breast(9)|skin(8)|testis(7)|liver(6)|oesophagus(3)|peritoneum(1)|autonomic_ganglia(1)|kidney(1)|central_nervous_system(1)|NS(1)|penis(1)|adrenal_gland(1)	c.G34C	GRCh37	CM076251	KRAS	M	rs121913530							93.0	83.0	86.0					12																	25398285		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	CGCCACCAGCTCC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.34G>C	12.37:g.25398285C>G	ENSP00000256078:p.Gly12Arg		179	0	0		660	0.05	34	NM_004985	214	0.12	26	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	37	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.930538	0.92389	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.84893	0.5573	M	0.84082	2.675	0.80722	D	1	P;P	0.43287	0.802;0.741	B;P	0.47941	0.36;0.562	D	0.86658	0.1902	10	0.66056	D	0.02	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	R	12	ENSP00000308495:G12R;ENSP00000452512:G12R;ENSP00000256078:G12R;ENSP00000451856:G12R	ENSP00000256078:G12R	G	-	1	0	KRAS	25289552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT			0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000412232.1		NM_033360	
MUC19	283463	bcgsc.ca;mdanderson.org	37	12	40805858	40805858	+	5'UTR	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:40805858T>C	ENST00000454784.4	+	0	183				RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TGGTAGTTCATCCTCTGGTGA	0.418																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	283463	.			AGTTCATCCTCTG	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.-551T>C	12.37:g.40805858T>C			52	0	0		41	0.15	6	.	0		0	Q8NA85	Missense_Mutation	SNP	ENST00000454784.4	37		.	.	.	.	.	.	.	.	.	.	T	10.44	1.350351	0.24512	.	.	ENSG00000205592	ENST00000425730	.	.	.	2.92	0.481	0.16809	.	.	.	.	.	T	0.18964	0.0455	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.20672	-1.0268	6	0.44086	T	0.13	.	2.2635	0.04073	0.2472:0.1413:0.0:0.6115	.	.	.	.	P	44	.	ENSP00000395253:S44P	S	+	1	0	MUC19	39092125	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.105000	0.15333	0.074000	0.16767	0.533000	0.62120	TCC			0.418	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000384257.6		XM_003403524	
ATF7	11016	mdanderson.org	37	12	53927032	53927032	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr12:53927032C>T	ENST00000548446.2	-	7	717	c.605G>A	c.(604-606)gGc>gAc	p.G202D	ATF7_ENST00000456903.4_Missense_Mutation_p.G191D|ATF7_ENST00000420353.2_Missense_Mutation_p.G191D|ATF7_ENST00000328463.7_Missense_Mutation_p.G202D|RP11-793H13.10_ENST00000591834.1_Missense_Mutation_p.G191D|ATF7_ENST00000415113.1_Missense_Mutation_p.G170D			P17544	ATF7_HUMAN	activating transcription factor 7	202	Transactivation domain.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9					Pseudoephedrine(DB00852)	AGGGAGGGAGCCAGTGGGAGA	0.473																																					p.G191D													.	.			0			c.G572A												66.0	66.0	66.0					12																	53927032		1984	4160	6144	SO:0001583	missense	11016	exon7			AGGGAGCCAGTGG	X52943	CCDS44906.1, CCDS58238.1	12q13	2013-01-10				ENSG00000170653		"""basic leucine zipper proteins"""	792	protein-coding gene	gene with protein product		606371				1694576, 11278933	Standard	NM_006856		Approved	ATFA	uc001sdz.3	P17544	OTTHUMG00000169776	ENST00000548446.2:c.605G>A	12.37:g.53927032C>T	ENSP00000449938:p.Gly202Asp		83	0	0		105	0.05	5	NM_006856	30	0.00	0	A5D6Y4|B2RMP1|B4DQL4|Q13814|Q8IVR8|Q9UD83	Missense_Mutation	SNP	ENST00000548446.2	37		.	.	.	.	.	.	.	.	.	.	C	17.53	3.412047	0.62511	.	.	ENSG00000170653	ENST00000548446;ENST00000328463;ENST00000415113;ENST00000420353;ENST00000456903	T;T;T;T;T	0.54675	0.56;0.56;0.62;0.6;0.6	4.87	3.97	0.46021	.	0.251760	0.47093	D	0.000256	T	0.53126	0.1777	M	0.62723	1.935	0.38038	D	0.93538	P;B;P	0.44429	0.835;0.18;0.628	B;B;B	0.42282	0.347;0.025;0.382	T	0.64914	-0.6295	10	0.66056	D	0.02	-14.4401	14.5721	0.68218	0.0:0.8525:0.1475:0.0	.	170;191;202	P17544-2;B2RMP1;P17544	.;.;ATF7_HUMAN	D	202;202;170;191;191	ENSP00000449938:G202D;ENSP00000329212:G202D;ENSP00000404880:G170D;ENSP00000399465:G191D;ENSP00000387406:G191D	ENSP00000329212:G202D	G	-	2	0	ATF7	52213299	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.787000	0.75099	1.407000	0.46875	-0.304000	0.09214	GGC			0.473	ATF7-007	KNOWN	NMD_exception|basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000406302.2		NM_001130059	
MTIF3	219402	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	28014201	28014201	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr13:28014201G>T	ENST00000381116.1	-	5	619	c.385C>A	c.(385-387)Cag>Aag	p.Q129K	MTIF3_ENST00000381120.3_Missense_Mutation_p.Q129K|MTIF3_ENST00000461838.1_5'UTR|MTIF3_ENST00000431572.2_Missense_Mutation_p.Q129K|MTIF3_ENST00000405591.2_Missense_Mutation_p.Q129K			Q9H2K0	IF3M_HUMAN	mitochondrial translational initiation factor 3	129					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7		Lung SC(185;0.0161)	Colorectal(13;0.00042)|READ - Rectum adenocarcinoma(15;0.105)	all cancers(112;0.108)|OV - Ovarian serous cystadenocarcinoma(117;0.157)		GTCATGAGCTGATACTCTGCA	0.512																																					p.Q129K													.	.			0			c.C385A												115.0	96.0	102.0					13																	28014201		2203	4300	6503	SO:0001583	missense	219402	exon4			TGAGCTGATACTC	BC046166	CCDS9322.1	13q12.2	2007-05-03			ENSG00000122033	ENSG00000122033			29788	protein-coding gene	gene with protein product						12095986	Standard	NM_152912		Approved	IF-3mt, IF3(mt)	uc001uri.3	Q9H2K0	OTTHUMG00000016633	ENST00000381116.1:c.385C>A	13.37:g.28014201G>T	ENSP00000370508:p.Gln129Lys		120	0	0		110	0.42	46	NM_001166263	131	0.40	53	Q05BL8|Q5W0V0|Q86X68	Missense_Mutation	SNP	ENST00000381116.1	37	CCDS9322.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529294	0.44969	.	.	ENSG00000122033	ENST00000431572;ENST00000405591;ENST00000381116;ENST00000381120	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.82	5.82	0.92795	Translation initiation factor 3, N-terminal (3);	0.251014	0.40302	N	0.001122	T	0.24275	0.0588	L	0.55990	1.75	0.33145	D	0.54492	P	0.47034	0.889	B	0.43658	0.426	T	0.11372	-1.0590	10	0.02654	T	1	-30.2051	13.0521	0.58960	0.0:0.0:0.734:0.266	.	129	Q9H2K0	IF3M_HUMAN	K	129	ENSP00000400084:Q129K;ENSP00000384659:Q129K;ENSP00000370508:Q129K;ENSP00000370512:Q129K	ENSP00000370508:Q129K	Q	-	1	0	MTIF3	26912201	1.000000	0.71417	1.000000	0.80357	0.327000	0.28475	2.972000	0.49256	2.751000	0.94390	0.655000	0.94253	CAG			0.512	MTIF3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044300.1		NM_152912	
FRY	10129	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	32721459	32721459	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr13:32721459T>G	ENST00000380250.3	+	12	1716	c.1220T>G	c.(1219-1221)cTc>cGc	p.L407R		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	407						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		CTGGAATCTCTCTACAGATTA	0.393																																					p.L407R													.	.			0			c.T1220G												104.0	97.0	99.0					13																	32721459		1861	4112	5973	SO:0001583	missense	10129	exon12			AATCTCTCTACAG	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.1220T>G	13.37:g.32721459T>G	ENSP00000369600:p.Leu407Arg		115	0	0		84	0.36	30	NM_023037	1	0.00	0	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	37	CCDS41875.1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.600279	0.87055	.	.	ENSG00000073910	ENST00000380250;ENST00000267067	T	0.32272	1.46	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.69503	-0.5128	10	0.87932	D	0	.	15.6385	0.76977	0.0:0.0:0.0:1.0	.	407	Q5TBA9	FRY_HUMAN	R	407;335	ENSP00000369600:L407R	ENSP00000267067:L335R	L	+	2	0	FRY	31619459	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.040000	0.89188	2.163000	0.67991	0.459000	0.35465	CTC			0.393	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044405.1		NM_023037	
PPP1R13B	23368	mdanderson.org	37	14	104206527	104206527	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr14:104206527G>T	ENST00000202556.9	-	12	2508	c.2226C>A	c.(2224-2226)ttC>ttA	p.F742L	PPP1R13B_ENST00000423488.2_Missense_Mutation_p.F161L|PPP1R13B_ENST00000555391.1_5'UTR	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	742	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				TGGGCTGGTAGAAAGGGGTGC	0.637																																					p.F742L													.	.			0			c.C2226A												59.0	70.0	66.0					14																	104206527		1980	4142	6122	SO:0001583	missense	23368	exon12			CTGGTAGAAAGGG	AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2226C>A	14.37:g.104206527G>T	ENSP00000202556:p.Phe742Leu		40	0	0		41	0.07	3	NM_015316	29	0.00	0	B2RMX5|O94870	Missense_Mutation	SNP	ENST00000202556.9	37	CCDS41997.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.20|16.20	3.055605|3.055605	0.55325|0.55325	.|.	.|.	ENSG00000088808|ENSG00000088808	ENST00000202556;ENST00000423488|ENST00000380023	T;T|.	0.54479|.	0.77;0.57|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.56187|0.56187	0.1968|0.1968	L|L	0.50333|0.50333	1.59|1.59	0.52501|0.52501	D|D	0.999951|0.999951	D|.	0.58620|.	0.983|.	P|.	0.52758|.	0.708|.	T|T	0.53380|0.53380	-0.8447|-0.8447	10|6	0.26408|0.27082	T|T	0.33|0.32	.|.	7.0456|7.0456	0.25044|0.25044	0.2101:0.0:0.7899:0.0|0.2101:0.0:0.7899:0.0	.|.	742|.	Q96KQ4|.	ASPP1_HUMAN|.	L|I	742;161|587	ENSP00000202556:F742L;ENSP00000395213:F161L|.	ENSP00000202556:F742L|ENSP00000369362:L587I	F|L	-|-	3|1	2|2	PPP1R13B|PPP1R13B	103276280|103276280	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.752000|1.752000	0.38349|0.38349	2.520000|2.520000	0.84964|0.84964	0.549000|0.549000	0.68633|0.68633	TTC|CTA			0.637	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414591.1		NM_015316	
AHNAK2	113146	mdanderson.org	37	14	105406054	105406054	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr14:105406054G>T	ENST00000333244.5	-	7	15853	c.15734C>A	c.(15733-15735)gCt>gAt	p.A5245D	AHNAK2_ENST00000557457.1_Missense_Mutation_p.A243D	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5245						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TAGGGACATAGCTGCCTCCAC	0.517																																					p.A5245D													.	.			0			c.C15734A												215.0	235.0	229.0					14																	105406054		2089	4222	6311	SO:0001583	missense	113146	exon7			GACATAGCTGCCT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.15734C>A	14.37:g.105406054G>T	ENSP00000353114:p.Ala5245Asp		85	0	0		39	0.08	3	NM_138420	2	0.00	0	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	37	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	C	0.422	-0.907704	0.02434	.	.	ENSG00000185567	ENST00000557457;ENST00000333244	T;T	0.02890	4.12;5.86	4.89	-5.97	0.02227	.	4.850960	0.01116	U	0.005693	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	B	0.27416	0.178	B	0.25140	0.058	T	0.41070	-0.9529	10	0.12766	T	0.61	.	12.2464	0.54572	0.0:0.1069:0.5621:0.331	.	5245	Q8IVF2	AHNK2_HUMAN	D	243;5245	ENSP00000450998:A243D;ENSP00000353114:A5245D	ENSP00000353114:A5245D	A	-	2	0	AHNAK2	104477099	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.463000	0.06696	-1.020000	0.03354	-2.061000	0.00397	GCT			0.517	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000410300.1		NM_138420	
HERC1	8925	ucsc.edu	37	15	64039940	64039940	+	Silent	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr15:64039940G>T	ENST00000443617.2	-	11	2424	c.2337C>A	c.(2335-2337)ctC>ctA	p.L779L		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	779					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						AAGGGAAAGGGAGTGGGGGAA	0.403																																					p.L779L													.	HERC1	624		0			c.C2337A												80.0	90.0	87.0					15																	64039940		1517	3078	4595	SO:0001819	synonymous_variant	8925	exon11			GAAAGGGAGTGGG	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2337C>A	15.37:g.64039940G>T			53	0	0		44	0.09	4	NM_003922	10	0.00	0	Q8IW65	Silent	SNP	ENST00000443617.2	37	CCDS45277.1																																																																																					0.403	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418523.1		NM_003922	
PLEKHO2	80301	mdanderson.org	37	15	65153711	65153711	+	Silent	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr15:65153711G>T	ENST00000323544.4	+	5	548	c.420G>T	c.(418-420)gtG>gtT	p.V140V	AC069368.3_ENST00000437723.1_Silent_p.V140V	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	140										NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGGAGCATGTGACACGGGACC	0.642																																					p.V140V													.	.			0			c.G420T												29.0	26.0	27.0					15																	65153711		2200	4299	6499	SO:0001819	synonymous_variant	80301	exon5			GCATGTGACACGG	AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.420G>T	15.37:g.65153711G>T			52	0	0		45	0.07	3	NM_025201	60	0.00	0	Q7L4H4|Q8WYS8	Silent	SNP	ENST00000323544.4	37	CCDS10196.1																																																																																					0.642	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256659.1		NM_025201	
CELF6	60677	mdanderson.org	37	15	72608195	72608195	+	Silent	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr15:72608195G>A	ENST00000569547.1	-	2	407	c.336C>T	c.(334-336)acC>acT	p.T112T	RP11-106M3.2_ENST00000379915.4_RNA|CELF6_ENST00000539635.1_5'UTR|CELF6_ENST00000287202.5_Silent_p.T112T|RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000567083.1_Silent_p.T112T			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	112	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						CCCCTGGCAGGGTCTTCTGCT	0.642																																					p.T112T													.	.			0			c.C336T												40.0	37.0	38.0					15																	72608195		2199	4297	6496	SO:0001819	synonymous_variant	60677	exon2			TGGCAGGGTCTTC	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.336C>T	15.37:g.72608195G>A			42	0	0		30	0.10	3	NM_001172684	16	0.00	0	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Silent	SNP	ENST00000569547.1	37	CCDS10242.1																																																																																					0.642	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding		OTTHUMT00000420180.1		NM_052840	
HAPLN3	145864	mdanderson.org	37	15	89421275	89421275	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr15:89421275G>T	ENST00000359595.3	-	5	1223	c.1009C>A	c.(1009-1011)Cct>Act	p.P337T	HAPLN3_ENST00000562889.1_Missense_Mutation_p.P399T	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	337	Link 2. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	CGGACCCCAGGCTCTGGGGGC	0.652																																					p.P337T													.	.			0			c.C1009A												57.0	64.0	62.0					15																	89421275		2200	4299	6499	SO:0001583	missense	145864	exon5			CCCCAGGCTCTGG	AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.1009C>A	15.37:g.89421275G>T	ENSP00000352606:p.Pro337Thr		48	0	0		43	0.07	3	NM_178232	33	0.00	0	A8K7P0	Missense_Mutation	SNP	ENST00000359595.3	37	CCDS10346.1	.	.	.	.	.	.	.	.	.	.	G	14.84	2.655601	0.47467	.	.	ENSG00000140511	ENST00000359595	T	0.32272	1.46	4.69	1.71	0.24356	C-type lectin fold (1);Link (3);C-type lectin-like (1);	0.170447	0.52532	D	0.000065	T	0.49983	0.1589	M	0.78285	2.405	0.52501	D	0.999958	D;D	0.67145	0.996;0.996	D;D	0.70227	0.968;0.968	T	0.42103	-0.9471	10	0.48119	T	0.1	-0.9656	8.9032	0.35507	0.0808:0.3016:0.6176:0.0	.	337;337	A8K7T8;Q96S86	.;HPLN3_HUMAN	T	337	ENSP00000352606:P337T	ENSP00000352606:P337T	P	-	1	0	HAPLN3	87222279	1.000000	0.71417	0.891000	0.34965	0.226000	0.24999	6.180000	0.71981	0.141000	0.18875	-0.172000	0.13284	CCT			0.652	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000309070.1		NM_178232	
ROGDI	79641	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	4848606	4848606	+	Silent	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr16:4848606G>A	ENST00000322048.7	-	7	873	c.495C>T	c.(493-495)acC>acT	p.T165T	ROGDI_ENST00000586336.1_5'UTR|RP11-127I20.5_ENST00000592465.1_RNA	NM_024589.2	NP_078865.1	Q9GZN7	ROGDI_HUMAN	rogdi homolog (Drosophila)	165					hemopoiesis (GO:0030097)|positive regulation of cell proliferation (GO:0008284)	intracellular (GO:0005622)|nucleus (GO:0005634)				endometrium(2)|lung(1)|ovary(1)|skin(1)	5						GGAGGGTGAGGGTGGCGGGGG	0.701																																					p.T165T													.	ROGDI	11		0			c.C495T												21.0	23.0	23.0					16																	4848606		2184	4290	6474	SO:0001819	synonymous_variant	79641	exon7			GGTGAGGGTGGCG	AK026039	CCDS10523.1	16p13.3	2014-09-17			ENSG00000067836	ENSG00000067836			29478	protein-coding gene	gene with protein product		614574				11230166	Standard	NM_024589		Approved	FLJ22386	uc002cxv.4	Q9GZN7	OTTHUMG00000129479	ENST00000322048.7:c.495C>T	16.37:g.4848606G>A			23	0	0		20	0.35	7	NM_024589	119	0.26	31	Q6IA00	Silent	SNP	ENST00000322048.7	37	CCDS10523.1																																																																																					0.701	ROGDI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251643.3		NM_024589	
DNAH3	55567	broad.mit.edu	37	16	20976354	20976354	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr16:20976354T>C	ENST00000261383.3	-	53	8851	c.8852A>G	c.(8851-8853)aAg>aGg	p.K2951R	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2951	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTCCAAGTCCTTTTTCTTGGT	0.498																																					p.K2951R													DNAH3_ENST00000261383,bladder,carcinoma,0,4	DNAH3	1142	4	0			c.A8852G												174.0	167.0	169.0					16																	20976354		2201	4300	6501	SO:0001583	missense	55567	exon53			AAGTCCTTTTTCT	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.8852A>G	16.37:g.20976354T>C	ENSP00000261383:p.Lys2951Arg		136	0	0		82	0.04	3	NM_017539	5	0.00	0	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	ENST00000261383.3	37	CCDS10594.1	.	.	.	.	.	.	.	.	.	.	T	0.058	-1.231781	0.01505	.	.	ENSG00000158486	ENST00000261383	T	0.74106	-0.81	5.93	-1.81	0.07882	Dynein heavy chain, coiled coil stalk (1);	0.710478	0.14064	N	0.343836	T	0.53932	0.1827	L	0.36672	1.1	0.36903	D	0.890499	B	0.09022	0.002	B	0.14023	0.01	T	0.32534	-0.9903	10	0.22109	T	0.4	.	1.5651	0.02602	0.4366:0.2698:0.1122:0.1814	.	2951	Q8TD57	DYH3_HUMAN	R	2951	ENSP00000261383:K2951R	ENSP00000261383:K2951R	K	-	2	0	DNAH3	20883855	0.102000	0.21896	0.062000	0.19696	0.003000	0.03518	0.427000	0.21379	-0.360000	0.08138	-0.327000	0.08410	AAG			0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000207361.1		NM_017539	
USP10	9100	hgsc.bcm.edu	37	16	84797756	84797756	+	Silent	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr16:84797756T>C	ENST00000219473.7	+	10	1832	c.1719T>C	c.(1717-1719)ggT>ggC	p.G573G	USP10_ENST00000570191.1_Silent_p.G577G	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	573	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						AAGAACAAGGTGAAGGAAGCG	0.493																																					p.G577G													.	.			0			c.T1731C												62.0	63.0	63.0					16																	84797756		1887	4098	5985	SO:0001819	synonymous_variant	9100	exon11			ACAAGGTGAAGGA	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1719T>C	16.37:g.84797756T>C			125	0	0		100	0.05	5	NM_001272075	277	0.00	0	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	ENST00000219473.7	37	CCDS45537.1																																																																																					0.493	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000433660.1			
MAPT	4137	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	44060770	44060770	+	Silent	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr17:44060770G>A	ENST00000571987.1	+	5	600	c.600G>A	c.(598-600)ggG>ggA	p.G200G	MAPT_ENST00000431008.3_Intron|MAPT_ENST00000344290.5_Silent_p.G200G|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000570299.1_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000415613.2_Silent_p.G200G|MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000262410.5_Silent_p.G200G|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000347967.5_Intron			P10636	TAU_HUMAN	microtubule-associated protein tau	200					adult walking behavior (GO:0007628)|apoptotic process (GO:0006915)|axon cargo transport (GO:0008088)|axon extension (GO:0048675)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|generation of neurons (GO:0048699)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of microtubule polymerization (GO:0031116)|regulation of autophagy (GO:0010506)|regulation of microtubule polymerization (GO:0031113)|regulation of microtubule-based movement (GO:0060632)	axon (GO:0030424)|axoneme (GO:0005930)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|growth cone (GO:0030426)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nuclear periphery (GO:0034399)|plasma membrane (GO:0005886)|tubulin complex (GO:0045298)	apolipoprotein binding (GO:0034185)|enzyme binding (GO:0019899)|lipoprotein particle binding (GO:0071813)|microtubule binding (GO:0008017)|SH3 domain binding (GO:0017124)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		Melanoma(429;0.216)			Docetaxel(DB01248)|Paclitaxel(DB01229)	ACCAGGAGGGGCCGCCGCTGA	0.677																																					p.G200G													.	.			0			c.G600A												18.0	16.0	17.0					17																	44060770		2191	4274	6465	SO:0001819	synonymous_variant	4137	exon6			GGAGGGGCCGCCG	J03778	CCDS11499.1, CCDS11500.1, CCDS11501.1, CCDS11502.1, CCDS45715.1, CCDS45716.1, CCDS56033.1	17q21	2014-09-17			ENSG00000186868	ENSG00000186868			6893	protein-coding gene	gene with protein product	"""G protein beta1/gamma2 subunit-interacting factor 1"", ""microtubule-associated protein tau, isoform 4"", ""protein phosphatase 1, regulatory subunit 103"""	157140		DDPAC, MAPTL		7936241, 3131773	Standard	NM_001123067		Approved	MTBT1, tau, PPND, FTDP-17, TAU, MSTD, MTBT2, FLJ31424, MGC138549, PPP1R103	uc010dau.3	P10636	OTTHUMG00000168833	ENST00000571987.1:c.600G>A	17.37:g.44060770G>A			72	0	0		65	0.32	21	NM_001123066	0		0	P18518|Q14799|Q15549|Q15550|Q15551|Q1RMF6|Q53YB1|Q5CZI7|Q5XWF0|Q6QT54|Q9UDJ3|Q9UMH0|Q9UQ96	Silent	SNP	ENST00000571987.1	37	CCDS11501.1																																																																																					0.677	MAPT-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000440133.1		NM_016835	
PTBP1	5725	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	19	806515	806515	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr19:806515G>A	ENST00000349038.4	+	9	1073	c.1000G>A	c.(1000-1002)Gca>Aca	p.A334T	MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000394601.4_Missense_Mutation_p.A353T|PTBP1_ENST00000356948.6_Missense_Mutation_p.A360T	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	334					alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGGCGGGGGCAGGAAATTC	0.697																																					p.A360T													.	.			0			c.G1078A												48.0	38.0	41.0					19																	806515		2196	4300	6496	SO:0001583	missense	5725	exon10			GCGGGGGCAGGAA	X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.1000G>A	19.37:g.806515G>A	ENSP00000014112:p.Ala334Thr		168	0	0		180	0.16	29	NM_002819	776	0.24	189	Q9BUQ0	Missense_Mutation	SNP	ENST00000349038.4	37	CCDS32859.1	.	.	.	.	.	.	.	.	.	.	G	6.907	0.536841	0.13188	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.47869	0.85;0.83;1.19	4.33	2.14	0.27477	.	0.285577	0.31697	N	0.007206	T	0.25269	0.0614	N	0.16903	0.455	0.48236	D	0.99961	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.002;0.003	T	0.04537	-1.0944	10	0.20046	T	0.44	-7.4611	5.8632	0.18760	0.1733:0.298:0.5287:0.0	.	334;353;360	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	T	360;353;334	ENSP00000349428:A360T;ENSP00000408096:A353T;ENSP00000014112:A334T	ENSP00000014112:A334T	A	+	1	0	PTBP1	757515	1.000000	0.71417	0.011000	0.14972	0.037000	0.13140	1.225000	0.32551	0.287000	0.22375	-0.251000	0.11542	GCA			0.697	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457605.1			
FBN3	84467	broad.mit.edu	37	19	8159377	8159377	+	Missense_Mutation	SNP	C	C	T	rs137977437		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr19:8159377C>T	ENST00000600128.1	-	47	6272	c.5858G>A	c.(5857-5859)cGc>cAc	p.R1953H	FBN3_ENST00000601739.1_Missense_Mutation_p.R1953H|FBN3_ENST00000270509.2_Missense_Mutation_p.R1953H			Q75N90	FBN3_HUMAN	fibrillin 3	1953	EGF-like 31; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						ACAGATGCAGCGGAAGGAGCC	0.592																																					p.R1953H													.	FBN3	300		0			c.G5858A							C	HIS/ARG	0,4406		0,0,2203	86.0	62.0	70.0		5858	3.8	1.0	19	dbSNP_134	70	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN3	NM_032447.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1953/2810	8159377	1,13005	2203	4300	6503	SO:0001583	missense	84467	exon46			ATGCAGCGGAAGG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5858G>A	19.37:g.8159377C>T	ENSP00000470498:p.Arg1953His		74	0.027027027	2		67	0.24	16	NM_032447	120	0.25	30	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	37	CCDS12196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.1|25.1	4.605051|4.605051	0.87157|0.87157	0.0|0.0	1.16E-4|1.16E-4	ENSG00000142449|ENSG00000142449	ENST00000341066|ENST00000270509	.|D	.|0.92446	.|-3.04	4.82|4.82	3.79|3.79	0.43588|0.43588	.|EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.85682	.|U	.|0.000000	D|D	0.92047|0.92047	0.7480|0.7480	L|L	0.35288|0.35288	1.05|1.05	0.58432|0.58432	D|D	0.999997|0.999997	.|D	.|0.89917	.|1.0	.|D	.|0.78314	.|0.991	D|D	0.88428|0.88428	0.3033|0.3033	6|10	0.16896|0.16420	T|T	0.51|0.52	.|.	12.2312|12.2312	0.54488|0.54488	0.0:0.9164:0.0:0.0836|0.0:0.9164:0.0:0.0836	.|.	.|1953	.|Q75N90	.|FBN3_HUMAN	T|H	73|1953	.|ENSP00000270509:R1953H	ENSP00000341317:A73T|ENSP00000270509:R1953H	A|R	-|-	1|2	0|0	FBN3|FBN3	8065377|8065377	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	2.813000|2.813000	0.48002|0.48002	1.005000|1.005000	0.39183|0.39183	0.563000|0.563000	0.77884|0.77884	GCT|CGC			0.592	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000461428.2		NM_032447	
ANKLE1	126549	broad.mit.edu	37	19	17397490	17397501	+	3'UTR	DEL	TGTGTGTGTGTT	TGTGTGTGTGTT	-	rs534658778|rs576892988|rs371454519|rs563327402|rs1465582|rs56209027|rs71180380	byFrequency	TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	TGTGTGTGTGTT	TGTGTGTGTGTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr19:17397490_17397501delTGTGTGTGTGTT	ENST00000394458.3	+	0	2253_2264				ANKLE1_ENST00000598347.1_In_Frame_Del_p.CVCL588del|ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000404085.1_3'UTR	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						tgtgtgtgtgtgtgtgtgtgtttgtgtgtgtg	0.524																																					.													.	ANKLE1	27		0			.																																									SO:0001624	3_prime_UTR_variant	126549	.			TGTGTGTGTGTGT	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*140TGTGTGTGTGTT>-	19.37:g.17397490_17397501delTGTGTGTGTGTT			17	0	0		20	0.40	8	.	6	0.00	0	A8VU82|Q8N8J8	In_Frame_Del	DEL	ENST00000394458.3	37	CCDS12354.2																																																																																					0.524	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325392.2		NM_152363	
GATAD2A	54815	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	19611944	19611944	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr19:19611944G>A	ENST00000360315.3	+	9	1531	c.1219G>A	c.(1219-1221)Gcc>Acc	p.A407T	GATAD2A_ENST00000358713.3_Missense_Mutation_p.A407T|GATAD2A_ENST00000252577.5_Missense_Mutation_p.A407T|GATAD2A_ENST00000537887.1_Missense_Mutation_p.A36T|GATAD2A_ENST00000429563.2_Missense_Mutation_p.A235T|GATAD2A_ENST00000404158.1_Missense_Mutation_p.A408T	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	407	CR2; histone tail-binding.				anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						GATGTCGGCCGCCACTGTGCT	0.652																																					p.A407T													.	GATAD2A	81		0			c.G1219A												41.0	39.0	40.0					19																	19611944		2202	4300	6502	SO:0001583	missense	54815	exon9			TCGGCCGCCACTG	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1219G>A	19.37:g.19611944G>A	ENSP00000353463:p.Ala407Thr		101	0.0099009901	1		95	0.19	18	NM_017660	570	0.25	144	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Missense_Mutation	SNP	ENST00000360315.3	37	CCDS12402.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.98|11.98	1.800095|1.800095	0.31869|0.31869	.|.	.|.	ENSG00000167491|ENSG00000167491	ENST00000360315;ENST00000252577;ENST00000537887;ENST00000404158;ENST00000358713;ENST00000429563|ENST00000418032	T;T;T;T|.	0.47869|.	1.4;1.41;1.4;0.83|.	5.76|5.76	2.48|2.48	0.30137|0.30137	.|.	0.365309|.	0.33327|.	N|.	0.005024|.	T|T	0.11623|0.11623	0.0283|0.0283	N|N	0.05078|0.05078	-0.115|-0.115	0.09310|0.09310	N|N	0.999999|0.999999	B;B;B|.	0.22346|.	0.009;0.068;0.068|.	B;B;B|.	0.14578|.	0.001;0.011;0.011|.	T|T	0.22941|0.22941	-1.0202|-1.0202	10|5	0.30854|.	T|.	0.27|.	-23.0477|-23.0477	2.2101|2.2101	0.03945|0.03945	0.1654:0.1555:0.5181:0.1611|0.1654:0.1555:0.5181:0.1611	.|.	235;427;407|.	B4DKZ7;B5MC40;Q86YP4|.	.;.;P66A_HUMAN|.	T|H	407;407;36;427;407;235|33	ENSP00000353463:A407T;ENSP00000252577:A407T;ENSP00000351552:A407T;ENSP00000388416:A235T|.	ENSP00000252577:A407T|.	A|R	+|+	1|2	0|0	GATAD2A|GATAD2A	19472944|19472944	0.122000|0.122000	0.22280|0.22280	0.056000|0.056000	0.19401|0.19401	0.024000|0.024000	0.10985|0.10985	0.657000|0.657000	0.24963|0.24963	0.782000|0.782000	0.33613|0.33613	-0.187000|-0.187000	0.12897|0.12897	GCC|CGC			0.652	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000326671.4		NM_017660	
ZNF432	9668	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	52550107	52550107	+	Splice_Site	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr19:52550107C>T	ENST00000594154.1	-	2	227	c.15G>A	c.(13-15)caG>caA	p.Q5Q	ZNF432_ENST00000597273.1_Splice_Site_p.Q5Q|ZNF432_ENST00000598446.1_5'Flank|ZNF432_ENST00000221315.5_Splice_Site_p.Q5Q			O94892	ZN432_HUMAN	zinc finger protein 432	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	29		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.0054)|OV - Ovarian serous cystadenocarcinoma(262;0.0182)		AAAAAGTCACCTGGGCATTGA	0.363																																					p.Q5Q													.	.			0			c.G15A												87.0	79.0	82.0					19																	52550107		2203	4300	6503	SO:0001630	splice_region_variant	9668	exon2			AGTCACCTGGGCA	AB018341	CCDS12848.1	19q13.41	2013-01-08				ENSG00000256087		"""Zinc fingers, C2H2-type"", ""-"""	20810	protein-coding gene	gene with protein product						9872452	Standard	NM_014650		Approved	KIAA0798	uc002pyk.3	O94892		ENST00000594154.1:c.15+1G>A	19.37:g.52550107C>T			106	0	0		150	0.19	28	NM_014650	49	0.08	4		Silent	SNP	ENST00000594154.1	37	CCDS12848.1																																																																																					0.363	ZNF432-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462410.1		NM_014650	Silent
ALK	238	mdanderson.org	37	2	29462644	29462644	+	Silent	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:29462644G>T	ENST00000389048.3	-	13	3163	c.2257C>A	c.(2257-2259)Cgg>Agg	p.R753R	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	753					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CCGTGGGACCGCATCATGGTG	0.592			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																												p.R753R			yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	ALK,right_lower_lobe,carcinoma,+1,1	ALK	1	1	0			c.C2257A												102.0	78.0	86.0					2																	29462644		2203	4300	6503	SO:0001819	synonymous_variant	238	exon13	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	GGGACCGCATCAT	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2257C>A	2.37:g.29462644G>T			54	0	0		54	0.06	3	NM_004304	1	0.00	0	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	ENST00000389048.3	37	CCDS33172.1																																																																																					0.592	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000324994.1		NM_004304	
TEKT4	150483	ucsc.edu	37	2	95542476	95542476	+	Missense_Mutation	SNP	C	C	T	rs1052809		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:95542476C>T	ENST00000295201.4	+	6	1407	c.1270C>T	c.(1270-1272)Cgc>Tgc	p.R424C	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	424					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						CCATCGTACTCGCTACCCCAC	0.592													C|||	1	0.000199681	0.0	0.0	5008	,	,		19845	0.0		0.0	False		,,,				2504	0.001				p.R424C													TEKT4,NS,carcinoma,0,1	TEKT4	72	1	0			c.C1270T												77.0	53.0	61.0					2																	95542476		2203	4300	6503	SO:0001583	missense	150483	exon6			CGTACTCGCTACC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.1270C>T	2.37:g.95542476C>T	ENSP00000295201:p.Arg424Cys		16	0	0		27	0.19	5	NM_144705	2	1.00	2		Missense_Mutation	SNP	ENST00000295201.4	37	CCDS2005.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033512	0.35893	.	.	ENSG00000163060	ENST00000295201	T	0.02916	4.11	2.43	2.43	0.29744	.	0.261531	0.37623	N	0.002019	T	0.03651	0.0104	L	0.60455	1.87	0.80722	D	1	P	0.36874	0.572	B	0.32583	0.148	T	0.50792	-0.8786	10	0.44086	T	0.13	-7.0137	10.5484	0.45072	0.0:1.0:0.0:0.0	rs1052809;rs3193279	424	Q8WW24	TEKT4_HUMAN	C	424	ENSP00000295201:R424C	ENSP00000295201:R424C	R	+	1	0	TEKT4	94906203	0.031000	0.19500	0.725000	0.30721	0.755000	0.42902	0.890000	0.28295	1.049000	0.40321	0.281000	0.19383	CGC			0.592	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252777.1		NM_144705	
FAHD2CP	729234	broad.mit.edu	37	2	96679935	96679937	+	RNA	DEL	AAC	AAC	-	rs113830014|rs545983595	byFrequency	TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:96679935_96679937delAAC	ENST00000607780.1	+	0	414									fumarylacetoacetate hydrolase domain containing 2C, pseudogene																		ggaggtgattaacaatttgaagg	0.433														2262	0.451677	0.5537	0.4078	5008	,	,		19642	0.3353		0.4066	False		,,,				2504	0.5112				.													.	.			0			.																																											0	.			GTGATTAACAATT			2q11.1	2012-06-29			ENSG00000231584	ENSG00000231584			44135	pseudogene	pseudogene							Standard	NR_003698		Approved		uc010fht.3		OTTHUMG00000155210		2.37:g.96679935_96679937delAAC			4	0	0		8	0.38	3	.	1	0.00	0		RNA	DEL	ENST00000607780.1	37																																																																																						0.433	FAHD2CP-005	KNOWN	non_canonical_TEC|basic	processed_transcript	pseudogene		OTTHUMT00000470200.1		NR_003698	
FAM178B	51252	mdanderson.org	37	2	97543710	97543710	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:97543710C>T	ENST00000417561.3	-	20	2367	c.2368G>A	c.(2368-2370)Gcc>Acc	p.A790T	FAM178B_ENST00000490605.2_Missense_Mutation_p.A642T|FAM178B_ENST00000393526.2_Missense_Mutation_p.A82T|FAM178B_ENST00000470789.1_5'UTR|FAM178B_ENST00000327896.3_Missense_Mutation_p.A610T			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	790										large_intestine(1)|ovary(1)	2						CGGTGCATGGCCTGGGGGCTC	0.667																																					p.A642T													.	.			0			c.G1924A												76.0	64.0	68.0					2																	97543710		2203	4300	6503	SO:0001583	missense	51252	exon16			GCATGGCCTGGGG	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.2368G>A	2.37:g.97543710C>T	ENSP00000413245:p.Ala790Thr		44	0	0		45	0.07	3	NM_001122646	18	0.00	0	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	37		.	.	.	.	.	.	.	.	.	.	C	17.55	3.417601	0.62622	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000393526;ENST00000490605	T;T;T;T	0.47528	0.84;0.88;0.89;0.86	5.2	5.2	0.72013	.	.	.	.	.	T	0.67277	0.2876	M	0.70595	2.14	0.31473	N	0.668127	D	0.71674	0.998	D	0.77557	0.99	T	0.71104	-0.4689	9	0.56958	D	0.05	-10.8013	14.2422	0.65963	0.0:1.0:0.0:0.0	.	790	Q8IXR5	F178B_HUMAN	T	790;610;82;642	ENSP00000413245:A790T;ENSP00000333553:A610T;ENSP00000377160:A82T;ENSP00000429896:A642T	ENSP00000333553:A610T	A	-	1	0	FAM178B	96907437	1.000000	0.71417	1.000000	0.80357	0.459000	0.32528	1.686000	0.37669	2.423000	0.82170	0.455000	0.32223	GCC			0.667	FAM178B-202	KNOWN	basic	protein_coding	protein_coding				NM_016490	
LRP1B	53353	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	141459406	141459406	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:141459406G>A	ENST00000389484.3	-	40	7282	c.6311C>T	c.(6310-6312)gCa>gTa	p.A2104V		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2104					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AGACCCGTTTGCATGTGCTCT	0.423										TSP Lung(27;0.18)																											p.A2104V	Colon(99;50 2074 2507 20106)												LRP1B,colon,carcinoma,+1,2	LRP1B	1	2	0			c.C6311T												158.0	145.0	149.0					2																	141459406		2203	4300	6503	SO:0001583	missense	53353	exon40			CCGTTTGCATGTG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6311C>T	2.37:g.141459406G>A	ENSP00000374135:p.Ala2104Val		204	0	0		199	0.23	46	NM_018557	1	0.00	0	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	37	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798864	0.70567	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90069	-2.61	5.24	5.24	0.73138	Six-bladed beta-propeller, TolB-like (1);	0.076531	0.51477	U	0.000083	D	0.86276	0.5894	L	0.42632	1.34	0.40690	D	0.98238	P	0.43094	0.799	B	0.40901	0.343	D	0.85637	0.1274	10	0.30078	T	0.28	.	18.8145	0.92072	0.0:0.0:1.0:0.0	.	2104	Q9NZR2	LRP1B_HUMAN	V	2104;2042	ENSP00000374135:A2104V	ENSP00000374135:A2104V	A	-	2	0	LRP1B	141175876	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.722000	0.98770	2.424000	0.82194	0.563000	0.77884	GCA			0.423	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254736.2		NM_018557	
TTN	7273	bcgsc.ca;mdanderson.org	37	2	179605648	179605648	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:179605648G>T	ENST00000591111.1	-	46	11585	c.11361C>A	c.(11359-11361)agC>agA	p.S3787R	TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S3741R|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S3933R|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Missense_Mutation_p.S3866R|TTN_ENST00000589042.1_Missense_Mutation_p.S4104R			Q8WZ42	TITIN_HUMAN	titin	33959					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAAGCTGACTGCTCAATTCAT	0.403																																					p.S4104R													TTN_ENST00000359218,NS,carcinoma,-1,3	TTN	18412	3	0			c.C12312A												106.0	104.0	104.0					2																	179605648		1897	4105	6002	SO:0001583	missense	7273	exon48			CTGACTGCTCAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.11361C>A	2.37:g.179605648G>T	ENSP00000465570:p.Ser3787Arg		91	0	0		70	0.07	5	NM_001267550	0		0	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	37		.	.	.	.	.	.	.	.	.	.	G	11.47	1.647290	0.29246	.	.	ENSG00000155657	ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T	0.61040	0.21;0.14;0.14	5.37	-1.39	0.08997	.	.	.	.	.	T	0.37183	0.0994	N	0.19112	0.55	0.20307	N	0.999914	B;B;B	0.20671	0.013;0.013;0.047	B;B;B	0.17433	0.018;0.018;0.018	T	0.29852	-0.9998	9	0.87932	D	0	.	5.582	0.17254	0.3676:0.0:0.5115:0.1209	.	3741;3866;3933	D3DPF9;E7EQE6;E7ET18	.;.;.	R	3741;3933;3866;3741	ENSP00000434586:S3741R;ENSP00000340554:S3933R;ENSP00000352154:S3866R	ENSP00000340554:S3933R	S	-	3	2	TTN	179313893	0.001000	0.12720	0.084000	0.20598	0.053000	0.15095	0.654000	0.24918	-0.181000	0.10619	-0.137000	0.14449	AGC			0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding		OTTHUMT00000460310.1		NM_133378	
UNC80	285175	mdanderson.org	37	2	210707111	210707111	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:210707111G>T	ENST00000439458.1	+	21	3481	c.3401G>T	c.(3400-3402)gGg>gTg	p.G1134V	UNC80_ENST00000272845.6_Missense_Mutation_p.G1129V	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1134					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						TCTGAAGGTGGGCCAGGAAGT	0.368																																					p.G1134V													.	.			0			c.G3401T												184.0	177.0	179.0					2																	210707111		692	1591	2283	SO:0001583	missense	285175	exon21			AAGGTGGGCCAGG	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3401G>T	2.37:g.210707111G>T	ENSP00000391088:p.Gly1134Val		44	0	0		50	0.06	3	NM_032504	0		0	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	37	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063235	0.76187	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.38560	1.13;1.13	5.18	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.30854	0.0778	N	0.22421	0.69	0.80722	D	1	P	0.44044	0.825	B	0.37780	0.258	T	0.19811	-1.0294	10	0.87932	D	0	-12.3481	15.6381	0.76970	0.0:0.1379:0.8621:0.0	.	1134	Q8N2C7	UNC80_HUMAN	V	1134;1129	ENSP00000391088:G1134V;ENSP00000272845:G1129V	ENSP00000272845:G1129V	G	+	2	0	UNC80	210415356	1.000000	0.71417	0.963000	0.40424	0.995000	0.86356	9.230000	0.95299	1.142000	0.42291	0.585000	0.79938	GGG			0.368	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_182587	
XRCC5	7520	broad.mit.edu	37	2	217012963	217012963	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:217012963A>G	ENST00000392133.3	+	16	2095	c.1634A>G	c.(1633-1635)aAg>aGg	p.K545R	XRCC5_ENST00000392132.2_Missense_Mutation_p.K545R			P13010	XRCC5_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)	545					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to fatty acid (GO:0071398)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|hematopoietic stem cell differentiation (GO:0060218)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of type I interferon production (GO:0032481)|response to drug (GO:0042493)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear chromosome, telomeric region (GO:0000784)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|kidney(3)|large_intestine(8)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Renal(323;0.0328)		Epithelial(149;9.78e-06)|all cancers(144;0.000632)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.0117)		GCCAAGAAAAAGGATCAAGTG	0.383								Non-homologous end-joining																													p.K545R													.	XRCC5	64		0			c.A1634G												80.0	80.0	80.0					2																	217012963		2203	4300	6503	SO:0001583	missense	7520	exon14			AGAAAAAGGATCA	AF039597	CCDS2402.1	2q35	2008-07-31	2008-07-31		ENSG00000079246	ENSG00000079246			12833	protein-coding gene	gene with protein product	"""Ku autoantigen, 80kDa"""	194364	"""X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining; Ku autoantigen, 80kD)"""			9636207, 9214634	Standard	NM_021141		Approved	KU80, KARP-1, Ku86, KUB2	uc002vfy.3	P13010	OTTHUMG00000133059	ENST00000392133.3:c.1634A>G	2.37:g.217012963A>G	ENSP00000375978:p.Lys545Arg		270	0	0		287	0.01	4	NM_021141	3275	0.00	1	A8K3X5|Q0Z7V0|Q4VBQ5|Q53HH7|Q7M4N0|Q9UCQ0|Q9UCQ1	Missense_Mutation	SNP	ENST00000392133.3	37	CCDS2402.1	.	.	.	.	.	.	.	.	.	.	A	10.67	1.414871	0.25465	.	.	ENSG00000079246	ENST00000392133;ENST00000392132	T;T	0.34667	1.35;1.35	5.62	2.88	0.33553	Spen Paralogue and Orthologue SPOC, C-terminal-like (1);Ku70/Ku80 C-terminal arm (2);	0.050645	0.85682	D	0.000000	T	0.29190	0.0726	L	0.59912	1.85	0.43965	D	0.996646	B	0.12013	0.005	B	0.14023	0.01	T	0.06661	-1.0814	10	0.17832	T	0.49	.	7.4672	0.27328	0.8043:0.0:0.1957:0.0	.	545	P13010	XRCC5_HUMAN	R	545	ENSP00000375978:K545R;ENSP00000375977:K545R	ENSP00000375977:K545R	K	+	2	0	XRCC5	216721208	1.000000	0.71417	0.890000	0.34922	0.785000	0.44390	2.219000	0.42899	0.947000	0.37659	0.482000	0.46254	AAG			0.383	XRCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256675.3		NM_021141	
PER2	8864	mdanderson.org	37	2	239171600	239171600	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr2:239171600G>T	ENST00000254657.3	-	10	1425	c.1146C>A	c.(1144-1146)caC>caA	p.H382Q	PER2_ENST00000440245.1_Missense_Mutation_p.H382Q|PER2_ENST00000254658.3_Intron|PER2_ENST00000355768.2_Intron	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	382	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TACTCTTTTTGTGGATGGCCA	0.567											OREG0015337	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H382Q													.	.			0			c.C1146A												92.0	78.0	82.0					2																	239171600		2203	4300	6503	SO:0001583	missense	8864	exon10			CTTTTTGTGGATG	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.1146C>A	2.37:g.239171600G>T	ENSP00000254657:p.His382Gln		58	0	0	2409	50	0.06	3	NM_022817	10	0.00	0	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	37	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	G	17.68	3.449873	0.63290	.	.	ENSG00000132326	ENST00000254657;ENST00000440245	T;T	0.19105	2.17;2.17	4.56	2.74	0.32292	PAS fold-3 (1);PAS (2);	0.103502	0.64402	D	0.000004	T	0.54255	0.1847	H	0.95114	3.625	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.996;0.998	T	0.61083	-0.7134	10	0.87932	D	0	-31.6807	9.0681	0.36475	0.1857:0.0:0.8143:0.0	.	382;382;382	F5GYD5;B4DH14;O15055	.;.;PER2_HUMAN	Q	382	ENSP00000254657:H382Q;ENSP00000397516:H382Q	ENSP00000254657:H382Q	H	-	3	2	PER2	238836339	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	1.107000	0.31110	0.624000	0.30286	0.655000	0.94253	CAC			0.567	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257167.1		NM_022817	
SRMS	6725	mdanderson.org	37	20	62172595	62172595	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr20:62172595A>G	ENST00000217188.1	-	7	1274	c.1234T>C	c.(1234-1236)Ttc>Ctc	p.F412L		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	412	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			AGGACGCCGAAGGACCAGACG	0.607																																					p.F412L													.	.			0			c.T1234C												94.0	98.0	97.0					20																	62172595		2203	4300	6503	SO:0001583	missense	6725	exon7			CGCCGAAGGACCA		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1234T>C	20.37:g.62172595A>G	ENSP00000217188:p.Phe412Leu		51	0	0		48	0.06	3	NM_080823	1	0.00	0		Missense_Mutation	SNP	ENST00000217188.1	37	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.391526	0.83011	.	.	ENSG00000125508	ENST00000217188	D	0.88975	-2.45	4.98	3.88	0.44766	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.226336	0.31167	N	0.008124	D	0.92351	0.7573	M	0.67625	2.065	0.36495	D	0.868652	D	0.69078	0.997	D	0.69479	0.964	D	0.93601	0.6930	10	0.87932	D	0	.	10.2779	0.43521	0.9205:0.0:0.0795:0.0	.	412	Q9H3Y6	SRMS_HUMAN	L	412	ENSP00000217188:F412L	ENSP00000217188:F412L	F	-	1	0	SRMS	61643039	1.000000	0.71417	0.973000	0.42090	0.600000	0.36913	5.657000	0.67996	0.865000	0.35603	0.533000	0.62120	TTC			0.607	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080148.1		NM_080823	
LDOC1L	84247	broad.mit.edu;ucsc.edu;mdanderson.org	37	22	44893010	44893010	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr22:44893010G>A	ENST00000341255.3	-	2	936	c.427C>T	c.(427-429)Cga>Tga	p.R143*		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	143										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		CCAGTCAGTCGAGACACAAGG	0.612																																					p.R143X													.	LDOC1L	24		0			c.C427T												41.0	43.0	42.0					22																	44893010		2203	4300	6503	SO:0001587	stop_gained	84247	exon2			TCAGTCGAGACAC	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.427C>T	22.37:g.44893010G>A	ENSP00000340434:p.Arg143*		72	0	0		75	0.21	16	NM_032287	20	0.15	3	Q6ZTR1	Nonsense_Mutation	SNP	ENST00000341255.3	37	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	G	41	9.117727	0.99071	.	.	ENSG00000188636	ENST00000341255	.	.	.	3.27	3.27	0.37495	.	0.534989	0.15166	N	0.276937	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-8.705	10.3019	0.43656	0.0:0.0:1.0:0.0	.	.	.	.	X	143	.	ENSP00000340434:R143X	R	-	1	2	LDOC1L	43271674	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.502000	0.53332	2.139000	0.66308	0.591000	0.81541	CGA			0.612	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318222.1		NM_032287	
ITPR1	3708	mdanderson.org	37	3	4730230	4730230	+	Nonsense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr3:4730230C>T	ENST00000443694.2	+	28	3709	c.3709C>T	c.(3709-3711)Cag>Tag	p.Q1237*	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Nonsense_Mutation_p.Q1252*|ITPR1_ENST00000302640.8_Nonsense_Mutation_p.Q1237*|ITPR1_ENST00000456211.2_Nonsense_Mutation_p.Q1228*|ITPR1_ENST00000357086.4_Nonsense_Mutation_p.Q1243*|ITPR1_ENST00000423119.2_Nonsense_Mutation_p.Q1243*			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1252					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	TGAATTTTTGCAGAATTTCTG	0.468																																					p.Q1243X													.	.			0			c.C3727T												120.0	118.0	119.0					3																	4730230		1904	4124	6028	SO:0001587	stop_gained	3708	exon31			TTTTTGCAGAATT	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.3709C>T	3.37:g.4730230C>T	ENSP00000401671:p.Gln1237*		65	0	0		50	0.06	3	NM_001099952	2	0.00	0	E7EPX7|E9PDE9|Q14660|Q99897	Nonsense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	44	10.686949	0.99450	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000357086;ENST00000456211;ENST00000443694	.	.	.	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	19.1808	0.93622	0.0:1.0:0.0:0.0	.	.	.	.	X	1252;1237;1252;1243;1243;1228;1237	.	ENSP00000306253:Q1237X	Q	+	1	0	ITPR1	4705230	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.673000	0.83973	2.518000	0.84900	0.655000	0.94253	CAG			0.468	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
ITPR1	3708	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	4810414	4810414	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr3:4810414A>G	ENST00000443694.2	+	43	5900	c.5900A>G	c.(5899-5901)cAg>cGg	p.Q1967R	ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.Q1967R|ITPR1_ENST00000302640.8_Missense_Mutation_p.Q1967R|ITPR1_ENST00000456211.2_Missense_Mutation_p.Q1919R|ITPR1_ENST00000357086.4_Missense_Mutation_p.Q1934R|ITPR1_ENST00000423119.2_Missense_Mutation_p.Q1934R			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1982					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CGCTTCCTTCAGCTCCTGTGT	0.647																																					p.Q1967R													.	.			0			c.A5900G												68.0	75.0	72.0					3																	4810414		2126	4262	6388	SO:0001583	missense	3708	exon45			TCCTTCAGCTCCT	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.5900A>G	3.37:g.4810414A>G	ENSP00000401671:p.Gln1967Arg		267	0	0		189	0.23	43	NM_001168272	15	0.13	2	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	37	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612596	0.87258	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	4.88	4.88	0.63580	RyR/IP3R Homology associated domain (1);	0.000000	0.85682	D	0.000000	D	0.99227	0.9731	M	0.82323	2.585	0.80722	D	1	D;D	0.76494	0.999;0.985	D;P	0.87578	0.998;0.835	D	0.99293	1.0899	10	0.59425	D	0.04	.	14.5205	0.67847	1.0:0.0:0.0:0.0	.	1982;1934	Q14643;G5E9P1	ITPR1_HUMAN;.	R	1982;1967;1967;1934;428;1934;1919;1967	ENSP00000306253:Q1967R;ENSP00000346595:Q1967R;ENSP00000405934:Q1934R;ENSP00000349597:Q1934R;ENSP00000397885:Q1919R;ENSP00000401671:Q1967R	ENSP00000306253:Q1967R	Q	+	2	0	ITPR1	4785414	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.140000	0.94607	1.842000	0.53543	0.377000	0.23210	CAG			0.647	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000337982.3		NM_002222	
ZNF717	100131827	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	75786560	75786560	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr3:75786560T>G	ENST00000478296.1	-	4	2340	c.2064A>C	c.(2062-2064)aaA>aaC	p.K688N	MIR4273_ENST00000582824.1_RNA|ZNF717_ENST00000422325.1_Missense_Mutation_p.K738N|ZNF717_ENST00000491507.1_Intron|ZNF717_ENST00000400845.3_Missense_Mutation_p.K731N|ZNF717_ENST00000477374.1_Intron			Q9BY31	ZN717_HUMAN	zinc finger protein 717	728					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(6)|endometrium(3)|lung(2)|ovary(1)|stomach(7)	19						TCTGACAAGGTTTTTCCACAT	0.398																																					p.K738N													.	ZNF717	160		0			c.A2214C												3.0	3.0	3.0					3																	75786560		624	1297	1921	SO:0001583	missense	100131827	exon5			ACAAGGTTTTTCC	AF226994		3p12.3	2013-01-08			ENSG00000227124	ENSG00000227124		"""Zinc fingers, C2H2-type"", ""-"""	29448	protein-coding gene	gene with protein product			"""zinc finger protein 838"""	ZNF838			Standard	NM_001128223		Approved	X17	uc011bgi.2	Q9BY31	OTTHUMG00000158965	ENST00000478296.1:c.2064A>C	3.37:g.75786560T>G	ENSP00000419377:p.Lys688Asn		66	0	0		71	0.30	21	NM_001128223	14	0.29	4		Missense_Mutation	SNP	ENST00000478296.1	37		.	.	.	.	.	.	.	.	.	.	.	9.672	1.146859	0.21288	.	.	ENSG00000227124	ENST00000478296;ENST00000422325;ENST00000400845	T;T;T	0.07567	3.18;3.35;3.34	1.62	-1.89	0.07689	.	.	.	.	.	T	0.06600	0.0169	L	0.43701	1.375	0.09310	N	1	B	0.19817	0.039	B	0.19666	0.026	T	0.40776	-0.9545	9	0.72032	D	0.01	.	2.169	0.03845	0.4692:0.1726:0.0:0.3582	.	738	C9JSV9	.	N	688;738;731	ENSP00000419377:K688N;ENSP00000409514:K738N;ENSP00000383643:K731N	ENSP00000383643:K731N	K	-	3	2	ZNF717	75869250	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.726000	0.04936	-0.360000	0.08138	0.367000	0.22151	AAA			0.398	ZNF717-002	NOVEL	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000352764.2		NM_001128223	
C3orf36	80111	mdanderson.org	37	3	133647172	133647172	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr3:133647172C>T	ENST00000408895.2	-	1	1484	c.476G>A	c.(475-477)gGc>gAc	p.G159D		NM_025041.2	NP_079317.2	Q3SXR2	CC036_HUMAN	chromosome 3 open reading frame 36	159										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	6						CCCCGCTCTGCCTTGAGACTG	0.517																																					p.G159D													.	.			0			c.G476A												67.0	75.0	72.0					3																	133647172		2203	4300	6503	SO:0001583	missense	80111	exon1			GCTCTGCCTTGAG	AK025826	CCDS3083.1	3q22.1	2011-09-30			ENSG00000221972	ENSG00000221972			26170	protein-coding gene	gene with protein product						12477932	Standard	NM_025041		Approved	FLJ22173	uc003epz.1	Q3SXR2		ENST00000408895.2:c.476G>A	3.37:g.133647172C>T	ENSP00000386219:p.Gly159Asp		50	0	0		40	0.08	3	NM_025041	0		0	Q3SXR3|Q9H6K8	Missense_Mutation	SNP	ENST00000408895.2	37	CCDS3083.1	.	.	.	.	.	.	.	.	.	.	C	9.612	1.131416	0.21041	.	.	ENSG00000221972	ENST00000408895	.	.	.	2.25	0.41	0.16387	.	.	.	.	.	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	P	0.38800	0.648	B	0.39152	0.292	T	0.14727	-1.0462	8	0.87932	D	0	.	4.2897	0.10872	0.0:0.6453:0.0:0.3547	.	159	Q3SXR2	CC036_HUMAN	D	159	.	ENSP00000386219:G159D	G	-	2	0	C3orf36	135129862	0.000000	0.05858	0.007000	0.13788	0.031000	0.12232	0.139000	0.16036	0.078000	0.16900	0.462000	0.41574	GGC			0.517	C3orf36-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_025041	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.E545K	Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,carcinoma,0,1370	PIK3CA_ENST00000263967	0	1370	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)	c.G1633A												61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290	exon10			ATCACTGAGCAGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys		348	0	0		315	0.26	81	NM_006218	38	0.34	13	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG			0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000348409.2			
HOPX	84525	mdanderson.org	37	4	57522142	57522142	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr4:57522142G>T	ENST00000337881.7	-	2	681	c.25C>A	c.(25-27)Ccc>Acc	p.P9T	HOPX_ENST00000555760.2_Missense_Mutation_p.P9T|HOPX_ENST00000556376.2_Missense_Mutation_p.P9T|HOPX_ENST00000420433.1_Missense_Mutation_p.P27T|HOPX_ENST00000381260.3_Missense_Mutation_p.P9T|HOPX_ENST00000381255.3_Missense_Mutation_p.P9T|HOPX_ENST00000317745.7_Missense_Mutation_p.P9T|HOPX_ENST00000556614.2_Missense_Mutation_p.P9T|HOPX_ENST00000503639.3_Missense_Mutation_p.P9T|HOPX_ENST00000508121.1_Missense_Mutation_p.P27T|HOPX_ENST00000554144.1_Missense_Mutation_p.P27T|HOPX_ENST00000553379.2_Missense_Mutation_p.P9T	NM_139212.3	NP_631958.1	Q9BPY8	HOP_HUMAN	HOP homeobox	9					heart development (GO:0007507)|histone deacetylation (GO:0016575)|lung alveolus development (GO:0048286)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of heart contraction (GO:0008016)|regulation of protein binding (GO:0043393)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(5)|skin(1)	8	Glioma(25;0.08)|all_neural(26;0.101)					TCCTCTGTGGGGCCGCTCGCG	0.687																																					p.P27T													.	.			0			c.C79A												61.0	54.0	57.0					4																	57522142		2202	4300	6502	SO:0001583	missense	84525	exon3			CTGTGGGGCCGCT		CCDS3507.1, CCDS47062.1, CCDS54767.1	4q12	2011-06-20			ENSG00000171476	ENSG00000171476		"""Homeoboxes / PRD class"""	24961	protein-coding gene	gene with protein product	"""homeobox only domain"""	607275				12297045	Standard	NM_032495		Approved	LAGY, HOP, OB1, NECC1, SMAP31	uc003hbz.2	Q9BPY8	OTTHUMG00000128768	ENST00000337881.7:c.25C>A	4.37:g.57522142G>T	ENSP00000337330:p.Pro9Thr		26	0	0		42	0.07	3	NM_001145460	9	0.00	0	A8K0Z2|E9PB55|G3V294|Q8N0V6|Q96CI1	Missense_Mutation	SNP	ENST00000337881.7	37	CCDS3507.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.887207	0.33348	.	.	ENSG00000171476	ENST00000420433;ENST00000554144;ENST00000508121;ENST00000556376;ENST00000553379;ENST00000381260;ENST00000381255;ENST00000317745;ENST00000503639;ENST00000503864;ENST00000337881;ENST00000555760;ENST00000556614;ENST00000509435;ENST00000514890;ENST00000506661;ENST00000557328	D;D;D;D;D;D;D;D;D;D	0.96365	-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99;-3.99	4.67	4.67	0.58626	Homeobox (2);Homeodomain-like (1);	0.263406	0.34200	N	0.004176	D	0.96855	0.8973	L	0.50333	1.59	0.47698	D	0.999494	D;P;P	0.71674	0.998;0.951;0.761	D;P;B	0.68943	0.961;0.772;0.239	D	0.96953	0.9696	10	0.59425	D	0.04	-18.7351	13.0775	0.59095	0.0:0.0:1.0:0.0	.	27;27;9	G3V294;E9PB55;Q9BPY8	.;.;HOP_HUMAN	T	27;27;27;9;9;9;9;9;9;9;9;9;9;9;9;9;9	ENSP00000396275:P27T;ENSP00000422175:P27T;ENSP00000451794:P9T;ENSP00000452340:P9T;ENSP00000370654:P9T;ENSP00000315198:P9T;ENSP00000424101:P9T;ENSP00000337330:P9T;ENSP00000452098:P9T;ENSP00000452003:P9T	ENSP00000315198:P9T	P	-	1	0	HOPX	57216899	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	6.937000	0.75898	2.128000	0.65567	0.491000	0.48974	CCC			0.687	HOPX-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250689.4			
COX18	285521	broad.mit.edu;mdanderson.org	37	4	73935349	73935349	+	Silent	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr4:73935349G>A	ENST00000295890.4	-	1	109	c.18C>T	c.(16-18)ggC>ggT	p.G6G	COX18_ENST00000507544.2_Silent_p.G6G|COX18_ENST00000421792.2_5'UTR	NM_173827.2	NP_776188.1	Q8N8Q8	COX18_HUMAN	COX18 cytochrome C oxidase assembly factor	6					protein insertion into mitochondrial membrane (GO:0051204)|protein transport (GO:0015031)|respiratory chain complex IV assembly (GO:0008535)	integral component of mitochondrial inner membrane (GO:0031305)	protein transporter activity (GO:0008565)			large_intestine(4)|lung(2)	6	Breast(15;0.00096)		Epithelial(6;1.26e-06)|OV - Ovarian serous cystadenocarcinoma(6;9.45e-06)|all cancers(17;2.05e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GCCACCGACCGCCGAGCCGGC	0.701																																					p.G6G													.	COX18	20		0			c.C18T												3.0	3.0	3.0					4																	73935349		1617	3517	5134	SO:0001819	synonymous_variant	285521	exon1			CCGACCGCCGAGC	AY957564	CCDS3554.1, CCDS75139.1	4q13.3	2013-06-12	2013-06-12		ENSG00000163626	ENSG00000163626		"""Mitochondrial respiratory chain complex assembly factors"""	26801	protein-coding gene	gene with protein product		610428	"""COX18 cytochrome c oxidase assembly homolog (S. cerevisiae)"", ""cytochrome c oxidase assembly homolog 18 (yeast)"""			16212937, 16911509	Standard	XM_005265679		Approved	FLJ38991	uc003hgm.1	Q8N8Q8	OTTHUMG00000129917	ENST00000295890.4:c.18C>T	4.37:g.73935349G>A			15	0	0		14	0.29	4	NM_173827	20	0.25	5	Q2PB66|Q2PB67|Q2PB68|Q49B97|Q6IPP9	Silent	SNP	ENST00000295890.4	37	CCDS3554.1																																																																																					0.701	COX18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000252169.2		NM_173827	
SDHA	6389	hgsc.bcm.edu	37	5	256508	256508	+	Silent	SNP	C	C	T	rs3211499		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:256508C>T	ENST00000264932.6	+	15	2083	c.1968C>T	c.(1966-1968)acC>acT	p.T656T	SDHA_ENST00000510361.1_Silent_p.T608T|SDHA_ENST00000507522.1_3'UTR|SDHA_ENST00000504309.1_Silent_p.T575T	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	656					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	ACTGTGCCACCGTCCCGCCAG	0.438									Familial Paragangliomas																												p.T656T													SDHA,NS,carcinoma,+2,1	SDHA	2	1	0			c.C1968T												70.0	78.0	75.0					5																	256508		2203	4300	6503	SO:0001819	synonymous_variant	6389	exon15	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	TGCCACCGTCCCG	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.1968C>T	5.37:g.256508C>T			161	0.0062111801	1		104	0.06	6	NM_004168	193	0.01	2	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Silent	SNP	ENST00000264932.6	37	CCDS3853.1																																																																																					0.438	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206599.1		NM_004168	
CTNND2	1501	mdanderson.org	37	5	11098816	11098816	+	Silent	SNP	T	T	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:11098816T>C	ENST00000304623.8	-	15	2697	c.2508A>G	c.(2506-2508)aaA>aaG	p.K836K	CTNND2_ENST00000458100.2_Silent_p.K403K|CTNND2_ENST00000503622.1_Silent_p.K499K|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Intron|CTNND2_ENST00000511377.1_Silent_p.K745K	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	836					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TCTGGATCCCTTTTGGTGGTT	0.517																																					p.K836K													.	.			0			c.A2508G												147.0	133.0	138.0					5																	11098816		2203	4300	6503	SO:0001819	synonymous_variant	1501	exon15			GATCCCTTTTGGT	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2508A>G	5.37:g.11098816T>C			86	0	0		52	0.06	3	NM_001332	5	0.00	0	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	ENST00000304623.8	37	CCDS3881.1																																																																																					0.517	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206999.1		NM_001332	
PDZD2	23037	mdanderson.org	37	5	32089541	32089541	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:32089541G>T	ENST00000438447.1	+	20	6375	c.5987G>T	c.(5986-5988)gGc>gTc	p.G1996V	PDZD2_ENST00000282493.3_Missense_Mutation_p.G1996V			O15018	PDZD2_HUMAN	PDZ domain containing 2	1996					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCTGAGCAAGGCATGTGGAGC	0.587																																					p.G1996V													.	.			0			c.G5987T												112.0	110.0	111.0					5																	32089541		2203	4300	6503	SO:0001583	missense	23037	exon19			AGCAAGGCATGTG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.5987G>T	5.37:g.32089541G>T	ENSP00000402033:p.Gly1996Val		55	0	0		31	0.10	3	NM_178140	3	0.00	0	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.434409	0.43224	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.09630	2.96;2.96	3.86	0.87	0.19102	.	0.319207	0.22988	N	0.053222	T	0.17365	0.0417	L	0.59436	1.845	0.20975	N	0.999815	D	0.63880	0.993	P	0.59643	0.861	T	0.08597	-1.0714	10	0.56958	D	0.05	.	2.3162	0.04199	0.1102:0.1925:0.4991:0.1982	.	1996	O15018	PDZD2_HUMAN	V	1996;1797;1996	ENSP00000402033:G1996V;ENSP00000282493:G1996V	ENSP00000282493:G1996V	G	+	2	0	PDZD2	32125298	0.049000	0.20398	0.002000	0.10522	0.004000	0.04260	0.983000	0.29552	0.163000	0.19507	-0.157000	0.13467	GGC			0.587	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366608.1			
DND1	373863	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	140052912	140052912	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:140052912G>T	ENST00000542735.1	-	2	129	c.86C>A	c.(85-87)aCa>aAa	p.T29K	HARS_ENST00000504156.1_3'UTR	NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	29					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGGATGCCTGTCTCCCTGAC	0.647																																					p.T29K													.	.			0			c.C86A												61.0	61.0	61.0					5																	140052912		2203	4300	6503	SO:0001583	missense	373863	exon2			ATGCCTGTCTCCC	AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.86C>A	5.37:g.140052912G>T	ENSP00000445366:p.Thr29Lys		82	0	0		46	0.39	18	NM_194249	317	0.41	131		Missense_Mutation	SNP	ENST00000542735.1	37	CCDS4236.1	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807228	0.70797	.	.	ENSG00000256453	ENST00000542735	T	0.40225	1.04	4.58	4.58	0.56647	.	0.000000	0.64402	D	0.000004	T	0.66694	0.2815	M	0.82716	2.605	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	T	0.73132	-0.4079	10	0.66056	D	0.02	-5.2316	17.1476	0.86770	0.0:0.0:1.0:0.0	.	29	Q8IYX4	DND1_HUMAN	K	29	ENSP00000445366:T29K	ENSP00000445366:T29K	T	-	2	0	DND1	140033096	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	2.926000	0.48892	2.358000	0.79984	0.462000	0.41574	ACA			0.647	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251669.2		NM_194249	
TCOF1	6949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	149776279	149776279	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:149776279G>T	ENST00000504761.2	+	24	4216	c.4216G>T	c.(4216-4218)Ggg>Tgg	p.G1406W	TCOF1_ENST00000377797.3_Missense_Mutation_p.G1407W|TCOF1_ENST00000513346.1_Missense_Mutation_p.G1406W|TCOF1_ENST00000323668.7_Missense_Mutation_p.G1329W|TCOF1_ENST00000445265.2_Missense_Mutation_p.G1330W|TCOF1_ENST00000439160.2_Missense_Mutation_p.G1369W|TCOF1_ENST00000451292.1_Missense_Mutation_p.G1443W			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1406					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAAGGGAAGGGGTCTCTTGG	0.542																																					p.G1406W													.	.			0			c.G4216T												25.0	22.0	23.0					5																	149776279		2203	4300	6503	SO:0001583	missense	6949	exon24			GGGAAGGGGTCTC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.4216G>T	5.37:g.149776279G>T	ENSP00000421655:p.Gly1406Trp		131	0	0		61	0.25	15	NM_001135243	343	0.49	168	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	37	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	G	13.52	2.261438	0.39995	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T	0.80480	-1.36;-1.35;-1.35;-1.36;-1.38;-1.38;-1.35;-1.38	4.42	4.42	0.53409	.	0.382221	0.19111	N	0.122433	D	0.84188	0.5417	L	0.38175	1.15	0.27211	N	0.959914	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	D;D;D;D;D	0.79108	0.992;0.992;0.992;0.97;0.992	T	0.77164	-0.2688	10	0.87932	D	0	-10.6252	12.8881	0.58055	0.0:0.0:1.0:0.0	.	1369;1329;1368;1406;1330	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	W	1443;1407;1330;1329;1369;1368;1406;1406	ENSP00000400939:G1443W;ENSP00000367028:G1407W;ENSP00000409944:G1330W;ENSP00000325223:G1329W;ENSP00000406888:G1369W;ENSP00000390717:G1368W;ENSP00000421655:G1406W;ENSP00000427484:G1406W	ENSP00000325223:G1329W	G	+	1	0	TCOF1	149756472	0.914000	0.31030	0.911000	0.35937	0.237000	0.25408	2.119000	0.41958	2.160000	0.67779	0.561000	0.74099	GGG			0.542	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000380552.1		NM_001008656	
DDX41	51428	mdanderson.org	37	5	176938912	176938912	+	Silent	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr5:176938912G>T	ENST00000507955.1	-	17	2272	c.1749C>A	c.(1747-1749)gcC>gcA	p.A583A	DOK3_ENST00000312943.6_5'Flank|DOK3_ENST00000377112.4_5'Flank|DOK3_ENST00000357198.4_5'Flank|DOK3_ENST00000501403.2_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	583					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CCCCGCAGAAGGCACAGCCGC	0.647																																					p.A583A													.	.			0			c.C1749A												57.0	58.0	58.0					5																	176938912		2203	4300	6503	SO:0001819	synonymous_variant	51428	exon17			GCAGAAGGCACAG	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1749C>A	5.37:g.176938912G>T			50	0	0		23	0.09	2	NM_016222	281	0.00	0	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Silent	SNP	ENST00000507955.1	37	CCDS4427.1																																																																																					0.647	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253432.2		NM_016222	
DEK	7913	bcgsc.ca	37	6	18264096	18264096	+	Missense_Mutation	SNP	C	C	G	rs147127829	byFrequency	TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:18264096C>G	ENST00000397239.3	-	2	570	c.123G>C	c.(121-123)gaG>gaC	p.E41D	DEK_ENST00000244776.7_Missense_Mutation_p.E41D	NM_003472.3	NP_003463.1	P35659	DEK_HUMAN	DEK proto-oncogene	41	Asp/Glu-rich (highly acidic).				chromatin modification (GO:0016568)|regulation of double-strand break repair (GO:2000779)|regulation of double-strand break repair via nonhomologous end joining (GO:2001032)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|viral genome replication (GO:0019079)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	7	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			cctcctcctcctcgtcgtcct	0.562			T	NUP214	AML								C|||	10	0.00199681	0.0068	0.0	5008	,	,		14423	0.0		0.0	False		,,,				2504	0.001				p.E41D				Dom	yes		6	6p23	7913	DEK oncogene (DNA binding)		L	.	DEK	31		0			c.G123C							-	ASP/GLU,ASP/GLU	8,4398	14.3+/-33.2	0,8,2195	43.0	47.0	45.0		123,123	-3.7	0.1	6	dbSNP_134	45	0,8600		0,0,4300	yes	missense,missense	DEK	NM_001134709.1,NM_003472.3	45,45	0,8,6495	GG,GC,CC		0.0,0.1816,0.0615	benign,benign	41/342,41/376	18264096	8,12998	2203	4300	6503	SO:0001583	missense	7913	exon2			CTCCTCCTCGTCG	X64229	CCDS34344.1, CCDS47382.1	6p23	2014-06-25	2014-06-25		ENSG00000124795	ENSG00000124795			2768	protein-coding gene	gene with protein product		125264	"""DEK oncogene (DNA binding)"", ""DEK oncogene"""			1549122	Standard	NM_003472		Approved	D6S231E	uc003ncr.1	P35659	OTTHUMG00000014319	ENST00000397239.3:c.123G>C	6.37:g.18264096C>G	ENSP00000380414:p.Glu41Asp		129	0.015503876	2		107	0.06	6	NM_003472	141	0.01	2	B2R6K6|B4DN37|Q5TGV4|Q5TGV5	Missense_Mutation	SNP	ENST00000397239.3	37	CCDS34344.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	6.267	0.417416	0.11870	0.001816	0.0	ENSG00000124795	ENST00000397239;ENST00000244776;ENST00000515742	T;T;T	0.51817	0.76;0.85;0.69	4.57	-3.65	0.04502	.	0.440668	0.20131	N	0.098587	T	0.09598	0.0236	L	0.48642	1.525	0.22880	N	0.998611	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38585	-0.9654	10	0.12766	T	0.61	-5.206	1.3254	0.02124	0.2162:0.3697:0.1081:0.306	.	41;41	B4DN37;P35659	.;DEK_HUMAN	D	41;41;46	ENSP00000380414:E41D;ENSP00000244776:E41D;ENSP00000423553:E46D	ENSP00000244776:E41D	E	-	3	2	DEK	18372075	0.003000	0.15002	0.050000	0.19076	0.529000	0.34654	-2.192000	0.01245	-1.460000	0.01911	-2.294000	0.00264	GAG			0.562	DEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039962.4			
HIST1H3C	8352	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	26045834	26045834	+	Silent	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:26045834C>T	ENST00000540144.1	+	1	196	c.196C>T	c.(196-198)Ctg>Ttg	p.L66L	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	66					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GATCCGGAAGCTGCCGTTCCA	0.632																																					p.L66L													.	.			0			c.C196T												48.0	51.0	50.0					6																	26045834		2203	4300	6503	SO:0001819	synonymous_variant	8352	exon1			CGGAAGCTGCCGT	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.196C>T	6.37:g.26045834C>T			118	0	0		100	0.27	27	NM_003531	135	0.27	37	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	ENST00000540144.1	37	CCDS4576.1																																																																																					0.632	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040078.1		NM_003531	
GGNBP1	449520	mdanderson.org	37	6	33555397	33555397	+	Intron	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:33555397G>T	ENST00000374458.1	+	5	846				LINC00336_ENST00000477984.1_RNA			Q5YKI7	GGNB1_HUMAN	gametogenetin binding protein 1 (pseudogene)						cell differentiation (GO:0030154)|mitochondrial fission (GO:0000266)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)											ttctttacccgtgaaagggga	0.512																																					.													.	.			0			.												57.0	58.0	58.0					6																	33555397		2203	4300	6503	SO:0001627	intron_variant	401253	.			TTACCCGTGAAAG			6p21	2012-04-19	2012-04-19		ENSG00000204188	ENSG00000204188			19427	pseudogene	pseudogene		609495	"""gametogenetin binding protein 1"""			15642376	Standard	NR_028361		Approved		uc021ywq.1	Q5YKI7		ENST00000374458.1:c.216+832G>T	6.37:g.33555397G>T			65	0	0		49	0.06	3	.	0		0	Q5YKI8	RNA	SNP	ENST00000374458.1	37																																																																																						0.512	GGNBP1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding					
PI16	221476	mdanderson.org	37	6	36926939	36926939	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:36926939G>A	ENST00000373674.3	+	2	518	c.190G>A	c.(190-192)Gcc>Acc	p.A64T		NM_001199159.1|NM_153370.2	NP_001186088.1|NP_699201.2	Q6UXB8	PI16_HUMAN	peptidase inhibitor 16	64	SCP.				negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	peptidase inhibitor activity (GO:0030414)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CGAGGAGCTGGCCGCCTTCGC	0.652																																					p.A64T													.	.			0			c.G190A												21.0	18.0	19.0					6																	36926939		2196	4297	6493	SO:0001583	missense	221476	exon2			GAGCTGGCCGCCT		CCDS34440.1	6p21.31	2014-01-28	2005-08-17		ENSG00000164530	ENSG00000164530			21245	protein-coding gene	gene with protein product	"""microseminoprotein, beta-binding protein"""		"""protease inhibitor 16"""				Standard	NM_001199159		Approved	MGC45378, dJ90K10.5, MSMBBP	uc003ona.3	Q6UXB8	OTTHUMG00000014611	ENST00000373674.3:c.190G>A	6.37:g.36926939G>A	ENSP00000362778:p.Ala64Thr		63	0	0		36	0.08	3	NM_153370	5	0.00	0	Q6ZVG9|Q8IYL8|Q8NBK0|Q8TCB8	Missense_Mutation	SNP	ENST00000373674.3	37	CCDS34440.1	.	.	.	.	.	.	.	.	.	.	G	35	5.440042	0.96168	.	.	ENSG00000164530	ENST00000536757;ENST00000373674	T	0.09630	2.96	5.29	5.29	0.74685	CAP domain (3);	0.346678	0.27031	N	0.021275	T	0.21718	0.0523	M	0.81497	2.545	0.42263	D	0.992026	P;D	0.56035	0.895;0.974	P;P	0.54100	0.742;0.736	T	0.02190	-1.1198	10	0.66056	D	0.02	.	18.5179	0.90942	0.0:0.0:1.0:0.0	.	64;64	Q6UXB8;Q6UXB8-2	PI16_HUMAN;.	T	64	ENSP00000362778:A64T	ENSP00000362778:A64T	A	+	1	0	PI16	37034917	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.936000	0.75892	2.462000	0.83206	0.511000	0.50034	GCC			0.652	PI16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040380.1		NM_153370	
COL12A1	1303	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	75904580	75904580	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:75904580C>A	ENST00000322507.8	-	3	466	c.157G>T	c.(157-159)Gtg>Ttg	p.V53L	COL12A1_ENST00000416123.2_Missense_Mutation_p.V53L|COL12A1_ENST00000483888.2_Missense_Mutation_p.V53L|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	53	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						CTGTAACCCACAATTGGATCA	0.393																																					p.V53L													.	.			0			c.G157T												125.0	118.0	120.0					6																	75904580		1834	4092	5926	SO:0001583	missense	1303	exon3			AACCCACAATTGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.157G>T	6.37:g.75904580C>A	ENSP00000325146:p.Val53Leu		92	0	0		114	0.24	27	NM_004370	0		0	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	37	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	C	11.72	1.723632	0.30593	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.56444	0.46;0.46;0.46	5.77	2.0	0.26442	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.420350	0.22376	N	0.060871	T	0.13329	0.0323	N	0.22421	0.69	0.27037	N	0.964117	B	0.21225	0.053	B	0.15484	0.013	T	0.23332	-1.0191	10	0.28530	T	0.3	.	5.0786	0.14644	0.2539:0.5499:0.0:0.1963	.	53	Q99715	COCA1_HUMAN	L	53	ENSP00000325146:V53L;ENSP00000412864:V53L;ENSP00000421216:V53L	ENSP00000325146:V53L	V	-	1	0	COL12A1	75961300	1.000000	0.71417	0.994000	0.49952	0.890000	0.51754	0.585000	0.23879	0.078000	0.16900	-0.919000	0.02742	GTG			0.393	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041249.3		NM_004370	
FRMD1	79981	mdanderson.org	37	6	168479734	168479734	+	Missense_Mutation	SNP	C	C	T	rs148792644	byFrequency	TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr6:168479734C>T	ENST00000283309.6	-	1	105	c.41G>A	c.(40-42)cGg>cAg	p.R14Q		NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	14						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AGGGTTTGTCCGGGCGGGGTC	0.667													c|||	2	0.000399361	0.0015	0.0	5008	,	,		15283	0.0		0.0	False		,,,				2504	0.0				p.R14Q	GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												.	.			0			c.G41A								GLN/ARG	0,4406		0,0,2203	57.0	54.0	55.0		41	-3.1	0.0	6	dbSNP_134	55	4,8596	3.7+/-12.6	0,4,4296	yes	missense	FRMD1	NM_024919.3	43	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	benign	14/550	168479734	4,13002	2203	4300	6503	SO:0001583	missense	79981	exon1			TTTGTCCGGGCGG		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.41G>A	6.37:g.168479734C>T	ENSP00000283309:p.Arg14Gln		56	0	0		45	0.07	3	NM_024919	0		0	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	ENST00000283309.6	37	CCDS5306.1	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	1.915	-0.449746	0.04572	0.0	4.65E-4	ENSG00000153303	ENST00000283309	D	0.83992	-1.79	1.57	-3.14	0.05250	.	.	.	.	.	T	0.35219	0.0924	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.19160	-1.0314	9	0.21014	T	0.42	.	3.7437	0.08540	0.1739:0.379:0.0:0.447	.	14	Q8N878	FRMD1_HUMAN	Q	14	ENSP00000283309:R14Q	ENSP00000283309:R14Q	R	-	2	0	FRMD1	168222583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.758000	0.01810	-1.188000	0.02705	-2.024000	0.00429	CGG	0		0.667	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362513.2		NM_024919	
PPP1R17	10842	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	7	31735181	31735181	+	Nonsense_Mutation	SNP	A	A	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr7:31735181A>T	ENST00000342032.3	+	3	809	c.181A>T	c.(181-183)Aaa>Taa	p.K61*	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	61					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)										GTCAGACCAAAAAAAACCAAG	0.448																																					p.K61X													.	.			0			c.A181T												143.0	139.0	141.0					7																	31735181		2203	4300	6503	SO:0001587	stop_gained	10842	exon3			GACCAAAAAAAAC	AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.181A>T	7.37:g.31735181A>T	ENSP00000340125:p.Lys61*		143	0	0		228	0.08	18	NM_006658	0		0	B4DE58|Q9UDQ0	Nonsense_Mutation	SNP	ENST00000342032.3	37	CCDS5436.1	.	.	.	.	.	.	.	.	.	.	A	44	10.662890	0.99445	.	.	ENSG00000106341	ENST00000342032	.	.	.	5.45	5.45	0.79879	.	0.062789	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6829	15.4777	0.75497	1.0:0.0:0.0:0.0	.	.	.	.	X	61	.	ENSP00000340125:K61X	K	+	1	0	C7orf16	31701706	1.000000	0.71417	0.952000	0.39060	0.998000	0.95712	6.381000	0.73163	2.195000	0.70347	0.533000	0.62120	AAA			0.448	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250498.1		NM_006658	
UPK3BL	100134938	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	102279619	102279619	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr7:102279619T>G	ENST00000340457.8	-	4	562	c.513A>C	c.(511-513)gaA>gaC	p.E171D	RP11-514P8.6_ENST00000519541.1_Missense_Mutation_p.E171D|POLR2J2_ENST00000476151.1_3'UTR|POLR2J2_ENST00000591000.1_3'UTR	NM_001114403.2	NP_001107875.1	B0FP48	UPK3L_HUMAN	uroplakin 3B-like	171						integral component of membrane (GO:0016021)				kidney(2)|stomach(1)	3						CCACGGGTCCTTCGTCATTCA	0.612																																					p.E171D													UPK3BL,NS,carcinoma,-2,4	UPK3BL	-2	4	0			c.A513C												87.0	58.0	67.0					7																	102279619		691	1584	2275	SO:0001583	missense	100134938	exon4			GGGTCCTTCGTCA	EU341824	CCDS47675.1	7q22.1	2014-02-12	2010-03-03		ENSG00000267368	ENSG00000267368			37278	protein-coding gene	gene with protein product	"""uroplakin-like protein"""						Standard	NM_001114403		Approved	UPLP		B0FP48	OTTHUMG00000165036	ENST00000340457.8:c.513A>C	7.37:g.102279619T>G	ENSP00000342938:p.Glu171Asp		613	0	0		554	0.05	30	NM_001114403	162	0.04	7		Missense_Mutation	SNP	ENST00000340457.8	37	CCDS47675.1	.	.	.	.	.	.	.	.	.	.	t	5.354	0.250573	0.10130	.	.	ENSG00000205236	ENST00000519541;ENST00000340457	T;T	0.63417	-0.04;-0.04	1.82	-0.959	0.10343	.	.	.	.	.	T	0.42966	0.1226	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.29336	-1.0015	7	0.19147	T	0.46	-0.3179	1.9225	0.03310	0.3132:0.4555:0.0:0.2313	.	.	.	.	D	171	ENSP00000429397:E171D;ENSP00000342938:E171D	ENSP00000342938:E171D	E	-	3	2	UPK3BL	102066855	0.000000	0.05858	0.147000	0.22382	0.086000	0.17979	-0.931000	0.03967	0.081000	0.16988	0.156000	0.16432	GAA			0.612	UPK3BL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381510.1		NM_001114403	
CPED1	79974	broad.mit.edu;bcgsc.ca	37	7	120782123	120782149	+	In_Frame_Del	DEL	ACTCACCATCTATAGAGAAGACCGCCC	ACTCACCATCTATAGAGAAGACCGCCC	-			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	ACTCACCATCTATAGAGAAGACCGCCC	ACTCACCATCTATAGAGAAGACCGCCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr7:120782123_120782149delACTCACCATCTATAGAGAAGACCGCCC	ENST00000310396.5	+	16	2450_2476	c.1983_2009delACTCACCATCTATAGAGAAGACCGCCC	c.(1981-2010)aaactcaccatctatagagaagaccgccca>aaa	p.LTIYREDRP662del	CPED1_ENST00000450913.2_In_Frame_Del_p.LTIYREDRP662del|CPED1_ENST00000423795.1_In_Frame_Del_p.LTIYREDRP442del	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	662						endoplasmic reticulum (GO:0005783)		p.R669H(1)|p.P670Q(1)|p.P670S(1)									TCACGTACAAACTCACCATCTATAGAGAAGACCGCCCAAGTCTGCCC	0.458																																					p.661_670del													.	.			3	Substitution - Missense(3)	large_intestine(1)|lung(1)|kidney(1)	c.1983_2009del																																									SO:0001651	inframe_deletion	79974	exon15			GTACAAACTCACC		CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.1983_2009delACTCACCATCTATAGAGAAGACCGCCC	7.37:g.120782123_120782149delACTCACCATCTATAGAGAAGACCGCCC	ENSP00000309772:p.Leu662_Pro670del		116	0	0		118	0.07	8	NM_001105533	1	0.00	0	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	In_Frame_Del	DEL	ENST00000310396.5	37	CCDS34739.1																																																																																					0.458	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000346959.1		NM_024913	
ZBED6CL	113763	mdanderson.org	37	7	150027939	150027939	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr7:150027939A>G	ENST00000343855.4	+	1	1002	c.446A>G	c.(445-447)gAg>gGg	p.E149G	LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	149																	AGCCAGGGGGAGCCTCTGCAG	0.662																																					p.E149G													.	.			0			c.A446G												14.0	18.0	17.0					7																	150027939		2191	4275	6466	SO:0001583	missense	113763	exon1			AGGGGGAGCCTCT	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.446A>G	7.37:g.150027939A>G	ENSP00000343242:p.Glu149Gly		46	0.0217391304	1		23	0.09	2	NM_138434	11	0.00	0		Missense_Mutation	SNP	ENST00000343855.4	37	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	A	7.894	0.732912	0.15507	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.75	-0.0623	0.13781	.	.	.	.	.	T	0.20901	0.0503	N	0.19112	0.55	0.09310	N	1	B	0.32829	0.386	B	0.36666	0.23	T	0.24764	-1.0151	8	0.56958	D	0.05	.	1.7022	0.02875	0.5559:0.1744:0.101:0.1687	.	149	Q96FA7	CG029_HUMAN	G	149	.	ENSP00000343242:E149G	E	+	2	0	C7orf29	149658872	0.002000	0.14202	0.003000	0.11579	0.052000	0.14988	-0.116000	0.10724	0.113000	0.18004	0.456000	0.33151	GAG			0.662	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350702.1		NM_138434	
AGAP3	116988	mdanderson.org	37	7	150813895	150813895	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr7:150813895G>T	ENST00000397238.2	+	2	347	c.347G>T	c.(346-348)aGc>aTc	p.S116I	AGAP3_ENST00000476375.1_3'UTR|AGAP3_ENST00000463381.1_5'UTR|AGAP3_ENST00000479901.1_Missense_Mutation_p.S116I|AGAP3_ENST00000473312.1_Missense_Mutation_p.S116I|AGAP3_ENST00000335367.3_Missense_Mutation_p.S296I	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	80	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						TTTGTGAACAGCCAGGAGTGG	0.657																																					p.S116I													.	.			0			c.G347T												66.0	73.0	71.0					7																	150813895		2150	4267	6417	SO:0001583	missense	116988	exon2			TGAACAGCCAGGA	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.347G>T	7.37:g.150813895G>T	ENSP00000380413:p.Ser116Ile		74	0	0		45	0.07	3	NM_031946	20	0.00	0	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000397238.2	37	CCDS43681.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.0|29.0	4.965386|4.965386	0.92855|0.92855	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000469901|ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355;ENST00000335367	.|D;D;T;D	.|0.90732	.|-2.35;-2.44;-0.86;-2.72	4.07|4.07	4.07|4.07	0.47477|0.47477	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.95046|0.95046	0.8396|0.8396	M|M	0.80746|0.80746	2.51|2.51	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.998;0.997;0.997;1.0	.|D;D;D;D	.|0.79784	.|0.985;0.979;0.931;0.993	D|D	0.95794|0.95794	0.8827|0.8827	5|10	.|0.87932	.|D	.|0	.|.	15.4575|15.4575	0.75327|0.75327	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|116;296;116;116	.|C9J975;E7ESL9;Q96P47-4;E9PAL8	.|.;.;.;.	S|I	52|116;116;116;80;296	.|ENSP00000418921:S116I;ENSP00000418125:S116I;ENSP00000380413:S116I;ENSP00000335589:S296I	.|ENSP00000334157:S80I	A|S	+|+	1|2	0|0	AGAP3|AGAP3	150444828|150444828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	5.187000|5.187000	0.65087|0.65087	2.123000|2.123000	0.65237|0.65237	0.400000|0.400000	0.26472|0.26472	GCC|AGC			0.657	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000351908.3		NM_031946	
SNTG1	54212	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	51503445	51503445	+	Missense_Mutation	SNP	A	A	G	rs370352160		TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr8:51503445A>G	ENST00000522124.1	+	13	1478	c.817A>G	c.(817-819)Aaa>Gaa	p.K273E	SNTG1_ENST00000518864.1_Missense_Mutation_p.K273E|SNTG1_ENST00000276467.5_Missense_Mutation_p.K273E|SNTG1_ENST00000517473.1_Missense_Mutation_p.K273E	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	273					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GCAGATTAAAAAAATCAACAG	0.269																																					p.K273E													.	.			0			c.A817G												18.0	20.0	19.0					8																	51503445		2185	4260	6445	SO:0001583	missense	54212	exon13			ATTAAAAAAATCA	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.817A>G	8.37:g.51503445A>G	ENSP00000429842:p.Lys273Glu		662	0.001510574	1		844	0.15	129	NM_018967	0		0	Q2M3Q0|Q9NY98	Missense_Mutation	SNP	ENST00000522124.1	37	CCDS6147.1	.	.	.	.	.	.	.	.	.	.	A	13.67	2.307885	0.40895	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.25250	1.81;1.81;2.53;2.53	4.78	4.78	0.61160	.	0.196841	0.52532	D	0.000075	T	0.18635	0.0447	L	0.47716	1.5	0.49213	D	0.999768	B;B	0.28933	0.228;0.139	B;B	0.27076	0.076;0.04	T	0.03043	-1.1079	10	0.02654	T	1	.	10.726	0.46068	1.0:0.0:0.0:0.0	.	273;273	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	E	273	ENSP00000429276:K273E;ENSP00000429842:K273E;ENSP00000431123:K273E;ENSP00000276467:K273E	ENSP00000276467:K273E	K	+	1	0	SNTG1	51665998	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.969000	0.49232	1.791000	0.52520	0.528000	0.53228	AAA			0.269	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377964.1			
TATDN1	83940	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	8	125520903	125520903	+	Nonsense_Mutation	SNP	G	G	C			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr8:125520903G>C	ENST00000276692.6	-	7	453	c.416C>G	c.(415-417)tCa>tGa	p.S139*	TATDN1_ENST00000519548.1_Nonsense_Mutation_p.S92*|TATDN1_ENST00000521546.1_5'UTR|TATDN1_ENST00000605953.1_Nonsense_Mutation_p.S139*|TATDN1_ENST00000517678.1_Nonsense_Mutation_p.S85*	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1	139					DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TGTTTGTTCTGACAGTTCAAA	0.289																																					p.S139X													.	.			0			c.C416G												48.0	44.0	45.0					8																	125520903		2201	4292	6493	SO:0001587	stop_gained	83940	exon7			TGTTCTGACAGTT	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068	ENST00000276692.6:c.416C>G	8.37:g.125520903G>C	ENSP00000276692:p.Ser139*		177	0	0		259	0.18	46	NM_032026	248	0.06	14	B2R5J0|Q8TD02|Q9BY40	Nonsense_Mutation	SNP	ENST00000276692.6	37	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	G	36	5.937770	0.97122	.	.	ENSG00000147687	ENST00000276692;ENST00000519548;ENST00000522810;ENST00000517678;ENST00000523888;ENST00000523152	.	.	.	5.72	5.72	0.89469	.	0.117768	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-4.3909	19.8917	0.96932	0.0:0.0:1.0:0.0	.	.	.	.	X	139;92;139;85;92;79	.	ENSP00000276692:S139X	S	-	2	0	TATDN1	125590084	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.156000	0.77453	2.705000	0.92388	0.591000	0.81541	TCA			0.289	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381655.1		NM_032026	
KCNK9	51305	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	140630919	140630919	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr8:140630919C>T	ENST00000520439.1	-	2	770	c.707G>A	c.(706-708)gGg>gAg	p.G236E	KCNK9_ENST00000523477.1_5'Flank|KCNK9_ENST00000303015.1_Missense_Mutation_p.G236E	NM_001282534.1	NP_001269463.1	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	236			G -> R (in BIBAS; inactive). {ECO:0000269|PubMed:18678320}.		cochlea development (GO:0090102)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|endometrium(9)|kidney(1)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)	43	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)		Doxapram(DB00561)|Halothane(DB01159)	GAGGAAGGCCCCGATGACCGT	0.597																																					p.G236E													.	.			0			c.G707A												46.0	51.0	50.0					8																	140630919		2203	4300	6503	SO:0001583	missense	51305	exon2			AAGGCCCCGATGA	AF212829	CCDS6377.1	8q24.3	2012-03-07			ENSG00000169427	ENSG00000169427		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6283	protein-coding gene	gene with protein product		605874				10734076, 16382106	Standard	NM_001282534		Approved	K2p9.1, TASK3, TASK-3	uc003yvf.1	Q9NPC2	OTTHUMG00000164186	ENST00000520439.1:c.707G>A	8.37:g.140630919C>T	ENSP00000430676:p.Gly236Glu		85	0	0		104	0.13	14	NM_016601	0		0	Q2M290|Q540F2	Missense_Mutation	SNP	ENST00000520439.1	37	CCDS6377.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541842	0.85917	.	.	ENSG00000169427	ENST00000522317;ENST00000303015;ENST00000520439	T;T;T	0.32272	1.46;1.46;1.46	5.7	5.7	0.88788	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.67382	0.2887	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.74754	-0.3558	10	0.54805	T	0.06	.	18.8306	0.92137	0.0:1.0:0.0:0.0	.	236	Q9NPC2	KCNK9_HUMAN	E	236	ENSP00000429847:G236E;ENSP00000302166:G236E;ENSP00000430676:G236E	ENSP00000302166:G236E	G	-	2	0	KCNK9	140700101	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.917000	0.69989	2.673000	0.90976	0.655000	0.94253	GGG			0.597	KCNK9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378473.1		NM_016601	
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	18775867	18775867	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr9:18775867A>T	ENST00000380548.4	+	18	2863	c.2524A>T	c.(2524-2526)Agg>Tgg	p.R842W		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	842	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TTCCTCCATCAGGCCCTGTAT	0.572																																					p.R842W													.	.			0			c.A2524T												30.0	35.0	33.0					9																	18775867		1949	4141	6090	SO:0001583	missense	92949	exon18			TCCATCAGGCCCT	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2524A>T	9.37:g.18775867A>T	ENSP00000369921:p.Arg842Trp		83	0	0		62	0.21	13	NM_001040272	0		0	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.236761	0.79800	.	.	ENSG00000178031	ENST00000380548	T	0.64260	-0.09	5.81	4.7	0.59300	.	0.000000	0.08080	U	1.000000	D	0.83608	0.5291	M	0.93375	3.41	0.80722	D	1	D	0.65815	0.995	P	0.60789	0.879	T	0.82034	-0.0657	10	0.87932	D	0	.	13.9339	0.64012	0.8461:0.1539:0.0:0.0	.	842	Q8N6G6	ATL1_HUMAN	W	842	ENSP00000369921:R842W	ENSP00000369921:R842W	R	+	1	2	ADAMTSL1	18765867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.302000	0.43637	2.210000	0.71456	0.533000	0.62120	AGG			0.572	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401206.1			
TMOD1	7111	broad.mit.edu	37	9	100361953	100361953	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr9:100361953C>G	ENST00000259365.4	+	10	1266	c.1053C>G	c.(1051-1053)atC>atG	p.I351M	TMOD1_ENST00000375175.1_Missense_Mutation_p.I224M|TMOD1_ENST00000395211.2_Missense_Mutation_p.I351M	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	351					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)				breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		CTGGGCCCATCATTCCCAAGT	0.532											OREG0019346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I351M													.	TMOD1	29		0			c.C1053G												223.0	169.0	187.0					9																	100361953		2203	4300	6503	SO:0001583	missense	7111	exon10			GCCCATCATTCCC		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.1053C>G	9.37:g.100361953C>G	ENSP00000259365:p.Ile351Met		114	0	0	1350	142	0.02	3	NM_001166116	70	0.01	1	B2RB77|Q5T7W3|Q9BUF1	Missense_Mutation	SNP	ENST00000259365.4	37	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	C	15.47	2.842324	0.51057	.	.	ENSG00000136842	ENST00000395211;ENST00000259365;ENST00000375175	T;T;T	0.27104	2.23;2.23;1.69	5.26	3.35	0.38373	.	0.000000	0.85682	D	0.000000	T	0.15089	0.0364	N	0.08118	0	0.46954	D	0.999261	P	0.46512	0.879	B	0.43478	0.421	T	0.07558	-1.0766	10	0.87932	D	0	-18.9141	10.7885	0.46419	0.0:0.7763:0.0:0.2237	.	351	P28289	TMOD1_HUMAN	M	351;351;224	ENSP00000378637:I351M;ENSP00000259365:I351M;ENSP00000364318:I224M	ENSP00000259365:I351M	I	+	3	3	TMOD1	99401774	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.104000	0.31074	1.339000	0.45563	0.563000	0.77884	ATC			0.532	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053320.2		NM_003275	
BAAT	570	broad.mit.edu	37	9	104133369	104133369	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr9:104133369T>A	ENST00000395051.3	-	1	388	c.318A>T	c.(316-318)aaA>aaT	p.K106N	BAAT_ENST00000259407.2_Missense_Mutation_p.K106N			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	106					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	AGTCATAAAGTTTTACTTGGA	0.443																																					p.K106N													.	BAAT	52		0			c.A318T												93.0	95.0	94.0					9																	104133369		2203	4300	6503	SO:0001583	missense	570	exon2			ATAAAGTTTTACT	L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.318A>T	9.37:g.104133369T>A	ENSP00000378491:p.Lys106Asn		176	0	0		195	0.03	6	NM_001127610	0		0	Q3B7W9|Q96L31	Missense_Mutation	SNP	ENST00000395051.3	37	CCDS6752.1	.	.	.	.	.	.	.	.	.	.	T	10.57	1.386098	0.25031	.	.	ENSG00000136881	ENST00000259407;ENST00000395051	T;T	0.70749	-0.51;-0.51	4.21	1.69	0.24217	Acyl-CoA thioester hydrolase/bile acid-CoA amino acid N-acetyltransferase (1);	0.748951	0.12591	N	0.455567	T	0.50939	0.1645	N	0.21194	0.64	0.09310	N	1	B	0.19331	0.035	B	0.20384	0.029	T	0.43163	-0.9408	10	0.54805	T	0.06	-9.1819	2.5251	0.04689	0.2005:0.2194:0.0:0.5801	.	106	Q14032	BAAT_HUMAN	N	106	ENSP00000259407:K106N;ENSP00000378491:K106N	ENSP00000259407:K106N	K	-	3	2	BAAT	103173190	0.000000	0.05858	0.279000	0.24732	0.023000	0.10783	-0.913000	0.04042	0.768000	0.33290	0.533000	0.62120	AAA			0.443	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053433.1			
FUBP3	8939	mdanderson.org	37	9	133510064	133510064	+	Silent	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr9:133510064C>T	ENST00000319725.9	+	17	1596	c.1521C>T	c.(1519-1521)agC>agT	p.S507S		NM_003934.1	NP_003925.1	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	507					positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|urinary_tract(2)	21				OV - Ovarian serous cystadenocarcinoma(145;0.000279)		GCCAGCAGAGCCAGCCGCAGA	0.627																																					p.S507S													.	.			0			c.C1521T												37.0	48.0	45.0					9																	133510064		2057	4205	6262	SO:0001819	synonymous_variant	8939	exon17			GCAGAGCCAGCCG	U69127	CCDS43893.1	9q34.11	2008-02-05			ENSG00000107164	ENSG00000107164			4005	protein-coding gene	gene with protein product		603536		FBP3		8940189	Standard	NM_003934		Approved		uc004bzr.1	Q96I24	OTTHUMG00000020809	ENST00000319725.9:c.1521C>T	9.37:g.133510064C>T			39	0	0		44	0.07	3	NM_003934	212	0.00	0	A3KFK8|A3KFL0|Q92946|Q9BVB6	Silent	SNP	ENST00000319725.9	37	CCDS43893.1																																																																																					0.627	FUBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054666.1			
NOTCH1	4851	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	139396539	139396539	+	Splice_Site	SNP	G	G	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chr9:139396539G>T	ENST00000277541.6	-	29	5461	c.5386C>A	c.(5386-5388)Ccc>Acc	p.P1796T		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1796					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TTCTTCAGGGGCCTGGGGGGT	0.672			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.P1796T				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	.			0			c.C5386A												52.0	58.0	56.0					9																	139396539		1906	4116	6022	SO:0001630	splice_region_variant	4851	exon29			TCAGGGGCCTGGG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5385-1C>A	9.37:g.139396539G>T			46	0	0		47	0.62	29	NM_017617	18	0.39	7	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	13.53	2.263527	0.39995	.	.	ENSG00000148400	ENST00000277541	T	0.81415	-1.49	4.61	4.61	0.57282	.	0.055260	0.64402	D	0.000001	T	0.79269	0.4417	M	0.73753	2.245	0.80722	D	1	B	0.29766	0.256	B	0.25759	0.063	T	0.77378	-0.2610	10	0.26408	T	0.33	.	16.7746	0.85548	0.0:0.0:1.0:0.0	.	1796	P46531	NOTC1_HUMAN	T	1796	ENSP00000277541:P1796T	ENSP00000277541:P1796T	P	-	1	0	NOTCH1	138516360	1.000000	0.71417	1.000000	0.80357	0.382000	0.30200	9.093000	0.94163	2.277000	0.76020	0.549000	0.68633	CCC			0.672	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055087.1		NM_017617	Missense_Mutation
RPGR	6103	mdanderson.org	37	X	38186593	38186593	+	Splice_Site	SNP	C	C	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chrX:38186593C>T	ENST00000339363.3	-	1	195	c.28G>A	c.(28-30)Gat>Aat	p.D10N	RPGR_ENST00000338898.3_Splice_Site_p.D10N|RPGR_ENST00000309513.3_Splice_Site_p.D10N|RPGR_ENST00000378505.2_Splice_Site_p.D10N|RPGR_ENST00000342811.3_Splice_Site_p.D10N|RPGR_ENST00000318842.7_Splice_Site_p.D10N|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	10					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						CGCAACTCACCGGGCATCAGC	0.746																																					p.D10N													.	.			0			c.G28A												4.0	5.0	5.0					X																	38186593		2010	3996	6006	SO:0001630	splice_region_variant	6103	exon1			ACTCACCGGGCAT	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.28+1G>A	X.37:g.38186593C>T			18	0	0		23	0.09	2	NM_001034853	36	0.03	1	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	37		.	.	.	.	.	.	.	.	.	.	C	13.69	2.310970	0.40895	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	3.68	2.81	0.32909	.	0.195047	0.43919	U	0.000505	T	0.71316	0.3325	L	0.38175	1.15	0.33288	D	0.563152	P;B	0.42692	0.787;0.424	B;B	0.43623	0.425;0.221	T	0.73534	-0.3952	9	.	.	.	.	7.9056	0.29761	0.0:0.8733:0.0:0.1267	.	10;10	E9PE28;Q92834-2	.;.	N	10	ENSP00000343671:D10N;ENSP00000308783:D10N;ENSP00000340208:D10N;ENSP00000322219:D10N;ENSP00000339531:D10N;ENSP00000367766:D10N	.	D	-	1	0	RPGR	38071537	0.982000	0.34865	0.996000	0.52242	0.122000	0.20287	2.122000	0.41987	0.695000	0.31675	0.370000	0.22315	GAT			0.746	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding				NM_000328	Missense_Mutation
IQSEC2	23096	broad.mit.edu	37	X	53263992	53263992	+	Silent	SNP	T	T	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chrX:53263992T>G	ENST00000375368.5	-	14	4046	c.3846A>C	c.(3844-3846)ccA>ccC	p.P1282P	IQSEC2_ENST00000396435.3_Silent_p.P1292P|IQSEC2_ENST00000375365.2_3'UTR			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1282	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GCTGGGGAGGTGGGGGAAGAG	0.701													t|||	4	0.0010596	0.0015	0.0014	3775	,	,		4092	0.0		0.0	False		,,,				2504	0.001				p.P1292P													.	IQSEC2	195		0			c.A3876C												2.0	2.0	2.0					X																	53263992		579	1233	1812	SO:0001819	synonymous_variant	23096	exon15			GGGAGGTGGGGGA	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3846A>C	X.37:g.53263992T>G			24	0.0833333333	2		19	0.32	6	NM_001111125	47	0.00	0	B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	ENST00000375368.5	37																																																																																						0.701	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding				XM_291345	
AWAT2	158835	broad.mit.edu	37	X	69263370	69263370	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chrX:69263370A>G	ENST00000276101.3	-	4	435	c.430T>C	c.(430-432)Ttt>Ctt	p.F144L		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	144					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						ATCCAGAAAAAGGCTCCCAGT	0.483																																					p.F144L	NSCLC(80;1334 1436 9350 24214 26427)												.	AWAT2	36		0			c.T430C												48.0	41.0	43.0					X																	69263370		2203	4300	6503	SO:0001583	missense	158835	exon4			AGAAAAAGGCTCC	BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.430T>C	X.37:g.69263370A>G	ENSP00000421172:p.Phe144Leu		122	0	0		132	0.02	3	NM_001002254	5	0.00	0	Q6IEE3|Q6P437	Missense_Mutation	SNP	ENST00000276101.3	37	CCDS35320.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761262	0.31137	.	.	ENSG00000147160	ENST00000276101	D	0.87334	-2.24	5.02	5.02	0.67125	.	0.306960	0.26400	N	0.024590	D	0.83055	0.5171	L	0.32530	0.975	0.32489	N	0.540493	P	0.49961	0.93	P	0.53102	0.718	T	0.80329	-0.1428	10	0.10902	T	0.67	.	7.1606	0.25662	0.7984:0.0:0.0:0.2016	.	144	Q6E213	AWAT2_HUMAN	L	144	ENSP00000421172:F144L	ENSP00000421172:F144L	F	-	1	0	AWAT2	69180095	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	4.020000	0.57189	1.845000	0.53610	0.417000	0.27973	TTT			0.483	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358738.1		NM_001002254	
GPRASP1	9737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101909826	101909826	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chrX:101909826A>T	ENST00000361600.5	+	5	1786	c.985A>T	c.(985-987)Aac>Tac	p.N329Y	GPRASP1_ENST00000415986.1_Missense_Mutation_p.N329Y|GPRASP1_ENST00000444152.1_Missense_Mutation_p.N329Y|GPRASP1_ENST00000537097.1_Missense_Mutation_p.N329Y|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	329					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GGAGGCCAATAACAGGGCCAG	0.478																																					p.N329Y													.	.			0			c.A985T												80.0	81.0	81.0					X																	101909826		2203	4300	6503	SO:0001583	missense	9737	exon3			GCCAATAACAGGG	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.985A>T	X.37:g.101909826A>T	ENSP00000355146:p.Asn329Tyr		31	0	0		35	0.43	15	NM_001099411	3	0.67	2	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	37	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	A	2.385	-0.341140	0.05243	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.08546	3.08;3.08;3.08;3.08	1.89	0.712	0.18167	.	.	.	.	.	T	0.03783	0.0107	N	0.08118	0	0.09310	N	1	B	0.19706	0.038	B	0.14578	0.011	T	0.40794	-0.9544	9	0.56958	D	0.05	4.6325	2.9861	0.05969	0.6599:0.0:0.3401:0.0	.	329	Q5JY77	GASP1_HUMAN	Y	329	ENSP00000393691:N329Y;ENSP00000409420:N329Y;ENSP00000355146:N329Y;ENSP00000445683:N329Y	ENSP00000355146:N329Y	N	+	1	0	GPRASP1	101796482	0.000000	0.05858	0.002000	0.10522	0.072000	0.16883	0.198000	0.17217	0.127000	0.18452	0.372000	0.22366	AAC			0.478	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057634.2		NM_014710	
GPRASP1	9737	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	101909834	101909834	+	Silent	SNP	C	C	A			TCGA-XE-A8H5-01A-11D-A435-10	TCGA-XE-A8H5-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	665a50ed-6767-411a-b99d-7e994cbe5e17	0ff8a73f-f639-4798-82f0-852d9c183b9d	g.chrX:101909834C>A	ENST00000361600.5	+	5	1794	c.993C>A	c.(991-993)gcC>gcA	p.A331A	GPRASP1_ENST00000415986.1_Silent_p.A331A|GPRASP1_ENST00000444152.1_Silent_p.A331A|GPRASP1_ENST00000537097.1_Silent_p.A331A|RP4-769N13.7_ENST00000602441.1_RNA	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	331					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						ATAACAGGGCCAGGCACAGGG	0.473																																					p.A331A													.	.			0			c.C993A												78.0	79.0	79.0					X																	101909834		2203	4300	6503	SO:0001819	synonymous_variant	9737	exon3			CAGGGCCAGGCAC	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.993C>A	X.37:g.101909834C>A			32	0	0		31	0.45	14	NM_001099411	5	0.40	2	O43168|Q96LA1	Silent	SNP	ENST00000361600.5	37	CCDS35352.1																																																																																					0.473	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057634.2		NM_014710	
