#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
LDLRAP1	26119	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	25880446	25880446	+	Missense_Mutation	SNP	C	C	T	rs142920998		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr1:25880446C>T	ENST00000374338.4	+	2	241	c.122C>T	c.(121-123)aCg>aTg	p.T41M	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	41					amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		ACGCGGGAGACGCTGCTGGAG	0.642													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17869	0.0		0.0	False		,,,				2504	0.0				p.T41M													.	.			0			c.C122T							C	MET/THR	2,4404	4.2+/-10.8	0,2,2201	60.0	49.0	53.0		122	5.6	1.0	1	dbSNP_134	53	0,8600		0,0,4300	no	missense	LDLRAP1	NM_015627.2	81	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	probably-damaging	41/309	25880446	2,13004	2203	4300	6503	SO:0001583	missense	26119	exon2			GGGAGACGCTGCT	BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.122C>T	1.37:g.25880446C>T	ENSP00000363458:p.Thr41Met		56	0	0		76	0.28	21	NM_015627	44	0.27	12	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	ENST00000374338.4	37	CCDS30639.1	.	.	.	.	.	.	.	.	.	.	C	30	5.050575	0.93740	4.54E-4	0.0	ENSG00000157978	ENST00000374338	T	0.63417	-0.04	5.59	5.59	0.84812	Pleckstrin homology-type (1);	0.045089	0.85682	D	0.000000	T	0.71005	0.3289	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.67382	0.951	T	0.72554	-0.4258	10	0.59425	D	0.04	-12.98	18.5826	0.91177	0.0:1.0:0.0:0.0	.	41	Q5SW96	ARH_HUMAN	M	41	ENSP00000363458:T41M	ENSP00000363458:T41M	T	+	2	0	LDLRAP1	25753033	1.000000	0.71417	0.964000	0.40570	0.969000	0.65631	7.789000	0.85783	2.642000	0.89623	0.561000	0.74099	ACG			0.642	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019350.3		NM_015627	
DOCK7	85440	broad.mit.edu;mdanderson.org	37	1	63021531	63021531	+	Missense_Mutation	SNP	C	C	T	rs370921127		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr1:63021531C>T	ENST00000340370.5	-	21	2578	c.2561G>A	c.(2560-2562)cGc>cAc	p.R854H	DOCK7_ENST00000251157.5_Missense_Mutation_p.R854H	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	854					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)	p.R854H(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATTTGGTAGGCGGAAAACATA	0.333																																					p.R854H													DOCK7,caecum,carcinoma,0,2	DOCK7	184	2	1	Substitution - Missense(1)	large_intestine(1)	c.G2561A												166.0	157.0	160.0					1																	63021531		2203	4300	6503	SO:0001583	missense	85440	exon21			GGTAGGCGGAAAA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.2561G>A	1.37:g.63021531C>T	ENSP00000340742:p.Arg854His		46	0	0		34	0.09	3	NM_001271999	23	0.30	7	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	C	17.19	3.325675	0.60743	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370	T;T	0.32753	1.44;1.44	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.25195	0.0612	N	0.25332	0.735	0.80722	D	1	B;B;B;B;B	0.34241	0.046;0.046;0.094;0.444;0.091	B;B;B;B;B	0.33042	0.018;0.018;0.036;0.157;0.045	T	0.02574	-1.1139	10	0.24483	T	0.36	.	19.4782	0.94998	0.0:1.0:0.0:0.0	.	854;854;854;854;854	Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.;.;.;.;.	H	854	ENSP00000251157:R854H;ENSP00000340742:R854H	ENSP00000251157:R854H	R	-	2	0	DOCK7	62794119	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.932000	0.70121	2.838000	0.97847	0.655000	0.94253	CGC			0.333	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036806.1		NM_033407	
KCND3	3752	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	112524653	112524653	+	Silent	SNP	C	C	T	rs370453605		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr1:112524653C>T	ENST00000315987.2	-	2	1175	c.696G>A	c.(694-696)gcG>gcA	p.A232A	KCND3_ENST00000369697.1_Silent_p.A232A|KCND3_ENST00000302127.4_Silent_p.A232A	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	232					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCATGACGCACGCCGTGTCCA	0.667													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16332	0.0		0.0	False		,,,				2504	0.0				p.A232A													KCND3_ENST00000315987,NS,carcinoma,0,2	KCND3_ENST00000315987	0	2	0			c.G696A							C	,	2,4404	4.2+/-10.8	0,2,2201	35.0	35.0	35.0		696,696	1.3	1.0	1		35	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	KCND3	NM_004980.4,NM_172198.2	,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,	232/656,232/637	112524653	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3752	exon2			GACGCACGCCGTG	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.696G>A	1.37:g.112524653C>T			65	0	0		54	0.24	13	NM_004980	0		0	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Silent	SNP	ENST00000315987.2	37	CCDS843.1																																																																																					0.667	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000033144.1		NM_172198	
OR13A1	79290	mdanderson.org	37	10	45799527	45799527	+	Missense_Mutation	SNP	C	C	T	rs115582445	byFrequency	TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr10:45799527C>T	ENST00000553795.1	-	4	652	c.344G>A	c.(343-345)tGc>tAc	p.C115Y	OR13A1_ENST00000536058.1_Missense_Mutation_p.C115Y|OR13A1_ENST00000374401.2_Missense_Mutation_p.C115Y	NM_001004297.2	NP_001004297.2	Q8NGR1	O13A1_HUMAN	olfactory receptor, family 13, subfamily A, member 1	115						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)|urinary_tract(1)	19						CTGGGCCATGCAGCCCCCGTA	0.592																																					p.C115Y													.	.			0			c.G344A												51.0	45.0	47.0					10																	45799527		2203	4300	6503	SO:0001583	missense	79290	exon4			GCCATGCAGCCCC	AB065728	CCDS31188.1	10q11.21	2012-10-03			ENSG00000256574	ENSG00000256574		"""GPCR / Class A : Olfactory receptors"""	14772	protein-coding gene	gene with protein product							Standard	NM_001004297		Approved		uc001jcc.1	Q8NGR1	OTTHUMG00000018080	ENST00000553795.1:c.344G>A	10.37:g.45799527C>T	ENSP00000451950:p.Cys115Tyr		94	0	0		48	0.06	3	NM_001004297	0		0	Q2M3M4|Q5VV57|Q6IFH5|Q6ZMN6	Missense_Mutation	SNP	ENST00000553795.1	37	CCDS31188.1	.	.	.	.	.	.	.	.	.	.	c	17.52	3.410093	0.62399	.	.	ENSG00000256574	ENST00000553795;ENST00000536058;ENST00000374401	T;T;T	0.00547	6.66;6.66;6.66	5.58	3.72	0.42706	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000177	T	0.01523	0.0049	H	0.94503	3.545	0.49130	D	0.999758	P	0.41450	0.75	B	0.43360	0.417	T	0.34279	-0.9835	10	0.87932	D	0	-67.8229	8.795	0.34874	0.15:0.7709:0.0:0.0791	.	115	Q8NGR1	O13A1_HUMAN	Y	115	ENSP00000451950:C115Y;ENSP00000438657:C115Y;ENSP00000363522:C115Y	ENSP00000311379:C115Y	C	-	2	0	OR13A1	45119533	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	3.755000	0.55197	0.704000	0.31869	0.650000	0.86243	TGC			0.592	OR13A1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000047779.2		NM_001004297	
TET1	80312	hgsc.bcm.edu;mdanderson.org	37	10	70333543	70333543	+	Nonsense_Mutation	SNP	C	C	G			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr10:70333543C>G	ENST00000373644.4	+	2	1657	c.1448C>G	c.(1447-1449)tCa>tGa	p.S483*		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	483					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						TCATCAAACTCAGAGAAAAAT	0.453																																					p.S483X													.	.			0			c.C1448G												48.0	46.0	47.0					10																	70333543		2203	4300	6503	SO:0001587	stop_gained	80312	exon2			CAAACTCAGAGAA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1448C>G	10.37:g.70333543C>G	ENSP00000362748:p.Ser483*		99	0	0		84	0.08	7	NM_030625	12	0.25	3	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Nonsense_Mutation	SNP	ENST00000373644.4	37	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	C	37	6.435580	0.97564	.	.	ENSG00000138336	ENST00000373644	.	.	.	5.31	3.1	0.35709	.	1.577610	0.04056	N	0.305535	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	7.1634	0.25677	0.0:0.7219:0.0:0.2781	.	.	.	.	X	483	.	ENSP00000362748:S483X	S	+	2	0	TET1	70003549	0.018000	0.18449	0.579000	0.28588	0.812000	0.45895	2.001000	0.40825	1.240000	0.43803	0.305000	0.20034	TCA			0.453	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048354.1		NM_030625	
PHLDA2	7262	broad.mit.edu	37	11	2950513	2950513	+	Missense_Mutation	SNP	G	G	T	rs554708054		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:2950513G>T	ENST00000314222.4	-	1	172	c.82C>A	c.(82-84)Cgc>Agc	p.R28S		NM_003311.3	NP_003302.1	Q53GA4	PHLA2_HUMAN	pleckstrin homology-like domain, family A, member 2	28	PH.				apoptotic process (GO:0006915)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|regulation of gene expression (GO:0010468)|regulation of glycogen metabolic process (GO:0070873)	cytoplasm (GO:0005737)|membrane (GO:0016020)		p.R28S(1)		central_nervous_system(1)	1		all_epithelial(84;0.000124)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)|all_lung(207;0.198)		BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGCACCCCGCGCTTCTTCTTC	0.672																																					p.R28S													PHLDA2,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	PHLDA2	10	1	1	Substitution - Missense(1)	central_nervous_system(1)	c.C82A												18.0	20.0	19.0					11																	2950513		2199	4297	6496	SO:0001583	missense	7262	exon1			CCCCGCGCTTCTT	AF035444	CCDS7741.1	11p15.4	2013-01-10	2003-09-26	2003-10-01	ENSG00000181649	ENSG00000181649		"""Pleckstrin homology (PH) domain containing"""	12385	protein-coding gene	gene with protein product		602131	"""tumor suppressing subtransferable candidate 3"""	TSSC3		9328465, 9403053	Standard	NM_003311		Approved	IPL, BWR1C, HLDA2	uc001lxa.1	Q53GA4	OTTHUMG00000010926	ENST00000314222.4:c.82C>A	11.37:g.2950513G>T	ENSP00000319231:p.Arg28Ser		82	0.012195122	1		54	0.07	4	NM_003311	8	0.00	0	O00496	Missense_Mutation	SNP	ENST00000314222.4	37	CCDS7741.1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727508	0.69074	.	.	ENSG00000181649	ENST00000314222	T	0.45668	0.89	3.51	3.51	0.40186	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.303419	0.25124	U	0.032956	T	0.43055	0.1230	M	0.66939	2.045	0.40575	D	0.98133	P	0.43578	0.811	B	0.39771	0.309	T	0.53507	-0.8429	10	0.44086	T	0.13	-19.9369	15.3955	0.74790	0.0:0.0:1.0:0.0	.	28	Q53GA4	PHLA2_HUMAN	S	28	ENSP00000319231:R28S	ENSP00000319231:R28S	R	-	1	0	PHLDA2	2907089	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.678000	0.46900	1.660000	0.50760	0.313000	0.20887	CGC			0.672	PHLDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000030116.1		NM_003311	
ZNF215	7762	mdanderson.org	37	11	6953825	6953825	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:6953825G>T	ENST00000278319.5	+	3	910	c.322G>T	c.(322-324)Gtg>Ttg	p.V108L	ZNF215_ENST00000529903.1_Missense_Mutation_p.V108L|ZNF215_ENST00000414517.2_Missense_Mutation_p.V108L|ZNF215_ENST00000527171.1_3'UTR	NM_013250.2	NP_037382.2	Q9UL58	ZN215_HUMAN	zinc finger protein 215	108	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(2)|skin(4)	32				Epithelial(150;6.33e-08)|BRCA - Breast invasive adenocarcinoma(625;0.134)		CAGGACTTGGGTGAATTTACA	0.383																																					p.V108L													.	.			0			c.G322T												61.0	65.0	64.0					11																	6953825		2201	4296	6497	SO:0001583	missense	7762	exon3			ACTTGGGTGAATT	AF056618	CCDS7775.1	11p15.4	2013-01-09			ENSG00000149054	ENSG00000149054		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13007	protein-coding gene	gene with protein product		605016					Standard	XM_005253130		Approved	ZKSCAN11, ZSCAN43	uc001mey.3	Q9UL58	OTTHUMG00000165507	ENST00000278319.5:c.322G>T	11.37:g.6953825G>T	ENSP00000278319:p.Val108Leu		69	0	0		49	0.06	3	NM_013250	7	0.00	0	Q96C84	Missense_Mutation	SNP	ENST00000278319.5	37	CCDS7775.1	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617525	0.46736	.	.	ENSG00000149054	ENST00000278319;ENST00000414517;ENST00000529903	T;T;T	0.08896	3.04;3.04;3.04	3.86	3.86	0.44501	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.36555	N	0.002527	T	0.24586	0.0596	M	0.66378	2.025	0.26746	N	0.970303	D;D;D	0.76494	0.997;0.997;0.999	D;D;D	0.85130	0.994;0.994;0.997	T	0.00819	-1.1553	10	0.87932	D	0	-13.6592	11.6165	0.51092	0.0:0.0:1.0:0.0	.	108;108;108	B4DYW9;Q96C84;Q9UL58	.;.;ZN215_HUMAN	L	108	ENSP00000278319:V108L;ENSP00000393202:V108L;ENSP00000432306:V108L	ENSP00000278319:V108L	V	+	1	0	ZNF215	6910401	1.000000	0.71417	1.000000	0.80357	0.239000	0.25481	4.673000	0.61604	2.427000	0.82271	0.655000	0.94253	GTG			0.383	ZNF215-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384550.1			
SCUBE2	57758	mdanderson.org	37	11	9082017	9082017	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:9082017G>T	ENST00000309263.3	-	8	977	c.905C>A	c.(904-906)aCa>aAa	p.T302K	SCUBE2_ENST00000520467.1_Missense_Mutation_p.T302K|SCUBE2_ENST00000450649.2_Missense_Mutation_p.T302K|RP11-467K18.2_ENST00000521394.2_RNA|SCUBE2_ENST00000457346.2_Missense_Mutation_p.T302K			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	302	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		GTGGACACCTGTCGAAGTATC	0.507																																					p.T302K													.	.			0			c.C905A												171.0	154.0	160.0					11																	9082017		2201	4296	6497	SO:0001583	missense	57758	exon8			ACACCTGTCGAAG	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.905C>A	11.37:g.9082017G>T	ENSP00000310658:p.Thr302Lys		59	0	0		50	0.06	3	NM_001170690	0		0	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.471950|4.471950	0.84533|0.84533	.|.	.|.	ENSG00000175356|ENSG00000175356	ENST00000519788;ENST00000531429|ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	.|D;D;D;D	.|0.87103	.|-2.21;-2.21;-2.21;-2.21	5.94|5.94	5.94|5.94	0.96194|0.96194	.|Epidermal growth factor-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94195|0.94195	0.8137|0.8137	M|M	0.82323|0.82323	2.585|2.585	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;0.999	D|D	0.92837|0.92837	0.6285|0.6285	5|10	.|0.41790	.|T	.|0.15	.|.	20.3736|20.3736	0.98901|0.98901	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|302;302;302	.|Q9NQ36-3;Q9NQ36-2;Q9NQ36	.|.;.;SCUB2_HUMAN	K|K	26;67|302	.|ENSP00000390481:T302K;ENSP00000310658:T302K;ENSP00000415187:T302K;ENSP00000429969:T302K	.|ENSP00000310658:T302K	Q|T	-|-	1|2	0|0	SCUBE2|SCUBE2	9038593|9038593	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.977000|0.977000	0.68977|0.68977	9.869000|9.869000	0.99810|0.99810	2.820000|2.820000	0.97059|0.97059	0.650000|0.650000	0.86243|0.86243	CAG|ACA			0.507	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000385812.2		NM_020974	
LDHAL6A	160287	mdanderson.org	37	11	18500372	18500372	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:18500372G>T	ENST00000280706.2	+	7	1751	c.954G>T	c.(952-954)aaG>aaT	p.K318N	TSG101_ENST00000536719.1_Intron|LDHAL6A_ENST00000396213.3_Missense_Mutation_p.K318N	NM_144972.4	NP_659409.2	Q6ZMR3	LDH6A_HUMAN	lactate dehydrogenase A-like 6A	318					cellular carbohydrate metabolic process (GO:0044262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	L-lactate dehydrogenase activity (GO:0004459)			large_intestine(3)|lung(9)|urinary_tract(1)	13						GCTTGCAAAAGAGTGCAGAAA	0.383																																					p.K318N													.	.			0			c.G954T												152.0	165.0	160.0					11																	18500372		2199	4293	6492	SO:0001583	missense	160287	exon7			GCAAAAGAGTGCA	AK131523	CCDS7841.1	11p15.1	2011-01-27			ENSG00000166800	ENSG00000166800			28335	protein-coding gene	gene with protein product						12477932	Standard	NM_001144071		Approved	MGC23940, LDH6A	uc001mop.1	Q6ZMR3	OTTHUMG00000167724	ENST00000280706.2:c.954G>T	11.37:g.18500372G>T	ENSP00000280706:p.Lys318Asn		38	0	0		19	0.16	3	NM_144972	0		0	D3DQY5	Missense_Mutation	SNP	ENST00000280706.2	37	CCDS7841.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975189	0.34848	.	.	ENSG00000166800	ENST00000396213;ENST00000280706	T;T	0.69175	-0.38;-0.38	4.06	3.14	0.36123	Lactate/malate dehydrogenase, C-terminal (1);Lactate dehydrogenase/glycoside hydrolase, family 4, C-terminal (2);	0.082018	0.48286	U	0.000198	T	0.75729	0.3889	M	0.64567	1.98	0.48040	D	0.999577	D	0.76494	0.999	D	0.68353	0.957	T	0.74340	-0.3697	10	0.48119	T	0.1	.	10.4535	0.44537	0.099:0.0:0.901:0.0	.	318	Q6ZMR3	LDH6A_HUMAN	N	318	ENSP00000379516:K318N;ENSP00000280706:K318N	ENSP00000280706:K318N	K	+	3	2	LDHAL6A	18456948	1.000000	0.71417	0.050000	0.19076	0.685000	0.39939	1.918000	0.40006	0.696000	0.31696	0.555000	0.69702	AAG			0.383	LDHAL6A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000395904.1		NM_144972	
BDNF	627	hgsc.bcm.edu	37	11	27681201	27681201	+	5'UTR	SNP	C	C	T	rs182322619|rs200712840|rs202011320		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:27681201C>T	ENST00000525528.1	-	0	4				BDNF_ENST00000395986.2_Intron|BDNF_ENST00000530861.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000584049.1_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000418212.1_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000420794.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000532997.1_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000438929.1_Intron|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000533246.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						tgtgtgcgcgcgcgcgtgtgC	0.433																																					.													.	.			0			.																																									SO:0001623	5_prime_UTR_variant	497258	.			TGCGCGCGCGCGT	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1090G>A	11.37:g.27681201C>T			115	0	0		62	0.15	9	.	1	0.00	0	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	SNP	ENST00000525528.1	37	CCDS7866.1																																																																																					0.433	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388135.1		NM_170735	
TMEM132A	54972	mdanderson.org	37	11	60698068	60698068	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr11:60698068G>T	ENST00000453848.2	+	5	1111	c.953G>T	c.(952-954)gGc>gTc	p.G318V	TMEM132A_ENST00000005286.4_Missense_Mutation_p.G318V			Q24JP5	T132A_HUMAN	transmembrane protein 132A	318						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				breast(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|prostate(1)|skin(3)	32						CGCTTCAAGGGCTCCAGGCAC	0.642																																					p.G318V													.	.			0			c.G953T												72.0	76.0	75.0					11																	60698068		2203	4299	6502	SO:0001583	missense	54972	exon5			TCAAGGGCTCCAG	AK000546	CCDS7997.1, CCDS44618.1	11q12.2	2006-03-02	2006-03-02	2006-03-02	ENSG00000006118	ENSG00000006118			31092	protein-coding gene	gene with protein product			"""heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) binding protein 1"""	HSPA5BP1		12514190, 10997877	Standard	NM_017870		Approved	GBP, FLJ20539	uc001nqi.3	Q24JP5	OTTHUMG00000167803	ENST00000453848.2:c.953G>T	11.37:g.60698068G>T	ENSP00000405823:p.Gly318Val		39	0	0		37	0.08	3	NM_017870	122	0.00	0	Q69YU7|Q86VZ8|Q86W97|Q9H8K3|Q9HCI9|Q9NWY0	Missense_Mutation	SNP	ENST00000453848.2	37	CCDS44618.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014113	0.75161	.	.	ENSG00000006118	ENST00000544065;ENST00000444690;ENST00000453848;ENST00000005286	T;T;T	0.19250	2.83;2.16;2.16	5.5	4.58	0.56647	.	0.083355	0.49305	D	0.000145	T	0.46073	0.1374	M	0.70595	2.14	0.53688	D	0.999972	D;P;D;D	0.89917	1.0;0.926;1.0;1.0	D;P;D;D	0.97110	1.0;0.68;0.993;1.0	T	0.50056	-0.8872	10	0.87932	D	0	.	14.7648	0.69632	0.0:0.1442:0.8558:0.0	.	307;68;318;318	Q24JP5-3;Q24JP5-4;Q24JP5;Q24JP5-2	.;.;T132A_HUMAN;.	V	56;68;318;318	ENSP00000442754:G56V;ENSP00000405823:G318V;ENSP00000005286:G318V	ENSP00000005286:G318V	G	+	2	0	TMEM132A	60454644	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.317000	0.59184	1.448000	0.47680	0.655000	0.94253	GGC			0.642	TMEM132A-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000396352.1		NM_017870	
TAS2R20	259295	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	12	11150095	11150096	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	CT	CT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:11150095_11150096delCT	ENST00000538986.1	-	1	378_379	c.379_380delAG	c.(379-381)agtfs	p.S127fs	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176889.2	NP_795370.2	P59543	T2R20_HUMAN	taste receptor, type 2, member 20	127					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13						CAGAACTACACTCTTAGCCTTC	0.381																																					p.127_127del													.	TAS2R20	17		0			c.380_381del																																									SO:0001589	frameshift_variant	259295	exon1			ACTACACTCTTAG	AX097732, AF494236	CCDS8639.1	12p13.2	2012-08-22			ENSG00000255837	ENSG00000255837		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19109	protein-coding gene	gene with protein product		613962	"""taste receptor, type 2, member 49"""	TAS2R49			Standard	NM_176889		Approved	T2R20, T2R56	uc001qzm.2	P59543	OTTHUMG00000162695	ENST00000538986.1:c.379_380delAG	12.37:g.11150097_11150098delCT	ENSP00000441624:p.Ser127fs		119	0	0		214	0.14	30	NM_176889	1	0.00	0	P59549|Q2HIZ4|Q496D8|Q645X9	Frame_Shift_Del	DEL	ENST00000538986.1	37	CCDS8639.1																																																																																					0.381	TAS2R20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000370130.2		NM_176889	
PRB4	5545	broad.mit.edu	37	12	11461592	11461592	+	Missense_Mutation	SNP	G	G	T	rs199532199		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:11461592G>T	ENST00000535904.1	-	3	358	c.325C>A	c.(325-327)Cag>Aag	p.Q109K	PRB4_ENST00000279575.1_Missense_Mutation_p.Q109K|PRB4_ENST00000445719.2_Missense_Mutation_p.Q109K			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	130	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						CCTTGGGACTGGTTTCCTCCT	0.607										HNSCC(22;0.051)																											p.Q109K													.	PRB4	59		0			c.C325A												177.0	186.0	183.0					12																	11461592		2202	4299	6501	SO:0001583	missense	5545	exon3			GGGACTGGTTTCC		CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.325C>A	12.37:g.11461592G>T	ENSP00000442834:p.Gln109Lys		151	0.0132450331	2		263	0.04	10	NM_001261399	0		0	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	ENST00000535904.1	37	CCDS8641.1	.	.	.	.	.	.	.	.	.	.	.	0	-2.660851	0.00107	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.06068	3.35;3.35;3.35	0.678	-1.36	0.09085	.	.	.	.	.	T	0.02455	0.0075	N	0.11560	0.145	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.44375	-0.9332	8	0.17369	T	0.5	.	.	.	.	.	109	E9PAL0	.	K	109	ENSP00000279575:Q109K;ENSP00000442834:Q109K;ENSP00000412740:Q109K	ENSP00000279575:Q109K	Q	-	1	0	PRB4	11352859	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.408000	0.01042	-2.282000	0.00673	-1.086000	0.02197	CAG			0.607	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000402308.1		NM_002723	
GXYLT1	283464	broad.mit.edu;mdanderson.org	37	12	42491294	42491294	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:42491294G>T	ENST00000398675.3	-	7	1343	c.1111C>A	c.(1111-1113)Cat>Aat	p.H371N	GXYLT1_ENST00000280876.6_Missense_Mutation_p.H340N	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	371					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						TTATCGTCATGGTAAACACCT	0.348																																					p.H371N													.	GXYLT1	47		0			c.C1111A												123.0	117.0	119.0					12																	42491294		1871	4112	5983	SO:0001583	missense	283464	exon7			CGTCATGGTAAAC	BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.1111C>A	12.37:g.42491294G>T	ENSP00000381666:p.His371Asn		53	0	0		64	0.06	4	NM_173601	65	0.00	0	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	ENST00000398675.3	37	CCDS41772.1	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604987	0.87157	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	T;T	0.21932	1.98;1.98	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	M	0.84326	2.69	0.80722	D	1	D;D	0.69078	0.995;0.997	D;P	0.66979	0.948;0.889	T	0.40794	-0.9544	10	0.31617	T	0.26	-16.834	20.1294	0.97995	0.0:0.0:1.0:0.0	.	340;371	Q4G148-2;Q4G148	.;GXLT1_HUMAN	N	371;340	ENSP00000381666:H371N;ENSP00000280876:H340N	ENSP00000280876:H340N	H	-	1	0	GXYLT1	40777561	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.773000	0.98989	2.758000	0.94735	0.591000	0.81541	CAT			0.348	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000403778.1		XM_290597	
TUBA1A	7846	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	49579631	49579631	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:49579631G>C	ENST00000295766.5	-	4	997	c.518C>G	c.(517-519)cCg>cGg	p.P173R	TUBA1A_ENST00000301071.7_Missense_Mutation_p.P173R|TUBA1A_ENST00000546918.1_Missense_Mutation_p.R224G|TUBA1A_ENST00000550767.1_Missense_Mutation_p.P138R	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	173					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	CTGGGGCGCCGGGTAAATAGA	0.532																																					p.P173R	Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)												.	.			0			c.C518G												51.0	56.0	54.0					12																	49579631		2203	4300	6503	SO:0001583	missense	7846	exon4			GGCGCCGGGTAAA	AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.518C>G	12.37:g.49579631G>C	ENSP00000439020:p.Pro173Arg		161	0	0		219	0.18	39	NM_001270399	2287	0.13	305	A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	ENST00000295766.5	37	CCDS58227.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.25|14.25	2.479410|2.479410	0.44044|0.44044	.|.	.|.	ENSG00000167552|ENSG00000167552	ENST00000301071;ENST00000548405;ENST00000295766;ENST00000550767;ENST00000547939|ENST00000546918	D;D;D;D|T	0.89746|0.65732	-2.56;-2.56;-2.56;-2.56|-0.17	5.25|5.25	5.25|5.25	0.73442|0.73442	Tubulin/FtsZ, GTPase domain (4);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|D	0.90407|0.90407	0.6997|0.6997	H|H	0.99975|0.99975	5.155|5.155	0.45216|0.45216	D|D	0.998226|0.998226	D|.	0.89917|.	1.0|.	D|.	0.97110|.	1.0|.	D|D	0.95362|0.95362	0.8456|0.8456	10|7	0.87932|0.87932	D|D	0|0	.|.	17.6261|17.6261	0.88095|0.88095	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	173|.	Q71U36|.	TBA1A_HUMAN|.	R|G	173;20;173;138;138|224	ENSP00000301071:P173R;ENSP00000439020:P173R;ENSP00000446637:P138R;ENSP00000450268:P138R|ENSP00000446613:R224G	ENSP00000439020:P173R|ENSP00000446613:R224G	P|R	-|-	2|1	0|2	TUBA1A|TUBA1A	47865898|47865898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.825000|0.825000	0.46686|0.46686	9.330000|9.330000	0.96422|0.96422	2.443000|2.443000	0.82685|0.82685	0.462000|0.462000	0.41574|0.41574	CCG|CGG			0.532	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000404547.2		NM_006009	
MMP19	4327	broad.mit.edu;bcgsc.ca	37	12	56231059	56231081	+	Frame_Shift_Del	DEL	AGGGCTGGTTTGGCACTCCCGTA	AGGGCTGGTTTGGCACTCCCGTA	-			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	AGGGCTGGTTTGGCACTCCCGTA	AGGGCTGGTTTGGCACTCCCGTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:56231059_56231081delAGGGCTGGTTTGGCACTCCCGTA	ENST00000322569.4	-	9	1357_1379	c.1266_1288delTACGGGAGTGCCAAACCAGCCCT	c.(1264-1290)tttacgggagtgccaaaccagccctcgfs	p.TGVPNQPS423fs	MMP19_ENST00000548629.1_Frame_Shift_Del_p.TGVPNQPS400fs|MMP19_ENST00000409200.3_3'UTR|TMEM198B_ENST00000478241.1_RNA|MMP19_ENST00000394182.1_Frame_Shift_Del_p.TGVPNQPS137fs	NM_002429.4	NP_002420.1	Q99542	MMP19_HUMAN	matrix metallopeptidase 19	423					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|luteolysis (GO:0001554)|ovarian follicle development (GO:0001541)|ovulation from ovarian follicle (GO:0001542)|proteolysis (GO:0006508)|response to cAMP (GO:0051591)|response to hormone (GO:0009725)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	26					Marimastat(DB00786)	ATAGCAGCCGAGGGCTGGTTTGGCACTCCCGTAAACAAACCCT	0.565																																					p.422_430del													.	MMP19	61		0			c.1266_1288del																																									SO:0001589	frameshift_variant	4327	exon9			CAGCCGAGGGCTG	X92521	CCDS8895.1, CCDS61146.1	12q14	2005-08-08	2005-08-08			ENSG00000123342			7165	protein-coding gene	gene with protein product		601807	"""matrix metalloproteinase 19"""	MMP18		9232430	Standard	NM_002429		Approved	RASI-1	uc001sib.4	Q99542	OTTHUMG00000170216	ENST00000322569.4:c.1266_1288delTACGGGAGTGCCAAACCAGCCCT	12.37:g.56231059_56231081delAGGGCTGGTTTGGCACTCCCGTA	ENSP00000313437:p.Thr423fs		118	0	0		165	0.00	0	NM_002429	11	0.00	0	B4E030|O15278|O95606|Q99580	Frame_Shift_Del	DEL	ENST00000322569.4	37	CCDS8895.1																																																																																					0.565	MMP19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408023.1		NM_002429	
GRIP1	23426	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	66838439	66838439	+	Missense_Mutation	SNP	C	C	T	rs369501964		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:66838439C>T	ENST00000398016.3	-	12	1524	c.1456G>A	c.(1456-1458)Gaa>Aaa	p.E486K	GRIP1_ENST00000286445.7_Missense_Mutation_p.E538K|GRIP1_ENST00000359742.4_Missense_Mutation_p.E538K	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		CTGGCTTCTTCGAAGGTGCTG	0.458																																					p.E486K													.	GRIP1	106		0			c.G1456A												120.0	120.0	120.0					12																	66838439		1948	4143	6091	SO:0001583	missense	23426	exon12			CTTCTTCGAAGGT	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.1456G>A	12.37:g.66838439C>T	ENSP00000381098:p.Glu486Lys		149	0.0067114094	1		194	0.16	32	NM_001178074	2	0.50	1	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	37	CCDS41807.1	.	.	.	.	.	.	.	.	.	.	C	34	5.318744	0.95682	.	.	ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	5.61	5.61	0.85477	PDZ/DHR/GLGF (4);	0.105878	0.64402	D	0.000008	T	0.44117	0.1278	M	0.70903	2.155	0.80722	D	1	B;P;B;P	0.52061	0.394;0.521;0.146;0.95	P;B;B;P	0.47134	0.455;0.267;0.244;0.539	T	0.35325	-0.9793	9	.	.	.	-23.918	19.6387	0.95748	0.0:1.0:0.0:0.0	.	486;538;486;538	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2	.;GRIP1_HUMAN;.;.	K	486;538;538;486;430;378	ENSP00000381098:E486K;ENSP00000352780:E538K;ENSP00000286445:E538K;ENSP00000446047:E486K;ENSP00000446024:E430K;ENSP00000446011:E378K	.	E	-	1	0	GRIP1	65124706	1.000000	0.71417	0.966000	0.40874	0.990000	0.78478	7.487000	0.81328	2.641000	0.89580	0.544000	0.68410	GAA			0.458	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401975.2			
PLXNC1	10154	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	12	94542893	94542893	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:94542893T>A	ENST00000258526.4	+	1	395	c.146T>A	c.(145-147)aTc>aAc	p.I49N		NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	49	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ATCGGAGCCATCGCGGCGAGC	0.721																																					p.I49N													.	.			0			c.T146A												12.0	14.0	13.0					12																	94542893		2143	4220	6363	SO:0001583	missense	10154	exon1			GAGCCATCGCGGC	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.146T>A	12.37:g.94542893T>A	ENSP00000258526:p.Ile49Asn		10	0	0		29	0.17	5	NM_005761	0		0	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	37	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316714	0.40996	.	.	ENSG00000136040	ENST00000258526	T	0.05649	3.41	4.48	4.48	0.54585	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (2);	0.179052	0.27871	N	0.017515	T	0.08714	0.0216	L	0.44542	1.39	0.80722	D	1	D	0.61697	0.99	P	0.46850	0.529	T	0.05517	-1.0880	10	0.87932	D	0	.	9.3135	0.37919	0.0:0.0:0.1811:0.8189	.	49	O60486	PLXC1_HUMAN	N	49	ENSP00000258526:I49N	ENSP00000258526:I49N	I	+	2	0	PLXNC1	93067024	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.274000	0.58921	1.643000	0.50594	0.374000	0.22700	ATC			0.721	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408126.2			
SSH1	54434	broad.mit.edu	37	12	109181808	109181809	+	Frame_Shift_Ins	INS	-	-	G	rs575424530		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:109181808_109181809insG	ENST00000326495.5	-	15	3198_3199	c.3105_3106insC	c.(3103-3108)cccgccfs	p.A1036fs	SSH1_ENST00000360239.3_Frame_Shift_Ins_p.A724fs	NM_018984.3	NP_061857.3	Q8WYL5	SSH1_HUMAN	slingshot protein phosphatase 1	1036	Interaction with YWHAG.				actin cytoskeleton organization (GO:0030036)|cell morphogenesis (GO:0000902)|cellular response to ATP (GO:0071318)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of cellular protein metabolic process (GO:0032268)|regulation of lamellipodium assembly (GO:0010591)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.A1036T(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTTTCTGGGGCGGGTTTCCCTG	0.55																																					p.A1036fs													SSH1,NS,carcinoma,0,1	SSH1	144	1	1	Substitution - Missense(1)	endometrium(1)	c.3106_3107insC																																									SO:0001589	frameshift_variant	54434	exon15			CTGGGGCGGGTTT	BC062341	CCDS9121.1, CCDS53825.1, CCDS55882.1	12q24.12	2013-03-05	2013-03-05			ENSG00000084112		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30579	protein-coding gene	gene with protein product		606778	"""slingshot homolog 1 (Drosophila)"""			10718198, 11832213	Standard	NM_018984		Approved	KIAA1298	uc001tnm.3	Q8WYL5	OTTHUMG00000169371	ENST00000326495.5:c.3106dupC	12.37:g.109181811_109181811dupG	ENSP00000315713:p.Ala1036fs		107	0	0		156	0.03	4	NM_018984	26	0.00	0	Q6P6C0|Q8N9A7|Q8WYL3|Q8WYL4|Q9P2P8	Frame_Shift_Ins	INS	ENST00000326495.5	37	CCDS9121.1																																																																																					0.550	SSH1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000403724.1		NM_018984	
NCOR2	9612	mdanderson.org	37	12	124887093	124887093	+	Silent	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr12:124887093C>T	ENST00000405201.1	-	14	1497	c.1497G>A	c.(1495-1497)caG>caA	p.Q499Q	NCOR2_ENST00000397355.1_Silent_p.Q499Q|NCOR2_ENST00000404621.1_Silent_p.Q498Q|NCOR2_ENST00000429285.2_Silent_p.Q498Q|NCOR2_ENST00000356219.3_Silent_p.Q499Q|NCOR2_ENST00000404121.2_Silent_p.Q69Q			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	499	Poly-Gln.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)	p.Q499Q(9)		breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		gctgctgctgctgttgttgct	0.617																																					p.Q499Q													NCOR2_ENST00000405201,NS,carcinoma,0,11	NCOR2_ENST00000405201	0	11	9	Substitution - coding silent(9)	endometrium(4)|large_intestine(3)|kidney(2)	c.G1497A												9.0	10.0	10.0					12																	124887093		2051	4183	6234	SO:0001819	synonymous_variant	9612	exon16			CTGCTGCTGTTGT	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1497G>A	12.37:g.124887093C>T			43	0.023255814	1		74	0.07	5	NM_006312	26	0.04	1	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Silent	SNP	ENST00000405201.1	37	CCDS41858.2																																																																																					0.617	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318173.2		NM_006312	
IRS2	8660	mdanderson.org	37	13	110435299	110435299	+	Silent	SNP	C	C	T	rs538782363	byFrequency	TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr13:110435299C>T	ENST00000375856.3	-	1	3616	c.3102G>A	c.(3100-3102)ccG>ccA	p.P1034P		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1034	Poly-Pro.				brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			gggccggcggcggtggcggcg	0.786																																					p.P1034P	Melanoma(100;613 2409 40847)												.	.			0			c.G3102A												1.0	2.0	1.0					13																	110435299		686	2116	2802	SO:0001819	synonymous_variant	8660	exon1			CGGCGGCGGTGGC	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3102G>A	13.37:g.110435299C>T			19	0	0		14	0.14	2	NM_003749	0		0	Q96RR2|Q9BZG0|Q9Y6I5	Silent	SNP	ENST00000375856.3	37	CCDS9510.1																																																																																					0.786	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045755.1		NM_003749	
DCUN1D2	55208	mdanderson.org	37	13	114138337	114138337	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr13:114138337C>T	ENST00000478244.1	-	2	320	c.38G>A	c.(37-39)cGc>cAc	p.R13H	DCUN1D2_ENST00000375399.2_Missense_Mutation_p.R13H|DCUN1D2_ENST00000460318.1_5'Flank|DCUN1D2_ENST00000332592.3_Intron	NM_001014283.1	NP_001014305.1	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 2	13	UBA-like.									breast(1)|endometrium(1)|large_intestine(1)|lung(3)|stomach(1)	7	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			CATAAACTGGCGGACCTTGTC	0.502																																					p.R13H													.	.			0			c.G38A												159.0	139.0	146.0					13																	114138337		2203	4300	6503	SO:0001583	missense	55208	exon2			AACTGGCGGACCT	AK001566	CCDS32013.1	13q34	2013-06-10	2013-06-10	2005-10-04	ENSG00000150401	ENSG00000150401			20328	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 17"", ""DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)"""	C13orf17		15988528	Standard	XM_005268320		Approved	FLJ10704, FLJ20092	uc001vtr.1	Q6PH85	OTTHUMG00000017390	ENST00000478244.1:c.38G>A	13.37:g.114138337C>T	ENSP00000417706:p.Arg13His		63	0	0		47	0.06	3	NM_001014283	9	0.00	0	Q5JSA5|Q5JSA6|Q5JSA7|Q9NVJ1|Q9NXR6	Missense_Mutation	SNP	ENST00000478244.1	37	CCDS32013.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.497884	0.85069	.	.	ENSG00000150401	ENST00000478244;ENST00000375399	.	.	.	4.49	3.65	0.41850	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.75946	0.3919	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.77731	-0.2478	9	0.56958	D	0.05	.	13.8795	0.63674	0.1536:0.8464:0.0:0.0	.	13	Q6PH85	DCNL2_HUMAN	H	13	.	ENSP00000364548:R13H	R	-	2	0	DCUN1D2	113186338	1.000000	0.71417	0.994000	0.49952	0.952000	0.60782	1.980000	0.40618	0.878000	0.35920	0.655000	0.94253	CGC			0.502	DCUN1D2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045938.4		NM_018185	
MAPKBP1	23005	mdanderson.org	37	15	42114276	42114276	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr15:42114276G>T	ENST00000456763.2	+	26	3213	c.3017G>T	c.(3016-3018)aGc>aTc	p.S1006I	MAPKBP1_ENST00000260357.7_Missense_Mutation_p.S839I|MAPKBP1_ENST00000514566.1_Missense_Mutation_p.S1000I|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.S1000I|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.S883I	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1006										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		TACAGCAGCAGCTGCCTTTCC	0.657																																					p.S1006I													.	.			0			c.G3017T												19.0	18.0	18.0					15																	42114276		2202	4300	6502	SO:0001583	missense	23005	exon26			GCAGCAGCTGCCT	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.3017G>T	15.37:g.42114276G>T	ENSP00000393099:p.Ser1006Ile		92	0	0		113	0.04	5	NM_001128608	26	0.00	0	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	ENST00000456763.2	37	CCDS45239.1	.	.	.	.	.	.	.	.	.	.	.	21.0	4.076806	0.76415	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.54279	0.75;0.91;0.58;0.8;1.01	5.52	5.52	0.82312	.	0.129261	0.64402	D	0.000001	T	0.65471	0.2694	L	0.32530	0.975	0.36900	D	0.89034	P;D;D;D;D;D	0.89917	0.859;0.96;0.961;0.999;1.0;1.0	B;P;P;D;D;D	0.91635	0.414;0.684;0.708;0.996;0.997;0.999	T	0.71344	-0.4621	10	0.72032	D	0.01	-17.3851	19.4555	0.94886	0.0:0.0:1.0:0.0	.	839;883;839;1000;1006;1000	F8WC21;O60336-3;B4DYK7;O60336-2;O60336;O60336-6	.;.;.;.;MABP1_HUMAN;.	I	1000;883;839;1006;1000	ENSP00000397570:S1000I;ENSP00000221214:S883I;ENSP00000260357:S839I;ENSP00000393099:S1006I;ENSP00000426154:S1000I	ENSP00000221214:S883I	S	+	2	0	MAPKBP1	39901568	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.837000	0.75354	2.625000	0.88918	0.556000	0.70494	AGC			0.657	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000359745.1		NM_014994	
RLBP1	6017	mdanderson.org	37	15	89761813	89761813	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr15:89761813G>T	ENST00000268125.5	-	4	563	c.124C>A	c.(124-126)Cgc>Agc	p.R42S		NM_000326.4	NP_000317.1	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	42					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|visual perception (GO:0007601)|vitamin A metabolic process (GO:0006776)	cell body (GO:0044297)|cytosol (GO:0005829)	11-cis retinal binding (GO:0005502)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(1)|prostate(1)|skin(1)	18	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	AAGGTGTGGCGGGGCAGCTGG	0.592																																					p.R42S													.	.			0			c.C124A												65.0	62.0	63.0					15																	89761813		2200	4299	6499	SO:0001583	missense	6017	exon4			TGTGGCGGGGCAG	BC004199	CCDS32324.1	15q26.1	2007-07-16	2001-11-28			ENSG00000140522			10024	protein-coding gene	gene with protein product		180090	"""retinaldehyde-binding protein 1"""			1733864, 9326942	Standard	NM_000326		Approved	CRALBP	uc002bnl.3	P12271		ENST00000268125.5:c.124C>A	15.37:g.89761813G>T	ENSP00000268125:p.Arg42Ser		53	0	0		81	0.04	3	NM_000326	0		0	B2R667	Missense_Mutation	SNP	ENST00000268125.5	37	CCDS32324.1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329637	0.41297	.	.	ENSG00000140522	ENST00000268125	T	0.78364	-1.17	5.95	5.0	0.66597	Cellular retinaldehyde-binding/triple function, N-terminal (1);	0.947543	0.08931	N	0.872985	T	0.54447	0.1859	N	0.01048	-1.04	0.20975	N	0.999811	B	0.18013	0.025	B	0.15870	0.014	T	0.32981	-0.9886	10	0.25751	T	0.34	-0.4826	15.9801	0.80102	0.0:0.354:0.646:0.0	.	42	P12271	RLBP1_HUMAN	S	42	ENSP00000268125:R42S	ENSP00000268125:R42S	R	-	1	0	RLBP1	87562817	0.751000	0.28327	0.996000	0.52242	0.989000	0.77384	3.670000	0.54569	2.822000	0.97130	0.655000	0.94253	CGC			0.592	RLBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000421135.1		NM_000326	
MEF2A	4205	mdanderson.org	37	15	100214645	100214645	+	Silent	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr15:100214645G>T	ENST00000557785.1	+	6	787	c.438G>T	c.(436-438)gtG>gtT	p.V146V	MEF2A_ENST00000354410.5_Silent_p.V148V|MEF2A_ENST00000338042.6_Silent_p.V146V|MEF2A_ENST00000558812.1_Silent_p.V78V|MEF2A_ENST00000453228.2_Silent_p.V146V|MEF2A_ENST00000557942.1_Silent_p.V146V|MEF2A_ENST00000449277.2_Silent_p.V78V	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	148	Ser/Thr-rich.				apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			CAGTTCCAGTGACCAGCCCCA	0.453																																					p.V148V													.	.			0			c.G444T												198.0	187.0	191.0					15																	100214645		1906	4136	6042	SO:0001819	synonymous_variant	4205	exon6			TCCAGTGACCAGC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.438G>T	15.37:g.100214645G>T			124	0	0		131	0.04	5	NM_005587	52	0.00	0	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Silent	SNP	ENST00000557785.1	37	CCDS53978.1																																																																																					0.453	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415985.1			
MSLN	10232	mdanderson.org	37	16	815590	815590	+	Silent	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr16:815590C>T	ENST00000382862.3	+	9	863	c.768C>T	c.(766-768)ggC>ggT	p.G256G	MSLN_ENST00000563941.1_Silent_p.G256G|MSLN_ENST00000566549.1_Silent_p.G256G|MSLN_ENST00000545450.2_Silent_p.G256G	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	256					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				CCGTGCTGGGCCAGCCCATCA	0.701																																					p.G256G													.	.			0			c.C768T												32.0	33.0	32.0					16																	815590		2175	4286	6461	SO:0001819	synonymous_variant	10232	exon10			GCTGGGCCAGCCC	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.768C>T	16.37:g.815590C>T			27	0	0		39	0.08	3	NM_005823	0		0	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	ENST00000382862.3	37	CCDS32356.1																																																																																					0.701	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000109253.2			
CDH5	1003	broad.mit.edu	37	16	66437043	66437044	+	Frame_Shift_Ins	INS	-	-	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr16:66437043_66437044insC	ENST00000341529.3	+	12	2474_2475	c.2326_2327insC	c.(2326-2328)tcgfs	p.S776fs	CDH5_ENST00000539168.1_Frame_Shift_Ins_p.S215fs	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	776					adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	GCTGTACGGCTCGGACCCCCGG	0.639																																					p.S776fs													.	CDH5	111		0			c.2326_2327insC																																									SO:0001589	frameshift_variant	1003	exon12			TACGGCTCGGACC	X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.2327dupC	16.37:g.66437044_66437044dupC	ENSP00000344115:p.Ser776fs		150	0	0		146	0.05	7	NM_001795	34	0.00	0	Q4VAI5|Q4VAI6	Frame_Shift_Ins	INS	ENST00000341529.3	37	CCDS10804.1																																																																																					0.639	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268767.1		NM_001795	
SPATA2L	124044	mdanderson.org	37	16	89763952	89763952	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr16:89763952G>T	ENST00000289805.5	-	3	1133	c.1065C>A	c.(1063-1065)taC>taA	p.Y355*	SPATA2L_ENST00000335360.7_Intron	NM_152339.3	NP_689552.2	Q8IUW3	SPA2L_HUMAN	spermatogenesis associated 2-like	355										breast(1)|cervix(1)|endometrium(1)|lung(2)|skin(1)	6		Lung NSC(15;0.00043)|all_lung(18;0.000665)|all_hematologic(23;0.0355)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		TGTGTGCCTGGTAGCCTGGGG	0.692																																					p.Y355X													.	.			0			c.C1065A												25.0	30.0	28.0					16																	89763952		2198	4299	6497	SO:0001587	stop_gained	124044	exon3			TGCCTGGTAGCCT	AF070574	CCDS10985.1	16q24.3	2007-01-30	2007-01-30	2007-01-30	ENSG00000158792	ENSG00000158792			28393	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 76"""	C16orf76		8619474	Standard	NM_152339		Approved	MGC26885, tamo	uc002foj.3	Q8IUW3	OTTHUMG00000138047	ENST00000289805.5:c.1065C>A	16.37:g.89763952G>T	ENSP00000289805:p.Tyr355*		18	0	0		18	0.11	2	NM_152339	10	0.00	0	D3DX85|Q8NHV3	Nonsense_Mutation	SNP	ENST00000289805.5	37	CCDS10985.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.963250	0.92791	.	.	ENSG00000158792	ENST00000289805	.	.	.	4.43	4.43	0.53597	.	0.594469	0.16183	N	0.225732	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9534	0.64133	0.0:0.0:1.0:0.0	.	.	.	.	X	355	.	ENSP00000289805:Y355X	Y	-	3	2	SPATA2L	88291453	1.000000	0.71417	0.951000	0.38953	0.775000	0.43874	3.865000	0.56033	2.020000	0.59435	0.462000	0.41574	TAC			0.692	SPATA2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269923.1		NM_152339	
MPO	4353	mdanderson.org	37	17	56355261	56355261	+	Silent	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:56355261C>T	ENST00000225275.3	-	7	1307	c.1131G>A	c.(1129-1131)ctG>ctA	p.L377L	MPO_ENST00000340482.3_Silent_p.L409L|MPO_ENST00000578493.1_5'UTR	NM_000250.1	NP_000241.1	P05164	PERM_HUMAN	myeloperoxidase	377					aging (GO:0007568)|defense response (GO:0006952)|defense response to fungus (GO:0050832)|hydrogen peroxide catabolic process (GO:0042744)|hypochlorous acid biosynthetic process (GO:0002149)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of apoptotic process (GO:0043066)|negative regulation of growth of symbiont in host (GO:0044130)|oxidation-reduction process (GO:0055114)|removal of superoxide radicals (GO:0019430)|respiratory burst involved in defense response (GO:0002679)|response to food (GO:0032094)|response to lipopolysaccharide (GO:0032496)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|response to yeast (GO:0001878)	azurophil granule (GO:0042582)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|secretory granule (GO:0030141)	chromatin binding (GO:0003682)|heme binding (GO:0020037)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(13)|ovary(2)|pancreas(1)|skin(4)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	46					Aminosalicylic Acid(DB00233)|Bivalirudin(DB00006)|Calcipotriol(DB02300)|Carboplatin(DB00958)|Cefaclor(DB00833)|Cefdinir(DB00535)|Cisplatin(DB00515)|Cysteamine(DB00847)|Dapsone(DB00250)|Enoxaparin(DB01225)|Human Serum Albumin(DB00062)|L-Carnitine(DB00583)|Melatonin(DB01065)|Mesalazine(DB00244)|Nabumetone(DB00461)|Octreotide(DB00104)|Oxaliplatin(DB00526)|Propylthiouracil(DB00550)|Ticlopidine(DB00208)|Tolmetin(DB00500)	TGTCAAAGGGCAGCAGGGCCC	0.657																																					p.L377L													.	.			0			c.G1131A												66.0	66.0	66.0					17																	56355261		2203	4300	6503	SO:0001819	synonymous_variant	4353	exon7			AAAGGGCAGCAGG		CCDS11604.1	17q21.3-q23	2014-09-17				ENSG00000005381	1.11.1.7		7218	protein-coding gene	gene with protein product		606989					Standard	NM_000250		Approved		uc002ivu.1	P05164		ENST00000225275.3:c.1131G>A	17.37:g.56355261C>T			23	0	0		29	0.10	3	NM_000250	2	0.00	0	A1L4B8|Q14862|Q4PJH5|Q9UCL7	Silent	SNP	ENST00000225275.3	37	CCDS11604.1																																																																																					0.657	MPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443971.1			
AXIN2	8313	mdanderson.org	37	17	63554672	63554672	+	Silent	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:63554672G>T	ENST00000375702.5	-	1	175	c.67C>A	c.(67-69)Cgg>Agg	p.R23R	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Silent_p.R23R			Q9Y2T1	AXIN2_HUMAN	axin 2	23					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						ACTGGGGGCCGCGGGGCATCC	0.632									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.R23R													AXIN2,NS,carcinoma,0,1	AXIN2	0	1	0			c.C67A												31.0	35.0	33.0					17																	63554672		2202	4298	6500	SO:0001819	synonymous_variant	8313	exon2	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	GGGGCCGCGGGGC	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.67C>A	17.37:g.63554672G>T			31	0	0		38	0.08	3	NM_004655	22	0.00	0	Q3MJ88|Q9H3M6|Q9UH84	Silent	SNP	ENST00000375702.5	37																																																																																						0.632	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000445901.1		NM_004655	
UNK	85451	mdanderson.org	37	17	73812897	73812897	+	Silent	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:73812897C>T	ENST00000589666.1	+	8	1118	c.1008C>T	c.(1006-1008)agC>agT	p.S336S	UNK_ENST00000293218.3_Silent_p.S412S|RP11-552F3.4_ENST00000586808.1_RNA	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	336							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGTGTCCAGCCCCACCCAGC	0.667																																					p.S336S													.	.			0			c.C1008T												32.0	39.0	37.0					17																	73812897		2173	4252	6425	SO:0001819	synonymous_variant	85451	exon8			GTCCAGCCCCACC	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.1008C>T	17.37:g.73812897C>T			23	0	0		17	0.12	2	NM_001080419	15	0.00	0		Silent	SNP	ENST00000589666.1	37	CCDS45778.2																																																																																					0.667	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448835.1		NM_001080419	
EVPL	2125	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	17	74003793	74003794	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:74003793_74003794delAT	ENST00000301607.3	-	22	5745_5746	c.5492_5493delAT	c.(5491-5493)tatfs	p.Y1831fs	EVPL_ENST00000586740.1_Frame_Shift_Del_p.Y1853fs|TEN1-CDK3_ENST00000567351.1_RNA	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1831	Globular 2.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.Y1831C(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						TGGTTGTGTCATAGATCCCGGC	0.614																																					p.1831_1832del													EVPL,NS,malignant_melanoma,0,1	EVPL	155		1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	c.5493_5494del																																									SO:0001589	frameshift_variant	2125	exon22			TGTGTCATAGATC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.5492_5493delAT	17.37:g.74003793_74003794delAT	ENSP00000301607:p.Tyr1831fs		75	0	0		49	0.31	15	NM_001988	2	0.00	0	A0AUV5	Frame_Shift_Del	DEL	ENST00000301607.3	37	CCDS11737.1																																																																																					0.614	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449483.1		NM_001988	
TNRC6C	57690	mdanderson.org	37	17	76046266	76046266	+	Missense_Mutation	SNP	G	G	A	rs202206566		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:76046266G>A	ENST00000588061.1	+	5	1850	c.1123G>A	c.(1123-1125)Gta>Ata	p.V375I	TNRC6C_ENST00000335749.4_Missense_Mutation_p.V375I|TNRC6C_ENST00000544502.1_Missense_Mutation_p.V375I|TNRC6C_ENST00000301624.4_Missense_Mutation_p.V375I|TNRC6C_ENST00000541771.1_Missense_Mutation_p.V375I|TNRC6C_ENST00000588847.1_Missense_Mutation_p.V375I			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	375	Gly-rich.|Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.V375I(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			GAACCCTACCGTACAGCCTGG	0.522																																					p.V375I													TNRC6C,rectum,carcinoma,0,1	TNRC6C	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G1123A												59.0	59.0	59.0					17																	76046266		1988	4154	6142	SO:0001583	missense	57690	exon4			CCTACCGTACAGC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1123G>A	17.37:g.76046266G>A	ENSP00000468647:p.Val375Ile		31	0	0		16	0.19	3	NM_018996	15	0.00	0	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	37	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	G	9.211	1.030999	0.19590	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.12	-9.34	0.00636	.	1.100860	0.07055	N	0.832741	T	0.05227	0.0139	N	0.14661	0.345	0.19300	N	0.999977	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.0	T	0.35525	-0.9785	10	0.21014	T	0.42	1.9699	4.9047	0.13793	0.5787:0.2184:0.0926:0.1103	.	375;375;375	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	I	375	ENSP00000336783:V375I;ENSP00000301624:V375I;ENSP00000440310:V375I;ENSP00000442421:V375I	ENSP00000301624:V375I	V	+	1	0	TNRC6C	73557861	0.376000	0.25098	0.244000	0.24202	0.880000	0.50808	-0.586000	0.05787	-1.757000	0.01316	0.655000	0.94253	GTA			0.522	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000395947.1		NM_018996	
PDE6G	5148	mdanderson.org	37	17	79620321	79620321	+	Silent	SNP	C	C	T	rs370812916		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr17:79620321C>T	ENST00000331056.5	-	2	158	c.15G>A	c.(13-15)ccG>ccA	p.P5P	PDE6G_ENST00000574777.1_Intron|PDE6G_ENST00000571224.1_Silent_p.P5P|PDE6G_ENST00000571004.1_Silent_p.P5P|PDE6G_ENST00000573076.1_Silent_p.P55P	NM_002602.3	NP_002593.1	P18545	CNRG_HUMAN	phosphodiesterase 6G, cGMP-specific, rod, gamma	5					activation of MAPK activity (GO:0000187)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|enzyme inhibitor activity (GO:0004857)			lung(2)|urinary_tract(1)	3	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)		Sildenafil(DB00203)|Vardenafil(DB00862)	CAGCCTTGGGCGGTTCCAGGT	0.657																																					p.P5P	GBM(189;38 2147 16440 40945 46567)												.	.			0			c.G15A									0,4406		0,0,2203	37.0	40.0	39.0		15	-11.1	0.3	17		39	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PDE6G	NM_002602.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		5/88	79620321	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	5148	exon2			CTTGGGCGGTTCC		CCDS11783.1	17q21.1	2014-01-28				ENSG00000185527	3.1.4.17	"""Phosphodiesterases"""	8789	protein-coding gene	gene with protein product		180073		PDEG		2155175	Standard	NM_002602		Approved	RP57	uc002kay.3	P18545		ENST00000331056.5:c.15G>A	17.37:g.79620321C>T			24	0	0		31	0.10	3	NM_002602	15	0.00	0	Q3KP63|Q7Z3U8	Silent	SNP	ENST00000331056.5	37	CCDS11783.1																																																																																					0.657	PDE6G-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440314.1			
LDLRAD4	753	mdanderson.org	37	18	13387732	13387732	+	Missense_Mutation	SNP	C	C	G	rs530289864		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr18:13387732C>G	ENST00000359446.5	+	2	479	c.11C>G	c.(10-12)gCt>gGt	p.A4G	LDLRAD4_ENST00000361205.4_Missense_Mutation_p.A4G|LDLRAD4_ENST00000399848.3_Missense_Mutation_p.A4G	NM_001276251.1	NP_001263180.1	O15165	LRAD4_HUMAN	low density lipoprotein receptor class A domain containing 4	4					negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	early endosome membrane (GO:0031901)|endosome (GO:0005768)|integral component of membrane (GO:0016021)	R-SMAD binding (GO:0070412)										ATGCCGGAAGCTGGTTTTCAG	0.582																																					p.A4G													.	.			0			c.C11G												146.0	125.0	132.0					18																	13387732		2203	4300	6503	SO:0001583	missense	753	exon3			CGGAAGCTGGTTT	AF009424, AF009428	CCDS32793.1, CCDS32794.1, CCDS32795.1, CCDS42415.1, CCDS62392.1, CCDS62393.1	18p11.21	2014-04-29	2012-10-24	2012-10-24	ENSG00000168675	ENSG00000168675			1224	protein-coding gene	gene with protein product	"""clone 22"""	606571	"""chromosome 18 open reading frame 1"""	C18orf1		9479497, 9129712, 24627487	Standard	NM_181482		Approved		uc002ksb.3	O15165	OTTHUMG00000181925	ENST00000359446.5:c.11C>G	18.37:g.13387732C>G	ENSP00000352420:p.Ala4Gly		38	0	0		27	0.11	3	NM_181482	2	0.00	0	B3KNT9|E9PAY9|K7EN38|O15166|O15167|O15168|Q5U646|Q6NXP3	Missense_Mutation	SNP	ENST00000359446.5	37	CCDS32793.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536289	0.65085	.	.	ENSG00000168675	ENST00000361205;ENST00000399848	T;T	0.29142	1.58;1.59	4.93	4.05	0.47172	.	0.397421	0.22381	N	0.060810	T	0.40498	0.1119	N	0.19112	0.55	0.80722	D	1	D;D	0.67145	0.996;0.993	D;D	0.77557	0.99;0.978	T	0.41413	-0.9510	10	0.87932	D	0	0.1279	14.523	0.67867	0.1479:0.852:0.0:0.0	.	4;4	O15165-2;O15165	.;CR001_HUMAN	G	4	ENSP00000354753:A4G;ENSP00000382741:A4G	ENSP00000354753:A4G	A	+	2	0	C18orf1	13377732	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	4.077000	0.57598	1.065000	0.40693	-0.282000	0.10007	GCT			0.582	LDLRAD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458326.1		NM_181481	
REXO1	57455	broad.mit.edu	37	19	1827048	1827048	+	Silent	SNP	T	T	G			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:1827048T>G	ENST00000170168.4	-	2	1834	c.1740A>C	c.(1738-1740)ccA>ccC	p.P580P	CTB-31O20.4_ENST00000593201.1_RNA|CTB-31O20.4_ENST00000587741.1_RNA|REXO1_ENST00000587524.1_5'Flank	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	580	Ser-rich.					nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggaggaggatggggcggggg	0.706																																					p.P580P													.	REXO1	55		0			c.A1740C												3.0	2.0	2.0					19																	1827048		1731	3439	5170	SO:0001819	synonymous_variant	57455	exon2			GGAGGATGGGGCG	AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1740A>C	19.37:g.1827048T>G			54	0.1481481481	8		84	0.25	21	NM_020695	12	0.00	0	Q9ULT2	Silent	SNP	ENST00000170168.4	37	CCDS32866.1																																																																																					0.706	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449200.1		NM_020695	
DPP9	91039	mdanderson.org	37	19	4688811	4688811	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:4688811G>T	ENST00000598800.1	-	17	2261	c.1756C>A	c.(1756-1758)Cac>Aac	p.H586N	DPP9_ENST00000262960.9_Missense_Mutation_p.H615N|AC005594.3_ENST00000381796.1_RNA|DPP9_ENST00000594671.1_Missense_Mutation_p.H586N			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	586						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		GGCTGCTTGTGCAGGGGGTCG	0.677																																					p.H615N													.	.			0			c.C1843A												18.0	23.0	21.0					19																	4688811		2058	4183	6241	SO:0001583	missense	91039	exon16			GCTTGTGCAGGGG	AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.1756C>A	19.37:g.4688811G>T	ENSP00000469603:p.His586Asn		38	0	0		50	0.06	3	NM_139159	67	0.00	0	O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Missense_Mutation	SNP	ENST00000598800.1	37		.	.	.	.	.	.	.	.	.	.	G	13.92	2.380141	0.42207	.	.	ENSG00000142002	ENST00000357909;ENST00000381797;ENST00000262960	T	0.29397	1.57	4.89	3.85	0.44370	.	0.054480	0.64402	D	0.000001	T	0.23766	0.0575	L	0.44542	1.39	0.51233	D	0.999912	B	0.16396	0.017	B	0.16289	0.015	T	0.05162	-1.0902	10	0.27785	T	0.31	-38.0985	9.0298	0.36252	0.1673:0.0:0.8327:0.0	.	615	Q1ZZB8	.	N	694;556;615	ENSP00000262960:H615N	ENSP00000262960:H615N	H	-	1	0	DPP9	4639811	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	7.756000	0.85195	1.306000	0.44926	0.549000	0.68633	CAC			0.677	DPP9-026	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000459343.2			
PALM3	342979	broad.mit.edu	37	19	14164676	14164676	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:14164676T>C	ENST00000340790.4	-	6	1762	c.1763A>G	c.(1762-1764)gAa>gGa	p.E588G		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	588	Glu-rich.				negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						CTTCACTCCTTCCTCCTCCAG	0.642																																					p.E588G													.	PALM3	26		0			c.A1763G												47.0	47.0	47.0					19																	14164676		692	1591	2283	SO:0001583	missense	342979	exon6			ACTCCTTCCTCCT		CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.1763A>G	19.37:g.14164676T>C	ENSP00000344996:p.Glu588Gly		124	0	0		130	0.03	4	NM_001145028	228	0.00	0		Missense_Mutation	SNP	ENST00000340790.4	37	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	t	15.47	2.844244	0.51164	.	.	ENSG00000187867	ENST00000340790	T	0.34667	1.35	2.91	0.549	0.17213	.	.	.	.	.	T	0.21267	0.0512	L	0.36672	1.1	0.09310	N	1	P	0.46784	0.884	B	0.37780	0.258	T	0.11916	-1.0568	9	0.26408	T	0.33	.	4.4067	0.11413	0.1876:0.0:0.2109:0.6015	.	588	A6NDB9	PALM3_HUMAN	G	588	ENSP00000344996:E588G	ENSP00000344996:E588G	E	-	2	0	PALM3	14025676	0.000000	0.05858	0.003000	0.11579	0.283000	0.27025	-0.633000	0.05483	0.062000	0.16340	0.149000	0.16113	GAA			0.642	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458540.1		NM_001145028	
UPF1	5976	mdanderson.org	37	19	18971766	18971766	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:18971766G>A	ENST00000599848.1	+	17	2674	c.2465G>A	c.(2464-2466)gGc>gAc	p.G822D	UPF1_ENST00000262803.5_Missense_Mutation_p.G811D			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	822					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						CAGTTCAGCGGCTCCCTGCAC	0.607																																					p.G811D													.	.			0			c.G2432A												63.0	39.0	47.0					19																	18971766		2192	4298	6490	SO:0001583	missense	5976	exon17			TCAGCGGCTCCCT	AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.2465G>A	19.37:g.18971766G>A	ENSP00000470142:p.Gly822Asp		42	0	0		50	0.06	3	NM_002911	111	0.00	0	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	ENST00000599848.1	37		.	.	.	.	.	.	.	.	.	.	G	26.5	4.747520	0.89663	.	.	ENSG00000005007	ENST00000262803	D	0.91894	-2.93	4.73	4.73	0.59995	.	0.106321	0.64402	D	0.000004	D	0.95736	0.8613	M	0.82630	2.6	0.80722	D	1	B;D	0.67145	0.375;0.996	P;D	0.66084	0.632;0.941	D	0.96375	0.9277	10	0.87932	D	0	-36.0934	14.8621	0.70389	0.0:0.0:1.0:0.0	.	822;811	Q92900;Q92900-2	RENT1_HUMAN;.	D	811	ENSP00000262803:G811D	ENSP00000262803:G811D	G	+	2	0	UPF1	18832766	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.425000	0.97467	2.166000	0.68216	0.561000	0.74099	GGC			0.607	UPF1-002	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000464684.1		NM_002911	
CTC-513N18.6	0	broad.mit.edu	37	19	20680085	20680085	+	lincRNA	DEL	A	A	-			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:20680085delA	ENST00000598131.1	+	0	389																											GCTGTGTTCCAAAGGAAATAG	0.393																																					.													.	.			0			.																																											0	.			TGTTCCAAAGGAA																													19.37:g.20680085delA			8	0	0		6	0.33	2	.	0		0		RNA	DEL	ENST00000598131.1	37																																																																																						0.393	CTC-513N18.6-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000463072.1			
GRIN2D	2906	mdanderson.org	37	19	48945587	48945587	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:48945587G>T	ENST00000263269.3	+	12	2709	c.2621G>T	c.(2620-2622)cGg>cTg	p.R874L		NM_000836.2	NP_000827.2	O15399	NMDE4_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2D	874					adult locomotory behavior (GO:0008344)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|regulation of sensory perception of pain (GO:0051930)|signal transduction (GO:0007165)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			autonomic_ganglia(1)|breast(6)|endometrium(2)|large_intestine(9)|lung(12)|ovary(5)|pancreas(1)|prostate(1)	37		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGGCGCCTGCGGCACTGCCTG	0.672																																					p.R874L													.	.			0			c.G2621T												79.0	82.0	81.0					19																	48945587		2203	4300	6503	SO:0001583	missense	2906	exon12			GCCTGCGGCACTG	U77783	CCDS12719.1	19q13.33	2012-08-29			ENSG00000105464	ENSG00000105464		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4588	protein-coding gene	gene with protein product	"""N-methyl-d-aspartate receptor subunit 2D"""	602717		NMDAR2D		9480759, 9418891	Standard	NM_000836		Approved	GluN2D, EB11, NR2D	uc002pjc.4	O15399		ENST00000263269.3:c.2621G>T	19.37:g.48945587G>T	ENSP00000263269:p.Arg874Leu		34	0	0		56	0.05	3	NM_000836	3	0.00	0		Missense_Mutation	SNP	ENST00000263269.3	37	CCDS12719.1	.	.	.	.	.	.	.	.	.	.	g	21.7	4.184931	0.78677	.	.	ENSG00000105464	ENST00000263269	T	0.39056	1.1	3.85	3.85	0.44370	.	0.000000	0.64402	D	0.000001	T	0.55065	0.1897	L	0.48362	1.52	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.60677	-0.7216	10	0.87932	D	0	.	15.1404	0.72607	0.0:0.0:1.0:0.0	.	874	O15399	NMDE4_HUMAN	L	874	ENSP00000263269:R874L	ENSP00000263269:R874L	R	+	2	0	GRIN2D	53637399	1.000000	0.71417	0.999000	0.59377	0.746000	0.42486	9.443000	0.97568	2.161000	0.67846	0.450000	0.29827	CGG			0.672	GRIN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466121.1			
DHDH	27294	mdanderson.org	37	19	49438276	49438276	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:49438276G>T	ENST00000221403.2	+	2	150	c.110G>T	c.(109-111)cGc>cTc	p.R37L	DHDH_ENST00000522614.1_Missense_Mutation_p.R37L|DHDH_ENST00000523250.1_Missense_Mutation_p.R37L	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	37					carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GTGGCGGCCCGCGATCTGAGC	0.632																																					p.R37L													DHDH,right_lower_lobe,carcinoma,0,1	DHDH	0	1	0			c.G110T												24.0	20.0	22.0					19																	49438276		2196	4289	6485	SO:0001583	missense	27294	exon2			CGGCCCGCGATCT	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.110G>T	19.37:g.49438276G>T	ENSP00000221403:p.Arg37Leu		36	0	0		21	0.10	2	NM_014475	8	0.00	0		Missense_Mutation	SNP	ENST00000221403.2	37	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872975	0.51695	.	.	ENSG00000104808	ENST00000221403;ENST00000523250;ENST00000522614	T;T;T	0.25579	1.79;1.79;1.79	4.99	3.92	0.45320	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.054693	0.64402	D	0.000002	T	0.61135	0.2323	H	0.96691	3.865	0.48975	D	0.999737	D	0.69078	0.997	D	0.69479	0.964	T	0.72443	-0.4292	10	0.87932	D	0	-22.8341	10.6847	0.45835	0.0981:0.0:0.9019:0.0	.	37	Q9UQ10	DHDH_HUMAN	L	37	ENSP00000221403:R37L;ENSP00000428935:R37L;ENSP00000428672:R37L	ENSP00000221403:R37L	R	+	2	0	DHDH	54130088	1.000000	0.71417	0.546000	0.28166	0.009000	0.06853	8.351000	0.90072	1.398000	0.46701	0.563000	0.77884	CGC			0.632	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000381477.1		NM_014475	
ZNF525	170958	broad.mit.edu	37	19	53885254	53885254	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr19:53885254G>T	ENST00000355326.3	+	1	576	c.576G>T	c.(574-576)aaG>aaT	p.K192N	ZNF525_ENST00000474037.1_Missense_Mutation_p.K474N|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000467003.1_Missense_Mutation_p.K438N			Q8N782	ZN525_HUMAN	zinc finger protein 525	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						AATGTGACAAGGCTTACAGTT	0.388																																					.													.	ZNF525	35		0			.																																									SO:0001583	missense	170958	.			TGACAAGGCTTAC	AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.576G>T	19.37:g.53885254G>T	ENSP00000408929:p.Lys192Asn		29	0	0		28	0.11	3	.	5	0.00	0	Q8TF23	Missense_Mutation	SNP	ENST00000355326.3	37		.	.	.	.	.	.	.	.	.	.	G	2.503	-0.314739	0.05422	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	T;T;T	0.27890	1.64;1.64;1.64	1.49	-2.98	0.05513	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42854	0.1221	.	.	.	0.09310	N	1	D	0.71674	0.998	D	0.69479	0.964	T	0.45977	-0.9224	8	0.87932	D	0	.	0.6561	0.00835	0.4059:0.1729:0.2468:0.1744	.	192	Q8N782	ZN525_HUMAN	N	474;438;192	ENSP00000417696:K474N;ENSP00000419136:K438N;ENSP00000408929:K192N	ENSP00000408929:K192N	K	+	3	2	ZNF525	58577066	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.881000	0.01626	-2.750000	0.00375	-2.974000	0.00080	AAG			0.388	ZNF525-201	KNOWN	basic	protein_coding	protein_coding				NR_003699	
RASGRP3	25780	mdanderson.org	37	2	33783348	33783348	+	Silent	SNP	G	G	T	rs376806433		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr2:33783348G>T	ENST00000403687.3	+	16	2390	c.1650G>T	c.(1648-1650)gcG>gcT	p.A550A	RASGRP3_ENST00000402538.3_Silent_p.A550A|RASGRP3_ENST00000407811.1_Silent_p.A549A|AC020594.5_ENST00000437680.1_RNA	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	550					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					TTGCCCGGGCGCCCTCCTTGA	0.557																																					p.A550A													.	.			0			c.G1650T												50.0	52.0	51.0					2																	33783348		1920	4107	6027	SO:0001819	synonymous_variant	25780	exon16			CCGGGCGCCCTCC	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1650G>T	2.37:g.33783348G>T			67	0	0		45	0.07	3	NM_001139488	13	0.00	0	D6W583|O94931|Q53SD7	Silent	SNP	ENST00000403687.3	37	CCDS46256.1																																																																																					0.557	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325462.2		NM_015376	
TGFBRAP1	9392	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	105886112	105886112	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr2:105886112T>C	ENST00000393359.2	-	11	2449	c.2023A>G	c.(2023-2025)Aag>Gag	p.K675E	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.K675E			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	675					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TCGCCCAGCTTCCCGTGCAGG	0.647																																					p.K675E	Esophageal Squamous(183;794 2019 9730 21801 48859)												.	.			0			c.A2023G												23.0	23.0	23.0					2																	105886112		2203	4300	6503	SO:0001583	missense	9392	exon11			CCAGCTTCCCGTG	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2023A>G	2.37:g.105886112T>C	ENSP00000377027:p.Lys675Glu		35	0	0		40	0.25	10	NM_004257	31	0.29	9	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	37	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	T	28.2	4.903281	0.92035	.	.	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.25085	1.82;1.82	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	M	0.87381	2.88	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.995	T	0.65459	-0.6163	10	0.72032	D	0.01	-39.4981	15.3928	0.74758	0.0:0.0:0.0:1.0	.	130;675	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	E	675;675;130	ENSP00000377027:K675E;ENSP00000258449:K675E	ENSP00000258449:K675E	K	-	1	0	TGFBRAP1	105252544	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.698000	0.84413	2.054000	0.61138	0.379000	0.24179	AAG			0.647	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253354.2		NM_004257	
ATRN	8455	broad.mit.edu	37	20	3451967	3451969	+	In_Frame_Del	DEL	GCT	GCT	-			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr20:3451967_3451969delGCT	ENST00000262919.5	+	1	281_283	c.213_215delGCT	c.(211-216)ccgctg>ccg	p.L77del	ATRN_ENST00000446916.2_In_Frame_Del_p.L77del	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	77	Leu-rich.				cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						tctcgccgccgctgctgctgctg	0.764																																					p.71_72del													.	ATRN	118		0			c.213_215del								,,	17,913		5,7,453					,,	-0.9	0.0			1	76,1972		27,22,975	no	coding,coding,intron	ATRN	NM_139322.2,NM_139321.2,NM_001207047.1	,,	32,29,1428	A1A1,A1R,RR		3.7109,1.828,3.1229	,,	,,		93,2885				SO:0001651	inframe_deletion	8455	exon1			GCCGCCGCTGCTG	AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.213_215delGCT	20.37:g.3451976_3451978delGCT	ENSP00000262919:p.Leu77del		8	0	0		9	0.33	3	NM_139321	1	0.00	0	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	In_Frame_Del	DEL	ENST00000262919.5	37	CCDS13053.1																																																																																					0.764	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000077740.2		NM_139321	
GZF1	64412	mdanderson.org	37	20	23346327	23346327	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr20:23346327G>T	ENST00000338121.5	+	2	1384	c.1307G>T	c.(1306-1308)gGc>gTc	p.G436V	GZF1_ENST00000377051.2_Missense_Mutation_p.G436V|GZF1_ENST00000544236.1_Intron|GZF1_ENST00000542987.1_Intron|GZF1_ENST00000461789.1_3'UTR			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	436					branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					CGGCCCTACGGCTGCACCGAG	0.721																																					p.G436V													.	.			0			c.G1307T												16.0	18.0	18.0					20																	23346327		2183	4255	6438	SO:0001583	missense	64412	exon1			CCTACGGCTGCAC	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.1307G>T	20.37:g.23346327G>T	ENSP00000338290:p.Gly436Val		8	0	0		13	0.15	2	NM_022482	12	0.08	1	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	ENST00000338121.5	37	CCDS13151.1	.	.	.	.	.	.	.	.	.	.	G	7.356	0.623827	0.14193	.	.	ENSG00000125812	ENST00000338121;ENST00000377051	T;T	0.16597	2.33;2.33	4.58	2.54	0.30619	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.276633	0.30437	N	0.009626	T	0.04318	0.0119	N	0.00275	-1.725	0.80722	D	1	B	0.33477	0.413	B	0.36186	0.219	T	0.40869	-0.9540	10	0.36615	T	0.2	.	9.4239	0.38567	0.0812:0.1434:0.7754:0.0	.	436	Q9H116	GZF1_HUMAN	V	436	ENSP00000338290:G436V;ENSP00000366250:G436V	ENSP00000338290:G436V	G	+	2	0	GZF1	23294327	1.000000	0.71417	0.873000	0.34254	0.002000	0.02628	3.686000	0.54685	1.138000	0.42230	-0.182000	0.12963	GGC			0.721	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078333.1		NM_022482	
L3MBTL1	26013	mdanderson.org	37	20	42159018	42159018	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr20:42159018G>A	ENST00000427442.2	+	10	1244	c.1085G>A	c.(1084-1086)gGc>gAc	p.G362D	L3MBTL1_ENST00000444063.1_Missense_Mutation_p.G294D|L3MBTL1_ENST00000373134.1_Missense_Mutation_p.G294D|L3MBTL1_ENST00000373135.3_Missense_Mutation_p.G294D|L3MBTL1_ENST00000418998.1_Missense_Mutation_p.G362D			Q9Y468	LMBL1_HUMAN	l(3)mbt-like 1 (Drosophila)	294					chromatin modification (GO:0016568)|hemopoiesis (GO:0030097)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of megakaryocyte differentiation (GO:0045652)|regulation of mitosis (GO:0007088)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome (GO:0000793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|nucleosome binding (GO:0031491)|SAM domain binding (GO:0032093)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(3)|ovary(1)|skin(2)	7						CACCCTGCTGGCTGGTTCGAG	0.567																																					p.G362D													.	.			0			c.G1085A												117.0	105.0	109.0					20																	42159018		2203	4300	6503	SO:0001583	missense	26013	exon10			CTGCTGGCTGGTT	U89358	CCDS13319.1, CCDS46602.1, CCDS46602.2	20q13.12	2013-01-10	2010-09-03	2010-09-03	ENSG00000185513	ENSG00000185513		"""Zinc fingers, C2HC-type containing"", ""Sterile alpha motif (SAM) domain containing"""	15905	protein-coding gene	gene with protein product	"""lethal (3) malignant brain tumor l(3)"""	608802	"""l(3)mbt (Drosophila)-like"", ""l(3)mbt-like (Drosophila)"""	L3MBTL		10445843, 17540172	Standard	NM_032107		Approved	ZC2HC3, dJ138B7.3, DKFZp586P1522, KIAA0681	uc010zwh.2	Q9Y468	OTTHUMG00000032503	ENST00000427442.2:c.1085G>A	20.37:g.42159018G>A	ENSP00000402107:p.Gly362Asp		98	0	0		114	0.04	5	NM_032107	6	0.00	0	B4DRC9|E1P5W7|Q5H8Y8|Q5H8Y9|Q8IUV7|Q9H1E6|Q9H1G5|Q9UG06|Q9UJB9|Q9Y4C9	Missense_Mutation	SNP	ENST00000427442.2	37	CCDS46602.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.265361|5.265361	0.95399|0.95399	.|.	.|.	ENSG00000185513|ENSG00000185513	ENST00000427442;ENST00000418998;ENST00000373135;ENST00000444063;ENST00000373134;ENST00000422861|ENST00000445228	D;D;D;D;D;D|.	0.82081|.	-1.57;-1.57;-1.57;-1.57;-1.57;-1.57|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.88269|.	0.6391|.	H|H	0.96489|0.96489	3.83|3.83	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|.	0.91376|.	0.5123|.	10|.	0.87932|.	D|.	0|.	.|.	18.7926|18.7926	0.91980|0.91980	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	362;294;294|.	Q9Y468-5;Q9Y468-2;Q9Y468-1|.	.;.;.|.	D|X	362;362;294;294;294;80|15	ENSP00000402107:G362D;ENSP00000398516:G362D;ENSP00000362227:G294D;ENSP00000403316:G294D;ENSP00000362226:G294D;ENSP00000410139:G80D|.	ENSP00000362226:G294D|.	G|W	+|+	2|3	0|0	L3MBTL1|L3MBTL1	41592432|41592432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.810000|9.810000	0.99221|0.99221	2.735000|2.735000	0.93741|0.93741	0.561000|0.561000	0.74099|0.74099	GGC|TGG			0.567	L3MBTL1-007	KNOWN	upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079300.3		NM_032107	
EEF1A2	1917	broad.mit.edu	37	20	62120282	62120282	+	Missense_Mutation	SNP	T	T	G	rs200931909		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr20:62120282T>G	ENST00000298049.7	-	6	1323	c.1253A>C	c.(1252-1254)tAc>tCc	p.Y418S	EEF1A2_ENST00000217182.3_Missense_Mutation_p.Y418S			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	418					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)	p.Y418S(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			GAGAGGCGGGTACTGGGAGAA	0.667																																					p.Y418S													EEF1A2,bladder,carcinoma,0,5	EEF1A2	60	5	1	Substitution - Missense(1)	lung(1)	c.A1253C												28.0	29.0	29.0					20																	62120282		2189	4283	6472	SO:0001583	missense	1917	exon7			GGCGGGTACTGGG	AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.1253A>C	20.37:g.62120282T>G	ENSP00000298049:p.Tyr418Ser		46	0.2826086957	13		74	0.32	24	NM_001958	6	0.17	1	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	ENST00000298049.7	37	CCDS13522.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511359	0.64522	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.44881	0.91;0.91	3.12	3.12	0.35913	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.170048	0.39759	N	0.001263	T	0.74405	0.3712	H	0.96142	3.775	0.80722	D	1	P	0.39696	0.683	D	0.68039	0.955	T	0.79629	-0.1724	10	0.87932	D	0	-10.4709	11.6664	0.51376	0.0:0.0:0.0:1.0	.	418	Q05639	EF1A2_HUMAN	S	418	ENSP00000298049:Y418S;ENSP00000217182:Y418S	ENSP00000217182:Y418S	Y	-	2	0	EEF1A2	61590726	1.000000	0.71417	0.999000	0.59377	0.696000	0.40369	5.966000	0.70395	1.187000	0.43000	0.392000	0.25879	TAC			0.667	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080495.1		NM_001958	
KRTAP10-6	386674	mdanderson.org	37	21	46011801	46011801	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr21:46011801C>A	ENST00000400368.1	-	1	585	c.565G>T	c.(565-567)Gcg>Tcg	p.A189S	TSPEAR_ENST00000323084.4_Intron	NM_198688.2	NP_941961.2	P60371	KR106_HUMAN	keratin associated protein 10-6	189	29 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(6)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23						TCACAGACCGCCTGGCAGCAG	0.637																																					p.A189S													.	.			0			c.G565T												44.0	61.0	55.0					21																	46011801		2199	4296	6495	SO:0001583	missense	386674	exon1			AGACCGCCTGGCA	AB076353	CCDS42959.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000188155	ENSG00000188155		"""Keratin associated proteins"""	20523	protein-coding gene	gene with protein product			"""keratin associated protein 18-6"""	KRTAP18-6			Standard	NM_198688		Approved	KRTAP18.6, KAP18.6, KAP10.6	uc002zfm.3	P60371	OTTHUMG00000057634	ENST00000400368.1:c.565G>T	21.37:g.46011801C>A	ENSP00000383219:p.Ala189Ser		142	0	0		153	0.03	5	NM_198688	0		0		Missense_Mutation	SNP	ENST00000400368.1	37	CCDS42959.1	.	.	.	.	.	.	.	.	.	.	-	0.342	-0.949829	0.02285	.	.	ENSG00000188155	ENST00000400368	T	0.00768	5.72	2.89	-5.78	0.02362	.	.	.	.	.	T	0.00440	0.0014	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44937	-0.9295	9	0.05833	T	0.94	.	7.1885	0.25813	0.5581:0.1634:0.2785:0.0	.	189	P60371	KR106_HUMAN	S	189	ENSP00000383219:A189S	ENSP00000383219:A189S	A	-	1	0	KRTAP10-6	44836229	.	.	0.000000	0.03702	0.018000	0.09664	.	.	-1.826000	0.01205	0.194000	0.17425	GCG			0.637	KRTAP10-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128037.1		NM_198688	
ZDHHC8	29801	mdanderson.org	37	22	20131012	20131012	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr22:20131012G>T	ENST00000334554.7	+	10	2000	c.1859G>T	c.(1858-1860)cGc>cTc	p.R620L	ZDHHC8_ENST00000405930.3_Missense_Mutation_p.R620L|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.R528L	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	620					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					GGTGGCGCCCGCAACCCTGCC	0.706																																					p.R620L													.	.			0			c.G1859T												24.0	24.0	24.0					22																	20131012		2185	4292	6477	SO:0001583	missense	29801	exon10			GCGCCCGCAACCC	AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.1859G>T	22.37:g.20131012G>T	ENSP00000334490:p.Arg620Leu		16	0	0		21	0.10	2	NM_013373	16	0.00	0	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	ENST00000334554.7	37	CCDS13776.1	.	.	.	.	.	.	.	.	.	.	.	15.87	2.959318	0.53400	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.77358	0.97;-1.09;0.84	4.71	3.69	0.42338	.	0.405503	0.23249	N	0.050265	D	0.85362	0.5679	M	0.61703	1.905	0.58432	D	0.999998	P;D;D	0.89917	0.921;1.0;1.0	D;D;D	0.85130	0.939;0.976;0.997	D	0.86048	0.1524	10	0.87932	D	0	.	12.7849	0.57498	0.08:0.0:0.92:0.0	.	528;620;620	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	L	620;528;620	ENSP00000334490:R620L;ENSP00000317804:R528L;ENSP00000384716:R620L	ENSP00000317804:R528L	R	+	2	0	ZDHHC8	18511012	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	9.049000	0.93837	0.986000	0.38683	-0.373000	0.07131	CGC			0.706	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318564.1		NM_013373	
LZTR1	8216	mdanderson.org	37	22	21348866	21348866	+	Silent	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr22:21348866G>T	ENST00000215739.8	+	15	1994	c.1635G>T	c.(1633-1635)ctG>ctT	p.L545L	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Silent_p.L526L	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	545					anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGGATGTGCTGCTCATCATGG	0.647																																					p.L545L													.	.			0			c.G1635T												82.0	65.0	70.0					22																	21348866		2202	4300	6502	SO:0001819	synonymous_variant	8216	exon15			TGTGCTGCTCATC	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1635G>T	22.37:g.21348866G>T			30	0	0		36	0.08	3	NM_006767	20	0.00	0	Q14776|Q20WK0	Silent	SNP	ENST00000215739.8	37	CCDS33606.1																																																																																					0.647	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320387.1		NM_006767	
CELSR1	9620	mdanderson.org	37	22	46768935	46768935	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr22:46768935G>T	ENST00000262738.3	-	25	7603	c.7604C>A	c.(7603-7605)gCc>gAc	p.A2535D		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2535					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GAGGAGGATGGCAACCACTGT	0.617																																					p.A2535D													.	.			0			c.C7604A												98.0	68.0	78.0					22																	46768935		2200	4298	6498	SO:0001583	missense	9620	exon25			AGGATGGCAACCA	AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.7604C>A	22.37:g.46768935G>T	ENSP00000262738:p.Ala2535Asp		51	0	0		54	0.06	3	NM_014246	9	0.00	0	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	ENST00000262738.3	37	CCDS14076.1	.	.	.	.	.	.	.	.	.	.	g	16.90	3.249449	0.59103	.	.	ENSG00000075275	ENST00000262738	T	0.51817	0.69	4.28	4.28	0.50868	GPCR, family 2-like (1);	0.000000	0.64402	U	0.000004	T	0.80428	0.4621	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.88658	0.3187	10	0.72032	D	0.01	.	16.6681	0.85258	0.0:0.0:1.0:0.0	.	856;2535	B7Z7U7;Q9NYQ6	.;CELR1_HUMAN	D	2535	ENSP00000262738:A2535D	ENSP00000262738:A2535D	A	-	2	0	CELSR1	45147599	1.000000	0.71417	0.787000	0.31911	0.064000	0.16182	9.443000	0.97568	2.076000	0.62316	0.461000	0.40582	GCC			0.617	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318037.1		NM_014246	
VHL	7428	mdanderson.org	37	3	10191524	10191524	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr3:10191524G>T	ENST00000256474.2	+	3	1357	c.517G>T	c.(517-519)Gag>Tag	p.E173*	VHL_ENST00000477538.1_3'UTR|VHL_ENST00000345392.2_Nonsense_Mutation_p.E132*	NM_000551.3	NP_000542.1	P40337	VHL_HUMAN	von Hippel-Lindau tumor suppressor, E3 ubiquitin protein ligase	173					cell morphogenesis (GO:0000902)|cellular response to hypoxia (GO:0071456)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061428)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|transcription factor binding (GO:0008134)|ubiquitin protein ligase activity (GO:0061630)|ubiquitin-protein transferase activity (GO:0004842)	p.P172fs*39(2)|p.N174fs*41(1)|p.E173_R176del(1)|p.E173*(1)|p.E173fs*26(1)|p.E173fs*>42(1)|p.P172_E173del(1)		adrenal_gland(25)|autonomic_ganglia(3)|central_nervous_system(2)|endometrium(6)|kidney(1662)|large_intestine(14)|lung(6)|pancreas(18)|paratesticular_tissues(1)|pleura(1)|skin(1)|soft_tissue(24)|thyroid(3)|upper_aerodigestive_tract(3)	1769				Kidney(1;0.000404)|KIRC - Kidney renal clear cell carcinoma(1;0.000569)		AGTCAAGCCTGAGAATTACAG	0.527		1	"""D, Mis, N, F, S"""		"""renal, hemangioma, pheochromocytoma"""	"""renal, hemangioma, pheochromocytoma"""			von Hippel-Lindau disease;Pheochromocytoma (Adrenal), Familial;Chuvash Polycythemia																												p.E173X			yes	Rec	yes	von Hippel-Lindau syndrome	3	3p25	7428	von Hippel-Lindau syndrome gene		"""E, M, O"""	VHL,NS,carcinoma,0,1	VHL	0	1	8	Deletion - Frameshift(4)|Deletion - In frame(2)|Substitution - Nonsense(1)|Insertion - Frameshift(1)	kidney(8)	c.G517T	GRCh37	CM982011	VHL	M								90.0	82.0	85.0					3																	10191524		2203	4300	6503	SO:0001587	stop_gained	7428	exon3	Familial Cancer Database	VHL; ;Erythrocytosis, Familial type 2	AAGCCTGAGAATT	L15409	CCDS2597.1, CCDS2598.1	3p25.3	2014-09-17	2012-02-23		ENSG00000134086	ENSG00000134086			12687	protein-coding gene	gene with protein product		608537	"""von Hippel-Lindau syndrome"", ""von Hippel-Lindau tumor suppressor"""			9671762	Standard	NM_000551		Approved	VHL1	uc003bvc.3	P40337	OTTHUMG00000128668	ENST00000256474.2:c.517G>T	3.37:g.10191524G>T	ENSP00000256474:p.Glu173*		52	0	0		41	0.07	3	NM_000551	88	0.00	0	B2RE45|Q13599|Q6PDA9	Nonsense_Mutation	SNP	ENST00000256474.2	37	CCDS2597.1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609534	0.87258	.	.	ENSG00000134086	ENST00000256474;ENST00000345392;ENST00000450183	.	.	.	4.86	4.86	0.63082	.	0.053579	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-9.7954	15.8663	0.79067	0.0:0.0:1.0:0.0	.	.	.	.	X	173;132;91	.	ENSP00000256474:E173X	E	+	1	0	VHL	10166524	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	4.212000	0.58514	2.676000	0.91093	0.655000	0.94253	GAG			0.527	VHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250559.1		NM_000551	
HACL1	26061	ucsc.edu;bcgsc.ca	37	3	15621444	15621444	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr3:15621444G>T	ENST00000321169.5	-	9	1143	c.776C>A	c.(775-777)cCa>cAa	p.P259Q	HACL1_ENST00000457447.2_Missense_Mutation_p.P233Q|HACL1_ENST00000456194.2_Missense_Mutation_p.P232Q|HACL1_ENST00000451445.2_Missense_Mutation_p.P177Q|HACL1_ENST00000435217.2_Intron	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	259					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						TACACAGTATGGATGGTTGTC	0.418																																					p.P259Q													.	HACL1	33		0			c.C776A												118.0	108.0	111.0					3																	15621444		2203	4300	6503	SO:0001583	missense	26061	exon9			CAGTATGGATGGT	AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.776C>A	3.37:g.15621444G>T	ENSP00000323811:p.Pro259Gln		68	0	0		42	0.10	4	NM_012260	66	0.00	0	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	ENST00000321169.5	37	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	G	15.75	2.925020	0.52759	.	.	ENSG00000131373	ENST00000321169;ENST00000451445;ENST00000456194;ENST00000457447;ENST00000421993	T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48	5.65	4.77	0.60923	Thiamine pyrophosphate enzyme, central domain (1);	0.000000	0.85682	D	0.000000	T	0.79028	0.4377	H	0.95470	3.675	0.80722	D	1	D;P;P;P	0.71674	0.998;0.872;0.872;0.872	D;P;P;P	0.68039	0.955;0.493;0.76;0.691	D	0.84758	0.0760	10	0.54805	T	0.06	.	14.0377	0.64656	0.0732:0.0:0.9268:0.0	.	177;233;232;259	B4DXI5;E9PEN4;B4DWI1;Q9UJ83	.;.;.;HACL1_HUMAN	Q	259;177;232;233;232	ENSP00000323811:P259Q;ENSP00000403656:P177Q;ENSP00000390699:P232Q;ENSP00000404883:P233Q;ENSP00000391393:P232Q	ENSP00000323811:P259Q	P	-	2	0	HACL1	15596448	1.000000	0.71417	0.899000	0.35326	0.559000	0.35586	4.101000	0.57769	1.389000	0.46526	0.563000	0.77884	CCA			0.418	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252104.3		NM_012260	
QRICH1	54870	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49094416	49094416	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr3:49094416T>A	ENST00000395443.2	-	3	1689	c.1217A>T	c.(1216-1218)tAc>tTc	p.Y406F	QRICH1_ENST00000479449.1_5'UTR|QRICH1_ENST00000424300.1_Missense_Mutation_p.Y406F|QRICH1_ENST00000357496.2_Missense_Mutation_p.Y406F	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	406	Gln-rich.					nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CGTATTCTGGTACGTGCCTGC	0.552																																					p.Y406F													.	.			0			c.A1217T												101.0	90.0	93.0					3																	49094416		2203	4300	6503	SO:0001583	missense	54870	exon3			TTCTGGTACGTGC		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.1217A>T	3.37:g.49094416T>A	ENSP00000378830:p.Tyr406Phe		131	0	0		105	0.15	16	NM_198880	113	0.30	34	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	37	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741862	0.49151	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	L	0.27053	0.805	0.50171	D	0.999851	P	0.49783	0.928	B	0.39465	0.3	T	0.41770	-0.9490	9	0.49607	T	0.09	-2.5458	16.6407	0.85098	0.0:0.0:0.0:1.0	.	406	Q2TAL8	QRIC1_HUMAN	F	406	.	ENSP00000350094:Y406F	Y	-	2	0	QRICH1	49069420	1.000000	0.71417	0.996000	0.52242	0.823000	0.46562	5.525000	0.67110	2.326000	0.78906	0.533000	0.62120	TAC			0.552	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345669.1		NM_017730	
MIR1324	100302212	bcgsc.ca	37	3	75679944	75679944	+	RNA	SNP	C	C	T	rs7614638	byFrequency	TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr3:75679944C>T	ENST00000408868.1	+	0	31					NR_031714.1				microRNA 1324																		CTGGTCCTGCCCTCACTGGGA	0.547																																					.													.	.			0			.												48.0	51.0	50.0					3																	75679944		1568	3576	5144			100302212	.			TCCTGCCCTCACT			3	2011-09-12		2008-12-18	ENSG00000221795	ENSG00000221795		"""ncRNAs / Micro RNAs"""	35377	non-coding RNA	RNA, micro				MIRN1324			Standard	NR_031714		Approved	hsa-mir-1324	uc021xar.1				3.37:g.75679944C>T			78	0.0384615385	3		69	0.20	14	.	3	0.33	1		RNA	SNP	ENST00000408868.1	37																																																																																						0.547	MIR1324-201	KNOWN	basic	miRNA	miRNA				NR_031714	
PIK3CA	5290	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	178921553	178921553	+	Missense_Mutation	SNP	T	T	A	rs121913284		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr3:178921553T>A	ENST00000263967.3	+	5	1192	c.1035T>A	c.(1033-1035)aaT>aaA	p.N345K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.N345K(44)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTACGTGAATGTAAATATTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.N345K	Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,adenocarcinoma,0,61	PIK3CA_ENST00000263967	0	61	44	Substitution - Missense(44)	breast(27)|endometrium(6)|large_intestine(6)|central_nervous_system(5)	c.T1035A												67.0	66.0	66.0					3																	178921553		1807	4074	5881	SO:0001583	missense	5290	exon5			CGTGAATGTAAAT		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1035T>A	3.37:g.178921553T>A	ENSP00000263967:p.Asn345Lys		64	0	0		89	0.29	26	NM_006218	18	0.39	7	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	37	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	T	16.01	3.002090	0.54254	.	.	ENSG00000121879	ENST00000263967	T	0.70164	-0.46	5.41	3.03	0.35002	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	T	0.77745	0.4176	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75465	-0.3308	10	0.49607	T	0.09	-21.0442	9.7159	0.40274	0.0:0.1415:0.0:0.8585	.	345	P42336	PK3CA_HUMAN	K	345	ENSP00000263967:N345K	ENSP00000263967:N345K	N	+	3	2	PIK3CA	180404247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.030000	0.41108	0.441000	0.26529	0.402000	0.26972	AAT			0.308	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000348409.2			
SCARB2	950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77091110	77091110	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr4:77091110G>C	ENST00000264896.2	-	8	1372	c.1023C>G	c.(1021-1023)caC>caG	p.H341Q	SCARB2_ENST00000452464.2_Missense_Mutation_p.H198Q	NM_005506.3	NP_005497.1	Q14108	SCRB2_HUMAN	scavenger receptor class B, member 2	341					cell adhesion (GO:0007155)|protein targeting to lysosome (GO:0006622)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	enzyme binding (GO:0019899)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(3)|prostate(2)|skin(1)	22			Lung(101;0.196)			CTTGGTAAAAGTGTGGGAAAG	0.393																																					p.H341Q													SCARB2,NS,carcinoma,-2,1	SCARB2	-2	1	0			c.C1023G												147.0	138.0	141.0					4																	77091110		2203	4300	6503	SO:0001583	missense	950	exon8			GTAAAAGTGTGGG	D12676	CCDS3577.1, CCDS56335.1	4q21.1	2014-07-11	2002-09-06	2002-09-06	ENSG00000138760	ENSG00000138760			1665	protein-coding gene	gene with protein product		602257	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II)"""	CD36L2		1374238	Standard	NM_005506		Approved	HLGP85, LIMPII, SR-BII, LIMP-2	uc003hju.2	Q14108	OTTHUMG00000130099	ENST00000264896.2:c.1023C>G	4.37:g.77091110G>C	ENSP00000264896:p.His341Gln		172	0	0		89	0.12	11	NM_005506	123	0.14	17	B4DKD8|E7EM68|Q53Y63	Missense_Mutation	SNP	ENST00000264896.2	37	CCDS3577.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522885	0.64747	.	.	ENSG00000138760	ENST00000264896;ENST00000452464	D;D	0.90385	-2.66;-2.66	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.96194	0.8759	H	0.95850	3.73	0.58432	D	0.999992	D;D	0.89917	1.0;0.995	D;D	0.83275	0.996;0.989	D	0.96094	0.9064	10	0.87932	D	0	.	7.8673	0.29545	0.1796:0.0:0.8204:0.0	.	198;341	E7EM68;Q14108	.;SCRB2_HUMAN	Q	341;198	ENSP00000264896:H341Q;ENSP00000399154:H198Q	ENSP00000264896:H341Q	H	-	3	2	SCARB2	77310134	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.527000	0.53517	2.406000	0.81754	0.460000	0.39030	CAC			0.393	SCARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252403.1		NM_005506	
SDHA	6389	broad.mit.edu	37	5	228449	228449	+	Splice_Site	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr5:228449G>T	ENST00000264932.6	+	6	885		c.e6+1		SDHA_ENST00000504309.1_Splice_Site|SDHA_ENST00000510361.1_Splice_Site	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)						cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	TTGCCACAGGGTAGGAATCTC	0.383									Familial Paragangliomas																												.													.	SDHA	80		0			c.770+1G>T												85.0	78.0	81.0					5																	228449		2203	4300	6503	SO:0001630	splice_region_variant	6389	exon6	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	CACAGGGTAGGAA	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.770+1G>T	5.37:g.228449G>T			51	0	0		52	0.06	3	NM_004168	0		0	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Splice_Site	SNP	ENST00000264932.6	37	CCDS3853.1	.	.	.	.	.	.	.	.	.	.	g	17.28	3.350481	0.61183	.	.	ENSG00000073578	ENST00000264932;ENST00000504309;ENST00000510361	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7213	0.85410	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SDHA	281449	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	9.074000	0.93998	2.633000	0.89246	0.644000	0.83932	.			0.383	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206599.1		NM_004168	Intron
CHSY3	337876	mdanderson.org	37	5	129241175	129241175	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr5:129241175C>A	ENST00000305031.4	+	1	1011	c.653C>A	c.(652-654)cCg>cAg	p.P218Q	CTC-575N7.1_ENST00000503616.1_RNA|CTC-575N7.1_ENST00000515569.1_RNA	NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	218	Pro-rich.				carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		GGCCAGCCCCCGCCACCCCTG	0.662																																					p.P218Q													.	.			0			c.C653A												25.0	32.0	30.0					5																	129241175		2173	4276	6449	SO:0001583	missense	337876	exon1			AGCCCCCGCCACC	AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.653C>A	5.37:g.129241175C>A	ENSP00000302629:p.Pro218Gln		53	0	0		50	0.06	3	NM_175856	1	0.00	0	B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	ENST00000305031.4	37	CCDS34223.1	.	.	.	.	.	.	.	.	.	.	C	10.75	1.437141	0.25900	.	.	ENSG00000198108	ENST00000305031	T	0.34472	1.36	3.37	2.5	0.30297	.	0.000000	0.35096	U	0.003458	T	0.22399	0.0540	L	0.35854	1.095	0.38561	D	0.949716	P	0.35656	0.514	B	0.33521	0.165	T	0.06232	-1.0838	9	.	.	.	.	5.1763	0.15137	0.165:0.6515:0.0:0.1835	.	218	Q70JA7	CHSS3_HUMAN	Q	218	ENSP00000302629:P218Q	.	P	+	2	0	CHSY3	129269074	0.297000	0.24408	0.992000	0.48379	0.915000	0.54546	2.118000	0.41949	0.995000	0.38917	0.305000	0.20034	CCG			0.662	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000371453.1		NM_175856	
GRK6	2870	mdanderson.org	37	5	176863196	176863196	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr5:176863196C>T	ENST00000355472.5	+	12	1348	c.1180C>T	c.(1180-1182)Cgg>Tgg	p.R394W	PRR7-AS1_ENST00000425316.3_RNA|GRK6_ENST00000393576.3_Missense_Mutation_p.R360W|GRK6_ENST00000507633.1_Missense_Mutation_p.R394W|GRK6_ENST00000528793.1_Missense_Mutation_p.R394W|GRK6_ENST00000355958.5_Missense_Mutation_p.R394W	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6	394	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)			breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGATCAAGCGGGAGGAGGT	0.627																																					p.R394W													.	.			0			c.C1180T												63.0	76.0	72.0					5																	176863196		2203	4300	6503	SO:0001583	missense	2870	exon12			ATCAAGCGGGAGG		CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.1180C>T	5.37:g.176863196C>T	ENSP00000347655:p.Arg394Trp		75	0	0		47	0.06	3	NM_001004106	133	0.01	1	O60541|Q13652	Missense_Mutation	SNP	ENST00000355472.5	37	CCDS34303.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.758984	0.69763	.	.	ENSG00000198055	ENST00000355472;ENST00000507633;ENST00000393576;ENST00000355958;ENST00000528793	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	5.9	4.06	0.47325	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	L	0.50847	1.595	0.80722	D	1	D;P;P;D	0.89917	0.999;0.601;0.896;1.0	D;B;B;D	0.79784	0.941;0.213;0.129;0.993	T	0.33189	-0.9878	10	0.52906	T	0.07	-28.6486	15.1362	0.72569	0.2583:0.7417:0.0:0.0	.	394;364;394;394	P43250;B3KPS5;P43250-2;D6RHX8	GRK6_HUMAN;.;.;.	W	394;394;360;394;394	ENSP00000347655:R394W;ENSP00000427581:R394W;ENSP00000377204:R360W;ENSP00000348230:R394W;ENSP00000433511:R394W	ENSP00000347655:R394W	R	+	1	2	GRK6	176795802	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.867000	0.27968	0.778000	0.33520	-0.188000	0.12872	CGG			0.627	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000373204.1		NM_002082	
LPAL2	80350	mdanderson.org	37	6	160921922	160921922	+	RNA	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr6:160921922G>T	ENST00000335388.5	-	0	216					NR_028092.1		Q16609	LPAL2_HUMAN	lipoprotein, Lp(a)-like 2, pseudogene							extracellular region (GO:0005576)				large_intestine(1)|lung(4)	5		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.214)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)		CGATAACTCTGTCCATTACTG	0.458																																					.													.	.			0			.												208.0	213.0	211.0					6																	160921922		2203	4300	6503			80350	.			AACTCTGTCCATT	U19517		6q26-q27	2010-10-27	2010-10-27	2004-02-18	ENSG00000213071	ENSG00000213071			21210	pseudogene	pseudogene		611682	"""apolipoprotein A-like"", ""lipoprotein, Lp(a)-like 2"""	APOAL		7749817, 7679504	Standard	NR_028092		Approved	APOARGC	uc011efy.2	Q16609	OTTHUMG00000015952		6.37:g.160921922G>T			52	0	0		44	0.07	3	.	1	0.00	0	E1P5B4	RNA	SNP	ENST00000335388.5	37																																																																																						0.458	LPAL2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000042950.1		NM_024492	
NOD1	10392	broad.mit.edu	37	7	30491698	30491698	+	Missense_Mutation	SNP	G	G	T	rs5743343	byFrequency	TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr7:30491698G>T	ENST00000222823.4	-	6	1860	c.1335C>A	c.(1333-1335)aaC>aaA	p.N445K		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	445	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GGCTGCGTGTGTTCCGCTGCA	0.637																																					p.N445K													.	NOD1	79		0			c.C1335A												49.0	49.0	49.0					7																	30491698		2203	4300	6503	SO:0001583	missense	10392	exon6			GCGTGTGTTCCGC	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1335C>A	7.37:g.30491698G>T	ENSP00000222823:p.Asn445Lys		79	0	0		117	0.03	4	NM_006092	10	0.00	0	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	37	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	G	16.56	3.158728	0.57368	.	.	ENSG00000106100	ENST00000222823	T	0.70045	-0.45	5.74	4.84	0.62591	NACHT nucleoside triphosphatase (1);	0.301030	0.42420	D	0.000714	T	0.50514	0.1620	N	0.22421	0.69	0.80722	D	1	P	0.49090	0.919	P	0.45343	0.477	T	0.52034	-0.8629	10	0.05959	T	0.93	.	10.9408	0.47273	0.0718:0.1313:0.7968:0.0	.	445	Q9Y239	NOD1_HUMAN	K	445	ENSP00000222823:N445K	ENSP00000222823:N445K	N	-	3	2	NOD1	30458223	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	3.874000	0.56101	1.382000	0.46385	0.655000	0.94253	AAC			0.637	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250443.2			
H2AFV	94239	mdanderson.org	37	7	44874113	44874113	+	Missense_Mutation	SNP	T	T	C	rs1802437		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr7:44874113T>C	ENST00000308153.4	-	5	465	c.374A>G	c.(373-375)cAg>cGg	p.Q125R	H2AFV_ENST00000350771.3_Missense_Mutation_p.Q99R|H2AFV_ENST00000349299.3_Missense_Mutation_p.Q87R|H2AFV_ENST00000521529.1_3'UTR|H2AFV_ENST00000437072.1_Intron|H2AFV_ENST00000222690.6_Intron|H2AFV_ENST00000381124.5_3'UTR	NM_012412.4	NP_036544.1	Q71UI9	H2AV_HUMAN	H2A histone family, member V	125			Q -> R (in dbSNP:rs1802437).			extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|urinary_tract(1)	9						AGCAGTTTTCTGCTGTCCCTT	0.373																																					p.Q125R													.	.			0			c.A374G												90.0	79.0	83.0					7																	44874113		2203	4300	6503	SO:0001583	missense	94239	exon5			GTTTTCTGCTGTC	AF081192	CCDS5495.1, CCDS5496.1, CCDS5497.1, CCDS5498.1, CCDS47581.1	7p13	2011-01-27		2004-03-26	ENSG00000105968	ENSG00000105968		"""Histones / Replication-independent"""	20664	protein-coding gene	gene with protein product				H2AV			Standard	NM_012412		Approved	MGC10170, MGC10831, MGC1947	uc003tma.2	Q71UI9	OTTHUMG00000129217	ENST00000308153.4:c.374A>G	7.37:g.44874113T>C	ENSP00000308405:p.Gln125Arg		92	0.0108695652	1		76	0.08	6	NM_012412	604	0.00	0	A6NFA8|A6NKY0|A6NN01|A8MQC5|Q59GV8|Q6PK98	Missense_Mutation	SNP	ENST00000308153.4	37	CCDS5496.1	.	.	.	.	.	.	.	.	.	.	T	17.73	3.461982	0.63513	.	.	ENSG00000105968	ENST00000349299;ENST00000308153;ENST00000350771	T;D;T	0.82619	0.93;-1.63;0.94	5.91	5.91	0.95273	Histone-fold (1);Histone H2A (1);	.	.	.	.	T	0.71600	0.3359	N	0.17474	0.49	0.80722	D	1	B;B;P	0.41673	0.0;0.029;0.759	B;B;B	0.37267	0.001;0.009;0.245	T	0.76405	-0.2971	9	0.59425	D	0.04	-19.8855	14.2973	0.66321	0.0:0.0:0.0:1.0	rs1802437	99;87;125	A6NKY0;A6NFA8;Q71UI9	.;.;H2AV_HUMAN	R	87;125;99	ENSP00000342714:Q87R;ENSP00000308405:Q125R;ENSP00000340708:Q99R	ENSP00000308405:Q125R	Q	-	2	0	H2AFV	44840638	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.465000	0.80898	2.261000	0.74972	0.533000	0.62120	CAG	0.001		0.373	H2AFV-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251305.1		NM_012412	
PKD1L1	168507	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	47947691	47947691	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr7:47947691G>A	ENST00000289672.2	-	9	1435	c.1385C>T	c.(1384-1386)tCc>tTc	p.S462F		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	462					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATTCACTTGGGAGTCAGCAAA	0.453																																					p.S462F													.	.			0			c.C1385T												103.0	92.0	95.0					7																	47947691		2203	4300	6503	SO:0001583	missense	168507	exon9			ACTTGGGAGTCAG	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1385C>T	7.37:g.47947691G>A	ENSP00000289672:p.Ser462Phe		75	0	0		69	0.13	9	NM_138295	2	0.00	0	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	37	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.959007	0.53400	.	.	ENSG00000158683	ENST00000289672	T	0.22336	1.96	5.17	5.17	0.71159	.	0.314057	0.24649	N	0.036740	T	0.30510	0.0767	N	0.24115	0.695	0.09310	N	1	D	0.69078	0.997	D	0.65573	0.936	T	0.09314	-1.0680	10	0.52906	T	0.07	-24.5499	14.215	0.65788	0.0:0.0:1.0:0.0	.	462	Q8TDX9	PK1L1_HUMAN	F	462	ENSP00000289672:S462F	ENSP00000289672:S462F	S	-	2	0	PKD1L1	47914216	0.088000	0.21588	0.047000	0.18901	0.008000	0.06430	2.783000	0.47766	2.418000	0.82041	0.650000	0.86243	TCC			0.453	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000340974.1		NM_138295	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72663998	72663998	+	RNA	SNP	T	T	G			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr7:72663998T>G	ENST00000425256.1	-	0	902									GTF2I repeat domain containing 2 pseudogene 1																		ATAGCCGGGGTCCTTGAATAC	0.488																																					.													.	.			0			.																																											0	.			CCGGGGTCCTTGA	AY312852		7q11.23	2010-03-19	2010-02-09	2010-02-09	ENSG00000214544	ENSG00000214544			33127	pseudogene	pseudogene			"""GTF2I repeat domain containing 2 pseudogene"""	GTF2IRD2P		15100712	Standard	NG_033736		Approved		uc003txs.1		OTTHUMG00000156803		7.37:g.72663998T>G			110	0.0090909091	1		125	0.02	3	.	0		0		RNA	SNP	ENST00000425256.1	37																																																																																						0.488	GTF2IRD2P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345921.1		NR_002164	
ZNF277	11179	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	111926968	111926969	+	Frame_Shift_Ins	INS	-	-	AGTCC			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr7:111926968_111926969insAGTCC	ENST00000361822.3	+	2	261_262	c.132_133insAGTCC	c.(133-135)agtfs	p.-46fs	ZNF277_ENST00000421043.1_Frame_Shift_Ins_p.-46fs|ZNF277_ENST00000450657.1_Frame_Shift_Ins_p.-46fs|RN7SKP187_ENST00000365536.1_RNA	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277						cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						CCCTGCCAGAAAGTCCAGGTGG	0.406																																					p.E44fs													.	ZNF277	46		0			c.132_133insAGTCC																																									SO:0001589	frameshift_variant	11179	exon2			GCCAGAAAGTCCA	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.133_137dupAGTCC	7.37:g.111926969_111926973dupAGTCC	ENSP00000354501:p.Pro46fs		103	0	0		96	0.14	13	NM_021994	17	0.00	0	Q75MZ2|Q75MZ3|Q8WY14	Frame_Shift_Ins	INS	ENST00000361822.3	37	CCDS5755.2																																																																																					0.406	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316843.2		NM_021994	
PRSS3	5646	mdanderson.org	37	9	33794809	33794809	+	Intron	SNP	G	G	A	rs201061108		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr9:33794809G>A	ENST00000361005.5	+	2	211				PRSS3_ENST00000429677.3_Intron|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Missense_Mutation_p.S7N|PRSS3_ENST00000379405.3_5'Flank	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			AGAGAGACAAGTGGCTTCACA	0.502																																					p.S7N													.	.			0			c.G20A																																									SO:0001627	intron_variant	5646	exon2			AGACAAGTGGCTT		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.212-1832G>A	9.37:g.33794809G>A			62	0	0		44	0.09	4	NM_001197097	0		0	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	ENST00000361005.5	37	CCDS47958.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.932356	0.00488	.	.	ENSG00000010438	ENST00000457896;ENST00000342836	D;D	0.88741	-2.29;-2.42	1.75	-2.5	0.06384	.	.	.	.	.	T	0.69260	0.3091	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.59096	-0.7518	9	0.02654	T	1	.	5.9988	0.19509	0.4674:0.0:0.5326:0.0	.	7	P35030-4	.	N	5;7	ENSP00000401249:S5N;ENSP00000340889:S7N	ENSP00000340889:S7N	S	+	2	0	PRSS3	33784809	0.000000	0.05858	0.000000	0.03702	0.136000	0.21042	-1.129000	0.03244	-0.673000	0.05259	-1.096000	0.02151	AGT			0.502	PRSS3-003	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000052121.1		NM_002771	
SIGMAR1	10280	mdanderson.org	37	9	34635841	34635841	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr9:34635841G>T	ENST00000277010.4	-	4	533	c.460C>A	c.(460-462)Cac>Aac	p.H154N	SIGMAR1_ENST00000477726.1_Missense_Mutation_p.H123N|SIGMAR1_ENST00000461426.1_5'UTR|SIGMAR1_ENST00000378892.1_Missense_Mutation_p.H65N	NM_001282208.1|NM_005866.2	NP_001269137.1|NP_005857.1	Q99720	SGMR1_HUMAN	sigma non-opioid intracellular receptor 1	154					cell death (GO:0008219)|lipid transport (GO:0006869)|nervous system development (GO:0007399)|regulation of neuron apoptotic process (GO:0043523)	cell junction (GO:0030054)|cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lipid particle (GO:0005811)|nuclear envelope (GO:0005635)	drug binding (GO:0008144)|opioid receptor activity (GO:0004985)			large_intestine(1)|lung(1)	2					Amitriptyline(DB00321)|Dextromethorphan(DB00514)|Nortriptyline(DB00540)|Pentazocine(DB00652)|Remoxipride(DB00409)	CCAGGCCCGTGTACTACCGTC	0.642																																					p.H154N													.	.			0			c.C460A												71.0	68.0	69.0					9																	34635841		2203	4300	6503	SO:0001583	missense	10280	exon4			GCCCGTGTACTAC	BC004899	CCDS6562.1, CCDS6563.1	9p13.3	2008-12-18	2008-12-18	2008-12-18	ENSG00000147955	ENSG00000147955			8157	protein-coding gene	gene with protein product		601978	"""opioid receptor, sigma 1"""	OPRS1		8954936, 9453537	Standard	NM_005866		Approved	SR-BP1	uc003zvb.3	Q99720	OTTHUMG00000019829	ENST00000277010.4:c.460C>A	9.37:g.34635841G>T	ENSP00000277010:p.His154Asn		45	0	0		30	0.10	3	NM_005866	55	0.00	0	D3DRM7|O00673|O00725|Q0Z9W6|Q153Z1|Q2TSD1|Q53GN2|Q7Z653|Q8N7H3|Q9NYX0	Missense_Mutation	SNP	ENST00000277010.4	37	CCDS6562.1	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659602	0.67586	.	.	ENSG00000147955	ENST00000378892;ENST00000277010;ENST00000360710;ENST00000477726	T;T;T	0.66815	-0.23;-0.23;-0.23	4.67	4.67	0.58626	.	0.000000	0.85682	D	0.000000	D	0.82370	0.5022	M	0.81239	2.535	0.58432	D	0.999992	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.996;0.972;0.995	D	0.85132	0.0975	10	0.72032	D	0.01	-15.1296	16.3227	0.82956	0.0:0.0:1.0:0.0	.	123;154;134	A2A3U5;Q99720;Q99720-2	.;SGMR1_HUMAN;.	N	65;154;120;123	ENSP00000368170:H65N;ENSP00000277010:H154N;ENSP00000420022:H123N	ENSP00000277010:H154N	H	-	1	0	SIGMAR1	34625841	1.000000	0.71417	0.905000	0.35620	0.634000	0.38068	9.202000	0.95026	2.425000	0.82216	0.462000	0.41574	CAC			0.642	SIGMAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000052204.1		NM_005866	
FAM120A	23196	mdanderson.org	37	9	96320139	96320139	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr9:96320139C>T	ENST00000277165.6	+	14	2709	c.2515C>T	c.(2515-2517)Cgc>Tgc	p.R839C	FAM120A_ENST00000340893.4_Missense_Mutation_p.R839C|FAM120A_ENST00000333936.5_Missense_Mutation_p.R867C	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	839	RNA binding.					cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AGAGAAGATGCGCCAGAGCGT	0.572																																					p.R839C													.	.			0			c.C2515T												63.0	56.0	59.0					9																	96320139		2203	4300	6503	SO:0001583	missense	23196	exon14			AAGATGCGCCAGA	AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.2515C>T	9.37:g.96320139C>T	ENSP00000277165:p.Arg839Cys		27	0	0		33	0.09	3	NM_014612	47	0.00	0	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	ENST00000277165.6	37	CCDS6706.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419011	0.83559	.	.	ENSG00000048828	ENST00000277165;ENST00000333936;ENST00000340893;ENST00000427765	T;T;T;T	0.60920	0.63;0.67;0.53;0.15	5.85	3.95	0.45737	.	0.194749	0.39475	N	0.001345	T	0.71409	0.3336	L	0.55213	1.73	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	P;D;D	0.85130	0.897;0.997;0.996	T	0.73824	-0.3861	10	0.87932	D	0	-13.3557	14.9661	0.71196	0.2612:0.7388:0.0:0.0	.	839;867;839	Q9NZB2-4;Q9NZB2-6;Q9NZB2	.;.;F120A_HUMAN	C	839;867;839;261	ENSP00000277165:R839C;ENSP00000334918:R867C;ENSP00000344698:R839C;ENSP00000412440:R261C	ENSP00000277165:R839C	R	+	1	0	FAM120A	95359960	1.000000	0.71417	0.986000	0.45419	0.990000	0.78478	5.777000	0.68931	0.750000	0.32877	0.655000	0.94253	CGC			0.572	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053160.2		NM_014612	
RABEPK	10244	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	127996190	127996190	+	Silent	SNP	T	T	C			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chr9:127996190T>C	ENST00000373538.3	+	8	1360	c.1050T>C	c.(1048-1050)tgT>tgC	p.C350C	RABEPK_ENST00000259460.8_Silent_p.C299C|RABEPK_ENST00000394124.4_3'UTR|RABEPK_ENST00000394125.4_Silent_p.C350C	NM_005833.3	NP_005824.2	Q7Z6M1	RABEK_HUMAN	Rab9 effector protein with kelch motifs	350					receptor-mediated endocytosis (GO:0006898)|vesicle docking involved in exocytosis (GO:0006904)	endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15						CACTGCTCTGTTTGGTGTTTG	0.423																																					p.C350C													.	.			0			c.T1050C												205.0	194.0	198.0					9																	127996190		2203	4300	6503	SO:0001819	synonymous_variant	10244	exon8			GCTCTGTTTGGTG	BC000503	CCDS6862.1, CCDS55341.1	9q33.1-q33.3	2010-04-19			ENSG00000136933	ENSG00000136933			16896	protein-coding gene	gene with protein product		605962				9230071	Standard	NM_005833		Approved	RAB9P40, bA65N13.1	uc004bpi.3	Q7Z6M1	OTTHUMG00000020674	ENST00000373538.3:c.1050T>C	9.37:g.127996190T>C			208	0	0		192	0.08	15	NM_005833	41	0.10	4	A8K403|O00568|Q69YR2|Q6FHA4|Q6IBG7|Q6P092|Q86Y76|Q9BWB1	Silent	SNP	ENST00000373538.3	37	CCDS6862.1																																																																																					0.423	RABEPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054064.1		NM_005833	
STS	412	mdanderson.org	37	X	7171292	7171292	+	Missense_Mutation	SNP	G	G	T	rs377179856		TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chrX:7171292G>T	ENST00000217961.4	+	2	287	c.67G>T	c.(67-69)Gca>Tca	p.A23S		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	23				A -> E (in Ref. 2; AAA60596). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CGAGAGCCACGCAGCATCAAG	0.498									Ichthyosis																												p.A23S													.	.			0			c.G67T												125.0	92.0	103.0					X																	7171292		2203	4299	6502	SO:0001583	missense	412	exon2	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	AGCCACGCAGCAT	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.67G>T	X.37:g.7171292G>T	ENSP00000217961:p.Ala23Ser		59	0	0		39	0.08	3	NM_000351	6	0.00	0	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	37	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	0.011	-1.735407	0.00681	.	.	ENSG00000101846	ENST00000217961	D	0.94793	-3.52	3.68	-2.78	0.05859	Alkaline-phosphatase-like, core domain (1);	11.187500	0.00702	N	0.000799	D	0.86280	0.5895	L	0.28556	0.865	0.09310	N	1	B	0.16802	0.019	B	0.08055	0.003	T	0.78768	-0.2075	10	0.05721	T	0.95	.	0.5013	0.00580	0.2439:0.24:0.2871:0.2289	.	23	P08842	STS_HUMAN	S	23	ENSP00000217961:A23S	ENSP00000217961:A23S	A	+	1	0	STS	7181292	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.146000	0.10250	-1.356000	0.02183	-2.351000	0.00242	GCA			0.498	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055686.1		NM_000351	
TFE3	7030	mdanderson.org	37	X	48900701	48900701	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-A9SE-01A-21D-A435-10	TCGA-XE-A9SE-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6a58d663-cd26-4aba-b604-263d1fd05531	7a457edc-11a8-4600-b310-4375e3d2c130	g.chrX:48900701C>T	ENST00000315869.7	-	1	311	c.52G>A	c.(52-54)Ggc>Agc	p.G18S		NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	18					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GCTCGAGGGCCCTCCGCGCTG	0.756			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																p.G18S				Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	.	.			0			c.G52A												7.0	8.0	7.0					X																	48900701		2092	4119	6211	SO:0001583	missense	7030	exon1			GAGGGCCCTCCGC	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.52G>A	X.37:g.48900701C>T	ENSP00000314129:p.Gly18Ser		14	0	0		19	0.11	2	NM_006521	18	0.00	0	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	ENST00000315869.7	37	CCDS14315.3	.	.	.	.	.	.	.	.	.	.	C	31	5.073367	0.94000	.	.	ENSG00000068323	ENST00000315869	T	0.13307	2.6	4.48	4.48	0.54585	.	0.340826	0.21202	N	0.078453	T	0.07503	0.0189	N	0.22421	0.69	0.32828	D	0.50364	P	0.40578	0.722	B	0.23852	0.049	T	0.14476	-1.0471	10	0.52906	T	0.07	-12.9642	11.3906	0.49811	0.0:1.0:0.0:0.0	.	18	P19532	TFE3_HUMAN	S	18	ENSP00000314129:G18S	ENSP00000314129:G18S	G	-	1	0	TFE3	48787645	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.873000	0.39558	2.064000	0.61679	0.506000	0.49869	GGC			0.756	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058872.2		NM_006521	
