#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
AGRN	375790	mdanderson.org	37	1	955749	955749	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:955749G>T	ENST00000379370.2	+	1	247	c.197G>T	c.(196-198)tGc>tTc	p.C66F		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	66	NtA. {ECO:0000255|PROSITE- ProRule:PRU00443}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		ACGTACTCCTGCAAGGTGCGC	0.756																																					p.C66F													.	.			0			c.G197T												10.0	8.0	8.0					1																	955749		1550	2806	4356	SO:0001583	missense	375790	exon1			ACTCCTGCAAGGT	XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.197G>T	1.37:g.955749G>T	ENSP00000368678:p.Cys66Phe		47	0	0		25	0.12	3	NM_198576	4	0.00	0	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Missense_Mutation	SNP	ENST00000379370.2	37	CCDS30551.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.914123	0.52546	.	.	ENSG00000188157	ENST00000379370	T	0.39406	1.08	2.24	2.24	0.28232	Agrin NtA (2);Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.000000	0.35349	U	0.003270	T	0.49081	0.1536	L	0.29908	0.895	0.46203	D	0.998927	D	0.76494	0.999	D	0.87578	0.998	T	0.52631	-0.8550	10	0.72032	D	0.01	.	11.6222	0.51124	0.0:0.0:1.0:0.0	.	66	O00468	AGRIN_HUMAN	F	66	ENSP00000368678:C66F	ENSP00000368678:C66F	C	+	2	0	AGRN	945612	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	8.021000	0.88750	1.283000	0.44513	0.472000	0.43445	TGC			0.756	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097990.2		NM_198576	
KIF1B	23095	broad.mit.edu;mdanderson.org	37	1	10355744	10355744	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:10355744G>A	ENST00000377086.1	+	19	1899	c.1697G>A	c.(1696-1698)cGc>cAc	p.R566H	KIF1B_ENST00000377083.1_Missense_Mutation_p.R520H|KIF1B_ENST00000377081.1_Missense_Mutation_p.R566H|KIF1B_ENST00000377093.4_Missense_Mutation_p.R520H|KIF1B_ENST00000263934.6_Missense_Mutation_p.R520H			O60333	KIF1B_HUMAN	kinesin family member 1B	566	FHA. {ECO:0000255|PROSITE- ProRule:PRU00086}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		GCTGAGCGGCGCCAGGACATA	0.502																																					p.R520H													.	KIF1B	242		0			c.G1559A												81.0	87.0	85.0					1																	10355744		2203	4300	6503	SO:0001583	missense	23095	exon17			AGCGGCGCCAGGA	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1697G>A	1.37:g.10355744G>A	ENSP00000366290:p.Arg566His		105	0	0		66	0.06	4	NM_183416	2	0.00	0	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	37		.	.	.	.	.	.	.	.	.	.	G	26.3	4.727684	0.89390	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17	6.07	6.07	0.98685	Forkhead-associated (FHA) domain (4);SMAD/FHA domain (1);	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	L	0.48877	1.53	0.80722	D	1	P;P;B;P;B;D;P	0.69078	0.603;0.607;0.391;0.894;0.4;0.997;0.525	B;B;B;B;B;P;B	0.60236	0.315;0.333;0.263;0.36;0.087;0.871;0.098	D	0.88666	0.3192	10	0.38643	T	0.18	.	19.6475	0.95784	0.0:0.0:1.0:0.0	.	552;526;566;540;566;520;520	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	H	566;520;520;566;520;566	ENSP00000263934:R520H;ENSP00000366297:R520H;ENSP00000366290:R566H;ENSP00000366287:R520H;ENSP00000366284:R566H	ENSP00000263934:R520H	R	+	2	0	KIF1B	10278331	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.885000	0.99019	0.655000	0.94253	CGC			0.502	KIF1B-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000005102.1			
NBPF1	55672	broad.mit.edu	37	1	16918653	16918653	+	Splice_Site	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:16918653C>T	ENST00000430580.2	-	6	853		c.e6+1			NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TCTTAACTTACTGTTGTGAAA	0.418																																					.													.	.			0			.																																									SO:0001630	splice_region_variant	55672	.			AACTTACTGTTGT	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.34+1G>A	1.37:g.16918653C>T			42	0.0238095238	1		26	0.12	3	.	2	0.00	0	Q8N4E8|Q9C0H0	Splice_Site	SNP	ENST00000430580.2	37																																																																																						0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000106436.3		NM_017940	Intron
CROCCP2	84809	broad.mit.edu	37	1	16945182	16945184	+	lincRNA	DEL	AAT	AAT	-	rs374889577|rs71803374	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	AAT	AAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:16945182_16945184delAAT	ENST00000412962.1	-	0	2335_2337				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TACTGATGAAAATAATAACAGAT	0.325														915	0.182708	0.1906	0.2853	5008	,	,		89095	0.0278		0.2157	False		,,,				2504	0.2249				.													.	.			0			.																																											0	.			GATGAAAATAATA	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16945185_16945187delAAT			6	0	0		6	0.33	2	.	7	0.00	0	Q8NF65|Q96FR5|Q9BRE8	RNA	DEL	ENST00000412962.1	37																																																																																						0.325	CROCCP2-003	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000092784.1		NR_026752.1	
PADI3	51702	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17607185	17607185	+	Missense_Mutation	SNP	G	G	A	rs146338253	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:17607185G>A	ENST00000375460.3	+	15	1695	c.1655G>A	c.(1654-1656)cGt>cAt	p.R552H	MIR3972_ENST00000582732.1_RNA	NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	552					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GACTGGAACCGTGAGGTGCTG	0.597																																					p.R552H													PADI3,NS,carcinoma,+1,1	PADI3	1	1	0			c.G1655A												92.0	91.0	91.0					1																	17607185		2203	4300	6503	SO:0001583	missense	51702	exon15			GGAACCGTGAGGT	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1655G>A	1.37:g.17607185G>A	ENSP00000364609:p.Arg552His		124	0	0		92	0.10	9	NM_016233	0		0	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	37	CCDS179.1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894361	0.72639	.	.	ENSG00000142619	ENST00000375460	T	0.34667	1.35	4.43	4.43	0.53597	Protein-arginine deiminase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65176	0.2666	M	0.86343	2.81	0.51233	D	0.999916	D	0.89917	1.0	D	0.87578	0.998	T	0.72734	-0.4204	10	0.62326	D	0.03	-22.8206	16.002	0.80301	0.0:0.0:1.0:0.0	.	552	Q9ULW8	PADI3_HUMAN	H	552	ENSP00000364609:R552H	ENSP00000364609:R552H	R	+	2	0	PADI3	17479772	1.000000	0.71417	0.999000	0.59377	0.433000	0.31745	9.276000	0.95745	2.202000	0.70862	0.313000	0.20887	CGT			0.597	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006805.1			
PUM1	9698	mdanderson.org	37	1	31426815	31426815	+	Missense_Mutation	SNP	A	A	T	rs2275741	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:31426815A>T	ENST00000257075.5	-	15	2430	c.2337T>A	c.(2335-2337)aaT>aaA	p.N779K	PUM1_ENST00000440538.2_Missense_Mutation_p.N753K|PUM1_ENST00000373747.3_Missense_Mutation_p.N780K|PUM1_ENST00000423018.2_Missense_Mutation_p.N635K|PUM1_ENST00000424085.2_Missense_Mutation_p.N537K|PUM1_ENST00000373741.4_Missense_Mutation_p.N815K|PUM1_ENST00000373742.2_Missense_Mutation_p.N720K|PUM1_ENST00000426105.2_Missense_Mutation_p.N779K	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	779	Ser-rich.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		TTCCACTGCCATTCGTGAGTC	0.512																																					p.N779K													.	.			0			c.T2337A												80.0	83.0	82.0					1																	31426815		2203	4300	6503	SO:0001583	missense	9698	exon15			ACTGCCATTCGTG	AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.2337T>A	1.37:g.31426815A>T	ENSP00000257075:p.Asn779Lys		75	0	0		51	0.04	2	NM_014676	14	0.00	0	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	ENST00000257075.5	37	CCDS338.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.1|20.1	3.936958|3.936958	0.73557|0.73557	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742|ENST00000525843;ENST00000498419	T;T;T;T;T;T;T;T|.	0.19250|.	2.23;2.16;2.44;2.43;2.5;2.42;2.53;2.2|.	6.02|6.02	-4.63|-4.63	0.03359|0.03359	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.61899|0.61899	0.2384|0.2384	M|M	0.63843|0.63843	1.955|1.955	0.09310|0.09310	P|P	0.99999854687|0.99999854687	D;P;P;D;D;P;P;D|.	0.55605|.	0.972;0.949;0.949;0.97;0.972;0.629;0.949;0.972|.	P;P;P;P;P;B;P;P|.	0.58454|.	0.694;0.776;0.694;0.839;0.694;0.416;0.694;0.694|.	T|T	0.66176|0.66176	-0.5989|-0.5989	9|4	0.62326|.	D|.	0.03|.	-8.7022|-8.7022	16.103|16.103	0.81201|0.81201	0.8127:0.0:0.1873:0.0|0.8127:0.0:0.1873:0.0	.|.	720;635;815;753;779;779;780;779|.	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5|.	.;.;.;.;PUM1_HUMAN;.;.;.|.	K|R	537;779;780;517;779;753;815;635;720|718;491	ENSP00000400141:N537K;ENSP00000257075:N779K;ENSP00000362852:N780K;ENSP00000391723:N779K;ENSP00000401777:N753K;ENSP00000362846:N815K;ENSP00000399440:N635K;ENSP00000362847:N720K|.	ENSP00000257075:N779K|.	N|W	-|-	3|1	2|0	PUM1|PUM1	31199402|31199402	0.053000|0.053000	0.20554|0.20554	0.831000|0.831000	0.32960|0.32960	0.925000|0.925000	0.55904|0.55904	-0.433000|-0.433000	0.06948|0.06948	-1.276000|-1.276000	0.02414|0.02414	-1.551000|-1.551000	0.00897|0.00897	AAT|TGG			0.512	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000010671.1			
MACF1	23499	broad.mit.edu	37	1	39801335	39801335	+	Silent	SNP	A	A	G			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:39801335A>G	ENST00000372915.3	+	36	9177	c.9090A>G	c.(9088-9090)aaA>aaG	p.K3030K	MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Silent_p.K3025K|MACF1_ENST00000567887.1_Silent_p.K3062K|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000289893.4_Silent_p.K1465K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3030					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)	p.K1465K(1)		breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CAAGTGAAAAAGGGAAAGAAG	0.368																																					.													MACF1,NS,carcinoma,0,1	MACF1	909	1	1	Substitution - coding silent(1)	lung(1)	.												63.0	67.0	66.0					1																	39801335		2203	4300	6503	SO:0001819	synonymous_variant	23499	.			TGAAAAAGGGAAA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.9090A>G	1.37:g.39801335A>G			284	0	0		211	0.03	6	.	0		0	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	37																																																																																						0.368	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding		OTTHUMT00000392096.1		NM_033044	
COL9A2	1298	mdanderson.org	37	1	40775830	40775830	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:40775830G>T	ENST00000372748.3	-	15	841	c.745C>A	c.(745-747)Cat>Aat	p.H249N		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	249	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TTATATCCATGAGGGCCCTGG	0.587																																					p.H249N													.	.			0			c.C745A												62.0	66.0	64.0					1																	40775830		2203	4300	6503	SO:0001583	missense	1298	exon15			ATCCATGAGGGCC	M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.745C>A	1.37:g.40775830G>T	ENSP00000361834:p.His249Asn		52	0	0		28	0.11	3	NM_001852	3	0.00	0	B2RMP9	Missense_Mutation	SNP	ENST00000372748.3	37	CCDS450.1	.	.	.	.	.	.	.	.	.	.	.	9.784	1.176155	0.21704	.	.	ENSG00000049089	ENST00000372748	D	0.94046	-3.34	4.12	4.12	0.48240	.	0.808768	0.11718	N	0.536225	D	0.84297	0.5441	N	0.10809	0.05	0.19300	N	0.999979	B	0.06786	0.001	B	0.06405	0.002	T	0.69877	-0.5026	10	0.15952	T	0.53	.	10.2144	0.43160	0.0:0.2024:0.7976:0.0	.	249	Q14055	CO9A2_HUMAN	N	249	ENSP00000361834:H249N	ENSP00000361834:H249N	H	-	1	0	COL9A2	40548417	0.687000	0.27671	0.977000	0.42913	0.475000	0.33008	1.657000	0.37366	2.313000	0.78055	0.558000	0.71614	CAT			0.587	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000015764.3		NM_001852	
OSBPL9	114883	bcgsc.ca	37	1	52255291	52255291	+	IGR	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:52255291G>T	ENST00000428468.1	+	0	2893				NRD1_ENST00000352171.7_Silent_p.V1069V|NRD1_ENST00000354831.7_Silent_p.V1137V|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000539524.1_Silent_p.V1005V			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9						lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						TGAACCAGTTGACCAGGTCTG	0.408																																					p.V1137V													.	NRD1	89		0			c.C3411A												117.0	110.0	113.0					1																	52255291		2203	4300	6503	SO:0001628	intergenic_variant	4898	exon32			CCAGTTGACCAGG	AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234		1.37:g.52255291G>T			81	0	0		47	0.09	4	NM_002525	215	0.00	0	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Silent	SNP	ENST00000428468.1	37	CCDS41332.3	.	.	.	.	.	.	.	.	.	.	G	7.674	0.687527	0.14973	.	.	ENSG00000078618	ENST00000440943	.	.	.	4.98	1.96	0.26148	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.54753	D	0.999989	.	.	.	.	.	.	T	0.49899	-0.8890	4	.	.	.	-9.5244	8.0416	0.30526	0.2165:0.1287:0.6547:0.0	.	.	.	.	K	456	.	.	Q	-	1	0	NRD1	52027879	0.052000	0.20516	0.933000	0.37362	0.992000	0.81027	0.165000	0.16564	0.720000	0.32209	0.650000	0.86243	CAA			0.408	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000022584.4			
DOCK7	85440	mdanderson.org	37	1	62970399	62970399	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:62970399T>C	ENST00000340370.5	-	36	4590	c.4573A>G	c.(4573-4575)Agg>Ggg	p.R1525G	DOCK7_ENST00000251157.5_Missense_Mutation_p.R1547G	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1556					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CGGAGAAGCCTGAGGCATAAA	0.423																																					p.R1547G													.	.			0			c.A4639G												90.0	84.0	86.0					1																	62970399		2203	4300	6503	SO:0001583	missense	85440	exon37			GAAGCCTGAGGCA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.4573A>G	1.37:g.62970399T>C	ENSP00000340742:p.Arg1525Gly		76	0.0131578947	1		45	0.07	3	NM_001271999	14	0.00	0	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	37	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.25|17.25	3.342298|3.342298	0.61073|0.61073	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.62788	.|0.0;0.0	5.15|5.15	3.2|3.2	0.36748|0.36748	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.76083|0.76083	0.3938|0.3938	M|M	0.65975|0.65975	2.015|2.015	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D;D;D;D;D	.|0.76494	.|0.998;0.998;0.999;0.999;0.992;0.967	.|D;D;D;D;D;P	.|0.85130	.|0.936;0.964;0.997;0.997;0.917;0.879	T|T	0.76564|0.76564	-0.2913|-0.2913	5|10	.|0.54805	.|T	.|0.06	.|.	14.2696|14.2696	0.66143|0.66143	0.0:0.0:0.5567:0.4433|0.0:0.0:0.5567:0.4433	.|.	.|1556;1547;1525;1516;1516;1547	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	R|G	718|1556;1547;1525;286	.|ENSP00000251157:R1547G;ENSP00000340742:R1525G	.|ENSP00000251157:R1547G	Q|R	-|-	2|1	0|2	DOCK7|DOCK7	62742987|62742987	0.962000|0.962000	0.33011|0.33011	0.992000|0.992000	0.48379|0.48379	0.916000|0.916000	0.54674|0.54674	1.160000|1.160000	0.31761|0.31761	0.505000|0.505000	0.28104|0.28104	-0.316000|-0.316000	0.08728|0.08728	CAG|AGG			0.423	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000036806.1		NM_033407	
STRIP1	85369	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	110596376	110596376	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:110596376G>A	ENST00000369795.3	+	21	2378	c.2356G>A	c.(2356-2358)Gcc>Acc	p.A786T	STRIP1_ENST00000369796.1_Missense_Mutation_p.A691T	NM_033088.3	NP_149079.2	Q5VSL9	STRP1_HUMAN	striatin interacting protein 1	786					cortical actin cytoskeleton organization (GO:0030866)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)											CTATGACCGGGCCCACAGCAA	0.587											OREG0013647	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A786T													.	.			0			c.G2356A												55.0	52.0	53.0					1																	110596376		2203	4300	6503	SO:0001583	missense	85369	exon21			GACCGGGCCCACA	AK027649	CCDS30798.1, CCDS59197.1	1p13.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000143093	ENSG00000143093			25916	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog A (yeast)"""		"""family with sequence similarity 40, member A"""	FAM40A		11214970, 12588993, 22782902, 22298706, 18782753	Standard	NM_033088		Approved	FLJ14743, KIAA1761, FAR11A	uc001dza.2	Q5VSL9	OTTHUMG00000170607	ENST00000369795.3:c.2356G>A	1.37:g.110596376G>A	ENSP00000358810:p.Ala786Thr		106	0	0	1428	101	0.32	32	NM_033088	69	0.26	18	Q0V925|Q5VSL8|Q658K2|Q6ZV31|Q8N598|Q96SN2|Q9C0A2	Missense_Mutation	SNP	ENST00000369795.3	37	CCDS30798.1	.	.	.	.	.	.	.	.	.	.	G	14.40	2.524501	0.44969	.	.	ENSG00000143093	ENST00000369796;ENST00000369795	T;T	0.44083	0.93;0.94	6.07	-0.355	0.12587	.	0.311519	0.40144	N	0.001173	T	0.04861	0.0131	N	0.01352	-0.895	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.11329	0.002;0.006	T	0.28902	-1.0029	10	0.12766	T	0.61	-3.9429	11.4942	0.50398	0.5536:0.0:0.4464:0.0	.	691;786	Q5VSL9-2;Q5VSL9	.;FA40A_HUMAN	T	691;786	ENSP00000358811:A691T;ENSP00000358810:A786T	ENSP00000358810:A786T	A	+	1	0	FAM40A	110397899	1.000000	0.71417	0.852000	0.33557	0.998000	0.95712	1.042000	0.30303	0.025000	0.15241	0.655000	0.94253	GCC			0.587	STRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032213.1		NM_033088	
PTGFRN	5738	mdanderson.org	37	1	117487338	117487338	+	Silent	SNP	G	G	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:117487338G>C	ENST00000393203.2	+	3	603	c.456G>C	c.(454-456)cgG>cgC	p.R152R		NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	152	Ig-like C2-type 2.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		CCAGCGCGCGGCCCCCGCCGA	0.746																																					p.R152R													.	.			0			c.G456C												5.0	6.0	5.0					1																	117487338		1387	3211	4598	SO:0001819	synonymous_variant	5738	exon3			CGCGCGGCCCCCG	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.456G>C	1.37:g.117487338G>C			44	0.1363636364	6		28	0.32	9	NM_020440	2	0.00	0	Q5VVU9|Q8N2K6	Silent	SNP	ENST00000393203.2	37	CCDS890.1																																																																																					0.746	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033271.1		NM_020440	
ADAMTSL4	54507	mdanderson.org	37	1	150530476	150530476	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr1:150530476C>T	ENST00000369038.2	+	12	2434	c.2233C>T	c.(2233-2235)Cac>Tac	p.H745Y	ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.H768Y|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.H745Y|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.H745Y			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	745	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			CGGCACCCAGCACCGCCAGCT	0.687																																					p.H745Y													.	.			0			c.C2233T												24.0	29.0	27.0					1																	150530476		2105	4173	6278	SO:0001583	missense	54507	exon14			ACCCAGCACCGCC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.2233C>T	1.37:g.150530476C>T	ENSP00000358034:p.His745Tyr		47	0	0		43	0.07	3	NM_019032	13	0.00	0	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	ENST00000369038.2	37	CCDS955.1	.	.	.	.	.	.	.	.	.	.	C	32	5.139823	0.94560	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000407995;ENST00000369039;ENST00000369038	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	5.92	5.92	0.95590	.	.	.	.	.	T	0.41003	0.1140	N	0.16790	0.44	0.53688	D	0.99997	P;B;P;D	0.58970	0.936;0.2;0.892;0.984	P;B;P;P	0.57846	0.806;0.198;0.806;0.828	T	0.38222	-0.9671	9	0.51188	T	0.08	.	17.8145	0.88627	0.0:1.0:0.0:0.0	.	706;768;745;745	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	Y	745;745;283;768;745	ENSP00000358037:H745Y;ENSP00000271643:H745Y;ENSP00000358035:H768Y;ENSP00000358034:H745Y	ENSP00000271643:H745Y	H	+	1	0	ADAMTSL4	148797100	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.644000	0.67902	2.813000	0.96785	0.561000	0.74099	CAC			0.687	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000084395.4		NM_019032	
ZNF503	84858	mdanderson.org	37	10	77159069	77159069	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr10:77159069G>T	ENST00000372524.4	-	2	1865	c.1379C>A	c.(1378-1380)gCg>gAg	p.A460E	ZNF503-AS2_ENST00000466942.2_RNA|ZNF503_ENST00000535216.1_Missense_Mutation_p.A460E|RP11-399K21.11_ENST00000418818.2_lincRNA	NM_032772.4	NP_116161.2	Q96F45	ZN503_HUMAN	zinc finger protein 503	460	Ala-rich.				G1 to G0 transition involved in cell differentiation (GO:0070315)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|neural precursor cell proliferation (GO:0061351)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			lung(4)|ovary(1)|skin(1)	6	all_cancers(46;0.105)|all_epithelial(25;0.00449)|Prostate(51;0.0112)|Ovarian(15;0.088)					CTTCAGCGCCGCAGCCGCAGC	0.716																																					p.A460E													.	.			0			c.C1379A												8.0	11.0	10.0					10																	77159069		2179	4256	6435	SO:0001583	missense	84858	exon2			AGCGCCGCAGCCG	AK127647	CCDS7350.1	10q22.3	2011-02-09			ENSG00000165655	ENSG00000165655		"""Zinc fingers, C2H2-type"""	23589	protein-coding gene	gene with protein product		613902				12477932	Standard	NM_032772		Approved	FLJ45745, MGC2555	uc001jxg.3	Q96F45	OTTHUMG00000018526	ENST00000372524.4:c.1379C>A	10.37:g.77159069G>T	ENSP00000361602:p.Ala460Glu		24	0	0		26	0.12	3	NM_032772	1	0.00	0	Q8NAC5|Q96E25|Q96IJ0	Missense_Mutation	SNP	ENST00000372524.4	37	CCDS7350.1	.	.	.	.	.	.	.	.	.	.	G	4.331	0.060728	0.08339	.	.	ENSG00000165655	ENST00000372524;ENST00000535216;ENST00000372516	T;T	0.46451	0.87;0.87	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	T	0.37839	0.1018	L	0.55481	1.735	0.45205	D	0.998219	P	0.48589	0.912	P	0.46208	0.507	T	0.33650	-0.9860	10	0.02654	T	1	-0.0451	12.2083	0.54365	0.0:0.0:1.0:0.0	.	460	Q96F45	ZN503_HUMAN	E	460;460;423	ENSP00000361602:A460E;ENSP00000438988:A460E	ENSP00000361594:A423E	A	-	2	0	ZNF503	76829075	1.000000	0.71417	0.723000	0.30687	0.539000	0.34962	6.452000	0.73485	2.240000	0.73641	0.643000	0.83706	GCG			0.716	ZNF503-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048826.1		NM_032772	
DLG5	9231	mdanderson.org	37	10	79579175	79579175	+	Missense_Mutation	SNP	A	A	G	rs142466775	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr10:79579175A>G	ENST00000372391.2	-	17	3580	c.3575T>C	c.(3574-3576)cTg>cCg	p.L1192P	DLG5_ENST00000372388.2_Missense_Mutation_p.L852P|DLG5_ENST00000459739.1_5'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)	1192					apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GGGGTTCCGCAGGATGGAGCT	0.627																																					p.L1192P													.	.			0			c.T3575C							A	PRO/LEU	1,4405	2.1+/-5.4	0,1,2202	53.0	54.0	53.0		3575	5.5	1.0	10	dbSNP_134	53	2,8598	2.2+/-6.3	0,2,4298	yes	missense	DLG5	NM_004747.3	98	0,3,6500	GG,GA,AA		0.0233,0.0227,0.0231	probably-damaging	1192/1920	79579175	3,13003	2203	4300	6503	SO:0001583	missense	9231	exon17			TTCCGCAGGATGG	U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.3575T>C	10.37:g.79579175A>G	ENSP00000361467:p.Leu1192Pro		57	0	0		38	0.08	3	NM_004747	36	0.00	0	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	Missense_Mutation	SNP	ENST00000372391.2	37	CCDS7353.2	.	.	.	.	.	.	.	.	.	.	A	22.8	4.338091	0.81911	2.27E-4	2.33E-4	ENSG00000151208	ENST00000372391;ENST00000424842;ENST00000372388	T;T;T	0.05925	3.47;3.37;3.55	5.54	5.54	0.83059	.	0.000000	0.29480	N	0.012038	T	0.14570	0.0352	L	0.29908	0.895	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.68943	0.961;0.914;0.953	T	0.10847	-1.0612	10	0.31617	T	0.26	.	15.6783	0.77344	1.0:0.0:0.0:0.0	.	1082;1192;852	Q8TDM6-4;Q8TDM6;Q8TDM6-2	.;DLG5_HUMAN;.	P	1192;153;852	ENSP00000361467:L1192P;ENSP00000394797:L153P;ENSP00000361464:L852P	ENSP00000361464:L852P	L	-	2	0	DLG5	79249181	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.709000	0.91379	2.114000	0.64651	0.528000	0.53228	CTG	0		0.627	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000048900.2			
MUC2	4583	mdanderson.org	37	11	1093210	1093210	+	Missense_Mutation	SNP	G	G	C	rs56396523		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:1093210G>C	ENST00000441003.2	+	30	5056	c.5029G>C	c.(5029-5031)Gcc>Ccc	p.A1677P	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.A1644P|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	aaccccaacagccatcaccac	0.627																																					p.A1677P													.	.			0			c.G5029C												114.0	177.0	154.0					11																	1093210		1786	3249	5035	SO:0001583	missense	4583	exon30			CCAACAGCCATCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5029G>C	11.37:g.1093210G>C	ENSP00000415183:p.Ala1677Pro		22	0.2272727273	5		16	0.31	5	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.173	-1.069534	0.01918	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.10192	2.9;3.27	1.75	-3.49	0.04724	.	0.815224	0.08676	U	0.910149	T	0.06050	0.0157	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21552	-1.0242	9	0.30078	T	0.28	.	1.5588	0.02590	0.1363:0.3641:0.2725:0.2271	rs56396523	1677	E7EUV1	.	P	1677;1644	ENSP00000415183:A1677P;ENSP00000351956:A1644P	ENSP00000351956:A1644P	A	+	1	0	MUC2	1083210	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.188000	0.03064	-4.444000	0.00048	-3.498000	0.00033	GCC			0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
MUC2	4583	hgsc.bcm.edu	37	11	1093420	1093420	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:1093420A>G	ENST00000441003.2	+	30	5266	c.5239A>G	c.(5239-5241)Atc>Gtc	p.I1747V	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000359061.5_Missense_Mutation_p.I1714V|MUC2_ENST00000333592.6_Missense_Mutation_p.I35V	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	cacgacacccatcaccaccac	0.647																																					p.I1747V													MUC2_ENST00000441003,NS,carcinoma,-2,2	MUC2_ENST00000441003	-2	2	0			c.A5239G												211.0	240.0	230.0					11																	1093420		2041	3977	6018	SO:0001583	missense	4583	exon30			ACACCCATCACCA	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5239A>G	11.37:g.1093420A>G	ENSP00000415183:p.Ile1747Val		51	0.0392156863	2		35	0.06	2	NM_002457	0		0	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	A	4.945	0.175503	0.09391	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.09538	3.12;3.17;2.97	0.458	0.458	0.16670	.	220.785000	0.00531	N	0.000208	T	0.07458	0.0188	.	.	.	0.09310	N	1	B	0.18461	0.028	B	0.08055	0.003	T	0.29305	-1.0016	9	0.30854	T	0.27	.	5.1455	0.14983	0.9999:0.0:1.0E-4:0.0	.	1747	E7EUV1	.	V	1747;1714;35	ENSP00000415183:I1747V;ENSP00000351956:I1714V;ENSP00000331373:I35V	ENSP00000331373:I35V	I	+	1	0	MUC2	1083420	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.390000	0.07332	0.387000	0.25024	0.164000	0.16699	ATC			0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000345894.2		NM_002457	
FAR1	84188	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	11	13743357	13743357	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:13743357C>T	ENST00000354817.3	+	10	1352	c.1208C>T	c.(1207-1209)aCt>aTt	p.T403I	FAR1_ENST00000532502.1_Missense_Mutation_p.T27I	NM_032228.5	NP_115604.1	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	403					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)|wax biosynthetic process (GO:0010025)	integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13						GTTTGGAATACTGAGAATGTC	0.294																																					p.T403I													.	.			0			c.C1208T												79.0	78.0	78.0					11																	13743357		2197	4290	6487	SO:0001583	missense	84188	exon10			GGAATACTGAGAA	AK026381	CCDS7813.1	11p15.2	2011-09-14	2008-06-06	2008-06-06	ENSG00000197601	ENSG00000197601	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	26222	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 1"""		"""male sterility domain containing 2"""	MLSTD2		15220348, 15220349, 19027726	Standard	NM_032228		Approved	FLJ22728, SDR10E1	uc001mld.3	Q8WVX9	OTTHUMG00000165743	ENST00000354817.3:c.1208C>T	11.37:g.13743357C>T	ENSP00000346874:p.Thr403Ile		185	0	0		105	0.33	35	NM_032228	2	0.50	1	D3DQW8|Q5CZA3	Missense_Mutation	SNP	ENST00000354817.3	37	CCDS7813.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011853	0.75046	.	.	ENSG00000197601	ENST00000354817;ENST00000532502	T	0.24723	1.84	5.48	5.48	0.80851	.	0.194396	0.53938	D	0.000051	T	0.42921	0.1224	L	0.58354	1.805	0.51233	D	0.999918	P	0.45531	0.86	P	0.57009	0.811	T	0.13522	-1.0506	10	0.56958	D	0.05	-15.4666	14.1937	0.65656	0.1497:0.8503:0.0:0.0	.	403	Q8WVX9	FACR1_HUMAN	I	403;27	ENSP00000346874:T403I	ENSP00000346874:T403I	T	+	2	0	FAR1	13699933	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.735000	0.62051	2.734000	0.93682	0.563000	0.77884	ACT			0.294	FAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385990.2		NM_032228	
Unknown	0	bcgsc.ca	37	11	50227517	50227517	+	IGR	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:50227517C>T								OR4C12 (223446 upstream) : RP11-347H15.4 (30232 downstream)																							GATCCACCGGCATTAGGGATG	0.393																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CACCGGCATTAGG																													11.37:g.50227517C>T			81	0	0		62	0.42	26	.	0		0		RNA	SNP		37																																																																																					0	0.393										
C11orf95	65998	mdanderson.org	37	11	63533331	63533331	+	lincRNA	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:63533331T>C	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcctcctcttcttcctcct	0.672																																					p.E195E													.	.			0			c.A585G												21.0	18.0	19.0					11																	63533331		692	1591	2283			65998	exon2			CTCCTCTTCTTCC																													11.37:g.63533331T>C			25	0.04	1		18	0.11	2	NM_001144936	0		0		Silent	SNP	ENST00000546282.2	37																																																																																						0.672	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
C11orf95	65998	broad.mit.edu;mdanderson.org	37	11	63533337	63533337	+	lincRNA	SNP	C	C	T	rs373116664		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:63533337C>T	ENST00000546282.2	-	0	738				C11orf95_ENST00000433688.1_lincRNA																							cctcttcttcctcctcctcct	0.667																																					p.E193E													.	.			0			c.G579A												23.0	19.0	20.0					11																	63533337		692	1591	2283			65998	exon2			TTCTTCCTCCTCC																													11.37:g.63533337C>T			30	0	0		23	0.13	3	NM_001144936	0		0		RNA	SNP	ENST00000546282.2	37																																																																																						0.667	RP11-466C23.4-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000396567.2			
RNF169	254225	mdanderson.org	37	11	74521243	74521243	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:74521243G>T	ENST00000299563.4	+	3	604	c.591G>T	c.(589-591)aaG>aaT	p.K197N		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	197					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						GAGAAGAAAAGTTACAAGAGG	0.318																																					p.K197N													.	.			0			c.G591T												74.0	72.0	72.0					11																	74521243		1801	4068	5869	SO:0001583	missense	254225	exon3			AGAAAAGTTACAA	AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.591G>T	11.37:g.74521243G>T	ENSP00000299563:p.Lys197Asn		69	0	0		53	0.06	3	NM_001098638	0		0	Q6N015	Missense_Mutation	SNP	ENST00000299563.4	37	CCDS41691.1	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537731	0.65085	.	.	ENSG00000166439	ENST00000299563	T	0.53857	0.6	5.89	3.04	0.35103	.	0.108250	0.64402	D	0.000007	T	0.67571	0.2907	M	0.75447	2.3	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.65886	-0.6059	10	0.59425	D	0.04	-28.7221	8.2856	0.31926	0.2457:0.0:0.7543:0.0	.	197	Q8NCN4	RN169_HUMAN	N	197	ENSP00000299563:K197N	ENSP00000299563:K197N	K	+	3	2	RNF169	74198891	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.693000	0.25497	0.409000	0.25649	-0.136000	0.14681	AAG			0.318	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384741.1		XM_495886	
CEP164	22897	mdanderson.org	37	11	117263830	117263830	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:117263830G>T	ENST00000278935.3	+	20	2751	c.2604G>T	c.(2602-2604)caG>caT	p.Q868H	CEP164_ENST00000533706.1_3'UTR	NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	868	Glu-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CCAGAGAGCAGTATGAAGCTG	0.562																																					p.Q871H													.	.			0			c.G2613T												195.0	135.0	155.0					11																	117263830		2201	4296	6497	SO:0001583	missense	22897	exon19			AGAGCAGTATGAA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.2604G>T	11.37:g.117263830G>T	ENSP00000278935:p.Gln868His		54	0	0		34	0.09	3	NM_001271933	15	0.00	0	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983144	0.53827	.	.	ENSG00000110274	ENST00000278935;ENST00000529538;ENST00000375253	T	0.42131	0.98	5.27	4.35	0.52113	.	0.295773	0.24810	N	0.035411	T	0.46483	0.1395	L	0.32530	0.975	0.31362	N	0.681211	D;D;D;D	0.60160	0.977;0.987;0.965;0.965	P;P;P;P	0.57911	0.62;0.829;0.729;0.729	T	0.54879	-0.8227	10	0.72032	D	0.01	-3.8882	10.9903	0.47545	0.0887:0.0:0.9113:0.0	.	842;642;868;871	E9PI34;Q9NTH6;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	H	868;842;749	ENSP00000278935:Q868H	ENSP00000278935:Q868H	Q	+	3	2	CEP164	116769040	1.000000	0.71417	0.961000	0.40146	0.757000	0.42996	2.039000	0.41193	1.199000	0.43173	0.655000	0.94253	CAG			0.562	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392893.1		NM_014956	
C11orf44	283171	mdanderson.org	37	11	130583145	130583145	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr11:130583145G>T	ENST00000317019.2	+	2	290	c.267G>T	c.(265-267)caG>caT	p.Q89H		NM_001271983.1	NP_001258912.1	Q8N8P7	CK044_HUMAN	chromosome 11 open reading frame 44	89						extracellular region (GO:0005576)				central_nervous_system(1)	1						gagagagccagtgtgggaggc	0.512																																					p.Q89H													.	.			0			c.G267T												40.0	45.0	44.0					11																	130583145		692	1591	2283	SO:0001583	missense	283171	exon2			GAGCCAGTGTGGG	AK096377	CCDS8489.1	11q24.3	2005-10-27			ENSG00000175728	ENSG00000175728			26805	protein-coding gene	gene with protein product							Standard	NM_001271983		Approved	FLJ39058	uc031qfg.1	Q8N8P7	OTTHUMG00000150705	ENST00000317019.2:c.267G>T	11.37:g.130583145G>T	ENSP00000326394:p.Gln89His		39	0	0		29	0.10	3	NM_001271983	0		0		Missense_Mutation	SNP	ENST00000317019.2	37		.	.	.	.	.	.	.	.	.	.	G	3.561	-0.089721	0.07053	.	.	ENSG00000175728	ENST00000317019	.	.	.	1.9	-1.79	0.07932	.	.	.	.	.	T	0.26991	0.0661	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35847	-0.9772	5	0.87932	D	0	.	0.8414	0.01151	0.1624:0.2302:0.3739:0.2335	.	.	.	.	H	89	.	ENSP00000326394:Q89H	Q	+	3	2	C11orf44	130088355	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.057000	0.14279	-0.430000	0.07318	0.549000	0.68633	CAG			0.512	C11orf44-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000319680.1		NM_173580	
FAM66C	440078	broad.mit.edu	37	12	8363889	8363890	+	RNA	DEL	AA	AA	-			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr12:8363889_8363890delAA	ENST00000454799.2	+	0	1821				FAM66C_ENST00000372173.5_RNA|RP11-266K4.1_ENST00000542600.1_RNA					family with sequence similarity 66, member C																		CATTTATATTAAGTTACAATTA	0.317																																					.													.	.			0			.																																											0	.			TATATTAAGTTAC			12p13.31	2013-07-05			ENSG00000226711	ENSG00000226711		"""Long non-coding RNAs"""	21644	non-coding RNA	RNA, long non-coding							Standard	NR_026788		Approved		uc001que.4		OTTHUMG00000168638		12.37:g.8363889_8363890delAA			9	0	0		17	0.29	5	.	0		0		RNA	DEL	ENST00000454799.2	37																																																																																						0.317	FAM66C-001	KNOWN	basic	antisense	antisense		OTTHUMT00000400453.1		NR_026788	
FAM66C	440078	broad.mit.edu	37	12	8363896	8363896	+	RNA	DEL	A	A	-			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr12:8363896delA	ENST00000454799.2	+	0	1821				FAM66C_ENST00000372173.5_RNA|RP11-266K4.1_ENST00000542600.1_RNA					family with sequence similarity 66, member C																		ATTAAGTTACAATTAATTAGG	0.313																																					.													.	.			0			.																																											0	.			AGTTACAATTAAT			12p13.31	2013-07-05			ENSG00000226711	ENSG00000226711		"""Long non-coding RNAs"""	21644	non-coding RNA	RNA, long non-coding							Standard	NR_026788		Approved		uc001que.4		OTTHUMG00000168638		12.37:g.8363896delA			7	0	0		16	0.31	5	.	0		0		RNA	DEL	ENST00000454799.2	37																																																																																						0.313	FAM66C-001	KNOWN	basic	antisense	antisense		OTTHUMT00000400453.1		NR_026788	
TUBA1A	7846	bcgsc.ca	37	12	49580192	49580192	+	Silent	SNP	A	A	G			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr12:49580192A>G	ENST00000295766.5	-	3	755	c.276T>C	c.(274-276)ctT>ctC	p.L92L	TUBA1A_ENST00000550767.1_Silent_p.L57L|TUBA1A_ENST00000301071.7_Silent_p.L92L|TUBA1A_ENST00000546918.1_Missense_Mutation_p.L143S	NM_001270399.1	NP_001257328.1	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	92					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			stomach(1)|upper_aerodigestive_tract(1)	2					Albendazole(DB00518)|Mebendazole(DB00643)|Vinblastine(DB00570)	TGCCTGTGATAAGTTGCTCAG	0.562																																					p.L92L	Pancreas(111;782 2307 24613 44561)|NSCLC(165;1667 2752 9496 39006)|Ovarian(19;24 776 10875 37451)												.	TUBA1A	32		0			c.T276C												116.0	119.0	118.0					12																	49580192		2203	4300	6503	SO:0001819	synonymous_variant	7846	exon3			TGTGATAAGTTGC	AF141347	CCDS8781.1, CCDS58226.1, CCDS58227.1	12q13.12	2007-02-07						"""Tubulins"""	20766	protein-coding gene	gene with protein product	"""tubulin, alpha, brain-specific"""	602529				11504633, 3839072	Standard	NM_006009		Approved	TUBA3, B-ALPHA-1, FLJ25113	uc010smg.1	Q71U36	OTTHUMG00000169511	ENST00000295766.5:c.276T>C	12.37:g.49580192A>G			185	0.0324324324	6		140	0.09	12	NM_001270399	756	0.01	5	A8K0B8|G3V1U9|P04687|P05209	Missense_Mutation	SNP	ENST00000295766.5	37	CCDS58227.1	.	.	.	.	.	.	.	.	.	.	G	7.820	0.717529	0.15372	.	.	ENSG00000167552	ENST00000546918	T	0.61859	0.07	5.22	3.26	0.37387	.	0.000000	0.64402	D	0.000005	T	0.56587	0.1995	.	.	.	0.29205	N	0.87495	.	.	.	.	.	.	T	0.57207	-0.7851	7	0.72032	D	0.01	.	7.1443	0.25575	0.152:0.264:0.584:0.0	.	.	.	.	S	143	ENSP00000446613:L143S	ENSP00000446613:L143S	L	-	2	0	TUBA1A	47866459	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	0.737000	0.26144	0.697000	0.31718	-0.215000	0.12644	TTA			0.562	TUBA1A-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000404547.2		NM_006009	
LRP1	4035	mdanderson.org	37	12	57588470	57588470	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr12:57588470G>T	ENST00000243077.3	+	50	8645	c.8179G>T	c.(8179-8181)Gag>Tag	p.E2727*	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2727	LDL-receptor class A 15. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGGCGAGGACGAGACCCACTG	0.592																																					p.E2727X													.	.			0			c.G8179T												67.0	60.0	62.0					12																	57588470		2203	4300	6503	SO:0001587	stop_gained	4035	exon50			GAGGACGAGACCC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8179G>T	12.37:g.57588470G>T	ENSP00000243077:p.Glu2727*		40	0	0		34	0.09	3	NM_002332	19	0.00	0	Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	ENST00000243077.3	37	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	g	52	19.452967	0.99919	.	.	ENSG00000123384	ENST00000243077	.	.	.	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.2421	0.87016	0.0:0.0:1.0:0.0	.	.	.	.	X	2727	.	ENSP00000243077:E2727X	E	+	1	0	LRP1	55874737	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	9.754000	0.98908	2.339000	0.79563	0.450000	0.29827	GAG			0.592	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000412772.2		NM_002332	
P2RX7	5027	bcgsc.ca;mdanderson.org	37	12	121605293	121605293	+	Silent	SNP	C	C	T	rs147505804		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr12:121605293C>T	ENST00000546057.1	+	8	890	c.747C>T	c.(745-747)ggC>ggT	p.G249G	P2RX7_ENST00000328963.5_Silent_p.G79G|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000535250.1_Silent_p.G159G|P2RX7_ENST00000541446.1_Intron|P2RX7_ENST00000377162.2_Intron	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	249					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TCCTTCAGGGCGGAATAATGG	0.512																																					p.G249G													.	P2RX7	53		0			c.C747T												197.0	150.0	166.0					12																	121605293		2203	4300	6503	SO:0001819	synonymous_variant	5027	exon8			TCAGGGCGGAATA	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.747C>T	12.37:g.121605293C>T			90	0	0		82	0.06	5	NM_002562	0		0	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Silent	SNP	ENST00000546057.1	37	CCDS9213.1																																																																																					0.512	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000402532.1		NM_002562	
LATS2	26524	mdanderson.org	37	13	21562308	21562308	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr13:21562308G>T	ENST00000382592.4	-	4	2016	c.1611C>A	c.(1609-1611)tgC>tgA	p.C537*	LATS2_ENST00000542899.1_Nonsense_Mutation_p.C537*|LATS2_ENST00000472754.1_5'Flank	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CCATGCCTGCGCACAGGCTGT	0.667																																					p.C537X													.	.			0			c.C1611A												54.0	56.0	55.0					13																	21562308		2203	4299	6502	SO:0001587	stop_gained	26524	exon4			GCCTGCGCACAGG	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.1611C>A	13.37:g.21562308G>T	ENSP00000372035:p.Cys537*		55	0	0		41	0.07	3	NM_014572	4	0.00	0		Nonsense_Mutation	SNP	ENST00000382592.4	37	CCDS9294.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.790209	0.90367	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	.	.	.	5.12	-8.65	0.00870	.	0.158559	0.45361	D	0.000365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	21.7824	0.99961	0.2076:0.0:0.7924:0.0	.	.	.	.	X	537	.	ENSP00000372035:C537X	C	-	3	2	LATS2	20460308	0.000000	0.05858	0.000000	0.03702	0.131000	0.20780	-1.645000	0.02000	-1.949000	0.01031	-0.492000	0.04666	TGC			0.667	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044102.1			
ABCC4	10257	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	13	95858899	95858899	+	Missense_Mutation	SNP	G	G	T	rs532299842	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr13:95858899G>T	ENST00000376887.4	-	8	1162	c.1048C>A	c.(1048-1050)Cgc>Agc	p.R350S	ABCC4_ENST00000431522.1_Missense_Mutation_p.R350S|ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000412704.1_Missense_Mutation_p.R350S|ABCC4_ENST00000536256.1_Missense_Mutation_p.R275S	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	350	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	ACGAACACGCGGCTGGCTGTG	0.542																																					p.R350S													.	.			0			c.C1048A												119.0	103.0	109.0					13																	95858899		2203	4300	6503	SO:0001583	missense	10257	exon8			ACACGCGGCTGGC	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1048C>A	13.37:g.95858899G>T	ENSP00000366084:p.Arg350Ser		106	0	0		94	0.32	30	NM_005845	11	0.45	5	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	37	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.821078	0.50633	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.88896	-2.44;-2.44;-2.44;-2.44	5.34	5.34	0.76211	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.491888	0.22640	N	0.057462	D	0.89213	0.6651	L	0.59436	1.845	0.43896	D	0.99652	B;B;B;B;B	0.18610	0.01;0.029;0.003;0.029;0.011	B;B;B;B;B	0.30782	0.048;0.12;0.017;0.075;0.047	D	0.86071	0.1538	10	0.54805	T	0.06	.	18.6246	0.91333	0.0:0.0:1.0:0.0	.	275;350;350;350;350	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	S	350;350;275;350	ENSP00000388657:R350S;ENSP00000366084:R350S;ENSP00000442024:R275S;ENSP00000398562:R350S	ENSP00000366084:R350S	R	-	1	0	ABCC4	94656900	1.000000	0.71417	0.950000	0.38849	0.057000	0.15508	3.759000	0.55227	2.471000	0.83476	0.655000	0.94253	CGC			0.542	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045478.2		NM_005845	
UPF3A	65110	mdanderson.org	37	13	115051797	115051797	+	Missense_Mutation	SNP	G	G	T	rs529401037		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr13:115051797G>T	ENST00000375299.3	+	4	498	c.442G>T	c.(442-444)Gta>Tta	p.V148L	UPF3A_ENST00000351487.5_Intron	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)	148					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		TCCTGCAGTGGTAGAGTTTGC	0.403																																					p.V148L													.	.			0			c.G442T												108.0	110.0	109.0					13																	115051797		2203	4300	6503	SO:0001583	missense	65110	exon4			GCAGTGGTAGAGT	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.442G>T	13.37:g.115051797G>T	ENSP00000364448:p.Val148Leu		119	0	0		75	0.05	4	NM_023011	17	0.00	0	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Missense_Mutation	SNP	ENST00000375299.3	37	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	G	32	5.137246	0.94517	.	.	ENSG00000169062	ENST00000375299	T	0.71103	-0.54	5.55	5.55	0.83447	Regulator of nonsense-mediated decay, UPF3 (1);Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.84056	0.5388	M	0.75085	2.285	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	D	0.83511	0.0080	9	.	.	.	-23.6783	19.5118	0.95144	0.0:0.0:1.0:0.0	.	148	Q9H1J1	REN3A_HUMAN	L	148	ENSP00000364448:V148L	.	V	+	1	0	UPF3A	114069899	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	8.953000	0.93041	2.616000	0.88540	0.561000	0.74099	GTA			0.403	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045968.2			
NPAS3	64067	mdanderson.org	37	14	34269689	34269689	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr14:34269689G>A	ENST00000356141.4	+	12	2176	c.2176G>A	c.(2176-2178)Gcc>Acc	p.A726T	NPAS3_ENST00000548645.1_Missense_Mutation_p.A696T|NPAS3_ENST00000357798.5_Missense_Mutation_p.A713T|NPAS3_ENST00000551492.1_Missense_Mutation_p.A731T|NPAS3_ENST00000346562.2_Missense_Mutation_p.A694T			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	726	Gly-rich.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		cggcgcggccgcccgcAAGAC	0.801																																					p.A726T													.	.			0			c.G2176A												1.0	2.0	2.0					14																	34269689		562	1388	1950	SO:0001583	missense	64067	exon12			GCGGCCGCCCGCA	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2176G>A	14.37:g.34269689G>A	ENSP00000348460:p.Ala726Thr		32	0	0		39	0.08	3	NM_001164749	0		0	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	37	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	1.817	-0.473212	0.04445	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.06528	3.55;3.42;3.43;3.43;3.42;3.29	4.42	-3.03	0.05429	.	0.577020	0.17160	N	0.184725	T	0.03095	0.0091	N	0.19112	0.55	0.38544	D	0.949289	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	T	0.46359	-0.9197	10	0.20046	T	0.44	.	6.0724	0.19897	0.5509:0.0:0.3213:0.1278	.	696;726;694;713	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	T	700;731;694;696;726;713	ENSP00000448373:A700T;ENSP00000450392:A731T;ENSP00000319610:A694T;ENSP00000448916:A696T;ENSP00000348460:A726T;ENSP00000350446:A713T	ENSP00000319610:A694T	A	+	1	0	NPAS3	33339440	0.830000	0.29337	0.024000	0.17045	0.837000	0.47467	1.160000	0.31761	-0.478000	0.06823	-0.263000	0.10527	GCC			0.801	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000276645.1			
GPR135	64582	mdanderson.org	37	14	59930940	59930940	+	Silent	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr14:59930940G>T	ENST00000395116.1	-	1	1120	c.1005C>A	c.(1003-1005)atC>atA	p.I335I		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	335						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		AGACGATCATGATGAGGACGG	0.692																																					p.I335I													.	.			0			c.C1005A												22.0	23.0	23.0					14																	59930940		2197	4291	6488	SO:0001819	synonymous_variant	64582	exon1			GATCATGATGAGG	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1005C>A	14.37:g.59930940G>T			28	0	0		32	0.09	3	NM_022571	0		0	Q7Z604|Q86SM3|Q8NH39	Silent	SNP	ENST00000395116.1	37	CCDS9738.1	.	.	.	.	.	.	.	.	.	.	g	10.19	1.282638	0.23392	.	.	ENSG00000181619	ENST00000539022	.	.	.	4.31	3.42	0.39159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-7.3025	12.1489	0.54038	0.0836:0.0:0.9164:0.0	.	.	.	.	X	322	.	ENSP00000444314:S322X	S	-	2	0	GPR135	59000693	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	3.649000	0.54417	1.034000	0.39945	0.558000	0.71614	TCA			0.692	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276941.1		NM_022571	
UBR1	197131	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	43335557	43335557	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr15:43335557T>C	ENST00000290650.4	-	15	1783	c.1705A>G	c.(1705-1707)Aaa>Gaa	p.K569E	UBR1_ENST00000382177.2_Missense_Mutation_p.K569E	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	569					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATCACAGCTTTGTGACATTCT	0.348																																					p.K569E													.	.			0			c.A1705G												141.0	126.0	131.0					15																	43335557		2203	4299	6502	SO:0001583	missense	197131	exon15			CAGCTTTGTGACA		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.1705A>G	15.37:g.43335557T>C	ENSP00000290650:p.Lys569Glu		155	0	0		170	0.19	33	NM_174916	6	0.17	1	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	37	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	T	9.444	1.088776	0.20390	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.52295	0.67;0.67	4.21	3.05	0.35203	.	0.444283	0.25267	N	0.031905	T	0.20373	0.0490	N	0.11064	0.09	0.39435	D	0.967148	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.10405	-1.0631	10	0.08179	T	0.78	-22.3478	4.4294	0.11520	0.0:0.1634:0.1879:0.6487	.	569;569	B4DYL2;Q8IWV7	.;UBR1_HUMAN	E	569	ENSP00000290650:K569E;ENSP00000371612:K569E	ENSP00000290650:K569E	K	-	1	0	UBR1	41122849	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.358000	0.44134	1.776000	0.52262	0.254000	0.18369	AAA			0.348	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253202.1		NM_174916	
MYH11	4629	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	16	15869978	15869978	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr16:15869978G>T	ENST00000300036.5	-	8	955	c.846C>A	c.(844-846)caC>caA	p.H282Q	MYH11_ENST00000576790.2_Missense_Mutation_p.H282Q|MYH11_ENST00000396324.3_Missense_Mutation_p.H289Q|MYH11_ENST00000452625.2_Missense_Mutation_p.H289Q	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	282	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						AGTAAAAGATGTGGAATGTCC	0.473			T	CBFB	AML																																p.H289Q				Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	.	.			0			c.C867A												336.0	299.0	312.0					16																	15869978		2197	4300	6497	SO:0001583	missense	4629	exon9			AAAGATGTGGAAT	X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.846C>A	16.37:g.15869978G>T	ENSP00000300036:p.His282Gln		146	0	0		96	0.05	5	NM_001040114	14	0.00	0	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Missense_Mutation	SNP	ENST00000300036.5	37	CCDS10565.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.256780	0.80246	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	D;D;D;D	0.92199	-2.99;-2.99;-2.99;-2.99	5.91	4.95	0.65309	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.98105	0.9375	H	0.99949	5.025	0.80722	D	1	P;D;D;D;D	0.61697	0.944;0.99;0.99;0.99;0.99	D;D;D;D;D	0.83275	0.996;0.994;0.994;0.994;0.994	D	0.97727	1.0200	10	0.87932	D	0	.	11.7139	0.51641	0.1349:0.0:0.8651:0.0	.	289;282;289;282;289	B1PS43;P35749;Q3MNF1;Q3MIV8;Q3MNF0	.;MYH11_HUMAN;.;.;.	Q	282;282;289;289;289	ENSP00000300036:H282Q;ENSP00000345136:H282Q;ENSP00000379616:H289Q;ENSP00000407821:H289Q	ENSP00000300036:H282Q	H	-	3	2	MYH11	15777479	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.966000	0.40481	2.804000	0.96469	0.462000	0.41574	CAC			0.473	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252192.2		NM_001040113	
TCF25	22980	mdanderson.org	37	16	89965261	89965261	+	Missense_Mutation	SNP	G	G	A	rs139981645		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr16:89965261G>A	ENST00000263346.8	+	11	1258	c.1202G>A	c.(1201-1203)cGc>cAc	p.R401H	TCF25_ENST00000263347.7_Missense_Mutation_p.R166H	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	401					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		TACCTGATCCGCCTCTTCCAG	0.632																																					p.R401H													.	.			0			c.G1202A							G	HIS/ARG	1,4395	2.1+/-5.4	0,1,2197	47.0	46.0	46.0		1202	2.6	1.0	16	dbSNP_134	46	1,8599	1.2+/-3.3	0,1,4299	yes	missense	TCF25	NM_014972.2	29	0,2,6496	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	401/677	89965261	2,12994	2198	4300	6498	SO:0001583	missense	22980	exon11			TGATCCGCCTCTT	AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1202G>A	16.37:g.89965261G>A	ENSP00000263346:p.Arg401His		41	0	0		39	0.08	3	NM_014972	105	0.00	0	Q2MK75|Q9UPV3	Missense_Mutation	SNP	ENST00000263346.8	37	CCDS10987.1	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217809	0.58560	2.27E-4	1.16E-4	ENSG00000141002	ENST00000263346;ENST00000263347	.	.	.	5.63	2.64	0.31445	.	0.209281	0.51477	N	0.000082	T	0.50599	0.1625	M	0.64676	1.99	0.50039	D	0.999849	P;B	0.35612	0.512;0.275	B;B	0.31614	0.133;0.126	T	0.51387	-0.8712	9	0.87932	D	0	.	10.3222	0.43773	0.2053:0.0:0.7947:0.0	.	166;401	Q9H384;Q9BQ70	.;TCF25_HUMAN	H	401;166	.	ENSP00000263346:R401H	R	+	2	0	TCF25	88492762	0.997000	0.39634	1.000000	0.80357	0.975000	0.68041	1.419000	0.34793	0.337000	0.23665	-0.258000	0.10820	CGC	0		0.632	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000272875.2		NM_014972	
UBBP4	23666	broad.mit.edu	37	17	21731270	21731270	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:21731270T>C	ENST00000584755.1	+	2	969	c.572T>C	c.(571-573)aTc>aCc	p.I191T	UBBP4_ENST00000578713.1_Intron|UBBP4_ENST00000583708.1_3'UTR					ubiquitin B pseudogene 4									p.I191T(3)		endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						ATCCCCCCGATCAGCAGAGGC	0.547																																					.													UBBP4_ENST00000584755,bladder,carcinoma,0,6	.		6	3	Substitution - Missense(3)	kidney(2)|endometrium(1)	.																																									SO:0001583	missense	0	.			CCCCGATCAGCAG	X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000584755.1:c.572T>C	17.37:g.21731270T>C	ENSP00000463647:p.Ile191Thr		125	0.008	1		124	0.02	3	.	0		0		Missense_Mutation	SNP	ENST00000584755.1	37																																																																																						0.547	UBBP4-001	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000444585.1			
FLJ36000	284124	broad.mit.edu	37	17	21906899	21906899	+	lincRNA	DEL	C	C	-	rs146413441		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:21906899delC	ENST00000581223.2	+	0	148					NR_027084.1																						GTGGACCGGTCTTTGGTGAGC	0.552																																					.													.	.			0			.																																											0	.			ACCGGTCTTTGGT																													17.37:g.21906899delC			29	0	0		12	0.17	2	.	0		0		RNA	DEL	ENST00000581223.2	37																																																																																						0.552	RP11-744K17.9-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000451067.1			
SPAG5	10615	mdanderson.org	37	17	26905514	26905514	+	Silent	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:26905514G>T	ENST00000321765.5	-	21	3563	c.3231C>A	c.(3229-3231)cgC>cgA	p.R1077R	ALDOC_ENST00000395319.3_5'Flank|ALDOC_ENST00000395321.2_5'Flank|ALDOC_ENST00000226253.4_5'Flank	NM_006461.3	NP_006452.3	Q96R06	SPAG5_HUMAN	sperm associated antigen 5	1077					chromosome segregation (GO:0007059)|mitotic sister chromatid segregation (GO:0000070)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|spindle organization (GO:0007051)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|microtubule plus-end (GO:0035371)|mitotic spindle (GO:0072686)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43	Lung NSC(42;0.00431)					GCCGAAGTGAGCGGGTAAGGT	0.552																																					p.R1077R													.	.			0			c.C3231A												72.0	74.0	73.0					17																	26905514		2203	4300	6503	SO:0001819	synonymous_variant	10615	exon21			AAGTGAGCGGGTA	AF063308	CCDS32594.1	17q11.2	2008-07-18			ENSG00000076382	ENSG00000076382			13452	protein-coding gene	gene with protein product	"""mitotic spindle coiled-coil related protein"", ""astrin"", ""mitotic spindle associated protein p126"""	615562				11549262	Standard	NM_006461		Approved	DEEPEST, MAP126, hMAP126	uc002hbq.3	Q96R06	OTTHUMG00000166586	ENST00000321765.5:c.3231C>A	17.37:g.26905514G>T			47	0	0		42	0.07	3	NM_006461	142	0.01	1	O95213|Q9BWE8|Q9NT17|Q9UFE6	Silent	SNP	ENST00000321765.5	37	CCDS32594.1																																																																																					0.552	SPAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390564.2		NM_006461	
ZPBP2	124626	mdanderson.org	37	17	38028693	38028693	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:38028693G>T	ENST00000348931.4	+	5	768	c.577G>T	c.(577-579)Gaa>Taa	p.E193*	ZPBP2_ENST00000377940.3_Nonsense_Mutation_p.E171*|ZPBP2_ENST00000584588.1_Intron	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2	193					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCATTCTGTTGAAATTCCAGA	0.308																																					p.E193X													ZPBP2,NS,carcinoma,0,1	ZPBP2	0	1	0			c.G577T												71.0	65.0	67.0					17																	38028693		2202	4299	6501	SO:0001587	stop_gained	124626	exon5			TCTGTTGAAATTC	BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.577G>T	17.37:g.38028693G>T	ENSP00000335384:p.Glu193*		102	0	0		91	0.05	5	NM_199321	0		0	A8K8L8|Q6X783|Q86XL5	Nonsense_Mutation	SNP	ENST00000348931.4	37	CCDS11352.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391318	0.62066	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	.	.	.	5.48	1.81	0.25067	.	0.549745	0.18832	N	0.129956	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.8867	7.9074	0.29769	0.6404:0.0:0.3596:0.0	.	.	.	.	X	193;171	.	ENSP00000335384:E193X	E	+	1	0	ZPBP2	35282219	1.000000	0.71417	0.987000	0.45799	0.637000	0.38172	1.612000	0.36889	0.367000	0.24454	0.460000	0.39030	GAA			0.308	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256609.2		NM_198844	
CASC3	22794	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	38318013	38318013	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:38318013A>G	ENST00000264645.7	+	4	531	c.305A>G	c.(304-306)gAa>gGa	p.E102G		NM_007359.4	NP_031385.2	O15234	CASC3_HUMAN	cancer susceptibility candidate 3	102					gene expression (GO:0010467)|intracellular mRNA localization (GO:0008298)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translation (GO:0006417)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(2)	16						CAGGGTGAAGAAGGTGAATAC	0.423																																					p.E102G													CASC3,NS,carcinoma,+1,1	CASC3	1	1	0			c.A305G												78.0	80.0	80.0					17																	38318013		2203	4299	6502	SO:0001583	missense	22794	exon4			GTGAAGAAGGTGA	X80199	CCDS11362.1	17q21.1	2012-09-20			ENSG00000108349	ENSG00000108349			17040	protein-coding gene	gene with protein product		606504				7490069, 18332872	Standard	NM_007359		Approved	MLN51, BTZ	uc002hue.3	O15234	OTTHUMG00000133323	ENST00000264645.7:c.305A>G	17.37:g.38318013A>G	ENSP00000264645:p.Glu102Gly		164	0	0		141	0.19	27	NM_007359	56	0.34	19	A8K8R0	Missense_Mutation	SNP	ENST00000264645.7	37	CCDS11362.1	.	.	.	.	.	.	.	.	.	.	A	14.94	2.686409	0.47991	.	.	ENSG00000108349	ENST00000264645;ENST00000418132;ENST00000394114	.	.	.	5.89	4.8	0.61643	.	0.207411	0.47852	D	0.000202	T	0.42787	0.1218	L	0.29908	0.895	0.53688	D	0.999979	B;B	0.31383	0.321;0.058	B;B	0.26770	0.073;0.033	T	0.25572	-1.0128	9	0.33141	T	0.24	-4.3206	11.461	0.50211	0.8647:0.0:0.0:0.1353	.	102;102	B4DKR6;O15234	.;CASC3_HUMAN	G	102	.	ENSP00000264645:E102G	E	+	2	0	CASC3	35571539	1.000000	0.71417	0.997000	0.53966	0.843000	0.47879	4.269000	0.58890	1.018000	0.39521	0.491000	0.48974	GAA			0.423	CASC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257127.3		NM_007359	
LRRC37A4P	55073	broad.mit.edu	37	17	43591984	43591985	+	RNA	INS	-	-	G	rs368999726		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:43591984_43591985insG	ENST00000579913.1	-	0	537_538				RP11-798G7.5_ENST00000253803.2_RNA	NR_002940.2				leucine rich repeat containing 37, member A4, pseudogene																		GTGGGTCATGCGGAGCGAGTTT	0.411																																					.													.	.			0			.																																											0	.			GTCATGCGGAGCG	AK000982		17q21.31	2014-04-01	2012-03-07	2012-03-07	ENSG00000214425	ENSG00000214425			25479	pseudogene	pseudogene			"""leucine rich repeat containing 37, member A4 (pseudogene)"""	LRRC37A4			Standard	NR_002940		Approved	FLJ10120	uc031rhd.1		OTTHUMG00000179212		17.37:g.43591986_43591986dupG			41	0.0243902439	1		40	0.08	3	.	3	0.00	0		RNA	INS	ENST00000579913.1	37																																																																																						0.411	LRRC37A4P-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000445300.1		NR_002940	
KCNH6	81033	hgsc.bcm.edu	37	17	61622539	61622539	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr17:61622539T>C	ENST00000583023.1	+	13	2616	c.2605T>C	c.(2605-2607)Tcc>Ccc	p.S869P	KCNH6_ENST00000314672.5_Missense_Mutation_p.S833P|KCNH6_ENST00000456941.2_Missense_Mutation_p.S780P|KCNH6_ENST00000581784.1_Missense_Mutation_p.S780P	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	869					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	AGCCCCTGCCTCCAATGACCT	0.642																																					p.S869P													.	.			0			c.T2605C												71.0	70.0	70.0					17																	61622539		2203	4300	6503	SO:0001583	missense	81033	exon13			CCTGCCTCCAATG	AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.2605T>C	17.37:g.61622539T>C	ENSP00000463533:p.Ser869Pro		67	0	0		99	0.05	5	NM_030779	9	0.00	0	Q9BRD7	Missense_Mutation	SNP	ENST00000583023.1	37	CCDS11638.1	.	.	.	.	.	.	.	.	.	.	T	6.062	0.379825	0.11466	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D	0.99338	-5.76	5.55	0.917	0.19380	.	0.673240	0.13977	N	0.349792	D	0.97864	0.9298	L	0.34521	1.04	0.09310	N	1	B;D;B;B	0.67145	0.016;0.996;0.005;0.167	B;P;B;B	0.56216	0.01;0.794;0.004;0.063	D	0.94855	0.8017	10	0.32370	T	0.25	.	5.6206	0.17455	0.0:0.2142:0.1444:0.6414	.	710;833;780;869	B4DPJ3;B4DKC0;Q9H252-2;Q9H252	.;.;.;KCNH6_HUMAN	P	869;780	ENSP00000396900:S780P	ENSP00000318212:S869P	S	+	1	0	KCNH6	58976271	0.006000	0.16342	0.004000	0.12327	0.008000	0.06430	-0.013000	0.12678	-0.031000	0.13781	-0.331000	0.08364	TCC			0.642	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000443853.1		NM_030779	
TMEM259	91304	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	1014364	1014364	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:1014364G>A	ENST00000356663.3	-	2	455	c.334C>T	c.(334-336)Cgt>Tgt	p.R112C	TMEM259_ENST00000333175.5_Missense_Mutation_p.R112C	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259	112						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											ACTTCCACACGCAGGATGCCC	0.657																																					p.R112C													.	.			0			c.C334T												39.0	38.0	38.0					19																	1014364		2200	4299	6499	SO:0001583	missense	91304	exon2			CCACACGCAGGAT	BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3		ENST00000356663.3:c.334C>T	19.37:g.1014364G>A	ENSP00000349087:p.Arg112Cys		308	0	0		216	0.24	51	NM_033420	146	0.21	30	O60392|Q8NF79|Q96H30	Missense_Mutation	SNP	ENST00000356663.3	37	CCDS32862.1	.	.	.	.	.	.	.	.	.	.	G	16.15	3.042694	0.55003	.	.	ENSG00000182087	ENST00000356663;ENST00000333175	.	.	.	4.19	4.19	0.49359	.	0.067371	0.64402	D	0.000013	T	0.79088	0.4387	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.82402	-0.0475	9	0.87932	D	0	-14.0215	12.5147	0.56026	0.0:0.0:0.8329:0.1671	.	112;112	Q4ZIN3-2;Q4ZIN3	.;MBRL_HUMAN	C	112	.	ENSP00000331423:R112C	R	-	1	0	C19orf6	965364	1.000000	0.71417	0.714000	0.30535	0.170000	0.22686	3.183000	0.50918	2.182000	0.69389	0.561000	0.74099	CGT			0.657	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458236.1		NM_033420	
PRKCSH	5589	mdanderson.org	37	19	11546995	11546995	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:11546995G>T	ENST00000589838.1	+	1	57	c.57G>T	c.(55-57)agG>agT	p.R19S	CCDC151_ENST00000586836.1_5'Flank|PRKCSH_ENST00000591462.1_Missense_Mutation_p.R19S|CCDC151_ENST00000545100.1_5'Flank|PRKCSH_ENST00000252455.2_Missense_Mutation_p.R19S|CCDC151_ENST00000356392.4_5'Flank|PRKCSH_ENST00000592741.1_Missense_Mutation_p.R19S|PRKCSH_ENST00000412601.1_Missense_Mutation_p.R19S|CCDC151_ENST00000591179.1_5'Flank|PRKCSH_ENST00000587327.1_Missense_Mutation_p.R19S			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	19					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						AGGTCAAGAGGCCCCGGGGCG	0.632											OREG0025257	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R19S													.	.			0			c.G57T												36.0	31.0	32.0					19																	11546995		2200	4295	6495	SO:0001583	missense	5589	exon2			CAAGAGGCCCCGG		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.57G>T	19.37:g.11546995G>T	ENSP00000465461:p.Arg19Ser		33	0	0	673	43	0.07	3	NM_001001329	382	0.00	1	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	37	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555693	0.65425	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.71341	-0.56;-0.56	5.46	-3.46	0.04767	.	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	M	0.71296	2.17	0.47862	D	0.999531	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.81914	0.995;0.978;0.995	T	0.74278	-0.3717	10	0.59425	D	0.04	-33.4024	7.7898	0.29114	0.5085:0.1081:0.3834:0.0	.	19;19;19	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	S	19	ENSP00000252455:R19S;ENSP00000395616:R19S	ENSP00000252455:R19S	R	+	3	2	PRKCSH	11407995	0.494000	0.26043	0.746000	0.31095	0.538000	0.34931	-0.497000	0.06428	-0.519000	0.06444	0.561000	0.74099	AGG			0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000458817.1			
CAPNS1	826	bcgsc.ca	37	19	36632054	36632054	+	Silent	SNP	C	C	T	rs17879825		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:36632054C>T	ENST00000246533.3	+	2	739	c.141C>T	c.(139-141)ggC>ggT	p.G47G	CAPNS1_ENST00000587718.1_Silent_p.G47G|AD001527.7_ENST00000604228.1_RNA|CAPNS1_ENST00000588815.1_Silent_p.G47G|CAPNS1_ENST00000588780.1_Silent_p.G47G|CAPNS1_ENST00000589146.1_Intron|CAPNS1_ENST00000590874.1_Silent_p.G47G	NM_001003962.1|NM_001749.2	NP_001003962.1|NP_001740.1	P04632	CPNS1_HUMAN	calpain, small subunit 1	47	Gly-rich (hydrophobic).|Poly-Gly.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			cervix(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gcggcggcggcggtggtggag	0.761																																					p.G47G	Esophageal Squamous(129;1541 1691 5780 18353 34150)												.	CAPNS1	19		0			c.C141T																																									SO:0001819	synonymous_variant	826	exon2			CGGCGGCGGTGGT	X04106	CCDS12489.1	19q13.1	2013-01-10		2001-08-10	ENSG00000126247	ENSG00000126247	3.4.22.52	"""EF-hand domain containing"""	1481	protein-coding gene	gene with protein product		114170		CAPN4		3024120, 3016651	Standard	NM_001003962		Approved	CANP, CANPS, 30K, CDPS	uc002odj.3	P04632		ENST00000246533.3:c.141C>T	19.37:g.36632054C>T			150	0.0266666667	4		118	0.07	8	NM_001749	0		0	A8K0P1|Q8WTX3|Q96EW0	Silent	SNP	ENST00000246533.3	37	CCDS12489.1																																																																																					0.761	CAPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457411.2			
DMRTC2	63946	mdanderson.org	37	19	42352958	42352958	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:42352958G>A	ENST00000269945.3	+	5	594	c.543G>A	c.(541-543)tgG>tgA	p.W181*	DMRTC2_ENST00000596827.1_Nonsense_Mutation_p.W181*	NM_001040283.1	NP_001035373.1	Q8IXT2	DMRTD_HUMAN	DMRT-like family C2	181	Pro-rich.				male meiosis I (GO:0007141)|positive regulation of histone H3-K9 dimethylation (GO:1900111)|positive regulation of histone H3-K9 trimethylation (GO:1900114)|sex differentiation (GO:0007548)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|XY body (GO:0001741)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	10						CTGGACACTGGCTGCCTCCAG	0.622																																					p.W181X													.	.			0			c.G543A												73.0	77.0	76.0					19																	42352958		2203	4300	6503	SO:0001587	stop_gained	63946	exon5			ACACTGGCTGCCT	AJ291669	CCDS33034.1	19q13.2	2008-07-16				ENSG00000142025			13911	protein-coding gene	gene with protein product		614806				11863363	Standard	NM_001040283		Approved		uc002ors.3	Q8IXT2		ENST00000269945.3:c.543G>A	19.37:g.42352958G>A	ENSP00000269945:p.Trp181*		63	0	0		47	0.06	3	NM_001040283	0		0	Q8N6Q2|Q96M39|Q96SD4	Nonsense_Mutation	SNP	ENST00000269945.3	37	CCDS33034.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858130	0.91433	.	.	ENSG00000142025	ENST00000269945	.	.	.	5.29	4.22	0.49857	.	0.135440	0.34853	N	0.003628	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-6.6995	11.9314	0.52849	0.0:0.1757:0.8243:0.0	.	.	.	.	X	181	.	ENSP00000269945:W181X	W	+	3	0	DMRTC2	47044798	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	4.311000	0.59147	1.321000	0.45227	0.561000	0.74099	TGG			0.622	DMRTC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463045.1		NM_001040283	
MEGF8	1954	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	42874860	42874860	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:42874860A>T	ENST00000251268.6	+	40	7013	c.7013A>T	c.(7012-7014)aAc>aTc	p.N2338I	MEGF8_ENST00000334370.4_Missense_Mutation_p.N2271I|MEGF8_ENST00000378073.4_5'UTR	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2338					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CAGATTGAAAACTGGGTGACA	0.572																																					p.N2338I													.	.			0			c.A7013T												63.0	55.0	58.0					19																	42874860		2202	4298	6500	SO:0001583	missense	1954	exon40			TTGAAAACTGGGT	AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7013A>T	19.37:g.42874860A>T	ENSP00000251268:p.Asn2338Ile		97	0	0		84	0.25	21	NM_001271938	9	0.33	3	A8KAY0|O75097	Missense_Mutation	SNP	ENST00000251268.6	37		.	.	.	.	.	.	.	.	.	.	A	13.22	2.171349	0.38315	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.21031	2.03;2.03	4.21	3.16	0.36331	.	0.553646	0.18723	N	0.132942	T	0.12220	0.0297	N	0.19112	0.55	0.80722	D	1	B;B	0.21688	0.059;0.005	B;B	0.21546	0.035;0.008	T	0.09509	-1.0671	10	0.39692	T	0.17	-10.9879	5.9354	0.19163	0.663:0.1777:0.0:0.1593	.	2338;2271	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	I	2271;2338	ENSP00000334219:N2271I;ENSP00000251268:N2338I	ENSP00000251268:N2338I	N	+	2	0	MEGF8	47566700	0.000000	0.05858	1.000000	0.80357	0.994000	0.84299	0.454000	0.21827	0.931000	0.37242	0.459000	0.35465	AAC			0.572	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000463854.1		NM_001410	
DHX34	9704	mdanderson.org	37	19	47876120	47876120	+	Silent	SNP	G	G	A	rs529993771		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:47876120G>A	ENST00000328771.4	+	8	2251	c.1902G>A	c.(1900-1902)ccG>ccA	p.P634P		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	634					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CACGGCGGCCGCTGGAGAGCG	0.677																																					p.P634P													.	.			0			c.G1902A												33.0	33.0	33.0					19																	47876120		2203	4300	6503	SO:0001819	synonymous_variant	9704	exon8			GCGGCCGCTGGAG	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1902G>A	19.37:g.47876120G>A			50	0	0		42	0.07	3	NM_014681	23	0.00	0	B4DMY8	Silent	SNP	ENST00000328771.4	37	CCDS12700.1																																																																																					0.677	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000314313.3		NM_014681	
GLTSCR2	29997	mdanderson.org	37	19	48258024	48258024	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:48258024A>G	ENST00000246802.5	+	8	967	c.929A>G	c.(928-930)gAg>gGg	p.E310G	CTD-2571L23.6_ENST00000602048.1_RNA|GLTSCR2_ENST00000598681.1_3'UTR|SNORD23_ENST00000408876.1_RNA	NM_015710.4	NP_056525.2	Q9NZM5	GSCR2_HUMAN	glioma tumor suppressor candidate region gene 2	310						intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	15		all_cancers(25;1.47e-06)|all_lung(116;6.89e-05)|all_epithelial(76;0.000108)|Lung NSC(112;0.000117)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000301)|OV - Ovarian serous cystadenocarcinoma(262;0.00031)|Epithelial(262;0.0149)|GBM - Glioblastoma multiforme(486;0.0278)		GGTGAGGGGGAGCCAGGCCAG	0.716																																					p.E310G	Colon(58;613 1041 9473 10089 15241)												.	.			0			c.A929G												9.0	14.0	13.0					19																	48258024		2049	4057	6106	SO:0001583	missense	29997	exon8			AGGGGGAGCCAGG	AF182076	CCDS12705.1	19q13.3	2014-01-20				ENSG00000105373			4333	protein-coding gene	gene with protein product		605691				10708517, 16971513, 17657248	Standard	NM_015710		Approved	PICT-1	uc002phm.2	Q9NZM5		ENST00000246802.5:c.929A>G	19.37:g.48258024A>G	ENSP00000246802:p.Glu310Gly		35	0	0		23	0.13	3	NM_015710	1334	0.00	1	Q9BTC6|Q9HAX6|Q9NPP1|Q9NPR4|Q9UFI2	Missense_Mutation	SNP	ENST00000246802.5	37	CCDS12705.1	.	.	.	.	.	.	.	.	.	.	A	16.52	3.145481	0.57044	.	.	ENSG00000105373	ENST00000246802;ENST00000325566	T	0.50277	0.75	3.63	2.57	0.30868	.	0.328592	0.27375	N	0.019657	T	0.55561	0.1928	M	0.62723	1.935	0.30544	N	0.766194	D;D;D	0.61080	0.98;0.98;0.989	P;P;P	0.62435	0.831;0.861;0.902	T	0.54370	-0.8304	10	0.37606	T	0.19	-15.632	5.9924	0.19474	0.8733:0.0:0.1267:0.0	.	310;310;308	Q53YP0;Q9NZM5;Q96CS0	.;GSCR2_HUMAN;.	G	310	ENSP00000246802:E310G	ENSP00000246802:E310G	E	+	2	0	GLTSCR2	52949836	0.723000	0.28027	0.102000	0.21198	0.345000	0.29048	1.826000	0.39092	0.514000	0.28300	0.338000	0.21704	GAG			0.716	GLTSCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464870.1		NM_015710	
SHANK1	50944	mdanderson.org	37	19	51171612	51171612	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:51171612G>T	ENST00000293441.1	-	22	3623	c.3605C>A	c.(3604-3606)cCg>cAg	p.P1202Q	SHANK1_ENST00000391814.1_Missense_Mutation_p.P1210Q|SYT3_ENST00000544769.1_5'UTR|SHANK1_ENST00000359082.3_Missense_Mutation_p.P1193Q|SHANK1_ENST00000391813.1_Missense_Mutation_p.P589Q	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1202					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		tgacatggccggggcggggct	0.816																																					p.P1202Q													.	.			0			c.C3605A												2.0	3.0	3.0					19																	51171612		399	1003	1402	SO:0001583	missense	50944	exon22			ATGGCCGGGGCGG	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.3605C>A	19.37:g.51171612G>T	ENSP00000293441:p.Pro1202Gln		13	0	0		13	0.15	2	NM_016148	0		0	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	37	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	g	7.281	0.609061	0.14066	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.40756	1.14;1.65;1.05;1.02	1.5	1.5	0.22942	.	0.204155	0.30602	U	0.009278	T	0.43500	0.1250	L	0.36672	1.1	0.27403	N	0.954791	D;D	0.64830	0.989;0.994	P;D	0.66716	0.884;0.946	T	0.23691	-1.0181	10	0.20519	T	0.43	.	6.3769	0.21513	0.0:0.0:1.0:0.0	.	1202;589	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Q	1202;589;1193;1210	ENSP00000293441:P1202Q;ENSP00000375689:P589Q;ENSP00000351984:P1193Q;ENSP00000375690:P1210Q	ENSP00000293441:P1202Q	P	-	2	0	SHANK1	55863424	1.000000	0.71417	0.987000	0.45799	0.348000	0.29142	2.035000	0.41155	0.819000	0.34492	0.165000	0.16767	CCG			0.816	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268071.1		NM_016148	
SIGLECL1	284369	mdanderson.org	37	19	51768757	51768757	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr19:51768757G>A	ENST00000316401.7	+	3	539	c.158G>A	c.(157-159)gGc>gAc	p.G53D	CTD-3187F8.2_ENST00000597569.1_RNA|SIGLECL1_ENST00000597824.1_Intron|SIGLECL1_ENST00000593968.1_Intron	NM_173635.1	NP_775906.1	Q96PQ1	SIG12_HUMAN	SIGLEC family like 1	416	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)										GGCATGGATGGCAGCCTCCAA	0.577																																					p.G53D													.	.			0			c.G158A												61.0	54.0	56.0					19																	51768757		2203	4300	6503	SO:0001583	missense	284369	exon3			TGGATGGCAGCCT	AK097554	CCDS12827.1	19q13.33	2013-03-20	2012-07-20	2012-07-20	ENSG00000179213	ENSG00000179213			26856	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 75"", ""sialic acid binding Ig-like lectin 23, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 7"""	C19orf75, SIGLEC23P, SIGLECP7			Standard	NM_173635		Approved	FLJ40235	uc002pwb.1	Q8N7X8	OTTHUMG00000182881	ENST00000316401.7:c.158G>A	19.37:g.51768757G>A	ENSP00000321249:p.Gly53Asp		146	0	0		101	0.05	5	NM_173635	0		0	Q8IYH7	Missense_Mutation	SNP	ENST00000316401.7	37	CCDS12827.1	.	.	.	.	.	.	.	.	.	.	G	0.340	-0.950805	0.02285	.	.	ENSG00000179213	ENST00000316401	T	0.41758	0.99	3.63	-2.27	0.06846	Immunoglobulin-like fold (1);	1.679820	0.03729	N	0.253140	T	0.21718	0.0523	N	0.13235	0.315	0.09310	N	1	B	0.18461	0.028	B	0.17433	0.018	T	0.24368	-1.0162	10	0.02654	T	1	-7.8328	7.6042	0.28093	0.6459:0.0:0.3541:0.0	.	53	Q8N7X8	CS075_HUMAN	D	53	ENSP00000321249:G53D	ENSP00000321249:G53D	G	+	2	0	C19orf75	56460569	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.177000	0.09796	-0.292000	0.08999	-0.142000	0.14014	GGC			0.577	SIGLECL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464161.2		NM_173635	
NBAS	51594	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	15557681	15557681	+	Silent	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr2:15557681G>A	ENST00000281513.5	-	24	2758	c.2733C>T	c.(2731-2733)gaC>gaT	p.D911D	NBAS_ENST00000441750.1_Intron	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	911					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						GTTTTTCAATGTCTTTCATCT	0.333																																					p.D911D													.	.			0			c.C2733T												82.0	75.0	77.0					2																	15557681		2203	4300	6503	SO:0001819	synonymous_variant	51594	exon24			TTCAATGTCTTTC	BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.2733C>T	2.37:g.15557681G>A			262	0	0		260	0.23	59	NM_015909	15	0.13	2	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Silent	SNP	ENST00000281513.5	37	CCDS1685.1	.	.	.	.	.	.	.	.	.	.	G	8.531	0.871029	0.17322	.	.	ENSG00000151779	ENST00000429842	.	.	.	5.72	1.9	0.25705	.	.	.	.	.	T	0.54886	0.1886	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45498	-0.9257	4	.	.	.	.	7.3035	0.26434	0.1931:0.0:0.6881:0.1188	.	.	.	.	Y	9	.	.	H	-	1	0	NBAS	15475132	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	3.019000	0.49635	0.367000	0.24454	-0.237000	0.12165	CAT			0.333	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241638.1		NM_015909	
RRBP1	6238	broad.mit.edu	37	20	17617269	17617269	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr20:17617269C>T	ENST00000377813.1	-	6	2593	c.2290G>A	c.(2290-2292)Gcc>Acc	p.A764T	RRBP1_ENST00000455029.2_Missense_Mutation_p.A105T|RRBP1_ENST00000377807.2_Missense_Mutation_p.A331T|RRBP1_ENST00000360807.4_Missense_Mutation_p.A331T|RRBP1_ENST00000246043.4_Missense_Mutation_p.A764T			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	764					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						CGGTAGCTGGCCTGCATGCGT	0.652																																					p.A331T													.	RRBP1	157		0			c.G991A												89.0	80.0	83.0					20																	17617269		2203	4300	6503	SO:0001583	missense	6238	exon6			AGCTGGCCTGCAT	AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.2290G>A	20.37:g.17617269C>T	ENSP00000367044:p.Ala764Thr		42	0	0		52	0.08	4	NM_004587	143	0.00	0	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	ENST00000377813.1	37		.	.	.	.	.	.	.	.	.	.	C	20.4	3.984135	0.74474	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000455029	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	5.79	4.83	0.62350	.	0.000000	0.37348	N	0.002136	T	0.34337	0.0894	L	0.49126	1.545	0.58432	D	0.999999	P	0.49358	0.923	P	0.56042	0.79	T	0.02713	-1.1120	10	0.27082	T	0.32	-17.502	15.8832	0.79219	0.0:0.8644:0.1356:0.0	.	331	Q9P2E9-3	.	T	331;764;331;764;105	ENSP00000354045:A331T;ENSP00000367044:A764T;ENSP00000367038:A331T;ENSP00000246043:A764T;ENSP00000401206:A105T	ENSP00000246043:A764T	A	-	1	0	RRBP1	17565269	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	6.081000	0.71309	1.418000	0.47098	0.561000	0.74099	GCC			0.652	RRBP1-002	NOVEL	basic	protein_coding	protein_coding		OTTHUMT00000078125.1		NM_001042576	
BMP7	655	mdanderson.org	37	20	55841035	55841035	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr20:55841035G>T	ENST00000395863.3	-	1	649	c.144C>A	c.(142-144)agC>agA	p.S48R	BMP7_ENST00000450594.2_Missense_Mutation_p.S48R|BMP7_ENST00000395864.3_Missense_Mutation_p.S48R|RP4-813D12.3_ENST00000412321.1_lincRNA	NM_001719.2	NP_001710.1	P18075	BMP7_HUMAN	bone morphogenetic protein 7	48					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of an epithelial tube (GO:0048754)|cartilage development (GO:0051216)|cellular response to hypoxia (GO:0071456)|dendrite development (GO:0016358)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic skeletal joint morphogenesis (GO:0060272)|epithelial cell differentiation (GO:0030855)|epithelial to mesenchymal transition (GO:0001837)|extracellular matrix organization (GO:0030198)|growth (GO:0040007)|mesenchymal cell differentiation (GO:0048762)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|mesonephros development (GO:0001823)|metanephric mesenchymal cell proliferation involved in metanephros development (GO:0072136)|metanephric mesenchyme morphogenesis (GO:0072133)|metanephros development (GO:0001656)|monocyte aggregation (GO:0070487)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell death (GO:0060548)|negative regulation of glomerular mesangial cell proliferation (GO:0072125)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mesenchymal cell apoptotic process involved in nephron morphogenesis (GO:0072040)|negative regulation of mitosis (GO:0045839)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostatic bud formation (GO:0060686)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of dendrite development (GO:1900006)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of hyaluranon cable assembly (GO:1900106)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|regulation of removal of superoxide radicals (GO:2000121)|response to estradiol (GO:0032355)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|steroid hormone mediated signaling pathway (GO:0043401)|ureteric bud development (GO:0001657)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	heparin binding (GO:0008201)			endometrium(4)|kidney(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	20	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			GCCGCTCCTGGCTGCGGAGGC	0.687																																					p.S48R													.	.			0			c.C144A												8.0	8.0	8.0					20																	55841035		2116	4140	6256	SO:0001583	missense	655	exon1			CTCCTGGCTGCGG		CCDS13455.1	20q13	2014-01-30	2008-05-22		ENSG00000101144	ENSG00000101144		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1074	protein-coding gene	gene with protein product	"""osteogenic protein 1"""	112267				1427904	Standard	NM_001719		Approved	OP-1	uc010gip.1	P18075	OTTHUMG00000032812	ENST00000395863.3:c.144C>A	20.37:g.55841035G>T	ENSP00000379204:p.Ser48Arg		34	0	0		33	0.09	3	NM_001719	1	0.00	0	Q9H512|Q9NTQ7	Missense_Mutation	SNP	ENST00000395863.3	37	CCDS13455.1	.	.	.	.	.	.	.	.	.	.	G	16.18	3.051154	0.55218	.	.	ENSG00000101144	ENST00000395863;ENST00000395864;ENST00000450594	T;T;T	0.64618	-0.11;-0.11;-0.11	5.04	1.97	0.26223	Transforming growth factor-beta, N-terminal (1);	0.116551	0.85682	D	0.000000	T	0.63022	0.2476	L	0.46741	1.465	0.50313	D	0.999867	B;B;D	0.57257	0.02;0.009;0.979	B;B;P	0.57468	0.016;0.026;0.821	T	0.56019	-0.8048	10	0.16896	T	0.51	.	10.4331	0.44419	0.2139:0.0:0.7861:0.0	.	48;48;48	B1AKZ9;P18075;B1AL00	.;BMP7_HUMAN;.	R	48	ENSP00000379204:S48R;ENSP00000379205:S48R;ENSP00000398687:S48R	ENSP00000379204:S48R	S	-	3	2	BMP7	55274442	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.033000	0.57282	0.141000	0.18875	0.491000	0.48974	AGC			0.687	BMP7-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000079831.2			
LAMA5	3911	mdanderson.org	37	20	60898602	60898602	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr20:60898602G>T	ENST00000252999.3	-	45	6040	c.5974C>A	c.(5974-5976)Cgt>Agt	p.R1992S		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1992	Laminin EGF-like 19. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AGGCAGCCACGGCAGGCGCCC	0.706																																					p.R1992S													.	.			0			c.C5974A												8.0	14.0	12.0					20																	60898602		2153	4247	6400	SO:0001583	missense	3911	exon45			AGCCACGGCAGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5974C>A	20.37:g.60898602G>T	ENSP00000252999:p.Arg1992Ser		54	0	0		45	0.07	3	NM_005560	13	0.00	0	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	37	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	G	1.988	-0.432542	0.04669	.	.	ENSG00000130702	ENST00000252999	T	0.60797	0.16	3.72	0.126	0.14722	EGF-like, laminin (4);	0.887861	0.09803	U	0.753887	T	0.28067	0.0692	N	0.04508	-0.205	0.26535	N	0.974184	B	0.14012	0.009	B	0.10450	0.005	T	0.20638	-1.0269	10	0.21540	T	0.41	.	3.5487	0.07837	0.3958:0.0:0.312:0.2922	.	1992	O15230	LAMA5_HUMAN	S	1992	ENSP00000252999:R1992S	ENSP00000252999:R1992S	R	-	1	0	LAMA5	60331997	0.947000	0.32204	0.048000	0.18961	0.617000	0.37484	1.372000	0.34261	0.550000	0.28991	0.297000	0.19635	CGT			0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080014.2		NM_005560	
TNFRSF6B	8771	mdanderson.org	37	20	62328205	62328205	+	Missense_Mutation	SNP	G	G	A	rs61760055	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr20:62328205G>A	ENST00000369996.1	+	1	185	c.85G>A	c.(85-87)Gga>Aga	p.G29R	ARFRP1_ENST00000485858.1_5'Flank|RTEL1_ENST00000318100.4_Missense_Mutation_p.R1331Q|RTEL1-TNFRSF6B_ENST00000482936.1_Missense_Mutation_p.R1331Q	NM_003823.3	NP_003814.1	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily, member 6b, decoy	29					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	extracellular space (GO:0005615)	receptor activity (GO:0004872)			central_nervous_system(1)|lung(2)|skin(1)	4	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)			GGCTGTACGCGGAGTGGCAGA	0.706													G|||	11	0.00219649	0.0	0.0	5008	,	,		13358	0.0109		0.0	False		,,,				2504	0.0				p.G29R													.	.			0			c.G85A												19.0	19.0	19.0					20																	62328205		2177	4274	6451	SO:0001583	missense	8771	exon1			GTACGCGGAGTGG	AF104419	CCDS13532.1	20q13.33	2012-06-27						"""Tumor necrosis factor receptor superfamily"""	11921	protein-coding gene	gene with protein product		603361				9872321, 10318773	Standard	NM_003823		Approved	DcR3, DCR3, TR6, M68	uc002yfz.3	O95407	OTTHUMG00000143724	ENST00000369996.1:c.85G>A	20.37:g.62328205G>A	ENSP00000359013:p.Gly29Arg		49	0	0		71	0.07	5	NM_003823	10	0.00	0		Missense_Mutation	SNP	ENST00000369996.1	37	CCDS13532.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.82|13.82	2.351030|2.351030	0.41599|0.41599	.|.	.|.	ENSG00000243509|ENSG00000258366	ENST00000370006;ENST00000369996;ENST00000342852|ENST00000318100	T|D	0.71222|0.82803	-0.55|-1.65	3.23|3.23	0.0726|0.0726	0.14387|0.14387	.|.	.|2.043580	.|0.03935	.|U	.|0.285886	T|T	0.79695|0.79695	0.4490|0.4490	L|L	0.61218|0.61218	1.895|1.895	0.09310|0.09310	N|N	1|1	B|.	0.21688|.	0.059|.	B|.	0.10450|.	0.005|.	T|T	0.56595|0.56595	-0.7953|-0.7953	9|8	0.32370|0.21540	T|T	0.25|0.41	-28.0394|-28.0394	2.7912|2.7912	0.05388|0.05388	0.3288:0.0:0.296:0.3752|0.3288:0.0:0.296:0.3752	rs61760055|rs61760055	29|.	O95407|.	TNF6B_HUMAN|.	R|Q	29|1331	ENSP00000359013:G29R|ENSP00000322287:R1331Q	ENSP00000342328:G29R|ENSP00000322287:R1331Q	G|R	+|+	1|2	0|0	TNFRSF6B|AL353715.1	61798649|61798649	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	-0.397000|-0.397000	0.07269|0.07269	-0.157000|-0.157000	0.11059|0.11059	0.462000|0.462000	0.41574|0.41574	GGA|CGG			0.706	TNFRSF6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080182.1			
BAGE2	85319	broad.mit.edu	37	21	11062214	11062214	+	RNA	DEL	C	C	-	rs374146310|rs113361486		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr21:11062214delC	ENST00000470054.1	-	0	324							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		taaaaagaaaccccccaaaaa	0.299																																					.													.	.			0			.																																											85319	.			AAGAAACCCCCCA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11062214delC			4	0	0		7	0.43	3	.	0		0	A8K925|Q08ER0	RNA	DEL	ENST00000470054.1	37																																																																																						0.299	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
SNAP29	9342	bcgsc.ca	37	22	21242096	21242096	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr22:21242096G>T	ENST00000215730.7	+	5	877	c.749G>T	c.(748-750)aGc>aTc	p.S250I	AC007308.7_ENST00000608856.1_RNA	NM_004782.3	NP_004773.1	O95721	SNP29_HUMAN	synaptosomal-associated protein, 29kDa	250	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				autophagic vacuole fusion (GO:0000046)|exocytosis (GO:0006887)|membrane fusion (GO:0061025)|protein transport (GO:0015031)|vesicle targeting (GO:0006903)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|synapse (GO:0045202)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|large_intestine(5)|lung(1)|upper_aerodigestive_tract(1)	9	all_cancers(11;2.77e-25)|all_epithelial(7;8.92e-24)|Lung NSC(8;1.49e-15)|all_lung(8;2.54e-14)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000592)|Lung(15;0.0117)			AACATAAAAAGCACAGAAAGA	0.393																																					p.S250I													.	SNAP29	22		0			c.G749T												123.0	111.0	115.0					22																	21242096		2203	4300	6503	SO:0001583	missense	9342	exon5			TAAAAAGCACAGA	AF115436	CCDS13784.1	22q11.21	2008-06-10	2002-08-29		ENSG00000099940	ENSG00000099940			11133	protein-coding gene	gene with protein product	"""soluble 29 kDa NSF attachment protein"""	604202	"""synaptosomal-associated protein, 29kD"""			9852078, 10591208	Standard	NM_004782		Approved	SNAP-29, CEDNIK	uc011ahw.2	O95721	OTTHUMG00000150765	ENST00000215730.7:c.749G>T	22.37:g.21242096G>T	ENSP00000215730:p.Ser250Ile		70	0	0		49	0.08	4	NM_004782	73	0.00	0		Missense_Mutation	SNP	ENST00000215730.7	37	CCDS13784.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952974	0.73902	.	.	ENSG00000099940	ENST00000215730;ENST00000439214	.	.	.	5.78	3.57	0.40892	Target SNARE coiled-coil domain (3);	0.207946	0.56097	D	0.000034	T	0.62502	0.2433	L	0.48877	1.53	0.45791	D	0.998678	P	0.49307	0.922	P	0.53861	0.736	T	0.62562	-0.6828	9	0.35671	T	0.21	-17.1009	15.4289	0.75077	0.0:0.3882:0.6118:0.0	.	250	O95721	SNP29_HUMAN	I	250;157	.	ENSP00000215730:S250I	S	+	2	0	SNAP29	19572096	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.681000	0.25320	1.439000	0.47511	0.655000	0.94253	AGC			0.393	SNAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320000.4		NM_004782	
GGT5	2687	mdanderson.org	37	22	24628058	24628058	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr22:24628058T>C	ENST00000327365.4	-	5	1131	c.715A>G	c.(715-717)Agg>Ggg	p.R239G	GGT5_ENST00000263112.7_Missense_Mutation_p.R207G|GGT5_ENST00000398292.3_Missense_Mutation_p.R239G|GGT5_ENST00000418439.2_Missense_Mutation_p.R162G	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	239					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						TGGCCCAGCCTCCCCGTGTAG	0.637																																					p.R239G													.	.			0			c.A715G												58.0	48.0	51.0					22																	24628058		2203	4300	6503	SO:0001583	missense	2687	exon5			CCAGCCTCCCCGT	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.715A>G	22.37:g.24628058T>C	ENSP00000330080:p.Arg239Gly		88	0.0113636364	1		39	0.08	3	NM_001099781	18	0.00	0	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	37	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	T	8.833	0.940384	0.18281	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	T;T;T;T	0.06849	3.25;3.25;3.25;3.25	4.73	-1.74	0.08056	.	1.309180	0.04547	N	0.389230	T	0.06645	0.0170	L	0.41573	1.285	0.09310	N	1	P;B;B;B;B	0.40794	0.729;0.018;0.047;0.018;0.047	B;B;B;B;B	0.37480	0.251;0.062;0.103;0.012;0.103	T	0.31052	-0.9957	10	0.37606	T	0.19	-5.7966	2.0777	0.03628	0.1376:0.178:0.4238:0.2606	.	162;207;239;239;239	E7EUG3;P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;.;GGT5_HUMAN	G	239;207;154;239;162	ENSP00000330080:R239G;ENSP00000263112:R207G;ENSP00000381340:R239G;ENSP00000392146:R162G	ENSP00000263112:R207G	R	-	1	2	GGT5	22958058	0.000000	0.05858	0.064000	0.19789	0.679000	0.39708	-0.722000	0.04958	-0.033000	0.13736	0.397000	0.26171	AGG			0.637	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000320119.1		NM_004121	
RNF215	200312	mdanderson.org	37	22	30775729	30775729	+	Missense_Mutation	SNP	G	G	T	rs149275092	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr22:30775729G>T	ENST00000382363.3	-	8	1156	c.1082C>A	c.(1081-1083)aCc>aAc	p.T361N	RP1-130H16.16_ENST00000332468.4_RNA	NM_001017981.1	NP_001017981.1	Q9Y6U7	RN215_HUMAN	ring finger protein 215	361						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)	6						CAGTGGGCAGGTCTGCTGGAG	0.622																																					p.T361N													.	.			0			c.C1082A												61.0	57.0	59.0					22																	30775729		2199	4287	6486	SO:0001583	missense	200312	exon8			GGGCAGGTCTGCT		CCDS33633.1	22q12.2	2013-01-09			ENSG00000099999	ENSG00000099999		"""RING-type (C3HC4) zinc fingers"""	33434	protein-coding gene	gene with protein product							Standard	NM_001017981		Approved		uc003ahp.3	Q9Y6U7	OTTHUMG00000151016	ENST00000382363.3:c.1082C>A	22.37:g.30775729G>T	ENSP00000371800:p.Thr361Asn		72	0	0		53	0.06	3	NM_001017981	26	0.00	0	A6NEL1	Missense_Mutation	SNP	ENST00000382363.3	37	CCDS33633.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.03|18.03	3.532901|3.532901	0.64972|0.64972	.|.	.|.	ENSG00000099999|ENSG00000099999	ENST00000215798|ENST00000421022;ENST00000382363	.|T;T	.|0.69435	.|-0.4;0.87	4.71|4.71	4.71|4.71	0.59529|0.59529	.|Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79528|0.79528	0.4461|0.4461	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	T|T	0.81839|0.81839	-0.0748|-0.0748	5|10	.|0.87932	.|D	.|0	-19.5122|-19.5122	15.6269|15.6269	0.76867|0.76867	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|361	.|Q9Y6U7	.|RN215_HUMAN	E|N	298|12;361	.|ENSP00000396278:T12N;ENSP00000371800:T361N	.|ENSP00000371800:T361N	D|T	-|-	3|2	2|0	RNF215|RNF215	29105729|29105729	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	8.727000|8.727000	0.91480|0.91480	2.431000|2.431000	0.82371|0.82371	0.561000|0.561000	0.74099|0.74099	GAC|ACC			0.622	RNF215-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000320960.1		NM_001017981	
CMTM8	152189	broad.mit.edu	37	3	32280541	32280541	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr3:32280541G>C	ENST00000307526.3	+	1	371	c.77G>C	c.(76-78)aGc>aCc	p.S26T	RP11-384L8.1_ENST00000565519.1_RNA|CMTM8_ENST00000458535.2_Missense_Mutation_p.S26T	NM_178868.3	NP_849199.2	Q8IZV2	CKLF8_HUMAN	CKLF-like MARVEL transmembrane domain containing 8	26					chemotaxis (GO:0006935)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(1)|lung(1)	4						TTCTCCACCAGCAGCAGCAGC	0.706																																					p.S26T													.	CMTM8	9		0			c.G77C												29.0	28.0	28.0					3																	32280541		2195	4297	6492	SO:0001583	missense	152189	exon1			CCACCAGCAGCAG	AF474370	CCDS2652.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000170293	ENSG00000170293			19179	protein-coding gene	gene with protein product		607891	"""chemokine-like factor super family 8"", ""chemokine-like factor superfamily 8"""	CKLFSF8			Standard	NM_178868		Approved		uc003cex.3	Q8IZV2	OTTHUMG00000130753	ENST00000307526.3:c.77G>C	3.37:g.32280541G>C	ENSP00000307741:p.Ser26Thr		260	0	0		178	0.02	4	NM_178868	2	0.00	0	A5D6I7|Q8IW01	Missense_Mutation	SNP	ENST00000307526.3	37	CCDS2652.1	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479469	0.26511	.	.	ENSG00000170293	ENST00000458535;ENST00000307526	T	0.31769	1.48	4.68	-1.37	0.09056	.	0.707951	0.12993	N	0.422322	T	0.16257	0.0391	N	0.08118	0	0.23681	N	0.997128	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17531	-1.0366	10	0.14252	T	0.57	-14.9292	18.726	0.91714	0.0:0.6653:0.3347:0.0	.	26;26	A5D6I7;Q8IZV2	.;CKLF8_HUMAN	T	26	ENSP00000307741:S26T	ENSP00000307741:S26T	S	+	2	0	CMTM8	32255545	1.000000	0.71417	0.937000	0.37676	0.953000	0.61014	0.649000	0.24843	0.045000	0.15804	0.462000	0.41574	AGC			0.706	CMTM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253253.1		NM_178868	
SH3BP2	6452	mdanderson.org	37	4	2826352	2826352	+	Silent	SNP	G	G	T	rs149515000		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:2826352G>T	ENST00000356331.5	+	4	513	c.252G>T	c.(250-252)gcG>gcT	p.A84A	SH3BP2_ENST00000452765.2_Silent_p.A84A|SH3BP2_ENST00000435136.2_Silent_p.A84A|SH3BP2_ENST00000503393.2_Silent_p.A141A|SH3BP2_ENST00000442312.2_Silent_p.A112A|SH3BP2_ENST00000511747.1_Silent_p.A84A	NM_003023.4	NP_003014.3	P78314	3BP2_HUMAN	SH3-domain binding protein 2	84	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)		SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	20				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		TGATGCGGGCGGCTGAGGAGA	0.617									Cherubism																												p.A141A													.	.			0			c.G423T												88.0	82.0	84.0					4																	2826352		2203	4300	6503	SO:0001819	synonymous_variant	6452	exon4	Familial Cancer Database	Familial Benign Giant-cell Tumor of the Jaw, Familial Multilocular Cystic Disease	GCGGGCGGCTGAG	BC022996	CCDS33944.1, CCDS54715.1, CCDS54716.1	4p16.3	2013-02-14				ENSG00000087266		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	10825	protein-coding gene	gene with protein product		602104	"""Cherubism"""			9299232, 11381256	Standard	NM_003023		Approved	RES4-23, CRBM	uc003gfj.4	P78314		ENST00000356331.5:c.252G>T	4.37:g.2826352G>T			48	0	0		42	0.07	3	NM_001145856	5	0.00	0	A6NNC2|B2R5R6|B4DT04|D3DVR0|D6R919|O00500|O15373|P78315	Silent	SNP	ENST00000356331.5	37	CCDS33944.1																																																																																					0.617	SH3BP2-007	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000362406.2		NM_003023	
MFSD10	10227	mdanderson.org	37	4	2933865	2933865	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:2933865G>T	ENST00000329687.4	-	6	1243	c.709C>A	c.(709-711)Ctg>Atg	p.L237M	NOP14-AS1_ENST00000507999.1_RNA|MFSD10_ENST00000507555.1_Missense_Mutation_p.L237M|NOP14-AS1_ENST00000505731.1_RNA|MFSD10_ENST00000514800.1_Missense_Mutation_p.L237M|MFSD10_ENST00000508221.1_Missense_Mutation_p.L237M|MFSD10_ENST00000355443.4_Missense_Mutation_p.L237M	NM_001120.4	NP_001111.3	Q14728	MFS10_HUMAN	major facilitator superfamily domain containing 10	237					apoptotic process (GO:0006915)|tetracycline transport (GO:0015904)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)	tetracycline transporter activity (GO:0008493)			breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CGGAACCCCAGGGCGATAGAG	0.662																																					p.L237M													.	.			0			c.C709A												20.0	20.0	20.0					4																	2933865		2199	4295	6494	SO:0001583	missense	10227	exon7			ACCCCAGGGCGAT	L11669	CCDS3365.1	4p16.3	2008-03-03			ENSG00000109736	ENSG00000109736			16894	protein-coding gene	gene with protein product	"""tetracycline transporter like protein"""	610977				8353488, 17362938	Standard	NM_001120		Approved	TETRAN, IT10C3	uc003gfz.3	Q14728	OTTHUMG00000122081	ENST00000329687.4:c.709C>A	4.37:g.2933865G>T	ENSP00000332646:p.Leu237Met		31	0	0		10	0.20	2	NM_001146069	27	0.00	0	Q07706	Missense_Mutation	SNP	ENST00000329687.4	37	CCDS3365.1	.	.	.	.	.	.	.	.	.	.	G	16.30	3.084703	0.55861	.	.	ENSG00000109736	ENST00000514800;ENST00000355443;ENST00000329687;ENST00000508221;ENST00000507555	T;T;T;T;T	0.80738	-1.41;-1.41;-1.41;-1.41;-1.41	4.92	2.83	0.33086	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.631167	0.15783	N	0.244829	T	0.75568	0.3867	L	0.27053	0.805	0.19300	N	0.999978	P;P;D;P	0.58970	0.913;0.951;0.984;0.854	P;P;P;P	0.59115	0.796;0.852;0.744;0.796	T	0.62506	-0.6840	10	0.33141	T	0.24	-0.0372	3.0645	0.06210	0.3161:0.2269:0.457:0.0	.	237;237;237;237	D6RIZ4;D6RE79;D6RA47;Q14728	.;.;.;MFS10_HUMAN	M	237	ENSP00000426907:L237M;ENSP00000347619:L237M;ENSP00000332646:L237M;ENSP00000425757:L237M;ENSP00000423402:L237M	ENSP00000332646:L237M	L	-	1	2	MFSD10	2903663	0.140000	0.22579	0.038000	0.18304	0.003000	0.03518	2.983000	0.49345	1.032000	0.39892	0.637000	0.83480	CTG			0.662	MFSD10-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000358072.2		NM_001120	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599321	55599321	+	Missense_Mutation	SNP	A	A	T	rs121913507		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:55599321A>T	ENST00000288135.5	+	17	2544	c.2447A>T	c.(2446-2448)gAc>gTc	p.D816V		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816V(758)|p.D816F(6)|p.D816I(2)|p.D816G(2)|p.D816>VVA(1)|p.D816A(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTAGCCAGAGACATCAAGAAT	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816V			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,+1,932	KIT	1	932	770	Substitution - Missense(769)|Complex - insertion inframe(1)	haematopoietic_and_lymphoid_tissue(745)|testis(16)|ovary(5)|skin(2)|soft_tissue(1)|genital_tract(1)	c.A2447T	GRCh37	CM952169	KIT	M	rs121913507							145.0	146.0	145.0					4																	55599321		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	CCAGAGACATCAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2447A>T	4.37:g.55599321A>T	ENSP00000288135:p.Asp816Val		96	0	0		61	0.59	36	NM_000222	50	1.00	50	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.831107	0.91036	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83591	-1.74;-1.74	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	D	0.85093	0.5618	N	0.21097	0.63	0.80722	A	1	D;D	0.71674	0.998;0.991	D;D	0.68943	0.961;0.933	D	0.88419	0.3027	9	0.87932	D	0	.	15.8126	0.78576	1.0:0.0:0.0:0.0	.	812;816	P10721-2;P10721	.;KIT_HUMAN	V	816;812	ENSP00000288135:D816V;ENSP00000390987:D812V	ENSP00000288135:D816V	D	+	2	0	KIT	55294078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.181000	0.94874	2.148000	0.66965	0.477000	0.44152	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
DMP1	1758	mdanderson.org	37	4	88583550	88583550	+	Missense_Mutation	SNP	G	G	A	rs200520896		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:88583550G>A	ENST00000339673.6	+	6	719	c.620G>A	c.(619-621)gGc>gAc	p.G207D	RP11-742B18.1_ENST00000506480.1_RNA|DMP1_ENST00000282479.7_Missense_Mutation_p.G191D|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000507894.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	207					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		CATGGAGACGGCTCCGAGTTG	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		19277	0.0		0.001	False		,,,				2504	0.0				p.G207D													.	.			0			c.G620A												87.0	72.0	77.0					4																	88583550		2203	4300	6503	SO:0001583	missense	1758	exon6			GAGACGGCTCCGA	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.620G>A	4.37:g.88583550G>A	ENSP00000340935:p.Gly207Asp		60	0	0		33	0.09	3	NM_004407	0		0	A1L4L3|O43265	Missense_Mutation	SNP	ENST00000339673.6	37	CCDS3623.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	9.720	1.159440	0.21454	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	T;T	0.62941	-0.01;-0.01	5.26	3.15	0.36227	.	0.381181	0.22630	N	0.057598	T	0.73094	0.3543	M	0.67700	2.07	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61277	-0.7095	10	0.33141	T	0.24	-41.3426	9.8431	0.41010	0.0882:0.1442:0.7676:0.0	.	191;207	Q13316-2;Q13316	.;DMP1_HUMAN	D	207;191	ENSP00000340935:G207D;ENSP00000282479:G191D	ENSP00000282479:G191D	G	+	2	0	DMP1	88802574	1.000000	0.71417	0.783000	0.31826	0.022000	0.10575	2.762000	0.47597	1.199000	0.43173	0.650000	0.86243	GGC	0		0.547	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253047.1			
LINC01378	103689918	broad.mit.edu	37	4	118496039	118496040	+	lincRNA	INS	-	-	A	rs375830371		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:118496039_118496040insA	ENST00000422145.3	+	0	159				NT5C3AP1_ENST00000441170.1_RNA																							TCTTTTTTTTTAATGGGTTAGA	0.342																																					.													.	.			0			.																																											0	.			TTTTTTTAATGGG																													4.37:g.118496041_118496041dupA			8	0	0		7	0.57	4	.	5	0.00	0		RNA	INS	ENST00000422145.3	37																																																																																						0.342	AC092661.1-002	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000291362.3			
SPCS3	60559	broad.mit.edu	37	4	177248366	177248366	+	Silent	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr4:177248366G>A	ENST00000503362.1	+	4	461	c.348G>A	c.(346-348)ccG>ccA	p.P116P	SPCS3_ENST00000507001.1_3'UTR	NM_021928.3	NP_068747.1	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3 homolog (S. cerevisiae)	116					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			ovary(2)	2		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		GTGATAATCCGAAGCTGCTGC	0.318																																					p.P116P													.	SPCS3	15		0			c.G348A												49.0	47.0	47.0					4																	177248366		1806	4069	5875	SO:0001819	synonymous_variant	60559	exon4			TAATCCGAAGCTG	AK092634	CCDS54823.1	4q34.2	2008-02-05				ENSG00000129128			26212	protein-coding gene	gene with protein product						12477932	Standard	NM_021928		Approved	FLJ22649, SPC22/23, SPC3, YLR066W, PRO3567	uc003iur.4	P61009		ENST00000503362.1:c.348G>A	4.37:g.177248366G>A			474	0	0		298	0.02	6	NM_021928	18	0.00	0	P12280|Q9H0S7	Silent	SNP	ENST00000503362.1	37	CCDS54823.1																																																																																					0.318	SPCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362329.1		NM_021928	
GRIA1	2890	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	153149891	153149891	+	Missense_Mutation	SNP	G	G	A	rs370642711		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr5:153149891G>A	ENST00000285900.5	+	13	2529	c.2186G>A	c.(2185-2187)cGg>cAg	p.R729Q	GRIA1_ENST00000518142.1_Missense_Mutation_p.R649Q|GRIA1_ENST00000340592.5_Missense_Mutation_p.R729Q|GRIA1_ENST00000448073.4_Missense_Mutation_p.R739Q|GRIA1_ENST00000521843.2_Missense_Mutation_p.R660Q|GRIA1_ENST00000518783.1_Missense_Mutation_p.R739Q	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	729					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	ATTGAGCAGCGGAAACCCTGT	0.507																																					p.R739Q													GRIA1_ENST00000544403,NS,carcinoma,0,3	GRIA1_ENST00000544403	0	3	0			c.G2216A							G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	113.0	95.0	101.0		2186,2186	5.4	1.0	5		101	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	GRIA1	NM_000827.3,NM_001114183.1	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	729/907,729/907	153149891	1,13005	2203	4300	6503	SO:0001583	missense	2890	exon13			AGCAGCGGAAACC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2186G>A	5.37:g.153149891G>A	ENSP00000285900:p.Arg729Gln		198	0.0050505051	1		147	0.24	36	NM_001258021	0		0	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	37	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.047286	0.93740	0.0	1.16E-4	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.37584	1.19;1.19;1.19;1.19;1.19;1.19;1.19	5.37	5.37	0.77165	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.70903	2.155	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.998;0.934;0.997;0.999	T	0.64820	-0.6317	10	0.87932	D	0	.	18.1529	0.89679	0.0:0.0:1.0:0.0	.	739;739;649;729;729	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	Q	729;729;649;683;729;662;660;739;739	ENSP00000285900:R729Q;ENSP00000427920:R649Q;ENSP00000339343:R729Q;ENSP00000427864:R662Q;ENSP00000442108:R660Q;ENSP00000428994:R739Q;ENSP00000415569:R739Q	ENSP00000285900:R729Q	R	+	2	0	GRIA1	153130084	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.637000	0.98443	2.521000	0.84997	0.650000	0.86243	CGG			0.507	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252456.3			
PANK3	79646	broad.mit.edu;bcgsc.ca;mdanderson.org	37	5	167995711	167995711	+	Silent	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr5:167995711C>T	ENST00000239231.6	-	2	637	c.321G>A	c.(319-321)ttG>ttA	p.L107L	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	107					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		GCACCGTCTGCAATGTTGAGA	0.408																																					p.L107L													.	PANK3	39		0			c.G321A												114.0	112.0	112.0					5																	167995711		2203	4300	6503	SO:0001819	synonymous_variant	79646	exon2			CGTCTGCAATGTT	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.321G>A	5.37:g.167995711C>T			88	0	0		75	0.07	5	NM_024594	8	0.00	0	D3DQL1|Q53FJ9|Q7RTX4	Silent	SNP	ENST00000239231.6	37	CCDS4368.1																																																																																					0.408	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252793.2		NM_024594	
DNAH8	1769	mdanderson.org	37	6	38881682	38881682	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr6:38881682C>T	ENST00000359357.3	+	65	9520	c.9266C>T	c.(9265-9267)gCa>gTa	p.A3089V	DNAH8_ENST00000449981.2_Missense_Mutation_p.A3306V|DNAH8_ENST00000441566.1_Missense_Mutation_p.A3053V			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	3089	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAGGATCTTGCAGTCAAGGAG	0.363																																					p.A3306V													.	.			0			c.C9917T												140.0	137.0	138.0					6																	38881682		2203	4300	6503	SO:0001583	missense	1769	exon67			ATCTTGCAGTCAA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.9266C>T	6.37:g.38881682C>T	ENSP00000352312:p.Ala3089Val		150	0.0066666667	1		116	0.04	5	NM_001206927	0		0	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	37		.	.	.	.	.	.	.	.	.	.	C	7.355	0.623718	0.14193	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T;T	0.80214	-0.85;-1.35;-1.35;-1.35	6.08	6.08	0.98989	Dynein heavy chain, coiled coil stalk (1);	0.165438	0.53938	D	0.000045	T	0.57286	0.2043	N	0.17800	0.525	0.50039	D	0.999848	B	0.16166	0.016	B	0.16289	0.015	T	0.53760	-0.8393	10	0.29301	T	0.29	.	15.3887	0.74726	0.1392:0.8608:0.0:0.0	.	3089	Q96JB1	DYH8_HUMAN	V	3294;3294;3089;3053	ENSP00000415331:A3294V;ENSP00000333363:A3294V;ENSP00000352312:A3089V;ENSP00000402294:A3053V	ENSP00000333363:A3294V	A	+	2	0	DNAH8	38989660	0.992000	0.36948	0.815000	0.32552	0.729000	0.41735	2.971000	0.49248	2.894000	0.99253	0.655000	0.94253	GCA			0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000043574.1		NM_001206927	
TRIM74	378108	broad.mit.edu	37	7	72436666	72436666	+	Missense_Mutation	SNP	A	A	G	rs369836495		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr7:72436666A>G	ENST00000285805.3	-	2	222	c.23T>C	c.(22-24)cTg>cCg	p.L8P	TRIM74_ENST00000395244.1_Missense_Mutation_p.L8P	NM_198853.1	NP_942150.1	Q86UV6	TRI74_HUMAN	tripartite motif containing 74	8						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			prostate(1)	1						CTCCAGCTCCAGCAGGCTCAC	0.612																																					.													TRIM74,NS,carcinoma,0,1	.		1	0			.												20.0	20.0	20.0					7																	72436666		2183	4256	6439	SO:0001583	missense	378108	.			AGCTCCAGCAGGC	AF498999	CCDS5545.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000155428	ENSG00000155428		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	17453	protein-coding gene	gene with protein product		612550	"""tripartite motif-containing 50C"", ""tripartite motif-containing 74"""	TRIM50C			Standard	NM_198853		Approved	MGC45440		Q86UV6	OTTHUMG00000129851	ENST00000285805.3:c.23T>C	7.37:g.72436666A>G	ENSP00000285805:p.Leu8Pro		115	0.0173913043	2		120	0.05	6	.	0		0	B7WP46	Missense_Mutation	SNP	ENST00000285805.3	37	CCDS5545.1	.	.	.	.	.	.	.	.	.	.	A	0.001	-3.083784	0.00035	.	.	ENSG00000155428	ENST00000395244;ENST00000285805	D;D	0.84370	-1.84;-1.84	2.39	2.39	0.29439	.	0.716055	0.13135	N	0.411154	T	0.64951	0.2645	N	0.11064	0.09	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48625	-0.9019	10	0.19147	T	0.46	.	1.5137	0.02501	0.1346:0.2061:0.4491:0.2102	.	8	Q86UV6-2	.	P	8	ENSP00000378665:L8P;ENSP00000285805:L8P	ENSP00000285805:L8P	L	-	2	0	TRIM74	72074602	0.000000	0.05858	0.019000	0.16419	0.319000	0.28217	-0.327000	0.07955	0.591000	0.29711	-0.528000	0.04320	CTG			0.612	TRIM74-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000252093.1		NM_198853	
GPR22	2845	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	107115390	107115390	+	Silent	SNP	G	G	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr7:107115390G>A	ENST00000304402.4	+	3	2228	c.885G>A	c.(883-885)cgG>cgA	p.R295R	COG5_ENST00000347053.3_Intron|COG5_ENST00000475638.2_Intron|COG5_ENST00000297135.3_Intron|COG5_ENST00000393603.2_Intron	NM_005295.2	NP_005286.2	Q99680	GPR22_HUMAN	G protein-coupled receptor 22	295					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			large_intestine(3)|lung(6)|ovary(2)|stomach(1)	12						TTGCCCTCCGGCGAGCTGTGA	0.428																																					p.R295R													.	.			0			c.G885A												115.0	113.0	114.0					7																	107115390		2203	4300	6503	SO:0001819	synonymous_variant	2845	exon3			CCTCCGGCGAGCT	U66581	CCDS5744.1	7q22-q31.1	2012-08-21			ENSG00000172209	ENSG00000172209		"""GPCR / Class A : Orphans"""	4477	protein-coding gene	gene with protein product		601910				9073069	Standard	NM_005295		Approved		uc003vef.3	Q99680	OTTHUMG00000154902	ENST00000304402.4:c.885G>A	7.37:g.107115390G>A			215	0	0		303	0.19	59	NM_005295	0		0	O14554	Silent	SNP	ENST00000304402.4	37	CCDS5744.1																																																																																					0.428	GPR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000337598.1			
C7orf60	154743	broad.mit.edu	37	7	112462251	112462251	+	Silent	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr7:112462251G>T	ENST00000297145.4	-	5	931	c.766C>A	c.(766-768)Cga>Aga	p.R256R	C7orf60_ENST00000485446.1_5'Flank	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	256							rRNA (adenine) methyltransferase activity (GO:0016433)	p.R256*(1)		breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						CAAATCCATCGCTGGTAAGGA	0.403																																					p.R256R													C7orf60,NS,carcinoma,0,1	C7orf60	55	1	1	Substitution - Nonsense(1)	endometrium(1)	c.C766A												72.0	67.0	69.0					7																	112462251		1849	4112	5961	SO:0001819	synonymous_variant	154743	exon5			TCCATCGCTGGTA		CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.766C>A	7.37:g.112462251G>T			91	0	0		115	0.03	3	NM_152556	14	0.00	0	Q8N3D0|Q96MV7	Silent	SNP	ENST00000297145.4	37	CCDS43634.1																																																																																					0.403	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338923.1		NM_152556	
AGO2	27161	broad.mit.edu;mdanderson.org	37	8	141561493	141561493	+	Silent	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr8:141561493G>T	ENST00000220592.5	-	11	1424	c.1312C>A	c.(1312-1314)Cgg>Agg	p.R438R	AGO2_ENST00000519980.1_Silent_p.R438R	NM_012154.3	NP_036286.2	Q9UKV8	AGO2_HUMAN	argonaute RISC catalytic component 2	438					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|negative regulation of translational initiation (GO:0045947)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|mRNA cap binding complex (GO:0005845)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|RISC complex (GO:0016442)	endoribonuclease activity (GO:0004521)|endoribonuclease activity, cleaving siRNA-paired mRNA (GO:0070551)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|siRNA binding (GO:0035197)|translation initiation factor activity (GO:0003743)	p.R438W(2)									TGCTTGTTCCGCATGTCCCAG	0.532																																					p.R438R													EIF2C2,NS,carcinoma,0,1	.		1	2	Substitution - Missense(2)	urinary_tract(1)|lung(1)	c.C1312A												92.0	87.0	89.0					8																	141561493		2203	4300	6503	SO:0001819	synonymous_variant	27161	exon11			TGTTCCGCATGTC	AF121255	CCDS6380.1, CCDS55279.1	8q24.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000123908	ENSG00000123908		"""Argonaute/PIWI family"""	3263	protein-coding gene	gene with protein product	"""argonaute 2"""	606229	"""eukaryotic translation initiation factor 2C, 2"""	EIF2C2		10534406, 12906857	Standard	NM_012154		Approved	hAGO2, Q10	uc003yvn.3	Q9UKV8	OTTHUMG00000164232	ENST00000220592.5:c.1312C>A	8.37:g.141561493G>T			94	0	0		76	0.05	4	NM_012154	4	0.00	0	Q8TCZ5|Q8WV58|Q96ID1	Silent	SNP	ENST00000220592.5	37	CCDS6380.1																																																																																					0.532	AGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377866.4			
AQP7	364	bcgsc.ca	37	9	33385733	33385733	+	Missense_Mutation	SNP	C	C	T	rs201117022		TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr9:33385733C>T	ENST00000537089.1	-	6	699	c.381G>A	c.(379-381)atG>atA	p.M127I	AQP7_ENST00000377425.4_Missense_Mutation_p.M162I|AQP7_ENST00000541274.1_Missense_Mutation_p.E88K|AQP7_ENST00000539936.1_Missense_Mutation_p.M219I			O14520	AQP7_HUMAN	aquaporin 7	219					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		ATCCTGTGTTCATGCCAAGGG	0.597																																					p.M219I													AQP7,head_neck,carcinoma,0,1	AQP7	58	1	0			c.G657A												115.0	109.0	111.0					9																	33385733		2203	4300	6503	SO:0001583	missense	364	exon7			TGTGTTCATGCCA	AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000537089.1:c.381G>A	9.37:g.33385733C>T	ENSP00000441619:p.Met127Ile		38	0.0263157895	1		42	0.24	10	NM_001170	2	0.00	0	Q08E94|Q5T5L9|Q8NHM3	Missense_Mutation	SNP	ENST00000537089.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	10.51|10.51	1.369405|1.369405	0.24771|0.24771	.|.	.|.	ENSG00000165269|ENSG00000165269	ENST00000541274|ENST00000537089;ENST00000379507;ENST00000447660;ENST00000297988;ENST00000377425;ENST00000439678;ENST00000379506;ENST00000539936;ENST00000379503	T|D;D;D;D;D;D;D;D;D	0.54479|0.84944	0.57|-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.04|5.04	5.04|5.04	0.67666|0.67666	.|Aquaporin-like (2);	.|0.074541	.|0.85682	.|D	.|0.000000	T|T	0.79551|0.79551	0.4465|0.4465	L|L	0.39085|0.39085	1.19|1.19	0.42957|0.42957	D|D	0.99439|0.99439	D|B;B;B;B	0.62365|0.09022	0.991|0.002;0.0;0.0;0.0	P|B;B;B;B	0.56042|0.10450	0.79|0.005;0.005;0.003;0.003	T|T	0.73949|0.73949	-0.3821|-0.3821	9|10	0.72032|0.30854	D|T	0.01|0.27	-22.7314|-22.7314	15.9417|15.9417	0.79758|0.79758	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	88|218;219;162;219	B7Z7F6|Q5T5M0;B7Z4U2;Q6P5T0;O14520	.|.;.;.;AQP7_HUMAN	K|I	88|127;218;87;219;162;127;218;219;155	ENSP00000438860:E88K|ENSP00000441619:M127I;ENSP00000368821:M218I;ENSP00000412868:M87I;ENSP00000297988:M219I;ENSP00000396111:M162I;ENSP00000410138:M127I;ENSP00000368820:M218I;ENSP00000439534:M219I;ENSP00000368817:M155I	ENSP00000438860:E88K|ENSP00000297988:M219I	E|M	-|-	1|3	0|0	AQP7|AQP7	33375733|33375733	0.990000|0.990000	0.36364|0.36364	1.000000|1.000000	0.80357|0.80357	0.234000|0.234000	0.25298|0.25298	1.171000|1.171000	0.31896|0.31896	2.621000|2.621000	0.88768|0.88768	0.550000|0.550000	0.68814|0.68814	GAA|ATG			0.597	AQP7-202	KNOWN	basic	protein_coding	protein_coding				NM_001170	
Unknown	0	bcgsc.ca	37	9	77550214	77550214	+	IGR	SNP	C	C	A			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr9:77550214C>A								TRPM6 (47204 upstream) : C9orf40 (11282 downstream)																							ATACCACATGCAGCACACTGA	0.368																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CACATGCAGCACA																													9.37:g.77550214C>A			35	0	0		26	0.15	4	.	0		0		RNA	SNP		37																																																																																					0	0.368										
SLC34A3	142680	mdanderson.org	37	9	140128577	140128577	+	Silent	SNP	G	G	T	rs34664302	byFrequency	TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chr9:140128577G>T	ENST00000538474.1	+	10	1166	c.942G>T	c.(940-942)gcG>gcT	p.A314A	SLC34A3_ENST00000361134.2_Silent_p.A314A	NM_001177316.1|NM_001177317.1	NP_001170787|NP_001170788	Q8N130	NPT2C_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 3	314					cellular phosphate ion homeostasis (GO:0030643)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)			kidney(3)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		ACCTGTTTGCGGGCACGGAGC	0.731																																					p.A314A													.	.			0			c.G942T												14.0	14.0	14.0					9																	140128577		2180	4286	6466	SO:0001819	synonymous_variant	142680	exon10			GTTTGCGGGCACG	AB055000	CCDS7038.1	9q34.3	2013-07-17	2013-07-17		ENSG00000198569	ENSG00000198569		"""Solute carriers"""	20305	protein-coding gene	gene with protein product		609826	"""solute carrier family 34 (sodium phosphate), member 3"""			11880379, 16358215, 16358214	Standard	NM_080877		Approved	NPTIIc, FLJ38680	uc004cmf.1	Q8N130	OTTHUMG00000131780	ENST00000538474.1:c.942G>T	9.37:g.140128577G>T			16	0	0		17	0.12	2	NM_080877	0		0	A2BFA1	Silent	SNP	ENST00000538474.1	37	CCDS7038.1																																																																																					0.731	SLC34A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254712.1		NM_080877	
GPM6B	2824	mdanderson.org	37	X	13825789	13825789	+	Intron	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chrX:13825789G>T	ENST00000356942.5	-	1	503				GPM6B_ENST00000454189.2_Intron|GPM6B_ENST00000493677.1_Missense_Mutation_p.A28D|GPM6B_ENST00000316715.4_Missense_Mutation_p.A54D|GPM6B_ENST00000398361.3_Intron|GPM6B_ENST00000355135.2_Missense_Mutation_p.A54D	NM_005278.3	NP_005269.1	Q13491	GPM6B_HUMAN	glycoprotein M6B						cell differentiation (GO:0030154)|extracellular matrix assembly (GO:0085029)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of serotonin uptake (GO:0051612)|nervous system development (GO:0007399)|ossification (GO:0001503)|positive regulation of bone mineralization (GO:0030501)|protein transport (GO:0015031)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of focal adhesion assembly (GO:0051893)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)|pancreas(1)	6						CAAGGGGCTAGCCCTGTCCCC	0.483																																					p.A54D													.	.			0			c.C161A												139.0	125.0	130.0					X																	13825789		2203	4300	6503	SO:0001627	intron_variant	2824	exon2			GGGCTAGCCCTGT		CCDS14158.1, CCDS35206.1, CCDS35207.1, CCDS48084.1	Xp22.2	2010-08-03			ENSG00000046653	ENSG00000046653			4461	protein-coding gene	gene with protein product		300051				8661015	Standard	NM_001001995		Approved	M6B, MGC17150, MGC54284	uc004cvw.3	Q13491	OTTHUMG00000021162	ENST00000356942.5:c.61+9173C>A	X.37:g.13825789G>T			107	0	0		117	0.04	5	NM_001001996	0		0	O76077|Q86X43|Q8N956	Missense_Mutation	SNP	ENST00000356942.5	37	CCDS14158.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825686	0.50739	.	.	ENSG00000046653	ENST00000316715;ENST00000493677;ENST00000355135	D;D;D	0.99186	-5.53;-5.52;-5.52	5.85	4.88	0.63580	.	0.231844	0.36482	N	0.002566	D	0.93996	0.8077	N	0.08118	0	0.80722	D	1	B;B;B	0.29085	0.037;0.232;0.037	B;B;B	0.31245	0.014;0.126;0.023	D	0.89937	0.4070	10	0.12103	T	0.63	-0.7638	3.6465	0.08187	0.309:0.0:0.691:0.0	.	28;54;54	B7Z613;Q13491-3;Q8N956	.;.;.	D	54;28;54	ENSP00000316861:A54D;ENSP00000419904:A28D;ENSP00000347258:A54D	ENSP00000316861:A54D	A	-	2	0	GPM6B	13735710	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.248000	0.58760	2.469000	0.83416	0.600000	0.82982	GCT			0.483	GPM6B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055822.1		NM_001001995	
DLG3	1741	broad.mit.edu	37	X	69713237	69713237	+	Intron	SNP	G	G	T			TCGA-XE-AANR-01A-11D-A435-10	TCGA-XE-AANR-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	13cd0963-4be6-4087-b13b-50df1732c263	b4cb7d5c-2f34-456b-a858-320fde2a5f2b	g.chrX:69713237G>T	ENST00000374360.3	+	12	2006				DLG3_ENST00000374355.3_Silent_p.T258T|DLG3_ENST00000194900.4_Intron|DLG3_ENST00000542398.1_Silent_p.T112T	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)						axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					CGATCAAAACGAAACGTAAAA	0.388																																					p.T258T													.	DLG3	100		0			c.G774T												64.0	52.0	55.0					X																	69713237		1916	4118	6034	SO:0001627	intron_variant	1741	exon7			CAAAACGAAACGT	U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.1773+791G>T	X.37:g.69713237G>T			252	0	0		290	0.01	4	NM_020730	76	0.00	0	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Silent	SNP	ENST00000374360.3	37	CCDS14403.1																																																																																					0.388	DLG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057074.2		NM_021120	
