#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
DPYD	1806	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	97839132	97839132	+	Silent	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:97839132G>T	ENST00000370192.3	-	16	2143	c.2043C>A	c.(2041-2043)ggC>ggA	p.G681G		NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	681					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	CACAGGCCAGGCCCATTCCTC	0.463																																					p.G681G													.	.			0			c.C2043A												60.0	58.0	59.0					1																	97839132		2203	4300	6503	SO:0001819	synonymous_variant	1806	exon16			GGCCAGGCCCATT	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.2043C>A	1.37:g.97839132G>T			262	0	0		202	0.16	32	NM_000110	2	0.00	0	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Silent	SNP	ENST00000370192.3	37	CCDS30777.1																																																																																					0.463	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000095698.3		NM_000110	
CELF3	11189	mdanderson.org	37	1	151679994	151679994	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:151679994G>T	ENST00000290583.4	-	7	1554	c.761C>A	c.(760-762)aCc>aAc	p.T254N	AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000470688.1_5'UTR|CELF3_ENST00000392706.3_Missense_Mutation_p.T71N|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000290585.4_Missense_Mutation_p.T254N|RIIAD1_ENST00000326413.3_5'Flank	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	254					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						TGAGGATGGGGTGATGGGGGT	0.637																																					p.T254N													.	.			0			c.C761A												31.0	29.0	30.0					1																	151679994		2203	4300	6503	SO:0001583	missense	11189	exon7			GATGGGGTGATGG	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.761C>A	1.37:g.151679994G>T	ENSP00000290583:p.Thr254Asn		28	0	0		19	0.11	2	NM_007185	0		0	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	37	CCDS1002.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.93|15.93	2.979567|2.979567	0.53827|0.53827	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290585;ENST00000290583;ENST00000392706;ENST00000368833	.|T;T;T	.|0.16457	.|2.34;2.38;3.41	4.04|4.04	4.04|4.04	0.47022|0.47022	.|.	.|0.146929	.|0.45867	.|D	.|0.000339	T|T	0.28797|0.28797	0.0714|0.0714	M|M	0.74647|0.74647	2.275|2.275	0.58432|0.58432	D|D	0.999999|0.999999	.|P;P;D;P;P;P	.|0.62365	.|0.913;0.845;0.991;0.763;0.605;0.634	.|P;P;P;B;B;B	.|0.60541	.|0.536;0.52;0.876;0.226;0.264;0.215	T|T	0.07731|0.07731	-1.0757|-1.0757	5|10	.|0.59425	.|D	.|0.04	-21.5519|-21.5519	14.9467|14.9467	0.71039|0.71039	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|71;254;254;253;254;253	.|B4DQL3;Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.|.;.;.;.;CELF3_HUMAN;.	T|N	255|254;254;71;253	.|ENSP00000290585:T254N;ENSP00000290583:T254N;ENSP00000376470:T71N	.|ENSP00000290583:T254N	P|T	-|-	1|2	0|0	CELF3|CELF3	149946618|149946618	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	8.606000|8.606000	0.90888|0.90888	2.094000|2.094000	0.63399|0.63399	0.650000|0.650000	0.86243|0.86243	CCC|ACC			0.637	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036663.2		NM_007185	
SLAMF1	6504	broad.mit.edu	37	1	160604502	160604502	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:160604502G>T	ENST00000302035.6	-	3	950	c.601C>A	c.(601-603)Cag>Aag	p.Q201K	SLAMF1_ENST00000235739.5_Missense_Mutation_p.Q201K|SLAMF1_ENST00000538290.1_Missense_Mutation_p.Q201K|SLAMF1_ENST00000355199.3_Missense_Mutation_p.Q201K	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	201	Ig-like C2-type.				lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			TCAGCATGCTGGGGGCCGAGG	0.607																																					p.Q201K													.	SLAMF1	74		0			c.C601A												137.0	128.0	131.0					1																	160604502		2203	4300	6503	SO:0001583	missense	6504	exon3			CATGCTGGGGGCC	U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.601C>A	1.37:g.160604502G>T	ENSP00000306190:p.Gln201Lys		193	0	0		159	0.03	4	NM_003037	17	0.00	0	Q5W172|Q9HBE8	Missense_Mutation	SNP	ENST00000302035.6	37	CCDS1207.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219010	0.39201	.	.	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000538290;ENST00000355199	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	4.3	3.36	0.38483	Immunoglobulin-like (1);	0.677563	0.15378	N	0.265443	T	0.38453	0.1041	M	0.71920	2.185	0.32198	N	0.578175	D	0.60575	0.988	P	0.59012	0.85	T	0.39583	-0.9607	10	0.05721	T	0.95	-14.5377	9.5434	0.39266	0.0:0.0:0.7908:0.2092	.	201	Q13291	SLAF1_HUMAN	K	201	ENSP00000306190:Q201K;ENSP00000235739:Q201K;ENSP00000438406:Q201K;ENSP00000347333:Q201K	ENSP00000235739:Q201K	Q	-	1	0	SLAMF1	158871126	0.556000	0.26538	0.950000	0.38849	0.923000	0.55619	1.022000	0.30052	1.352000	0.45808	0.650000	0.86243	CAG			0.607	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060454.1			
EPRS	2058	hgsc.bcm.edu	37	1	220156424	220156424	+	Intron	SNP	T	T	C			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:220156424T>C	ENST00000366923.3	-	22	3570					NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase						cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	CAGAACTTTTTAATAAAAATG	0.269																																					.													.	.			0			.																																									SO:0001627	intron_variant	26828	.			ACTTTTTAATAAA	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3300+106A>G	1.37:g.220156424T>C			109	0	0		76	0.21	16	.	0		0	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	RNA	SNP	ENST00000366923.3	37	CCDS31027.1																																																																																					0.269	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000091133.2		NM_004446	
EFCAB2	84288	mdanderson.org	37	1	245245457	245245457	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:245245457G>T	ENST00000366522.2	+	5	805	c.664G>T	c.(664-666)Gaa>Taa	p.E222*	EFCAB2_ENST00000366523.1_Nonsense_Mutation_p.E86*|EFCAB2_ENST00000447569.2_Nonsense_Mutation_p.E86*|EFCAB2_ENST00000487845.1_3'UTR			Q5VUJ9	EFCB2_HUMAN	EF-hand calcium binding domain 2	222							calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|stomach(2)	13	all_cancers(71;2.93e-06)|all_epithelial(71;2.13e-05)|all_lung(81;0.0337)|Lung NSC(105;0.0472)|Ovarian(71;0.0584)|Breast(184;0.0716)|all_neural(11;0.0982)		OV - Ovarian serous cystadenocarcinoma(106;0.015)			AATACTACTAGAAAGAAAGTA	0.343																																					p.E86X													.	.			0			c.G256T												76.0	74.0	74.0					1																	245245457		2203	4300	6503	SO:0001587	stop_gained	84288	exon5			CTACTAGAAAGAA	AB209286	CCDS31082.1, CCDS44341.1	1q44	2014-07-18			ENSG00000203666	ENSG00000203666		"""EF-hand domain containing"""	28166	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 8"""					23427265	Standard	NM_032328		Approved	MGC12458, DRC8, CFAP200	uc001ibc.2	Q5VUJ9	OTTHUMG00000040474	ENST00000366522.2:c.664G>T	1.37:g.245245457G>T	ENSP00000355479:p.Glu222*		34	0	0		25	0.12	3	NM_032328	7	0.00	0	B4DZE9|Q59G23|Q9BS36	Nonsense_Mutation	SNP	ENST00000366522.2	37		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.16|16.16|16.16	3.045420|3.045420|3.045420	0.55110|0.55110|0.55110	.|.|.	.|.|.	ENSG00000203666|ENSG00000203666|ENSG00000203666	ENST00000366523;ENST00000366522;ENST00000447569|ENST00000366521|ENST00000551317;ENST00000425550	.|.|.	.|.|.	.|.|.	5.62|5.62|5.62	4.7|4.7|4.7	0.59300|0.59300|0.59300	.|.|.	0.072799|.|.	0.52532|.|.	D|.|.	0.000062|.|.	.|T|.	.|0.64864|.	.|0.2637|.	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|.	.|0.71034|.	.|-0.4709|.	.|3|.	0.87932|.|.	D|.|.	0|.|.	.|.|.	14.3158|14.3158|14.3158	0.66450|0.66450|0.66450	0.0:0.1498:0.8502:0.0|0.0:0.1498:0.8502:0.0|0.0:0.1498:0.8502:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|I|Y	86;222;86|144|77	.|.|.	ENSP00000355479:E222X|.|.	E|R|X	+|+|+	1|2|3	0|0|2	EFCAB2|EFCAB2|EFCAB2	243312080|243312080|243312080	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.541000|0.541000|0.541000	0.28102|0.28102|0.28102	0.454000|0.454000|0.454000	0.32378|0.32378|0.32378	6.820000|6.820000|6.820000	0.75267|0.75267|0.75267	1.359000|1.359000|1.359000	0.45940|0.45940|0.45940	-0.310000|-0.310000|-0.310000	0.09108|0.09108|0.09108	GAA|AGA|TAG			0.343	EFCAB2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000097407.2			
OR2T34	127068	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	248737452	248737452	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr1:248737452G>C	ENST00000328782.2	-	1	628	c.607C>G	c.(607-609)Ctc>Gtc	p.L203V		NM_001001821.1	NP_001001821.1	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T, member 34	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(28)|ovary(2)|skin(2)|stomach(3)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AGGTACGTGAGCATCTTATAG	0.512																																					p.L203V													.	.			0			c.C607G												193.0	208.0	203.0					1																	248737452		2102	4300	6402	SO:0001583	missense	127068	exon1			ACGTGAGCATCTT	BK004477	CCDS31120.1	1q44	2012-08-09			ENSG00000183310	ENSG00000183310		"""GPCR / Class A : Olfactory receptors"""	31256	protein-coding gene	gene with protein product							Standard	NM_001001821		Approved		uc001iep.1	Q8NGX1	OTTHUMG00000040387	ENST00000328782.2:c.607C>G	1.37:g.248737452G>C	ENSP00000330904:p.Leu203Val		391	0	0		356	0.17	59	NM_001001821	0		0	B2RNJ8|Q6IEY5|Q96R31	Missense_Mutation	SNP	ENST00000328782.2	37	CCDS31120.1	.	.	.	.	.	.	.	.	.	.	.	0.016	-1.514612	0.00975	.	.	ENSG00000183310	ENST00000328782	T	0.37915	1.17	2.37	-1.22	0.09494	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.13970	0.0338	N	0.05574	-0.02	0.09310	N	1	B	0.14805	0.011	B	0.24006	0.05	T	0.35375	-0.9791	9	0.08179	T	0.78	.	3.8244	0.08848	0.4069:0.3304:0.2627:0.0	.	203	Q8NGX1	O2T34_HUMAN	V	203	ENSP00000330904:L203V	ENSP00000330904:L203V	L	-	1	0	OR2T34	246804075	0.000000	0.05858	0.374000	0.26016	0.071000	0.16799	-0.097000	0.11042	0.214000	0.20742	0.123000	0.15791	CTC			0.512	OR2T34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000097138.1		NM_001001821	
ITIH5	80760	mdanderson.org	37	10	7618461	7618461	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:7618461G>T	ENST00000256861.6	-	10	2011	c.1933C>A	c.(1933-1935)Ccc>Acc	p.P645T	ITIH5_ENST00000446830.2_Missense_Mutation_p.P427T|ITIH5_ENST00000397146.2_Missense_Mutation_p.P645T|ITIH5_ENST00000298441.6_Missense_Mutation_p.P431T|ITIH5_ENST00000397145.2_Missense_Mutation_p.P645T|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	645					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						ACCGGTTCGGGTCCCATGGCA	0.677																																					p.P645T													.	.			0			c.C1933A												21.0	22.0	22.0					10																	7618461		2200	4297	6497	SO:0001583	missense	80760	exon10			GTTCGGGTCCCAT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1933C>A	10.37:g.7618461G>T	ENSP00000256861:p.Pro645Thr		51	0	0		33	0.09	3	NM_001001851	8	0.00	0	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	37		.	.	.	.	.	.	.	.	.	.	G	12.76	2.033175	0.35893	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.03468	3.92;3.92;3.92;3.92;3.92	5.33	5.33	0.75918	.	0.310779	0.35179	N	0.003387	T	0.04092	0.0114	.	.	.	0.09310	N	1	B;P;B	0.50617	0.232;0.937;0.256	B;B;B	0.42851	0.113;0.4;0.069	T	0.46414	-0.9193	9	0.35671	T	0.21	-22.4613	9.4549	0.38750	0.1012:0.0:0.8988:0.0	.	645;645;431	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	T	645;645;431;427;645	ENSP00000256861:P645T;ENSP00000380333:P645T;ENSP00000298441:P431T;ENSP00000387969:P427T;ENSP00000380332:P645T	ENSP00000256861:P645T	P	-	1	0	ITIH5	7658467	0.928000	0.31464	0.131000	0.22000	0.045000	0.14185	2.099000	0.41767	2.474000	0.83562	0.561000	0.74099	CCC			0.677	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000046688.1		NM_030569	
GATA3	2625	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	8115773	8115773	+	Missense_Mutation	SNP	A	A	C			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:8115773A>C	ENST00000346208.3	+	6	1574	c.1119A>C	c.(1117-1119)aaA>aaC	p.K373N	GATA3_ENST00000379328.3_Missense_Mutation_p.K374N|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	373					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GCAAATCCAAAAAGTGCAAAA	0.438			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.K374N				Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	.			0			c.A1122C												68.0	73.0	71.0					10																	8115773		2203	4300	6503	SO:0001583	missense	2625	exon6			ATCCAAAAAGTGC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1119A>C	10.37:g.8115773A>C	ENSP00000341619:p.Lys373Asn		114	0	0		129	0.21	27	NM_001002295	11	0.00	0	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	ENST00000346208.3	37	CCDS7083.1	.	.	.	.	.	.	.	.	.	.	A	14.96	2.692140	0.48202	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.97404	-4.37;-4.35	5.26	5.26	0.73747	.	0.147064	0.56097	D	0.000027	D	0.98074	0.9365	M	0.71206	2.165	0.80722	D	1	D;D	0.76494	0.999;0.985	D;D	0.80764	0.994;0.924	D	0.99187	1.0869	10	0.87932	D	0	-14.6037	15.1792	0.72941	1.0:0.0:0.0:0.0	.	373;374	P23771;P23771-2	GATA3_HUMAN;.	N	374;373	ENSP00000368632:K374N;ENSP00000341619:K373N	ENSP00000341619:K373N	K	+	3	2	GATA3	8155779	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.226000	0.72277	1.981000	0.57761	0.379000	0.24179	AAA			0.438	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000046719.1		NM_001002295	
IGKV1OR10-1	642424	bcgsc.ca	37	10	42681152	42681152	+	IGR	SNP	C	C	T	rs111787724		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:42681152C>T								None (None upstream) : AL031601.1 (49198 downstream)																							GACAGTGGATCTGGGACAGAT	0.473																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GTGGATCTGGGAC																													10.37:g.42681152C>T			229	0.0829694323	19		168	0.14	24	.	12	0.08	1		RNA	SNP		37																																																																																					0	0.473										
RRP12	23223	mdanderson.org	37	10	99126540	99126540	+	Silent	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:99126540C>T	ENST00000370992.4	-	27	3285	c.3174G>A	c.(3172-3174)gaG>gaA	p.E1058E	RRP12_ENST00000479481.1_5'UTR|RRP12_ENST00000414986.1_Silent_p.E997E|RRP12_ENST00000536831.1_Silent_p.E776E|RRP12_ENST00000315563.6_Silent_p.E958E	NM_015179.3	NP_055994.2	Q5JTH9	RRP12_HUMAN	ribosomal RNA processing 12 homolog (S. cerevisiae)	1058	Glu-rich.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(2)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Colorectal(252;0.162)		Epithelial(162;2.72e-09)|all cancers(201;1.76e-07)		cctcctcctcctcttcttcct	0.662																																					p.E1058E													.	.			0			c.G3174A												94.0	108.0	103.0					10																	99126540		2203	4300	6503	SO:0001819	synonymous_variant	23223	exon27			CTCCTCCTCTTCT		CCDS7457.1, CCDS44467.1, CCDS60605.1	10q24.2	2006-11-06	2006-11-06	2006-11-06	ENSG00000052749	ENSG00000052749			29100	protein-coding gene	gene with protein product			"""KIAA0690"""	KIAA0690		9734811	Standard	NM_015179		Approved		uc001knf.3	Q5JTH9	OTTHUMG00000018855	ENST00000370992.4:c.3174G>A	10.37:g.99126540C>T			91	0	0		61	0.07	4	NM_015179	144	0.01	1	B4DK00|E9PCK7|Q5JTH8|Q69YK4|Q96E87|Q9BUH3|Q9Y4C7	Silent	SNP	ENST00000370992.4	37	CCDS7457.1																																																																																					0.662	RRP12-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000049699.4		NM_015179	
CNNM1	26507	mdanderson.org	37	10	101089211	101089211	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:101089211G>T	ENST00000356713.4	+	1	356	c.67G>T	c.(67-69)Gct>Tct	p.A23S	CNNM1_ENST00000370528.3_Missense_Mutation_p.A23S|CNNM1_ENST00000370534.4_5'Flank|CNNM1_ENST00000446890.1_Missense_Mutation_p.A23S	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	23					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		CAGCCGAGGCGCTGTGCTCCT	0.736																																					p.A23S													.	.			0			c.G67T												3.0	4.0	4.0					10																	101089211		1462	2913	4375	SO:0001583	missense	26507	exon1			CGAGGCGCTGTGC	AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.67G>T	10.37:g.101089211G>T	ENSP00000349147:p.Ala23Ser		31	0	0		26	0.08	2	NM_020348	1	0.00	0	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Missense_Mutation	SNP	ENST00000356713.4	37	CCDS7478.2	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177621	0.57692	.	.	ENSG00000119946	ENST00000356713;ENST00000446890;ENST00000370528	D;D;D	0.84070	-1.73;-1.8;-1.79	4.0	4.0	0.46444	.	.	.	.	.	T	0.65491	0.2696	N	0.08118	0	0.80722	D	1	B;B	0.33583	0.418;0.294	B;B	0.24155	0.051;0.023	T	0.67369	-0.5688	9	0.33940	T	0.23	-5.8655	15.0403	0.71785	0.0:0.0:1.0:0.0	.	23;23	Q9NRU3-2;Q9NRU3	.;CNNM1_HUMAN	S	23	ENSP00000349147:A23S;ENSP00000406492:A23S;ENSP00000359559:A23S	ENSP00000349147:A23S	A	+	1	0	CNNM1	101079201	1.000000	0.71417	0.996000	0.52242	0.896000	0.52359	4.158000	0.58150	2.073000	0.62155	0.462000	0.41574	GCT			0.736	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000049792.2		NM_020348	
RBM20	282996	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	10	112559661	112559661	+	Silent	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr10:112559661G>A	ENST00000369519.3	+	7	1843	c.1785G>A	c.(1783-1785)aaG>aaA	p.K595K		NM_001134363.1	NP_001127835.1	Q5T481	RBM20_HUMAN	RNA binding motif protein 20	595					heart development (GO:0007507)|mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(4)|kidney(3)|large_intestine(1)|ovary(1)|skin(2)	12						AGAGATACAAGGAATTGCAGC	0.443																																					p.K595K													.	.			0			c.G1785A												163.0	149.0	153.0					10																	112559661		692	1591	2283	SO:0001819	synonymous_variant	282996	exon7			ATACAAGGAATTG	BX648563	CCDS44477.1	10q25.3	2014-09-17			ENSG00000203867	ENSG00000203867		"""RNA binding motif (RRM) containing"""	27424	protein-coding gene	gene with protein product		613171					Standard	NM_001134363		Approved		uc001kzf.2	Q5T481	OTTHUMG00000019043	ENST00000369519.3:c.1785G>A	10.37:g.112559661G>A			87	0	0		71	0.23	16	NM_001134363	0		0	A6NIP5|B5A868|Q5JVI1	Silent	SNP	ENST00000369519.3	37	CCDS44477.1																																																																																					0.443	RBM20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000050339.2		NM_001134363	
UBQLN3	50613	broad.mit.edu;mdanderson.org	37	11	5529527	5529527	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr11:5529527G>T	ENST00000311659.4	-	2	1409	c.1262C>A	c.(1261-1263)aCt>aAt	p.T421N	HBG2_ENST00000380252.1_5'Flank|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_5'Flank|AC104389.28_ENST00000415970.1_RNA	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	421										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACCTTGTCCAGTACTGTTCTC	0.562																																					p.T421N	Ovarian(72;684 1260 12332 41642 52180)												.	UBQLN3	107		0			c.C1262A												115.0	116.0	116.0					11																	5529527		2201	4297	6498	SO:0001583	missense	50613	exon2			TGTCCAGTACTGT	AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.1262C>A	11.37:g.5529527G>T	ENSP00000347997:p.Thr421Asn		161	0	0		102	0.05	5	NM_017481	0		0	Q9NRE0	Missense_Mutation	SNP	ENST00000311659.4	37	CCDS7758.1	.	.	.	.	.	.	.	.	.	.	G	7.137	0.581033	0.13686	.	.	ENSG00000175520	ENST00000311659	T	0.36699	1.24	4.89	3.98	0.46160	.	0.174778	0.27659	N	0.018381	T	0.32556	0.0833	M	0.75447	2.3	0.09310	N	1	P	0.40476	0.718	B	0.33890	0.172	T	0.23904	-1.0175	10	0.27082	T	0.32	-25.8163	9.3361	0.38051	0.0976:0.0:0.9024:0.0	.	421	Q9H347	UBQL3_HUMAN	N	421	ENSP00000347997:T421N	ENSP00000347997:T421N	T	-	2	0	UBQLN3	5486103	0.023000	0.18921	0.002000	0.10522	0.622000	0.37654	2.181000	0.42547	1.420000	0.47138	0.655000	0.94253	ACT			0.562	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143348.1		NM_017481	
DCHS1	8642	mdanderson.org	37	11	6643167	6643167	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr11:6643167G>T	ENST00000299441.3	-	21	10151	c.9740C>A	c.(9739-9741)tCa>tAa	p.S3247*	TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000299427.6_5'Flank|TPP1_ENST00000528657.1_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3247					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.S3247L(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATGGCAGCTGAGGACAGGGA	0.632																																					p.S3247X													DCHS1,pharynx,carcinoma,0,1	DCHS1	0	1	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.C9740A												61.0	56.0	58.0					11																	6643167		2201	4296	6497	SO:0001587	stop_gained	8642	exon21			GCAGCTGAGGACA	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9740C>A	11.37:g.6643167G>T	ENSP00000299441:p.Ser3247*		74	0	0		40	0.08	3	NM_003737	48	0.00	0	O15098	Nonsense_Mutation	SNP	ENST00000299441.3	37	CCDS7771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	52|52	19.686354|19.686354	0.99922|0.99922	.|.	.|.	ENSG00000166341|ENSG00000166341	ENST00000442153|ENST00000299441	.|.	.|.	.|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|0.000000	.|0.35805	.|N	.|0.002976	T|.	0.44052|.	0.1275|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.31916|.	-0.9926|.	5|.	0.87932|0.02654	D|T	0|1	.|.	17.0523|17.0523	0.86523|0.86523	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	7|3247	.|.	ENSP00000390601:Q7K|ENSP00000299441:S3247X	Q|S	-|-	1|2	0|0	DCHS1|DCHS1	6599743|6599743	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.559000|9.559000	0.98135|0.98135	2.595000|2.595000	0.87683|0.87683	0.462000|0.462000	0.41574|0.41574	CAG|TCA			0.632	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257258.1		NM_003737	
TMEM135	65084	broad.mit.edu	37	11	87032260	87032260	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr11:87032260G>T	ENST00000305494.5	+	15	1301	c.1262G>T	c.(1261-1263)cGa>cTa	p.R421L	TMEM135_ENST00000340353.7_Missense_Mutation_p.R399L|TMEM135_ENST00000532959.1_Missense_Mutation_p.R292L|TMEM135_ENST00000535167.1_Missense_Mutation_p.R282L	NM_022918.3	NP_075069.3	Q86UB9	TM135_HUMAN	transmembrane protein 135	421					peroxisome organization (GO:0007031)	integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTCATGAACCGAAAAGTCCTT	0.328																																					p.R421L													TMEM135,colon,carcinoma,+1,1	TMEM135	40	1	0			c.G1262T												87.0	83.0	84.0					11																	87032260		2201	4299	6500	SO:0001583	missense	65084	exon15			TGAACCGAAAAGT	BX648678	CCDS8280.1, CCDS53692.1	11q14.2	2006-03-09			ENSG00000166575	ENSG00000166575			26167	protein-coding gene	gene with protein product						12477932	Standard	NM_022918		Approved	FLJ22104	uc001pch.3	Q86UB9	OTTHUMG00000167248	ENST00000305494.5:c.1262G>T	11.37:g.87032260G>T	ENSP00000306344:p.Arg421Leu		139	0	0		96	0.03	3	NM_022918	20	0.00	0	Q6AW91|Q8ND01|Q9H6M3	Missense_Mutation	SNP	ENST00000305494.5	37	CCDS8280.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.075969	0.55646	.	.	ENSG00000166575	ENST00000340353;ENST00000544294;ENST00000532959;ENST00000305494;ENST00000535167	T;T;T;T	0.55413	0.56;0.54;0.52;0.54	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.71913	0.3396	M	0.68728	2.09	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.70245	-0.4925	9	.	.	.	-4.7877	18.6946	0.91596	0.0:0.0:1.0:0.0	.	399;421	Q86UB9-2;Q86UB9	.;TM135_HUMAN	L	399;258;292;421;282	ENSP00000345513:R399L;ENSP00000436179:R292L;ENSP00000306344:R421L;ENSP00000439525:R282L	.	R	+	2	0	TMEM135	86709908	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.938000	0.92943	2.665000	0.90641	0.655000	0.94253	CGA			0.328	TMEM135-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393875.1		NM_022918	
ZBTB16	7704	mdanderson.org	37	11	114121101	114121101	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr11:114121101G>T	ENST00000335953.4	+	7	2226	c.1846G>T	c.(1846-1848)Gcc>Tcc	p.A616S	RP11-64D24.2_ENST00000544925.1_RNA|ZBTB16_ENST00000535379.1_3'UTR|ZBTB16_ENST00000392996.2_Missense_Mutation_p.A616S	NM_006006.4	NP_005997.2	Q05516	ZBT16_HUMAN	zinc finger and BTB domain containing 16	616					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|cartilage development (GO:0051216)|central nervous system development (GO:0007417)|embryonic digit morphogenesis (GO:0042733)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic pattern specification (GO:0009880)|forelimb morphogenesis (GO:0035136)|hemopoiesis (GO:0030097)|male germ-line stem cell asymmetric division (GO:0048133)|mesonephros development (GO:0001823)|myeloid cell differentiation (GO:0030099)|negative regulation of cell proliferation (GO:0008285)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of ossification (GO:0045778)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to nucleus (GO:0034504)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear body (GO:0016604)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(2)	6		all_cancers(61;3.79e-18)|all_epithelial(67;2.32e-10)|all_hematologic(158;2.96e-05)|Melanoma(852;0.000362)|Acute lymphoblastic leukemia(157;0.00108)|Breast(348;0.0104)|all_neural(223;0.0294)|Prostate(24;0.0318)|Medulloblastoma(222;0.0438)		BRCA - Breast invasive adenocarcinoma(274;6.75e-06)|Epithelial(105;0.000181)|all cancers(92;0.0018)		GGACTACTCGGCCATGATCAA	0.602																																					p.A616S													.	.			0			c.G1846T												105.0	90.0	95.0					11																	114121101		2201	4296	6497	SO:0001583	missense	7704	exon7			TACTCGGCCATGA	Z19002	CCDS8367.1	11q23	2013-10-17	2004-07-16	2004-07-16	ENSG00000109906	ENSG00000109906		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12930	protein-coding gene	gene with protein product	"""promyelocytic leukaemia zinc finger"""	176797	"""zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia)"""	ZNF145			Standard	XM_006718899		Approved	PLZF	uc001poq.3	Q05516	OTTHUMG00000168243	ENST00000335953.4:c.1846G>T	11.37:g.114121101G>T	ENSP00000338157:p.Ala616Ser		62	0	0		38	0.08	3	NM_006006	2	0.00	0	Q8TAL4	Missense_Mutation	SNP	ENST00000335953.4	37	CCDS8367.1	.	.	.	.	.	.	.	.	.	.	g	17.11	3.306407	0.60305	.	.	ENSG00000109906	ENST00000335953;ENST00000392996;ENST00000310883	T;T	0.59638	0.25;0.25	5.28	5.28	0.74379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.54919	0.1888	N	0.04746	-0.17	0.58432	D	0.999998	D	0.55605	0.972	D	0.63597	0.916	T	0.56294	-0.8003	10	0.18276	T	0.48	-9.6137	18.8905	0.92399	0.0:0.0:1.0:0.0	.	616	Q05516	ZBT16_HUMAN	S	616;616;493	ENSP00000338157:A616S;ENSP00000376721:A616S	ENSP00000309507:A493S	A	+	1	0	ZBTB16	113626311	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.762000	0.98944	2.460000	0.83146	0.443000	0.29094	GCC			0.602	ZBTB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398940.1		NM_006006	
ETV6	2120	mdanderson.org	37	12	12022716	12022716	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr12:12022716G>T	ENST00000396373.4	+	5	1096	c.822G>T	c.(820-822)atG>atT	p.M274I		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	274					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				GCCCCATCATGCACCCTCTGA	0.617			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																p.M274I				Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	.	.			0			c.G822T												89.0	86.0	87.0					12																	12022716		2203	4300	6503	SO:0001583	missense	2120	exon5			CATCATGCACCCT	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.822G>T	12.37:g.12022716G>T	ENSP00000379658:p.Met274Ile		31	0	0		50	0.06	3	NM_001987	13	0.00	0	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	ENST00000396373.4	37	CCDS8643.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531284	0.85706	.	.	ENSG00000139083	ENST00000396373	T	0.03717	3.83	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.06872	0.0175	M	0.68952	2.095	0.80722	D	1	B	0.28880	0.226	B	0.22601	0.04	T	0.38067	-0.9678	10	0.18710	T	0.47	.	19.571	0.95419	0.0:0.0:1.0:0.0	.	274	P41212	ETV6_HUMAN	I	274	ENSP00000379658:M274I	ENSP00000379658:M274I	M	+	3	0	ETV6	11913983	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.604000	0.90877	2.713000	0.92767	0.655000	0.94253	ATG			0.617	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400130.2		NM_001987	
ASB2	51676	broad.mit.edu	37	14	94405527	94405527	+	Missense_Mutation	SNP	T	T	G	rs199833352		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr14:94405527T>G	ENST00000315988.4	-	6	1888	c.1400A>C	c.(1399-1401)cAc>cCc	p.H467P	ASB2_ENST00000556337.1_5'Flank|ASB2_ENST00000555019.1_Missense_Mutation_p.H515P|RP11-131H24.4_ENST00000557646.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	467					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		GGCCGGCGGGTGCGGGCCGTT	0.692																																					p.H515P													.	ASB2	71		0			c.A1544C												11.0	13.0	12.0					14																	94405527		2100	4140	6240	SO:0001583	missense	51676	exon8			GGCGGGTGCGGGC	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1400A>C	14.37:g.94405527T>G	ENSP00000320675:p.His467Pro		61	0.262295082	16		65	0.31	20	NM_001202429	28	0.11	3	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	37	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	T	17.65	3.443232	0.63067	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.69685	-0.42;-0.34;-0.32	5.07	3.92	0.45320	.	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	M	0.80847	2.515	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.987;0.994;0.987	T	0.78076	-0.2345	10	0.30854	T	0.27	.	12.1543	0.54068	0.0:0.0:0.1436:0.8564	.	483;515;467	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	515;483;467;413;413	ENSP00000451575:H515P;ENSP00000320675:H467P;ENSP00000450940:H413P	ENSP00000320675:H467P	H	-	2	0	ASB2	93475280	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	7.714000	0.84703	0.781000	0.33589	-0.527000	0.04329	CAC			0.692	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000412845.1			
CEP170B	283638	broad.mit.edu;mdanderson.org	37	14	105353593	105353593	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr14:105353593A>G	ENST00000414716.3	+	12	3245	c.3017A>G	c.(3016-3018)cAg>cGg	p.Q1006R	CEP170B_ENST00000453495.1_Missense_Mutation_p.Q1007R|CEP170B_ENST00000556508.1_Missense_Mutation_p.Q936R|CEP170B_ENST00000418279.1_Missense_Mutation_p.Q936R	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1006						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GCCCGTGAGCAGTCCTCAGAG	0.697																																					p.Q1006R													.	.			0			c.A3017G												13.0	17.0	16.0					14																	105353593		2090	4204	6294	SO:0001583	missense	283638	exon12			GTGAGCAGTCCTC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.3017A>G	14.37:g.105353593A>G	ENSP00000404151:p.Gln1006Arg		41	0	0		38	0.18	7	NM_001112726	42	0.12	5	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	37	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.160706	0.00321	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.34275	1.37;1.4;1.39;1.39	4.37	3.47	0.39725	.	0.140478	0.46145	N	0.000305	T	0.10723	0.0262	N	0.01134	-0.995	0.20703	N	0.999868	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.32295	-0.9912	10	0.02654	T	1	-12.8418	11.4304	0.50036	0.0919:0.0:0.9081:0.0	.	1006;1006;936	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	R	936;1006;1007;936	ENSP00000451249:Q936R;ENSP00000404151:Q1006R;ENSP00000407238:Q1007R;ENSP00000415006:Q936R	ENSP00000404151:Q1006R	Q	+	2	0	KIAA0284	104424638	0.488000	0.25996	0.002000	0.10522	0.004000	0.04260	2.432000	0.44784	0.790000	0.33803	-0.415000	0.06103	CAG			0.697	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000410289.2		NM_001112726	
TYRO3	7301	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	15	41854893	41854893	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr15:41854893C>T	ENST00000263798.3	+	4	781	c.557C>T	c.(556-558)tCt>tTt	p.S186F	TYRO3_ENST00000559066.1_Missense_Mutation_p.S141F	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	186	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCCGCTCCCTCTCCATCTGTT	0.567																																					p.S186F													.	.			0			c.C557T												36.0	35.0	35.0					15																	41854893		2203	4300	6503	SO:0001583	missense	7301	exon4			CTCCCTCTCCATC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.557C>T	15.37:g.41854893C>T	ENSP00000263798:p.Ser186Phe		77	0	0		76	0.14	11	NM_006293	127	0.16	20	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	c	19.21	3.782708	0.70222	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.15017	2.46	4.8	4.8	0.61643	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.38663	N	0.001610	T	0.28433	0.0703	M	0.79693	2.465	0.80722	D	1	B	0.33135	0.399	B	0.34590	0.186	T	0.15521	-1.0434	10	0.54805	T	0.06	-13.6273	18.0396	0.89315	0.0:1.0:0.0:0.0	.	186	Q06418	TYRO3_HUMAN	F	118;186	ENSP00000263798:S186F	ENSP00000263798:S186F	S	+	2	0	TYRO3	39642185	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.121000	0.71602	2.481000	0.83766	0.472000	0.43445	TCT			0.567	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252693.2			
KBTBD13	390594	mdanderson.org	37	15	65369189	65369189	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr15:65369189G>T	ENST00000432196.2	+	1	36	c.36G>T	c.(34-36)tgG>tgT	p.W12C	RASL12_ENST00000434605.2_5'Flank	NM_001101362.2	NP_001094832.1	C9JR72	KBTBD_HUMAN	kelch repeat and BTB (POZ) domain containing 13	12	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				lung(1)|prostate(1)|skin(1)	3						TGCAGGTGTGGGTGGGCGGCC	0.711																																					p.W12C													.	.			0			c.G36T												7.0	11.0	10.0					15																	65369189		1880	4039	5919	SO:0001583	missense	390594	exon1			GGTGTGGGTGGGC		CCDS45281.1	15q22.31	2014-09-17			ENSG00000234438	ENSG00000234438		"""BTB/POZ domain containing"""	37227	protein-coding gene	gene with protein product	"""nemaline myopathy type 6"""	613727				21109227, 22542517	Standard	NM_001101362		Approved	hCG_1645727, NEM6	uc010uis.2	C9JR72		ENST00000432196.2:c.36G>T	15.37:g.65369189G>T	ENSP00000388723:p.Trp12Cys		13	0	0		26	0.12	3	NM_001101362	3	0.00	0		Missense_Mutation	SNP	ENST00000432196.2	37	CCDS45281.1	.	.	.	.	.	.	.	.	.	.	G	7.840	0.721763	0.15372	.	.	ENSG00000234438	ENST00000432196	T	0.66995	-0.24	4.44	4.44	0.53790	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.46249	0.1383	N	0.22421	0.69	0.48571	D	0.999679	B	0.19817	0.039	B	0.15484	0.013	T	0.47249	-0.9132	9	0.37606	T	0.19	.	3.3973	0.07311	0.0934:0.1695:0.5615:0.1755	.	12	C9JR72	KBTBD_HUMAN	C	12	ENSP00000388723:W12C	ENSP00000388723:W12C	W	+	3	0	KBTBD13	63156242	0.991000	0.36638	1.000000	0.80357	0.550000	0.35303	0.645000	0.24782	2.294000	0.77228	0.650000	0.86243	TGG			0.711	KBTBD13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000418468.2		NM_001101362	
ARNT2	9915	broad.mit.edu	37	15	80883970	80883970	+	Nonsense_Mutation	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr15:80883970G>A	ENST00000303329.4	+	18	2145	c.1980G>A	c.(1978-1980)tgG>tgA	p.W660*	ARNT2_ENST00000533983.1_Nonsense_Mutation_p.W649*|ARNT2_ENST00000527771.1_Nonsense_Mutation_p.W649*	NM_014862.3	NP_055677.3	Q9HBZ2	ARNT2_HUMAN	aryl-hydrocarbon receptor nuclear translocator 2	660					central nervous system development (GO:0007417)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	aryl hydrocarbon receptor binding (GO:0017162)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|pancreas(2)|prostate(2)|skin(1)	35			BRCA - Breast invasive adenocarcinoma(143;0.134)			GGTCGCAGTGGCAAAGCCAGC	0.577																																					p.W660X													.	ARNT2	88		0			c.G1980A												115.0	111.0	112.0					15																	80883970		2203	4300	6503	SO:0001587	stop_gained	9915	exon18			GCAGTGGCAAAGC	AB002305	CCDS32307.1	15q25.1	2013-05-21			ENSG00000172379	ENSG00000172379		"""Basic helix-loop-helix proteins"""	16876	protein-coding gene	gene with protein product		606036				11247670	Standard	NM_014862		Approved	KIAA0307, bHLHe1	uc002bfr.3	Q9HBZ2	OTTHUMG00000165478	ENST00000303329.4:c.1980G>A	15.37:g.80883970G>A	ENSP00000307479:p.Trp660*		207	0.0048309179	1		198	0.02	4	NM_014862	2	0.00	0	B4DIS7|O15024|Q8IYC2	Nonsense_Mutation	SNP	ENST00000303329.4	37	CCDS32307.1	.	.	.	.	.	.	.	.	.	.	G	40	8.086756	0.98646	.	.	ENSG00000172379	ENST00000360062;ENST00000303329	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.7216	0.91697	0.0:0.0:1.0:0.0	.	.	.	.	X	649;660	.	ENSP00000307479:W660X	W	+	3	0	ARNT2	78671025	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.771000	0.91751	2.414000	0.81942	0.462000	0.41574	TGG			0.577	ARNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384389.2			
CSPG4P5	114817	broad.mit.edu	37	15	84957480	84957499	+	RNA	DEL	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA	-	rs554759799|rs529134831|rs548880213	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr15:84957480_84957499delGGCCCCACATCCATTGAGAA	ENST00000558801.1	-	0	7230_7249									DNM1 pseudogene 51																		TGTGTGCACTGGCCCCACATCCATTGAGAAGGCCCCACAT	0.586														762	0.152157	0.146	0.3256	5008	,	,		24353	0.1339		0.1481	False		,,,				2504	0.0603				.													.	.			0			.																																											0	.			TGCACTGGCCCCA			15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957480_84957499delGGCCCCACATCCATTGAGAA			7	0	0		15	0.47	7	.	0		0		RNA	DEL	ENST00000558801.1	37																																																																																						0.586	DNM1P51-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000471721.1			
PRR35	146325	broad.mit.edu;bcgsc.ca;mdanderson.org	37	16	614076	614076	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr16:614076C>T	ENST00000409413.3	+	2	1061	c.782C>T	c.(781-783)gCc>gTc	p.A261V	NHLRC4_ENST00000424439.2_5'Flank|PIGQ_ENST00000409527.2_5'Flank|NHLRC4_ENST00000540585.1_5'Flank	NM_145270.2	NP_660313.1	P0CG20	PRR35_HUMAN		261	Pro-rich.									central_nervous_system(1)|endometrium(1)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10						CCCACCCCGGCCCCCCGCCTG	0.736																																					p.A261V													.	C16orf11	27		0			c.C782T												3.0	3.0	3.0					16																	614076		1321	3162	4483	SO:0001583	missense	146325	exon2			CCCCGGCCCCCCG																												ENST00000409413.3:c.782C>T	16.37:g.614076C>T	ENSP00000386499:p.Ala261Val		26	0	0		17	0.24	4	NM_145270	0		0	B8ZZ27|Q8N233|Q96AX3|Q96S23	Missense_Mutation	SNP	ENST00000409413.3	37	CCDS45365.1	.	.	.	.	.	.	.	.	.	.	C	0.984	-0.696145	0.03279	.	.	ENSG00000161992	ENST00000409413	T	0.09350	2.99	5.0	-3.5	0.04710	.	1.437530	0.05000	N	0.468952	T	0.05456	0.0144	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.41448	-0.9508	10	0.34782	T	0.22	.	7.1871	0.25804	0.0:0.4101:0.2153:0.3746	.	261	P0CG20	CP011_HUMAN	V	261	ENSP00000386499:A261V	ENSP00000386499:A261V	A	+	2	0	C16orf11	554077	0.001000	0.12720	0.002000	0.10522	0.000000	0.00434	0.629000	0.24538	-0.884000	0.03976	-1.867000	0.00556	GCC			0.736	C16orf11-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000333913.1			
EME2	197342	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	1825969	1825969	+	Silent	SNP	C	C	A	rs143964421	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr16:1825969C>A	ENST00000568449.1	+	7	972	c.951C>A	c.(949-951)tcC>tcA	p.S317S	MRPS34_ENST00000397375.2_5'Flank|MRPS34_ENST00000177742.3_5'Flank|EME2_ENST00000307394.7_Silent_p.S382S	NM_001257370.1	NP_001244299.1	A4GXA9	EME2_HUMAN	essential meiotic structure-specific endonuclease subunit 2	317					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)			central_nervous_system(1)|kidney(2)|lung(5)|pancreas(1)	9						CCTTCCCCTCCCCCCGCCTTC	0.692								Direct reversal of damage;Homologous recombination					C|||	6	0.00119808	0.0	0.0	5008	,	,		15043	0.0		0.001	False		,,,				2504	0.0051				p.S317S													.	.			0			c.C951A												20.0	17.0	18.0					16																	1825969		2183	4276	6459	SO:0001819	synonymous_variant	197342	exon7			CCCCTCCCCCCGC	AK074080	CCDS58404.1	16p13.3	2013-07-03	2013-07-03			ENSG00000197774			27289	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog B (S. cerevisiae)"""	610886	"""essential meiotic endonuclease 1 homolog 2 (S. pombe)"""			12721304	Standard	NM_001257370		Approved	FLJ00151, SLX2B	uc010brw.1	A4GXA9		ENST00000568449.1:c.951C>A	16.37:g.1825969C>A			40	0	0		35	0.23	8	NM_001257370	1	0.00	0	Q8TEP2|Q96RY3	Silent	SNP	ENST00000568449.1	37	CCDS58404.1																																																																																			0		0.692	EME2-001	NOVEL	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000433185.2		NM_001010865	
LOC653786	653786	broad.mit.edu	37	16	22579566	22579569	+	RNA	DEL	ATTC	ATTC	-	rs370421878|rs200819155		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	ATTC	ATTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr16:22579566_22579569delATTC	ENST00000550753.1	+	0	1976					NR_003676.2																						AAATGGGTTAattcatccatccat	0.426																																					.													.	.			0			.																																											0	.			GGGTTAATTCATC																													16.37:g.22579566_22579569delATTC			90	0.0222222222	2		85	0.15	13	.	0		0		RNA	DEL	ENST00000550753.1	37																																																																																						0.426	RP11-368J21.3-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000409041.1			
FAM65A	79567	mdanderson.org	37	16	67575907	67575907	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr16:67575907G>T	ENST00000379312.3	+	13	1351	c.1230G>T	c.(1228-1230)caG>caT	p.Q410H	CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000428437.2_Missense_Mutation_p.Q420H|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.Q406H|FAM65A_ENST00000422602.2_Missense_Mutation_p.Q426H|FAM65A_ENST00000540839.3_Missense_Mutation_p.Q426H|CTD-2012K14.2_ENST00000567122.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	410						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		TGGTGCAGCAGCCCGAGCCCC	0.652																																					p.Q426H													.	.			0			c.G1278T												37.0	43.0	41.0					16																	67575907		2197	4297	6494	SO:0001583	missense	79567	exon13			GCAGCAGCCCGAG	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.1230G>T	16.37:g.67575907G>T	ENSP00000368614:p.Gln410His		48	0	0		25	0.12	3	NM_001193523	32	0.00	0	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.65|11.65	1.701380|1.701380	0.30142|0.30142	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000428437|ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	.|T;T;T	.|0.15718	.|2.4;2.4;2.4	5.12|5.12	-0.457|-0.457	0.12186|0.12186	.|.	.|0.372012	.|0.24547	.|N	.|0.037590	T|T	0.11836|0.11836	0.0288|0.0288	L|L	0.36672|0.36672	1.1|1.1	0.30125|0.30125	N|N	0.80537|0.80537	.|B;B;B;B	.|0.29188	.|0.236;0.236;0.236;0.236	.|B;B;B;B	.|0.28553	.|0.091;0.091;0.091;0.091	T|T	0.16305|0.16305	-1.0407|-1.0407	5|10	.|0.30854	.|T	.|0.27	-4.7845|-4.7845	10.5167|10.5167	0.44894|0.44894	0.3783:0.0:0.6217:0.0|0.3783:0.0:0.6217:0.0	.|.	.|420;426;410;426	.|B4DIM2;E9PBS3;Q6ZS17;B4DEQ9	.|.;.;FA65A_HUMAN;.	S|H	401|410;406;426;420	.|ENSP00000368614:Q410H;ENSP00000042381:Q406H;ENSP00000400099:Q426H	.|ENSP00000042381:Q406H	A|Q	+|+	1|3	0|2	FAM65A|FAM65A	66133408|66133408	0.998000|0.998000	0.40836|0.40836	0.996000|0.996000	0.52242|0.52242	0.589000|0.589000	0.36550|0.36550	0.988000|0.988000	0.29616|0.29616	0.049000|0.049000	0.15920|0.15920	0.543000|0.543000	0.68304|0.68304	GCC|CAG			0.652	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000268866.3		NM_024519	
CENPT	80152	hgsc.bcm.edu	37	16	67864336	67864336	+	Silent	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr16:67864336G>A	ENST00000562787.1	-	11	1367	c.819C>T	c.(817-819)gcC>gcT	p.A273A	CENPT_ENST00000564817.1_Silent_p.A273A|CENPT_ENST00000440851.2_Silent_p.A273A|CENPT_ENST00000562947.1_5'UTR|CENPT_ENST00000219172.3_Silent_p.A273A	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	273	Flexible stalk domain. {ECO:0000250}.				chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		TCTTGCGACCGGCAGCCTGCT	0.597																																					p.A273A													.	.			0			c.C819T												57.0	67.0	64.0					16																	67864336		2114	4246	6360	SO:0001819	synonymous_variant	80152	exon11			GCGACCGGCAGCC	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.819C>T	16.37:g.67864336G>A			111	0	0		100	0.04	4	NM_025082	179	0.00	0	Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	37	CCDS42182.1																																																																																					0.597	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000422020.1		NM_025082	
ZBTB4	57659	broad.mit.edu;mdanderson.org	37	17	7366300	7366300	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr17:7366300G>T	ENST00000311403.4	-	4	2340	c.2001C>A	c.(1999-2001)taC>taA	p.Y667*	ZBTB4_ENST00000380599.4_Nonsense_Mutation_p.Y667*	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	667					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		TGTAGGAGTAGTAGGGCCTCC	0.642																																					p.Y667X													.	ZBTB4	163		0			c.C2001A												61.0	61.0	61.0					17																	7366300		2203	4300	6503	SO:0001587	stop_gained	57659	exon4			GGAGTAGTAGGGC	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.2001C>A	17.37:g.7366300G>T	ENSP00000307858:p.Tyr667*		43	0	0		41	0.07	3	NM_001128833	23	0.00	0	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Nonsense_Mutation	SNP	ENST00000311403.4	37	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	G	38	7.212826	0.98139	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	.	.	.	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3761	7.555	0.27819	0.1746:0.0:0.8254:0.0	.	.	.	.	X	667	.	ENSP00000307858:Y667X	Y	-	3	2	ZBTB4	7307024	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	3.110000	0.50352	2.643000	0.89663	0.462000	0.41574	TAC			0.642	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226940.2		NM_020899	
KRTAP4-8	728224	mdanderson.org	37	17	39254149	39254149	+	Missense_Mutation	SNP	G	G	C	rs201246375		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr17:39254149G>C	ENST00000333822.4	-	1	244	c.188C>G	c.(187-189)aCc>aGc	p.T63S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	63	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						GCGACAGCAGGTGGGCTGGCA	0.652																																					p.T63S													.	.			0			c.C188G												7.0	10.0	9.0					17																	39254149		651	1515	2166	SO:0001583	missense	728224	exon1			CAGCAGGTGGGCT	AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.188C>G	17.37:g.39254149G>C	ENSP00000328444:p.Thr63Ser		23	0	0		16	0.19	3	NM_031960	0		0	A8MSH3	Missense_Mutation	SNP	ENST00000333822.4	37	CCDS45674.1	.	.	.	.	.	.	.	.	.	.	.	3.249	-0.153662	0.06585	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.01215	5.16	3.11	-1.04	0.10068	.	1.573260	0.03861	N	0.273912	T	0.00724	0.0024	N	0.10809	0.05	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.43637	-0.9379	10	0.05721	T	0.95	.	4.7356	0.12986	0.2319:0.434:0.3341:0.0	.	63	Q9BYQ9	KRA48_HUMAN	S	63	ENSP00000328444:T63S	ENSP00000414561:T63S	T	-	2	0	KRTAP4-8	36507675	0.000000	0.05858	0.109000	0.21407	0.234000	0.25298	-2.396000	0.01052	-0.528000	0.06366	0.449000	0.29647	ACC			0.652	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257684.1		NM_031960	
CDH19	28513	mdanderson.org	37	18	64211262	64211262	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr18:64211262G>T	ENST00000540086.1	-	7	1406	c.1160C>A	c.(1159-1161)tCa>tAa	p.S387*	CDH19_ENST00000262150.2_Nonsense_Mutation_p.S387*	NM_001271028.1	NP_001257957.1	Q96JQ0	PCD16_HUMAN	cadherin 19, type 2	490	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(22)|ovary(1)|prostate(3)|skin(7)	61		Esophageal squamous(42;0.0132)				GCCTACAAATGATCCCTGTGG	0.388																																					p.S387X													.	.			0			c.C1160A												52.0	52.0	52.0					18																	64211262		2203	4300	6503	SO:0001587	stop_gained	28513	exon7			ACAAATGATCCCT	AJ007607	CCDS11994.1, CCDS59325.1	18q22.1	2010-01-26			ENSG00000071991	ENSG00000071991		"""Cadherins / Major cadherins"""	1758	protein-coding gene	gene with protein product		603016				10995570	Standard	NM_021153		Approved	CDH7	uc002lkc.2	Q9H159	OTTHUMG00000132802	ENST00000540086.1:c.1160C>A	18.37:g.64211262G>T	ENSP00000439593:p.Ser387*		129	0	0		81	0.05	4	NM_001271028	1	0.00	0	O15098	Nonsense_Mutation	SNP	ENST00000540086.1	37	CCDS59325.1	.	.	.	.	.	.	.	.	.	.	G	37	6.319339	0.97471	.	.	ENSG00000071991	ENST00000262150;ENST00000540086;ENST00000454642	.	.	.	5.62	4.76	0.60689	.	0.222293	0.39985	N	0.001202	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	14.7364	0.69419	0.0703:0.0:0.9297:0.0	.	.	.	.	X	387;387;332	.	ENSP00000262150:S387X	S	-	2	0	CDH19	62362242	0.949000	0.32298	0.013000	0.15412	0.549000	0.35272	2.743000	0.47442	1.531000	0.49152	-0.143000	0.13931	TCA			0.388	CDH19-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000442285.1		NM_021153	
DOT1L	84444	mdanderson.org	37	19	2226425	2226425	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:2226425G>T	ENST00000398665.3	+	27	3941	c.3905G>T	c.(3904-3906)gGg>gTg	p.G1302V		NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase	1302					histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCCCTGTCGGGGGCTGACGGA	0.677																																					p.G1302V													.	.			0			c.G3905T												13.0	17.0	16.0					19																	2226425		1957	4111	6068	SO:0001583	missense	84444	exon27			TGTCGGGGGCTGA	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.3905G>T	19.37:g.2226425G>T	ENSP00000381657:p.Gly1302Val		22	0.0454545455	1		20	0.10	2	NM_032482	79	0.00	0	O60379|Q96JL1	Missense_Mutation	SNP	ENST00000398665.3	37	CCDS42460.1	.	.	.	.	.	.	.	.	.	.	G	11.03	1.517752	0.27123	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000457590	T;T	0.34667	1.78;1.35	3.91	2.82	0.32997	.	0.130398	0.34828	N	0.003654	T	0.34513	0.0900	L	0.50333	1.59	0.28764	N	0.900729	B;B	0.28760	0.028;0.221	B;B	0.37239	0.004;0.244	T	0.37126	-0.9719	10	0.87932	D	0	-13.3176	7.5633	0.27864	0.0:0.1909:0.6277:0.1814	.	1302;1302	Q8TEK3;Q8TEK3-2	DOT1L_HUMAN;.	V	1302;1302;182	ENSP00000381657:G1302V;ENSP00000407411:G182V	ENSP00000221482:G1302V	G	+	2	0	DOT1L	2177425	0.944000	0.32072	0.028000	0.17463	0.010000	0.07245	1.051000	0.30417	0.719000	0.32188	0.561000	0.74099	GGG			0.677	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000318066.1		NM_032482	
OR7C2	26658	broad.mit.edu	37	19	15052604	15052604	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:15052604delT	ENST00000248072.3	+	1	304	c.304delT	c.(304-306)tttfs	p.F104fs		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					CACTCAGATATTTTTTTTCAT	0.468																																					p.F102fs													.	OR7C2	50		0			c.304delT												56.0	54.0	55.0					19																	15052604		2203	4300	6503	SO:0001589	frameshift_variant	26658	exon1			CAGATATTTTTTT	U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.304delT	19.37:g.15052604delT	ENSP00000248072:p.Phe104fs		166	0	0		191	0.04	8	NM_012377	0		0	O43881|Q6IFP9	Frame_Shift_Del	DEL	ENST00000248072.3	37	CCDS12320.1																																																																																					0.468	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466281.1			
ZNF676	163223	ucsc.edu	37	19	22363172	22363172	+	Silent	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:22363172G>A	ENST00000397121.2	-	3	1664	c.1347C>T	c.(1345-1347)taC>taT	p.Y449Y		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CTTCACATTTGTAGGGTTTCT	0.438																																					p.Y449Y													.	ZNF676	146		0			c.C1347T																																									SO:0001819	synonymous_variant	163223	exon3			ACATTTGTAGGGT	AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.1347C>T	19.37:g.22363172G>A			74	0.0405405405	3		75	0.04	3	NM_001001411	56	0.27	15	A8MVX5	Silent	SNP	ENST00000397121.2	37	CCDS42539.1																																																																																					0.438	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000464392.1		NM_001001411	
ZNF540	163255	hgsc.bcm.edu	37	19	38103206	38103206	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:38103206T>C	ENST00000592533.1	+	5	1357	c.1025T>C	c.(1024-1026)cTt>cCt	p.L342P	ZNF540_ENST00000316433.4_Missense_Mutation_p.L342P|ZNF540_ENST00000343599.5_Missense_Mutation_p.L342P|ZNF540_ENST00000589117.1_Missense_Mutation_p.L310P	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	342					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGCGGACAACTTACCCGTCAT	0.363																																					p.L342P													.	.			0			c.T1025C												73.0	70.0	71.0					19																	38103206		2203	4300	6503	SO:0001583	missense	163255	exon5			GACAACTTACCCG	AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1025T>C	19.37:g.38103206T>C	ENSP00000466274:p.Leu342Pro		99	0	0		77	0.05	4	NM_152606	17	0.00	0	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	ENST00000592533.1	37	CCDS12506.1	.	.	.	.	.	.	.	.	.	.	T	15.35	2.808865	0.50421	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T;T	0.53857	0.6;3.04	2.39	2.39	0.29439	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.77054	0.4074	H	0.95079	3.62	0.23351	N	0.997859	D;D	0.89917	1.0;1.0	D;D	0.67548	0.92;0.952	T	0.65796	-0.6081	9	0.87932	D	0	.	9.4104	0.38489	0.0:0.0:0.0:1.0	.	310;342	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	P	342;310	ENSP00000324598:L342P;ENSP00000343768:L310P	ENSP00000324598:L342P	L	+	2	0	ZNF540	42795046	0.354000	0.24912	0.037000	0.18230	0.429000	0.31625	3.977000	0.56874	1.081000	0.41110	0.254000	0.18369	CTT			0.363	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000459481.1		NM_152606	
TOMM40	10452	broad.mit.edu	37	19	45404037	45404037	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:45404037G>T	ENST00000426677.2	+	6	874	c.694G>T	c.(694-696)Ggt>Tgt	p.G232C	TOMM40_ENST00000405636.2_Missense_Mutation_p.G232C|TOMM40_ENST00000592434.1_Missense_Mutation_p.G232C|TOMM40_ENST00000252487.5_Missense_Mutation_p.G232C	NM_001128917.1	NP_001122389.1	O96008	TOM40_HUMAN	translocase of outer mitochondrial membrane 40 homolog (yeast)	232					cellular protein metabolic process (GO:0044267)|ion transport (GO:0006811)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial outer membrane translocase complex (GO:0005742)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein transmembrane transporter activity (GO:0008320)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|ovary(1)	5	Lung NSC(12;0.0018)|all_lung(12;0.00481)			OV - Ovarian serous cystadenocarcinoma(262;0.0033)|Epithelial(262;0.176)		CCTGGCCCTGGGTGGAGAGCT	0.612																																					p.G232C													.	TOMM40	13		0			c.G694T												66.0	58.0	61.0					19																	45404037		2203	4300	6503	SO:0001583	missense	10452	exon6			GCCCTGGGTGGAG	AF043250	CCDS12646.1	19q13	2008-07-04				ENSG00000130204			18001	protein-coding gene	gene with protein product		608061				10980201, 15644312	Standard	NM_006114		Approved	PEREC1, D19S1177E, C19orf1, TOM40, PER-EC1	uc002paa.4	O96008		ENST00000426677.2:c.694G>T	19.37:g.45404037G>T	ENSP00000410339:p.Gly232Cys		159	0	0		127	0.03	4	NM_001128917	478	0.00	0	Q86VW4|Q8WY09|Q8WY10|Q8WY11|Q9BR95	Missense_Mutation	SNP	ENST00000426677.2	37	CCDS12646.1	.	.	.	.	.	.	.	.	.	.	g	19.60	3.857985	0.71834	.	.	ENSG00000130204	ENST00000426677;ENST00000405636;ENST00000252487	D;D;D	0.96427	-4.01;-4.01;-4.01	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	D	0.98413	0.9472	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99316	1.0905	10	0.87932	D	0	-14.2944	14.5157	0.67818	0.0:0.0:1.0:0.0	.	232;232	O96008-2;O96008	.;TOM40_HUMAN	C	232	ENSP00000410339:G232C;ENSP00000385184:G232C;ENSP00000252487:G232C	ENSP00000252487:G232C	G	+	1	0	TOMM40	50095877	1.000000	0.71417	1.000000	0.80357	0.587000	0.36485	9.431000	0.97494	2.286000	0.76751	0.457000	0.33378	GGT			0.612	TOMM40-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000453241.1			
ZNF524	147807	mdanderson.org	37	19	56113901	56113901	+	Silent	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr19:56113901G>A	ENST00000591046.1	+	1	657	c.423G>A	c.(421-423)ccG>ccA	p.P141P	FIZ1_ENST00000592585.1_5'Flank|ZNF865_ENST00000568956.1_5'Flank|ZNF524_ENST00000301073.3_Silent_p.P141P			Q96C55	ZN524_HUMAN	zinc finger protein 524	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|large_intestine(2)|lung(6)|prostate(1)	10			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		AGCTGAAGCCGCACCAGTGCA	0.677																																					p.P141P													.	.			0			c.G423A												14.0	16.0	15.0					19																	56113901		2201	4296	6497	SO:0001819	synonymous_variant	147807	exon2			GAAGCCGCACCAG	BC014666	CCDS12929.1	19q13.43	2013-01-08				ENSG00000171443		"""Zinc fingers, C2H2-type"""	28322	protein-coding gene	gene with protein product						12477932	Standard	NM_153219		Approved	MGC23143	uc002qlk.1	Q96C55		ENST00000591046.1:c.423G>A	19.37:g.56113901G>A			26	0	0		25	0.12	3	NM_153219	34	0.00	0	Q6NW31|Q96IL7	Silent	SNP	ENST00000591046.1	37	CCDS12929.1																																																																																					0.677	ZNF524-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000457938.1		NM_153219	
AC021021.2	0	bcgsc.ca	37	2	6636132	6636132	+	lincRNA	SNP	G	G	T	rs112561968	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:6636132G>T	ENST00000436082.1	+	0	0																											GAAGTGCTTCGTTAAACTTCA	0.547																																					.													.	.			0			.																																											0	.			TGCTTCGTTAAAC																													2.37:g.6636132G>T			48	0	0		40	0.18	7	.	0		0		RNA	SNP	ENST00000436082.1	37																																																																																						0.547	AC021021.2-001	KNOWN	basic|exp_conf	lincRNA	lincRNA		OTTHUMT00000322748.1			
ANKRD36BP2	645784	broad.mit.edu	37	2	89104503	89104504	+	RNA	INS	-	-	C	rs149625899|rs67367050	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:89104503_89104504insC	ENST00000393525.3	+	0	4868									ankyrin repeat domain 36B pseudogene 2																		gtagatttttttcagattttgg	0.307													-|-|C|insertion	512	0.102236	0.1067	0.0965	5008	,	,		29304	0.0694		0.1064	False		,,,				2504	0.1299				.													.	.			0			.																																											0	.			ATTTTTTTCAGAT			2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89104503_89104504insC			16	0.375	6		20	0.55	11	.	0		0		RNA	INS	ENST00000393525.3	37																																																																																						0.307	ANKRD36BP2-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000323523.1			
FAM178B	51252	mdanderson.org	37	2	97633354	97633354	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:97633354G>T	ENST00000417561.3	-	9	1080	c.1081C>A	c.(1081-1083)Ctg>Atg	p.L361M	FAM178B_ENST00000490605.2_Missense_Mutation_p.L213M|FAM178B_ENST00000327896.3_Missense_Mutation_p.L181M			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	361										large_intestine(1)|ovary(1)	2						TCCTGCTCCAGGGCCTGTTCC	0.582																																					p.L213M													.	.			0			c.C637A												30.0	32.0	31.0					2																	97633354		692	1591	2283	SO:0001583	missense	51252	exon5			GCTCCAGGGCCTG	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.1081C>A	2.37:g.97633354G>T	ENSP00000413245:p.Leu361Met		28	0	0		23	0.09	2	NM_001122646	5	0.00	0	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	37		.	.	.	.	.	.	.	.	.	.	G	9.845	1.192213	0.21954	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000490605	T;T;T	0.50277	0.75;0.79;0.78	3.53	1.71	0.24356	.	.	.	.	.	T	0.41419	0.1158	L	0.44542	1.39	0.19575	N	0.999963	.	.	.	.	.	.	T	0.32079	-0.9920	7	0.42905	T	0.14	.	5.6098	0.17398	0.2522:0.0:0.7478:0.0	.	.	.	.	M	361;181;213	ENSP00000413245:L361M;ENSP00000333553:L181M;ENSP00000429896:L213M	ENSP00000333553:L181M	L	-	1	2	FAM178B	96997081	0.000000	0.05858	0.983000	0.44433	0.138000	0.21146	0.068000	0.14531	0.488000	0.27723	0.655000	0.94253	CTG			0.582	FAM178B-202	KNOWN	basic	protein_coding	protein_coding				NM_016490	
CCDC74B	91409	broad.mit.edu	37	2	130894105	130894106	+	IGR	INS	-	-	CATATACA	rs111582269|rs3030127	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:130894105_130894106insCATATACA	ENST00000310463.6	-	0	1549				MED15P9_ENST00000427638.1_RNA	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					TGCTCTGTCTTCTGGGCCCAGG	0.658														2766	0.552316	0.9228	0.4928	5008	,	,		13973	0.4355		0.3489	False		,,,				2504	0.4233				.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CTGTCTTCTGGGC		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629		2.37:g.130894105_130894106insCATATACA			8	0	0		6	0.50	3	.	0		0	Q6NW18	RNA	INS	ENST00000310463.6	37	CCDS2155.1																																																																																					0.658	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000254522.3		NM_207310	
ANKRD30BL	554226	mdanderson.org	37	2	132919099	132919099	+	Silent	SNP	C	C	T	rs199974298		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:132919099C>T	ENST00000409867.1	-	1	429	c.180G>A	c.(178-180)aaG>aaA	p.K60K	ANKRD30BL_ENST00000470729.1_Intron			A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like	60										endometrium(1)|kidney(3)	4						CCATTGTCGTCTTCTTCATCA	0.582																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	554226	.			TGTCGTCTTCTTC			2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000409867.1:c.180G>A	2.37:g.132919099C>T			85	0.0235294118	2		73	0.10	7	.	1	0.00	0	B8ZZL7	RNA	SNP	ENST00000409867.1	37																																																																																				0.009		0.582	ANKRD30BL-001	NOVEL	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000331353.2		NR_027019	
ACVR2A	92	broad.mit.edu	37	2	148676128	148676128	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:148676128T>A	ENST00000241416.7	+	7	1565	c.929T>A	c.(928-930)cTa>cAa	p.L310Q	ACVR2A_ENST00000535787.1_Missense_Mutation_p.L202Q|ACVR2A_ENST00000404590.1_Missense_Mutation_p.L310Q	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	310	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		ATACCTGGCCTAAAAGATGGC	0.378																																					p.L310Q													.	ACVR2A	125		0			c.T929A												55.0	56.0	56.0					2																	148676128		2203	4300	6503	SO:0001583	missense	92	exon7			CTGGCCTAAAAGA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.929T>A	2.37:g.148676128T>A	ENSP00000241416:p.Leu310Gln		137	0.0656934307	9		107	0.14	15	NM_001616	11	0.00	0	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Missense_Mutation	SNP	ENST00000241416.7	37	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	T	15.50	2.852481	0.51270	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	D;D;D	0.87966	-2.32;-2.27;-2.32	5.63	3.22	0.36961	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.138068	0.49305	D	0.000153	T	0.75539	0.3863	N	0.20685	0.6	0.46376	D	0.99901	B	0.19706	0.038	B	0.23419	0.046	T	0.63256	-0.6678	10	0.28530	T	0.3	.	7.3172	0.26507	0.0:0.0733:0.1448:0.7819	.	310	P27037	AVR2A_HUMAN	Q	310;202;310	ENSP00000241416:L310Q;ENSP00000439988:L202Q;ENSP00000384338:L310Q	ENSP00000241416:L310Q	L	+	2	0	ACVR2A	148392598	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	3.490000	0.53245	0.401000	0.25424	0.460000	0.39030	CTA			0.378	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000319051.1		NM_001616	
STRADB	55437	hgsc.bcm.edu	37	2	202344886	202344886	+	Silent	SNP	C	C	T	rs146098224		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:202344886C>T	ENST00000194530.3	+	12	1610	c.1245C>T	c.(1243-1245)taC>taT	p.Y415Y	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	415					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						AAGACTCATACTGGGAATTCT	0.393																																					p.Y415Y													.	.			0			c.C1245T												134.0	136.0	135.0					2																	202344886		2203	4300	6503	SO:0001819	synonymous_variant	55437	exon12			CTCATACTGGGAA	AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1245C>T	2.37:g.202344886C>T			142	0	0		146	0.07	10	NM_018571	155	0.00	0	Q5BKY7|Q9P1L0	Silent	SNP	ENST00000194530.3	37	CCDS2348.1																																																																																					0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256297.1		NM_018571	
CPS1	1373	mdanderson.org	37	2	211444493	211444493	+	Splice_Site	SNP	A	A	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:211444493A>T	ENST00000233072.5	+	5	723	c.527A>T	c.(526-528)aAg>aTg	p.K176M	CPS1_ENST00000430249.2_Splice_Site_p.K182M	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	176	Anthranilate phosphoribosyltransferase homolog.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATTCGGGATAAGGTATAATCA	0.378																																					p.K182M													.	.			0			c.A545T												144.0	147.0	146.0					2																	211444493		2203	4300	6503	SO:0001630	splice_region_variant	1373	exon6			GGGATAAGGTATA	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.528+1A>T	2.37:g.211444493A>T			55	0	0		41	0.07	3	NM_001122633	7	0.00	0	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	37	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.188143	0.78789	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000536125	D;D	0.94687	-3.49;-3.49	5.52	5.52	0.82312	Carbamoyl-phosphate synthase, small subunit, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96987	0.9016	M	0.89715	3.055	0.80722	D	1	D;P	0.57571	0.98;0.932	P;P	0.58577	0.841;0.781	D	0.96726	0.9536	10	0.37606	T	0.19	0.5463	14.2142	0.65783	1.0:0.0:0.0:0.0	.	186;176	Q59HF8;P31327	.;CPSM_HUMAN	M	182;184;176;176	ENSP00000402608:K182M;ENSP00000233072:K176M	ENSP00000233072:K176M	K	+	2	0	CPS1	211152738	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.356000	0.73046	2.106000	0.64143	0.482000	0.46254	AAG			0.378	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256569.5			Missense_Mutation
UGT1A10	54575	mdanderson.org	37	2	234545847	234545847	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:234545847G>T	ENST00000344644.5	+	1	748	c.679G>T	c.(679-681)Gcc>Tcc	p.A227S	UGT1A10_ENST00000373445.1_Missense_Mutation_p.A227S|UGT1A1_ENST00000373450.4_Intron	NM_019075.2	NP_061948.1	Q9HAW8	UD110_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A10	227					cellular glucuronidation (GO:0052695)|flavone metabolic process (GO:0051552)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(2)|skin(3)	32		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)	Acetaminophen(DB00316)|Etodolac(DB00749)|Losartan(DB00678)|Mycophenolate mofetil(DB00688)|Valproic Acid(DB00313)	TTTTAGAAATGCCCTAGAAAT	0.428																																					p.A227S													.	.			0			c.G679T												214.0	228.0	224.0					2																	234545847		2203	4300	6503	SO:0001583	missense	54575	exon1			AGAAATGCCCTAG	U39550	CCDS33403.1	2q37	2010-03-05	2005-07-20		ENSG00000242515	ENSG00000242515		"""UDP glucuronosyltransferases"""	12531	other	complex locus constituent		606435	"""UDP glycosyltransferase 1 family, polypeptide A10"""			9295054, 9325166	Standard	NM_019075		Approved	UGT1J		Q9HAW8	OTTHUMG00000059121	ENST00000344644.5:c.679G>T	2.37:g.234545847G>T	ENSP00000343838:p.Ala227Ser		193	0.0051813472	1		133	0.04	5	NM_019075	0		0	O00474|Q6NT91|Q7Z6H8	Missense_Mutation	SNP	ENST00000344644.5	37	CCDS33403.1	.	.	.	.	.	.	.	.	.	.	G	3.069	-0.191642	0.06299	.	.	ENSG00000242515	ENST00000344644;ENST00000373445	T;T	0.59906	0.23;0.23	3.52	2.57	0.30868	.	.	.	.	.	T	0.48370	0.1496	L	0.46157	1.445	0.09310	N	1	B;B	0.22146	0.013;0.065	B;B	0.28638	0.043;0.092	T	0.48822	-0.9001	9	0.72032	D	0.01	.	4.4365	0.11552	0.1326:0.0:0.4764:0.391	.	227;227	Q9HAW8;Q7Z6H8	UD110_HUMAN;.	S	227	ENSP00000343838:A227S;ENSP00000362544:A227S	ENSP00000343838:A227S	A	+	1	0	UGT1A10	234210586	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	1.022000	0.30052	0.755000	0.32990	0.405000	0.27470	GCC			0.428	UGT1A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130986.1		NM_019075	
PASK	23178	broad.mit.edu	37	2	242063441	242063441	+	Missense_Mutation	SNP	T	T	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr2:242063441T>G	ENST00000405260.1	-	11	3525	c.2827A>C	c.(2827-2829)Acc>Ccc	p.T943P	PASK_ENST00000544142.1_Missense_Mutation_p.T757P|PASK_ENST00000403638.3_Missense_Mutation_p.T943P|PASK_ENST00000358649.4_Missense_Mutation_p.T943P|PASK_ENST00000539818.1_Missense_Mutation_p.T727P|PASK_ENST00000234040.4_Missense_Mutation_p.T943P	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	943					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AACAGGCGGGTCCTGGCGGCT	0.637																																					p.T943P													.	PASK	230		0			c.A2827C												48.0	51.0	50.0					2																	242063441		2203	4300	6503	SO:0001583	missense	23178	exon11			GGCGGGTCCTGGC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2827A>C	2.37:g.242063441T>G	ENSP00000384016:p.Thr943Pro		66	0.1818181818	12		57	0.25	14	NM_015148	110	0.07	8	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	ENST00000405260.1	37	CCDS2545.1	.	.	.	.	.	.	.	.	.	.	T	17.13	3.311424	0.60414	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.42;-0.46;0.5	4.87	-2.56	0.06268	.	0.220980	0.31279	N	0.007936	T	0.72471	0.3464	M	0.66939	2.045	0.09310	N	0.999997	D;D;D;D;D	0.67145	0.974;0.995;0.985;0.996;0.974	P;D;P;D;P	0.65874	0.548;0.939;0.735;0.931;0.649	T	0.62877	-0.6761	10	0.72032	D	0.01	.	1.3812	0.02230	0.132:0.2418:0.1362:0.4899	.	908;757;943;943;943	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	P	943;757;943;943;727;943	ENSP00000234040:T943P;ENSP00000441374:T757P;ENSP00000384016:T943P;ENSP00000351475:T943P;ENSP00000443083:T727P;ENSP00000384438:T943P	ENSP00000234040:T943P	T	-	1	0	PASK	241712114	0.658000	0.27402	0.021000	0.16686	0.917000	0.54804	0.753000	0.26376	-0.391000	0.07763	0.454000	0.30748	ACC			0.637	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000323753.1		NM_015148	
SIGLEC1	6614	mdanderson.org	37	20	3673769	3673769	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr20:3673769C>T	ENST00000344754.4	-	14	3517	c.3518G>A	c.(3517-3519)cGc>cAc	p.R1173H	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.R1173H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1173					cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GCGCAGGTTGCGGGGCGCGTC	0.677																																					p.R1173H													.	.			0			c.G3518A												17.0	24.0	21.0					20																	3673769		2174	4273	6447	SO:0001583	missense	6614	exon14			AGGTTGCGGGGCG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3518G>A	20.37:g.3673769C>T	ENSP00000341141:p.Arg1173His		24	0	0		19	0.11	2	NM_023068	10	0.00	0	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	37	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	17.69	3.452245	0.63290	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.23950	1.91;1.88	4.83	3.87	0.44632	.	0.000000	0.37857	N	0.001914	T	0.53738	0.1815	M	0.89715	3.055	0.30881	N	0.731423	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.60989	-0.7153	10	0.35671	T	0.21	.	10.23	0.43250	0.198:0.802:0.0:0.0	.	1173;1173	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	H	1173	ENSP00000341141:R1173H;ENSP00000202578:R1173H	ENSP00000202578:R1173H	R	-	2	0	SIGLEC1	3621769	0.851000	0.29673	0.840000	0.33206	0.801000	0.45260	1.469000	0.35343	1.235000	0.43724	0.655000	0.94253	CGC			0.677	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077761.2		NM_023068	
PREX1	57580	broad.mit.edu;mdanderson.org	37	20	47273634	47273634	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr20:47273634G>T	ENST00000371941.3	-	18	2089	c.2067C>A	c.(2065-2067)aaC>aaA	p.N689K	PREX1_ENST00000396220.1_Missense_Mutation_p.N689K	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	689	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.N689K(2)		breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGAAGGACTGGTTGAGGATGG	0.642																																					p.N689K													PREX1_ENST00000396220,NS,carcinoma,0,2	PREX1	441	2	2	Substitution - Missense(2)	lung(2)	c.C2067A												93.0	69.0	77.0					20																	47273634		2203	4300	6503	SO:0001583	missense	57580	exon18			GGACTGGTTGAGG	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2067C>A	20.37:g.47273634G>T	ENSP00000361009:p.Asn689Lys		50	0	0		49	0.06	3	NM_020820	122	0.00	0	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	37	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	9.330	1.060183	0.19987	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.49139	0.79;0.79	5.12	3.14	0.36123	PDZ/DHR/GLGF (2);	0.000000	0.64402	U	0.000015	T	0.21921	0.0528	N	0.08118	0	0.54753	D	0.999985	B	0.19583	0.037	B	0.12837	0.008	T	0.14062	-1.0486	10	0.02654	T	1	.	11.8942	0.52648	0.1287:0.0:0.8713:0.0	.	689	Q8TCU6	PREX1_HUMAN	K	689	ENSP00000361009:N689K;ENSP00000379522:N689K	ENSP00000361009:N689K	N	-	3	2	PREX1	46707041	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.887000	0.39698	2.376000	0.81061	0.561000	0.74099	AAC			0.642	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079623.1		NM_020820	
BAGE2	85319	broad.mit.edu	37	21	11043637	11043638	+	RNA	INS	-	-	A	rs545953973|rs113014139|rs59194524|rs71232275|rs397825014	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr21:11043637_11043638insA	ENST00000470054.1	-	0	774							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTGAAAAAAGAAAAAAACAAG	0.342														2226	0.444489	0.3737	0.4755	5008	,	,		122323	0.4742		0.4831	False		,,,				2504	0.4479				.													.	.			0			.																																											85319	.			AAAAAAGAAAAAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11043644_11043644dupA			6	0	0		6	0.67	4	.	0		0	A8K925|Q08ER0	RNA	INS	ENST00000470054.1	37																																																																																						0.342	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000157417.3		NM_182482	
MX1	4599	bcgsc.ca	37	21	42823120	42823120	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr21:42823120G>T	ENST00000398600.2	+	17	2484	c.1459G>T	c.(1459-1461)Gtt>Ttt	p.V487F	MX1_ENST00000455164.2_Missense_Mutation_p.V487F|MX1_ENST00000288383.6_Missense_Mutation_p.V464F|MX1_ENST00000398598.3_Missense_Mutation_p.V487F	NM_001144925.1	NP_001138397.1	P20591	MX1_HUMAN	MX dynamin-like GTPase 1	487	Middle domain.|Stalk.				apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|response to type I interferon (GO:0034340)|response to virus (GO:0009615)|signal transduction (GO:0007165)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	27		Prostate(19;3.18e-07)|all_epithelial(19;0.0277)				TTTCACAGATGTTTCGATAAA	0.308																																					p.V487F													.	MX1	58		0			c.G1459T												175.0	197.0	190.0					21																	42823120		2203	4300	6503	SO:0001583	missense	4599	exon17			ACAGATGTTTCGA		CCDS13673.1, CCDS74796.1	21q22.3	2014-07-15	2014-07-15		ENSG00000157601	ENSG00000157601			7532	protein-coding gene	gene with protein product	"""interferon-inducible protein p78"""	147150	"""myxovirus (influenza) resistance 1, homolog of murine (interferon-inducible protein p78)"", ""myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse)"""			17570575	Standard	XM_005260979		Approved	IFI-78K, MxA	uc010goq.3	P20591	OTTHUMG00000086755	ENST00000398600.2:c.1459G>T	21.37:g.42823120G>T	ENSP00000381601:p.Val487Phe		104	0	0		137	0.04	6	NM_001144925	433	0.00	0	B2RDA5|B3KU10|C9IYV7|C9J8D6|C9JN19|C9JN88|C9JUL1|C9JZS6|D3DSI8|Q86YP5|Q96CI3	Missense_Mutation	SNP	ENST00000398600.2	37	CCDS13673.1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861693	0.51482	.	.	ENSG00000157601	ENST00000398600;ENST00000398598;ENST00000455164;ENST00000288383	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	4.62	0.775	0.18527	Dynamin central domain (1);	0.622757	0.16274	N	0.221647	T	0.80412	0.4618	M	0.79805	2.47	0.09310	N	1	P	0.49447	0.924	P	0.59221	0.854	T	0.68872	-0.5294	10	0.72032	D	0.01	-7.5311	3.9084	0.09193	0.4041:0.1801:0.4158:0.0	.	487	P20591	MX1_HUMAN	F	487;487;487;464	ENSP00000381601:V487F;ENSP00000381599:V487F;ENSP00000410523:V487F;ENSP00000288383:V464F	ENSP00000288383:V464F	V	+	1	0	MX1	41744990	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	0.148000	0.16224	0.254000	0.21573	0.655000	0.94253	GTT			0.308	MX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195161.2			
ITIH1	3697	broad.mit.edu	37	3	52825612	52825612	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr3:52825612G>T	ENST00000273283.2	+	21	2598	c.2574G>T	c.(2572-2574)atG>atT	p.M858I	ITIH1_ENST00000405128.3_Missense_Mutation_p.M224I|ITIH1_ENST00000537050.1_Missense_Mutation_p.M570I|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000540715.1_Missense_Mutation_p.M716I	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	858	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ATGCCACGATGGTGGTGAGGA	0.582																																					p.M858I													.	ITIH1	108		0			c.G2574T												73.0	73.0	73.0					3																	52825612		2203	4300	6503	SO:0001583	missense	3697	exon21			CACGATGGTGGTG		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2574G>T	3.37:g.52825612G>T	ENSP00000273283:p.Met858Ile		59	0.0169491525	1		54	0.06	3	NM_002215	0		0	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	37	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	G	33	5.223417	0.95139	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	5.61	5.61	0.85477	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.042802	0.85682	D	0.000000	T	0.36496	0.0969	M	0.87617	2.895	0.53005	D	0.999965	B;B;P;P	0.43392	0.056;0.4;0.805;0.787	B;B;B;P	0.49683	0.037;0.189;0.364;0.619	T	0.23762	-1.0179	10	0.59425	D	0.04	-32.2762	19.2382	0.93871	0.0:0.0:1.0:0.0	.	716;224;459;858	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	I	858;716;570;411;224	ENSP00000273283:M858I;ENSP00000443973:M716I;ENSP00000443847:M570I;ENSP00000395836:M411I;ENSP00000384589:M224I	ENSP00000273283:M858I	M	+	3	0	ITIH1	52800652	1.000000	0.71417	0.994000	0.49952	0.946000	0.59487	7.011000	0.76359	2.640000	0.89533	0.591000	0.81541	ATG			0.582	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317522.1		NM_002215	
TMCC1	23023	broad.mit.edu	37	3	129370614	129370614	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr3:129370614G>T	ENST00000393238.3	-	6	2012	c.1672C>A	c.(1672-1674)Cgc>Agc	p.R558S	TMCC1_ENST00000329333.5_Missense_Mutation_p.R379S|TMCC1_ENST00000426664.2_Missense_Mutation_p.R444S|TMCC1_ENST00000432054.2_Missense_Mutation_p.R234S	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	558						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TTGGAGATGCGCGTCTGGCAT	0.582																																					p.R558S													.	TMCC1	105		0			c.C1672A												64.0	63.0	63.0					3																	129370614		2203	4300	6503	SO:0001583	missense	23023	exon6			AGATGCGCGTCTG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1672C>A	3.37:g.129370614G>T	ENSP00000376930:p.Arg558Ser		79	0	0		78	0.05	4	NM_001017395	36	0.00	0	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	37	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703717	0.48412	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.16	5.16	0.70880	.	0.051157	0.85682	D	0.000000	T	0.79009	0.4374	M	0.89095	3.005	0.58432	D	0.999999	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.993	T	0.81297	-0.0996	10	0.51188	T	0.08	-7.1955	14.5535	0.68084	0.0:0.0:0.8533:0.1467	.	379;558	B4DE04;O94876	.;TMCC1_HUMAN	S	234;558;444;379	ENSP00000404711:R234S;ENSP00000376930:R558S;ENSP00000389892:R444S;ENSP00000327349:R379S	ENSP00000327349:R379S	R	-	1	0	TMCC1	130853304	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.478000	0.53158	2.689000	0.91719	0.655000	0.94253	CGC			0.582	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356418.2		NM_015008	
DGKQ	1609	mdanderson.org	37	4	961354	961354	+	Missense_Mutation	SNP	C	C	T	rs529521985		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:961354C>T	ENST00000273814.3	-	8	1043	c.970G>A	c.(970-972)Ggt>Agt	p.G324S	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	324					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			TCCTCGGCACCGGCCAGGCGG	0.677													c|||	1	0.000199681	0.0	0.0	5008	,	,		10574	0.0		0.0	False		,,,				2504	0.001				p.G324S	Esophageal Squamous(17;537 645 4447 26373)												.	.			0			c.G970A												48.0	47.0	47.0					4																	961354		2201	4300	6501	SO:0001583	missense	1609	exon8			CGGCACCGGCCAG	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.970G>A	4.37:g.961354C>T	ENSP00000273814:p.Gly324Ser		92	0	0		52	0.06	3	NM_001347	10	0.00	0	Q6P3W4	Missense_Mutation	SNP	ENST00000273814.3	37	CCDS3342.1	.	.	.	.	.	.	.	.	.	.	c	0.179	-1.063737	0.01934	.	.	ENSG00000145214	ENST00000273814	T	0.78481	-1.18	4.97	-9.95	0.00446	.	0.350344	0.27429	N	0.019405	T	0.42381	0.1200	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.51702	-0.8672	10	0.05959	T	0.93	.	13.7051	0.62633	0.0:0.0805:0.7425:0.177	.	324;324	E9KL49;P52824	.;DGKQ_HUMAN	S	324	ENSP00000273814:G324S	ENSP00000273814:G324S	G	-	1	0	DGKQ	951354	0.000000	0.05858	0.018000	0.16275	0.002000	0.02628	-1.252000	0.02880	-1.310000	0.02312	-1.525000	0.00928	GGT			0.677	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000200888.1			
NWD2	57495	mdanderson.org	37	4	37447775	37447775	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:37447775G>T	ENST00000309447.5	+	7	5013	c.4165G>T	c.(4165-4167)Ggt>Tgt	p.G1389C		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1389										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						CACCAGCAGTGGTGAAAACCT	0.453																																					p.G1389C													.	.			0			c.G4165T												55.0	50.0	51.0					4																	37447775		692	1591	2283	SO:0001583	missense	57495	exon7			AGCAGTGGTGAAA																												ENST00000309447.5:c.4165G>T	4.37:g.37447775G>T	ENSP00000309501:p.Gly1389Cys		76	0.0131578947	1		51	0.06	3	NM_001144990	0		0	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	37	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229504	0.79688	.	.	ENSG00000174145	ENST00000309447	T	0.43688	0.94	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58235	0.2108	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56854	-0.7910	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	1389	Q9ULI1	K1239_HUMAN	C	1389	ENSP00000309501:G1389C	ENSP00000309501:G1389C	G	+	1	0	KIAA1239	37124170	1.000000	0.71417	0.795000	0.32087	0.931000	0.56810	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GGT			0.453	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000347551.2			
ATP10D	57205	mdanderson.org	37	4	47563065	47563065	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:47563065A>G	ENST00000273859.3	+	14	2910	c.2641A>G	c.(2641-2643)Agg>Ggg	p.R881G	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	881					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						ATCTGCCATGAGGTTGGAGAA	0.378																																					p.R881G													.	.			0			c.A2641G												169.0	159.0	162.0					4																	47563065		2203	4300	6503	SO:0001583	missense	57205	exon14			GCCATGAGGTTGG	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.2641A>G	4.37:g.47563065A>G	ENSP00000273859:p.Arg881Gly		96	0	0		61	0.05	3	NM_020453	6	0.00	0	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	37	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.953529	0.73902	.	.	ENSG00000145246	ENST00000273859	T	0.39592	1.07	5.11	3.91	0.45181	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.048098	0.85682	D	0.000000	T	0.60117	0.2244	M	0.77712	2.385	0.80722	D	1	D	0.56035	0.974	D	0.63033	0.91	T	0.60265	-0.7297	10	0.40728	T	0.16	-11.7337	11.5056	0.50463	0.8497:0.1503:0.0:0.0	.	881	Q9P241	AT10D_HUMAN	G	881	ENSP00000273859:R881G	ENSP00000273859:R881G	R	+	1	2	ATP10D	47257822	0.986000	0.35501	1.000000	0.80357	0.997000	0.91878	2.695000	0.47043	0.949000	0.37715	0.533000	0.62120	AGG			0.378	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000216900.1		NM_020453	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55593667	55593667	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:55593667A>G	ENST00000288135.5	+	11	1830	c.1733A>G	c.(1732-1734)tAt>tGt	p.Y578C		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	578					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.N564_Y578del(2)|p.P577_Y578del(1)|p.I571_N587del(1)|p.P577_D579del(1)|p.D579del(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAACTTCCTTATGATCACAAA	0.413		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.Y578C			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	.			6	Deletion - In frame(6)	soft_tissue(5)|thymus(1)	c.A1733G												72.0	71.0	72.0					4																	55593667		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TTCCTTATGATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1733A>G	4.37:g.55593667A>G	ENSP00000288135:p.Tyr578Cys		137	0	0		89	0.28	25	NM_000222	223	0.64	143	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.312811	0.81358	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.95724	-3.79;-3.79	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.56097	D	0.000028	D	0.97776	0.9270	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.974;0.995;0.967	D	0.98487	1.0608	10	0.87932	D	0	.	16.6003	0.84812	1.0:0.0:0.0:0.0	.	85;574;578	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	C	578;574	ENSP00000288135:Y578C;ENSP00000390987:Y574C	ENSP00000288135:Y578C	Y	+	2	0	KIT	55288424	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.150000	0.94667	2.319000	0.78375	0.533000	0.62120	TAT			0.413	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599348	55599348	+	Missense_Mutation	SNP	T	T	A	rs121913524		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:55599348T>A	ENST00000288135.5	+	17	2571	c.2474T>A	c.(2473-2475)gTt>gAt	p.V825D		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	825	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.V825A(27)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AATTATGTGGTTAAAGGAAAC	0.373		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.V825D			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,lymphoid_neoplasm,0,31	KIT	0	31	27	Substitution - Missense(27)	haematopoietic_and_lymphoid_tissue(27)	c.T2474A												150.0	153.0	152.0					4																	55599348		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	ATGTGGTTAAAGG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2474T>A	4.37:g.55599348T>A	ENSP00000288135:p.Val825Asp		90	0	0		51	0.33	17	NM_000222	338	0.51	172	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.428803	0.83667	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82619	-1.63;-1.63	5.47	5.47	0.80525	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000093	D	0.86397	0.5923	L	0.31065	0.9	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.951;0.999	D	0.88285	0.2939	10	0.87932	D	0	.	15.5485	0.76129	0.0:0.0:0.0:1.0	.	821;825	P10721-2;P10721	.;KIT_HUMAN	D	825;821	ENSP00000288135:V825D;ENSP00000390987:V821D	ENSP00000288135:V825D	V	+	2	0	KIT	55294105	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	6.130000	0.71663	2.084000	0.62774	0.477000	0.44152	GTT			0.373	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
EIF4E	1977	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	99812429	99812429	+	Silent	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:99812429C>T	ENST00000450253.2	-	3	1704	c.180G>A	c.(178-180)ctG>ctA	p.L60L	EIF4E_ENST00000280892.6_Silent_p.L80L|EIF4E_ENST00000504432.1_Silent_p.L88L|EIF4E_ENST00000505992.1_Silent_p.L60L	NM_001968.3	NP_001959.1	P06730	IF4E_HUMAN	eukaryotic translation initiation factor 4E	60					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of mitotic cell cycle (GO:0045931)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|mRNA cap binding complex (GO:0005845)|RISC complex (GO:0016442)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)		AGATCAGCCGCAGGTTTGCTT	0.333																																					p.L80L													.	.			0			c.G240A												72.0	73.0	73.0					4																	99812429		2203	4300	6503	SO:0001819	synonymous_variant	1977	exon3			CAGCCGCAGGTTT	M15353	CCDS34031.1, CCDS47109.1, CCDS54779.1	4q21-q25	2008-02-05			ENSG00000151247	ENSG00000151247			3287	protein-coding gene	gene with protein product		133440		EIF4EL1, EIF4F		9330633, 1916814	Standard	NM_001968		Approved	EIF4E1	uc011cea.1	P06730	OTTHUMG00000161090	ENST00000450253.2:c.180G>A	4.37:g.99812429C>T			333	0	0		230	0.19	43	NM_001130678	164	0.41	67	B7Z6V1|D6RCQ6|Q96E95	Silent	SNP	ENST00000450253.2	37	CCDS34031.1	.	.	.	.	.	.	.	.	.	.	C	8.630	0.893528	0.17613	.	.	ENSG00000151247	ENST00000511644	.	.	.	5.21	-2.34	0.06704	.	.	.	.	.	T	0.40040	0.1101	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30822	-0.9965	4	.	.	.	-16.2618	2.4992	0.04629	0.4595:0.2447:0.0665:0.2293	.	.	.	.	T	57	.	.	A	-	1	0	EIF4E	100031452	0.996000	0.38824	0.990000	0.47175	0.975000	0.68041	0.582000	0.23834	-0.189000	0.10482	-1.500000	0.00958	GCG			0.333	EIF4E-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000363739.1		NM_001968	
PALLD	23022	broad.mit.edu	37	4	169632923	169632923	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr4:169632923G>T	ENST00000505667.1	+	10	1986	c.1813G>T	c.(1813-1815)Gct>Tct	p.A605S	PALLD_ENST00000512127.1_Missense_Mutation_p.A223S|PALLD_ENST00000261509.6_Missense_Mutation_p.A605S|PALLD_ENST00000335742.7_Missense_Mutation_p.A223S			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	605					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		GCAATTCAATGCTGCTGAGAG	0.483									Pancreatic Cancer, Familial Clustering of																												p.A605S	Esophageal Squamous(109;1482 1532 18347 40239 51172)												PALLD_ENST00000335742,NS,carcinoma,-1,2	PALLD	179	2	0			c.G1813T												84.0	79.0	81.0					4																	169632923		2203	4300	6503	SO:0001583	missense	23022	exon10	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	TTCAATGCTGCTG	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1813G>T	4.37:g.169632923G>T	ENSP00000425556:p.Ala605Ser		162	0.0061728395	1		145	0.03	5	NM_001166108	5	0.00	0	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	ENST00000505667.1	37	CCDS54818.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.150479	0.00328	.	.	ENSG00000129116	ENST00000261509;ENST00000335742;ENST00000505667;ENST00000512127	T;T;T;T	0.60424	0.2;0.19;0.47;0.21	5.81	0.466	0.16716	.	0.598230	0.12595	N	0.455203	T	0.15869	0.0382	N	0.00677	-1.265	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.26155	-1.0111	10	0.05436	T	0.98	.	0.8911	0.01254	0.2205:0.1854:0.1163:0.4778	.	605;223;605	B7ZMM5;B3KTG2;B2RTX2	.;.;.	S	605;223;605;223	ENSP00000261509:A605S;ENSP00000336735:A223S;ENSP00000425556:A605S;ENSP00000426947:A223S	ENSP00000261509:A605S	A	+	1	0	PALLD	169869498	0.008000	0.16893	0.000000	0.03702	0.000000	0.00434	0.283000	0.18846	-0.112000	0.11979	-1.785000	0.00643	GCT			0.483	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000363762.1		NM_016081	
GPR98	84059	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	5	89949379	89949379	+	Frame_Shift_Del	DEL	T	T	-			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr5:89949379delT	ENST00000405460.2	+	20	4084	c.3988delT	c.(3988-3990)tttfs	p.F1330fs		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1330					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGCTTTGTACTTTACCGGACT	0.453																																					p.Y1329fs													.	GPR98	605		0			c.3987delC												121.0	112.0	115.0					5																	89949379		1954	4137	6091	SO:0001589	frameshift_variant	84059	exon20			TTGTACTTTACCG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3988delT	5.37:g.89949379delT	ENSP00000384582:p.Phe1330fs		158	0	0		154	0.17	26	NM_032119	2	0.00	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Frame_Shift_Del	DEL	ENST00000405460.2	37	CCDS47246.1																																																																																					0.453	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369993.2		NM_032119	
PWWP2A	114825	mdanderson.org	37	5	159546149	159546149	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr5:159546149C>A	ENST00000307063.7	-	1	281	c.247G>T	c.(247-249)Gag>Tag	p.E83*	PWWP2A_ENST00000456329.3_Nonsense_Mutation_p.E83*|PWWP2A_ENST00000523662.1_Nonsense_Mutation_p.E83*	NM_001130864.1	NP_001124336.1	Q96N64	PWP2A_HUMAN	PWWP domain containing 2A	83	Pro-rich.									kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCACCGCCTCTGGGCTGCGG	0.751																																					p.E83X													.	.			0			c.G247T												15.0	17.0	17.0					5																	159546149		1361	3149	4510	SO:0001587	stop_gained	114825	exon1			CCGCCTCTGGGCT		CCDS47331.1, CCDS47332.1, CCDS58990.1	5q33.3	2011-03-23			ENSG00000170234	ENSG00000170234			29406	protein-coding gene	gene with protein product							Standard	NM_052927		Approved	KIAA1935	uc011ded.2	Q96N64	OTTHUMG00000163546	ENST00000307063.7:c.247G>T	5.37:g.159546149C>A	ENSP00000305151:p.Glu83*		8	0	0		12	0.25	3	NM_052927	8	0.00	0	G5EA07|Q2HJJ2|Q8IYR3|Q96PV3	Nonsense_Mutation	SNP	ENST00000307063.7	37	CCDS47332.1	.	.	.	.	.	.	.	.	.	.	c	34	5.393284	0.96009	.	.	ENSG00000170234	ENST00000456329;ENST00000523662;ENST00000307063	.	.	.	3.65	2.78	0.32641	.	0.158907	0.24422	U	0.038671	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-8.4941	6.6968	0.23203	0.0:0.8692:0.0:0.1308	.	.	.	.	X	83	.	ENSP00000305151:E83X	E	-	1	0	PWWP2A	159478727	0.299000	0.24426	0.994000	0.49952	0.876000	0.50452	2.023000	0.41040	0.751000	0.32900	0.543000	0.68304	GAG			0.751	PWWP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000374092.1			
CPLX2	10814	broad.mit.edu	37	5	175306867	175306869	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr5:175306867_175306869delAGG	ENST00000359546.4	+	5	867_869	c.224_226delAGG	c.(223-228)aaggag>aag	p.E77del	CPLX2_ENST00000393745.3_In_Frame_Del_p.E77del|CPLX2_ENST00000515094.1_In_Frame_Del_p.E77del	NM_001008220.1|NM_006650.3	NP_001008221.1|NP_006641.1	Q6PUV4	CPLX2_HUMAN	complexin 2	77	Interaction with the SNARE complex. {ECO:0000250}.				cell differentiation (GO:0030154)|mast cell degranulation (GO:0043303)|nervous system development (GO:0007399)|positive regulation of synaptic plasticity (GO:0031915)|regulation of exocytosis (GO:0017157)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking involved in exocytosis (GO:0006904)	dendrite (GO:0030425)|mast cell granule (GO:0042629)|neuronal cell body (GO:0043025)|synapse (GO:0045202)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin II complex (GO:0070033)|synaptobrevin 2-SNAP-25-syntaxin-3-complexin complex (GO:0070554)				endometrium(3)|kidney(2)|lung(3)|ovary(2)	10	all_cancers(89;0.004)|Renal(175;0.000269)|Lung NSC(126;0.00441)|all_lung(126;0.00747)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CTGAAGAAGAAGGAGGAGAAGGA	0.645																																					p.75_76del													.	CPLX2	42		0			c.224_226del																																									SO:0001651	inframe_deletion	10814	exon5			AGAAGAAGGAGGA	U35100	CCDS4396.1	5q35.2	2008-05-23			ENSG00000145920	ENSG00000145920			2310	protein-coding gene	gene with protein product		605033				7553862, 16162394	Standard	XM_005265798		Approved	CPX-2, DKFZp547D155	uc003mdf.1	Q6PUV4	OTTHUMG00000130665	ENST00000359546.4:c.224_226delAGG	5.37:g.175306870_175306872delAGG	ENSP00000352544:p.Glu77del		144	0	0		129	0.07	9	NM_006650	0		0	B2RAG2|O09056|Q13329|Q28184|Q52M15|Q64386	In_Frame_Del	DEL	ENST00000359546.4	37	CCDS4396.1																																																																																					0.645	CPLX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253157.2			
BTN2A3P	54718	hgsc.bcm.edu;broad.mit.edu	37	6	26422353	26422353	+	RNA	SNP	C	C	T	rs571530750	byFrequency	TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr6:26422353C>T	ENST00000466808.2	+	0	7							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)		p.P3S(2)									GCTCATGGAACCAGCTGCTGC	0.622													C|||	7	0.00139776	0.0023	0.0	5008	,	,		16376	0.001		0.0	False		,,,				2504	0.0031				.													BTN2A3,NS,carcinoma,0,9	BTN2A3	0	9	2	Substitution - Missense(2)	endometrium(1)|kidney(1)	.																																											54718	.			ATGGAACCAGCTG	AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26422353C>T			94	0.0106382979	1		78	0.08	6	.	2	0.00	0	A6NEF4	RNA	SNP	ENST00000466808.2	37																																																																																						0.622	BTN2A3P-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000040118.4		NR_027795	
CLIC1	1192	mdanderson.org	37	6	31702039	31702039	+	Splice_Site	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr6:31702039G>A	ENST00000375780.2	-	3	613	c.41C>T	c.(40-42)gCt>gTt	p.A14V	CLIC1_ENST00000375779.2_Splice_Site_p.A14V|CLIC1_ENST00000375784.3_Splice_Site_p.A14V|CLIC1_ENST00000395892.1_Splice_Site_p.A14V			O00299	CLIC1_HUMAN	chloride intracellular channel 1	14	Required for insertion into the membrane.				chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|platelet aggregation (GO:0070527)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of mitochondrial membrane potential (GO:0051881)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|brush border (GO:0005903)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)|skin(1)	7						ATCACTGCCAGCCTGAAAAGT	0.547																																					p.A14V													.	.			0			c.C41T												76.0	60.0	65.0					6																	31702039		2203	4300	6503	SO:0001630	splice_region_variant	1192	exon2			CTGCCAGCCTGAA	U93205	CCDS4719.1	6p21.3	2012-09-26			ENSG00000213719	ENSG00000213719		"""Ion channels / Chloride channels : Intracellular"""	2062	protein-coding gene	gene with protein product		602872				9139710	Standard	NM_001288		Approved	NCC27, p64CLCP	uc003nwr.3	O00299	OTTHUMG00000031103	ENST00000375780.2:c.40-1C>T	6.37:g.31702039G>A			75	0	0		45	0.07	3	NM_001288	493	0.00	0	Q15089|Q502X1	Missense_Mutation	SNP	ENST00000375780.2	37	CCDS4719.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714018	0.89112	.	.	ENSG00000213719	ENST00000375784;ENST00000375779;ENST00000375780;ENST00000395892	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.4	5.4	0.78164	Thioredoxin-like fold (2);	0.000000	0.64402	U	0.000001	T	0.52500	0.1738	H	0.96691	3.865	0.80722	D	1	P	0.48911	0.917	B	0.35240	0.198	T	0.73726	-0.3892	10	0.72032	D	0.01	-8.7081	16.777	0.85553	0.0:0.0:1.0:0.0	.	14	O00299	CLIC1_HUMAN	V	14	ENSP00000364940:A14V;ENSP00000364934:A14V;ENSP00000364935:A14V;ENSP00000379229:A14V	ENSP00000364934:A14V	A	-	2	0	CLIC1	31810018	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.164000	0.94755	2.831000	0.97527	0.585000	0.79938	GCT			0.547	CLIC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076167.3		NM_001288	Missense_Mutation
ANKS1A	23294	hgsc.bcm.edu	37	6	34857324	34857324	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr6:34857324G>A	ENST00000360359.3	+	1	283	c.145G>A	c.(145-147)Ggc>Agc	p.G49S	TAF11_ENST00000361288.4_5'Flank|TAF11_ENST00000420584.2_5'Flank|ANKS1A_ENST00000535627.1_Missense_Mutation_p.G49S	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	49	Gly-rich.				ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						cggcagcggcggcggcggcgg	0.771																																					p.G49S													ANKS1A,NS,carcinoma,0,1	ANKS1A	0	1	0			c.G145A												2.0	2.0	2.0					6																	34857324		382	1194	1576	SO:0001583	missense	23294	exon1			AGCGGCGGCGGCG	D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.145G>A	6.37:g.34857324G>A	ENSP00000353518:p.Gly49Ser		6	0.1666666667	1		6	0.50	3	NM_015245	3	0.00	0	A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	ENST00000360359.3	37	CCDS4798.1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.008376	0.54361	.	.	ENSG00000064999	ENST00000544150;ENST00000360359;ENST00000535627	T;D	0.98649	1.19;-5.05	4.58	1.53	0.23141	Ankyrin repeat-containing domain (1);	1.264600	0.06451	N	0.727796	D	0.90783	0.7106	N	0.19112	0.55	0.25322	N	0.989108	P;B	0.49090	0.919;0.003	B;B	0.38655	0.278;0.002	D	0.88474	0.3064	10	0.17832	T	0.49	-4.009	8.7007	0.34323	0.0795:0.0:0.6816:0.2389	.	49;49	B4DQW8;Q92625	.;ANS1A_HUMAN	S	49	ENSP00000353518:G49S;ENSP00000438752:G49S	ENSP00000353518:G49S	G	+	1	0	ANKS1A	34965302	1.000000	0.71417	0.794000	0.32065	0.327000	0.28475	2.586000	0.46119	0.389000	0.25086	0.471000	0.43371	GGC			0.771	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040262.1		XM_166478	
FOXK1	221937	mdanderson.org	37	7	4799057	4799057	+	Silent	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr7:4799057G>T	ENST00000328914.4	+	7	1527	c.1527G>T	c.(1525-1527)gcG>gcT	p.A509A	FOXK1_ENST00000446823.1_Silent_p.A346A	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		AGCAGCCCGCGGGCCACGCCA	0.672																																					p.A509A													.	.			0			c.G1527T												31.0	25.0	27.0					7																	4799057		2197	4290	6487	SO:0001819	synonymous_variant	221937	exon7			GCCCGCGGGCCAC	BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1527G>T	7.37:g.4799057G>T			30	0	0		19	0.11	2	NM_001037165	16	0.00	0		Silent	SNP	ENST00000328914.4	37	CCDS34591.1																																																																																					0.672	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000323729.2			
RAC1	5879	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	6426908	6426908	+	Missense_Mutation	SNP	C	C	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr7:6426908C>G	ENST00000348035.4	+	2	314	c.101C>G	c.(100-102)cCt>cGt	p.P34R	RAC1_ENST00000488373.1_3'UTR|RAC1_ENST00000356142.4_Missense_Mutation_p.P34R	NM_006908.4	NP_008839.2	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)	34					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|anatomical structure arrangement (GO:0048532)|anatomical structure morphogenesis (GO:0009653)|apoptotic signaling pathway (GO:0097190)|auditory receptor cell morphogenesis (GO:0002093)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell adhesion (GO:0007155)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cell-cell junction organization (GO:0045216)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|cerebral cortex radially oriented cell migration (GO:0021799)|cochlea morphogenesis (GO:0090103)|dendrite morphogenesis (GO:0048813)|dopaminergic neuron differentiation (GO:0071542)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|engulfment of apoptotic cell (GO:0043652)|epithelial cell morphogenesis (GO:0003382)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G-protein coupled receptor signaling pathway (GO:0007186)|hyperosmotic response (GO:0006972)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|mast cell chemotaxis (GO:0002551)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of receptor-mediated endocytosis (GO:0048261)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA replication (GO:0045740)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein localization to plasma membrane (GO:0072659)|regulation of cell migration (GO:0030334)|regulation of defense response to virus by virus (GO:0050690)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|response to wounding (GO:0009611)|ruffle assembly (GO:0097178)|ruffle organization (GO:0031529)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell costimulation (GO:0031295)|viral process (GO:0016032)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GDP-dissociation inhibitor binding (GO:0051022)|thioesterase binding (GO:0031996)			cervix(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Dextromethorphan(DB00514)	GAATATATCCCTACTGTGTAA	0.363																																					p.P34R													.	.			0			c.C101G												103.0	102.0	103.0					7																	6426908		2203	4298	6501	SO:0001583	missense	5879	exon2			ATATCCCTACTGT	AJ132695	CCDS5348.1, CCDS5349.1	7p22	2014-01-30			ENSG00000136238	ENSG00000136238		"""Endogenous ligands"""	9801	protein-coding gene	gene with protein product		602048				2674130, 10597294	Standard	NM_006908		Approved	TC-25, p21-Rac1, Rac-1	uc003spw.3	P63000	OTTHUMG00000023540	ENST00000348035.4:c.101C>G	7.37:g.6426908C>G	ENSP00000258737:p.Pro34Arg		127	0	0		142	0.13	18	NM_006908	59	0.17	10	O95501|P15154|Q3Y4D3|Q5JAA8|Q9BTB4	Missense_Mutation	SNP	ENST00000348035.4	37	CCDS5348.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.921361	0.92249	.	.	ENSG00000136238	ENST00000348035;ENST00000356142	T;T	0.73789	-0.78;-0.78	6.06	6.06	0.98353	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.93207	0.7836	H	0.99379	4.54	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.95425	0.8511	10	0.87932	D	0	.	20.2312	0.98350	0.0:1.0:0.0:0.0	.	34;34	P63000;A4D2P0	RAC1_HUMAN;.	R	34	ENSP00000258737:P34R;ENSP00000348461:P34R	ENSP00000258737:P34R	P	+	2	0	RAC1	6393433	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.622000	0.83099	2.882000	0.98803	0.655000	0.94253	CCT			0.363	RAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000242868.2		NM_018890	
LRCH4	4034	broad.mit.edu	37	7	100183685	100183685	+	Silent	SNP	A	A	C			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr7:100183685A>C	ENST00000310300.6	-	1	91	c.39T>G	c.(37-39)ggT>ggG	p.G13G	FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000241071.6_5'Flank|FBXO24_ENST00000360609.2_5'Flank|LRCH4_ENST00000497245.1_5'Flank|FBXO24_ENST00000465843.1_5'Flank	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	13					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCGCCTCCTCACCCCCGGCGG	0.771																																					p.G13G													.	LRCH4	53		0			c.T39G												4.0	5.0	5.0					7																	100183685		1955	3870	5825	SO:0001819	synonymous_variant	4034	exon1			CTCCTCACCCCCG	AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.39T>G	7.37:g.100183685A>C			77	0.3116883117	24		102	0.30	31	NM_002319	94	0.06	6	A4D2D5|Q8WV85|Q96ID0	Silent	SNP	ENST00000310300.6	37	CCDS34706.1																																																																																					0.771	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000356110.1		NM_002319	
KMT2C	58508	bcgsc.ca	37	7	151945089	151945089	+	Silent	SNP	G	G	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr7:151945089G>A	ENST00000262189.6	-	14	2648	c.2430C>T	c.(2428-2430)aaC>aaT	p.N810N	KMT2C_ENST00000355193.2_Silent_p.N810N	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	810					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGGCATGATGTTTCCAGCAG	0.453																																					p.N810N													.	MLL3	1564		0			c.C2430T												447.0	398.0	415.0					7																	151945089		2203	4300	6503	SO:0001819	synonymous_variant	58508	exon14			CATGATGTTTCCA	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.2430C>T	7.37:g.151945089G>A			400	0.0175	7		489	0.04	19	NM_170606	15	0.07	1	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Silent	SNP	ENST00000262189.6	37	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	G	8.548	0.874782	0.17395	.	.	ENSG00000055609	ENST00000418673	.	.	.	5.57	0.677	0.17964	.	.	.	.	.	T	0.55000	0.1893	.	.	.	0.41253	D	0.98672	.	.	.	.	.	.	T	0.48714	-0.9011	4	.	.	.	.	8.0792	0.30735	0.5456:0.0:0.4544:0.0	.	.	.	.	Y	6	.	.	H	-	1	0	MLL3	151576022	0.460000	0.25776	0.882000	0.34594	0.867000	0.49689	0.666000	0.25097	0.310000	0.22990	0.650000	0.86243	CAT			0.453	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000318887.3	rescued with RNA-seq		
UNC5D	137970	mdanderson.org	37	8	35453077	35453077	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr8:35453077C>T	ENST00000404895.2	+	4	800	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	UNC5D_ENST00000420357.1_Missense_Mutation_p.R158W|UNC5D_ENST00000287272.2_Missense_Mutation_p.R158W|UNC5D_ENST00000416672.1_Missense_Mutation_p.R158W|UNC5D_ENST00000453357.2_Missense_Mutation_p.R153W	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	158	Ig-like C2-type.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TGCAGATTTACGGAAAAACTT	0.438																																					p.R158W													.	.			0			c.C472T												139.0	134.0	136.0					8																	35453077		2203	4300	6503	SO:0001583	missense	137970	exon4			GATTTACGGAAAA	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.472C>T	8.37:g.35453077C>T	ENSP00000385143:p.Arg158Trp		54	0	0		50	0.06	3	NM_080872	0		0	Q8WYP7	Missense_Mutation	SNP	ENST00000404895.2	37	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	C	19.95	3.921222	0.73213	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357	T;T;T;T;T	0.57752	0.4;0.89;0.89;0.4;0.38	5.93	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.79581	0.4470	H	0.94771	3.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.986	D	0.85360	0.1107	10	0.87932	D	0	-20.1685	13.8026	0.63212	0.3824:0.6176:0.0:0.0	.	153;158	Q6UXZ4-2;Q6UXZ4	.;UNC5D_HUMAN	W	158;158;158;158;153	ENSP00000385143:R158W;ENSP00000392739:R158W;ENSP00000287272:R158W;ENSP00000412652:R158W;ENSP00000394303:R153W	ENSP00000287272:R158W	R	+	1	2	UNC5D	35572619	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.401000	0.34589	1.504000	0.48704	0.591000	0.81541	CGG			0.438	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000347586.2			
ADAMTSL1	92949	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	18892551	18892551	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr9:18892551A>G	ENST00000380548.4	+	26	5147	c.4808A>G	c.(4807-4809)aAc>aGc	p.N1603S	ADAMTSL1_ENST00000380545.5_Missense_Mutation_p.N304S	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1603	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CAGGCCTGTAACCAGCAGCTG	0.567																																					p.N1603S													.	.			0			c.A4808G												12.0	15.0	14.0					9																	18892551		1974	4144	6118	SO:0001583	missense	92949	exon26			CCTGTAACCAGCA	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.4808A>G	9.37:g.18892551A>G	ENSP00000369921:p.Asn1603Ser		67	0	0		61	0.18	11	NM_001040272	1	0.00	0	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	37	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	A	7.580	0.668607	0.14776	.	.	ENSG00000178031	ENST00000380548;ENST00000380545;ENST00000316239	T;T	0.52295	0.67;0.67	5.31	5.31	0.75309	.	0.172300	0.50627	N	0.000113	T	0.28433	0.0703	N	0.20845	0.615	0.46954	D	0.999264	P;B	0.47545	0.897;0.119	B;B	0.38327	0.271;0.078	T	0.05733	-1.0867	10	0.23891	T	0.37	.	9.7411	0.40418	0.9228:0.0:0.0772:0.0	.	304;1603	Q8N6G6-6;Q8N6G6	.;ATL1_HUMAN	S	1603;304;307	ENSP00000369921:N1603S;ENSP00000369918:N304S	ENSP00000325584:N307S	N	+	2	0	ADAMTSL1	18882551	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.231000	0.58639	2.012000	0.59069	0.454000	0.30748	AAC			0.567	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401206.1			
BICD2	23299	mdanderson.org	37	9	95481138	95481138	+	Silent	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr9:95481138G>T	ENST00000375512.3	-	5	1856	c.1789C>A	c.(1789-1791)Cga>Aga	p.R597R	BICD2_ENST00000356884.6_Silent_p.R597R	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	597					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CCATCTGCTCGGCCCGCCTCA	0.721																																					p.R597R													.	.			0			c.C1789A												11.0	12.0	12.0					9																	95481138		2184	4282	6466	SO:0001819	synonymous_variant	23299	exon5			CTGCTCGGCCCGC	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.1789C>A	9.37:g.95481138G>T			48	0	0		50	0.06	3	NM_001003800	25	0.00	0	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Silent	SNP	ENST00000375512.3	37	CCDS6700.1																																																																																					0.721	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055508.1		NM_015250	
C9orf91	203197	broad.mit.edu	37	9	117379536	117379536	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr9:117379536G>T	ENST00000288502.4	+	2	498	c.61G>T	c.(61-63)Ggc>Tgc	p.G21C	C9orf91_ENST00000471206.1_3'UTR|Y_RNA_ENST00000364879.1_RNA|C9orf91_ENST00000374049.4_Missense_Mutation_p.G21C|AL160275.1_ENST00000606438.1_RNA			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	21						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						CTCCTCCCCTGGCTGGAGTGC	0.612																																					p.G21C													.	C9orf91	32		0			c.G61T												29.0	34.0	32.0					9																	117379536		2203	4300	6503	SO:0001583	missense	203197	exon2			TCCCCTGGCTGGA	BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.61G>T	9.37:g.117379536G>T	ENSP00000288502:p.Gly21Cys		292	0.0034246575	1		305	0.02	5	NM_153045	12	0.00	0	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Missense_Mutation	SNP	ENST00000288502.4	37	CCDS6808.1	.	.	.	.	.	.	.	.	.	.	G	11.18	1.562114	0.27915	.	.	ENSG00000157693	ENST00000374049;ENST00000288502	.	.	.	4.26	0.445	0.16597	.	0.469841	0.21777	N	0.069275	T	0.37073	0.0990	L	0.36672	1.1	0.21147	N	0.999778	D	0.56746	0.977	P	0.57548	0.823	T	0.14783	-1.0460	9	0.56958	D	0.05	0.0283	6.4935	0.22130	0.4067:0.0:0.5933:0.0	.	21	Q5VZI3	CI091_HUMAN	C	21	.	ENSP00000288502:G21C	G	+	1	0	C9orf91	116419357	0.650000	0.27331	0.112000	0.21494	0.023000	0.10783	0.640000	0.24705	0.078000	0.16900	0.555000	0.69702	GGC			0.612	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000053780.1		NM_153045	
PPP1R26	9858	ucsc.edu	37	9	138376590	138376590	+	Nonsense_Mutation	SNP	C	C	A			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chr9:138376590C>A	ENST00000356818.2	+	4	783	c.234C>A	c.(232-234)tgC>tgA	p.C78*	PPP1R26_ENST00000602993.1_Intron|PPP1R26_ENST00000605286.1_Nonsense_Mutation_p.C78*|PPP1R26_ENST00000401470.3_Nonsense_Mutation_p.C78*|PPP1R26_ENST00000604351.1_Nonsense_Mutation_p.C78*|PPP1R26_ENST00000605660.1_Nonsense_Mutation_p.C78*	NM_014811.3	NP_055626.3	Q5T8A7	PPR26_HUMAN	protein phosphatase 1, regulatory subunit 26	78					negative regulation of phosphatase activity (GO:0010923)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CAGAGGGATGCCACGACGCCA	0.687																																					p.C78X													.	.			0			c.C234A												24.0	29.0	28.0					9																	138376590		2199	4286	6485	SO:0001587	stop_gained	9858	exon4			GGGATGCCACGAC	AB014549	CCDS6988.1	9q34.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000196422	ENSG00000196422		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29089	protein-coding gene	gene with protein product	"""DRIM/UTP20 interacting protein"", ""1A6/DRIM (down-regulated in metastasis) interacting protein"""	614056	"""KIAA0649"""	KIAA0649		9734811, 16053918	Standard	NM_014811		Approved		uc004cfr.1	Q5T8A7	OTTHUMG00000020904	ENST00000356818.2:c.234C>A	9.37:g.138376590C>A	ENSP00000349274:p.Cys78*		34	0	0		29	0.14	4	NM_014811	36	0.00	0	Q86WU0|Q8WVV0|Q9Y4D3	Nonsense_Mutation	SNP	ENST00000356818.2	37	CCDS6988.1	.	.	.	.	.	.	.	.	.	.	C	17.51	3.407405	0.62399	.	.	ENSG00000196422	ENST00000356818;ENST00000401470	.	.	.	4.19	1.21	0.21127	.	0.732661	0.12785	N	0.439314	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-8.1175	4.9692	0.14105	0.0:0.5864:0.1541:0.2595	.	.	.	.	X	78	.	ENSP00000349274:C78X	C	+	3	2	KIAA0649	137516411	0.065000	0.20965	0.002000	0.10522	0.015000	0.08874	2.037000	0.41174	0.127000	0.18452	-0.136000	0.14681	TGC			0.687	PPP1R26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054987.1		NM_014811	
SUPT20HL1	100130302	bcgsc.ca	37	X	24382372	24382372	+	IGR	SNP	A	A	G	rs2695489		TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chrX:24382372A>G								AC004552.1 (15349 upstream) : PDK3 (100965 downstream)																							tgctgctgctattgctgctgc	0.577																																					p.I499V													.	.			0			c.A1495G												10.0	8.0	8.0					X																	24382372		1496	3415	4911	SO:0001628	intergenic_variant	0	exon1			GCTGCTATTGCTG																													X.37:g.24382372A>G			209	0.023923445	5		211	0.13	27	NM_001136234	0		0		RNA	SNP		37																																																																																					0	0.577										
NAP1L3	4675	mdanderson.org	37	X	92927835	92927835	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AANV-01A-11D-A435-10	TCGA-XE-AANV-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	d27a570c-2115-4885-9939-4aa5955bf4cd	b5dc854d-44a1-4ef2-87fe-c65fc39f7d2e	g.chrX:92927835G>T	ENST00000373079.3	-	1	732	c.469C>A	c.(469-471)Cct>Act	p.P157T	FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.P150T|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	157	Glu-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TCTTCTGTAGGCTCGTATTCT	0.428																																					p.P157T													.	.			0			c.C469A												69.0	55.0	60.0					X																	92927835		2203	4300	6503	SO:0001583	missense	4675	exon1			CTGTAGGCTCGTA		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.469C>A	X.37:g.92927835G>T	ENSP00000362171:p.Pro157Thr		101	0	0		79	0.05	4	NM_004538	33	0.00	0	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	37	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	G	12.89	2.073847	0.36566	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.28069	1.63	3.66	3.66	0.41972	.	0.000000	0.85682	D	0.000000	T	0.48150	0.1484	M	0.87758	2.905	0.20403	N	0.99991	P	0.42357	0.777	P	0.51170	0.661	T	0.46233	-0.9206	10	0.87932	D	0	.	8.3942	0.32546	0.0:0.2355:0.7645:0.0	.	157	Q99457	NP1L3_HUMAN	T	157;150	ENSP00000362171:P157T	ENSP00000362171:P157T	P	-	1	0	NAP1L3	92814491	1.000000	0.71417	0.405000	0.26409	0.977000	0.68977	3.444000	0.52914	2.109000	0.64355	0.529000	0.55759	CCT			0.428	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057449.1		NM_004538	
