#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
LRRC7	57554	broad.mit.edu	37	1	70504282	70504282	+	Silent	SNP	T	T	C			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr1:70504282T>C	ENST00000035383.5	+	19	2691	c.2661T>C	c.(2659-2661)ccT>ccC	p.P887P	LRRC7_ENST00000310961.5_Silent_p.P892P|LRRC7_ENST00000415775.2_Silent_p.P171P	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	887						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TACCTAGTCCTTTTTCTCCAG	0.443																																					p.P887P													.	LRRC7	400		0			c.T2661C												73.0	76.0	75.0					1																	70504282		2203	4300	6503	SO:0001819	synonymous_variant	57554	exon19			TAGTCCTTTTTCT		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2661T>C	1.37:g.70504282T>C			183	0.0054644809	1		170	0.03	5	NM_020794	1	0.00	0	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	37	CCDS645.1																																																																																					0.443	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000131261.1		NM_020794	
SCCPDH	51097	hgsc.bcm.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	246922343	246922343	+	Missense_Mutation	SNP	A	A	G	rs142346609	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr1:246922343A>G	ENST00000366510.3	+	7	1079	c.703A>G	c.(703-705)Att>Gtt	p.I235V		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	235						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		CAGGTGGCCAATTTCTTATTG	0.393													A|||	16	0.00319489	0.0121	0.0	5008	,	,		17890	0.0		0.0	False		,,,				2504	0.0				p.I235V													.	.			0			c.A703G							A	VAL/ILE	75,4331	67.0+/-104.6	1,73,2129	237.0	232.0	233.0		703	-9.0	0.0	1	dbSNP_134	233	0,8600		0,0,4300	yes	missense	SCCPDH	NM_016002.2	29	1,73,6429	GG,GA,AA		0.0,1.7022,0.5767	benign	235/430	246922343	75,12931	2203	4300	6503	SO:0001583	missense	51097	exon7			TGGCCAATTTCTT		CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.703A>G	1.37:g.246922343A>G	ENSP00000355467:p.Ile235Val		137	0	0		162	0.15	24	NM_016002	77	0.27	21	Q8TAR0|Q9Y363	Missense_Mutation	SNP	ENST00000366510.3	37	CCDS31084.1	6	0.0027472527472527475	6	0.012195121951219513	0	0.0	0	0.0	0	0.0	A	2.596	-0.294021	0.05568	0.017022	0.0	ENSG00000143653	ENST00000366510;ENST00000366509	T	0.39997	1.05	6.16	-8.97	0.00758	.	0.373010	0.29924	N	0.010852	T	0.04272	0.0118	N	0.01109	-1.01	0.09310	N	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.33624	-0.9861	10	0.02654	T	1	.	13.7522	0.62915	0.2047:0.1615:0.6338:0.0	.	235	Q8NBX0	SCPDL_HUMAN	V	235;66	ENSP00000355467:I235V	ENSP00000355466:I66V	I	+	1	0	SCCPDH	244988966	0.000000	0.05858	0.012000	0.15200	0.885000	0.51271	-1.167000	0.03126	-0.982000	0.03515	0.528000	0.53228	ATT	0.006		0.393	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000096902.2		NM_016002	
P4HA1	5033	hgsc.bcm.edu	37	10	74768046	74768046	+	Silent	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr10:74768046G>T	ENST00000307116.2	-	15	1655	c.1539C>A	c.(1537-1539)tcC>tcA	p.S513S	P4HA1_ENST00000412021.2_Silent_p.S513S|P4HA1_ENST00000394890.2_Silent_p.S513S|P4HA1_ENST00000263556.3_Silent_p.S513S|P4HA1_ENST00000440381.1_Silent_p.S495S|P4HA1_ENST00000373008.2_Silent_p.S513S			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I	513	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	GCCATTTATTGGATACTGTGA	0.343																																					p.S513S	Colon(147;367 2405 2662 52127)												.	.			0			c.C1539A												101.0	99.0	100.0					10																	74768046		2203	4300	6503	SO:0001819	synonymous_variant	5033	exon15			TTTATTGGATACT		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1539C>A	10.37:g.74768046G>T			87	0	0		114	0.06	7	NM_000917	180	0.00	0	C9JL12|Q15082|Q15083|Q5VSQ5	Silent	SNP	ENST00000307116.2	37																																																																																						0.343	P4HA1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000048601.1		NM_000917	
DENND5A	23258	mdanderson.org	37	11	9225755	9225755	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:9225755G>T	ENST00000328194.3	-	4	721	c.401C>A	c.(400-402)gCc>gAc	p.A134D	DENND5A_ENST00000530044.1_Missense_Mutation_p.A134D	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	134	UDENN.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						AAATGTGAGGGCAAACCCAAA	0.512																																					p.A134D													.	.			0			c.C401A												130.0	104.0	113.0					11																	9225755		2201	4296	6497	SO:0001583	missense	23258	exon4			GTGAGGGCAAACC	AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.401C>A	11.37:g.9225755G>T	ENSP00000328524:p.Ala134Asp		74	0	0		49	0.06	3	NM_001243254	37	0.00	0	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	ENST00000328194.3	37	CCDS31423.1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.644895	0.87859	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.49720	0.77;0.77	5.57	5.57	0.84162	uDENN (3);	0.106561	0.64402	D	0.000004	T	0.64416	0.2596	M	0.71206	2.165	0.80722	D	1	P;B	0.40731	0.728;0.053	P;B	0.51550	0.673;0.261	T	0.66376	-0.5939	10	0.87932	D	0	.	19.555	0.95342	0.0:0.0:1.0:0.0	.	134;134	E9PS91;Q6IQ26	.;DEN5A_HUMAN	D	134	ENSP00000328524:A134D;ENSP00000435866:A134D	ENSP00000328524:A134D	A	-	2	0	DENND5A	9182331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.022000	0.88759	2.640000	0.89533	0.655000	0.94253	GCC			0.512	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385910.2		NM_015213	
LPXN	9404	mdanderson.org	37	11	58322361	58322361	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:58322361C>T	ENST00000395074.2	-	4	359	c.271G>A	c.(271-273)Gct>Act	p.A91T	LPXN_ENST00000528954.1_Missense_Mutation_p.A96T|LPXN_ENST00000528489.1_Missense_Mutation_p.A71T	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	91					cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TCCAACTGAGCAGCTGCTGAC	0.478																																					p.A96T													.	.			0			c.G286A												156.0	141.0	146.0					11																	58322361		2201	4295	6496	SO:0001583	missense	9404	exon4			ACTGAGCAGCTGC	AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.271G>A	11.37:g.58322361C>T	ENSP00000378512:p.Ala91Thr		55	0	0		46	0.07	3	NM_001143995	27	0.00	0	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	ENST00000395074.2	37	CCDS7969.1	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883880	0.51908	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	T;T	0.30448	1.53;1.53	5.74	1.71	0.24356	.	0.364726	0.27754	N	0.017999	T	0.24812	0.0602	M	0.73598	2.24	0.09310	N	0.99999	B;B;B	0.28998	0.001;0.001;0.23	B;B;B	0.24006	0.002;0.003;0.05	T	0.26052	-1.0114	10	0.13108	T	0.6	.	4.6292	0.12493	0.1512:0.6043:0.0:0.2445	.	71;96;91	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	T	96;91	ENSP00000431284:A96T;ENSP00000378512:A91T	ENSP00000378512:A91T	A	-	1	0	LPXN	58078937	0.000000	0.05858	0.178000	0.23040	0.885000	0.51271	0.097000	0.15168	0.058000	0.16222	0.563000	0.77884	GCT			0.478	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000394709.1		NM_004811	
MS4A13	503497	mdanderson.org	37	11	60285575	60285575	+	Missense_Mutation	SNP	A	A	T	rs10736706	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:60285575A>T	ENST00000527948.1	+	2	577	c.19A>T	c.(19-21)Att>Ttt	p.I7F	MS4A13_ENST00000437058.2_Missense_Mutation_p.I7F|MS4A13_ENST00000378185.2_Missense_Mutation_p.I7F|MS4A13_ENST00000378186.2_Missense_Mutation_p.I7F			Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 13	0						integral component of membrane (GO:0016021)				endometrium(3)|large_intestine(1)|lung(2)|skin(2)	8						CATCTTTCACATTTTCATGTG	0.318																																					p.I7F													.	.			0			c.A19T												117.0	114.0	115.0					11																	60285575		2203	4300	6503	SO:0001583	missense	503497	exon3			TTTCACATTTTCA	AY324188	CCDS31571.1, CCDS41653.1, CCDS60801.1	11q12.2	2005-12-05	2005-12-05		ENSG00000204979	ENSG00000204979			16674	protein-coding gene	gene with protein product							Standard	NM_001012417		Approved		uc001nps.3	Q5J8X5	OTTHUMG00000167615	ENST00000527948.1:c.19A>T	11.37:g.60285575A>T	ENSP00000432713:p.Ile7Phe		87	0	0		59	0.03	2	NM_001100909	0		0	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	ENST00000527948.1	37		.	.	.	.	.	.	.	.	.	.	G	6.930	0.541380	0.13250	.	.	ENSG00000204979	ENST00000378186;ENST00000378185;ENST00000437058;ENST00000527948	T;T;T;T	0.35789	4.28;1.71;1.29;1.3	5.65	-2.11	0.07187	.	0.755505	0.11745	N	0.533590	T	0.17492	0.0420	N	0.19112	0.55	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.08055	0.001;0.001;0.003	T	0.21177	-1.0253	10	0.72032	D	0.01	-8.5856	0.9084	0.01289	0.3129:0.1122:0.3452:0.2297	.	7;7;7	Q5J8X5-3;Q5J8X5-2;Q5J8X5	.;.;M4A13_HUMAN	F	7	ENSP00000367428:I7F;ENSP00000367427:I7F;ENSP00000415535:I7F;ENSP00000432713:I7F	ENSP00000367427:I7F	I	+	1	0	MS4A13	60042151	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.024000	0.13555	-0.233000	0.09797	-1.918000	0.00516	ATT			0.318	MS4A13-003	NOVEL	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000395411.1		NM_001012417	
PTGDR2	11251	mdanderson.org	37	11	60621017	60621017	+	Missense_Mutation	SNP	C	C	T	rs145143849		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:60621017C>T	ENST00000332539.4	-	2	290	c.179G>A	c.(178-180)cGc>cAc	p.R60H	RP11-804A23.4_ENST00000538705.1_RNA	NM_004778.2	NP_004769.2	Q9Y5Y4	PD2R2_HUMAN	prostaglandin D2 receptor 2	60					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|calcium-mediated signaling (GO:0019722)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|prostaglandin D receptor activity (GO:0004956)|prostaglandin F receptor activity (GO:0004958)|prostaglandin J receptor activity (GO:0001785)									Indomethacin(DB00328)|Sulindac(DB00605)	CTGGCGCATGCGGCAGCCCAC	0.657																																					p.R60H													.	.			0			c.G179A												47.0	36.0	40.0					11																	60621017		2186	4267	6453	SO:0001583	missense	11251	exon2			CGCATGCGGCAGC	AF118265	CCDS7994.1	11q12-q13.3	2012-08-08	2011-11-11	2011-11-11		ENSG00000183134		"""CD molecules"", ""GPCR / Class A : Prostanoid receptors"""	4502	protein-coding gene	gene with protein product	"""chemoattractant receptor homologous molecule expressed on T helper type 2 cells"""	604837	"""G protein-coupled receptor 44"""	GPR44		10036181	Standard	NM_004778		Approved	CRTH2, CD294, DP2	uc001nqc.2	Q9Y5Y4		ENST00000332539.4:c.179G>A	11.37:g.60621017C>T	ENSP00000332812:p.Arg60His		58	0	0		43	0.07	3	NM_004778	1	0.00	0	O94765|Q4QRI6	Missense_Mutation	SNP	ENST00000332539.4	37	CCDS7994.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.427557	0.43122	.	.	ENSG00000183134	ENST00000332539	T	0.41065	1.01	4.63	3.69	0.42338	GPCR, rhodopsin-like superfamily (1);	0.165147	0.40728	U	0.001039	T	0.27663	0.0680	L	0.31065	0.9	0.30349	N	0.784936	B	0.15930	0.015	B	0.13407	0.009	T	0.10042	-1.0647	10	0.40728	T	0.16	.	7.2598	0.26197	0.0:0.8036:0.0:0.1964	.	60	Q9Y5Y4	GPR44_HUMAN	H	60	ENSP00000332812:R60H	ENSP00000332812:R60H	R	-	2	0	GPR44	60377593	0.017000	0.18338	1.000000	0.80357	0.994000	0.84299	0.478000	0.22212	2.409000	0.81822	0.561000	0.74099	CGC			0.657	PTGDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396328.1		NM_004778	
SLC22A10	387775	hgsc.bcm.edu	37	11	63072405	63072405	+	Intron	SNP	C	C	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:63072405C>G	ENST00000332793.6	+	9	1600				SLC22A10_ENST00000535888.1_Intron|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000526800.1_Intron|SLC22A10_ENST00000544661.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10							integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GCAGTGTACTCTATATCCGTG	0.433																																					.													.	.			0			.												67.0	59.0	61.0					11																	63072405		1909	4118	6027	SO:0001627	intron_variant	100500917	.			TGTACTCTATATC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.1598+44C>G	11.37:g.63072405C>G			63	0	0		41	0.44	18	.	0		0	Q68CJ0	RNA	SNP	ENST00000332793.6	37	CCDS41661.1																																																																																					0.433	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382622.3		NM_001039752	
MYO7A	4647	mdanderson.org	37	11	76891521	76891521	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:76891521G>T	ENST00000409709.3	+	22	2960	c.2688G>T	c.(2686-2688)aaG>aaT	p.K896N	MYO7A_ENST00000458637.2_Missense_Mutation_p.K896N|MYO7A_ENST00000409619.2_Missense_Mutation_p.K885N|MYO7A_ENST00000409893.1_Missense_Mutation_p.K896N	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	896					actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CCGAGCGCAAGCATCAGGTGA	0.622																																					p.K896N													.	.			0			c.G2688T												31.0	39.0	36.0					11																	76891521		2126	4224	6350	SO:0001583	missense	4647	exon22			GCGCAAGCATCAG	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2688G>T	11.37:g.76891521G>T	ENSP00000386331:p.Lys896Asn		35	0	0		31	0.10	3	NM_001127179	3	0.00	0	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	37	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	.	9.989	1.230345	0.22542	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000545136;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419;ENST00000458169	D;D;D;D;D	0.88818	-2.37;-2.43;-2.37;-2.39;-2.14	5.31	2.38	0.29361	.	0.115221	0.56097	D	0.000023	T	0.77579	0.4151	N	0.20881	0.62	0.41869	D	0.990263	B;B;B;B	0.06786	0.0;0.001;0.001;0.0	B;B;B;B	0.08055	0.002;0.002;0.003;0.001	T	0.67616	-0.5625	10	0.17832	T	0.49	.	8.2132	0.31496	0.3592:0.0:0.6408:0.0	.	896;885;896;896	B9A012;B9A011;F8VUN5;Q13402	.;.;.;MYO7A_HUMAN	N	896;896;896;885;107;895;895;772;895;77	ENSP00000386331:K896N;ENSP00000386689:K896N;ENSP00000392185:K896N;ENSP00000386635:K885N;ENSP00000417017:K77N	ENSP00000345075:K772N	K	+	3	2	MYO7A	76569169	0.985000	0.35326	1.000000	0.80357	0.935000	0.57460	0.193000	0.17116	1.234000	0.43709	0.448000	0.29417	AAG			0.622	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000328133.1		NM_000260	
ARHGAP20	57569	mdanderson.org	37	11	110561320	110561320	+	Silent	SNP	G	G	A	rs150049858	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:110561320G>A	ENST00000260283.4	-	3	422	c.138C>T	c.(136-138)agC>agT	p.S46S	ARHGAP20_ENST00000357139.3_Silent_p.S20S|ARHGAP20_ENST00000528829.1_Silent_p.S10S|ARHGAP20_ENST00000533353.1_Silent_p.S20S|ARHGAP20_ENST00000524756.1_Silent_p.S23S|ARHGAP20_ENST00000527598.1_Silent_p.S10S	NM_020809.3	NP_065860.2	Q9P2F6	RHG20_HUMAN	Rho GTPase activating protein 20	46					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)	p.S46S(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(18)|lung(13)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	60		all_cancers(61;3.26e-12)|all_epithelial(67;6.09e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000484)|Acute lymphoblastic leukemia(157;0.000967)|all_neural(223;0.0199)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;3.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|all cancers(92;0.000147)|OV - Ovarian serous cystadenocarcinoma(223;0.0475)		GAGATGGAGCGCTCCTCCTCC	0.388																																					p.S46S													ARHGAP20,caecum,carcinoma,0,1	ARHGAP20	0	1	1	Substitution - coding silent(1)	large_intestine(1)	c.C138T							G		4,4398	8.1+/-20.4	0,4,2197	122.0	103.0	110.0		138	-3.6	0.9	11	dbSNP_134	110	0,8594		0,0,4297	yes	coding-synonymous	ARHGAP20	NM_020809.2		0,4,6494	AA,AG,GG		0.0,0.0909,0.0308		46/1192	110561320	4,12992	2201	4297	6498	SO:0001819	synonymous_variant	57569	exon3			TGGAGCGCTCCTC	AB037812	CCDS31673.1, CCDS58175.1, CCDS58176.1, CCDS58177.1	11q23.2	2011-06-29			ENSG00000137727	ENSG00000137727		"""Rho GTPase activating proteins"""	18357	protein-coding gene	gene with protein product		609568				14532992	Standard	NM_020809		Approved	KIAA1391	uc001pkz.2	Q9P2F6	OTTHUMG00000166590	ENST00000260283.4:c.138C>T	11.37:g.110561320G>A			84	0	0		64	0.06	4	NM_020809	0		0	A8K8C5|B0YIW7|B0YIW8|Q6RJU1|Q6RJU2|Q6RJU3|Q6RJU5|Q8IXS1	Silent	SNP	ENST00000260283.4	37	CCDS31673.1																																																																																			0.001		0.388	ARHGAP20-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000390628.1		NM_020809	
HTR3A	3359	mdanderson.org	37	11	113854000	113854000	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr11:113854000G>T	ENST00000504030.2	+	5	978	c.533G>T	c.(532-534)tGg>tTg	p.W178L	HTR3A_ENST00000355556.2_Missense_Mutation_p.W184L|HTR3A_ENST00000375498.2_Missense_Mutation_p.W184L|HTR3A_ENST00000299961.5_Missense_Mutation_p.W163L|HTR3A_ENST00000506841.2_Missense_Mutation_p.W178L|HTR3A_ENST00000535865.1_5'UTR			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	178					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	TTCACCAGTTGGCTGCACACC	0.607																																					p.W184L													.	.			0			c.G551T												157.0	146.0	149.0					11																	113854000		2201	4296	6497	SO:0001583	missense	3359	exon5			CCAGTTGGCTGCA	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.533G>T	11.37:g.113854000G>T	ENSP00000424189:p.Trp178Leu		86	0	0		44	0.07	3	NM_000869	0		0	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	ENST00000504030.2	37		.	.	.	.	.	.	.	.	.	.	G	22.5	4.296521	0.81025	.	.	ENSG00000166736	ENST00000504030;ENST00000355556;ENST00000375498;ENST00000506841;ENST00000299961	T;T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22;-1.22	5.37	3.41	0.39046	.	0.056922	0.85682	D	0.000000	D	0.87301	0.6143	M	0.85099	2.735	0.80722	D	1	P;B;D	0.55605	0.933;0.036;0.972	P;B;P	0.61275	0.825;0.06;0.886	D	0.89778	0.3959	10	0.87932	D	0	-18.7677	14.5467	0.68035	0.0:0.0:0.7341:0.2659	.	163;184;184	B4DSY6;G5E986;Q7KZM7	.;.;.	L	178;184;184;178;163	ENSP00000424189:W178L;ENSP00000347754:W184L;ENSP00000364648:W184L;ENSP00000424776:W178L;ENSP00000299961:W163L	ENSP00000299961:W163L	W	+	2	0	HTR3A	113359210	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.940000	0.87693	1.245000	0.43885	0.561000	0.74099	TGG			0.607	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000360822.2		NM_000869	
KIAA1551	55196	broad.mit.edu	37	12	32136184	32136184	+	Silent	SNP	G	G	T	rs534318377		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr12:32136184G>T	ENST00000312561.4	+	4	2709	c.2295G>T	c.(2293-2295)ccG>ccT	p.P765P	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	765																	TAGTGTCACCGTTAGTTCTGT	0.403																																					p.P765P													.	.			0			c.G2295T												84.0	80.0	81.0					12																	32136184		2203	4300	6503	SO:0001819	synonymous_variant	55196	exon4			GTCACCGTTAGTT	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.2295G>T	12.37:g.32136184G>T			100	0	0		270	0.01	4	NM_018169	619	0.00	0	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Silent	SNP	ENST00000312561.4	37	CCDS8725.2																																																																																					0.403	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250307.2		NM_018169	
KRT78	196374	mdanderson.org	37	12	53233575	53233575	+	Missense_Mutation	SNP	C	C	T	rs373055664		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr12:53233575C>T	ENST00000304620.4	-	7	1304	c.1241G>A	c.(1240-1242)cGc>cAc	p.R414H	KRT78_ENST00000359499.4_Missense_Mutation_p.R304H	NM_173352.2	NP_775487.2	Q8N1N4	K2C78_HUMAN	keratin 78	414	Coil 2.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18						CAGCAGCCTGCGGTAAGTGGC	0.607																																					p.R414H													.	.			0			c.G1241A							C	HIS/ARG	0,4406		0,0,2203	70.0	61.0	64.0		1241	3.0	1.0	12		64	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT78	NM_173352.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	414/521	53233575	1,13005	2203	4300	6503	SO:0001583	missense	196374	exon7			AGCCTGCGGTAAG	AK096419	CCDS8840.1, CCDS73473.1	12q13.13	2013-06-25			ENSG00000170423	ENSG00000170423		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28926	protein-coding gene	gene with protein product		611159				16831889	Standard	XM_005268695		Approved	K5B	uc001sbc.1	Q8N1N4	OTTHUMG00000169880	ENST00000304620.4:c.1241G>A	12.37:g.53233575C>T	ENSP00000306261:p.Arg414His		48	0	0		44	0.07	3	NM_173352	0		0	A8K4D6|Q5HYM7|Q7RTT2	Missense_Mutation	SNP	ENST00000304620.4	37	CCDS8840.1	.	.	.	.	.	.	.	.	.	.	C	15.34	2.803941	0.50315	0.0	1.16E-4	ENSG00000170423	ENST00000359499;ENST00000304620;ENST00000539860	D;D	0.94687	-3.49;-3.49	3.89	2.98	0.34508	Filament (1);Intermediate filament protein, conserved site (1);	.	.	.	.	D	0.95043	0.8395	M	0.92833	3.35	0.27025	N	0.964374	B	0.31459	0.324	B	0.28465	0.09	D	0.91031	0.4864	9	0.72032	D	0.01	.	12.4504	0.55675	0.0:0.8293:0.1707:0.0	.	414	Q8N1N4	K2C78_HUMAN	H	304;414;185	ENSP00000352479:R304H;ENSP00000306261:R414H	ENSP00000306261:R414H	R	-	2	0	KRT78	51519842	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.883000	0.39658	0.966000	0.38159	-0.502000	0.04539	CGC			0.607	KRT78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406380.1		NM_173352	
CCDC60	160777	mdanderson.org	37	12	119954484	119954484	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr12:119954484G>T	ENST00000327554.2	+	8	1405	c.940G>T	c.(940-942)Gaa>Taa	p.E314*	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	314										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		AGTCACAATAGAAAATGGGAT	0.468																																					p.E314X													CCDC60,bladder,carcinoma,0,1	CCDC60	0	1	0			c.G940T												98.0	95.0	96.0					12																	119954484		2203	4300	6503	SO:0001587	stop_gained	160777	exon8			ACAATAGAAAATG	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.940G>T	12.37:g.119954484G>T	ENSP00000333374:p.Glu314*		41	0	0		45	0.07	3	NM_178499	0		0		Nonsense_Mutation	SNP	ENST00000327554.2	37	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	G	38	6.840025	0.97877	.	.	ENSG00000183273	ENST00000327554	.	.	.	5.06	4.17	0.49024	.	0.380664	0.22250	N	0.062565	.	.	.	.	.	.	0.21256	N	0.999746	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.851	9.4621	0.38792	0.096:0.0:0.904:0.0	.	.	.	.	X	314	.	.	E	+	1	0	CCDC60	118438867	0.076000	0.21285	0.005000	0.12908	0.003000	0.03518	2.745000	0.47459	1.360000	0.45960	-0.150000	0.13652	GAA			0.468	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401680.1		NM_178499	
MRPS31P5	100887750	broad.mit.edu	37	13	52764064	52764065	+	RNA	INS	-	-	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr13:52764064_52764065insA	ENST00000451298.1	-	0	1229				MRPS31P5_ENST00000416599.1_RNA																							AAAGATGCATTAAAAAAAATGA	0.307																																					.													.	.			0			.																																											0	.			ATGCATTAAAAAA																													13.37:g.52764072_52764072dupA			9	0	0		6	0.50	3	.	2	0.00	0		RNA	INS	ENST00000451298.1	37																																																																																						0.307	RP11-248G5.8-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000471093.1			
DACH1	1602	mdanderson.org	37	13	72440446	72440446	+	Silent	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr13:72440446G>A	ENST00000359684.2	-	1	461	c.462C>T	c.(460-462)agC>agT	p.S154S	DACH1_ENST00000354591.4_Silent_p.S154S|DACH1_ENST00000313174.7_Silent_p.S154S|DACH1_ENST00000305425.4_Silent_p.S154S			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	154	Poly-Ser.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		tgctactactgctgctgctgc	0.662																																					p.S154S													.	.			0			c.C462T												3.0	4.0	4.0					13																	72440446		1701	3505	5206	SO:0001819	synonymous_variant	1602	exon1			ACTACTGCTGCTG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.462C>T	13.37:g.72440446G>A			23	0	0		19	0.11	2	NM_080759	1	0.00	0	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Silent	SNP	ENST00000359684.2	37																																																																																						0.662	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding		OTTHUMT00000045240.1		NM_004392	
DCAF5	8816	mdanderson.org	37	14	69619649	69619649	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr14:69619649C>T	ENST00000341516.5	-	1	194	c.47G>A	c.(46-48)gGc>gAc	p.G16D	DCAF5_ENST00000389997.6_Missense_Mutation_p.G16D|DCAF5_ENST00000554215.1_5'Flank|DCAF5_ENST00000556847.1_5'Flank|DCAF5_ENST00000557386.1_Missense_Mutation_p.G16D	NM_001284206.1|NM_001284207.1|NM_003861.2	NP_001271135.1|NP_001271136.1|NP_003852.1	Q96JK2	DCAF5_HUMAN	DDB1 and CUL4 associated factor 5	16					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|upper_aerodigestive_tract(2)	29						GGACAAGAAGCCCACCACTGA	0.682																																					p.G16D													.	.			0			c.G47A												32.0	38.0	36.0					14																	69619649		2203	4300	6503	SO:0001583	missense	8816	exon1			AAGAAGCCCACCA	AB058727	CCDS32106.1, CCDS61480.1, CCDS61481.1, CCDS73646.1	14q23-q24.1	2013-01-09	2009-07-17	2009-07-17				"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20224	protein-coding gene	gene with protein product		603812	"""WD repeat domain 22"""	WDR22		9740667, 9521877	Standard	NM_003861		Approved	BCRP2, D14S1461E, BCRG2, KIAA1824	uc001xkp.3	Q96JK2		ENST00000341516.5:c.47G>A	14.37:g.69619649C>T	ENSP00000341351:p.Gly16Asp		40	0	0		44	0.07	3	NM_003861	22	0.00	0	B2RN31|G3V4J7|O60559|Q8N3V3|Q8N3V5	Missense_Mutation	SNP	ENST00000341516.5	37	CCDS32106.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.635495	0.87760	.	.	ENSG00000139990	ENST00000341516;ENST00000557386;ENST00000389997	T;T;T	0.69926	-0.38;0.32;-0.44	4.0	4.0	0.46444	.	0.000000	0.64402	D	0.000001	T	0.69233	0.3088	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;0.982;0.97	D;P;P	0.87578	0.998;0.83;0.762	T	0.65335	-0.6193	10	0.18276	T	0.48	-12.1656	16.0893	0.81082	0.0:1.0:0.0:0.0	.	16;16;16	Q8TBB7;G3V4J7;Q96JK2	.;.;DCAF5_HUMAN	D	16	ENSP00000341351:G16D;ENSP00000451845:G16D;ENSP00000374647:G16D	ENSP00000341351:G16D	G	-	2	0	DCAF5	68689402	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.592000	0.74095	1.966000	0.57179	0.491000	0.48974	GGC			0.682	DCAF5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000414806.2		NM_003861	
KIF26A	26153	mdanderson.org	37	14	104642874	104642874	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr14:104642874G>T	ENST00000423312.2	+	12	3749	c.3749G>T	c.(3748-3750)tGt>tTt	p.C1250F	KIF26A_ENST00000315264.7_Missense_Mutation_p.C1111F	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1250					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTAGGGGAGTGTGATACCCAG	0.692																																					p.C1250F													.	.			0			c.G3749T												28.0	35.0	33.0					14																	104642874		2013	4158	6171	SO:0001583	missense	26153	exon12			GGGAGTGTGATAC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.3749G>T	14.37:g.104642874G>T	ENSP00000388241:p.Cys1250Phe		13	0	0		20	0.10	2	NM_015656	72	0.00	0	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	ENST00000423312.2	37	CCDS45171.1	.	.	.	.	.	.	.	.	.	.	G	0.078	-1.189138	0.01607	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.78126	-1.15;-1.15	3.27	2.32	0.28847	.	.	.	.	.	T	0.66896	0.2836	L	0.36672	1.1	0.09310	N	1	P	0.36144	0.539	B	0.31016	0.123	T	0.57093	-0.7870	9	0.59425	D	0.04	.	12.3261	0.55011	0.0:0.1725:0.8275:0.0	.	1250	Q9ULI4	KI26A_HUMAN	F	1250;1111	ENSP00000388241:C1250F;ENSP00000325452:C1111F	ENSP00000325452:C1111F	C	+	2	0	KIF26A	103712627	0.268000	0.24133	0.014000	0.15608	0.253000	0.25986	2.227000	0.42972	0.674000	0.31244	0.205000	0.17691	TGT			0.692	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414356.1			
DISP2	85455	mdanderson.org	37	15	40660380	40660380	+	Silent	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr15:40660380G>A	ENST00000267889.3	+	8	2154	c.2067G>A	c.(2065-2067)ctG>ctA	p.L689L	RP11-64K12.4_ENST00000558421.1_RNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	689					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCTCGCGTCTGCTCTTCCAGC	0.746																																					p.L689L													.	.			0			c.G2067A												9.0	9.0	9.0					15																	40660380		2176	4253	6429	SO:0001819	synonymous_variant	85455	exon8			GCGTCTGCTCTTC	AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.2067G>A	15.37:g.40660380G>A			38	0	0		23	0.13	3	NM_033510	0		0	Q6AHW3|Q9C0C1	Silent	SNP	ENST00000267889.3	37	CCDS10056.1																																																																																					0.746	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252249.1		NM_033510	
DET1	55070	broad.mit.edu	37	15	89056263	89056263	+	Silent	SNP	A	A	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr15:89056263A>G	ENST00000268148.8	-	5	1717	c.1572T>C	c.(1570-1572)ccT>ccC	p.P524P	DET1_ENST00000564406.1_Silent_p.P535P|RP11-97O12.7_ENST00000606219.1_RNA|DET1_ENST00000444300.1_Silent_p.P535P	NM_001144074.1	NP_001137546.1	Q7L5Y6	DET1_HUMAN	de-etiolated homolog 1 (Arabidopsis)	524						nucleus (GO:0005634)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			AAGGCTCAAAAGGGTGAAAGG	0.552																																					p.P535P													.	DET1	55		0			c.T1605C												89.0	87.0	88.0					15																	89056263		2014	4177	6191	SO:0001819	synonymous_variant	55070	exon6			CTCAAAAGGGTGA	BC001242	CCDS45343.1, CCDS45344.1	15q25.3	2004-12-13				ENSG00000140543			25477	protein-coding gene	gene with protein product		608727				14739464	Standard	NM_001144074		Approved	FLJ10103	uc002bmq.2	Q7L5Y6		ENST00000268148.8:c.1572T>C	15.37:g.89056263A>G			135	0	0		139	0.02	3	NM_017996	41	0.00	0	B3KNN6|Q2VPC0|Q9NWD5	Silent	SNP	ENST00000268148.8	37	CCDS45344.1																																																																																					0.552	DET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415442.2		NM_017996	
PRR25	388199	mdanderson.org	37	16	855797	855797	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr16:855797G>T	ENST00000301698.1	+	1	355	c.355G>T	c.(355-357)Gga>Tga	p.G119*		NM_001013638.1	NP_001013660.1	Q96S07	PRR25_HUMAN	proline rich 25	119	Pro-rich.									large_intestine(1)|lung(1)|skin(1)	3						GCGCCCACAGGGAACTCCTGC	0.637																																					p.G119X													.	.			0			c.G355T												15.0	20.0	19.0					16																	855797		1944	4118	6062	SO:0001587	stop_gained	388199	exon1			CCACAGGGAACTC	BC156145	CCDS45372.1	16p13.3	2009-09-11			ENSG00000167945	ENSG00000167945			37230	protein-coding gene	gene with protein product						11157797	Standard	NM_001013638		Approved	gs64	uc010uut.2	Q96S07		ENST00000301698.1:c.355G>T	16.37:g.855797G>T	ENSP00000301698:p.Gly119*		27	0	0		26	0.12	3	NM_001013638	0		0		Nonsense_Mutation	SNP	ENST00000301698.1	37	CCDS45372.1	.	.	.	.	.	.	.	.	.	.	G	14.13	2.443840	0.43429	.	.	ENSG00000167945	ENST00000301698	.	.	.	0.668	0.668	0.17912	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	7.1142	0.25407	1.0E-4:0.0:0.9999:0.0	.	.	.	.	X	119	.	ENSP00000301698:G119X	G	+	1	0	PRR25	795798	0.061000	0.20836	0.090000	0.20809	0.032000	0.12392	1.140000	0.31516	0.613000	0.30089	0.462000	0.41574	GGA			0.637	PRR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440563.1		NM_001013638	
PKD1	5310	mdanderson.org	37	16	2162857	2162857	+	Silent	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr16:2162857C>T	ENST00000262304.4	-	13	3301	c.3093G>A	c.(3091-3093)ctG>ctA	p.L1031L	RP11-304L19.4_ENST00000568795.1_RNA|PKD1_ENST00000423118.1_Silent_p.L1031L	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	1031	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CATTGGGGGACAGCACGGCCG	0.652																																					p.L1031L													.	.			0			c.G3093A												107.0	102.0	103.0					16																	2162857		2195	4299	6494	SO:0001819	synonymous_variant	5310	exon13			GGGGGACAGCACG	L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.3093G>A	16.37:g.2162857C>T			19	0	0		18	0.11	2	NM_001009944	17	0.00	0	Q15140|Q15141	Silent	SNP	ENST00000262304.4	37	CCDS32369.1																																																																																					0.652	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341688.1			
PPL	5493	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	16	4943298	4943300	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	CTC	CTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr16:4943298_4943300delCTC	ENST00000345988.2	-	14	1653_1655	c.1564_1566delGAG	c.(1564-1566)gagdel	p.E522del	PPL_ENST00000590782.2_In_Frame_Del_p.E520del	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	522					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						TGATGGCCTTCTCCTGCCGGTCC	0.67																																					p.522_523del													.	PPL	168		0			c.1565_1567del																																									SO:0001651	inframe_deletion	5493	exon14			GGCCTTCTCCTGC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.1564_1566delGAG	16.37:g.4943298_4943300delCTC	ENSP00000340510:p.Glu522del		48	0	0		39	0.28	11	NM_002705	4	0.00	0	O60314|O60454|Q14C98	In_Frame_Del	DEL	ENST00000345988.2	37	CCDS10526.1																																																																																					0.670	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251715.1		NM_002705	
EXOC3L1	283849	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	67218711	67218711	+	Silent	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr16:67218711G>A	ENST00000314586.6	-	13	2148	c.1908C>T	c.(1906-1908)ggC>ggT	p.G636G	KIAA0895L_ENST00000563902.1_5'Flank|KIAA0895L_ENST00000290881.7_5'Flank|EXOC3L1_ENST00000562887.1_5'Flank|KIAA0895L_ENST00000563831.2_5'Flank|KIAA0895L_ENST00000561621.1_5'Flank	NM_178516.3	NP_848611.2	Q86VI1	EX3L1_HUMAN	exocyst complex component 3-like 1	636					exocytosis (GO:0006887)|peptide hormone secretion (GO:0030072)	exocyst (GO:0000145)|secretory granule (GO:0030141)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	21						TCTCCTCCAGGCCCTGAGCAC	0.701																																					p.G636G													.	EXOC3L1	52		0			c.C1908T												23.0	28.0	26.0					16																	67218711		2198	4293	6491	SO:0001819	synonymous_variant	283849	exon13			CTCCAGGCCCTGA	AK092858	CCDS10832.1	16q22.1	2011-01-31	2011-01-31	2011-01-31	ENSG00000179044	ENSG00000179044			27540	protein-coding gene	gene with protein product		614117	"""exocyst complex component 3-like"""	EXOC3L		12477932	Standard	NM_178516		Approved	FLJ35539, FLJ35587	uc002erx.1	Q86VI1	OTTHUMG00000137508	ENST00000314586.6:c.1908C>T	16.37:g.67218711G>A			27	0	0		25	0.16	4	NM_178516	12	0.08	1	A8K7I9|Q8NAD2|Q8TEN2	Silent	SNP	ENST00000314586.6	37	CCDS10832.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.665616	0.47677	.	.	ENSG00000179044	ENST00000545725;ENST00000314553	T	0.23147	1.92	4.91	-3.42	0.04825	.	.	.	.	.	T	0.14614	0.0353	.	.	.	0.80722	D	1	B;B	0.17268	0.017;0.021	B;B	0.18871	0.013;0.023	T	0.20840	-1.0263	8	0.66056	D	0.02	-4.9999	1.6756	0.02821	0.3099:0.228:0.3464:0.1157	.	564;564	F5H4W1;B7Z6U0	.;.	S	564;569	ENSP00000439910:P564S	ENSP00000325008:P569S	P	-	1	0	EXOC3L1	65776212	0.387000	0.25188	0.988000	0.46212	0.758000	0.43043	-0.576000	0.05854	-0.192000	0.10432	-0.258000	0.10820	CCT			0.701	EXOC3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268827.2		NM_178516	
ANKRD11	29123	mdanderson.org	37	16	89357055	89357055	+	Missense_Mutation	SNP	G	G	T	rs142820281		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr16:89357055G>T	ENST00000301030.4	-	6	1039	c.579C>A	c.(577-579)gaC>gaA	p.D193E	ANKRD11_ENST00000378330.2_Missense_Mutation_p.D193E	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	193					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGACGTTGACGTCTGCCCCCT	0.662																																					p.D193E													ANKRD11,NS,carcinoma,-2,1	ANKRD11	-2	1	0			c.C579A												56.0	58.0	57.0					16																	89357055		2198	4300	6498	SO:0001583	missense	29123	exon7			GTTGACGTCTGCC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.579C>A	16.37:g.89357055G>T	ENSP00000301030:p.Asp193Glu		57	0	0		40	0.08	3	NM_001256182	88	0.00	0	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	37	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255666	0.80135	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000378332	T;T	0.39229	1.09;1.09	5.45	-8.65	0.00870	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.50051	0.1593	L	0.45051	1.395	0.80722	D	1	D;D;D	0.56968	0.978;0.972;0.978	D;D;D	0.71870	0.975;0.966;0.969	T	0.68025	-0.5518	10	0.72032	D	0.01	.	19.7006	0.96050	0.7972:0.0:0.2028:0.0	.	193;207;193	A8K4M9;Q59GC3;Q6UB99	.;.;ANR11_HUMAN	E	193;193;207	ENSP00000301030:D193E;ENSP00000367581:D193E	ENSP00000301030:D193E	D	-	3	2	ANKRD11	87884556	0.210000	0.23517	0.099000	0.21106	0.833000	0.47200	-0.475000	0.06599	-1.582000	0.01640	-1.036000	0.02392	GAC			0.662	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
TVP23C	201158	ucsc.edu	37	17	15457087	15457087	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:15457087C>T	ENST00000225576.3	-	3	247	c.152G>A	c.(151-153)tGt>tAt	p.C51Y	TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.C51Y|TVP23C_ENST00000438826.3_Missense_Mutation_p.C51Y|TVP23C_ENST00000518321.1_Missense_Mutation_p.C51Y|TVP23C_ENST00000519970.1_Intron|TVP23C_ENST00000584811.1_5'UTR|TVP23C_ENST00000428082.2_Missense_Mutation_p.C51Y	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	51						integral component of membrane (GO:0016021)											ACAGAGAAGACAGACGATGAT	0.373																																					p.C51Y													.	.			0			c.G152A												274.0	265.0	268.0					17																	15457087		2203	4300	6503	SO:0001583	missense	0	exon3			AGAAGACAGACGA	BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.152G>A	17.37:g.15457087C>T	ENSP00000225576:p.Cys51Tyr		260	0.0384615385	10		199	0.08	15	NM_145301	89	0.33	29	Q3LIC7	Missense_Mutation	SNP	ENST00000225576.3	37	CCDS11170.1	.	.	.	.	.	.	.	.	.	.	.	2.368	-0.344949	0.05208	.	.	ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000225576;ENST00000428082;ENST00000438826	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.47	4.47	0.54385	.	0.000000	0.85682	N	0.000000	T	0.02571	0.0078	N	0.00004	-3.335	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.0;0.002	T	0.38457	-0.9660	10	0.02654	T	1	-3.8701	9.492	0.38965	0.0:0.0877:0.0:0.9123	.	51;51;51	Q96ET8-2;Q96ET8-3;Q96ET8	.;.;F18B2_HUMAN	Y	51	ENSP00000429865:C51Y;ENSP00000225576:C51Y;ENSP00000406387:C51Y;ENSP00000413355:C51Y	ENSP00000225576:C51Y	C	-	2	0	RP11-726O12.1;FAM18B2	15397812	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	6.178000	0.71968	0.670000	0.31165	-0.442000	0.05670	TGT			0.373	TVP23C-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000130705.2		NM_145301	
ALKBH5	54890	mdanderson.org	37	17	18087632	18087632	+	Silent	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:18087632G>A	ENST00000399138.4	+	1	80	c.75G>A	c.(73-75)gcG>gcA	p.A25A	ALKBH5_ENST00000541285.1_Intron|RP11-258F1.1_ENST00000577847.1_RNA|RP11-258F1.1_ENST00000583062.1_RNA	NM_017758.3	NP_060228.3	Q6P6C2	ALKB5_HUMAN	AlkB family member 5, RNA demethylase	25					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|oxidative single-stranded RNA demethylation (GO:0035553)|response to hypoxia (GO:0001666)|spermatogenesis (GO:0007283)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|oxidative RNA demethylase activity (GO:0035515)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|skin(1)	10	all_neural(463;0.228)					ACTATAAGGCGGGCAGCCGGG	0.726																																					p.A25A	Ovarian(166;154 1953 40235 46283 46309)												.	.			0			c.G75A												1.0	2.0	2.0					17																	18087632		958	2252	3210	SO:0001819	synonymous_variant	54890	exon1			TAAGGCGGGCAGC	AK000315	CCDS42272.1	17p11.2	2014-07-23	2014-07-23	2006-02-09	ENSG00000091542	ENSG00000091542	1.14.11.-	"""Alkylation repair homologs"""	25996	protein-coding gene	gene with protein product		613303	"""oxoglutarate and iron-dependent oxygenase domain containing"", ""alkB, alkylation repair homolog 5 (E. coli)"""	OFOXD1		11997338, 24778178	Standard	NM_017758		Approved	FLJ20308	uc010cpw.3	Q6P6C2	OTTHUMG00000059397	ENST00000399138.4:c.75G>A	17.37:g.18087632G>A			13	0	0		20	0.15	3	NM_017758	22	0.00	0	B4DVJ4|D3DXC6|Q9NXD6	Silent	SNP	ENST00000399138.4	37	CCDS42272.1																																																																																					0.726	ALKBH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000132069.3		NM_017758	
RP11-434D2.11	0	broad.mit.edu	37	17	20459719	20459719	+	RNA	DEL	A	A	-	rs57794427|rs149462269		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:20459719delA	ENST00000579603.1	-	0	63																											atatatatatatatatatata	0.353																																					.													.	.			0			.																																											0	.			ATATATATATATA																													17.37:g.20459719delA			132	0.0227272727	3		41	0.27	11	.	0		0		RNA	DEL	ENST00000579603.1	37																																																																																						0.353	RP11-434D2.11-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000448286.1			
SUPT6H	6830	mdanderson.org	37	17	27028472	27028472	+	Silent	SNP	A	A	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:27028472A>G	ENST00000314616.6	+	37	5293	c.5010A>G	c.(5008-5010)gcA>gcG	p.A1670A	SUPT6H_ENST00000347486.4_Silent_p.A1670A|PROCA1_ENST00000579650.1_5'Flank	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1670	Interaction with histone H2B and H3.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ACAGCCATGCAGCCATCGACT	0.567																																					p.A1670A													SUPT6H,NS,carcinoma,+1,1	SUPT6H	1	1	0			c.A5010G												65.0	64.0	64.0					17																	27028472		2203	4300	6503	SO:0001819	synonymous_variant	6830	exon37			CCATGCAGCCATC	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.5010A>G	17.37:g.27028472A>G			57	0	0		38	0.08	3	NM_003170	259	0.00	1	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Silent	SNP	ENST00000314616.6	37	CCDS32596.1																																																																																					0.567	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000446422.2		NM_003170	
ATAD5	79915	broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	29195417	29195417	+	Missense_Mutation	SNP	T	T	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:29195417T>A	ENST00000321990.4	+	12	3678	c.3300T>A	c.(3298-3300)gaT>gaA	p.D1100E		NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1100					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				GAAAAAGAGATGAGAAACATG	0.289																																					p.D1100E													.	ATAD5	150		0			c.T3300A												83.0	88.0	86.0					17																	29195417		2203	4300	6503	SO:0001583	missense	79915	exon12			AAGAGATGAGAAA		CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.3300T>A	17.37:g.29195417T>A	ENSP00000313171:p.Asp1100Glu		97	0.0103092784	1		88	0.30	26	NM_024857	37	0.30	11	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	ENST00000321990.4	37	CCDS11260.1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.769817	0.31320	.	.	ENSG00000176208	ENST00000321990	T	0.05382	3.45	5.42	-2.51	0.06365	.	0.551543	0.19964	N	0.102150	T	0.04907	0.0132	L	0.59436	1.845	0.39184	D	0.96283	B;B	0.09022	0.002;0.002	B;B	0.10450	0.005;0.003	T	0.43814	-0.9368	10	0.13470	T	0.59	.	3.3095	0.07011	0.1046:0.1939:0.4292:0.2723	.	1100;1100	Q96QE3-2;Q96QE3	.;ATAD5_HUMAN	E	1100	ENSP00000313171:D1100E	ENSP00000313171:D1100E	D	+	3	2	ATAD5	26219543	0.564000	0.26602	0.961000	0.40146	0.972000	0.66771	-0.630000	0.05502	-0.906000	0.03866	-0.313000	0.08912	GAT			0.289	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256206.2		NM_024857	
SLC35G3	146861	broad.mit.edu	37	17	33521194	33521194	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:33521194G>T	ENST00000297307.5	-	1	218	c.133C>A	c.(133-135)Ctg>Atg	p.L45M	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	45						integral component of membrane (GO:0016021)											CCCCCACCCAGCAGGGCCACC	0.677																																					p.L45M													.	.			0			c.C133A												46.0	51.0	50.0					17																	33521194		2202	4299	6501	SO:0001583	missense	146861	exon1			CACCCAGCAGGGC	AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.133C>A	17.37:g.33521194G>T	ENSP00000297307:p.Leu45Met		95	0	0		73	0.07	5	NM_152462	3	0.00	0	B9EGE9	Missense_Mutation	SNP	ENST00000297307.5	37	CCDS11293.1	.	.	.	.	.	.	.	.	.	.	G	5.126	0.208792	0.09757	.	.	ENSG00000164729	ENST00000297307	T	0.35236	1.32	.	.	.	.	0.475495	0.15592	N	0.254331	T	0.19446	0.0467	N	0.24115	0.695	0.32829	D	0.503737	B	0.18013	0.025	B	0.18263	0.021	T	0.11372	-1.0590	9	0.46703	T	0.11	-3.4659	2.6646	0.05037	0.4962:0.0:0.5037:0.0	.	45	Q8N808	S35G3_HUMAN	M	45	ENSP00000297307:L45M	ENSP00000297307:L45M	L	-	1	2	SLC35G3	30545307	1.000000	0.71417	0.359000	0.25824	0.362000	0.29581	0.221000	0.17680	0.064000	0.16427	0.064000	0.15345	CTG			0.677	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256445.2		NM_152462	
C17orf96	100170841	broad.mit.edu;mdanderson.org	37	17	36830085	36830085	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:36830085C>T	ENST00000325814.5	-	1	1102	c.664G>A	c.(664-666)Gct>Act	p.A222T		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	222	Pro-rich.				neuron fate commitment (GO:0048663)												GCCGCTGGAGCCTCGGGGGCG	0.741																																					p.A222T													.	.			0			c.G664A												2.0	3.0	3.0					17																	36830085		541	1297	1838	SO:0001583	missense	100170841	exon1			CTGGAGCCTCGGG		CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.664G>A	17.37:g.36830085C>T	ENSP00000317905:p.Ala222Thr		59	0	0		63	0.24	15	NM_001130677	13	0.31	4		Missense_Mutation	SNP	ENST00000325814.5	37	CCDS45661.1	.	.	.	.	.	.	.	.	.	.	C	18.95	3.731592	0.69189	.	.	ENSG00000179294	ENST00000325814	.	.	.	3.96	1.58	0.23477	.	.	.	.	.	T	0.17238	0.0414	N	0.12182	0.205	0.09310	N	0.999997	B	0.19935	0.04	B	0.21360	0.034	T	0.28933	-1.0028	8	0.07482	T	0.82	.	8.554	0.33469	0.0:0.775:0.0:0.225	.	222	A6NHQ4	CQ096_HUMAN	T	222	.	ENSP00000317905:A222T	A	-	1	0	C17orf96	34083611	0.000000	0.05858	0.340000	0.25575	0.026000	0.11368	0.638000	0.24674	0.651000	0.30788	0.462000	0.41574	GCT			0.741	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255465.2		NM_001130677	
ARL16	339231	mdanderson.org	37	17	79650804	79650804	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr17:79650804G>A	ENST00000397498.4	-	1	150	c.52C>T	c.(52-54)Ccg>Tcg	p.P18S	HGS_ENST00000329138.4_5'Flank|ARL16_ENST00000573392.1_5'Flank|ARL16_ENST00000574938.1_5'Flank|ARL16_ENST00000576135.1_5'Flank|ARL16_ENST00000570561.1_5'Flank	NM_001040025.1	NP_001035114.1	Q0P5N6	ARL16_HUMAN	ADP-ribosylation factor-like 16	18					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|lung(4)|skin(1)	7	all_neural(118;0.0878)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GCTCCACCCGGCACCCGTAGC	0.637																																					p.P18S													.	.			0			c.C52T												15.0	19.0	18.0					17																	79650804		1905	4097	6002	SO:0001583	missense	339231	exon1			CACCCGGCACCCG		CCDS45813.1	17q25.3	2014-05-09				ENSG00000214087		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	27902	protein-coding gene	gene with protein product						12477932	Standard	NM_001040025		Approved		uc002kbf.3	Q0P5N6		ENST00000397498.4:c.52C>T	17.37:g.79650804G>A	ENSP00000380635:p.Pro18Ser		20	0	0		23	0.13	3	NM_001040025	3	0.00	0		Missense_Mutation	SNP	ENST00000397498.4	37	CCDS45813.1	.	.	.	.	.	.	.	.	.	.	G	6.953	0.545786	0.13312	.	.	ENSG00000214087	ENST00000397498	T	0.69175	-0.38	4.2	-0.651	0.11454	.	1.833720	0.06186	U	0.680329	T	0.39937	0.1097	N	0.02802	-0.49	0.09310	N	0.999994	B	0.12013	0.005	B	0.11329	0.006	T	0.32348	-0.9910	10	0.87932	D	0	0.5135	4.756	0.13085	0.3689:0.2803:0.3508:0.0	.	18	Q0P5N6	ARL16_HUMAN	S	18	ENSP00000380635:P18S	ENSP00000380635:P18S	P	-	1	0	ARL16	77261209	0.000000	0.05858	0.003000	0.11579	0.170000	0.22686	-0.245000	0.08890	-0.101000	0.12219	-0.140000	0.14226	CCG			0.637	ARL16-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000440514.1		XM_290777	
GALR1	2587	mdanderson.org	37	18	74968158	74968158	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr18:74968158G>T	ENST00000299727.3	+	2	711	c.711G>T	c.(709-711)aaG>aaT	p.K237N	GALR1_ENST00000582943.1_3'UTR	NM_001480.3	NP_001471.2	P47211	GALR1_HUMAN	galanin receptor 1	237					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|digestion (GO:0007586)|negative regulation of adenylate cyclase activity (GO:0007194)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galanin receptor activity (GO:0004966)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		TGTCAAAGAAGTCTGAAGCAT	0.353																																					p.K237N													GALR1,NS,carcinoma,+1,1	GALR1	1	1	0			c.G711T												120.0	118.0	119.0					18																	74968158		2203	4300	6503	SO:0001583	missense	2587	exon2			AAAGAAGTCTGAA	U90658	CCDS12012.1	18q23	2012-08-08			ENSG00000166573	ENSG00000166573		"""GPCR / Class A : Galanin receptors"""	4132	protein-coding gene	gene with protein product		600377		GALNR1, GALNR		7524088	Standard	NM_001480		Approved		uc002lms.4	P47211	OTTHUMG00000132875	ENST00000299727.3:c.711G>T	18.37:g.74968158G>T	ENSP00000299727:p.Lys237Asn		109	0	0		45	0.07	3	NM_001480	0		0	Q4VBL7	Missense_Mutation	SNP	ENST00000299727.3	37	CCDS12012.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578854	0.46006	.	.	ENSG00000166573	ENST00000299727	T	0.37058	1.22	4.61	4.61	0.57282	GPCR, rhodopsin-like superfamily (1);	0.195606	0.49916	D	0.000126	T	0.36468	0.0968	L	0.57536	1.79	0.80722	D	1	B	0.28178	0.202	B	0.27170	0.077	T	0.25847	-1.0120	10	0.46703	T	0.11	.	14.538	0.67973	0.0:0.0:1.0:0.0	.	237	P47211	GALR1_HUMAN	N	237	ENSP00000299727:K237N	ENSP00000299727:K237N	K	+	3	2	GALR1	73097146	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.498000	0.53302	2.283000	0.76528	0.563000	0.77884	AAG			0.353	GALR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256362.1			
TMIGD2	126259	bcgsc.ca	37	19	4292842	4292842	+	Silent	SNP	C	C	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:4292842C>G	ENST00000301272.2	-	5	648	c.603G>C	c.(601-603)ggG>ggC	p.G201G	TMIGD2_ENST00000595645.1_Silent_p.G197G|TMIGD2_ENST00000600114.1_Silent_p.G81G|TMIGD2_ENST00000600349.1_Silent_p.G29G	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	201					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTTTGGGGCCCCCCGGGGCC	0.592																																					p.G201G													.	TMIGD2	38		0			c.G603C												53.0	59.0	57.0					19																	4292842		2202	4300	6502	SO:0001819	synonymous_variant	126259	exon5			TGGGGCCCCCCGG	BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.603G>C	19.37:g.4292842C>G			102	0	0		97	0.06	6	NM_144615	1	0.00	0	Q6UW59	Silent	SNP	ENST00000301272.2	37	CCDS12126.1																																																																																					0.592	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000458088.1		NM_144615	
CD209	30835	mdanderson.org	37	19	7810421	7810421	+	Missense_Mutation	SNP	T	T	C	rs199880715|rs145850292	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:7810421T>C	ENST00000315599.7	-	4	753	c.731A>G	c.(730-732)cAg>cGg	p.Q244R	CD209_ENST00000593821.1_Intron|CD209_ENST00000601256.1_Missense_Mutation_p.Q220R|CD209_ENST00000601951.1_Missense_Mutation_p.Q220R|CD209_ENST00000315591.8_Missense_Mutation_p.Q220R|CD209_ENST00000394161.5_Intron|CD209_ENST00000354397.6_Missense_Mutation_p.Q244R|CD209_ENST00000593660.1_Intron|CD209_ENST00000602261.1_Intron|CD209_ENST00000204801.8_Missense_Mutation_p.Q200R|CD209_ENST00000301357.8_Missense_Mutation_p.Q108R|CD209_ENST00000394173.4_Intron	NM_001144895.1|NM_001144897.1|NM_021155.3	NP_001138367.1|NP_001138369.1|NP_066978.1	Q9NNX6	CD209_HUMAN	CD209 molecule	244	7 X approximate tandem repeats.				antigen processing and presentation (GO:0019882)|cell-cell recognition (GO:0009988)|endocytosis (GO:0006897)|heterophilic cell-cell adhesion (GO:0007157)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|intracellular transport of virus (GO:0075733)|leukocyte cell-cell adhesion (GO:0007159)|modulation by virus of host morphology or physiology (GO:0019048)|peptide antigen transport (GO:0046968)|regulation of T cell proliferation (GO:0042129)|viral genome replication (GO:0019079)|virion attachment to host cell (GO:0019062)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)|peptide antigen binding (GO:0042605)|virion binding (GO:0046790)			endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AGCCTTCAGCTGGGTCAGCTC	0.562													t|||	6	0.00119808	0.0038	0.0	5008	,	,		19020	0.0		0.001	False		,,,				2504	0.0				p.Q244R													.	.			0			c.A731G							T	,ARG/GLN,,ARG/GLN,ARG/GLN,,ARG/GLN	14,4392	20.2+/-43.8	0,14,2189	152.0	156.0	155.0		,599,,659,731,,731	1.9	0.4	19	dbSNP_134	155	7,8593	5.7+/-21.5	0,7,4293	yes	intron,missense,intron,missense,missense,intron,missense	CD209	NM_001144893.1,NM_001144894.1,NM_001144895.1,NM_001144896.1,NM_001144897.1,NM_001144899.1,NM_021155.3	,43,,43,43,,43	0,21,6482	CC,CT,TT		0.0814,0.3177,0.1615	,benign,,benign,benign,,benign	,200/361,,220/381,244/399,,244/405	7810421	21,12985	2203	4300	6503	SO:0001583	missense	30835	exon4			TTCAGCTGGGTCA	M98457	CCDS12186.1, CCDS45949.1, CCDS45950.1, CCDS45951.1, CCDS45952.1, CCDS59344.1, CCDS59345.1	19p13	2011-08-30	2006-03-28			ENSG00000090659		"""C-type lectin domain containing"", ""CD molecules"""	1641	protein-coding gene	gene with protein product		604672	"""CD209 antigen"""			1518869	Standard	NM_021155		Approved	DC-SIGN, CDSIGN, DC-SIGN1, CLEC4L	uc002mht.2	Q9NNX6		ENST00000315599.7:c.731A>G	19.37:g.7810421T>C	ENSP00000315477:p.Gln244Arg		23	0	0		40	0.08	3	NM_021155	0		0	A8KAM4|A8MVQ9|G5E9C4|Q2TB19|Q96QP7|Q96QP8|Q96QP9|Q96QQ0|Q96QQ1|Q96QQ2|Q96QQ3|Q96QQ4|Q96QQ5|Q96QQ6|Q96QQ7|Q96QQ8	Missense_Mutation	SNP	ENST00000315599.7	37	CCDS12186.1	4	0.0018315018315018315	3	0.006097560975609756	0	0.0	0	0.0	1	0.0013192612137203166	t	9.117	1.008114	0.19199	0.003177	8.14E-4	ENSG00000090659	ENST00000315599;ENST00000354397;ENST00000315591;ENST00000204801;ENST00000301357;ENST00000540789	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	2.97	1.94	0.25998	C-type lectin fold (1);C-type lectin-like (1);	.	.	.	.	T	0.09512	0.0234	L	0.45581	1.43	0.24078	N	0.995952	B;B;P;B;B;B;B	0.37207	0.001;0.001;0.587;0.0;0.003;0.22;0.001	B;B;B;B;B;B;B	0.35114	0.003;0.006;0.196;0.006;0.004;0.042;0.003	T	0.17471	-1.0368	9	0.46703	T	0.11	.	4.7771	0.13184	0.0:0.1489:0.0:0.8511	.	244;220;200;220;244;220;244	Q9NNX6-2;Q9NNX6-12;Q9NNX6-7;Q9NNX6-6;Q9NNX6;Q9NNX6-10;Q9NNX6-5	.;.;.;.;CD209_HUMAN;.;.	R	244;244;220;200;108;228	ENSP00000315477:Q244R;ENSP00000346373:Q244R;ENSP00000315407:Q220R;ENSP00000204801:Q200R;ENSP00000301357:Q108R	ENSP00000204801:Q200R	Q	-	2	0	CD209	7716421	0.929000	0.31497	0.392000	0.26245	0.331000	0.28603	0.544000	0.23253	0.538000	0.28769	0.374000	0.22700	CAG	0.002		0.562	CD209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000462241.1		NM_021155	
IL12RB1	3594	ucsc.edu	37	19	18180385	18180385	+	Missense_Mutation	SNP	G	G	T	rs191062711		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:18180385G>T	ENST00000600835.2	-	11	1458	c.1160C>A	c.(1159-1161)gCg>gAg	p.A387E	IL12RB1_ENST00000593993.2_Missense_Mutation_p.A387E			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	387	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						GTCTTGCGGCGCAGTCAGGCT	0.622																																					p.A387E													.	IL12RB1	92		0			c.C1160A												41.0	49.0	47.0					19																	18180385		2020	4158	6178	SO:0001583	missense	3594	exon10			TGCGGCGCAGTCA	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1160C>A	19.37:g.18180385G>T	ENSP00000470788:p.Ala387Glu		31	0.0322580645	1		39	0.10	4	NM_005535	0		0	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	ENST00000600835.2	37	CCDS54232.1	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838614	0.32513	.	.	ENSG00000096996	ENST00000430026	T	0.80566	-1.39	3.64	-0.327	0.12694	.	1.570780	0.03587	N	0.231212	T	0.78065	0.4225	L	0.47716	1.5	0.09310	N	1	D;D	0.58970	0.984;0.973	P;P	0.55871	0.786;0.615	T	0.63571	-0.6607	10	0.05525	T	0.97	0.0383	2.9485	0.05854	0.2728:0.0:0.52:0.2072	.	387;387	P42701-2;P42701	.;I12R1_HUMAN	E	387	ENSP00000403103:A387E	ENSP00000403103:A387E	A	-	2	0	IL12RB1	18041385	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.572000	0.02136	0.057000	0.16193	0.430000	0.28490	GCG			0.622	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466525.3			
CTC-260E6.6	0	broad.mit.edu	37	19	20242475	20242475	+	RNA	DEL	A	A	-	rs377054215|rs34968733	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:20242475delA	ENST00000590606.1	-	0	315				CTC-260E6.6_ENST00000593655.1_RNA|CTC-260E6.6_ENST00000586657.1_RNA																							ttctgggttcaaagcgattct	0.423													AA|AAA|AA|insertion	2095	0.418331	0.7829	0.2939	5008	,	,		18602	0.4494		0.16	False		,,,				2504	0.2474				.													.	.			0			.																																											0	.			GGGTTCAAAGCGA																													19.37:g.20242475delA			5	0	0		8	0.75	6	.	2	0.00	0		RNA	DEL	ENST00000590606.1	37																																																																																						0.423	CTC-260E6.6-005	KNOWN	basic	antisense	antisense		OTTHUMT00000452859.1			
ATP4A	495	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	36050035	36050035	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:36050035A>G	ENST00000262623.3	-	8	1143	c.1115T>C	c.(1114-1116)cTg>cCg	p.L372P		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	372					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	CACCGCCTCCAGGTTCTTGAC	0.612																																					p.L372P													.	.			0			c.T1115C												212.0	192.0	199.0					19																	36050035		2203	4300	6503	SO:0001583	missense	495	exon8			GCCTCCAGGTTCT		CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1115T>C	19.37:g.36050035A>G	ENSP00000262623:p.Leu372Pro		89	0	0		97	0.13	13	NM_000704	1	0.00	0	O00738	Missense_Mutation	SNP	ENST00000262623.3	37	CCDS12467.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.685464	0.68157	.	.	ENSG00000105675	ENST00000262623	D	0.92099	-2.97	3.17	3.17	0.36434	HAD-like domain (1);ATPase, P-type, ATPase-associated domain (1);	0.137657	0.30020	N	0.010614	D	0.97049	0.9036	H	0.97635	4.045	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96768	0.9566	10	0.87932	D	0	.	9.6833	0.40082	1.0:0.0:0.0:0.0	.	372	P20648	ATP4A_HUMAN	P	372	ENSP00000262623:L372P	ENSP00000262623:L372P	L	-	2	0	ATP4A	40741875	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	9.006000	0.93592	1.444000	0.47605	0.379000	0.24179	CTG			0.612	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000109470.2		NM_000704	
HAUS5	23354	mdanderson.org	37	19	36104635	36104635	+	Silent	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:36104635G>T	ENST00000203166.5	+	2	127	c.102G>T	c.(100-102)ctG>ctT	p.L34L	AC002115.9_ENST00000589603.1_lincRNA|HAUS5_ENST00000379045.2_Silent_p.L34L	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	34					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CCCACAGGCTGTGTCTGGGCC	0.592																																					p.L34L													.	.			0			c.G102T												32.0	34.0	34.0					19																	36104635		1979	4151	6130	SO:0001819	synonymous_variant	23354	exon2			CAGGCTGTGTCTG	AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.102G>T	19.37:g.36104635G>T			42	0	0		56	0.07	4	NM_015302	124	0.00	0	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	ENST00000203166.5	37	CCDS42550.1																																																																																					0.592	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459055.2			
KMT2B	9757	mdanderson.org	37	19	36212614	36212614	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:36212614G>T	ENST00000222270.7	+	3	2365	c.2365G>T	c.(2365-2367)Gag>Tag	p.E789*	KMT2B_ENST00000420124.1_Nonsense_Mutation_p.E789*|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	789					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										GTCTGGGGTAGAGGAGAAGAT	0.592																																					p.E789X													.	.			0			c.G2365T												33.0	39.0	37.0					19																	36212614		2129	4264	6393	SO:0001587	stop_gained	8085	exon3			GGGGTAGAGGAGA	AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.2365G>T	19.37:g.36212614G>T	ENSP00000222270:p.Glu789*		63	0	0		48	0.06	3	NM_014727	88	0.00	0	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Nonsense_Mutation	SNP	ENST00000222270.7	37	CCDS46055.1	.	.	.	.	.	.	.	.	.	.	G	38	7.008610	0.97998	.	.	ENSG00000105663	ENST00000222270;ENST00000420124	.	.	.	5.38	5.38	0.77491	.	0.000000	0.40640	N	0.001041	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	14.5154	0.67816	0.0:0.0:1.0:0.0	.	.	.	.	X	789	.	ENSP00000222270:E789X	E	+	1	0	AD000671.1	40904454	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.302000	0.51849	2.799000	0.96334	0.650000	0.86243	GAG			0.592	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_014727	
LIPE	3991	mdanderson.org	37	19	42906128	42906128	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:42906128G>T	ENST00000244289.4	-	10	3343	c.3067C>A	c.(3067-3069)Ccg>Acg	p.P1023T	LIPE-AS1_ENST00000599276.1_RNA|LIPE-AS1_ENST00000593491.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000594624.2_RNA	NM_005357.2	NP_005348.2	Q05469	LIPS_HUMAN	lipase, hormone-sensitive	1023					cholesterol metabolic process (GO:0008203)|diacylglycerol catabolic process (GO:0046340)|lipid catabolic process (GO:0016042)|long-chain fatty acid catabolic process (GO:0042758)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	hormone-sensitive lipase activity (GO:0033878)|triglyceride lipase activity (GO:0004806)			breast(2)|endometrium(4)|kidney(7)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		Prostate(69;0.00682)				AAGCCGTGCGGCAGGTCCTCC	0.736																																					p.P1023T													.	.			0			c.C3067A												4.0	4.0	4.0					19																	42906128		1859	3702	5561	SO:0001583	missense	3991	exon10			CGTGCGGCAGGTC	L11706	CCDS12607.1	19q13.1-q13.2	2014-03-14			ENSG00000079435	ENSG00000079435	3.1.1.3		6621	protein-coding gene	gene with protein product		151750				8506334	Standard	NM_005357		Approved	HSL	uc002otr.3	Q05469	OTTHUMG00000182814	ENST00000244289.4:c.3067C>A	19.37:g.42906128G>T	ENSP00000244289:p.Pro1023Thr		21	0	0		17	0.12	2	NM_005357	12	0.00	0	Q3LRT2|Q6NSL7	Missense_Mutation	SNP	ENST00000244289.4	37	CCDS12607.1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.496219	0.64186	.	.	ENSG00000079435	ENST00000244289	T	0.09538	2.97	4.35	3.29	0.37713	Alpha/beta hydrolase fold-3 (1);	0.377447	0.26262	N	0.025381	T	0.23806	0.0576	L	0.43757	1.38	0.44918	D	0.997931	D	0.76494	0.999	D	0.70935	0.971	T	0.01416	-1.1360	10	0.87932	D	0	-20.3685	13.7242	0.62748	0.0:0.157:0.843:0.0	.	1023	Q05469	LIPS_HUMAN	T	1023	ENSP00000244289:P1023T	ENSP00000244289:P1023T	P	-	1	0	LIPE	47597968	1.000000	0.71417	1.000000	0.80357	0.181000	0.23173	5.827000	0.69300	1.101000	0.41535	0.462000	0.41574	CCG			0.736	LIPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463861.1		NM_005357	
SYMPK	8189	broad.mit.edu	37	19	46332317	46332317	+	Silent	SNP	G	G	T	rs373014308		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:46332317G>T	ENST00000245934.7	-	14	2140	c.1896C>A	c.(1894-1896)gcC>gcA	p.A632A	AC092301.3_ENST00000601618.1_RNA	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	632					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)		p.A632A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		AGGCACCTGCGGCCAGGTAGG	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17932	0.0		0.0	False		,,,				2504	0.001				p.A632A													SYMPK,colon,carcinoma,0,3	SYMPK	104	3	1	Substitution - coding silent(1)	breast(1)	c.C1896A												69.0	67.0	68.0					19																	46332317		2203	4300	6503	SO:0001819	synonymous_variant	8189	exon14			ACCTGCGGCCAGG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.1896C>A	19.37:g.46332317G>T			190	0.0052631579	1		226	0.03	6	NM_004819	202	0.00	0	O00521|O00689|O00733|Q59GT5|Q8N2U5	Silent	SNP	ENST00000245934.7	37	CCDS12676.2																																																																																					0.642	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316581.1		NM_004819	
IL4I1	259307	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	19	50397675	50397675	+	Silent	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:50397675G>T	ENST00000391826.2	-	5	559	c.417C>A	c.(415-417)acC>acA	p.T139T	IL4I1_ENST00000595948.1_Silent_p.T161T|IL4I1_ENST00000341114.3_Silent_p.T161T	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	139						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	TGTCGTACTGGGTGAACTTGG	0.632																																					p.T161T													.	.			0			c.C483A												108.0	104.0	105.0					19																	50397675		2203	4300	6503	SO:0001819	synonymous_variant	259307	exon7			GTACTGGGTGAAC	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.417C>A	19.37:g.50397675G>T			122	0	0		100	0.05	5	NM_172374	56	0.00	0	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Silent	SNP	ENST00000391826.2	37	CCDS12787.1																																																																																					0.632	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466413.1			
ZNF814	730051	bcgsc.ca	37	19	58385788	58385788	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr19:58385788A>G	ENST00000435989.2	-	3	1204	c.970T>C	c.(970-972)Tat>Cat	p.Y324H	ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	324					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						CCACATTCATAAGGTCTTTTC	0.358																																					p.Y324H													.	ZNF814	93		0			c.T970C												15.0	12.0	13.0					19																	58385788		688	1564	2252	SO:0001583	missense	730051	exon3			ATTCATAAGGTCT		CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.970T>C	19.37:g.58385788A>G	ENSP00000410545:p.Tyr324His		141	0	0		132	0.06	8	NM_001144989	21	0.00	0	A6NF35	Missense_Mutation	SNP	ENST00000435989.2	37	CCDS46212.1	.	.	.	.	.	.	.	.	.	.	.	8.644	0.896732	0.17686	.	.	ENSG00000204514	ENST00000435989	T	0.21734	1.99	2.27	-1.27	0.09347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.33485	1.01	0.09310	N	1	B	0.27498	0.18	B	0.22386	0.039	T	0.24368	-1.0162	9	0.72032	D	0.01	.	7.1587	0.25652	0.6135:0.0:0.3865:0.0	.	324	B7Z6K7	ZN814_HUMAN	H	324	ENSP00000410545:Y324H	ENSP00000410545:Y324H	Y	-	1	0	ZNF814	63077600	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	0.130000	0.15850	-0.181000	0.10619	0.113000	0.15668	TAT			0.358	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000466976.1		XM_001725708	
MFSD2B	388931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	24247062	24247062	+	Missense_Mutation	SNP	G	G	C			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr2:24247062G>C	ENST00000406420.3	+	13	1427	c.1411G>C	c.(1411-1413)Gct>Cct	p.A471P	MFSD2B_ENST00000338315.4_Missense_Mutation_p.A471P	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	471					transport (GO:0006810)	integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CATGATCCTTGCTGGGCTCTG	0.637																																					p.A471P													.	.			0			c.G1411C												53.0	61.0	58.0					2																	24247062		2096	4225	6321	SO:0001583	missense	388931	exon13			ATCCTTGCTGGGC		CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.1411G>C	2.37:g.24247062G>C	ENSP00000385527:p.Ala471Pro		95	0	0		67	0.30	20	NM_001080473	1	1.00	1	B5MC32	Missense_Mutation	SNP	ENST00000406420.3	37	CCDS46228.1	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715766	0.30413	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	D;D	0.88124	-2.34;-2.34	4.93	-2.88	0.05682	Major facilitator superfamily domain, general substrate transporter (1);	0.586082	0.14981	U	0.287266	T	0.77329	0.4114	N	0.08118	0	0.09310	N	1	P	0.35328	0.495	B	0.43838	0.433	T	0.71087	-0.4694	10	0.72032	D	0.01	0.8179	11.7264	0.51712	0.4893:0.0:0.5107:0.0	.	471	A6NFX1	MFS2B_HUMAN	P	471	ENSP00000385527:A471P;ENSP00000342501:A471P	ENSP00000342501:A471P	A	+	1	0	MFSD2B	24100566	0.000000	0.05858	0.001000	0.08648	0.673000	0.39480	-1.106000	0.03319	-0.612000	0.05701	-0.467000	0.05162	GCT			0.637	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000324307.1		NM_001080473	
DTNB	1838	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	25655860	25655860	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr2:25655860A>T	ENST00000406818.3	-	14	1601	c.1352T>A	c.(1351-1353)cTg>cAg	p.L451Q	DTNB_ENST00000496972.2_Missense_Mutation_p.L394Q|DTNB_ENST00000405222.1_Missense_Mutation_p.L421Q|DTNB_ENST00000545439.1_Missense_Mutation_p.L247Q|DTNB_ENST00000404103.3_Missense_Mutation_p.L451Q|DTNB_ENST00000407186.1_Missense_Mutation_p.L421Q|DTNB_ENST00000407661.3_Missense_Mutation_p.L451Q|DTNB_ENST00000407038.3_Missense_Mutation_p.L421Q|DTNB_ENST00000288642.8_Missense_Mutation_p.L451Q	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	451						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATCTCCTGCAGGATCTCTCT	0.587																																					p.L451Q													.	.			0			c.T1352A												24.0	29.0	28.0					2																	25655860		2172	4278	6450	SO:0001583	missense	1838	exon14			TCCTGCAGGATCT	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1352T>A	2.37:g.25655860A>T	ENSP00000384084:p.Leu451Gln		34	0	0		31	0.23	7	NM_021907	36	0.28	10	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	37	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.763817	0.89932	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439;ENST00000535791	T;T;T;T;T;T;T;T;T	0.39997	2.34;2.4;2.39;2.38;2.36;2.34;2.37;2.38;1.05	5.8	5.8	0.92144	.	0.284062	0.35291	N	0.003316	T	0.64800	0.2631	M	0.82923	2.615	0.58432	D	0.999998	D;D;D;D;D;D;D;D;D;D;D;D;D	0.71674	0.992;0.997;0.995;0.995;0.991;0.991;0.983;0.991;0.985;0.998;0.995;0.998;0.991	D;D;D;D;D;D;P;D;D;D;D;D;D	0.72982	0.928;0.939;0.979;0.967;0.954;0.954;0.897;0.939;0.956;0.972;0.979;0.966;0.939	T	0.63998	-0.6510	10	0.18276	T	0.48	-13.404	14.9789	0.71296	1.0:0.0:0.0:0.0	.	451;247;394;451;451;394;421;421;421;451;451;451;451	E7EVB6;B7Z202;F5GZG4;O60941-3;B7Z6A9;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941;Q86VR4	.;.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN;.	Q	394;451;451;451;421;421;421;451;247;304	ENSP00000444463:L394Q;ENSP00000384084:L451Q;ENSP00000385482:L451Q;ENSP00000385193:L451Q;ENSP00000384767:L421Q;ENSP00000384787:L421Q;ENSP00000385784:L421Q;ENSP00000288642:L451Q;ENSP00000444961:L247Q	ENSP00000288642:L451Q	L	-	2	0	DTNB	25509364	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	8.935000	0.92923	2.209000	0.71365	0.533000	0.62120	CTG			0.587	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000325361.1		NM_033147	
POTEF	728378	broad.mit.edu	37	2	130877755	130877755	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr2:130877755T>C	ENST00000409914.2	-	3	733	c.334A>G	c.(334-336)Agc>Ggc	p.S112G	POTEF_ENST00000361163.4_Missense_Mutation_p.S112G|POTEF_ENST00000357462.5_Missense_Mutation_p.S112G|POTEF_ENST00000360967.5_Missense_Mutation_p.S112G	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	112					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CTCTTGCTGCTCCCCCTGCAG	0.592																																					p.S112G													.	POTEF	140		0			c.A334G												41.0	66.0	58.0					2																	130877755		2181	4285	6466	SO:0001583	missense	728378	exon3			TGCTGCTCCCCCT	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.334A>G	2.37:g.130877755T>C	ENSP00000386786:p.Ser112Gly		184	0.0108695652	2		136	0.04	5	NM_001099771	0		0	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	37	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	10.35	1.325392	0.24080	.	.	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.77877	-1.13;-1.13;1.69;1.7	0.351	0.351	0.16042	.	.	.	.	.	T	0.71221	0.3314	L	0.50333	1.59	0.09310	N	1	B	0.26041	0.14	B	0.32805	0.153	T	0.64892	-0.6300	8	0.87932	D	0	.	.	.	.	.	112	A5A3E0	POTEF_HUMAN	G	112	ENSP00000350052:S112G;ENSP00000386786:S112G;ENSP00000354232:S112G;ENSP00000355012:S112G	ENSP00000350052:S112G	S	-	1	0	POTEF	130594225	0.003000	0.15002	0.021000	0.16686	0.027000	0.11550	0.047000	0.14056	0.366000	0.24427	0.076000	0.15429	AGC			0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331889.2		NM_001099771	
KYNU	8942	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	143685255	143685255	+	Silent	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr2:143685255G>A	ENST00000410015.2	+	4	408	c.318G>A	c.(316-318)aaG>aaA	p.K106K	KYNU_ENST00000409512.1_Silent_p.K106K|KYNU_ENST00000264170.4_Silent_p.K106K|KYNU_ENST00000375773.2_Silent_p.K106K					kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		AAGTGGGGAAGCGTCCTTGGA	0.368																																					p.K106K													.	.			0			c.G318A												206.0	193.0	197.0					2																	143685255		2203	4300	6503	SO:0001819	synonymous_variant	8942	exon5			GGGGAAGCGTCCT	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000410015.2:c.318G>A	2.37:g.143685255G>A			158	0	0		107	0.19	20	NM_001199241	9	0.11	1		Silent	SNP	ENST00000410015.2	37																																																																																						0.368	KYNU-004	PUTATIVE	basic|exp_conf	protein_coding	protein_coding		OTTHUMT00000332172.2		NM_001032998	
HOXD11	3237	mdanderson.org	37	2	176972598	176972598	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr2:176972598G>A	ENST00000249504.5	+	1	585	c.515G>A	c.(514-516)gGc>gAc	p.G172D	AC009336.1_ENST00000401374.2_RNA|HOXD11_ENST00000498438.1_Intron	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11	172					anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GGCCGCAATGGCATCTTGCCA	0.766			T	NUP98	AML																																p.G172D				Dom	yes		2	2q31-q32	3237	homeo box D11		L	.	.			0			c.G515A												2.0	3.0	3.0					2																	176972598		1011	1985	2996	SO:0001583	missense	3237	exon1			GCAATGGCATCTT		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.515G>A	2.37:g.176972598G>A	ENSP00000249504:p.Gly172Asp		24	0	0		36	0.08	3	NM_021192	0		0	A6NIS4|Q9NS02	Missense_Mutation	SNP	ENST00000249504.5	37	CCDS2265.1	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104093	0.76983	.	.	ENSG00000128713	ENST00000249504	T	0.56941	0.43	2.71	2.71	0.32032	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.195954	0.24831	U	0.035249	T	0.67097	0.2857	M	0.63843	1.955	0.51482	D	0.999928	D	0.89917	1.0	D	0.81914	0.995	T	0.69796	-0.5048	10	0.52906	T	0.07	.	13.2214	0.59890	0.0:0.0:1.0:0.0	.	172	P31277	HXD11_HUMAN	D	172	ENSP00000249504:G172D	ENSP00000249504:G172D	G	+	2	0	HOXD11	176680844	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.280000	0.78610	1.363000	0.46019	0.530000	0.56133	GGC			0.766	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000359250.2			
SLC4A11	83959	mdanderson.org	37	20	3209870	3209870	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr20:3209870G>A	ENST00000380056.3	-	15	1984	c.1937C>T	c.(1936-1938)gCg>gTg	p.A646V	SLC4A11_ENST00000380059.3_Missense_Mutation_p.A673V|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000539553.2_Missense_Mutation_p.A630V	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	646	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						CTGCGCCATCGCAAAGGGGCT	0.627																																					p.A673V	NSCLC(190;922 2139 10266 10292 38692)												.	.			0			c.C2018T												65.0	68.0	67.0					20																	3209870		2203	4300	6503	SO:0001583	missense	83959	exon16			GCCATCGCAAAGG	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1937C>T	20.37:g.3209870G>A	ENSP00000369396:p.Ala646Val		66	0	0		47	0.06	3	NM_001174090	39	0.00	0	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	37	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	G	8.890	0.953782	0.18431	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	T;T;T	0.76968	-1.06;-1.06;-1.06	4.93	2.57	0.30868	Bicarbonate transporter, C-terminal (1);	1.074070	0.07122	N	0.844049	T	0.49932	0.1586	N	0.01352	-0.895	0.23712	N	0.99704	B;B;B	0.11235	0.0;0.004;0.001	B;B;B	0.01281	0.0;0.0;0.0	T	0.38972	-0.9636	10	0.29301	T	0.29	.	6.2123	0.20636	0.3819:0.0:0.1305:0.4876	.	630;673;646	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	V	673;646;630	ENSP00000369399:A673V;ENSP00000369396:A646V;ENSP00000441370:A630V	ENSP00000369396:A646V	A	-	2	0	SLC4A11	3157870	1.000000	0.71417	0.750000	0.31169	0.680000	0.39746	1.351000	0.34022	0.286000	0.22352	-0.521000	0.04368	GCG			0.627	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000077728.1			
ZBED4	9889	mdanderson.org	37	22	50279862	50279862	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr22:50279862G>T	ENST00000216268.5	+	2	3029	c.2552G>T	c.(2551-2553)aGc>aTc	p.S851I		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	851						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		AACCTGCTGAGCCTCGCCCGG	0.632																																					p.S851I													ZBED4,NS,carcinoma,+1,2	ZBED4	1	2	0			c.G2552T												32.0	30.0	31.0					22																	50279862		2203	4300	6503	SO:0001583	missense	9889	exon2			TGCTGAGCCTCGC	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.2552G>T	22.37:g.50279862G>T	ENSP00000216268:p.Ser851Ile		57	0	0		50	0.06	3	NM_014838	26	0.00	0	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	37	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812925	0.50527	.	.	ENSG00000100426	ENST00000216268	T	0.23552	1.9	5.57	5.57	0.84162	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.51550	0.1681	M	0.72118	2.19	0.80722	D	1	D	0.69078	0.997	D	0.65987	0.94	T	0.50474	-0.8824	10	0.56958	D	0.05	-23.9141	19.5392	0.95267	0.0:0.0:1.0:0.0	.	851	O75132	ZBED4_HUMAN	I	851	ENSP00000216268:S851I	ENSP00000216268:S851I	S	+	2	0	ZBED4	48665866	1.000000	0.71417	0.076000	0.20297	0.019000	0.09904	9.220000	0.95180	2.602000	0.87976	0.655000	0.94253	AGC			0.632	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000317408.2		NM_014838	
UBE2E1	7324	broad.mit.edu	37	3	23848778	23848778	+	Silent	SNP	G	G	T	rs140553923		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr3:23848778G>T	ENST00000306627.3	+	2	237	c.18G>T	c.(16-18)tcG>tcT	p.S6S	UBE2E1-AS1_ENST00000426702.1_RNA|UBE2E1_ENST00000346855.3_Silent_p.S6S	NM_003341.4	NP_003332.1	P51965	UB2E1_HUMAN	ubiquitin-conjugating enzyme E2E 1	6					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cytokine-mediated signaling pathway (GO:0019221)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ISG15-protein conjugation (GO:0032020)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K48-linked ubiquitination (GO:0070936)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ATP binding (GO:0005524)|ISG15 ligase activity (GO:0042296)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|large_intestine(4)	7						ATGACGATTCGAGGGCCAGCA	0.542																																					p.S6S													.	UBE2E1	15		0			c.G18T												81.0	81.0	81.0					3																	23848778		2203	4300	6503	SO:0001819	synonymous_variant	7324	exon2			CGATTCGAGGGCC	X92963	CCDS2638.1, CCDS2639.1, CCDS56244.1	3p24.2	2011-05-19	2011-05-19		ENSG00000170142	ENSG00000170142		"""Ubiquitin-conjugating enzymes E2"""	12477	protein-coding gene	gene with protein product		602916	"""ubiquitin-conjugating enzyme E2E 1 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast)"""			8576257	Standard	NM_003341		Approved	UbcH6	uc003cch.3	P51965	OTTHUMG00000130483	ENST00000306627.3:c.18G>T	3.37:g.23848778G>T			93	0	0		69	0.04	3	NM_003341	164	0.00	0	B2RBX4|C9J8K2|K4DI90	Silent	SNP	ENST00000306627.3	37	CCDS2638.1																																																																																					0.542	UBE2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000252882.2		NM_003341	
GOLGB1	2804	broad.mit.edu	37	3	121395740	121395740	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr3:121395740G>T	ENST00000340645.5	-	17	9287	c.9162C>A	c.(9160-9162)aaC>aaA	p.N3054K	GOLGB1_ENST00000393667.3_Splice_Site_p.N3059K	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	3054					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		AAACACTTACGTTGCTGTTCA	0.403																																					p.N3059K													.	GOLGB1	319		0			c.C9177A												164.0	152.0	156.0					3																	121395740		2203	4300	6503	SO:0001630	splice_region_variant	2804	exon17			ACTTACGTTGCTG	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.9162+1C>A	3.37:g.121395740G>T			153	0	0		171	0.04	6	NM_001256486	156	0.01	1	B2ZZ91|D3DN92|E7EP74|Q14398	Splice_Site	SNP	ENST00000340645.5	37	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.395420	0.01175	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.06371	3.32;3.31	5.46	2.77	0.32553	.	0.097949	0.44902	N	0.000420	T	0.01765	0.0056	N	0.00926	-1.1	0.24446	N	0.994506	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46386	-0.9195	9	.	.	.	.	5.5906	0.17299	0.0:0.6659:0.163:0.1712	.	3059;3059;3054	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	K	3054;3059	ENSP00000341848:N3054K;ENSP00000377275:N3059K	.	N	-	3	2	GOLGB1	122878430	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	1.406000	0.34646	0.450000	0.26774	-0.749000	0.03505	AAC			0.403	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000355159.1		NM_004487	Missense_Mutation
KALRN	8997	broad.mit.edu	37	3	124438155	124438155	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr3:124438155G>T	ENST00000291478.5	+	27	3871	c.3708G>T	c.(3706-3708)ttG>ttT	p.L1236F	KALRN_ENST00000360013.3_Missense_Mutation_p.L2933F|KALRN_ENST00000428018.2_Missense_Mutation_p.L1204F	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2932					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCACATGCTTGCAGCATCCAT	0.527																																					p.L2933F													.	KALRN	556		0			c.G8799T												49.0	52.0	51.0					3																	124438155		2203	4300	6503	SO:0001583	missense	8997	exon60			ATGCTTGCAGCAT	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3708G>T	3.37:g.124438155G>T	ENSP00000291478:p.Leu1236Phe		120	0	0		124	0.03	4	NM_001024660	1	0.00	0	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	ENST00000291478.5	37	CCDS3028.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.26|13.26	2.182682|2.182682	0.38511|0.38511	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000291478;ENST00000428018	.|T;T;T	.|0.52526	.|0.66;0.66;0.66	5.3|5.3	-0.568|-0.568	0.11760|0.11760	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.64402	.|D	.|0.000015	T|T	0.61388|0.61388	0.2343|0.2343	M|M	0.76170|0.76170	2.325|2.325	0.30373|0.30373	N|N	0.782687|0.782687	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.87578	.|0.998;0.998	T|T	0.60357|0.60357	-0.7279|-0.7279	5|10	.|0.62326	.|D	.|0.03	.|.	7.9094|7.9094	0.29782|0.29782	0.343:0.1067:0.5503:0.0|0.343:0.1067:0.5503:0.0	.|.	.|1236;2932	.|C9JQ37;O60229	.|.;KALRN_HUMAN	F|F	2902|2933;1236;1204	.|ENSP00000353109:L2933F;ENSP00000291478:L1236F;ENSP00000402419:L1204F	.|ENSP00000291478:L1236F	C|L	+|+	2|3	0|2	KALRN|KALRN	125920845|125920845	0.999000|0.999000	0.42202|0.42202	0.993000|0.993000	0.49108|0.49108	0.477000|0.477000	0.33069|0.33069	0.433000|0.433000	0.21477|0.21477	-0.298000|-0.298000	0.08921|0.08921	-1.627000|-1.627000	0.00785|0.00785	TGC|TTG			0.527	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000246891.5		NM_003947	
ATP11B	23200	broad.mit.edu	37	3	182598724	182598724	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr3:182598724G>T	ENST00000323116.5	+	21	2724	c.2464G>T	c.(2464-2466)Ggt>Tgt	p.G822C		NM_014616.2	NP_055431.1	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	822					aminophospholipid transport (GO:0015917)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|ion transmembrane transporter activity (GO:0015075)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|liver(2)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	41	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)			TGTTGGTGATGGTGCTAATGA	0.343																																					p.G822C													.	ATP11B	115		0			c.G2464T												123.0	123.0	123.0					3																	182598724		2203	4300	6503	SO:0001583	missense	23200	exon21			GGTGATGGTGCTA	AF156548	CCDS33896.1	3q27	2010-04-20	2007-09-19		ENSG00000058063	ENSG00000058063		"""ATPases / P-type"""	13553	protein-coding gene	gene with protein product		605869	"""ATPase, Class VI, type 11B"""			10231032, 11015572	Standard	NM_014616		Approved	ATPIF, ATPIR, KIAA0956	uc003flb.3	Q9Y2G3	OTTHUMG00000158295	ENST00000323116.5:c.2464G>T	3.37:g.182598724G>T	ENSP00000321195:p.Gly822Cys		418	0	0		405	0.01	6	NM_014616	16	0.00	0	Q96FN1|Q9UKK7	Missense_Mutation	SNP	ENST00000323116.5	37	CCDS33896.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.7|25.7	4.668211|4.668211	0.88348|0.88348	.|.	.|.	ENSG00000058063|ENSG00000058063	ENST00000323116;ENST00000482070|ENST00000498086	T;T|.	0.66638|.	-0.22;-0.22|.	5.45|5.45	5.45|5.45	0.79879|0.79879	HAD-like domain (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91597|0.91597	0.7345|0.7345	H|H	0.99286|0.99286	4.5|4.5	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.998;1.0|.	D|D	0.95042|0.95042	0.8179|0.8179	10|5	0.87932|.	D|.	0|.	.|.	19.2773|19.2773	0.94038|0.94038	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	396;822|.	B3KSJ2;Q9Y2G3|.	.;AT11B_HUMAN|.	C|I	822;57|622	ENSP00000321195:G822C;ENSP00000417124:G57C|.	ENSP00000321195:G822C|.	G|M	+|+	1|3	0|0	ATP11B|ATP11B	184081418|184081418	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.390000|9.390000	0.97246|0.97246	2.538000|2.538000	0.85594|0.85594	0.585000|0.585000	0.79938|0.79938	GGT|ATG			0.343	ATP11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000350598.1		NM_014616	
MARCH6	10299	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	5	10415633	10415633	+	Missense_Mutation	SNP	C	C	G	rs182494860	byFrequency	TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr5:10415633C>G	ENST00000274140.5	+	21	2132	c.2000C>G	c.(1999-2001)aCg>aGg	p.T667R	MARCH6_ENST00000449913.2_Missense_Mutation_p.T619R|MARCH6_ENST00000510792.1_Missense_Mutation_p.T365R|MARCH6_ENST00000503788.1_Missense_Mutation_p.T562R	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	667					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.T667M(1)		breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TCGTTTTGGACGGGGACTGCC	0.453																																					p.T667R													MARCH6,caecum,carcinoma,0,1	MARCH6	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C2000G												272.0	241.0	252.0					5																	10415633		2203	4300	6503	SO:0001583	missense	10299	exon21			TTTGGACGGGGAC	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.2000C>G	5.37:g.10415633C>G	ENSP00000274140:p.Thr667Arg		163	0	0		110	0.35	39	NM_005885	41	0.44	18	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Missense_Mutation	SNP	ENST00000274140.5	37	CCDS34135.1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300501	0.81136	.	.	ENSG00000145495	ENST00000449913;ENST00000503788;ENST00000274140;ENST00000510792	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	5.6	5.6	0.85130	.	0.049301	0.85682	D	0.000000	T	0.46328	0.1387	M	0.69358	2.11	0.80722	D	1	D;P;P;P	0.56521	0.976;0.746;0.899;0.697	P;B;B;B	0.52881	0.712;0.163;0.416;0.113	T	0.21314	-1.0249	10	0.21540	T	0.41	-17.5761	19.6218	0.95660	0.0:1.0:0.0:0.0	.	562;619;247;667	B4DKJ2;B4DT33;B2RBJ1;O60337	.;.;.;MARH6_HUMAN	R	619;562;667;365	ENSP00000414643:T619R;ENSP00000425930:T562R;ENSP00000274140:T667R;ENSP00000424512:T365R	ENSP00000274140:T667R	T	+	2	0	MARCH6	10468633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.678000	0.61641	2.625000	0.88918	0.563000	0.77884	ACG			0.453	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366919.2		NM_005885	
GPR98	84059	mdanderson.org	37	5	90103520	90103520	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr5:90103520G>T	ENST00000405460.2	+	73	15034	c.14938G>T	c.(14938-14940)Gtg>Ttg	p.V4980L	GPR98_ENST00000425867.2_Missense_Mutation_p.V641L	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4980					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		CCTATCAGGAGTGCAGAGCAG	0.488																																					p.V4980L													.	.			0			c.G14938T												65.0	63.0	64.0					5																	90103520		1854	4100	5954	SO:0001583	missense	84059	exon73			TCAGGAGTGCAGA	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.14938G>T	5.37:g.90103520G>T	ENSP00000384582:p.Val4980Leu		81	0	0		49	0.06	3	NM_032119	7	0.00	0	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	37	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	10.05	1.245170	0.22796	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.32988	1.64;1.43	5.76	2.97	0.34412	.	0.307601	0.36134	N	0.002767	T	0.18299	0.0439	L	0.28192	0.835	0.23227	N	0.998087	B;B;B	0.19583	0.022;0.026;0.037	B;B;B	0.16722	0.007;0.015;0.016	T	0.21415	-1.0246	9	.	.	.	.	7.3877	0.26893	0.1409:0.269:0.5902:0.0	.	641;4980;641	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	L	4980;4980;641	ENSP00000384582:V4980L;ENSP00000392618:V641L	.	V	+	1	0	GPR98	90139276	0.989000	0.36119	0.369000	0.25952	0.299000	0.27559	2.021000	0.41020	0.334000	0.23590	0.655000	0.94253	GTG			0.488	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369993.2		NM_032119	
ANKRD32	84250	mdanderson.org	37	5	94024244	94024244	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr5:94024244G>T	ENST00000265140.5	+	17	2574	c.2155G>T	c.(2155-2157)Ggt>Tgt	p.G719C		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	719						centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		GGGGAAAACTGGTGTGCTTGG	0.363																																					p.G719C													.	.			0			c.G2155T												100.0	102.0	101.0					5																	94024244		2203	4300	6503	SO:0001583	missense	84250	exon17			AAAACTGGTGTGC	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.2155G>T	5.37:g.94024244G>T	ENSP00000265140:p.Gly719Cys		152	0.0065789474	1		101	0.05	5	NM_032290	39	0.00	0	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	37	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379180	0.61735	.	.	ENSG00000133302	ENST00000265140	T	0.48201	0.82	5.36	2.58	0.30949	.	0.688880	0.14227	N	0.333038	T	0.44953	0.1318	L	0.29908	0.895	0.20563	N	0.999884	D	0.64830	0.994	P	0.54401	0.751	T	0.21518	-1.0243	10	0.59425	D	0.04	.	7.2128	0.25943	0.2003:0.0:0.6777:0.1221	.	719	Q9BQI6	ANR32_HUMAN	C	719	ENSP00000265140:G719C	ENSP00000265140:G719C	G	+	1	0	ANKRD32	94050000	1.000000	0.71417	0.984000	0.44739	0.930000	0.56654	2.270000	0.43355	0.755000	0.32990	0.585000	0.79938	GGT			0.363	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000241610.1		NM_032290	
SKIV2L	6499	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	31936112	31936112	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr6:31936112C>T	ENST00000375394.2	+	24	2979	c.2866C>T	c.(2866-2868)Cct>Tct	p.P956S	DXO_ENST00000478221.1_5'Flank|SKIV2L_ENST00000544581.1_Missense_Mutation_p.P763S	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	956					ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CAGGAAGGATCCTCCCCTTGC	0.597																																					p.P956S													.	.			0			c.C2866T												106.0	127.0	119.0					6																	31936112		1508	2707	4215	SO:0001583	missense	6499	exon24			AAGGATCCTCCCC		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2866C>T	6.37:g.31936112C>T	ENSP00000364543:p.Pro956Ser		75	0	0		70	0.21	15	NM_006929	90	0.11	10	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	37	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481563	0.44147	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.39997	1.05;1.05	5.24	4.37	0.52481	.	0.048593	0.85682	N	0.000000	T	0.25568	0.0622	L	0.56769	1.78	0.80722	D	1	P	0.34934	0.476	B	0.36378	0.223	T	0.05801	-1.0863	10	0.30078	T	0.28	-14.2188	13.2276	0.59922	0.0:0.9211:0.0:0.0789	.	956	Q15477	SKIV2_HUMAN	S	956;798;763	ENSP00000364543:P956S;ENSP00000442645:P763S	ENSP00000364543:P956S	P	+	1	0	SKIV2L	32044091	1.000000	0.71417	0.993000	0.49108	0.982000	0.71751	6.490000	0.73645	1.340000	0.45581	0.655000	0.94253	CCT			0.597	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000076264.3			
SYNCRIP	10492	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	86346826	86346826	+	Silent	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr6:86346826C>T	ENST00000369622.3	-	6	1025	c.525G>A	c.(523-525)gaG>gaA	p.E175E	SYNCRIP_ENST00000355238.6_Silent_p.E175E	NM_001159675.1|NM_006372.4	NP_001153147.1|NP_006363.4	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA interacting protein	175	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to interferon-gamma (GO:0071346)|CRD-mediated mRNA stabilization (GO:0070934)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|CRD-mediated mRNA stability complex (GO:0070937)|endoplasmic reticulum (GO:0005783)|GAIT complex (GO:0097452)|histone pre-mRNA 3'end processing complex (GO:0071204)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	33		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		CAAGTTCATCCTCAAATAGAT	0.368																																					p.E175E													SYNCRIP,right_upper_lobe,carcinoma,-2,2	SYNCRIP	-2	2	0			c.G525A												52.0	50.0	51.0					6																	86346826		2203	4300	6503	SO:0001819	synonymous_variant	10492	exon6			TTCATCCTCAAAT	AF037448	CCDS5005.1, CCDS55041.1, CCDS75491.1	6q14-q15	2013-05-23			ENSG00000135316	ENSG00000135316		"""RNA binding motif (RRM) containing"""	16918	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein Q"""					9847309, 11352648	Standard	NM_006372		Approved	NSAP1, GRY-RBP, dJ3J17.2, HNRPQ1, hnRNP-Q, HNRNPQ	uc003pla.2	O60506	OTTHUMG00000015141	ENST00000369622.3:c.525G>A	6.37:g.86346826C>T			232	0	0		257	0.24	62	NM_006372	245	0.19	47	E1P501|E1P502|Q53H05|Q5TCG2|Q5TCG3|Q8IW78|Q8N599|Q96LC1|Q96LC2|Q9Y583	Silent	SNP	ENST00000369622.3	37	CCDS5005.1																																																																																					0.368	SYNCRIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000041396.1		NM_006372	
DACT2	168002	broad.mit.edu;mdanderson.org	37	6	168708534	168708534	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr6:168708534C>T	ENST00000366795.3	-	4	1991	c.1903G>A	c.(1903-1905)Gtg>Atg	p.V635M	DACT2_ENST00000610183.1_Missense_Mutation_p.V465M|DACT2_ENST00000607983.1_Missense_Mutation_p.V227M|DACT2_ENST00000366796.3_Intron	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	635					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		CTCCTGGCCACGGGCCTGGGG	0.721																																					p.V635M													.	DACT2	46		0			c.G1903A												7.0	9.0	9.0					6																	168708534		687	1583	2270	SO:0001583	missense	168002	exon4			TGGCCACGGGCCT	AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.1903G>A	6.37:g.168708534C>T	ENSP00000355760:p.Val635Met		25	0.04	1		22	0.23	5	NM_214462	138	0.31	43	Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation	SNP	ENST00000366795.3	37	CCDS47519.1	.	.	.	.	.	.	.	.	.	.	C	6.843	0.524839	0.13066	.	.	ENSG00000164488	ENST00000366795	T	0.42131	0.98	3.68	-6.55	0.01854	.	1.194150	0.06249	N	0.691715	T	0.04048	0.0113	N	0.02011	-0.69	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.28235	-1.0050	10	0.40728	T	0.16	-0.349	3.3569	0.07172	0.0985:0.2213:0.4381:0.2421	.	635	Q5SW24	DACT2_HUMAN	M	635	ENSP00000355760:V635M	ENSP00000355760:V635M	V	-	1	0	DACT2	168451383	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.079000	0.14782	-1.231000	0.02557	-3.888000	0.00017	GTG			0.721	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000043193.1			
VPS41	27072	mdanderson.org	37	7	38902196	38902196	+	Silent	SNP	G	G	T	rs187909170		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr7:38902196G>T	ENST00000310301.4	-	4	249	c.195C>A	c.(193-195)ggC>ggA	p.G65G	VPS41_ENST00000395969.2_Silent_p.G65G	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	65					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						AATAAACCTTGCCATAATGTG	0.308																																					p.G65G													.	.			0			c.C195A												82.0	83.0	82.0					7																	38902196		2203	4300	6503	SO:0001819	synonymous_variant	27072	exon4			AACCTTGCCATAA	U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.195C>A	7.37:g.38902196G>T			72	0	0		127	0.04	5	NM_080631	45	0.00	0	E9PF36|Q86TP8|Q99851|Q99852	Silent	SNP	ENST00000310301.4	37	CCDS5457.1																																																																																					0.308	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226986.3			
KCP	375616	broad.mit.edu	37	7	128548304	128548305	+	RNA	INS	-	-	A	rs370991615|rs370653893|rs10565205|rs55898241		TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr7:128548304_128548305insA	ENST00000476647.2	-	0	263				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						aagaaagaaagaagaaagaaag	0.371																																					.													.	KCP	16		0			.																																											375616	.			AAGAAAGAAGAAA	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128548306_128548306dupA			5	0	0		8	0.50	4	.	0		0	Q8NBE0	RNA	INS	ENST00000476647.2	37																																																																																						0.371	KCP-006	KNOWN	basic	processed_transcript	processed_transcript		OTTHUMT00000403051.1		NM_199349	
TAS2R40	259286	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	7	142919837	142919838	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	AC	AC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr7:142919837_142919838delAC	ENST00000408947.3	+	1	708_709	c.666_667delAC	c.(664-669)agacacfs	p.H223fs	AC073342.1_ENST00000595842.1_5'Flank	NM_176882.1	NP_795363.1	P59535	T2R40_HUMAN	taste receptor, type 2, member 40	223					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8	Melanoma(164;0.059)					CTCTCAAGAGACACACCCTACA	0.51																																					p.222_222del													.	TAS2R40	64		0			c.665_666del																																									SO:0001589	frameshift_variant	259286	exon1			CAAGAGACACACC	AF494229	CCDS43662.1	7q34	2012-08-22	2003-12-16		ENSG00000221937	ENSG00000221937		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18885	protein-coding gene	gene with protein product		613964	"""G protein-coupled receptor 60"""	GPR60		12379855	Standard	NM_176882		Approved		uc011ksx.2	P59535	OTTHUMG00000152638	ENST00000408947.3:c.666_667delAC	7.37:g.142919841_142919842delAC	ENSP00000386210:p.His223fs		70	0	0		103	0.22	23	NM_176882	0		0	A4D2I2|Q645W6	Frame_Shift_Del	DEL	ENST00000408947.3	37	CCDS43662.1																																																																																					0.510	TAS2R40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327097.1			
SSPO	23145	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	149486702	149486702	+	RNA	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr7:149486702C>T	ENST00000378016.2	+	0	4476							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGTGACCTGCGTCCCCGGGG	0.632																																					p.C1492C													.	.			0			c.C4476T												23.0	27.0	26.0					7																	149486702		1947	4126	6073			23145	exon31			GACCTGCGTCCCC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149486702C>T			62	0	0		80	0.23	18	NM_198455	0		0	Q76B61	Silent	SNP	ENST00000378016.2	37																																																																																						0.632	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript					
DUSP26	78986	broad.mit.edu	37	8	33449599	33449599	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr8:33449599G>T	ENST00000256261.4	-	4	1085	c.568C>A	c.(568-570)Ccc>Acc	p.P190T	DUSP26_ENST00000523956.1_Missense_Mutation_p.P190T	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	190	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		CCCCGGTTGGGGATGATGCCT	0.647																																					p.P190T													.	DUSP26	42		0			c.C568A												94.0	88.0	90.0					8																	33449599		2203	4300	6503	SO:0001583	missense	78986	exon4			GGTTGGGGATGAT	AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.568C>A	8.37:g.33449599G>T	ENSP00000256261:p.Pro190Thr		138	0	0		193	0.02	4	NM_024025	0		0	D3DSV8|Q9BTW0	Missense_Mutation	SNP	ENST00000256261.4	37	CCDS6092.1	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721519	0.89298	.	.	ENSG00000133878	ENST00000256261;ENST00000523956	T;T	0.63580	-0.05;-0.05	4.8	4.8	0.61643	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	D	0.88731	0.6516	H	0.99391	4.545	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.93943	0.7225	10	0.87932	D	0	-51.1467	17.8245	0.88660	0.0:0.0:1.0:0.0	.	190	Q9BV47	DUS26_HUMAN	T	190	ENSP00000256261:P190T;ENSP00000429176:P190T	ENSP00000256261:P190T	P	-	1	0	DUSP26	33569141	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.813000	0.99286	2.388000	0.81334	0.549000	0.68633	CCC			0.647	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376564.1		NM_024025	
VPS13B	157680	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	100733195	100733195	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr8:100733195C>T	ENST00000358544.2	+	39	7156	c.7045C>T	c.(7045-7047)Ctt>Ttt	p.L2349F	VPS13B_ENST00000357162.2_Missense_Mutation_p.L2324F|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2349					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGTACTCACCCTTGTACGAAT	0.403																																					p.L2349F	Colon(161;2205 2542 7338 31318)												.	.			0			c.C7045T												110.0	102.0	104.0					8																	100733195		2203	4300	6503	SO:0001583	missense	157680	exon39			CTCACCCTTGTAC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7045C>T	8.37:g.100733195C>T	ENSP00000351346:p.Leu2349Phe		118	0	0		128	0.18	23	NM_017890	7	0.43	3	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	37	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360816	0.61403	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69175	-0.38;-0.38	6.03	6.03	0.97812	.	0.070983	0.56097	D	0.000026	T	0.57242	0.2040	N	0.22421	0.69	0.80722	D	1	B;B	0.21606	0.058;0.034	B;B	0.20184	0.028;0.012	T	0.48525	-0.9028	10	0.32370	T	0.25	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	2324;2349	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	F	2324;2349	ENSP00000349685:L2324F;ENSP00000351346:L2349F	ENSP00000349685:L2324F	L	+	1	0	VPS13B	100802371	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	3.053000	0.49901	2.861000	0.98227	0.655000	0.94253	CTT			0.403	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000277138.1		NM_184042	
KIAA0020	9933	broad.mit.edu	37	9	2837296	2837296	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr9:2837296T>C	ENST00000397885.2	-	3	394	c.188A>G	c.(187-189)aAg>aGg	p.K63R		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	63						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTTTACACCCTTTTTCCCAAG	0.388																																					p.K63R													.	KIAA0020	56		0			c.A188G												259.0	237.0	244.0					9																	2837296		1837	4098	5935	SO:0001583	missense	9933	exon3			ACACCCTTTTTCC	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.188A>G	9.37:g.2837296T>C	ENSP00000380982:p.Lys63Arg		180	0	0		147	0.02	3	NM_014878	297	0.00	0	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	37	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	T	8.779	0.927712	0.18056	.	.	ENSG00000080608	ENST00000397885	T	0.12672	2.66	4.55	3.32	0.38043	.	0.404891	0.24027	N	0.042233	T	0.07369	0.0186	N	0.19112	0.55	0.22629	N	0.998913	B	0.10296	0.003	B	0.08055	0.003	T	0.24799	-1.0150	10	0.26408	T	0.33	-19.7444	5.606	0.17379	0.0:0.0997:0.2858:0.6145	.	63	Q15397	K0020_HUMAN	R	63	ENSP00000380982:K63R	ENSP00000380982:K63R	K	-	2	0	KIAA0020	2827296	0.997000	0.39634	1.000000	0.80357	0.984000	0.73092	1.577000	0.36515	2.041000	0.60428	0.528000	0.53228	AAG			0.388	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051529.3		NM_014878	
GSN	2934	mdanderson.org	37	9	124088834	124088834	+	Silent	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chr9:124088834G>T	ENST00000373818.4	+	12	1683	c.1614G>T	c.(1612-1614)ctG>ctT	p.L538L	GSN_ENST00000341272.2_Silent_p.L487L|GSN_ENST00000412819.1_Silent_p.L487L|GSN_ENST00000373823.3_Silent_p.L487L|GSN_ENST00000373808.2_Silent_p.L487L|GSN_ENST00000436847.1_Silent_p.L498L|GSN_ENST00000545652.1_Silent_p.L495L|GSN_ENST00000373806.1_5'Flank|GSN_ENST00000394353.2_Silent_p.L498L|GSN_ENST00000373807.1_Silent_p.L269L|GSN_ENST00000449733.1_Silent_p.L487L	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	538	Actin-binding, Ca-sensitive. {ECO:0000255}.				actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						TCATGAGCCTGTTTGGTGGGA	0.657																																					p.L538L													.	.			0			c.G1614T												49.0	46.0	47.0					9																	124088834		2203	4300	6503	SO:0001819	synonymous_variant	2934	exon12			GAGCCTGTTTGGT	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.1614G>T	9.37:g.124088834G>T			85	0	0		84	0.05	4	NM_000177	128	0.00	0	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Silent	SNP	ENST00000373818.4	37	CCDS6828.1																																																																																					0.657	GSN-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000053861.1		NM_000177	
STAG2	10735	mdanderson.org	37	X	123191755	123191755	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAO3-01A-11D-A435-10	TCGA-XE-AAO3-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	765d87ae-c060-43d6-bd02-548eeb78c0ec	bfa5e5f7-3f40-441f-a5ea-f48077e1495e	g.chrX:123191755G>T	ENST00000371160.1	+	15	1634	c.1344G>T	c.(1342-1344)atG>atT	p.M448I	STAG2_ENST00000371157.3_Missense_Mutation_p.M448I|STAG2_ENST00000371144.3_Missense_Mutation_p.M448I|STAG2_ENST00000371145.3_Missense_Mutation_p.M448I|STAG2_ENST00000354548.5_Missense_Mutation_p.M379I|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.M448I	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	448					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						ATGGAATGATGAAAAGAAGAG	0.308																																					p.M448I													.	.			0			c.G1344T												153.0	138.0	143.0					X																	123191755		2203	4300	6503	SO:0001583	missense	10735	exon15			AATGATGAAAAGA	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1344G>T	X.37:g.123191755G>T	ENSP00000360202:p.Met448Ile		64	0	0		129	0.04	5	NM_001042749	173	0.00	0	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	37	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.332035	0.24167	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.40756	2.0;1.02;1.58;1.58;1.58;2.0;1.58	5.74	4.86	0.63082	Armadillo-type fold (1);	0.238066	0.44902	D	0.000420	T	0.22859	0.0552	N	0.08118	0	0.31353	N	0.682346	B;B	0.10296	0.003;0.0	B;B	0.04013	0.001;0.0	T	0.11542	-1.0583	10	0.36615	T	0.2	-11.9393	10.8677	0.46864	0.0:0.1483:0.6811:0.1706	.	448;448	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	I	448;448;379;448;448;448;448	ENSP00000218089:M448I;ENSP00000397265:M448I;ENSP00000346555:M379I;ENSP00000360202:M448I;ENSP00000360199:M448I;ENSP00000360187:M448I;ENSP00000360186:M448I	ENSP00000218089:M448I	M	+	3	0	STAG2	123019436	0.835000	0.29415	1.000000	0.80357	0.998000	0.95712	0.039000	0.13884	2.407000	0.81776	0.600000	0.82982	ATG			0.308	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000156159.2		NM_006603	
