#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
CROCC	9696	mdanderson.org	37	1	17294828	17294828	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr1:17294828A>G	ENST00000375541.5	+	31	5060	c.4991A>G	c.(4990-4992)gAg>gGg	p.E1664G		NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		CTTGAGGGGGAGCTGCAGCGC	0.692																																					p.E1664G													.	.			0			c.A4991G												8.0	10.0	9.0					1																	17294828		2025	3970	5995	SO:0001583	missense	9696	exon31			AGGGGGAGCTGCA	AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.4991A>G	1.37:g.17294828A>G	ENSP00000364691:p.Glu1664Gly		84	0	0		69	0.06	4	NM_014675	38	0.00	0		Missense_Mutation	SNP	ENST00000375541.5	37	CCDS30616.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069119	0.76301	.	.	ENSG00000058453	ENST00000375541;ENST00000445545	T	0.77877	-1.13	3.43	3.43	0.39272	.	.	.	.	.	D	0.84593	0.5506	M	0.72894	2.215	0.51767	D	0.99993	D;D	0.59767	0.979;0.986	D;D	0.65684	0.914;0.937	D	0.85567	0.1231	9	0.72032	D	0.01	.	10.5038	0.44821	1.0:0.0:0.0:0.0	.	967;1664	Q5TZA2-2;Q5TZA2	.;CROCC_HUMAN	G	1664;1545	ENSP00000364691:E1664G	ENSP00000364691:E1664G	E	+	2	0	CROCC	17167415	1.000000	0.71417	0.977000	0.42913	0.972000	0.66771	7.803000	0.85983	1.525000	0.49052	0.379000	0.24179	GAG			0.692	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006249.2		NM_014675	
PFKP	5214	bcgsc.ca	37	10	3161041	3161041	+	Silent	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr10:3161041C>T	ENST00000381125.4	+	15	1586	c.1510C>T	c.(1510-1512)Ctg>Ttg	p.L504L	PFKP_ENST00000381075.2_Silent_p.L496L	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet	504	C-terminal regulatory PFK domain 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		CAACGCGCTGCTGATCATCGG	0.542																																					p.L504L													.	PFKP	182		0			c.C1510T												181.0	137.0	152.0					10																	3161041		2203	4300	6503	SO:0001819	synonymous_variant	5214	exon15			GCGCTGCTGATCA	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.1510C>T	10.37:g.3161041C>T			84	0	0		73	0.07	5	NM_002627	194	0.00	0	B3KS15|Q5VSR7|Q5VSR8	Silent	SNP	ENST00000381125.4	37	CCDS7059.1	.	.	.	.	.	.	.	.	.	.	C	0.504	-0.869791	0.02570	.	.	ENSG00000067057	ENST00000413079	.	.	.	5.32	-4.45	0.03546	.	.	.	.	.	T	0.51770	0.1694	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51764	-0.8664	4	.	.	.	.	9.3969	0.38408	0.098:0.2993:0.0:0.6027	.	.	.	.	V	67	.	.	A	+	2	0	PFKP	3151041	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-0.280000	0.08468	-0.754000	0.04715	0.561000	0.74099	GCT			0.542	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046454.1		NM_002627	
MUC6	4588	bcgsc.ca	37	11	1016822	1016822	+	Silent	SNP	A	A	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:1016822A>C	ENST00000421673.2	-	31	6029	c.5979T>G	c.(5977-5979)acT>acG	p.T1993T		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	1993	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTGGATAGGTAGTGGTGGTCT	0.547																																					p.T1993T													.	MUC6	408		0			c.T5979G												1476.0	1469.0	1471.0					11																	1016822		2203	4298	6501	SO:0001819	synonymous_variant	4588	exon31			ATAGGTAGTGGTG	U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.5979T>G	11.37:g.1016822A>C			523	0.0248565966	13		375	0.04	16	NM_005961	0		0	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Silent	SNP	ENST00000421673.2	37	CCDS44513.1																																																																																					0.547	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382120.2		XM_290540	
OR56B1	387748	mdanderson.org	37	11	5758268	5758268	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:5758268G>T	ENST00000317121.3	+	1	588	c.522G>T	c.(520-522)caG>caT	p.Q174H	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		TTGCAGCACAGCGTGATTATT	0.468																																					p.Q174H													.	.			0			c.G522T												130.0	113.0	119.0					11																	5758268		2201	4297	6498	SO:0001583	missense	387748	exon1			AGCACAGCGTGAT	BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.522G>T	11.37:g.5758268G>T	ENSP00000322939:p.Gln174His		80	0	0		49	0.06	3	NM_001005180	0		0	B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	ENST00000317121.3	37	CCDS31395.1	.	.	.	.	.	.	.	.	.	.	G	9.492	1.100998	0.20552	.	.	ENSG00000181023	ENST00000317121	T	0.00107	8.72	5.91	0.558	0.17266	GPCR, rhodopsin-like superfamily (1);	0.355217	0.20371	U	0.093656	T	0.00210	0.0006	L	0.35723	1.085	0.09310	N	1	D	0.57257	0.979	D	0.64687	0.928	T	0.51949	-0.8640	10	0.62326	D	0.03	-6.4166	2.8481	0.05549	0.1417:0.1224:0.4838:0.252	.	174	Q8NGI3	O56B1_HUMAN	H	174	ENSP00000322939:Q174H	ENSP00000322939:Q174H	Q	+	3	2	OR56B1	5714844	0.000000	0.05858	0.116000	0.21606	0.016000	0.09150	0.514000	0.22786	0.117000	0.18138	-0.150000	0.13652	CAG			0.468	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143354.1		NM_001005180	
PAX6	5080	broad.mit.edu	37	11	31816308	31816308	+	Silent	SNP	T	T	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:31816308T>C	ENST00000379132.3	-	7	832	c.552A>G	c.(550-552)ggA>ggG	p.G184G	PAX6_ENST00000379111.2_Silent_p.G184G|PAX6_ENST00000379115.4_Silent_p.G198G|PAX6_ENST00000419022.1_Silent_p.G198G|PAX6_ENST00000241001.8_Silent_p.G184G|PAX6_ENST00000379107.2_Silent_p.G198G|PAX6_ENST00000379129.2_Silent_p.G198G|PAX6_ENST00000379123.5_Silent_p.G184G			P26367	PAX6_HUMAN	paired box 6	184	Gln/Gly-rich.				astrocyte differentiation (GO:0048708)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|cerebral cortex regionalization (GO:0021796)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|cornea development in camera-type eye (GO:0061303)|dorsal/ventral axis specification (GO:0009950)|embryonic camera-type eye morphogenesis (GO:0048596)|eye development (GO:0001654)|eye photoreceptor cell development (GO:0042462)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain-midbrain boundary formation (GO:0021905)|glucose homeostasis (GO:0042593)|hindbrain development (GO:0030902)|iris morphogenesis (GO:0061072)|keratinocyte differentiation (GO:0030216)|lacrimal gland development (GO:0032808)|lens development in camera-type eye (GO:0002088)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|neuron migration (GO:0001764)|oligodendrocyte cell fate specification (GO:0021778)|organ morphogenesis (GO:0009887)|pancreatic A cell development (GO:0003322)|pituitary gland development (GO:0021983)|positive regulation of cell fate specification (GO:0042660)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of gene expression (GO:0010628)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to organelle (GO:0033365)|protein ubiquitination (GO:0016567)|regulation of cell migration (GO:0030334)|regulation of timing of cell differentiation (GO:0048505)|regulation of transcription from RNA polymerase II promoter involved in somatic motor neuron fate commitment (GO:0021918)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|salivary gland morphogenesis (GO:0007435)|signal transduction involved in regulation of gene expression (GO:0023019)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell differentiation (GO:0003309)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)	35	Lung SC(675;0.225)					TGGTATTCTCTCCCCCTCCTT	0.463									Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation																												p.G198G													.	PAX6	75		0			c.A594G												105.0	96.0	99.0					11																	31816308		2202	4299	6501	SO:0001819	synonymous_variant	5080	exon9	Familial Cancer Database	WAGR syndrome	ATTCTCTCCCCCT	AY707088	CCDS31451.1, CCDS31452.1	11p13	2014-09-17	2007-07-12		ENSG00000007372	ENSG00000007372		"""Paired boxes"", ""Homeoboxes / PRD class"""	8620	protein-coding gene	gene with protein product	"""aniridia, keratitis"""	607108	"""paired box gene 6 (aniridia, keratitis)"""	AN2		1302030	Standard	NM_001127612		Approved	D11S812E, AN, WAGR	uc021qfm.1	P26367	OTTHUMG00000041447	ENST00000379132.3:c.552A>G	11.37:g.31816308T>C			133	0.007518797	1		102	0.05	5	NM_001604	0		0	Q6N006|Q99413	Silent	SNP	ENST00000379132.3	37	CCDS31451.1																																																																																					0.463	PAX6-008	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000099293.4		NM_001604	
APLNR	187	mdanderson.org	37	11	57004401	57004401	+	Silent	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:57004401G>T	ENST00000606794.1	-	1	274	c.78C>A	c.(76-78)tcC>tcA	p.S26S		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	26					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GGGCCCCCGAGGATTTCCAGT	0.577																																					p.S26S													.	.			0			c.C78A												76.0	75.0	75.0					11																	57004401		2201	4296	6497	SO:0001819	synonymous_variant	187	exon1			CCCCGAGGATTTC	U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.78C>A	11.37:g.57004401G>T			81	0	0		48	0.06	3	NM_005161	22	0.00	0		Silent	SNP	ENST00000606794.1	37	CCDS7950.1																																																																																					0.577	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000470575.1		NM_005161	
SF1	7536	bcgsc.ca	37	11	64533334	64533334	+	Missense_Mutation	SNP	A	A	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:64533334A>T	ENST00000377390.3	-	13	2213	c.1876T>A	c.(1876-1878)Ttc>Atc	p.F626I	SF1_ENST00000377387.1_Intron|SF1_ENST00000377394.3_Intron|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000227503.9_Intron|SF1_ENST00000334944.5_Intron|SF1_ENST00000422298.2_Intron|SF1_ENST00000433274.2_Missense_Mutation_p.F600I	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	626	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						GGCATCCCGAAGGGCGGCATG	0.537																																					p.F626I													.	SF1	124		0			c.T1876A												7.0	7.0	7.0					11																	64533334		2132	4192	6324	SO:0001583	missense	7536	exon13			TCCCGAAGGGCGG	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1876T>A	11.37:g.64533334A>T	ENSP00000366607:p.Phe626Ile		74	0	0		34	0.12	4	NM_004630	201	0.00	0	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	37	CCDS31599.1	.	.	.	.	.	.	.	.	.	.	A	11.52	1.661798	0.29515	.	.	ENSG00000168066	ENST00000377390;ENST00000433274	T;T	0.44881	0.91;0.91	4.73	4.73	0.59995	.	.	.	.	.	T	0.26666	0.0652	N	0.19112	0.55	0.80722	D	1	B	0.28026	0.198	B	0.18871	0.023	T	0.06991	-1.0796	9	0.31617	T	0.26	.	12.1957	0.54296	1.0:0.0:0.0:0.0	.	626	Q15637	SF01_HUMAN	I	626;600	ENSP00000366607:F626I;ENSP00000396793:F600I	ENSP00000366607:F626I	F	-	1	0	SF1	64289910	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.287000	0.78681	1.781000	0.52344	0.454000	0.30748	TTC			0.537	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000143242.1		NM_004630	
INTS4	92105	broad.mit.edu	37	11	77635932	77635932	+	Missense_Mutation	SNP	A	A	C	rs148749715		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:77635932A>C	ENST00000534064.1	-	12	1412	c.1378T>G	c.(1378-1380)Tcc>Gcc	p.S460A	INTS4_ENST00000529807.1_Missense_Mutation_p.S460A|INTS4_ENST00000525931.1_5'UTR	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	460					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ATATCTCTGGATGAATCCTTT	0.398																																					p.S460A													.	INTS4	89		0			c.T1378G							A	ALA/SER	2,4376		0,2,2187	21.0	22.0	22.0		1378	4.5	1.0	11	dbSNP_134	22	0,8568		0,0,4284	no	missense	INTS4	NM_033547.3	99	0,2,6471	CC,CA,AA		0.0,0.0457,0.0154	benign	460/964	77635932	2,12944	2189	4284	6473	SO:0001583	missense	92105	exon12			CTCTGGATGAATC	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1378T>G	11.37:g.77635932A>C	ENSP00000434466:p.Ser460Ala		249	0	0		232	0.02	5	NM_033547	32	0.00	0	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	37	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.119484	0.77323	4.57E-4	0.0	ENSG00000149262	ENST00000534064;ENST00000354849;ENST00000529807	T;T	0.43294	0.95;1.52	4.51	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.66297	2.02	0.80722	D	1	D	0.57257	0.979	D	0.74023	0.982	T	0.65709	-0.6102	10	0.66056	D	0.02	-2.9581	14.2909	0.66278	1.0:0.0:0.0:0.0	.	460	Q96HW7	INT4_HUMAN	A	460;311;460	ENSP00000434466:S460A;ENSP00000433644:S460A	ENSP00000346913:S311A	S	-	1	0	INTS4	77313580	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.579000	0.90781	2.015000	0.59207	0.397000	0.26171	TCC			0.398	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000390927.1		NM_033547	
ANGPTL5	253935	mdanderson.org	37	11	101775579	101775579	+	Silent	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:101775579C>T	ENST00000334289.3	-	5	1000	c.405G>A	c.(403-405)ctG>ctA	p.L135L		NM_178127.4	NP_835228.2	Q86XS5	ANGL5_HUMAN	angiopoietin-like 5	135						extracellular region (GO:0005576)				breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(2)|skin(3)	29		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.043)		BRCA - Breast invasive adenocarcinoma(274;0.0328)		GAAAAGGATCCAGCTGTTTTC	0.348																																					p.L135L													.	.			0			c.G405A												96.0	100.0	99.0					11																	101775579		2203	4299	6502	SO:0001819	synonymous_variant	253935	exon5			AGGATCCAGCTGT	BC049170	CCDS8312.1	11q22.2	2013-02-06				ENSG00000187151		"""Fibrinogen C domain containing"""	19705	protein-coding gene	gene with protein product		607666				12624729	Standard	NM_178127		Approved		uc001pgl.3	Q86XS5		ENST00000334289.3:c.405G>A	11.37:g.101775579C>T			24	0	0		30	0.10	3	NM_178127	0		0	A8K658|Q86VR9	Silent	SNP	ENST00000334289.3	37	CCDS8312.1																																																																																					0.348	ANGPTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000394138.1		NM_178127	
TIRAP	114609	mdanderson.org	37	11	126162383	126162383	+	Nonsense_Mutation	SNP	C	C	T	rs202146623		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:126162383C>T	ENST00000392680.2	+	5	484	c.79C>T	c.(79-81)Cag>Tag	p.Q27*	RP11-712L6.7_ENST00000533378.1_RNA|TIRAP_ENST00000392678.3_Nonsense_Mutation_p.Q27*|RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392679.1_Nonsense_Mutation_p.Q27*	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	27					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		CTGGTTCAGGCAGACCCTGCT	0.607																																					p.Q27X													.	.			0			c.C79T							C	stop/GLN,stop/GLN	1,4401	2.1+/-5.4	0,1,2200	70.0	66.0	67.0		79,79	5.3	1.0	11		67	4,8592	3.7+/-12.6	0,4,4294	no	stop-gained,stop-gained	TIRAP	NM_001039661.1,NM_148910.2	,	0,5,6494	TT,TC,CC		0.0465,0.0227,0.0385	,	27/222,27/236	126162383	5,12993	2201	4298	6499	SO:0001587	stop_gained	114609	exon5			TTCAGGCAGACCC	AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.79C>T	11.37:g.126162383C>T	ENSP00000376447:p.Gln27*		60	0	0		42	0.07	3	NM_148910	3	0.00	0	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Nonsense_Mutation	SNP	ENST00000392680.2	37	CCDS8472.1	.	.	.	.	.	.	.	.	.	.	C	16.64	3.178546	0.57692	2.27E-4	4.65E-4	ENSG00000150455	ENST00000392679;ENST00000279992;ENST00000392678;ENST00000392680	.	.	.	5.27	5.27	0.74061	.	0.212694	0.33161	N	0.005218	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-16.6305	14.9309	0.70914	0.1436:0.8564:0.0:0.0	.	.	.	.	X	27	.	ENSP00000279992:Q27X	Q	+	1	0	TIRAP	125667593	0.981000	0.34729	1.000000	0.80357	0.526000	0.34562	1.107000	0.31110	2.614000	0.88457	0.655000	0.94253	CAG	0.001		0.607	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000277092.1		NM_148910	
GLB1L2	89944	mdanderson.org	37	11	134226237	134226237	+	Nonsense_Mutation	SNP	G	G	T	rs146193618		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr11:134226237G>T	ENST00000535456.2	+	6	789	c.601G>T	c.(601-603)Gaa>Taa	p.E201*	GLB1L2_ENST00000389881.3_Nonsense_Mutation_p.E201*|GLB1L2_ENST00000529077.1_3'UTR|GLB1L2_ENST00000339772.7_Nonsense_Mutation_p.E201*	NM_138342.3	NP_612351.2	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2	201					carbohydrate metabolic process (GO:0005975)	extracellular region (GO:0005576)	beta-galactosidase activity (GO:0004565)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GGTGGAGAATGAATATGGTTC	0.478																																					p.E201X													.	.			0			c.G601T												195.0	199.0	198.0					11																	134226237		2201	4297	6498	SO:0001587	stop_gained	89944	exon6			GAGAATGAATATG		CCDS31724.1	11q25	2008-01-29			ENSG00000149328	ENSG00000149328			25129	protein-coding gene	gene with protein product						12975309	Standard	NM_138342		Approved		uc001qhp.3	Q8IW92	OTTHUMG00000167179	ENST00000535456.2:c.601G>T	11.37:g.134226237G>T	ENSP00000444628:p.Glu201*		46	0	0		33	0.09	3	NM_138342	1	0.00	0	A6NCE6|Q6UX60|Q8NC62|Q8NCB3|Q8NCJ1|Q96HP3	Nonsense_Mutation	SNP	ENST00000535456.2	37	CCDS31724.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.634797|6.634797	0.97722|0.97722	.|.	.|.	ENSG00000149328|ENSG00000149328	ENST00000339772;ENST00000535456;ENST00000389881|ENST00000525089;ENST00000533324	.|.	.|.	.|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.87932|.	D|.	0|.	-27.4646|-27.4646	16.8905|16.8905	0.86086|0.86086	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	201|139;28	.|.	ENSP00000344659:E201X|.	E|X	+|+	1|2	0|2	GLB1L2|GLB1L2	133731447|133731447	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	7.379000|7.379000	0.79691|0.79691	2.732000|2.732000	0.93576|0.93576	0.655000|0.655000	0.94253|0.94253	GAA|TGA			0.478	GLB1L2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000393629.2		NM_138342	
PCBP2	5094	broad.mit.edu;ucsc.edu	37	12	53865577	53865577	+	Nonsense_Mutation	SNP	T	T	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr12:53865577T>G	ENST00000439930.3	+	13	1069	c.1047T>G	c.(1045-1047)taT>taG	p.Y349*	PCBP2_ENST00000552819.1_Nonsense_Mutation_p.Y306*|PCBP2_ENST00000552296.2_Nonsense_Mutation_p.Y345*|PCBP2_ENST00000437231.1_Nonsense_Mutation_p.Y302*|PCBP2_ENST00000359282.5_Nonsense_Mutation_p.Y315*|PCBP2_ENST00000549863.1_Nonsense_Mutation_p.Y305*|PCBP2_ENST00000546463.1_Nonsense_Mutation_p.Y346*|PCBP2_ENST00000603815.1_Nonsense_Mutation_p.Y349*|PCBP2_ENST00000548933.1_Nonsense_Mutation_p.Y319*|PCBP2_ENST00000359462.5_Nonsense_Mutation_p.Y350*|PCBP2_ENST00000455667.3_Nonsense_Mutation_p.Y302*|PCBP2_ENST00000447282.1_Nonsense_Mutation_p.Y319*			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	349	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						TGGCTCAATATCTAATCAATG	0.443																																					p.Y350X													.	PCBP2	38		0			c.T1050G												84.0	72.0	76.0					12																	53865577		2203	4300	6503	SO:0001587	stop_gained	5094	exon14			TCAATATCTAATC	BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.1047T>G	12.37:g.53865577T>G	ENSP00000408949:p.Tyr349*		148	0	0		114	0.04	4	NM_005016	2328	0.19	444	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Nonsense_Mutation	SNP	ENST00000439930.3	37	CCDS44901.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.678793	0.88542	.	.	ENSG00000197111	ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000379777;ENST00000553064	.	.	.	5.44	4.27	0.50696	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0624	0.30640	0.0:0.1602:0.0:0.8398	.	.	.	.	X	315;319;302;349;305;350;292;346;345;307;306;302;319;266;179	.	ENSP00000352228:Y315X	Y	+	3	2	PCBP2	52151844	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.178000	0.31981	1.047000	0.40274	0.528000	0.53228	TAT			0.443	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000407545.2	rescued with RNA-seq	NM_005016	
DNAH10	196385	mdanderson.org	37	12	124256228	124256228	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr12:124256228G>T	ENST00000409039.3	+	3	221	c.196G>T	c.(196-198)Gaa>Taa	p.E66*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	66	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGAGATTTCAGAAAAACTCCC	0.468																																					p.E66X													.	.			0			c.G196T												77.0	72.0	74.0					12																	124256228		1854	4092	5946	SO:0001587	stop_gained	196385	exon3			ATTTCAGAAAAAC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.196G>T	12.37:g.124256228G>T	ENSP00000386770:p.Glu66*		63	0	0		42	0.07	3	NM_207437	0		0	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	ENST00000409039.3	37	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908321	0.72868	.	.	ENSG00000197653	ENST00000409039	.	.	.	3.85	3.85	0.44370	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	11.9701	0.53060	0.0:0.0:1.0:0.0	.	.	.	.	X	66	.	ENSP00000386770:E66X	E	+	1	0	DNAH10	122822181	0.075000	0.21258	0.170000	0.22879	0.097000	0.18754	2.055000	0.41345	2.071000	0.62044	0.591000	0.81541	GAA			0.468	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000335420.3			
EP400	57634	hgsc.bcm.edu;mdanderson.org	37	12	132547147	132547147	+	Silent	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr12:132547147G>A	ENST00000333577.4	+	48	8452	c.8343G>A	c.(8341-8343)caG>caA	p.Q2781Q	EP400_ENST00000389562.2_Silent_p.Q2744Q|EP400_ENST00000389561.2_Silent_p.Q2745Q|EP400_ENST00000332482.4_Silent_p.Q2708Q|EP400_ENST00000330386.6_Silent_p.Q2664Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2781	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		aacagcagcagcagcaacagA	0.612																																					p.Q2745Q													.	.			0			c.G8235A												61.0	48.0	52.0					12																	132547147		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon47			GCAGCAGCAGCAA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8343G>A	12.37:g.132547147G>A			150	0	0		149	0.07	10	NM_015409	53	0.00	0	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	37																																																																																						0.612	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding				NM_015409	
ABHD4	63874	bcgsc.ca	37	14	23067200	23067200	+	5'UTR	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr14:23067200G>T	ENST00000428304.2	+	0	55				CTD-2555K7.4_ENST00000536432.2_RNA	NM_022060.2	NP_071343.2	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4						lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(3)|prostate(1)	14	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		CCAGGACCTGGCAAGGCTTGT	0.652																																					.													.	ABHD4	30		0			.												50.0	42.0	45.0					14																	23067200		1918	3599	5517	SO:0001623	5_prime_UTR_variant	0	.			GACCTGGCAAGGC	AK022878	CCDS9572.1	14q11.1	2006-10-06			ENSG00000100439	ENSG00000100439		"""Abhydrolase domain containing"""	20154	protein-coding gene	gene with protein product							Standard	NM_022060		Approved	FLJ12816	uc001wgm.3	Q8TB40	OTTHUMG00000028686	ENST00000428304.2:c.-16G>T	14.37:g.23067200G>T			37	0	0		60	0.07	4	.	6	0.00	0	B4DDH7|Q9H9E0	Missense_Mutation	SNP	ENST00000428304.2	37	CCDS9572.1	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364454	0.61513	.	.	ENSG00000228313	ENST00000536432	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	T	0.75287	0.3829	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.79082	-0.1949	5	0.87932	D	0	.	15.1775	0.72924	0.0:0.0:1.0:0.0	.	.	.	.	T	80	.	ENSP00000437400:P80T	P	-	1	0	AL160314.1	22137040	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	3.574000	0.53863	2.428000	0.82296	0.650000	0.86243	CCA			0.652	ABHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000071623.3			
TMEM30B	161291	mdanderson.org	37	14	61747673	61747673	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr14:61747673A>G	ENST00000555868.1	-	1	885	c.193T>C	c.(193-195)Tac>Cac	p.Y65H	TMEM30B_ENST00000355702.2_Missense_Mutation_p.Y65H|TMEM30B_ENST00000557163.1_5'UTR	NM_001017970.2	NP_001017970.1	Q3MIR4	CC50B_HUMAN	transmembrane protein 30B	65					lipid transport (GO:0006869)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(108;0.107)|BRCA - Breast invasive adenocarcinoma(234;0.181)		GTATAGTCGTACTCCAGCTCC	0.697																																					p.Y65H													.	.			0			c.T193C												7.0	6.0	6.0					14																	61747673		1976	3871	5847	SO:0001583	missense	161291	exon1			AGTCGTACTCCAG	AK091169	CCDS32093.1	14q23.1	2006-09-20				ENSG00000182107			27254	protein-coding gene	gene with protein product		611029				15375526	Standard	NM_001017970		Approved	CDC50B	uc001xfl.3	Q3MIR4		ENST00000555868.1:c.193T>C	14.37:g.61747673A>G	ENSP00000450842:p.Tyr65His		10	0	0		13	0.15	2	NM_001017970	0		0	B3KR84|Q14D00	Missense_Mutation	SNP	ENST00000555868.1	37	CCDS32093.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.308505	0.40895	.	.	ENSG00000182107	ENST00000555868;ENST00000355702	.	.	.	4.68	3.5	0.40072	.	0.462575	0.20950	N	0.082767	T	0.29882	0.0747	L	0.38175	1.15	0.25588	N	0.98673	B	0.06786	0.001	B	0.11329	0.006	T	0.18178	-1.0345	9	0.42905	T	0.14	-20.5078	6.2931	0.21071	0.803:0.0:0.197:0.0	.	65	Q3MIR4	CC50B_HUMAN	H	65	.	ENSP00000347930:Y65H	Y	-	1	0	TMEM30B	60817426	0.998000	0.40836	0.997000	0.53966	0.954000	0.61252	0.424000	0.21330	0.798000	0.33994	0.529000	0.55759	TAC			0.697	TMEM30B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413358.1		XM_090844	
GOLGA6L2	283685	bcgsc.ca	37	15	23685625	23685625	+	Missense_Mutation	SNP	T	T	C	rs372736971		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr15:23685625T>C	ENST00000567107.1	-	8	2049	c.1997A>G	c.(1996-1998)gAa>gGa	p.E666G	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tcccacatcttctcctcctgc	0.582																																					.													.	.			0			.																																									SO:0001583	missense	283685	.			ACATCTTCTCCTC	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1997A>G	15.37:g.23685625T>C	ENSP00000454407:p.Glu666Gly		37	0.027027027	1		33	0.12	4	.	0		0	A1L301	Missense_Mutation	SNP	ENST00000567107.1	37																																																																																						0.582	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000431937.1		NM_182561	
DPP8	54878	mdanderson.org	37	15	65744370	65744370	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr15:65744370C>T	ENST00000341861.5	-	18	3970	c.2390G>A	c.(2389-2391)gGt>gAt	p.G797D	DPP8_ENST00000339244.5_Missense_Mutation_p.G624D|DPP8_ENST00000321147.6_Missense_Mutation_p.G746D|DPP8_ENST00000358939.4_Missense_Mutation_p.G681D|DPP8_ENST00000559233.1_Missense_Mutation_p.G797D|DPP8_ENST00000321118.7_Missense_Mutation_p.G748D|DPP8_ENST00000560048.2_5'UTR|DPP8_ENST00000300141.6_Missense_Mutation_p.G781D	NM_197960.2	NP_932064.1	Q6V1X1	DPP8_HUMAN	dipeptidyl-peptidase 8	797					immune response (GO:0006955)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(2)|endometrium(3)|large_intestine(11)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTCAGGGTGACCCATATAACG	0.438																																					p.G797D													.	.			0			c.G2390A												162.0	157.0	159.0					15																	65744370		2201	4299	6500	SO:0001583	missense	54878	exon19			GGGTGACCCATAT	AF221634	CCDS10207.1, CCDS10208.1, CCDS10209.1, CCDS10210.1	15q22	2008-07-18	2006-01-12		ENSG00000074603	ENSG00000074603			16490	protein-coding gene	gene with protein product	"""dipeptidyl peptidase VIII"", ""dipeptidyl peptidase IV-related protein-1"", ""prolyl dipeptidase DPP8"""	606819	"""dipeptidylpeptidase 8"""			11012666	Standard	XM_005254500		Approved	DP8, DPRP1, MSTP141, FLJ14920, FLJ20283, MGC26191	uc002aox.3	Q6V1X1	OTTHUMG00000133150	ENST00000341861.5:c.2390G>A	15.37:g.65744370C>T	ENSP00000339208:p.Gly797Asp		71	0	0		47	0.06	3	NM_197960	34	0.00	0	Q7Z4C8|Q7Z4D3|Q7Z4E1|Q8IWG7|Q8NEM5|Q96JX1|Q9HBM2|Q9HBM3|Q9HBM4|Q9HBM5|Q9NXF4	Missense_Mutation	SNP	ENST00000341861.5	37	CCDS10207.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.661295	0.67700	.	.	ENSG00000074603	ENST00000341861;ENST00000358939;ENST00000300141;ENST00000321147;ENST00000321118;ENST00000339244	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.42	5.42	0.78866	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55609	0.1931	N	0.25485	0.75	0.58432	D	0.999997	P;B;B;P;B;B	0.40376	0.715;0.292;0.169;0.506;0.169;0.203	P;B;B;B;B;B	0.57548	0.823;0.268;0.164;0.131;0.164;0.253	T	0.40757	-0.9546	10	0.02654	T	1	-13.9446	19.2151	0.93774	0.0:1.0:0.0:0.0	.	624;748;781;681;746;797	C9JSG1;Q6V1X1-5;Q6V1X1-3;Q6V1X1-4;Q6V1X1-2;Q6V1X1	.;.;.;.;.;DPP8_HUMAN	D	797;681;781;746;748;624	ENSP00000339208:G797D;ENSP00000351817:G681D;ENSP00000300141:G781D;ENSP00000318111:G746D;ENSP00000316373:G748D;ENSP00000341230:G624D	ENSP00000300141:G781D	G	-	2	0	DPP8	63531423	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.593000	0.61034	2.542000	0.85734	0.563000	0.77884	GGT			0.438	DPP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000256847.1		NM_017743	
CD276	80381	mdanderson.org	37	15	74000783	74000783	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr15:74000783G>T	ENST00000318443.5	+	7	1775	c.1473G>T	c.(1471-1473)aaG>aaT	p.K491N	CD276_ENST00000537340.2_Missense_Mutation_p.K345N|CD276_ENST00000561213.1_Missense_Mutation_p.K491N|CD276_ENST00000318424.5_Missense_Mutation_p.K273N|CD276_ENST00000564751.1_Missense_Mutation_p.K273N	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	491					cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						GCTGGAGAAAGATCAAACAGA	0.547																																					p.K491N													.	.			0			c.G1473T												138.0	107.0	118.0					15																	74000783		2198	4297	6495	SO:0001583	missense	80381	exon7			GAGAAAGATCAAA	AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.1473G>T	15.37:g.74000783G>T	ENSP00000320084:p.Lys491Asn		81	0	0		42	0.07	3	NM_001024736	138	0.00	0	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Missense_Mutation	SNP	ENST00000318443.5	37	CCDS32288.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	15.71|15.71	2.914146|2.914146	0.52546|0.52546	.|.	.|.	ENSG00000103855|ENSG00000103855	ENST00000543481|ENST00000318424;ENST00000318443;ENST00000537340	.|T;T;T	.|0.21543	.|2.0;2.17;2.15	5.01|5.01	2.76|2.76	0.32466|0.32466	.|.	.|0.251153	.|0.38164	.|N	.|0.001782	T|T	0.25644|0.25644	0.0624|0.0624	L|L	0.27053|0.27053	0.805|0.805	0.44834|0.44834	D|D	0.997845|0.997845	.|D;D;D;D	.|0.89917	.|1.0;0.999;0.985;0.991	.|D;D;P;P	.|0.71414	.|0.963;0.973;0.777;0.889	T|T	0.02588|0.02588	-1.1137|-1.1137	6|10	0.87932|0.32370	D|T	0|0.25	-9.4183|-9.4183	6.7109|6.7109	0.23276|0.23276	0.2341:0.1442:0.6217:0.0|0.2341:0.1442:0.6217:0.0	.|.	.|437;273;491;491	.|B4DK26;Q5ZPR3-2;Q5ZPR3;Q5ZPR3-4	.|.;.;CD276_HUMAN;.	Y|N	136|273;491;345	.|ENSP00000320058:K273N;ENSP00000320084:K491N;ENSP00000441087:K345N	ENSP00000441338:D136Y|ENSP00000320058:K273N	D|K	+|+	1|3	0|2	CD276|CD276	71787836|71787836	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.811000|0.811000	0.45836|0.45836	0.864000|0.864000	0.27926|0.27926	1.095000|1.095000	0.41419|0.41419	-0.224000|-0.224000	0.12420|0.12420	GAT|AAG			0.547	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268979.1		NM_025240	
ABCA3	21	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2358479	2358479	+	Silent	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:2358479G>A	ENST00000301732.5	-	11	1957	c.1257C>T	c.(1255-1257)gcC>gcT	p.A419A	ABCA3_ENST00000382381.3_Intron	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	419					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	CAATGAGCTGGGCTCCCATTG	0.542																																					p.A419A													.	.			0			c.C1257T												107.0	90.0	96.0					16																	2358479		2198	4300	6498	SO:0001819	synonymous_variant	21	exon11			GAGCTGGGCTCCC	U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.1257C>T	16.37:g.2358479G>A			65	0	0		61	0.21	13	NM_001089	2	0.00	0	B2RU09|Q54A95|Q6P5P9|Q92473	Silent	SNP	ENST00000301732.5	37	CCDS10466.1																																																																																					0.542	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250784.2		NM_001089	
ZNF785	146540	mdanderson.org	37	16	30594392	30594392	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:30594392C>T	ENST00000395216.2	-	3	866	c.707G>A	c.(706-708)cGc>cAc	p.R236H	ZNF785_ENST00000470110.1_Missense_Mutation_p.R221H|AC002310.7_ENST00000486926.1_RNA|AC002310.7_ENST00000492040.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						CTGGCGGAAGCGGCGCCCGCA	0.652																																					p.R236H													.	.			0			c.G707A												29.0	32.0	31.0					16																	30594392		2197	4299	6496	SO:0001583	missense	146540	exon3			CGGAAGCGGCGCC	BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.707G>A	16.37:g.30594392C>T	ENSP00000378642:p.Arg236His		44	0	0		42	0.07	3	NM_152458	7	0.00	0	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	ENST00000395216.2	37	CCDS10685.1	.	.	.	.	.	.	.	.	.	.	c	17.00	3.277904	0.59758	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.19938	2.11;2.11	4.25	1.04	0.20106	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20047	0.0482	L	0.53249	1.67	0.09310	N	1	B;D;B	0.57257	0.003;0.979;0.002	B;B;B	0.42738	0.003;0.396;0.001	T	0.12630	-1.0540	9	0.66056	D	0.02	.	7.3112	0.26475	0.0:0.6765:0.0:0.3235	.	201;236;221	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	H	221;201;236	ENSP00000420340:R221H;ENSP00000378642:R236H	ENSP00000378642:R236H	R	-	2	0	ZNF785	30501893	0.188000	0.23250	0.005000	0.12908	0.169000	0.22640	1.445000	0.35079	0.076000	0.16826	-0.374000	0.07098	CGC			0.652	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255529.2		NM_152458	
ZNF668	79759	mdanderson.org	37	16	31073545	31073545	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:31073545C>T	ENST00000538906.1	-	3	1488	c.704G>A	c.(703-705)cGc>cAc	p.R235H	ZNF668_ENST00000539836.3_Missense_Mutation_p.R258H|ZNF668_ENST00000394983.2_Missense_Mutation_p.R235H|ZNF668_ENST00000535577.1_Missense_Mutation_p.R235H|ZNF668_ENST00000426488.2_Missense_Mutation_p.R258H|ZNF668_ENST00000564456.1_5'Flank|ZNF668_ENST00000300849.4_Missense_Mutation_p.R235H	NM_001172668.1	NP_001166139	Q96K58	ZN668_HUMAN	zinc finger protein 668	235					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	27						CGAGGATGAGCGGGAGAAGCT	0.667																																					p.R258H	Colon(181;1111 1980 5060 10512 25785)												.	.			0			c.G773A												29.0	34.0	32.0					16																	31073545		2196	4300	6496	SO:0001583	missense	79759	exon4			GATGAGCGGGAGA		CCDS10701.1, CCDS54003.1	16p11.2	2013-01-08			ENSG00000167394	ENSG00000167394		"""Zinc fingers, C2H2-type"""	25821	protein-coding gene	gene with protein product						12477932	Standard	NM_024706		Approved	FLJ13479	uc021tgt.1	Q96K58	OTTHUMG00000047357	ENST00000538906.1:c.704G>A	16.37:g.31073545C>T	ENSP00000440149:p.Arg235His		37	0	0		52	0.06	3	NM_001172669	51	0.00	0	C9JHH8|F5H7E7|Q59EV1|Q8N669|Q9H8L4	Missense_Mutation	SNP	ENST00000538906.1	37	CCDS10701.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530385	0.85706	.	.	ENSG00000167394	ENST00000539836;ENST00000535577;ENST00000538906;ENST00000394983;ENST00000300849	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	5.02	5.02	0.67125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.11110	0.0271	N	0.20986	0.625	0.58432	D	0.999996	P	0.47962	0.903	B	0.34991	0.193	T	0.15838	-1.0423	10	0.26408	T	0.33	-39.7347	17.2644	0.87081	0.0:1.0:0.0:0.0	.	235	Q96K58	ZN668_HUMAN	H	258;235;235;235;235	ENSP00000442573:R258H;ENSP00000441349:R235H;ENSP00000440149:R235H;ENSP00000378434:R235H;ENSP00000300849:R235H	ENSP00000300849:R235H	R	-	2	0	ZNF668	30981046	0.939000	0.31865	1.000000	0.80357	0.939000	0.58152	1.538000	0.36094	2.584000	0.87258	0.655000	0.94253	CGC			0.667	ZNF668-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000108516.2		NM_024706	
HSF4	3299	mdanderson.org	37	16	67198821	67198821	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:67198821T>C	ENST00000521374.1	+	1	107	c.107T>C	c.(106-108)cTg>cCg	p.L36P	HSF4_ENST00000584272.1_Missense_Mutation_p.L36P|HSF4_ENST00000421453.1_Missense_Mutation_p.L36P|HSF4_ENST00000264009.8_Missense_Mutation_p.L36P|RP11-5A19.5_ENST00000518227.1_3'UTR			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	36					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		ACAGACCACCTGATCCGCTGG	0.726																																					p.L36P													.	.			0			c.T107C												8.0	11.0	10.0					16																	67198821		1775	3924	5699	SO:0001583	missense	3299	exon3			ACCACCTGATCCG	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.107T>C	16.37:g.67198821T>C	ENSP00000430947:p.Leu36Pro		26	0	0		33	0.09	3	NM_001538	2	0.00	0	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	37	CCDS42175.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.782582	0.90282	.	.	ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374	D;D;D;D	0.91464	-2.85;-2.85;-2.85;-2.85	5.32	5.32	0.75619	Winged helix-turn-helix transcription repressor DNA-binding (1);Heat shock factor (HSF)-type, DNA-binding (3);	0.000000	0.64402	D	0.000001	D	0.95500	0.8538	M	0.85299	2.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96109	0.9075	10	0.87932	D	0	-0.0013	14.3944	0.67001	0.0:0.0:0.0:1.0	.	36;36	Q9ULV5-2;Q9ULV5	.;HSF4_HUMAN	P	36	ENSP00000408815:L36P;ENSP00000264009:L36P;ENSP00000428978:L36P;ENSP00000430947:L36P	ENSP00000264009:L36P	L	+	2	0	HSF4	65756322	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.859000	0.86982	2.143000	0.66587	0.418000	0.28097	CTG			0.726	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000375080.1		NM_001538	
FAM65A	79567	mdanderson.org	37	16	67578273	67578273	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:67578273G>T	ENST00000379312.3	+	15	2805	c.2684G>T	c.(2683-2685)gGg>gTg	p.G895V	FAM65A_ENST00000428437.2_Missense_Mutation_p.G905V|FAM65A_ENST00000540839.3_Missense_Mutation_p.G910V|FAM65A_ENST00000042381.4_Missense_Mutation_p.G891V|CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000422602.2_Missense_Mutation_p.G911V|CTD-2012K14.3_ENST00000563083.1_RNA	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	895						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CTCAGCACGGGGTGTCCAGCT	0.642																																					p.G911V													.	.			0			c.G2732T												96.0	88.0	91.0					16																	67578273		2198	4300	6498	SO:0001583	missense	79567	exon15			GCACGGGGTGTCC	AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2684G>T	16.37:g.67578273G>T	ENSP00000368614:p.Gly895Val		40	0	0		28	0.11	3	NM_001193523	43	0.00	0	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	ENST00000379312.3	37	CCDS54028.1	.	.	.	.	.	.	.	.	.	.	G	22.0	4.224674	0.79576	.	.	ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839	D;D;D	0.88741	-2.42;-2.42;-2.42	5.55	4.56	0.56223	.	0.282689	0.39985	N	0.001214	D	0.90304	0.6967	M	0.77313	2.365	0.52099	D	0.99994	P;P;P	0.49253	0.921;0.921;0.921	P;P;P	0.49451	0.488;0.611;0.488	D	0.90086	0.4174	10	0.87932	D	0	-12.8911	8.7131	0.34395	0.1251:0.0:0.8749:0.0	.	905;911;895	B4DIM2;E9PBS3;Q6ZS17	.;.;FA65A_HUMAN	V	895;891;911;905	ENSP00000368614:G895V;ENSP00000042381:G891V;ENSP00000400099:G911V	ENSP00000042381:G891V	G	+	2	0	FAM65A	66135774	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	5.775000	0.68915	1.191000	0.43056	0.655000	0.94253	GGG			0.642	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000268866.3		NM_024519	
ANKRD11	29123	mdanderson.org	37	16	89346815	89346815	+	Silent	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr16:89346815G>T	ENST00000301030.4	-	9	6595	c.6135C>A	c.(6133-6135)ccC>ccA	p.P2045P	ANKRD11_ENST00000378330.2_Silent_p.P2045P	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	2045	Pro-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGATGGCGGCGGGGACGGCGT	0.711																																					p.P2045P													.	.			0			c.C6135A												6.0	8.0	8.0					16																	89346815		1600	3403	5003	SO:0001819	synonymous_variant	29123	exon10			GGCGGCGGGGACG	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.6135C>A	16.37:g.89346815G>T			29	0	0		21	0.10	2	NM_001256182	55	0.02	1	Q6NTG1|Q6QMF8	Silent	SNP	ENST00000301030.4	37	CCDS32513.1																																																																																					0.711	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000430462.3		NM_013275	
SPNS2	124976	mdanderson.org	37	17	4439658	4439658	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:4439658G>T	ENST00000329078.3	+	11	1754	c.1544G>T	c.(1543-1545)gGc>gTc	p.G515V		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	515					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						GTGGTCCTGGGCGGCATGTTC	0.662																																					p.G515V													.	.			0			c.G1544T												101.0	83.0	89.0					17																	4439658		1568	3582	5150	SO:0001583	missense	124976	exon11			TCCTGGGCGGCAT	BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1544G>T	17.37:g.4439658G>T	ENSP00000333292:p.Gly515Val		42	0	0		35	0.09	3	NM_001124758	23	0.00	0	B9A1T3	Missense_Mutation	SNP	ENST00000329078.3	37	CCDS42237.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.693763	0.88735	.	.	ENSG00000183018	ENST00000329078	T	0.61158	0.13	4.82	4.82	0.62117	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	M	0.87269	2.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83512	0.0081	10	0.87932	D	0	.	16.6284	0.84993	0.0:0.0:1.0:0.0	.	515	Q8IVW8	SPNS2_HUMAN	V	515	ENSP00000333292:G515V	ENSP00000333292:G515V	G	+	2	0	SPNS2	4386407	1.000000	0.71417	0.957000	0.39632	0.610000	0.37248	9.516000	0.98017	2.504000	0.84457	0.563000	0.77884	GGC			0.662	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000438802.1			
RARA	5914	broad.mit.edu	37	17	38512394	38512394	+	Silent	SNP	T	T	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:38512394T>G	ENST00000254066.5	+	9	1760	c.1305T>G	c.(1303-1305)ggT>ggG	p.G435G	RARA_ENST00000394081.3_Silent_p.G430G|RARA_ENST00000425707.3_Silent_p.G338G|RARA_ENST00000394086.3_Silent_p.G451G|RARA_ENST00000394089.2_Silent_p.G435G|RARA_ENST00000420042.1_3'UTR	NM_000964.3	NP_000955.1	P10276	RARA_HUMAN	retinoic acid receptor, alpha	435					apoptotic cell clearance (GO:0043277)|cellular response to estrogen stimulus (GO:0071391)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|chondroblast differentiation (GO:0060591)|embryonic camera-type eye development (GO:0031076)|face development (GO:0060324)|female pregnancy (GO:0007565)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|intracellular estrogen receptor signaling pathway (GO:0030520)|limb development (GO:0060173)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translational initiation (GO:0045947)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of binding (GO:0051099)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein phosphorylation (GO:0006468)|regulation of myelination (GO:0031641)|regulation of synaptic plasticity (GO:0048167)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|retinoic acid receptor signaling pathway (GO:0048384)|Sertoli cell fate commitment (GO:0060010)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chromatin DNA binding (GO:0031490)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|mRNA 5'-UTR binding (GO:0048027)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|protein kinase A binding (GO:0051018)|protein kinase B binding (GO:0043422)|receptor binding (GO:0005102)|retinoic acid binding (GO:0001972)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)|zinc ion binding (GO:0008270)			breast(1)|kidney(4)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|urinary_tract(2)	16		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	GGGACGGGGGTGGCCTGGCCC	0.711			T	"""PML, ZNF145, TIF1, NUMA1, NPM1"""	APL																																p.G435G				Dom	yes		17	17q12	5914	"""retinoic acid receptor, alpha"""		L	.	RARA	52		0			c.T1305G												2.0	3.0	3.0					17																	38512394		1493	2985	4478	SO:0001819	synonymous_variant	0	exon9			CGGGGGTGGCCTG	X06538	CCDS11366.1, CCDS42317.1, CCDS45671.1	17q21.1	2014-01-20			ENSG00000131759	ENSG00000131759		"""Nuclear hormone receptors"""	9864	protein-coding gene	gene with protein product		180240				2825036, 8244378	Standard	NM_001145301		Approved	RAR, NR1B1	uc002huk.2	P10276	OTTHUMG00000133328	ENST00000254066.5:c.1305T>G	17.37:g.38512394T>G			86	0	0		87	0.13	11	NM_000964	21	0.00	0	B8Y636|P78456|Q13440|Q13441|Q96S41|Q9NQS0	Silent	SNP	ENST00000254066.5	37	CCDS11366.1																																																																																					0.711	RARA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257136.2			
ITGA3	3675	mdanderson.org	37	17	48157689	48157689	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:48157689G>T	ENST00000320031.8	+	22	3100	c.2770G>T	c.(2770-2772)Gtc>Ttc	p.V924F	ITGA3_ENST00000007722.7_Missense_Mutation_p.V924F	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)	924					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						TGCCCCCGTTGTCACCAACGT	0.607																																					p.V924F													.	.			0			c.G2770T												118.0	82.0	94.0					17																	48157689		2203	4300	6503	SO:0001583	missense	3675	exon22			CCCGTTGTCACCA	M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.2770G>T	17.37:g.48157689G>T	ENSP00000315190:p.Val924Phe		39	0	0		31	0.10	3	NM_005501	30	0.00	0	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	ENST00000320031.8	37	CCDS11558.1	.	.	.	.	.	.	.	.	.	.	G	9.178	1.022804	0.19433	.	.	ENSG00000005884	ENST00000007722;ENST00000538917;ENST00000320031	T;T	0.48522	0.81;0.81	5.08	-6.64	0.01801	.	1.458410	0.03795	N	0.263454	T	0.34366	0.0895	N	0.24115	0.695	0.09310	N	1	B;B	0.30326	0.276;0.213	B;B	0.36030	0.216;0.071	T	0.47560	-0.9108	10	0.62326	D	0.03	.	8.1648	0.31220	0.278:0.3241:0.3979:0.0	.	924;924	P26006-1;P26006	.;ITA3_HUMAN	F	924;910;924	ENSP00000007722:V924F;ENSP00000315190:V924F	ENSP00000007722:V924F	V	+	1	0	ITGA3	45512688	0.001000	0.12720	0.003000	0.11579	0.014000	0.08584	-0.762000	0.04745	-0.964000	0.03595	0.655000	0.94253	GTC			0.607	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000366298.1		NM_005501	
C17orf80	55028	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	71232215	71232215	+	Silent	SNP	A	A	G	rs372656983	byFrequency	TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:71232215A>G	ENST00000535032.2	+	2	707	c.594A>G	c.(592-594)caA>caG	p.Q198Q	C17orf80_ENST00000255557.4_Silent_p.Q198Q|C17orf80_ENST00000577615.1_Silent_p.Q198Q|C17orf80_ENST00000426147.2_Silent_p.Q198Q|C17orf80_ENST00000268942.8_Silent_p.Q198Q|FAM104A_ENST00000583178.1_Intron|C17orf80_ENST00000582793.1_Intron|C17orf80_ENST00000359042.2_Silent_p.Q198Q			Q9BSJ5	CQ080_HUMAN	chromosome 17 open reading frame 80	198						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(2)|skin(2)|stomach(2)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(166;0.197)			ATGATGTACAAACTACCTCTG	0.378													A|||	3	0.000599042	0.0015	0.0	5008	,	,		20864	0.0		0.0	False		,,,				2504	0.001				p.Q198Q													.	.			0			c.A594G							A	,,	1,4405	2.1+/-5.4	0,1,2202	75.0	80.0	78.0		594,594,594	-7.4	0.0	17		78	1,8599		0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous	C17orf80	NM_001100621.1,NM_001100622.1,NM_017941.4	,,	0,2,6501	GG,GA,AA		0.0116,0.0227,0.0154	,,	198/574,198/584,198/610	71232215	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	55028	exon3			TGTACAAACTACC	AY163812	CCDS11694.1, CCDS42377.1, CCDS45767.1, CCDS74145.1	17q25.1	2012-02-24	2012-02-24	2012-02-24	ENSG00000141219	ENSG00000141219			29601	protein-coding gene	gene with protein product	"""sperm-expressed protein 1"", ""migration-inducing protein 3"""					12477932	Standard	NM_017941		Approved	HLC-8, MIG3, FLJ20721, SPEP1	uc002jjl.4	Q9BSJ5		ENST00000535032.2:c.594A>G	17.37:g.71232215A>G			164	0	0		219	0.15	33	NM_001100621	77	0.35	27	A8K9X3|Q5JB45|Q6YAU3|Q9H0L9|Q9H5E6|Q9NWN5	Silent	SNP	ENST00000535032.2	37	CCDS11694.1																																																																																					0.378	C17orf80-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000441893.1		NM_017941	
SRP68	6730	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	74046599	74046599	+	Missense_Mutation	SNP	G	G	T	rs148814451	byFrequency	TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:74046599G>T	ENST00000307877.2	-	9	1148	c.987C>A	c.(985-987)agC>agA	p.S329R	SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000602720.1_5'UTR|SRP68_ENST00000355113.5_Missense_Mutation_p.S228R|SRP68_ENST00000539137.1_Missense_Mutation_p.S291R	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	329					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						TAGTTTCTTCGCTTTCAGCCT	0.517																																					p.S329R													SRP68,NS,carcinoma,-1,1	SRP68	-1	1	0			c.C987A												94.0	80.0	85.0					17																	74046599		2203	4300	6503	SO:0001583	missense	6730	exon9			TTCTTCGCTTTCA	AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.987C>A	17.37:g.74046599G>T	ENSP00000312066:p.Ser329Arg		78	0	0		63	0.08	5	NM_014230	168	0.00	0	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Missense_Mutation	SNP	ENST00000307877.2	37	CCDS11738.1	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055735	0.55325	.	.	ENSG00000167881	ENST00000411758;ENST00000539137;ENST00000540937;ENST00000307877;ENST00000304220;ENST00000355113	.	.	.	5.87	-5.85	0.02311	.	0.121961	0.85682	D	0.000000	T	0.39410	0.1077	L	0.27053	0.805	0.80722	D	1	B;B	0.32071	0.117;0.355	B;B	0.32624	0.066;0.149	T	0.04427	-1.0952	9	0.41790	T	0.15	-19.9931	15.4917	0.75611	0.3876:0.0:0.6124:0.0	.	291;329	G3V1U4;Q9UHB9	.;SRP68_HUMAN	R	69;291;329;329;298;228	.	ENSP00000307756:S298R	S	-	3	2	SRP68	71558194	0.564000	0.26602	0.905000	0.35620	0.984000	0.73092	-0.181000	0.09740	-1.077000	0.03121	-0.290000	0.09829	AGC			0.517	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449487.1		NM_014230	
TNRC6C	57690	broad.mit.edu;mdanderson.org	37	17	76047438	76047438	+	Silent	SNP	C	C	T	rs541145487		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr17:76047438C>T	ENST00000588061.1	+	5	3022	c.2295C>T	c.(2293-2295)acC>acT	p.T765T	TNRC6C_ENST00000541771.1_Silent_p.T765T|TNRC6C_ENST00000301624.4_Silent_p.T765T|TNRC6C_ENST00000544502.1_Silent_p.T765T|TNRC6C_ENST00000588847.1_Silent_p.T765T|TNRC6C_ENST00000335749.4_Silent_p.T765T			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	765	Sufficient for interaction with argonaute family proteins.|Thr-rich.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ccaccaccaccactaccacga	0.547													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14023	0.0		0.0	False		,,,				2504	0.0				p.T765T													.	TNRC6C	173		0			c.C2295T												14.0	16.0	15.0					17																	76047438		1740	3495	5235	SO:0001819	synonymous_variant	57690	exon4			CACCACCACTACC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2295C>T	17.37:g.76047438C>T			37	0	0		47	0.06	3	NM_018996	20	0.00	0	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	ENST00000588061.1	37	CCDS45798.1																																																																																					0.547	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000395947.1		NM_018996	
NDC80	10403	mdanderson.org	37	18	2608749	2608749	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr18:2608749G>T	ENST00000261597.4	+	15	1790	c.1608G>T	c.(1606-1608)gaG>gaT	p.E536D		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	536	Interaction with NEK2 and ZWINT.|Interaction with PSMC2 and SMC1A.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AGTCCTTGGAGAAACACAAGC	0.428																																					p.E536D													.	.			0			c.G1608T												117.0	109.0	112.0					18																	2608749		2203	4300	6503	SO:0001583	missense	10403	exon15			CTTGGAGAAACAC	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1608G>T	18.37:g.2608749G>T	ENSP00000261597:p.Glu536Asp		56	0	0		50	0.06	3	NM_006101	109	0.00	0	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	37	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.532417	0.45073	.	.	ENSG00000080986	ENST00000261597	T	0.55234	0.53	5.53	1.51	0.23008	.	0.045304	0.85682	N	0.000000	T	0.45696	0.1355	M	0.66939	2.045	0.42144	D	0.991523	B	0.12013	0.005	B	0.14023	0.01	T	0.40794	-0.9544	10	0.40728	T	0.16	-8.2161	7.5345	0.27702	0.1347:0.0:0.6283:0.237	.	536	O14777	NDC80_HUMAN	D	536	ENSP00000261597:E536D	ENSP00000261597:E536D	E	+	3	2	NDC80	2598749	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.571000	0.23669	0.685000	0.31468	0.491000	0.48974	GAG			0.428	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000254327.1		NM_006101	
ZNF24	7572	mdanderson.org	37	18	32920572	32920572	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr18:32920572G>T	ENST00000261332.6	-	2	222	c.43C>A	c.(43-45)Cca>Aca	p.P15T	ZNF24_ENST00000399061.3_Missense_Mutation_p.P15T|ZNF24_ENST00000589881.1_Missense_Mutation_p.P15T	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	15					myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						TCTGGAGTTGGGATGATAAGT	0.433																																					p.P15T	Colon(42;769 913 8916 19469 46270)												.	.			0			c.C43A												73.0	72.0	72.0					18																	32920572		2203	4300	6503	SO:0001583	missense	7572	exon2			GAGTTGGGATGAT	AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.43C>A	18.37:g.32920572G>T	ENSP00000261332:p.Pro15Thr		44	0	0		39	0.08	3	NM_006965	22	0.00	0	O14754|Q53YE4|Q6ICR5|Q8IZN4	Missense_Mutation	SNP	ENST00000261332.6	37	CCDS11912.1	.	.	.	.	.	.	.	.	.	.	G	16.42	3.117247	0.56505	.	.	ENSG00000172466	ENST00000261332;ENST00000399061	T;T	0.04758	3.56;3.56	4.19	4.19	0.49359	.	0.152868	0.30890	N	0.008666	T	0.03871	0.0109	L	0.38175	1.15	0.35847	D	0.826447	B;P	0.41524	0.097;0.753	B;B	0.28553	0.038;0.091	T	0.48547	-0.9026	10	0.45353	T	0.12	.	12.2506	0.54595	0.0:0.0:1.0:0.0	.	15;15	P17028-2;P17028	.;ZNF24_HUMAN	T	15	ENSP00000261332:P15T;ENSP00000382015:P15T	ENSP00000261332:P15T	P	-	1	0	ZNF24	31174570	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	4.768000	0.62293	2.338000	0.79540	0.655000	0.94253	CCA			0.433	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000255769.1		NM_006965	
PIGN	23556	mdanderson.org	37	18	59781853	59781853	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr18:59781853G>T	ENST00000357637.5	-	15	1607	c.1192C>A	c.(1192-1194)Cag>Aag	p.Q398K	PIGN_ENST00000400334.3_Missense_Mutation_p.Q398K	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	398					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ATGTTGAACTGTTTGGAATCA	0.289																																					p.Q398K													.	.			0			c.C1192A												62.0	52.0	55.0					18																	59781853		1632	3742	5374	SO:0001583	missense	23556	exon15			TGAACTGTTTGGA	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1192C>A	18.37:g.59781853G>T	ENSP00000350263:p.Gln398Lys		51	0	0		49	0.06	3	NM_176787	20	0.00	0	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	37	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	G	9.629	1.135835	0.21123	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.26373	1.74;1.74	4.93	4.93	0.64822	.	0.139286	0.49305	D	0.000147	T	0.30916	0.0780	M	0.69463	2.115	0.58432	D	0.999995	B;B	0.18310	0.011;0.027	B;B	0.17979	0.017;0.02	T	0.08086	-1.0739	9	.	.	.	-8.8252	18.1231	0.89578	0.0:0.0:1.0:0.0	.	398;398	B2RCI8;O95427	.;PIGN_HUMAN	K	398	ENSP00000350263:Q398K;ENSP00000383188:Q398K	.	Q	-	1	0	PIGN	57932833	1.000000	0.71417	0.960000	0.40013	0.192000	0.23643	5.332000	0.65911	2.438000	0.82558	0.591000	0.81541	CAG			0.289	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000449757.2		NM_176787	
NOTCH3	4854	mdanderson.org	37	19	15296450	15296450	+	Silent	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr19:15296450G>A	ENST00000263388.2	-	13	2067	c.1992C>T	c.(1990-1992)agC>agT	p.S664S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	664	EGF-like 17; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CGCCGCATGGGCTGGAAGCAC	0.607																																					p.S664S													.	.			0			c.C1992T												90.0	73.0	79.0					19																	15296450		2203	4300	6503	SO:0001819	synonymous_variant	4854	exon13			GCATGGGCTGGAA	U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.1992C>T	19.37:g.15296450G>A			33	0	0		31	0.10	3	NM_000435	26	0.00	0	Q9UEB3|Q9UPL3|Q9Y6L8	Silent	SNP	ENST00000263388.2	37	CCDS12326.1																																																																																					0.607	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465714.1		NM_000435	
SPRED3	399473	mdanderson.org	37	19	38885395	38885395	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr19:38885395C>T	ENST00000338502.4	+	4	639	c.536C>T	c.(535-537)aCg>aTg	p.T179M	SPRED3_ENST00000587013.1_Missense_Mutation_p.T223M|SPRED3_ENST00000586301.1_Missense_Mutation_p.T179M	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	179					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGCCGACCACGCCCCCCCAG	0.726																																					p.T179M													.	.			0			c.C536T												5.0	8.0	7.0					19																	38885395		2033	4147	6180	SO:0001583	missense	399473	exon4			CGACCACGCCCCC		CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.536C>T	19.37:g.38885395C>T	ENSP00000345405:p.Thr179Met		31	0	0		24	0.13	3	NM_001042522	0		0	Q2MJR1	Missense_Mutation	SNP	ENST00000338502.4	37	CCDS42560.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811041	0.50421	.	.	ENSG00000188766	ENST00000338502	T	0.80738	-1.41	2.99	1.95	0.26073	.	0.755569	0.11605	N	0.547385	T	0.63462	0.2513	N	0.19112	0.55	0.80722	D	1	B	0.21381	0.055	B	0.06405	0.002	T	0.62015	-0.6943	10	0.41790	T	0.15	-3.7413	5.2512	0.15522	0.0:0.8386:0.0:0.1614	.	179	Q2MJR0	SPRE3_HUMAN	M	179	ENSP00000345405:T179M	ENSP00000345405:T179M	T	+	2	0	SPRED3	43577235	0.307000	0.24500	0.998000	0.56505	0.563000	0.35712	1.846000	0.39289	1.692000	0.51112	0.313000	0.20887	ACG			0.726	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000459216.1		XM_351191	
GRIK5	2901	mdanderson.org	37	19	42507589	42507589	+	Missense_Mutation	SNP	G	G	T	rs141544447		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr19:42507589G>T	ENST00000262895.3	-	18	2408	c.2409C>A	c.(2407-2409)aaC>aaA	p.N803K	GRIK5_ENST00000301218.4_Missense_Mutation_p.N803K|GRIK5_ENST00000593562.1_Missense_Mutation_p.N803K	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	803					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				TGCCACCAATGTTCTCCATGC	0.582																																					p.N803K													.	.			0			c.C2409A												101.0	84.0	90.0					19																	42507589		2203	4300	6503	SO:0001583	missense	2901	exon18			ACCAATGTTCTCC		CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2409C>A	19.37:g.42507589G>T	ENSP00000262895:p.Asn803Lys		79	0	0		51	0.06	3	NM_002088	2	0.00	0	Q8WWG8	Missense_Mutation	SNP	ENST00000262895.3	37	CCDS12595.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.064023|2.064023	0.36373|0.36373	.|.	.|.	ENSG00000105737|ENSG00000105737	ENST00000454993|ENST00000262895;ENST00000301218	.|T;T	.|0.54675	.|0.56;0.56	4.07|4.07	-0.699|-0.699	0.11277|0.11277	.|Ionotropic glutamate receptor (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.51363|0.51363	0.1670|0.1670	M|M	0.76727|0.76727	2.345|2.345	0.43103|0.43103	D|D	0.994793|0.994793	.|B	.|0.18461	.|0.028	.|B	.|0.33799	.|0.17	T|T	0.48854|0.48854	-0.8998|-0.8998	5|10	.|0.49607	.|T	.|0.09	.|.	7.9586|7.9586	0.30057|0.30057	0.5198:0.0:0.4802:0.0|0.5198:0.0:0.4802:0.0	.|.	.|803	.|Q16478	.|GRIK5_HUMAN	N|K	180|803	.|ENSP00000262895:N803K;ENSP00000301218:N803K	.|ENSP00000262895:N803K	H|N	-|-	1|3	0|2	GRIK5|GRIK5	47199429|47199429	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.892000|0.892000	0.51952|0.51952	0.667000|0.667000	0.25112|0.25112	0.061000|0.061000	0.16311|0.16311	0.561000|0.561000	0.74099|0.74099	CAT|AAC			0.582	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000463453.1			
LIG1	3978	mdanderson.org	37	19	48636349	48636349	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr19:48636349G>T	ENST00000263274.7	-	18	2034	c.1615C>A	c.(1615-1617)Ccc>Acc	p.P539T	LIG1_ENST00000536218.1_Missense_Mutation_p.P471T|LIG1_ENST00000427526.2_Missense_Mutation_p.P508T	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	539					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	GGTTTCAGGGGAATCCCTGGG	0.547								Nucleotide excision repair (NER)																													p.P539T													.	.			0			c.C1615A												85.0	83.0	84.0					19																	48636349		2203	4300	6503	SO:0001583	missense	3978	exon18			TCAGGGGAATCCC		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.1615C>A	19.37:g.48636349G>T	ENSP00000263274:p.Pro539Thr		73	0	0		48	0.06	3	NM_000234	143	0.00	0	B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	ENST00000263274.7	37	CCDS12711.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070641	0.76301	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218	T;T;T	0.57907	0.37;0.37;0.37	5.48	4.43	0.53597	DNA ligase, ATP-dependent, N-terminal (1);	0.051572	0.85682	D	0.000000	T	0.78861	0.4350	M	0.93638	3.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84923	0.0855	10	0.87932	D	0	-21.7801	14.264	0.66104	0.0:0.1505:0.8495:0.0	.	508;471;539	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	T	539;570;508;471	ENSP00000263274:P539T;ENSP00000442841:P508T;ENSP00000441531:P471T	ENSP00000263274:P539T	P	-	1	0	LIG1	53328161	1.000000	0.71417	0.835000	0.33067	0.885000	0.51271	6.589000	0.74080	1.424000	0.47217	0.655000	0.94253	CCC			0.547	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465575.1		NM_000234	
USP29	57663	broad.mit.edu	37	19	57641367	57641367	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr19:57641367G>T	ENST00000254181.4	+	4	1778	c.1324G>T	c.(1324-1326)Ggt>Tgt	p.G442C	USP29_ENST00000598197.1_Missense_Mutation_p.G442C	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	442	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAAAGCTTGTGGTCATGCTGT	0.393																																					p.G442C													USP29,NS,carcinoma,0,1	USP29	186	1	0			c.G1324T												167.0	157.0	161.0					19																	57641367		2203	4300	6503	SO:0001583	missense	0	exon4			GCTTGTGGTCATG		CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1324G>T	19.37:g.57641367G>T	ENSP00000254181:p.Gly442Cys		107	0	0		87	0.03	3	NM_020903	1	0.00	0		Missense_Mutation	SNP	ENST00000254181.4	37	CCDS33124.1	.	.	.	.	.	.	.	.	.	.	G	11.44	1.640150	0.29157	.	.	ENSG00000131864	ENST00000254181	T	0.77229	-1.08	2.69	0.399	0.16325	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.294810	0.18758	U	0.131987	D	0.84866	0.5567	M	0.83483	2.645	0.23906	N	0.996504	D	0.89917	1.0	D	0.97110	1.0	T	0.73122	-0.4082	10	0.87932	D	0	-11.5852	4.6279	0.12488	0.3377:0.0:0.6623:0.0	.	442	Q9HBJ7	UBP29_HUMAN	C	442	ENSP00000254181:G442C	ENSP00000254181:G442C	G	+	1	0	USP29	62333179	1.000000	0.71417	0.626000	0.29213	0.354000	0.29330	3.695000	0.54749	0.140000	0.18849	0.591000	0.81541	GGT			0.393	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000465075.1			
CPSF3	51692	broad.mit.edu	37	2	9568893	9568893	+	Splice_Site	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr2:9568893G>T	ENST00000238112.3	+	2	256		c.e2-1		CPSF3_ENST00000460593.1_Splice_Site	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa						gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		AATATTTACAGTGGAGCTGGG	0.318																																					.	Colon(194;1259 2048 3845 5218 19985)												.	CPSF3	63		0			c.51-1G>T												54.0	56.0	55.0					2																	9568893		2203	4297	6500	SO:0001630	splice_region_variant	51692	exon2			TTTACAGTGGAGC	AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.51-1G>T	2.37:g.9568893G>T			274	0	0		228	0.02	5	NM_016207	0		0	O14769|Q53RS2|Q96F36	Splice_Site	SNP	ENST00000238112.3	37	CCDS1664.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.010473	0.75046	.	.	ENSG00000119203	ENST00000238112;ENST00000427001	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.6533	0.88171	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPSF3	9486344	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.469000	0.97679	2.496000	0.84212	0.491000	0.48974	.			0.318	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206843.1		NM_016207	Intron
ASXL2	55252	mdanderson.org	37	2	25994311	25994311	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr2:25994311G>T	ENST00000435504.4	-	6	795	c.502C>A	c.(502-504)Cag>Aag	p.Q168K	ASXL2_ENST00000497092.1_5'UTR|ASXL2_ENST00000404843.1_5'UTR|ASXL2_ENST00000272341.4_5'UTR|ASXL2_ENST00000336112.4_Missense_Mutation_p.Q140K			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	168	Ser-rich.				adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCTTACCTGCTTTAGTGCC	0.428																																					p.Q168K													.	.			0			c.C502A												179.0	174.0	176.0					2																	25994311		2015	4180	6195	SO:0001583	missense	55252	exon5			TTACCTGCTTTAG			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.502C>A	2.37:g.25994311G>T	ENSP00000391447:p.Gln168Lys		126	0	0		130	0.04	5	NM_018263	8	0.00	0	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	37		.	.	.	.	.	.	.	.	.	.	G	27.5	4.841187	0.91197	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.22539	1.95;1.95	5.66	5.66	0.87406	.	0.062966	0.64402	D	0.000004	T	0.44871	0.1314	L	0.59436	1.845	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	T	0.28396	-1.0045	10	0.87932	D	0	-2.2762	18.309	0.90192	0.0:0.0:1.0:0.0	.	168	Q76L83	ASXL2_HUMAN	K	168;140	ENSP00000391447:Q168K;ENSP00000337250:Q140K	ENSP00000337250:Q140K	Q	-	1	0	ASXL2	25847815	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.533000	0.81994	2.672000	0.90937	0.591000	0.81541	CAG			0.428	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000325593.3		NM_018263	
THADA	63892	broad.mit.edu	37	2	43793648	43793648	+	Intron	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr2:43793648A>G	ENST00000405006.4	-	15	2663				THADA_ENST00000405975.2_Intron|THADA_ENST00000415080.2_Intron|THADA_ENST00000404790.1_Intron|THADA_ENST00000330266.7_Intron|THADA_ENST00000402360.2_Intron|THADA_ENST00000403856.1_Missense_Mutation_p.F834L	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated											breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				ATCAATGAAAAGGGAGATAGT	0.328																																					.													.	THADA	131		0			.																																									SO:0001627	intron_variant	63892	.			ATGAAAAGGGAGA	AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.2311+188T>C	2.37:g.43793648A>G			188	0	0		197	0.02	4	.	0		0	A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	ENST00000405006.4	37	CCDS46268.1	.	.	.	.	.	.	.	.	.	.	A	4.856	0.159195	0.09236	.	.	ENSG00000115970	ENST00000403856	T	0.31510	1.49	2.08	-0.576	0.11731	.	.	.	.	.	T	0.17408	0.0418	.	.	.	0.09310	N	0.999999	B	0.28667	0.219	B	0.39217	0.294	T	0.40850	-0.9541	8	0.08837	T	0.75	.	4.5289	0.11995	0.6592:0.0:0.3408:0.0	.	834	B5MC89	.	L	834	ENSP00000385469:F834L	ENSP00000385469:F834L	F	-	1	0	THADA	43647152	0.002000	0.14202	0.002000	0.10522	0.112000	0.19704	-0.049000	0.11924	-0.124000	0.11724	0.383000	0.25322	TTT			0.328	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000326070.3		NM_022065	
CCT4	10575	mdanderson.org	37	2	62110604	62110604	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr2:62110604G>T	ENST00000394440.3	-	3	556	c.260C>A	c.(259-261)gCa>gAa	p.A87E	AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000544079.1_Intron|CCT4_ENST00000538252.1_Missense_Mutation_p.A31E|CCT4_ENST00000544185.1_5'UTR	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	87					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			CATTCTGGCTGCTGGATGTAA	0.353																																					p.A87E													.	.			0			c.C260A												79.0	69.0	72.0					2																	62110604		2203	4300	6503	SO:0001583	missense	10575	exon3			CTGGCTGCTGGAT		CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.260C>A	2.37:g.62110604G>T	ENSP00000377958:p.Ala87Glu		34	0	0		29	0.07	2	NM_006430	524	0.00	0	B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	ENST00000394440.3	37	CCDS33206.1	.	.	.	.	.	.	.	.	.	.	G	33	5.225041	0.95173	.	.	ENSG00000115484	ENST00000394440;ENST00000538252	T;T	0.80304	-1.36;-1.36	5.07	5.07	0.68467	.	0.105724	0.64402	D	0.000006	D	0.94374	0.8191	H	0.99789	4.78	0.80722	D	1	D	0.55385	0.971	P	0.59703	0.862	D	0.97219	0.9876	10	0.87932	D	0	-15.5493	18.4301	0.90622	0.0:0.0:1.0:0.0	.	87	P50991	TCPD_HUMAN	E	87;31	ENSP00000377958:A87E;ENSP00000442174:A31E	ENSP00000377958:A87E	A	-	2	0	CCT4	61964108	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.619000	0.98369	2.500000	0.84329	0.655000	0.94253	GCA			0.353	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000325548.2			
LOC150776	150776	broad.mit.edu	37	2	132277686	132277686	+	RNA	SNP	C	C	T	rs9287520	byFrequency	TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr2:132277686C>T	ENST00000438378.2	+	0	2325					NR_026922.1																						GGACAGATGGCGGCTCTGTGT	0.647													c|||	1676	0.334665	0.1346	0.4265	5008	,	,		16879	0.6806		0.2197	False		,,,				2504	0.3016				.													.	.			0			.																																											0	.			AGATGGCGGCTCT																													2.37:g.132277686C>T			87	0	0		53	0.08	4	.	142	0.00	0		RNA	SNP	ENST00000438378.2	37																																																																																						0.647	AC093838.4-001	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331819.7			
FAM182B	728882	mdanderson.org	37	20	25755549	25755549	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr20:25755549C>A	ENST00000376403.1	-	3	785	c.407G>T	c.(406-408)gGc>gTc	p.G136V	FAM182B_ENST00000376404.2_Intron|FAM182B_ENST00000478164.1_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B	136										lung(1)	1						TGGTCTGCAGCCTTCCTGGGA	0.716																																					.													FAM182B,colon,carcinoma,0,1	FAM182B	0	1	0			.																																									SO:0001583	missense	728882	.			CTGCAGCCTTCCT			20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000376403.1:c.407G>T	20.37:g.25755549C>A	ENSP00000365585:p.Gly136Val		59	0	0		44	0.07	3	.	3	0.00	0	Q4G0Q1	RNA	SNP	ENST00000376403.1	37		.	.	.	.	.	.	.	.	.	.	.	1.024	-0.684035	0.03353	.	.	ENSG00000175170	ENST00000376403	.	.	.	.	.	.	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.39187	-0.9626	3	0.87932	D	0	.	.	.	.	.	.	.	.	V	136	.	ENSP00000365585:G136V	G	-	2	0	FAM182B	25703549	0.129000	0.22400	0.158000	0.22627	0.158000	0.22134	-0.337000	0.07852	0.064000	0.16427	0.064000	0.15345	GGC			0.716	FAM182B-003	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding		OTTHUMT00000078463.2		NR_026714	
C20orf203	284805	broad.mit.edu	37	20	31238232	31238232	+	lincRNA	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr20:31238232G>T	ENST00000608990.1	-	0	1159							Q8NBC4	CT203_HUMAN	chromosome 20 open reading frame 203							cytoplasm (GO:0005737)											CCCTGGGCTCGGCTAATTAAA	0.582																																					.													.	.			0			.																																											284805	.			GGGCTCGGCTAAT	AK091025		20q11.21	2013-12-06			ENSG00000198547	ENSG00000198547			26592	protein-coding gene	gene with protein product						20376170	Standard	NM_182584		Approved	FLJ33706	uc021wbx.1	Q8NBC4	OTTHUMG00000032224		20.37:g.31238232G>T			85	0	0		81	0.04	3	.	0		0	B8JHY2	RNA	SNP	ENST00000608990.1	37																																																																																						0.582	C20orf203-001	KNOWN	basic	lincRNA	lincRNA		OTTHUMT00000078641.3		NM_182584	
OGFR	11054	mdanderson.org	37	20	61444930	61444930	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr20:61444930G>T	ENST00000290291.6	+	7	1988	c.1963G>T	c.(1963-1965)Gcc>Tcc	p.A655S	OGFR_ENST00000370461.1_Missense_Mutation_p.A603S	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	655	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GGATGAGCCAGCCAAGGCGGG	0.682																																					p.A655S													.	.			0			c.G1963T												38.0	42.0	41.0					20																	61444930		2196	4296	6492	SO:0001583	missense	11054	exon7			GAGCCAGCCAAGG	AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1963G>T	20.37:g.61444930G>T	ENSP00000290291:p.Ala655Ser		70	0	0		43	0.07	3	NM_007346	229	0.00	0	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	ENST00000290291.6	37	CCDS13504.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027475	0.35797	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.54479	0.57;0.57	0.753	-0.567	0.11763	.	.	.	.	.	T	0.34513	0.0900	N	0.14661	0.345	0.09310	N	1	D;D;D	0.53462	0.96;0.96;0.96	P;P;P	0.46685	0.524;0.524;0.524	T	0.26467	-1.0102	9	0.23302	T	0.38	.	7.6255	0.28210	0.0:0.2679:0.7321:0.0	.	655;638;655	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	S	655;635;490;603	ENSP00000290291:A655S;ENSP00000359491:A603S	ENSP00000290291:A655S	A	+	1	0	OGFR	60915375	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.589000	0.00900	-0.202000	0.10268	0.511000	0.50034	GCC			0.682	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000080067.1			
OLIG2	10215	mdanderson.org	37	21	34399701	34399701	+	Silent	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr21:34399701C>T	ENST00000333337.3	+	1	1459	c.531C>T	c.(529-531)taC>taT	p.Y177Y	AP000282.2_ENST00000454622.1_RNA|OLIG2_ENST00000382357.3_Silent_p.Y177Y|AP000282.2_ENST00000420356.1_RNA			Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	177					myelination (GO:0042552)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|positive regulation of oligodendrocyte differentiation (GO:0048714)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|thalamus development (GO:0021794)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|central_nervous_system(2)	3						GCGAGATCTACGGGGGCCACC	0.697			T	TRA@	T-ALL																																p.Y177Y				Dom	yes		21	21q22.11	10215	oligodendrocyte lineage transcription factor 2 (BHLHB1)		L	.	.			0			c.C531T												12.0	10.0	11.0					21																	34399701		2129	4165	6294	SO:0001819	synonymous_variant	10215	exon2			GATCTACGGGGGC	U48250	CCDS13620.1	21q22.11	2013-05-21	2001-12-04	2001-12-07	ENSG00000205927	ENSG00000205927		"""Basic helix-loop-helix proteins"""	9398	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 2"", ""protein kinase C binding protein 2"", ""human protein kinase C-binding protein RACK17"", ""basic domain, helix-loop-helix protein, class B, 1"""	606386	"""protein kinase C binding protein 2"""	PRKCBP2, BHLHB1		11526205	Standard	NM_005806		Approved	RACK17, OLIGO2, bHLHe19	uc002yqx.2	Q13516	OTTHUMG00000065032	ENST00000333337.3:c.531C>T	21.37:g.34399701C>T			35	0	0		39	0.08	3	NM_005806	0		0	B3KRF3|Q05BP9|Q49AL3|Q86X04|Q9NZ14	Silent	SNP	ENST00000333337.3	37	CCDS13620.1																																																																																					0.697	OLIG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000139663.1		NM_005806	
KCNJ6	3763	bcgsc.ca	37	21	39087331	39087331	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr21:39087331G>T	ENST00000609713.1	-	3	718	c.129C>A	c.(127-129)caC>caA	p.H43Q	KCNJ6-IT1_ENST00000435001.1_RNA|KCNJ6_ENST00000288309.6_Missense_Mutation_p.H43Q	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	43					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	CTCGGCTGATGTGTCTTGGCA	0.552																																					p.H43Q	Pancreas(48;379 1118 2936 19024 28214)												.	KCNJ6	58		0			c.C129A												173.0	162.0	166.0					21																	39087331		2018	4183	6201	SO:0001583	missense	3763	exon3			GCTGATGTGTCTT	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.129C>A	21.37:g.39087331G>T	ENSP00000477437:p.His43Gln		196	0	0		128	0.05	6	NM_002240	0		0	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	37	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	G	2.605	-0.292048	0.05568	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.87491	-2.26;-2.26	5.8	4.92	0.64577	.	0.239335	0.43110	D	0.000617	T	0.72946	0.3524	N	0.14661	0.345	0.32583	N	0.528195	B	0.02656	0.0	B	0.01281	0.0	T	0.68258	-0.5456	10	0.18710	T	0.47	.	6.9344	0.24459	0.1939:0.1347:0.6714:0.0	.	43	P48051	IRK6_HUMAN	Q	43	ENSP00000383330:H43Q;ENSP00000288309:H43Q	ENSP00000288309:H43Q	H	-	3	2	KCNJ6	38009201	1.000000	0.71417	0.997000	0.53966	0.735000	0.41995	1.651000	0.37302	1.452000	0.47756	0.655000	0.94253	CAC			0.552	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000194828.2		NM_002240	
LL22NC03-75H12.2	101927722	bcgsc.ca	37	22	47859107	47859107	+	Silent	SNP	T	T	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr22:47859107T>C	ENST00000405369.3	-	2	412	c.81A>G	c.(79-81)aaA>aaG	p.K27K	LL22NC03-75H12.2_ENST00000481625.1_5'Flank																							TTTTTGCTCCTTTTTTGGGCC	0.453																																					.													.	.			0			.																																									SO:0001819	synonymous_variant	0	.			TGCTCCTTTTTTG																												ENST00000405369.3:c.81A>G	22.37:g.47859107T>C			82	0	0		72	0.06	4	.	0		0		Silent	SNP	ENST00000405369.3	37																																																																																						0.453	LL22NC03-75H12.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000317561.3			
QARS	5859	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	49139869	49139869	+	Silent	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr3:49139869G>A	ENST00000306125.6	-	6	890	c.553C>T	c.(553-555)Ctg>Ttg	p.L185L	QARS_ENST00000414533.1_Silent_p.L174L|QARS_ENST00000420147.2_Silent_p.L203L|QARS_ENST00000470225.1_5'UTR			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	185					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	TTCTTCTCCAGATCAGCCTCC	0.567																																					p.L185L													.	.			0			c.C553T												129.0	100.0	110.0					3																	49139869		2203	4300	6503	SO:0001819	synonymous_variant	5859	exon6			TCTCCAGATCAGC	X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.553C>T	3.37:g.49139869G>A			144	0	0		91	0.11	10	NM_005051	350	0.33	115	B4DWJ2	Silent	SNP	ENST00000306125.6	37	CCDS2788.1																																																																																					0.567	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000345689.2		NM_005051	
IFRD2	7866	mdanderson.org	37	3	50329785	50329785	+	Missense_Mutation	SNP	C	C	T	rs587742335	byFrequency	TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr3:50329785C>T	ENST00000429673.2	-	1	112	c.113G>A	c.(112-114)cGc>cAc	p.R38H	IFRD2_ENST00000336089.4_Missense_Mutation_p.R140H|IFRD2_ENST00000436390.1_5'UTR|IFRD2_ENST00000417626.2_5'UTR|IFRD2_ENST00000484043.1_5'Flank			Q12894	IFRD2_HUMAN	interferon-related developmental regulator 2	38						nucleus (GO:0005634)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)	14				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CCGGCCGGTGCGCTGCGCTGA	0.756																																					p.R38H													.	.			0			c.G113A												5.0	13.0	10.0					3																	50329785		643	1524	2167	SO:0001583	missense	7866	exon1			CCGGTGCGCTGCG	U09585		3p21.3	2008-07-18			ENSG00000214706	ENSG00000214706			5457	protein-coding gene	gene with protein product	"""interferon-related protein"""	602725				9050919	Standard	NM_006764		Approved	SKMc15, SM15, IFNRP	uc011bdp.2	Q12894	OTTHUMG00000156935	ENST00000429673.2:c.113G>A	3.37:g.50329785C>T	ENSP00000398971:p.Arg38His		23	0	0		22	0.09	2	NM_006764	13	0.00	0	Q9BVB4|Q9UJ88	Missense_Mutation	SNP	ENST00000429673.2	37	CCDS46831.1	.	.	.	.	.	.	.	.	.	.	C	8.295	0.818657	0.16607	.	.	ENSG00000214706	ENST00000336089;ENST00000429673	T;T	0.58652	0.32;0.53	5.13	-6.1	0.02138	.	1.200300	0.06337	N	0.707321	T	0.28234	0.0697	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.13019	-1.0525	10	0.72032	D	0.01	-0.301	0.0115	0.00001	0.2935:0.1926:0.2176:0.2963	.	38;140	Q12894;Q9UJ88	IFRD2_HUMAN;.	H	140;38	ENSP00000336936:R140H;ENSP00000398971:R38H	ENSP00000336936:R140H	R	-	2	0	IFRD2	50304789	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.435000	0.06931	-1.770000	0.01295	-0.894000	0.02916	CGC			0.756	IFRD2-202	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_006764	
PCGF3	10336	mdanderson.org	37	4	727493	727493	+	Silent	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr4:727493G>T	ENST00000362003.5	+	4	419	c.24G>T	c.(22-24)ctG>ctT	p.L8L	PCGF3_ENST00000482726.1_3'UTR|PCGF3_ENST00000521023.2_5'UTR|PCGF3_ENST00000400151.2_Silent_p.L8L|PCGF3_ENST00000505655.2_Silent_p.L8L|PCGF3_ENST00000470161.2_Silent_p.L8L	NM_006315.4	NP_006306.2	Q3KNV8	PCGF3_HUMAN	polycomb group ring finger 3	8					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(1)	7						AGATCAAGCTGTGGGACATCA	0.542																																					p.L8L													.	.			0			c.G24T												83.0	93.0	89.0					4																	727493		2159	4240	6399	SO:0001819	synonymous_variant	10336	exon4			CAAGCTGTGGGAC	AK093869	CCDS3339.2	4p16.3	2013-01-09	2005-01-17	2005-01-19	ENSG00000185619	ENSG00000185619		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	10066	protein-coding gene	gene with protein product			"""ring finger protein 3"""	RNF3			Standard	XM_005272250		Approved	FLJ36550, DONG1, RNF3A, MGC40413	uc003gbe.3	Q3KNV8	OTTHUMG00000119000	ENST00000362003.5:c.24G>T	4.37:g.727493G>T			40	0	0		39	0.08	3	NM_006315	62	0.00	0	D3DVN1|O15262	Silent	SNP	ENST00000362003.5	37	CCDS3339.2																																																																																					0.542	PCGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239197.2		NM_006315	
FGFRL1	53834	mdanderson.org	37	4	1016154	1016154	+	Silent	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr4:1016154G>A	ENST00000398484.2	+	4	823	c.243G>A	c.(241-243)ccG>ccA	p.P81P	FGFRL1_ENST00000510644.1_Silent_p.P81P|FGFRL1_ENST00000504138.1_Silent_p.P81P|FGFRL1_ENST00000264748.6_Silent_p.P81P			Q8N441	FGRL1_HUMAN	fibroblast growth factor receptor-like 1	81	Ig-like C2-type 1.				diaphragm development (GO:0060539)|heart valve morphogenesis (GO:0003179)|negative regulation of cell proliferation (GO:0008285)|skeletal system development (GO:0001501)|ventricular septum morphogenesis (GO:0060412)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	13			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GCGTGCTGCCGCAGGGGCTGA	0.687																																					p.P81P													.	.			0			c.G243A												36.0	33.0	34.0					4																	1016154		2194	4294	6488	SO:0001819	synonymous_variant	53834	exon3			GCTGCCGCAGGGG		CCDS3344.1	4p16	2013-01-11			ENSG00000127418	ENSG00000127418		"""Immunoglobulin superfamily / I-set domain containing"""	3693	protein-coding gene	gene with protein product		605830					Standard	NM_021923		Approved		uc003gcg.3	Q8N441	OTTHUMG00000118998	ENST00000398484.2:c.243G>A	4.37:g.1016154G>A			39	0	0		34	0.09	3	NM_001004356	20	0.00	0	B2RAU9|Q6PJN1|Q9BXN7|Q9H4D7	Silent	SNP	ENST00000398484.2	37	CCDS3344.1																																																																																					0.687	FGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000239195.2		NM_021923	
CLCN3	1182	broad.mit.edu	37	4	170618538	170618538	+	Missense_Mutation	SNP	T	T	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr4:170618538T>C	ENST00000513761.1	+	9	1775	c.1216T>C	c.(1216-1218)Ttt>Ctt	p.F406L	CLCN3_ENST00000504131.2_Missense_Mutation_p.F389L|CLCN3_ENST00000360642.3_Missense_Mutation_p.F379L|CLCN3_ENST00000347613.4_Missense_Mutation_p.F406L	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	406					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		TTGGGGAGCCTTTTTCATTAG	0.438																																					p.F406L													.	CLCN3	85		0			c.T1216C												145.0	144.0	144.0					4																	170618538		2203	4300	6503	SO:0001583	missense	0	exon9			GGAGCCTTTTTCA	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1216T>C	4.37:g.170618538T>C	ENSP00000424603:p.Phe406Leu		203	0.0098522167	2		170	0.02	4	NM_001829	9	0.00	0	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	37	CCDS34101.1	.	.	.	.	.	.	.	.	.	.	T	8.503	0.864743	0.17250	.	.	ENSG00000109572	ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	D;D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08;-3.08	5.84	5.84	0.93424	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	T	0.79592	0.4472	N	0.02315	-0.6	0.80722	D	1	B;B;B;B;B	0.06786	0.001;0.001;0.001;0.001;0.0	B;B;B;B;B	0.15484	0.009;0.009;0.009;0.013;0.005	T	0.76302	-0.3009	10	0.06494	T	0.89	-11.1807	16.2123	0.82170	0.0:0.0:0.0:1.0	.	379;389;379;406;406	B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.;.;.;CLCN3_HUMAN;.	L	406;406;379;389;379	ENSP00000424603:F406L;ENSP00000261514:F406L;ENSP00000353857:F379L;ENSP00000424540:F389L;ENSP00000425323:F379L	ENSP00000261514:F406L	F	+	1	0	CLCN3	170855113	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.182000	0.58310	2.231000	0.72958	0.455000	0.32223	TTT			0.438	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000363210.2			
CTNND2	1501	mdanderson.org	37	5	11385032	11385032	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr5:11385032C>T	ENST00000304623.8	-	7	1111	c.922G>A	c.(922-924)Gcc>Acc	p.A308T	CTNND2_ENST00000495388.2_5'Flank|CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000359640.2_Missense_Mutation_p.A308T|CTNND2_ENST00000511377.1_Missense_Mutation_p.A217T|CTNND2_ENST00000458100.2_Intron	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	308					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TAGGACTTGGCCAGGCGGCTG	0.736																																					p.A308T													.	.			0			c.G922A												49.0	56.0	54.0					5																	11385032		2195	4296	6491	SO:0001583	missense	1501	exon7			ACTTGGCCAGGCG	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.922G>A	5.37:g.11385032C>T	ENSP00000307134:p.Ala308Thr		15	0	0		27	0.11	3	NM_001332	0		0	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	37	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354936	0.82243	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377	T;T;T	0.79454	-1.21;-1.27;-1.17	3.61	3.61	0.41365	.	0.191852	0.31859	U	0.006951	T	0.79862	0.4519	L	0.40543	1.245	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	T	0.75007	-0.3469	10	0.06099	T	0.92	-8.0892	14.8296	0.70137	0.0:1.0:0.0:0.0	.	308	Q9UQB3	CTND2_HUMAN	T	308;308;217	ENSP00000307134:A308T;ENSP00000352661:A308T;ENSP00000426510:A217T	ENSP00000307134:A308T	A	-	1	0	CTNND2	11438032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.854000	0.55949	1.526000	0.49068	0.462000	0.41574	GCC			0.736	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206999.1		NM_001332	
FEM1C	56929	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	5	114860823	114860823	+	Missense_Mutation	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr5:114860823C>T	ENST00000274457.3	-	3	1597	c.1036G>A	c.(1036-1038)Gct>Act	p.A346T		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	346					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		GCATAGACAGCGCCTCTATAT	0.413																																					p.A346T													FEM1C,NS,carcinoma,0,1	FEM1C	0	1	0			c.G1036A												101.0	102.0	102.0					5																	114860823		2202	4300	6502	SO:0001583	missense	56929	exon3			AGACAGCGCCTCT		CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.1036G>A	5.37:g.114860823C>T	ENSP00000274457:p.Ala346Thr		72	0	0		54	0.07	4	NM_020177	8	0.00	0	B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	ENST00000274457.3	37	CCDS4118.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434245	0.83776	.	.	ENSG00000145780	ENST00000274457	T	0.74947	-0.89	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.89701	0.6791	M	0.91717	3.235	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91539	0.5248	10	0.87932	D	0	-18.9153	19.502	0.95098	0.0:1.0:0.0:0.0	.	346	Q96JP0	FEM1C_HUMAN	T	346	ENSP00000274457:A346T	ENSP00000274457:A346T	A	-	1	0	FEM1C	114888722	1.000000	0.71417	0.976000	0.42696	0.985000	0.73830	7.772000	0.85439	2.602000	0.87976	0.655000	0.94253	GCT			0.413	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250857.3		NM_020177	
EBF1	1879	mdanderson.org	37	5	158135162	158135162	+	Silent	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr5:158135162G>T	ENST00000313708.6	-	15	1851	c.1569C>A	c.(1567-1569)acC>acA	p.T523T	EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Silent_p.T492T|EBF1_ENST00000517373.1_Silent_p.T455T	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	523	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGAGGCCATGGTGGGGCTGG	0.557			T	HMGA2	lipoma																																p.T523T				Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	.			0			c.C1569A												59.0	57.0	58.0					5																	158135162		2200	4297	6497	SO:0001819	synonymous_variant	1879	exon15			GGCCATGGTGGGG	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1569C>A	5.37:g.158135162G>T			66	0	0		48	0.06	3	NM_024007	3	0.00	0	Q8IW11	Silent	SNP	ENST00000313708.6	37	CCDS4343.1																																																																																					0.557	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000252649.1		NM_024007	
TXNDC5	81567	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	7883446	7883446	+	Silent	SNP	C	C	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr6:7883446C>T	ENST00000379757.4	-	10	1267	c.1230G>A	c.(1228-1230)gaG>gaA	p.E410E	BLOC1S5-TXNDC5_ENST00000439343.2_3'UTR|TXNDC5_ENST00000473453.1_Silent_p.E302E|TXNDC5_ENST00000539054.1_Silent_p.E338E	NM_030810.3	NP_110437.2	Q8NBS9	TXND5_HUMAN	thioredoxin domain containing 5 (endoplasmic reticulum)	410	Thioredoxin 3. {ECO:0000255|PROSITE- ProRule:PRU00691}.				apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	protein disulfide isomerase activity (GO:0003756)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|skin(2)	22	Ovarian(93;0.0398)					CTCCACTGTGCTCACTGACTT	0.493																																					p.E410E	Ovarian(119;1430 1625 3928 26125 34589)												.	.			0			c.G1230A												164.0	127.0	140.0					6																	7883446		2203	4300	6503	SO:0001819	synonymous_variant	81567	exon10			ACTGTGCTCACTG	AK025006	CCDS4505.1, CCDS47369.1	6p24.3	2011-10-19	2009-02-23		ENSG00000239264	ENSG00000239264		"""Protein disulfide isomerases"""	21073	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 15"""		"""thioredoxin domain containing 5"""				Standard	NM_001145549		Approved	MGC3178, FLJ21353, FLJ90810, EndoPDI, Hcc-2, ERp46, PDIA15	uc003mxv.3	Q8NBS9	OTTHUMG00000014216	ENST00000379757.4:c.1230G>A	6.37:g.7883446C>T			81	0	0		98	0.05	5	NM_030810	639	0.02	14	B2RDM2|Q5TCQ0|Q8ND33|Q8TCT2|Q9BVH9	Silent	SNP	ENST00000379757.4	37	CCDS4505.1																																																																																					0.493	TXNDC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039792.1		NM_030810	
ID4	3400	mdanderson.org	37	6	19838202	19838202	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr6:19838202A>G	ENST00000378700.3	+	1	586	c.217A>G	c.(217-219)Agc>Ggc	p.S73G	RP1-167F1.2_ENST00000432171.2_RNA	NM_001546.3	NP_001537.1	P47928	ID4_HUMAN	inhibitor of DNA binding 4, dominant negative helix-loop-helix protein	73	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex neuron differentiation (GO:0021895)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|hippocampus development (GO:0021766)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast proliferation (GO:0007405)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			lung(1)	1	Ovarian(93;0.0355)|Breast(50;0.0654)|all_epithelial(95;0.12)		OV - Ovarian serous cystadenocarcinoma(7;0.00659)|all cancers(50;0.0327)|Epithelial(50;0.0621)			CGACTGCTATAGCCGCCTGCG	0.672																																					p.S73G	Esophageal Squamous(13;105 518 19978 28644 46870)												.	.			0			c.A217G												33.0	34.0	34.0					6																	19838202		2201	4298	6499	SO:0001583	missense	3400	exon1			TGCTATAGCCGCC	U16153	CCDS4544.1	6p22.3	2013-05-21			ENSG00000172201	ENSG00000172201		"""Basic helix-loop-helix proteins"""	5363	protein-coding gene	gene with protein product		600581				7665172	Standard	NM_001546		Approved	bHLHb27	uc003ncw.4	P47928	OTTHUMG00000014333	ENST00000378700.3:c.217A>G	6.37:g.19838202A>G	ENSP00000367972:p.Ser73Gly		67	0	0		61	0.05	3	NM_001546	33	0.00	0	Q13005	Missense_Mutation	SNP	ENST00000378700.3	37	CCDS4544.1	.	.	.	.	.	.	.	.	.	.	A	15.31	2.794268	0.50102	.	.	ENSG00000172201	ENST00000378700	D	0.98028	-4.67	2.88	1.68	0.24146	Helix-loop-helix DNA-binding (5);	0.213259	0.47093	D	0.000252	D	0.93135	0.7814	M	0.76170	2.325	0.54753	D	0.999982	B	0.14438	0.01	B	0.15484	0.013	D	0.88693	0.3210	9	.	.	.	-7.7635	7.5885	0.28006	0.8896:0.0:0.1104:0.0	.	73	P47928	ID4_HUMAN	G	73	ENSP00000367972:S73G	.	S	+	1	0	ID4	19946181	1.000000	0.71417	0.787000	0.31911	0.273000	0.26683	2.166000	0.42406	0.333000	0.23563	0.254000	0.18369	AGC			0.672	ID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039979.1		NM_001546	
MDN1	23195	mdanderson.org	37	6	90529232	90529232	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr6:90529232G>T	ENST00000369393.3	-	1	210	c.95C>A	c.(94-96)gCc>gAc	p.A32D	MDN1_ENST00000428876.1_Missense_Mutation_p.A32D			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	32					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TACCTGCTTGGCCAAGAACCT	0.612																																					p.A32D													.	.			0			c.C95A												179.0	177.0	178.0					6																	90529232		2203	4300	6503	SO:0001583	missense	23195	exon1			TGCTTGGCCAAGA	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.95C>A	6.37:g.90529232G>T	ENSP00000358400:p.Ala32Asp		73	0	0		56	0.05	3	NM_014611	1	0.00	0	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	37	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	G	13.33	2.205235	0.39003	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.17691	4.01;4.01;2.26	4.74	1.86	0.25419	.	0.559520	0.18371	N	0.143271	T	0.03477	0.0100	L	0.36672	1.1	0.30306	N	0.788952	B;B	0.33583	0.418;0.04	B;B	0.32393	0.145;0.015	T	0.43310	-0.9399	10	0.22109	T	0.4	.	5.0018	0.14268	0.1921:0.3295:0.4784:0.0	.	32;32	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	D	32	ENSP00000358400:A32D;ENSP00000413970:A32D;ENSP00000409664:A32D	ENSP00000358400:A32D	A	-	2	0	MDN1	90585953	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	1.855000	0.39378	0.268000	0.21939	0.561000	0.74099	GCC			0.612	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041514.2			
SYNE1	23345	broad.mit.edu;mdanderson.org	37	6	152469314	152469314	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr6:152469314A>G	ENST00000367255.5	-	137	25443	c.24842T>C	c.(24841-24843)aTc>aCc	p.I8281T	SYNE1_ENST00000347037.5_5'UTR|SYNE1_ENST00000265368.4_Missense_Mutation_p.I8281T|SYNE1_ENST00000354674.4_Missense_Mutation_p.I436T|SYNE1_ENST00000448038.1_Missense_Mutation_p.I8210T|SYNE1_ENST00000539504.1_Missense_Mutation_p.I436T|SYNE1_ENST00000423061.1_Missense_Mutation_p.I8210T|SYNE1_ENST00000356820.4_Missense_Mutation_p.I2805T|SYNE1_ENST00000341594.5_Missense_Mutation_p.I7893T	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	8281					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCAGGGGGATGGAGTCCAC	0.597										HNSCC(10;0.0054)																											p.I8281T													.	SYNE1	3227		0			c.T24842C												62.0	60.0	61.0					6																	152469314		2203	4300	6503	SO:0001583	missense	23345	exon137			AGGGGGATGGAGT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.24842T>C	6.37:g.152469314A>G	ENSP00000356224:p.Ile8281Thr		94	0	0		85	0.05	4	NM_182961	23	0.00	0	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	37	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	25.6	4.658455	0.88154	.	.	ENSG00000131018	ENST00000367255;ENST00000539504;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000313630;ENST00000367247;ENST00000367251;ENST00000354674	T;T;T;T;T;T;T;T;T;T	0.68025	-0.16;3.91;0.91;-0.3;-0.25;-0.29;0.06;1.88;0.84;3.88	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000033	T	0.81522	0.4840	M	0.88979	2.995	0.54753	D	0.999989	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.999;0.999;0.999;0.99	D	0.85873	0.1417	10	0.87932	D	0	.	15.1586	0.72764	1.0:0.0:0.0:0.0	.	8281;8281;8210;8210;483	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9;B7Z9Y6	SYNE1_HUMAN;.;.;.;.	T	8281;436;927;8210;8281;8210;7893;2805;443;438;1203;436	ENSP00000356224:I8281T;ENSP00000441052:I436T;ENSP00000356226:I927T;ENSP00000396024:I8210T;ENSP00000265368:I8281T;ENSP00000390975:I8210T;ENSP00000341887:I7893T;ENSP00000349276:I2805T;ENSP00000356220:I1203T;ENSP00000346701:I436T	ENSP00000265368:I8281T	I	-	2	0	SYNE1	152511007	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.937000	0.92936	1.999000	0.58509	0.460000	0.39030	ATC			0.597	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000334755.2		NM_182961	
SLC22A1	6580	mdanderson.org	37	6	160564645	160564645	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr6:160564645G>T	ENST00000366963.4	+	8	1496	c.1349G>T	c.(1348-1350)tGc>tTc	p.C450F	SLC22A1_ENST00000324965.4_Missense_Mutation_p.C450F|SLC22A1_ENST00000457470.2_Missense_Mutation_p.C450F	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	450		Involved in affinity and selectivity of cations as well as in translocation. {ECO:0000250}.			dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CAAATGATCTGCCTGGTGAAT	0.498																																					p.C450F													.	.			0			c.G1349T												221.0	169.0	187.0					6																	160564645		2203	4300	6503	SO:0001583	missense	6580	exon8			TGATCTGCCTGGT	U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1349G>T	6.37:g.160564645G>T	ENSP00000355930:p.Cys450Phe		75	0	0		45	0.07	3	NM_153187	2	0.00	0	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	ENST00000366963.4	37	CCDS5274.1	.	.	.	.	.	.	.	.	.	.	G	11.00	1.509805	0.27036	.	.	ENSG00000175003	ENST00000366963;ENST00000324965;ENST00000457470	T;T;T	0.73258	-0.73;0.47;0.47	5.64	4.78	0.61160	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.133795	0.52532	D	0.000080	T	0.65842	0.2730	L	0.42686	1.345	0.80722	D	1	D;B	0.62365	0.991;0.1	D;B	0.65684	0.937;0.098	T	0.64774	-0.6328	10	0.12430	T	0.62	.	14.1241	0.65208	0.0715:0.0:0.9285:0.0	.	450;450	O15245-2;O15245	.;S22A1_HUMAN	F	450	ENSP00000355930:C450F;ENSP00000318103:C450F;ENSP00000409557:C450F	ENSP00000318103:C450F	C	+	2	0	SLC22A1	160484635	1.000000	0.71417	0.976000	0.42696	0.405000	0.30901	5.373000	0.66162	1.386000	0.46466	0.650000	0.86243	TGC			0.498	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042938.2			
ZNF425	155054	broad.mit.edu;mdanderson.org	37	7	148801463	148801463	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr7:148801463G>T	ENST00000378061.2	-	4	1632	c.1500C>A	c.(1498-1500)tgC>tgA	p.C500*		NM_001001661.2	NP_001001661.1	Q6IV72	ZN425_HUMAN	zinc finger protein 425	500					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	50	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			TGCACTCGCCGCAGGGAAACT	0.632																																					p.C500X													.	ZNF425	99		0			c.C1500A												52.0	42.0	45.0					7																	148801463		2200	4297	6497	SO:0001587	stop_gained	155054	exon4			CTCGCCGCAGGGA	AK056498	CCDS34773.1	7q36.1	2013-01-08			ENSG00000204947	ENSG00000204947		"""Zinc fingers, C2H2-type"", ""-"""	20690	protein-coding gene	gene with protein product							Standard	NM_001001661		Approved		uc003wfj.3	Q6IV72	OTTHUMG00000158971	ENST00000378061.2:c.1500C>A	7.37:g.148801463G>T	ENSP00000367300:p.Cys500*		47	0	0		34	0.09	3	NM_001001661	1	0.00	0	B3KPM1|Q08AG3	Nonsense_Mutation	SNP	ENST00000378061.2	37	CCDS34773.1	.	.	.	.	.	.	.	.	.	.	G	18.47	3.631327	0.67015	.	.	ENSG00000204947	ENST00000378061	.	.	.	2.74	-3.93	0.04143	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.5738	0.39445	0.3804:0.0:0.6196:0.0	.	.	.	.	X	500	.	ENSP00000367300:C500X	C	-	3	2	ZNF425	148432396	0.005000	0.15991	0.000000	0.03702	0.002000	0.02628	0.178000	0.16820	-0.923000	0.03785	-1.021000	0.02439	TGC			0.632	ZNF425-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000352726.1		XM_088140	
AZIN1	51582	ucsc.edu	37	8	103841637	103841637	+	Silent	SNP	T	T	C			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		RNA-Seq	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr8:103841637T>C	ENST00000337198.5	-	11	2261	c.1098A>G	c.(1096-1098)gaA>gaG	p.E366E	AZIN1_ENST00000347770.4_Silent_p.E366E	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	366					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			GAAGACAGCTTTCCACAATTT	0.398																																					p.E366E													.	AZIN1	26		0			c.A1098G												174.0	183.0	180.0					8																	103841637		2203	4300	6503	SO:0001819	synonymous_variant	51582	exon12			ACAGCTTTCCACA	AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.1098A>G	8.37:g.103841637T>C			165	0	0		135	0.01	1	NM_015878	407	0.15	63	A6NCD5|Q6IBQ7|Q96D20	Silent	SNP	ENST00000337198.5	37	CCDS6295.1																																																																																					0.398	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000380133.1			
PSCA	8000	mdanderson.org	37	8	143763491	143763491	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr8:143763491G>A	ENST00000301258.4	+	3	369	c.286G>A	c.(286-288)Gcc>Acc	p.A96T		NM_005672.4	NP_005663.2	O43653	PSCA_HUMAN	prostate stem cell antigen	105						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)	2	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCCGGCTGCTGCCATCCTTGC	0.667																																					p.A96T													.	.			0			c.G286A												31.0	35.0	34.0					8																	143763491		2159	4269	6428	SO:0001583	missense	8000	exon3			GCTGCTGCCATCC	AF043498	CCDS47925.1, CCDS47925.2	8q24.2	2004-02-03				ENSG00000167653			9500	protein-coding gene	gene with protein product		602470				9465086	Standard	NM_005672		Approved		uc022bcd.1	O43653		ENST00000301258.4:c.286G>A	8.37:g.143763491G>A	ENSP00000301258:p.Ala96Thr		32	0	0		22	0.14	3	NM_005672	0		0	Q6UW92	Missense_Mutation	SNP	ENST00000301258.4	37	CCDS47925.2	.	.	.	.	.	.	.	.	.	.	G	4.308	0.056379	0.08291	.	.	ENSG00000167653	ENST00000301258	.	.	.	3.11	-0.659	0.11424	Ly-6 antigen / uPA receptor -like (1);	1.873280	0.02542	N	0.094687	T	0.18882	0.0453	N	0.08118	0	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.13308	-1.0514	9	0.20519	T	0.43	.	5.885	0.18876	0.6004:0.0:0.3996:0.0	.	105	O43653	PSCA_HUMAN	T	105	.	ENSP00000301258:A105T	A	+	1	0	PSCA	143760493	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.629000	0.24538	-0.126000	0.11682	-0.471000	0.05019	GCC			0.667	PSCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000367112.2		NM_005672	
PLEC	5339	mdanderson.org	37	8	145007483	145007483	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr8:145007483G>A	ENST00000322810.4	-	13	1880	c.1711C>T	c.(1711-1713)Cgg>Tgg	p.R571W	PLEC_ENST00000398774.2_Missense_Mutation_p.R402W|PLEC_ENST00000354958.2_Missense_Mutation_p.R412W|PLEC_ENST00000357649.2_Missense_Mutation_p.R438W|PLEC_ENST00000354589.3_Missense_Mutation_p.R434W|PLEC_ENST00000527096.1_Missense_Mutation_p.R457W|PLEC_ENST00000345136.3_Missense_Mutation_p.R434W|PLEC_ENST00000356346.3_Missense_Mutation_p.R420W|PLEC_ENST00000436759.2_Missense_Mutation_p.R461W	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	571	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCCCCCGCCCGCTGTGGCACT	0.652																																					p.R571W													.	.			0			c.C1711T												60.0	69.0	66.0					8																	145007483		2104	4214	6318	SO:0001583	missense	5339	exon13			CCGCCCGCTGTGG	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.1711C>T	8.37:g.145007483G>A	ENSP00000323856:p.Arg571Trp		42	0	0		35	0.09	3	NM_201380	27	0.00	0	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	37	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	G	8.360	0.832963	0.16820	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096;ENST00000528025	D;D;D;D;D;D;D;D;D;D	0.92699	-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09;-3.09	5.33	4.44	0.53790	.	0.096626	0.43747	U	0.000540	D	0.89413	0.6708	L	0.29908	0.895	0.41954	D	0.990677	D;D;D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.998;0.998;0.998;0.999;0.999	P;P;P;B;P;P;P;P	0.50490	0.642;0.642;0.642;0.439;0.642;0.642;0.642;0.642	D	0.89120	0.3502	10	0.51188	T	0.08	.	11.6398	0.51227	0.0:0.0:0.5576:0.4424	.	461;420;412;571;402;434;438;434	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	W	434;438;434;402;571;412;420;461;457;478	ENSP00000344848:R434W;ENSP00000350277:R438W;ENSP00000346602:R434W;ENSP00000381756:R402W;ENSP00000323856:R571W;ENSP00000347044:R412W;ENSP00000348702:R420W;ENSP00000388180:R461W;ENSP00000434583:R457W;ENSP00000437303:R478W	ENSP00000323856:R571W	R	-	1	2	PLEC	145079471	0.250000	0.23951	0.999000	0.59377	0.038000	0.13279	0.640000	0.24705	1.226000	0.43582	0.643000	0.83706	CGG			0.652	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000383281.1		NM_000445	
NOTCH1	4851	mdanderson.org	37	9	139407986	139407986	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr9:139407986G>T	ENST00000277541.6	-	14	2286	c.2211C>A	c.(2209-2211)taC>taA	p.Y737*		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	737	EGF-like 19; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGTCGCACTTGTACCTGCAAG	0.622			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.Y737X				Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	.			0			c.C2211A												82.0	88.0	86.0					9																	139407986		2157	4249	6406	SO:0001587	stop_gained	4851	exon14			GCACTTGTACCTG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.2211C>A	9.37:g.139407986G>T	ENSP00000277541:p.Tyr737*		51	0	0		38	0.08	3	NM_017617	15	0.00	0	Q59ED8|Q5SXM3	Nonsense_Mutation	SNP	ENST00000277541.6	37	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	37	6.359150	0.97502	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3474	0.83146	0.0:0.0:1.0:0.0	.	.	.	.	X	737	.	ENSP00000277541:Y737X	Y	-	3	2	NOTCH1	138527807	1.000000	0.71417	0.940000	0.37924	0.340000	0.28889	3.003000	0.49505	2.095000	0.63458	0.455000	0.32223	TAC			0.622	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055087.1		NM_017617	
ABCA2	20	mdanderson.org	37	9	139907513	139907513	+	Missense_Mutation	SNP	G	G	A	rs527601972		TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chr9:139907513G>A	ENST00000371605.3	-	29	4952	c.4805C>T	c.(4804-4806)gCg>gTg	p.A1602V	ABCA2_ENST00000265662.5_Missense_Mutation_p.A1603V|ABCA2_ENST00000341511.6_Missense_Mutation_p.A1603V			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1602					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ATCCGGGGACGCTGGCGAGTC	0.677													G|||	1	0.000199681	0.0	0.0	5008	,	,		10543	0.0		0.001	False		,,,				2504	0.0				p.A1633V													.	.			0			c.C4898T												8.0	12.0	10.0					9																	139907513		1919	4075	5994	SO:0001583	missense	20	exon30			GGGGACGCTGGCG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4805C>T	9.37:g.139907513G>A	ENSP00000360666:p.Ala1602Val		23	0	0		20	0.10	2	NM_212533	8	0.00	0	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	37		.	.	.	.	.	.	.	.	.	.	G	0.184	-1.059249	0.01950	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511;ENST00000477420	D;D;D	0.86769	-2.17;-2.17;-2.17	4.68	1.07	0.20283	.	1.273390	0.07279	U	0.870374	T	0.63343	0.2503	N	0.00841	-1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.53187	-0.8474	10	0.13470	T	0.59	.	7.4655	0.27320	0.6219:0.0:0.3781:0.0	.	1602;1633	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	V	1603;1602;1633;1603;29	ENSP00000265662:A1603V;ENSP00000360666:A1602V;ENSP00000344155:A1603V	ENSP00000265662:A1603V	A	-	2	0	ABCA2	139027334	0.034000	0.19679	0.002000	0.10522	0.004000	0.04260	0.958000	0.29227	0.187000	0.20147	-0.339000	0.08088	GCG			0.677	ABCA2-202	KNOWN	basic	protein_coding	protein_coding				NM_001606	
CXorf38	159013	mdanderson.org	37	X	40489933	40489933	+	Missense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:40489933G>T	ENST00000327877.5	-	6	920	c.894C>A	c.(892-894)agC>agA	p.S298R	CXorf38_ENST00000378426.1_Missense_Mutation_p.S179R|CXorf38_ENST00000440784.2_Missense_Mutation_p.S213R|CXorf38_ENST00000378421.1_Missense_Mutation_p.S179R	NM_144970.2	NP_659407.1	Q8TB03	CX038_HUMAN	chromosome X open reading frame 38	298										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	12						GTAGACAGAGGCTGTCTAGCT	0.453																																					p.S298R													.	.			0			c.C894A												201.0	147.0	165.0					X																	40489933		2203	4300	6503	SO:0001583	missense	159013	exon6			ACAGAGGCTGTCT	AL832829	CCDS14253.1	Xp11	2008-02-05			ENSG00000185753	ENSG00000185753			28589	protein-coding gene	gene with protein product							Standard	NM_144970		Approved	MGC39350	uc004dew.3	Q8TB03	OTTHUMG00000024104	ENST00000327877.5:c.894C>A	X.37:g.40489933G>T	ENSP00000330488:p.Ser298Arg		63	0	0		48	0.06	3	NM_144970	44	0.00	0	B3KW28|D3DWB5|Q5JPF5|Q8N941	Missense_Mutation	SNP	ENST00000327877.5	37	CCDS14253.1	.	.	.	.	.	.	.	.	.	.	g	14.06	2.422369	0.43020	.	.	ENSG00000185753	ENST00000378426;ENST00000327877;ENST00000378421;ENST00000440784	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.65	3.87	0.44632	.	0.482880	0.22879	N	0.054537	T	0.32041	0.0816	L	0.51422	1.61	0.09310	N	1	B;B	0.27882	0.192;0.077	B;B	0.23018	0.043;0.025	T	0.24835	-1.0149	10	0.46703	T	0.11	-15.7117	5.1633	0.15073	0.181:0.0:0.6553:0.1638	.	213;298	E7EN46;Q8TB03	.;CX038_HUMAN	R	179;298;179;213	ENSP00000367683:S179R;ENSP00000330488:S298R;ENSP00000367677:S179R;ENSP00000400019:S213R	ENSP00000330488:S298R	S	-	3	2	CXorf38	40374877	0.224000	0.23674	0.812000	0.32479	0.737000	0.42083	0.306000	0.19279	1.165000	0.42670	0.597000	0.82753	AGC			0.453	CXorf38-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060685.3		NM_144970	
NANOGP10	349372	bcgsc.ca	37	X	43267493	43267494	+	IGR	DNP	TG	TG	CT			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	TG	TG					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:43267493_43267494TG>CT								RP3-326I13.1 (181646 upstream) : MAOA (247972 downstream)																							TACACACAGCTGGGTGGAACGG	0.45																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			CACAGCTGGGTGG																													X.37:g.43267493_43267494delinsCT			18	0	0		17	0.24	4	.	0		0		RNA	DNP		37																																																																																					0	0.450										
OGT	8473	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	70793562	70793562	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:70793562A>G	ENST00000373719.3	+	22	3276	c.3059A>G	c.(3058-3060)tAt>tGt	p.Y1020C	OGT_ENST00000373701.3_Missense_Mutation_p.Y1010C	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase	1020					apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					GAGCGGCTCTATCTACAGATG	0.448																																					p.Y1020C													.	.			0			c.A3059G												114.0	90.0	98.0					X																	70793562		2203	4300	6503	SO:0001583	missense	8473	exon22			GGCTCTATCTACA	U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.3059A>G	X.37:g.70793562A>G	ENSP00000362824:p.Tyr1020Cys		85	0	0		69	0.19	13	NM_181672	351	0.28	100	Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Missense_Mutation	SNP	ENST00000373719.3	37	CCDS14414.1	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117186	0.56505	.	.	ENSG00000147162	ENST00000373719;ENST00000373701	T;T	0.79554	-1.28;-1.28	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	M	0.91663	3.23	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.75484	0.914;0.951;0.986	D	0.93052	0.6466	10	0.87932	D	0	0.1206	13.7944	0.63162	1.0:0.0:0.0:0.0	.	894;1010;1020	Q548W1;O15294-3;O15294	.;.;OGT1_HUMAN	C	1020;1010	ENSP00000362824:Y1020C;ENSP00000362805:Y1010C	ENSP00000362805:Y1010C	Y	+	2	0	OGT	70710287	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	8.999000	0.93557	1.900000	0.55004	0.486000	0.48141	TAT			0.448	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000081829.3		NM_003605, NM_181672	
GPRASP2	114928	hgsc.bcm.edu;broad.mit.edu;mdanderson.org	37	X	101971349	101971349	+	Nonsense_Mutation	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:101971349G>T	ENST00000535209.1	+	4	2383	c.1552G>T	c.(1552-1554)Gaa>Taa	p.E518*	GPRASP2_ENST00000332262.5_Nonsense_Mutation_p.E518*|GPRASP2_ENST00000543253.1_Nonsense_Mutation_p.E518*			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	518						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGGAATTCCCGAAGAGGCTTC	0.517																																					p.E518X													.	.			0			c.G1552T												63.0	62.0	63.0					X																	101971349		2203	4299	6502	SO:0001587	stop_gained	114928	exon4			ATTCCCGAAGAGG	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1552G>T	X.37:g.101971349G>T	ENSP00000437394:p.Glu518*		105	0	0		88	0.05	4	NM_138437	16	0.00	0	D3DXA0|Q8NAB4	Nonsense_Mutation	SNP	ENST00000535209.1	37	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	G	37	6.274068	0.97431	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	.	.	.	4.23	3.37	0.38596	.	0.487167	0.17632	N	0.167358	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	7.0736	0.25191	0.1227:0.0:0.8773:0.0	.	.	.	.	X	518	.	ENSP00000339057:E518X	E	+	1	0	GPRASP2	101858005	0.996000	0.38824	0.304000	0.25085	0.002000	0.02628	1.847000	0.39299	1.149000	0.42402	-0.191000	0.12829	GAA			0.517	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057626.2		NM_138437	
SLC25A5	292	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	118602491	118602491	+	Missense_Mutation	SNP	G	G	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:118602491G>A	ENST00000317881.8	+	1	129	c.13G>A	c.(13-15)Gct>Act	p.A5T	SLC25A5-AS1_ENST00000446986.1_RNA	NM_001152.4	NP_001143.2	P05141	ADT2_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5	5					adenine transport (GO:0015853)|chromosome segregation (GO:0007059)|energy reserve metabolic process (GO:0006112)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|MMXD complex (GO:0071817)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(2)	12					Clodronate(DB00720)	GACAGATGCCGCTGTGTCCTT	0.647																																					p.A5T													.	.			0			c.G13A												23.0	21.0	22.0					X																	118602491		2201	4300	6501	SO:0001583	missense	292	exon1			GATGCCGCTGTGT	BC068199	CCDS14578.1	Xq24	2013-08-09			ENSG00000005022	ENSG00000005022		"""Solute carriers"""	10991	protein-coding gene	gene with protein product		300150		ANT2		2168878, 2829183	Standard	NM_001152		Approved	T2, 2F1, T3	uc004erh.4	P05141	OTTHUMG00000022715	ENST00000317881.8:c.13G>A	X.37:g.118602491G>A	ENSP00000360671:p.Ala5Thr		176	0	0		168	0.15	26	NM_001152	559	0.39	220	B2RCV1|O43350	Missense_Mutation	SNP	ENST00000317881.8	37	CCDS14578.1	.	.	.	.	.	.	.	.	.	.	G	14.68	2.608118	0.46527	.	.	ENSG00000005022	ENST00000317881	T	0.78364	-1.17	3.15	2.29	0.28610	Mitochondrial carrier domain (1);	0.121726	0.53938	N	0.000042	T	0.65575	0.2704	L	0.37697	1.125	0.58432	D	0.999995	B	0.06786	0.001	B	0.08055	0.003	T	0.59595	-0.7425	10	0.41790	T	0.15	.	9.3982	0.38415	0.1139:0.0:0.8861:0.0	.	5	P05141	ADT2_HUMAN	T	5	ENSP00000360671:A5T	ENSP00000360671:A5T	A	+	1	0	SLC25A5	118486519	1.000000	0.71417	0.998000	0.56505	0.680000	0.39746	3.707000	0.54838	0.725000	0.32318	0.538000	0.68166	GCT			0.647	SLC25A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058952.2		NM_001152	
GLUD2	2747	mdanderson.org	37	X	120182071	120182071	+	Missense_Mutation	SNP	C	C	A			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:120182071C>A	ENST00000328078.1	+	1	610	c.533C>A	c.(532-534)cCg>cAg	p.P178Q		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	178					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						GTTGATGTGCCGTTTGGGGGT	0.453																																					p.P178Q													.	.			0			c.C533A												118.0	91.0	100.0					X																	120182071		2203	4300	6503	SO:0001583	missense	2747	exon1			ATGTGCCGTTTGG	U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.533C>A	X.37:g.120182071C>A	ENSP00000327589:p.Pro178Gln		46	0	0		55	0.05	3	NM_012084	89	0.00	0	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	ENST00000328078.1	37	CCDS14603.1	.	.	.	.	.	.	.	.	.	.	C	7.579	0.668349	0.14776	.	.	ENSG00000182890	ENST00000328078	D	0.97620	-4.46	1.62	0.69	0.18039	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.000000	0.85682	D	0.000000	D	0.98563	0.9520	H	0.97315	3.98	0.53688	D	0.999978	D	0.89917	1.0	D	0.91635	0.999	D	0.96424	0.9314	10	0.87932	D	0	.	4.7803	0.13199	0.3626:0.6374:0.0:0.0	.	178	P49448	DHE4_HUMAN	Q	178	ENSP00000327589:P178Q	ENSP00000327589:P178Q	P	+	2	0	GLUD2	120009752	0.986000	0.35501	0.370000	0.25965	0.080000	0.17528	1.818000	0.39012	0.175000	0.19841	0.472000	0.43445	CCG			0.453	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058133.1		NM_012084	
THOC2	57187	mdanderson.org	37	X	122747911	122747911	+	Silent	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:122747911G>T	ENST00000245838.8	-	34	4472	c.4441C>A	c.(4441-4443)Cgg>Agg	p.R1481R	THOC2_ENST00000355725.4_Silent_p.R1481R|THOC2_ENST00000497887.1_5'UTR|THOC2_ENST00000491737.1_Silent_p.R1366R	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	1481	Lys-rich.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						ACCCTTTTCCGCTCTTTCCTG	0.353																																					p.R1481R													.	.			0			c.C4441A												112.0	101.0	105.0					X																	122747911		1815	4067	5882	SO:0001819	synonymous_variant	57187	exon34			TTTTCCGCTCTTT	AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4441C>A	X.37:g.122747911G>T			25	0	0		17	0.12	2	NM_001081550	151	0.00	0	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Silent	SNP	ENST00000245838.8	37	CCDS43988.1	.	.	.	.	.	.	.	.	.	.	G	6.790	0.514841	0.12944	.	.	ENSG00000125676	ENST00000448128;ENST00000441692	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	T	0.71160	0.3307	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69544	-0.5117	4	.	.	.	-6.3811	14.3577	0.66748	0.0:0.0:0.8523:0.1477	.	.	.	.	R	76;275	.	.	S	-	3	2	THOC2	122575592	1.000000	0.71417	0.987000	0.45799	0.987000	0.75469	4.817000	0.62650	2.562000	0.86427	0.600000	0.82982	AGC			0.353	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058153.3			
XPNPEP2	7512	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	128886308	128886308	+	Missense_Mutation	SNP	A	A	G			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrX:128886308A>G	ENST00000371106.3	+	10	1196	c.1004A>G	c.(1003-1005)gAa>gGa	p.E335G		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	335						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GGGATCTATGAAATGATACCC	0.522																																					p.E335G													.	.			0			c.A1004G												112.0	93.0	99.0					X																	128886308		2203	4299	6502	SO:0001583	missense	7512	exon10			TCTATGAAATGAT	U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1004A>G	X.37:g.128886308A>G	ENSP00000360147:p.Glu335Gly		112	0	0		113	0.19	21	NM_003399	0		0	A0AV16|O75994	Missense_Mutation	SNP	ENST00000371106.3	37	CCDS14613.1	.	.	.	.	.	.	.	.	.	.	A	12.44	1.938362	0.34189	.	.	ENSG00000122121	ENST00000371106	T	0.74842	-0.88	5.89	4.76	0.60689	.	0.236305	0.49916	D	0.000139	T	0.61261	0.2333	L	0.41710	1.295	0.40841	D	0.983674	B	0.14012	0.009	B	0.09377	0.004	T	0.59606	-0.7423	10	0.39692	T	0.17	-16.9827	5.5432	0.17049	0.7944:0.0:0.2056:0.0	.	335	O43895	XPP2_HUMAN	G	335	ENSP00000360147:E335G	ENSP00000360147:E335G	E	+	2	0	XPNPEP2	128713989	1.000000	0.71417	0.996000	0.52242	0.716000	0.41182	3.392000	0.52537	1.995000	0.58328	0.430000	0.28490	GAA			0.522	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000058210.1		NM_003399	
NLGN4Y	22829	mdanderson.org	37	Y	16953087	16953087	+	3'UTR	SNP	G	G	T			TCGA-XE-AAOD-01A-11D-A435-10	TCGA-XE-AAOD-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	2a0bdd28-8993-44f4-a117-65ff51ff02c6	dc69fa13-f07c-4903-a807-b0a0e9d277ad	g.chrY:16953087G>T	ENST00000476359.1	+	0	2941							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						AAAACCTTCAGTGGAGGACAA	0.478																																					p.S799I													.	.			0			c.G2396T																																									SO:0001624	3_prime_UTR_variant	22829	exon6			CCTTCAGTGGAGG		CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2938G>T	Y.37:g.16953087G>T			106	0	0		46	0.07	3	NM_014893	1	0.00	0	F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	ENST00000476359.1	37																																																																																						0.478	NLGN4Y-004	KNOWN	basic	processed_transcript	protein_coding		OTTHUMT00000089064.2		NM_014893	
