#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
SDHB	6390	hgsc.bcm.edu	37	1	17371263	17371263	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr1:17371263G>T	ENST00000375499.3	-	2	343	c.193C>A	c.(193-195)Ctt>Att	p.L65I	SDHB_ENST00000466613.1_5'UTR	NM_003000.2	NP_002991.2	P21912	SDHB_HUMAN	succinate dehydrogenase complex, subunit B, iron sulfur (Ip)	65	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.		L -> H (in pheochromocytoma). {ECO:0000269|PubMed:12618761}.|L -> P (in pheochromocytoma). {ECO:0000269|PubMed:15328326}.		aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|3 iron, 4 sulfur cluster binding (GO:0051538)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)|ubiquinone binding (GO:0048039)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)	10		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0049)|COAD - Colon adenocarcinoma(227;1.18e-05)|BRCA - Breast invasive adenocarcinoma(304;2.41e-05)|Kidney(64;0.000188)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)	Succinic acid(DB00139)	CACTTATTAAGGTCAACTTCA	0.433			"""Mis, N, F"""			"""paraganglioma, pheochromocytoma"""			Familial Paragangliomas;Cowden syndrome;Carney-Stratakis syndrome																												p.L65I			yes	Rec		Familial paraganglioma	1	1p36.1-p35	6390	"""succinate dehydrogenase complex, subunit B, iron sulfur (Ip)"""		O	.	.			0			c.C193A												116.0	113.0	114.0					1																	17371263		2203	4300	6503	SO:0001583	missense	6390	exon2	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;Carney-Stratakis dyad, Paraganglioma-Gastric Stromal Sarcoma dyad	TATTAAGGTCAAC	U17248	CCDS176.1	1p36.1-p35	2014-09-17			ENSG00000117118	ENSG00000117118	1.3.99.1	"""Mitochondrial respiratory chain complex / Complex II"""	10681	protein-coding gene	gene with protein product		185470		SDH1, SDH			Standard	NM_003000		Approved		uc001bae.3	P21912	OTTHUMG00000002289	ENST00000375499.3:c.193C>A	1.37:g.17371263G>T	ENSP00000364649:p.Leu65Ile		81	0	0		92	0.04	4	NM_003000	158	0.00	0	B2R545|Q0QEY7|Q9NQ12	Missense_Mutation	SNP	ENST00000375499.3	37	CCDS176.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.662347	0.47572	.	.	ENSG00000117118	ENST00000375499	D	0.98937	-5.25	5.65	1.61	0.23674	Beta-grasp fold, ferredoxin-type (1);Ferredoxin (2);	0.000000	0.64402	D	0.000001	D	0.98463	0.9488	M	0.66439	2.03	0.58432	D	0.999999	D	0.59357	0.985	D	0.71184	0.972	D	0.97601	1.0123	10	0.72032	D	0.01	-12.3203	8.025	0.30431	0.5576:0.0:0.4424:0.0	.	65	P21912	DHSB_HUMAN	I	65	ENSP00000364649:L65I	ENSP00000364649:L65I	L	-	1	0	SDHB	17243850	1.000000	0.71417	0.995000	0.50966	0.305000	0.27757	3.134000	0.50538	0.128000	0.18479	-0.136000	0.14681	CTT			0.433	SDHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000006603.1		NM_003000	
EVI5	7813	broad.mit.edu	37	1	92979095	92979124	+	Splice_Site	DEL	TATATATATATATATATATATATATATATG	TATATATATATATATATATATATATATATG	-	rs11274071|rs146230362|rs12728513|rs201275224|rs199848107|rs201771520|rs201951736|rs202223184|rs200425212|rs6603978|rs200428687|rs200908663|rs201205364	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	TATATATATATATATATATATATATATATG	TATATATATATATATATATATATATATATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr1:92979095_92979124delTATATATATATATATATATATATATATATG	ENST00000540033.1	-	19	2528		c.e19-2		EVI5_ENST00000370331.1_3'UTR			O60447	EVI5_HUMAN	ecotropic viral integration site 5						cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		tatatatatatatatatatatatatatatatatatatatgtacatatGAA	0.261																																					.													.	EVI5	94		0			.																																									SO:0001630	splice_region_variant	7813	.			TATATATATATAT	AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000540033.1:c.2431-2CATATATATATATATATATATATATATATA>-	1.37:g.92979095_92979124delTATATATATATATATATATATATATATATG			15	0	0		37	0.89	33	.	0		0	A6NKX8|B9A6J0|Q9H1Y9	Splice_Site	DEL	ENST00000540033.1	37	CCDS30774.1																																																																																					0.261	EVI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_005665	Intron
NRAS	4893	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	115258748	115258748	+	Missense_Mutation	SNP	C	C	T	rs121913250		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr1:115258748C>T	ENST00000369535.4	-	2	287	c.34G>A	c.(34-36)Ggt>Agt	p.G12S	CSDE1_ENST00000483407.1_5'Flank	NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog	12			G -> C (in leukemia). {ECO:0000269|PubMed:2998510}.|G -> D (in KNEN). {ECO:0000269|PubMed:22499344}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12S(133)|p.G12C(81)|p.G12R(18)|p.G12N(2)|p.G12P(1)|p.G12Y(1)		NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACCACCTGCTCCAACC	0.493	G12C(KHM1B_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12C(P31FUJ_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12S(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											p.G12S				Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	NRAS,NS,haematopoietic_neoplasm,+1,861	NRAS	1	861	236	Substitution - Missense(236)	haematopoietic_and_lymphoid_tissue(149)|skin(29)|upper_aerodigestive_tract(21)|large_intestine(13)|thyroid(8)|prostate(6)|lung(4)|soft_tissue(2)|urinary_tract(1)|NS(1)|kidney(1)|pancreas(1)	c.G34A												203.0	181.0	189.0					1																	115258748		2203	4300	6503	SO:0001583	missense	4893	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CACCACCTGCTCC	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.34G>A	1.37:g.115258748C>T	ENSP00000358548:p.Gly12Ser		208	0	0		196	0.15	30	NM_002524	50	0.32	16	Q14971|Q15104|Q15282	Missense_Mutation	SNP	ENST00000369535.4	37	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	36	5.920083	0.97105	.	.	ENSG00000213281	ENST00000369535	T	0.76316	-1.01	5.58	5.58	0.84498	Small GTP-binding protein domain (1);	0.000000	0.56097	U	0.000025	T	0.73179	0.3554	L	0.37561	1.115	0.80722	D	1	B	0.31581	0.329	B	0.43783	0.431	T	0.74112	-0.3770	10	0.59425	D	0.04	.	19.3769	0.94514	0.0:1.0:0.0:0.0	.	12	P01111	RASN_HUMAN	S	12	ENSP00000358548:G12S	ENSP00000358548:G12S	G	-	1	0	NRAS	115060271	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.651000	0.83577	2.906000	0.99361	0.655000	0.94253	GGT			0.493	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000033395.2		NM_002524	
OBSCN	84033	hgsc.bcm.edu	37	1	228456342	228456342	+	Missense_Mutation	SNP	C	C	T	rs374036309		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr1:228456342C>T	ENST00000422127.1	+	17	5017	c.4973C>T	c.(4972-4974)aCg>aTg	p.T1658M	RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000570156.2_Missense_Mutation_p.T1842M|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.T1658M|OBSCN_ENST00000359599.6_Missense_Mutation_p.T314M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1658	Ig-like 17.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				ACAGAGGTGACGTGGTACAAG	0.667																																					p.T1842M													OBSCN_ENST00000570156,NS,carcinoma,-1,8	OBSCN_ENST00000570156	-1	8	0			c.C5525T							T	MET/THR,MET/THR	1,4111		0,1,2055	62.0	62.0	62.0		4973,4973	2.3	0.7	1		62	0,8384		0,0,4192	no	missense,missense	OBSCN	NM_001098623.1,NM_052843.2	81,81	0,1,6247	TT,TC,CC		0.0,0.0243,0.0080	probably-damaging,probably-damaging	1658/7969,1658/6621	228456342	1,12495	2056	4192	6248	SO:0001583	missense	84033	exon19			AGGTGACGTGGTA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4973C>T	1.37:g.228456342C>T	ENSP00000409493:p.Thr1658Met		102	0	0		98	0.04	4	NM_001271223	1	0.00	0	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	37	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	9.609	1.130776	0.21041	2.43E-4	0.0	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;T	0.68765	-0.35;-0.35;-0.35	5.37	2.3	0.28687	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.512237	0.19035	N	0.124439	T	0.62258	0.2413	M	0.73217	2.22	0.51767	D	0.999931	P;P;P	0.47191	0.818;0.891;0.64	P;P;B	0.45610	0.487;0.466;0.144	T	0.60546	-0.7242	10	0.48119	T	0.1	.	1.9347	0.03334	0.2367:0.4764:0.1226:0.1642	.	1658;104;1658	Q5VST9;Q24JT4;Q5VST9-3	OBSCN_HUMAN;.;.	M	1658;1658;314	ENSP00000284548:T1658M;ENSP00000409493:T1658M;ENSP00000352613:T314M	ENSP00000284548:T1658M	T	+	2	0	OBSCN	226522965	0.000000	0.05858	0.739000	0.30968	0.369000	0.29798	0.172000	0.16704	0.649000	0.30751	-0.320000	0.08662	ACG			0.667	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding				NM_052843	
SMYD3	64754	mdanderson.org	37	1	246670511	246670511	+	Silent	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr1:246670511C>T	ENST00000388985.4	-	1	8	c.9G>A	c.(7-9)ccG>ccA	p.P3P	SMYD3_ENST00000490107.1_5'UTR|SMYD3_ENST00000403792.3_Silent_p.P3P			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	3					cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		CCACCTTCAGCGGCTCCATCC	0.721																																					p.P3P													.	.			0			c.G9A												25.0	34.0	31.0					1																	246670511		692	1591	2283	SO:0001819	synonymous_variant	64754	exon1			CTTCAGCGGCTCC	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.9G>A	1.37:g.246670511C>T			51	0	0		76	0.05	4	NM_001167740	16	0.00	0	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Silent	SNP	ENST00000388985.4	37	CCDS53486.1																																																																																					0.721	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				NM_022743	
C11orf16	56673	mdanderson.org	37	11	8947472	8947472	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr11:8947472G>T	ENST00000326053.5	-	5	848	c.742C>A	c.(742-744)Cca>Aca	p.P248T	C11orf16_ENST00000528998.1_5'Flank|C11orf16_ENST00000525780.1_Missense_Mutation_p.P248T	NM_020643.2	NP_065694.2	Q9NQ32	CK016_HUMAN	chromosome 11 open reading frame 16	248										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	22				Epithelial(150;4.11e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0234)		CCAGTGATTGGCCCTAGCAGA	0.607																																					p.P248T													.	.			0			c.C742A												67.0	69.0	68.0					11																	8947472		2201	4296	6497	SO:0001583	missense	56673	exon5			TGATTGGCCCTAG	AJ400877	CCDS7794.1	11p15.3	2008-06-25			ENSG00000176029	ENSG00000176029			1169	protein-coding gene	gene with protein product						11528127	Standard	NM_020643		Approved		uc001mhb.4	Q9NQ32	OTTHUMG00000165654	ENST00000326053.5:c.742C>A	11.37:g.8947472G>T	ENSP00000318999:p.Pro248Thr		80	0	0		38	0.08	3	NM_020643	0		0	Q53FB2|Q8N6Y9	Missense_Mutation	SNP	ENST00000326053.5	37	CCDS7794.1	.	.	.	.	.	.	.	.	.	.	G	1.040	-0.679204	0.03378	.	.	ENSG00000176029	ENST00000525780;ENST00000326053	T;T	0.31247	1.51;1.5	5.8	-2.25	0.06888	.	0.852702	0.10394	N	0.680033	T	0.23330	0.0564	L	0.56769	1.78	0.09310	N	1	B;B	0.23377	0.041;0.084	B;B	0.21917	0.027;0.037	T	0.36986	-0.9725	10	0.59425	D	0.04	-10.3159	1.2981	0.02073	0.305:0.1013:0.3862:0.2076	.	248;248	Q9NQ32-2;Q9NQ32	.;CK016_HUMAN	T	248	ENSP00000436818:P248T;ENSP00000318999:P248T	ENSP00000318999:P248T	P	-	1	0	C11orf16	8904048	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	0.152000	0.16302	-0.404000	0.07610	-0.768000	0.03414	CCA			0.607	C11orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000385626.1		NM_020643	
Unknown	0	bcgsc.ca	37	11	62815368	62815368	+	IGR	SNP	G	G	A	rs150679703|rs374048942|rs7125680|rs372143980	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr11:62815368G>A								SLC22A8 (32057 upstream) : SLC22A24 (32043 downstream)																							CCAAGGTGCAGCATGCCATGT	0.562																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			GGTGCAGCATGCC																													11.37:g.62815368G>A			22	0	0		24	0.46	11	.	0		0		RNA	SNP		37																																																																																					0	0.562										
ATG2A	23130	mdanderson.org	37	11	64678133	64678133	+	Silent	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr11:64678133G>T	ENST00000377264.3	-	12	1774	c.1662C>A	c.(1660-1662)ccC>ccA	p.P554P	ATG2A_ENST00000421419.2_Silent_p.P554P	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	554					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						GATGGGCGCAGGGCCGAGCTG	0.687																																					p.P554P													.	.			0			c.C1662A												55.0	53.0	54.0					11																	64678133		2196	4292	6488	SO:0001819	synonymous_variant	23130	exon12			GGCGCAGGGCCGA		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1662C>A	11.37:g.64678133G>T			27	0	0		29	0.10	3	NM_015104	58	0.00	0	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Silent	SNP	ENST00000377264.3	37	CCDS31602.1	.	.	.	.	.	.	.	.	.	.	G	6.537	0.467262	0.12402	.	.	ENSG00000110046	ENST00000418259	.	.	.	4.97	0.793	0.18632	.	.	.	.	.	T	0.54159	0.1841	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42327	-0.9458	4	.	.	.	.	7.2481	0.26133	0.4041:0.0:0.5959:0.0	.	.	.	.	M	356	.	.	L	-	1	2	ATG2A	64434709	1.000000	0.71417	0.883000	0.34634	0.550000	0.35303	0.874000	0.28065	-0.044000	0.13491	-0.448000	0.05591	CTG			0.687	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000143224.1		NM_015104	
B3GNT1	11041	mdanderson.org	37	11	66114323	66114323	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr11:66114323G>T	ENST00000311181.4	-	1	840	c.694C>A	c.(694-696)Ccc>Acc	p.P232T	RP11-867G23.8_ENST00000531602.1_5'Flank|BRMS1_ENST00000425825.2_5'Flank|BRMS1_ENST00000359957.3_5'Flank	NM_006876.2	NP_006867.1	O43505	B3GN1_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1	232					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|poly-N-acetyllactosamine biosynthetic process (GO:0030311)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase activity (GO:0008532)			breast(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	12						CCCTCGCTGGGCACCATGTCC	0.607																																					p.P232T													.	.			0			c.C694A												64.0	65.0	64.0					11																	66114323		2200	4295	6495	SO:0001583	missense	11041	exon1			CGCTGGGCACCAT	AF029893	CCDS8136.1	11q13.2	2014-07-08	2006-04-12	2006-04-12	ENSG00000174684	ENSG00000174684	2.4.1.149	"""Beta 3-glycosyltransferases"""	15685	protein-coding gene	gene with protein product	"""N-acetyllactosaminide beta-1,3-N-acetylglucosaminyltransferase"""	605517	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6"""	B3GNT6		9405606	Standard	NM_006876		Approved	iGNT, iGAT, iGnT, BETA3GNTI, B3GN-T1	uc001ohr.3	O43505	OTTHUMG00000167082	ENST00000311181.4:c.694C>A	11.37:g.66114323G>T	ENSP00000309096:p.Pro232Thr		66	0	0		44	0.07	3	NM_006876	31	0.00	0	Q4TTN0	Missense_Mutation	SNP	ENST00000311181.4	37	CCDS8136.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022783	0.75275	.	.	ENSG00000174684	ENST00000311181;ENST00000538757	T	0.26810	1.71	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.59636	0.2208	M	0.89968	3.075	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66634	-0.5874	10	0.56958	D	0.05	-25.9009	16.7806	0.85562	0.0:0.0:1.0:0.0	.	232	O43505	B3GN1_HUMAN	T	232;3	ENSP00000309096:P232T	ENSP00000309096:P232T	P	-	1	0	B3GNT1	65870899	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.263000	0.78421	2.577000	0.86979	0.462000	0.41574	CCC			0.607	B3GNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000392959.1		NM_006876	
GRIN2B	2904	mdanderson.org	37	12	13716591	13716591	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:13716591G>T	ENST00000609686.1	-	13	3790	c.3581C>A	c.(3580-3582)cCt>cAt	p.P1194H		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1194					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCAAGGTGCAGGTACCCCGCT	0.627																																					p.P1194H													GRIN2B,NS,carcinoma,-1,1	GRIN2B	-1	1	0			c.C3581A												107.0	108.0	108.0					12																	13716591		2203	4300	6503	SO:0001583	missense	2904	exon13			GGTGCAGGTACCC		CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3581C>A	12.37:g.13716591G>T	ENSP00000477455:p.Pro1194His		41	0	0		43	0.07	3	NM_000834	0		0	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Missense_Mutation	SNP	ENST00000609686.1	37	CCDS8662.1	.	.	.	.	.	.	.	.	.	.	G	0.029	-1.346679	0.01266	.	.	ENSG00000150086	ENST00000279593	T	0.10668	2.85	5.03	4.13	0.48395	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.076435	0.52532	D	0.000068	T	0.07234	0.0183	N	0.08118	0	0.34311	D	0.685514	B	0.30727	0.292	B	0.39258	0.295	T	0.37934	-0.9684	10	0.15066	T	0.55	.	12.2126	0.54388	0.0796:0.0:0.9204:0.0	.	1194	Q13224	NMDE2_HUMAN	H	1194	ENSP00000279593:P1194H	ENSP00000279593:P1194H	P	-	2	0	GRIN2B	13607858	1.000000	0.71417	0.858000	0.33744	0.019000	0.09904	5.773000	0.68898	1.245000	0.43885	-0.150000	0.13652	CCT			0.627	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268014.2			
SMARCD1	6602	hgsc.bcm.edu	37	12	50492743	50492743	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:50492743G>T	ENST00000394963.4	+	13	1906	c.1508G>T	c.(1507-1509)cGa>cTa	p.R503L	SMARCD1_ENST00000381513.4_Missense_Mutation_p.R462L|SMARCD1_ENST00000548573.1_Missense_Mutation_p.R301L	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						CAGCAGAGACGACAAGAATTA	0.507																																					p.R503L													.	.			0			c.G1508T												119.0	114.0	116.0					12																	50492743		2203	4300	6503	SO:0001583	missense	6602	exon13			AGAGACGACAAGA	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1508G>T	12.37:g.50492743G>T	ENSP00000378414:p.Arg503Leu		83	0	0		96	0.04	4	NM_003076	262	0.00	0		Missense_Mutation	SNP	ENST00000394963.4	37	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788950	0.90367	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	T;T	0.55760	0.5;0.55	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.75903	0.3913	M	0.81179	2.53	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.994	D;D;D	0.81914	0.993;0.995;0.944	T	0.77800	-0.2452	10	0.87932	D	0	-0.3202	20.1044	0.97886	0.0:0.0:1.0:0.0	.	301;462;503	F8VRQ4;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	L	503;462;279;301	ENSP00000378414:R503L;ENSP00000370924:R462L	ENSP00000370924:R462L	R	+	2	0	SMARCD1	48779010	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.843000	0.99491	2.837000	0.97791	0.591000	0.81541	CGA			0.507	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316759.2		NM_003076	
AAAS	8086	broad.mit.edu;bcgsc.ca	37	12	53702803	53702804	+	Splice_Site	DEL	CT	CT	-			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:53702803_53702804delCT	ENST00000209873.4	-	10	1101_1102	c.936_937delAG	c.(934-939)cgagtc>cgtc	p.V313fs	AAAS_ENST00000394384.3_Splice_Site_p.V280fs|AAAS_ENST00000550286.1_Splice_Site_p.V189fs|AAAS_ENST00000549983.1_5'Flank	NM_015665.5	NP_056480.1	Q9NRG9	AAAS_HUMAN	achalasia, adrenocortical insufficiency, alacrimia	313					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nucleocytoplasmic transport (GO:0006913)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of nucleocytoplasmic transport (GO:0046822)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(2)	20						GCCTCCCAGACTCTGAGCCAGA	0.52																																					p.312_313del													.	AAAS	46		0			c.936_937del																																									SO:0001630	splice_region_variant	8086	exon10			CCCAGACTCTGAG	AJ289841	CCDS8856.1, CCDS53797.1	12q13	2013-06-27	2010-06-24		ENSG00000094914	ENSG00000094914		"""WD repeat domain containing"""	13666	protein-coding gene	gene with protein product	"""aladin"", ""Allgrove, triple-A"""	605378	"""achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)"""			11062474	Standard	NM_015665		Approved		uc001scr.4	Q9NRG9	OTTHUMG00000169729	ENST00000209873.4:c.936-1AG>-	12.37:g.53702805_53702806delCT			62	0	0		72	0.13	9	NM_015665	159	0.00	0	Q5JB47|Q9NWI6|Q9UG19	Splice_Site	DEL	ENST00000209873.4	37	CCDS8856.1																																																																																					0.520	AAAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405632.1			Frame_Shift_Del
TIMELESS	8914	broad.mit.edu	37	12	56817448	56817448	+	Silent	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:56817448C>T	ENST00000553532.1	-	17	2160	c.2010G>A	c.(2008-2010)gaG>gaA	p.E670E	TIMELESS_ENST00000229201.4_Silent_p.E669E|TIMELESS_ENST00000554616.1_Intron					timeless circadian clock									p.E670E(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						cctcctcctcctcttcttctt	0.527																																					p.E670E													TIMELESS,NS,carcinoma,0,1	TIMELESS	107	1	1	Substitution - coding silent(1)	kidney(1)	c.G2010A												51.0	49.0	50.0					12																	56817448		2203	4300	6503	SO:0001819	synonymous_variant	8914	exon17			CTCCTCCTCTTCT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2010G>A	12.37:g.56817448C>T			66	0.0151515152	1		97	0.04	4	NM_003920	121	0.01	1		Silent	SNP	ENST00000553532.1	37	CCDS8918.1																																																																																					0.527	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000409771.1		NM_003920	
POC1B	282809	mdanderson.org	37	12	89885738	89885738	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:89885738G>T	ENST00000313546.3	-	4	555	c.427C>A	c.(427-429)Cat>Aat	p.H143N	POC1B_ENST00000549035.1_Missense_Mutation_p.H101N|POC1B_ENST00000541909.1_Missense_Mutation_p.H13N|POC1B_ENST00000393179.4_Missense_Mutation_p.H13N|POC1B_ENST00000549504.1_Missense_Mutation_p.H13N|POC1B_ENST00000378528.2_Missense_Mutation_p.H13N	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	143					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						CAGTGTGTATGTCGATACAAG	0.413																																					p.H143N													.	.			0			c.C427A												130.0	124.0	126.0					12																	89885738		2203	4300	6503	SO:0001583	missense	282809	exon4			GTGTATGTCGATA	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.427C>A	12.37:g.89885738G>T	ENSP00000323302:p.His143Asn		46	0	0		71	0.06	4	NM_172240	6	0.00	0	G3V1X0	Missense_Mutation	SNP	ENST00000313546.3	37	CCDS31869.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181986	0.78677	.	.	ENSG00000139323	ENST00000393179;ENST00000313546;ENST00000378528;ENST00000549035;ENST00000541909;ENST00000549504	T;T;T;T;T	0.81078	-1.45;-1.45;-1.45;-1.45;-1.45	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.92753	0.7696	M	0.93720	3.45	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.93967	0.7246	10	0.72032	D	0.01	.	19.3361	0.94319	0.0:0.0:1.0:0.0	.	143	Q8TC44	POC1B_HUMAN	N	13;143;13;101;13;13	ENSP00000376877:H13N;ENSP00000323302:H143N;ENSP00000367789:H13N;ENSP00000447916:H101N;ENSP00000440301:H13N	ENSP00000323302:H143N	H	-	1	0	POC1B	88409869	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	9.608000	0.98331	2.676000	0.91093	0.467000	0.42956	CAT			0.413	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000406637.1		NM_172240	
CHFR	55743	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	12	133424713	133424713	+	Silent	SNP	G	G	A	rs372404283		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr12:133424713G>A	ENST00000432561.2	-	14	1714	c.1641C>T	c.(1639-1641)gaC>gaT	p.D547D	CHFR_ENST00000541341.1_De_novo_Start_OutOfFrame|CHFR_ENST00000537522.1_Silent_p.D169D|CHFR_ENST00000266880.7_Silent_p.D546D|CHFR_ENST00000541837.2_5'UTR|CHFR_ENST00000450056.2_Silent_p.D535D|CHFR_ENST00000315585.7_Silent_p.D506D|CHFR_ENST00000443047.2_Silent_p.D455D			Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains, E3 ubiquitin protein ligase	547					mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|modification-dependent protein catabolic process (GO:0019941)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)|PML body (GO:0016605)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		TCAGCACGCCGTCCAGACACT	0.557																																					p.D547D													.	.			0			c.C1641T												113.0	93.0	100.0					12																	133424713		2203	4300	6503	SO:0001819	synonymous_variant	55743	exon14			CACGCCGTCCAGA	AK001658	CCDS31937.1, CCDS53847.1, CCDS53848.1, CCDS53849.1	12q24.33	2012-02-23	2012-02-23			ENSG00000072609		"""RING-type (C3HC4) zinc fingers"""	20455	protein-coding gene	gene with protein product		605209	"""checkpoint with forkhead and ring finger domains"""			10935642, 11807090	Standard	NM_001161344		Approved	FLJ10796, RNF196	uc001ulf.2	Q96EP1		ENST00000432561.2:c.1641C>T	12.37:g.133424713G>A			109	0	0		135	0.04	6	NM_001161344	54	0.02	1	A6NEN5|B4DZ77|B4E2L6|Q96SL3|Q9NRT4|Q9NT32|Q9NVD5	Silent	SNP	ENST00000432561.2	37	CCDS53849.1																																																																																					0.557	CHFR-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000397130.2			
MTMR6	9107	mdanderson.org	37	13	25840300	25840300	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr13:25840300G>T	ENST00000381801.5	-	4	1190	c.429C>A	c.(427-429)caC>caA	p.H143Q	MTMR6_ENST00000540661.1_Missense_Mutation_p.H143Q	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	143	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		ACAACTGCCAGTGTGAGTTTG	0.438																																					p.H143Q													.	.			0			c.C429A												100.0	88.0	92.0					13																	25840300		2203	4300	6503	SO:0001583	missense	9107	exon4			CTGCCAGTGTGAG	AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.429C>A	13.37:g.25840300G>T	ENSP00000371221:p.His143Gln		62	0	0		41	0.07	3	NM_004685	9	0.00	0	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	ENST00000381801.5	37	CCDS9313.1	.	.	.	.	.	.	.	.	.	.	G	8.693	0.907837	0.17833	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.92199	-2.99;-2.99	5.74	4.02	0.46733	Myotubularin phosphatase domain (1);	0.366807	0.35124	N	0.003434	T	0.76097	0.3940	N	0.01219	-0.95	0.28571	N	0.910611	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.62793	-0.6779	10	0.11794	T	0.64	.	12.2683	0.54691	0.1366:0.0:0.8634:0.0	.	143;143	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	Q	143	ENSP00000443161:H143Q;ENSP00000371221:H143Q	ENSP00000371221:H143Q	H	-	3	2	MTMR6	24738300	1.000000	0.71417	0.988000	0.46212	0.489000	0.33432	1.315000	0.33608	0.788000	0.33755	0.650000	0.86243	CAC			0.438	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000044225.1		NM_004685	
FARP1	10160	mdanderson.org	37	13	99093031	99093031	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr13:99093031C>T	ENST00000319562.6	+	24	3002	c.2737C>T	c.(2737-2739)Cac>Tac	p.H913Y	FARP1_ENST00000376586.2_Missense_Mutation_p.H944Y|FARP1_ENST00000595437.1_Missense_Mutation_p.H944Y	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	913					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CACAATGGTGCACGTGTGCTG	0.647																																					p.H913Y													.	.			0			c.C2737T												51.0	41.0	44.0					13																	99093031		2202	4299	6501	SO:0001583	missense	10160	exon24			ATGGTGCACGTGT	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.2737C>T	13.37:g.99093031C>T	ENSP00000322926:p.His913Tyr		49	0	0		36	0.08	3	NM_005766	25	0.00	0	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	37	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	C	34	5.310660	0.95629	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	T;T	0.12672	2.66;2.66	5.43	5.43	0.79202	.	0.109057	0.64402	D	0.000007	T	0.43188	0.1236	M	0.81497	2.545	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.98;0.999	T	0.41556	-0.9502	10	0.87932	D	0	.	19.2581	0.93955	0.0:1.0:0.0:0.0	.	913;944	Q9Y4F1;C9JME2	FARP1_HUMAN;.	Y	944;913	ENSP00000365771:H944Y;ENSP00000322926:H913Y	ENSP00000322926:H913Y	H	+	1	0	FARP1	97891032	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.813000	0.86123	2.547000	0.85894	0.655000	0.94253	CAC			0.647	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045541.3		NM_005766	
TMEM55B	90809	mdanderson.org	37	14	20928916	20928916	+	Silent	SNP	C	C	A	rs149796661		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr14:20928916C>A	ENST00000250489.4	-	2	517	c.231G>T	c.(229-231)ggG>ggT	p.G77G	TMEM55B_ENST00000398020.4_Silent_p.G84G|TMEM55B_ENST00000554028.1_5'Flank			Q86T03	TM55B_HUMAN	transmembrane protein 55B	77	Pro-rich.					endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			endometrium(3)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)	11	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)		TAGGGGCACTCCCACTGTCCG	0.567																																					p.G84G													TMEM55B,NS,carcinoma,-2,1	TMEM55B	-2	1	0			c.G252T												122.0	117.0	119.0					14																	20928916		2203	4300	6503	SO:0001819	synonymous_variant	90809	exon2			GGCACTCCCACTG	BC002867	CCDS9551.1, CCDS41911.1	14q11.1	2002-11-27	2005-07-18	2005-07-18	ENSG00000165782	ENSG00000165782			19299	protein-coding gene	gene with protein product		609865	"""chromosome 14 open reading frame 9"""	C14orf9			Standard	NM_144568		Approved	MGC26684	uc001vxk.2	Q86T03	OTTHUMG00000029545	ENST00000250489.4:c.231G>T	14.37:g.20928916C>A			50	0	0		42	0.07	3	NM_001100814	63	0.00	0	B2RA35|Q86U09|Q8WUC0|Q9BU67|Q9NSU8	Silent	SNP	ENST00000250489.4	37	CCDS9551.1																																																																																					0.567	TMEM55B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000073643.3		NM_144568	
LOC101927079	101927079	broad.mit.edu	37	15	22332213	22332214	+	RNA	INS	-	-	A	rs144162914		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr15:22332213_22332214insA	ENST00000558896.1	+	0	194																											TCTATCAATATAAGACTACTGC	0.252																																					.													.	.			0			.																																											0	.			TCAATATAAGACT																													15.37:g.22332215_22332215dupA			6	0	0		6	0.33	2	.	1	0.00	0		RNA	INS	ENST00000558896.1	37																																																																																						0.252	RP11-69H14.6-001	KNOWN	basic	sense_overlapping	sense_overlapping		OTTHUMT00000417625.1			
GOLGA8DP	100132979	broad.mit.edu	37	15	22709885	22709885	+	RNA	DEL	G	G	-	rs372484877		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr15:22709885delG	ENST00000314246.8	-	0	1069				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TATCTAATGTGGGGGGGGCTG	0.537																																					.													.	.			0			.																																											0	.			TAATGTGGGGGGG			15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709885delG			9	0	0		12	0.50	6	.	0		0		RNA	DEL	ENST00000314246.8	37																																																																																						0.537	GOLGA8DP-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000415613.1		NR_027407	
LRRK1	79705	mdanderson.org	37	15	101593438	101593438	+	Silent	SNP	G	G	A			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr15:101593438G>A	ENST00000388948.3	+	26	4226	c.3867G>A	c.(3865-3867)ctG>ctA	p.L1289L	LRRK1_ENST00000284395.5_Silent_p.L1286L|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACACCATGCTGAGGCACCTGC	0.652																																					p.L1289L													.	.			0			c.G3867A												40.0	46.0	44.0					15																	101593438		2165	4264	6429	SO:0001819	synonymous_variant	79705	exon26			CATGCTGAGGCAC	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.3867G>A	15.37:g.101593438G>A			18	0	0		11	0.18	2	NM_024652	0		0		Silent	SNP	ENST00000388948.3	37	CCDS42086.1																																																																																					0.652	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384567.2		NM_024652	
COG7	91949	broad.mit.edu	37	16	23415150	23415150	+	Silent	SNP	T	T	C			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr16:23415150T>C	ENST00000307149.5	-	13	1853	c.1668A>G	c.(1666-1668)aaA>aaG	p.K556K		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	556					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		TGCTTGACCCTTTTTCCTAAG	0.507																																					p.K556K													.	COG7	62		0			c.A1668G												69.0	59.0	63.0					16																	23415150		2197	4300	6497	SO:0001819	synonymous_variant	91949	exon13			TGACCCTTTTTCC	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1668A>G	16.37:g.23415150T>C			94	0	0		66	0.05	3	NM_153603	26	0.00	0	Q6UWU7	Silent	SNP	ENST00000307149.5	37	CCDS10610.1																																																																																					0.507	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000211625.1			
RRAD	6236	mdanderson.org	37	16	66956208	66956208	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr16:66956208G>T	ENST00000299759.6	-	5	948	c.698C>A	c.(697-699)tCa>tAa	p.S233*	RRAD_ENST00000420652.1_Nonsense_Mutation_p.S233*			P55042	RAD_HUMAN	Ras-related associated with diabetes	233					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		CAATGCCGCTGATGTCTCAAT	0.587																																					p.S233X													.	.			0			c.C698A												75.0	65.0	68.0					16																	66956208		2200	4300	6500	SO:0001587	stop_gained	6236	exon5			GCCGCTGATGTCT	L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.698C>A	16.37:g.66956208G>T	ENSP00000299759:p.Ser233*		56	0	0		39	0.08	3	NM_004165	14	0.00	0	Q96F39	Nonsense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519826	0.85495	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.328	0.98708	0.0:0.0:1.0:0.0	.	.	.	.	X	233	.	ENSP00000299759:S233X	S	-	2	0	RRAD	65513709	1.000000	0.71417	0.100000	0.21137	0.278000	0.26855	9.471000	0.97696	2.802000	0.96397	0.561000	0.74099	TCA			0.587	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268830.1		NM_004165	
RP11-252A24.2	0	broad.mit.edu;bcgsc.ca	37	16	74372644	74372644	+	RNA	SNP	A	A	G			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr16:74372644A>G	ENST00000429810.2	-	0	1552																											TACCCTTGTCAGGGGGAACAA	0.443																																					.													.	.			0			.																																											0	.			CTTGTCAGGGGGA																													16.37:g.74372644A>G			78	0.0256410256	2		85	0.09	8	.	0		0		RNA	SNP	ENST00000429810.2	37																																																																																						0.443	RP11-252A24.2-003	KNOWN	basic	retained_intron	pseudogene		OTTHUMT00000434683.1			
PIEZO1	9780	broad.mit.edu	37	16	88800398	88800398	+	Missense_Mutation	SNP	G	G	C	rs144777557|rs144269709|rs62639697	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr16:88800398G>C	ENST00000301015.9	-	17	2491	c.2245C>G	c.(2245-2247)Cag>Gag	p.Q749E	RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.2_ENST00000567968.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	749					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)	p.Q749delQ(1)|p.E756_D757insE(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tcctcctcctgctgctgctgc	0.667																																					p.Q749E													.	PIEZO1	79		2	Insertion - In frame(1)|Deletion - In frame(1)	prostate(1)|breast(1)	c.C2245G												8.0	10.0	9.0					16																	88800398		685	1572	2257	SO:0001583	missense	9780	exon17			CCTCCTGCTGCTG	D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.2245C>G	16.37:g.88800398G>C	ENSP00000301015:p.Gln749Glu		61	0.0163934426	1		61	0.05	3	NM_001142864	23	0.00	0	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	ENST00000301015.9	37	CCDS54058.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.005|0.005	-2.233254|-2.233254	0.00277|0.00277	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|T	.|0.40756	.|1.02	0.844|0.844	0.844|0.844	0.18943|0.18943	.|.	.|3.384400	.|0.02084	.|N	.|0.052613	T|T	0.19604|0.19604	0.0471|0.0471	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	0.999999|0.999999	.|B	.|0.02656	.|0.0	.|B	.|0.01281	.|0.0	T|T	0.38436|0.38436	-0.9661|-0.9661	5|10	.|0.02654	.|T	.|1	.|.	7.2811|7.2811	0.26312|0.26312	0.0:0.4248:0.5752:0.0|0.0:0.4248:0.5752:0.0	rs62639697|rs62639697	.|749	.|Q92508	.|PIEZ1_HUMAN	G|E	694|749	.|ENSP00000301015:Q749E	.|ENSP00000301015:Q749E	A|Q	-|-	2|1	0|0	FAM38A|FAM38A	87327899|87327899	0.000000|0.000000	0.05858|0.05858	0.092000|0.092000	0.20876|0.20876	0.022000|0.022000	0.10575|0.10575	-0.494000|-0.494000	0.06451|0.06451	-1.966000|-1.966000	0.01009|0.01009	-1.954000|-1.954000	0.00483|0.00483	GCA|CAG			0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000345699.4		NM_014745	
TUBB8P7	197331	broad.mit.edu;ucsc.edu	37	16	90162556	90162556	+	RNA	SNP	G	G	A	rs532637415	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr16:90162556G>A	ENST00000564451.1	+	0	1909				TUBB8P7_ENST00000567960.1_RNA					tubulin, beta 8 class VIII pseudogene 7									p.E430*(1)									TGCCACGGCCGAGGAGGAGGA	0.517																																					.													ENSG00000196230,NS,malignant_melanoma,0,1	.		1	1	Substitution - Nonsense(1)	lung(1)	.																																											0	.			ACGGCCGAGGAGG			16q24.3	2013-02-18			ENSG00000261812	ENSG00000261812			42345	pseudogene	pseudogene							Standard	NG_002334		Approved				OTTHUMG00000172847		16.37:g.90162556G>A			45	0	0		40	0.33	13	.	9	0.56	5		RNA	SNP	ENST00000564451.1	37																																																																																						0.517	TUBB8P7-004	KNOWN	basic	processed_transcript	polymorphic_pseudogene		OTTHUMT00000420856.1		NG_002334	
SUZ12P1	440423	broad.mit.edu	37	17	29061588	29061588	+	RNA	DEL	A	A	-	rs72123191	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr17:29061588delA	ENST00000582557.1	+	0	508																											AGTTTAAATTAAGCTAAGTTA	0.318													|||unknown(NO_COVERAGE)	636	0.126997	0.1513	0.1412	5008	,	,		16902	0.0992		0.0706	False		,,,				2504	0.1708				.													.	.			0			.																																											0	.			TAAATTAAGCTAA																													17.37:g.29061588delA			5	0	0		8	0.50	4	.	0		0		RNA	DEL	ENST00000582557.1	37																																																																																						0.318	SUZ12P-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000444260.1			
KRTAP4-4	84616	mdanderson.org	37	17	39316640	39316640	+	Missense_Mutation	SNP	G	G	T	rs73983195	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr17:39316640G>T	ENST00000390661.3	-	1	343	c.304C>A	c.(304-306)Cgc>Agc	p.R102S		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	102	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].		Missing (in allele KAP4.4-v1).			keratin filament (GO:0045095)		p.R102C(1)		kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			CAGCTGGGGCGGCAGCAGGTG	0.662																																					p.R102S													KRTAP4-4,colon,carcinoma,0,1	KRTAP4-4	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.C304A												40.0	48.0	45.0					17																	39316640		2200	4297	6497	SO:0001583	missense	84616	exon1			TGGGGCGGCAGCA	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.304C>A	17.37:g.39316640G>T	ENSP00000375076:p.Arg102Ser		52	0	0		45	0.07	3	NM_032524	0		0	Q9BYU7	Missense_Mutation	SNP	ENST00000390661.3	37	CCDS11383.1	.	.	.	.	.	.	.	.	.	.	.	12.60	1.986211	0.35036	.	.	ENSG00000171396	ENST00000390661	T	0.01313	5.02	5.47	-10.9	0.00192	.	3.094940	0.03345	U	0.195326	T	0.02230	0.0069	M	0.86502	2.82	0.09310	N	1	B	0.29936	0.262	B	0.20384	0.029	T	0.43798	-0.9369	10	0.10111	T	0.7	.	11.4363	0.50070	0.0:0.1129:0.4846:0.4025	.	102	Q9BYR3	KRA44_HUMAN	S	102	ENSP00000375076:R102S	ENSP00000375076:R102S	R	-	1	0	KRTAP4-4	36570166	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-2.033000	0.01425	-1.585000	0.01634	-0.867000	0.03001	CGC			0.662	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257291.1			
ATP6V0A1	535	hgsc.bcm.edu	37	17	40653235	40653235	+	Silent	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr17:40653235G>T	ENST00000343619.4	+	17	2040	c.1917G>T	c.(1915-1917)ctG>ctT	p.L639L	ATP6V0A1_ENST00000585525.1_Silent_p.L596L|ATP6V0A1_ENST00000393829.2_Silent_p.L639L|ATP6V0A1_ENST00000537728.1_Silent_p.L596L|ATP6V0A1_ENST00000546249.1_Silent_p.L639L|ATP6V0A1_ENST00000264649.6_Silent_p.L646L|ATP6V0A1_ENST00000544137.1_Silent_p.L285L	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	639					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		AGTGTTTCCTGGTAGTGGTTG	0.418																																					p.L646L													.	.			0			c.G1938T												266.0	234.0	245.0					17																	40653235		2203	4300	6503	SO:0001819	synonymous_variant	535	exon17			TTTCCTGGTAGTG	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1917G>T	17.37:g.40653235G>T			101	0	0		95	0.05	5	NM_001130020	41	0.00	0	B7Z3B7|Q8N5G7|Q9NSX0	Silent	SNP	ENST00000343619.4	37	CCDS45684.1																																																																																					0.418	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000450364.1		NM_001130020	
COA3	28958	broad.mit.edu	37	17	40950543	40950543	+	Silent	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr17:40950543G>T	ENST00000328434.7	-	1	179	c.157C>A	c.(157-159)Cgg>Agg	p.R53R	CNTD1_ENST00000588408.1_5'Flank|CNTD1_ENST00000588527.1_5'Flank	NM_001040431.1	NP_001035521.1	Q9Y2R0	COA3_HUMAN	cytochrome c oxidase assembly factor 3	53					mitochondrial respiratory chain complex IV assembly (GO:0033617)|positive regulation of mitochondrial translation (GO:0070131)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											CGGGTTCGCCGCCGTGGTAGG	0.622																																					p.R53R													.	.			0			c.C157A												58.0	58.0	58.0					17																	40950543		2203	4300	6503	SO:0001819	synonymous_variant	28958	exon1			TTCGCCGCCGTGG	AF070665	CCDS32660.1	17q21.31	2014-01-28	2012-10-15	2012-08-07				"""Mitochondrial respiratory chain complex assembly factors"""	24990	protein-coding gene	gene with protein product		614775	"""coiled-coil domain containing 56"""	CCDC56		22356826, 22610097	Standard	NM_001040431		Approved	HSPC009, MITRAC12	uc010wgz.2	Q9Y2R0		ENST00000328434.7:c.157C>A	17.37:g.40950543G>T			60	0	0		59	0.05	3	NM_001040431	74	0.00	0	A8K498	Silent	SNP	ENST00000328434.7	37	CCDS32660.1																																																																																					0.622	COA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452397.1		NM_014019	
C17orf64	124773	broad.mit.edu	37	17	58511460	58511461	+	IGR	INS	-	-	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr17:58511460_58511461insT	ENST00000269127.4	+	0	950				RPL12P38_ENST00000588627.1_RNA	NM_181707.2	NP_859058.2	Q86WR6	CQ064_HUMAN	chromosome 17 open reading frame 64											breast(2)|large_intestine(1)|lung(3)	6	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			CACCACCAACGTTTTTTGGAGA	0.554																																					.													.	.			0			.																																									SO:0001628	intergenic_variant	0	.			ACCAACGTTTTTT	BC048806	CCDS32698.2	17q23.2	2005-12-16			ENSG00000141371	ENSG00000141371			26990	protein-coding gene	gene with protein product						12477932	Standard	NM_181707		Approved		uc002iyq.3	Q86WR6	OTTHUMG00000157171		17.37:g.58511466_58511466dupT			15	0	0		6	0.33	2	.	5	0.00	0	Q8IY87	RNA	INS	ENST00000269127.4	37	CCDS32698.2																																																																																					0.554	C17orf64-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000347743.1		NM_181707	
ZNF397	84307	mdanderson.org	37	18	32825534	32825534	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr18:32825534G>T	ENST00000330501.7	+	4	1018	c.865G>T	c.(865-867)Gta>Tta	p.V289L	ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000261333.6_Intron|ZNF397_ENST00000592264.1_Intron|ZNF397_ENST00000589420.1_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	289					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						TAGATGTGATGTATGTGGGCA	0.423																																					p.V289L													.	.			0			c.G865T												67.0	65.0	66.0					18																	32825534		692	1591	2283	SO:0001583	missense	84307	exon4			TGTGATGTATGTG	BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.865G>T	18.37:g.32825534G>T	ENSP00000331577:p.Val289Leu		95	0	0		51	0.06	3	NM_001135178	47	0.00	0	Q9BRM2	Missense_Mutation	SNP	ENST00000330501.7	37	CCDS45852.1	.	.	.	.	.	.	.	.	.	.	G	7.434	0.639228	0.14386	.	.	ENSG00000186812	ENST00000330501	T	0.09163	3.01	3.9	-0.0657	0.13767	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.568974	0.13224	N	0.404194	T	0.06188	0.0160	N	0.20574	0.59	0.09310	N	1	B	0.13145	0.007	B	0.17098	0.017	T	0.43278	-0.9401	9	.	.	.	.	7.7403	0.28837	0.3898:0.0:0.6102:0.0	.	289	Q8NF99	ZN397_HUMAN	L	289	ENSP00000331577:V289L	.	V	+	1	0	ZNF397	31079532	0.000000	0.05858	0.811000	0.32455	0.973000	0.67179	0.239000	0.18023	-0.128000	0.11641	0.305000	0.20034	GTA			0.423	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442398.1		NM_032347	
NANOS3	342977	mdanderson.org	37	19	13988167	13988167	+	Silent	SNP	G	G	A			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr19:13988167G>A	ENST00000397555.2	+	1	105	c.105G>A	c.(103-105)gaG>gaA	p.E35E	MIR181C_ENST00000384881.1_RNA|MIR181D_ENST00000384853.1_RNA|NANOS3_ENST00000591727.1_Intron|NANOS3_ENST00000339133.5_Silent_p.E35E	NM_001098622.2	NP_001092092.1	P60323	NANO3_HUMAN	nanos homolog 3 (Drosophila)	35					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	7			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			CCCAGCCAGAGCCAGAGCCAA	0.632																																					p.E35E													.	.			0			c.G105A												54.0	66.0	62.0					19																	13988167		2197	4298	6495	SO:0001819	synonymous_variant	342977	exon1			GCCAGAGCCAGAG	BM702754	CCDS42511.1	19p13.13	2003-12-01				ENSG00000187556			22048	protein-coding gene	gene with protein product		608229					Standard	NM_001098622		Approved	NANOS1L, NOS3	uc002mxj.4	P60323		ENST00000397555.2:c.105G>A	19.37:g.13988167G>A			30	0	0		29	0.10	3	NM_001098622	916	0.00	0	Q495E5	Silent	SNP	ENST00000397555.2	37																																																																																						0.632	NANOS3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				XM_292819	
CCDC141	285025	mdanderson.org	37	2	179702468	179702468	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr2:179702468G>T	ENST00000420890.2	-	23	3595	c.3478C>A	c.(3478-3480)Cag>Aag	p.Q1160K	CCDC141_ENST00000480419.1_5'UTR|CCDC141_ENST00000295723.5_Missense_Mutation_p.Q585K	NM_173648.3	NP_775919.3	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	1160										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			ACCTGCACCTGCCCCTTGAAA	0.448																																					p.Q1160K													.	.			0			c.C3478A												57.0	61.0	60.0					2																	179702468		2203	4300	6503	SO:0001583	missense	285025	exon23			GCACCTGCCCCTT	AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000420890.2:c.3478C>A	2.37:g.179702468G>T	ENSP00000395995:p.Gln1160Lys		74	0	0		69	0.07	5	NM_173648	0		0	H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	ENST00000420890.2	37		.	.	.	.	.	.	.	.	.	.	G	12.03	1.816381	0.32145	.	.	ENSG00000163492	ENST00000420890;ENST00000343876;ENST00000295723	T;T;T	0.44482	0.92;1.51;1.51	5.68	4.72	0.59763	.	0.667599	0.13754	N	0.365075	T	0.29588	0.0738	N	0.24115	0.695	0.09310	N	1	B;B	0.23806	0.063;0.091	B;B	0.18561	0.022;0.012	T	0.16660	-1.0395	10	0.40728	T	0.16	-0.637	10.5696	0.45192	0.0:0.1148:0.5552:0.33	.	585;585	Q6ZP82;Q6ZP82-2	CC141_HUMAN;.	K	1160;604;585	ENSP00000395995:Q1160K;ENSP00000344627:Q604K;ENSP00000295723:Q585K	ENSP00000295723:Q585K	Q	-	1	0	CCDC141	179410713	0.066000	0.20996	0.005000	0.12908	0.090000	0.18270	1.954000	0.40362	1.150000	0.42419	0.561000	0.74099	CAG			0.448	CCDC141-202	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_173648	
NFATC2	4773	mdanderson.org	37	20	50049078	50049078	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr20:50049078C>T	ENST00000396009.3	-	9	2467	c.2248G>A	c.(2248-2250)Gta>Ata	p.V750I	NFATC2_ENST00000609507.1_Missense_Mutation_p.V531I|NFATC2_ENST00000414705.1_Missense_Mutation_p.V730I|NFATC2_ENST00000610033.1_Missense_Mutation_p.V531I|NFATC2_ENST00000609943.1_Missense_Mutation_p.V730I|NFATC2_ENST00000371564.3_Missense_Mutation_p.V750I	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	750					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					TGGTAGAGTACGGCCGCTGGG	0.697																																					p.V750I													NFATC2,colon,carcinoma,0,1	NFATC2	0	1	0			c.G2248A												18.0	21.0	20.0					20																	50049078		2202	4300	6502	SO:0001583	missense	4773	exon9			AGAGTACGGCCGC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.2248G>A	20.37:g.50049078C>T	ENSP00000379330:p.Val750Ile		40	0	0		32	0.09	3	NM_012340	0		0	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Missense_Mutation	SNP	ENST00000396009.3	37	CCDS13437.1	.	.	.	.	.	.	.	.	.	.	C	12.17	1.856388	0.32791	.	.	ENSG00000101096	ENST00000371564;ENST00000396009;ENST00000414705	T;T;T	0.15834	2.39;2.39;2.4	5.45	5.45	0.79879	.	0.138929	0.47455	D	0.000226	T	0.12902	0.0313	L	0.34521	1.04	0.32230	N	0.574045	B;P;B;P	0.39157	0.355;0.662;0.119;0.555	B;B;B;B	0.28784	0.053;0.094;0.012;0.088	T	0.08889	-1.0700	10	0.21540	T	0.41	-24.6526	18.8911	0.92403	0.0:1.0:0.0:0.0	.	730;730;750;750	B5B2N9;B5B2P2;Q13469;B5B2N8	.;.;NFAC2_HUMAN;.	I	750;750;730	ENSP00000360619:V750I;ENSP00000379330:V750I;ENSP00000396471:V730I	ENSP00000360619:V750I	V	-	1	0	NFATC2	49482485	1.000000	0.71417	0.998000	0.56505	0.465000	0.32709	4.657000	0.61490	2.563000	0.86464	0.650000	0.86243	GTA			0.697	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000079730.2		NM_012340	
ZNF831	128611	mdanderson.org	37	20	57767022	57767022	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr20:57767022G>T	ENST00000371030.2	+	1	948	c.948G>T	c.(946-948)caG>caT	p.Q316H		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	316							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCGCCCTGCAGCGGCAGCAGG	0.711																																					p.Q316H													.	.			0			c.G948T												12.0	16.0	15.0					20																	57767022		1701	3874	5575	SO:0001583	missense	128611	exon1			CCTGCAGCGGCAG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.948G>T	20.37:g.57767022G>T	ENSP00000360069:p.Gln316His		26	0	0		21	0.14	3	NM_178457	0		0	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	37	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076345	0.55753	.	.	ENSG00000124203	ENST00000371030	T	0.10860	2.83	5.2	0.953	0.19590	.	.	.	.	.	T	0.24699	0.0599	M	0.68593	2.085	0.27377	N	0.95554	D	0.89917	1.0	D	0.71184	0.972	T	0.05468	-1.0883	9	0.72032	D	0.01	-2.6347	5.7576	0.18182	0.2728:0.1545:0.5727:0.0	.	316	Q5JPB2	ZN831_HUMAN	H	316	ENSP00000360069:Q316H	ENSP00000360069:Q316H	Q	+	3	2	ZNF831	57200417	0.969000	0.33509	1.000000	0.80357	0.776000	0.43924	0.223000	0.17719	0.551000	0.29008	0.655000	0.94253	CAG			0.711	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000079916.2		NM_178457	
STMN3	50861	mdanderson.org	37	20	62275591	62275591	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr20:62275591G>T	ENST00000370053.1	-	2	172	c.91C>A	c.(91-93)Ccc>Acc	p.P31T	STMN3_ENST00000540534.1_Missense_Mutation_p.P20T	NM_001276310.1|NM_015894.2	NP_001263239.1|NP_056978.2	Q9NZ72	STMN3_HUMAN	stathmin-like 3	31					cytoplasmic microtubule organization (GO:0031122)|negative regulation of Rac protein signal transduction (GO:0035021)|nervous system development (GO:0007399)|neuron projection development (GO:0031175)|regulation of cytoskeleton organization (GO:0051493)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of Rac GTPase activity (GO:0032314)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	protein domain specific binding (GO:0019904)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)	8	all_cancers(38;2.31e-11)|all_epithelial(29;7.76e-13)		Epithelial(9;1.9e-09)|all cancers(9;1.22e-08)|BRCA - Breast invasive adenocarcinoma(10;8.86e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.00559)			ACGGTATTGGGGTGCGGCTGT	0.637																																					p.P31T													.	.			0			c.C91A												155.0	123.0	134.0					20																	62275591		2203	4300	6503	SO:0001583	missense	50861	exon2			TATTGGGGTGCGG	AF069709	CCDS13529.1, CCDS63330.1	20q13.3	2007-01-22			ENSG00000197457	ENSG00000197457			15926	protein-coding gene	gene with protein product		608362				9603203, 10655513	Standard	NM_001276310		Approved	SCLIP	uc002yfr.2	Q9NZ72	OTTHUMG00000032985	ENST00000370053.1:c.91C>A	20.37:g.62275591G>T	ENSP00000359070:p.Pro31Thr		35	0	0		18	0.11	2	NM_015894	34	0.00	0	B3KSQ5|B7WP52|B7Z5G4|O75527|Q969Y4	Missense_Mutation	SNP	ENST00000370053.1	37	CCDS13529.1	.	.	.	.	.	.	.	.	.	.	G	11.12	1.545785	0.27652	.	.	ENSG00000197457	ENST00000370053;ENST00000540534	.	.	.	4.2	2.14	0.27477	.	0.000000	0.64402	U	0.000008	T	0.43366	0.1244	L	0.57536	1.79	0.33696	D	0.613871	B	0.27498	0.18	B	0.14578	0.011	T	0.49615	-0.8921	9	0.17832	T	0.49	-25.8329	12.3027	0.54884	0.0:0.0:0.6913:0.3087	.	31	Q9NZ72	STMN3_HUMAN	T	31;20	.	ENSP00000359070:P31T	P	-	1	0	STMN3	61746035	1.000000	0.71417	0.896000	0.35187	0.597000	0.36814	2.194000	0.42668	0.216000	0.20781	0.313000	0.20887	CCC			0.637	STMN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000080163.1		NM_015894	
SON	6651	hgsc.bcm.edu;bcgsc.ca;mdanderson.org	37	21	34923420	34923420	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr21:34923420G>T	ENST00000356577.4	+	3	2358	c.1883G>T	c.(1882-1884)gGg>gTg	p.G628V	SON_ENST00000290239.6_Missense_Mutation_p.G628V|SON_ENST00000381679.4_Missense_Mutation_p.G628V|SON_ENST00000300278.4_Missense_Mutation_p.G628V|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	628					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CTGGCAACAGGGGTGCTGGAG	0.647																																					p.G628V													.	.			0			c.G1883T												30.0	35.0	33.0					21																	34923420		2203	4299	6502	SO:0001583	missense	6651	exon3			CAACAGGGGTGCT	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.1883G>T	21.37:g.34923420G>T	ENSP00000348984:p.Gly628Val		65	0	0		105	0.07	7	NM_032195	104	0.01	1	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	ENST00000356577.4	37	CCDS13629.1	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585803	0.28268	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.14516	2.66;2.66;2.66;2.5	4.44	4.44	0.53790	.	0.105050	0.43260	D	0.000598	T	0.20170	0.0485	N	0.24115	0.695	0.48901	D	0.999726	D;D;D	0.89917	0.999;1.0;0.991	D;D;P	0.77004	0.964;0.989;0.857	T	0.01021	-1.1478	10	0.28530	T	0.3	.	10.9495	0.47321	0.0914:0.0:0.9086:0.0	.	628;628;628	P18583;P18583-3;P18583-6	SON_HUMAN;.;.	V	628	ENSP00000348984:G628V;ENSP00000290239:G628V;ENSP00000300278:G628V;ENSP00000371095:G628V	ENSP00000290239:G628V	G	+	2	0	SON	33845290	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.023000	0.30065	2.764000	0.94973	0.555000	0.69702	GGG			0.647	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000140978.2		NM_138927	
CBS	875	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	21	44485607	44485607	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr21:44485607C>T	ENST00000398165.3	-	7	815	c.556G>A	c.(556-558)Gct>Act	p.A186T	CBS_ENST00000398168.1_Missense_Mutation_p.A186T|CBS_ENST00000359624.3_Missense_Mutation_p.A186T|CBS_ENST00000352178.5_Missense_Mutation_p.A186T|CBS_ENST00000544202.1_Missense_Mutation_p.A98T|CBS_ENST00000398158.1_Missense_Mutation_p.A186T|CBS_ENST00000470912.1_5'Flank	NM_000071.2	NP_000062.1	P35520	CBS_HUMAN	cystathionine-beta-synthase	186					cellular nitrogen compound metabolic process (GO:0034641)|cysteine biosynthetic process from serine (GO:0006535)|cysteine biosynthetic process via cystathionine (GO:0019343)|homocysteine catabolic process (GO:0043418)|homocysteine metabolic process (GO:0050667)|hydrogen sulfide biosynthetic process (GO:0070814)|L-cysteine catabolic process (GO:0019448)|L-serine catabolic process (GO:0006565)|L-serine metabolic process (GO:0006563)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|transsulfuration (GO:0019346)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenyl nucleotide binding (GO:0030554)|cystathionine beta-synthase activity (GO:0004122)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|modified amino acid binding (GO:0072341)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|ubiquitin protein ligase binding (GO:0031625)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(8)	17					L-Cysteine(DB00151)|L-Serine(DB00133)|S-Adenosylmethionine(DB00118)	ACAATCTCAGCCCCCAGTGCC	0.657																																					p.A186T													.	.			0			c.G556A												39.0	42.0	41.0					21																	44485607		2203	4300	6503	SO:0001583	missense	875	exon7			TCTCAGCCCCCAG	L14577	CCDS13693.1	21q22.3	2014-09-17			ENSG00000160200	ENSG00000160200	4.2.1.22		1550	protein-coding gene	gene with protein product		613381				9790750	Standard	NM_000071		Approved	HIP4	uc002zcv.2	P35520	OTTHUMG00000086834	ENST00000398165.3:c.556G>A	21.37:g.44485607C>T	ENSP00000381231:p.Ala186Thr		76	0	0		103	0.23	24	NM_000071	5	0.40	2	B2R993|D3DSK4|Q99425|Q9BWC5	Missense_Mutation	SNP	ENST00000398165.3	37	CCDS13693.1	.	.	.	.	.	.	.	.	.	.	C	18.93	3.728661	0.69074	.	.	ENSG00000160200	ENST00000398158;ENST00000398165;ENST00000359624;ENST00000352178;ENST00000398168;ENST00000539520;ENST00000544202	D;D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91;-4.91	4.65	3.75	0.43078	Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	D	0.98820	0.9602	M	0.87900	2.915	0.58432	D	0.999993	D;D	0.64830	0.994;0.983	D;D	0.67548	0.952;0.919	D	0.99453	1.0941	10	0.87932	D	0	-25.7281	13.0098	0.58725	0.0:0.8375:0.1625:0.0	.	186;143	P35520;B7Z2D6	CBS_HUMAN;.	T	186;186;186;186;186;143;98	ENSP00000381225:A186T;ENSP00000381231:A186T;ENSP00000352643:A186T;ENSP00000344460:A186T;ENSP00000381234:A186T;ENSP00000439332:A98T	ENSP00000344460:A186T	A	-	1	0	CBS	43358676	1.000000	0.71417	0.815000	0.32552	0.219000	0.24729	6.387000	0.73191	1.056000	0.40484	-0.323000	0.08544	GCT			0.657	CBS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000195525.1		NM_000071	
KRTAP10-10	353333	hgsc.bcm.edu	37	21	46057832	46057832	+	Silent	SNP	T	T	A	rs149762795	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr21:46057832T>A	ENST00000380095.1	+	1	560	c.498T>A	c.(496-498)acT>acA	p.T166T	TSPEAR_ENST00000323084.4_Intron	NM_181688.1	NP_859016.1	P60014	KR10A_HUMAN	keratin associated protein 10-10	166	15 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				NS(1)|endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	13						GGGCTTCCACTTCATGCTGCC	0.622													T|||	19	0.00379393	0.0008	0.0029	5008	,	,		20544	0.0		0.0099	False		,,,				2504	0.0061				p.T166T													KRTAP10-10,NS,carcinoma,0,1	KRTAP10-10	0	1	0			c.T498A							T	,	12,4394	19.1+/-41.9	0,12,2191	222.0	207.0	212.0		,498	-3.5	0.1	21	dbSNP_134	212	98,8502	54.4+/-115.2	1,96,4203	no	intron,coding-synonymous	TSPEAR,KRTAP10-10	NM_144991.2,NM_181688.1	,	1,108,6394	AA,AT,TT		1.1395,0.2724,0.8458	,	,166/252	46057832	110,12896	2203	4300	6503	SO:0001819	synonymous_variant	353333	exon1			TTCCACTTCATGC	AJ566387	CCDS33585.1	21q22.3	2006-03-13			ENSG00000221859	ENSG00000221859		"""Keratin associated proteins"""	22972	protein-coding gene	gene with protein product							Standard	NM_181688		Approved	KAP10.10, KAP18.10, KRTAP18-10	uc002zfq.3	P60014	OTTHUMG00000057631	ENST00000380095.1:c.498T>A	21.37:g.46057832T>A			41	0	0		70	0.07	5	NM_181688	0		0		Silent	SNP	ENST00000380095.1	37	CCDS33585.1																																																																																			0.007		0.622	KRTAP10-10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000128034.1		NM_181688	
POM121L4P	266697	ucsc.edu	37	22	21044345	21044345	+	RNA	SNP	T	T	C	rs372189549	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr22:21044345T>C	ENST00000412250.3	+	0	27									POM121 transmembrane nucleoporin-like 4 pseudogene											breast(2)	2						GCCCAGGAGCTGGGAGTCACC	0.622													N|||	92	0.0183706	0.0492	0.0072	5008	,	,		12979	0.0069		0.007	False		,,,				2504	0.0082				.													.	POM121L4P	3		0			.																																											266697	.			AGGAGCTGGGAGT			22q11.2	2012-03-13	2012-03-13		ENSG00000217261	ENSG00000217261			19326	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 4 pseudogene (rat)"", ""POM121 membrane glycoprotein-like 4 pseudogene"""				Standard	NR_024592		Approved		uc002zsw.2		OTTHUMG00000150756		22.37:g.21044345T>C			22	0.1818181818	4		28	0.25	7	.	0		0		Silent	SNP	ENST00000412250.3	37																																																																																						0.622	POM121L4P-002	KNOWN	basic|exp_conf	processed_transcript	pseudogene		OTTHUMT00000468456.1			
DZIP3	9666	bcgsc.ca;mdanderson.org	37	3	108392975	108392975	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr3:108392975G>T	ENST00000361582.3	+	24	2870	c.2640G>T	c.(2638-2640)caG>caT	p.Q880H	DZIP3_ENST00000463306.1_Missense_Mutation_p.Q880H	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	880					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ATCTAGAGCAGACTGAAAAGG	0.408																																					p.Q880H													.	DZIP3	111		0			c.G2640T												168.0	164.0	165.0					3																	108392975		2203	4299	6502	SO:0001583	missense	9666	exon24			AGAGCAGACTGAA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.2640G>T	3.37:g.108392975G>T	ENSP00000355028:p.Gln880His		81	0	0		68	0.07	5	NM_014648	84	0.00	0	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	37	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087970	0.55968	.	.	ENSG00000198919	ENST00000361582;ENST00000463306	D;D	0.84442	-1.85;-1.85	4.56	2.77	0.32553	.	0.000000	0.43416	D	0.000565	D	0.85635	0.5742	L	0.38531	1.155	0.31874	N	0.619393	D;D	0.67145	0.99;0.996	D;D	0.74023	0.979;0.982	D	0.83576	0.0115	10	0.49607	T	0.09	-7.6388	6.675	0.23090	0.209:0.0:0.791:0.0	.	498;880	D3DN61;Q86Y13	.;DZIP3_HUMAN	H	880	ENSP00000355028:Q880H;ENSP00000419981:Q880H	ENSP00000355028:Q880H	Q	+	3	2	DZIP3	109875665	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.306000	0.33505	0.558000	0.29135	0.563000	0.77884	CAG			0.408	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000353968.1		NM_014648	
MUC4	4585	mdanderson.org	37	3	195510780	195510780	+	Silent	SNP	G	G	A	rs77303944	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr3:195510780G>A	ENST00000463781.3	-	2	8130	c.7671C>T	c.(7669-7671)caC>caT	p.H2557H	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Silent_p.H2557H	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAGAGGTGGCGTGACCTGTGG	0.577													.|||	6	0.00119808	0.0023	0.0029	5008	,	,		12450	0.0		0.0	False		,,,				2504	0.001				p.H2557H													.	.			0			c.C7671T												71.0	59.0	62.0					3																	195510780		678	1590	2268	SO:0001819	synonymous_variant	4585	exon2			GGTGGCGTGACCT	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.7671C>T	3.37:g.195510780G>A			220	0.0136363636	3		167	0.10	16	NM_018406	5	0.00	0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	37	CCDS54700.1																																																																																			0.009		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
SH3TC1	54436	mdanderson.org	37	4	8226907	8226907	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr4:8226907G>T	ENST00000245105.3	+	11	1316	c.1249G>T	c.(1249-1251)Gta>Tta	p.V417L	SH3TC1_ENST00000539824.1_Missense_Mutation_p.V341L|SH3TC1_ENST00000514274.1_3'UTR	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	417										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCCAGACTCAGTAGAGGAAGC	0.577																																					p.V417L	NSCLC(145;2298 2623 35616 37297)												.	.			0			c.G1249T												72.0	69.0	70.0					4																	8226907		2203	4300	6503	SO:0001583	missense	54436	exon11			GACTCAGTAGAGG	AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.1249G>T	4.37:g.8226907G>T	ENSP00000245105:p.Val417Leu		69	0	0		50	0.06	3	NM_018986	15	0.00	0	Q4W5G5	Missense_Mutation	SNP	ENST00000245105.3	37	CCDS3399.1	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.049498	0.00394	.	.	ENSG00000125089	ENST00000382516;ENST00000245105;ENST00000539824;ENST00000535265	T;T	0.45276	0.9;0.9	2.2	-3.9	0.04181	.	1.035180	0.07697	N	0.939635	T	0.09642	0.0237	N	0.00621	-1.32	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25847	-1.0120	10	0.02654	T	1	0.1201	4.9857	0.14189	0.0:0.5115:0.2149:0.2736	.	417	Q8TE82	S3TC1_HUMAN	L	155;417;341;246	ENSP00000245105:V417L;ENSP00000441045:V341L	ENSP00000245105:V417L	V	+	1	0	SH3TC1	8277807	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.683000	0.05179	-0.994000	0.03463	-0.521000	0.04368	GTA			0.577	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000206991.2		NM_018986	
KIT	3815	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	55599320	55599320	+	Missense_Mutation	SNP	G	G	C	rs121913506		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr4:55599320G>C	ENST00000288135.5	+	17	2543	c.2446G>C	c.(2446-2448)Gac>Cac	p.D816H		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	816	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> F (in mastocytosis; requires 2 nucleotide substitutions; somatic mutation; constitutively activated and is much more rapidly autophosphorylated than wild type). {ECO:0000269|PubMed:9990072}.|D -> H (in a testicular tumor; seminoma; somatic mutation; constitutively activated; dbSNP:rs28933969). {ECO:0000269|PubMed:10362788}.|D -> V (in mast cell leukemia and mastocytosis; somatic mutation; constitutively activated; loss of interaction with MPDZ). {ECO:0000269|PubMed:7691885, ECO:0000269|PubMed:9990072}.|D -> Y (in acute myeloid leukemia, mastocytosis and a germ cell tumor of the testis; somatic mutation; constitutively activated). {ECO:0000269|PubMed:16175573, ECO:0000269|PubMed:17344846, ECO:0000269|PubMed:9657776, ECO:0000269|PubMed:9990072}.		actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D816Y(46)|p.D816H(42)|p.D816F(6)|p.D816I(2)|p.D816N(1)|p.R815_D816insVI(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTAGCCAGAGACATCAAGAA	0.393		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.D816H			yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,932	KIT	0	932	98	Substitution - Missense(97)|Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(68)|testis(15)|ovary(10)|soft_tissue(3)|genital_tract(1)|skin(1)	c.G2446C												144.0	146.0	145.0					4																	55599320		2203	4300	6503	SO:0001583	missense	3815	exon17	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	GCCAGAGACATCA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2446G>C	4.37:g.55599320G>C	ENSP00000288135:p.Asp816His		63	0	0		80	0.35	28	NM_000222	253	0.40	102	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	37	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721319	0.68959	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.83837	-1.77;-1.77	5.62	5.62	0.85841	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000011	T	0.80732	0.4679	L	0.49699	1.58	0.80722	D	1	P;B	0.44734	0.842;0.353	B;B	0.38156	0.266;0.154	D	0.83488	0.0068	10	0.72032	D	0.01	.	19.6484	0.95791	0.0:0.0:1.0:0.0	rs28933969	812;816	P10721-2;P10721	.;KIT_HUMAN	H	816;812	ENSP00000288135:D816H;ENSP00000390987:D812H	ENSP00000288135:D816H	D	+	1	0	KIT	55294077	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.659000	0.90383	0.585000	0.79938	GAC			0.393	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250618.1			
CCDC158	339965	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	77290777	77290777	+	Splice_Site	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr4:77290777C>T	ENST00000388914.3	-	10	1302		c.e10-1			NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158									p.?(2)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						GTAGATCAGCCTAAAAAAAGA	0.393																																					.													CCDC158,NS,carcinoma,0,1	CCDC158	0	1	2	Unknown(2)	lung(2)	c.1150-1G>A												67.0	65.0	65.0					4																	77290777		1891	4124	6015	SO:0001630	splice_region_variant	339965	exon11			ATCAGCCTAAAAA	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1150-1G>A	4.37:g.77290777C>T			82	0	0		79	0.23	18	NM_001042784	0		0	Q8IYQ1|Q8N7D4|Q8N7E3	Splice_Site	SNP	ENST00000388914.3	37	CCDS43242.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051053	0.36181	.	.	ENSG00000163749	ENST00000388914	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.141	0.86752	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC158	77509801	1.000000	0.71417	0.957000	0.39632	0.186000	0.23388	5.052000	0.64263	2.572000	0.86782	0.585000	0.79938	.			0.393	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000362694.2		NM_001042784	Intron
DMGDH	29958	mdanderson.org	37	5	78328619	78328619	+	Silent	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr5:78328619G>T	ENST00000255189.3	-	9	1436	c.1408C>A	c.(1408-1410)Cga>Aga	p.R470R	DMGDH_ENST00000380311.4_Silent_p.R269R|DMGDH_ENST00000540686.1_Silent_p.R90R	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	470					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CCACTGACTCGTTGAGTCGGC	0.473																																					p.R470R													.	.			0			c.C1408A												125.0	129.0	128.0					5																	78328619		2203	4300	6503	SO:0001819	synonymous_variant	29958	exon9			TGACTCGTTGAGT	AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.1408C>A	5.37:g.78328619G>T			73	0	0		49	0.06	3	NM_013391	2	0.00	0	B2RBN0|B4E1J9	Silent	SNP	ENST00000255189.3	37	CCDS4044.1																																																																																					0.473	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000226963.3		NM_013391	
MUC21	394263	broad.mit.edu	37	6	30954534	30954534	+	Silent	SNP	T	T	A			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr6:30954534T>A	ENST00000376296.3	+	2	823	c.582T>A	c.(580-582)acT>acA	p.T194T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	194	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T194T(1)		NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACTGCCACCAACT	0.612																																					p.T194T													MUC21,NS,carcinoma,0,3	MUC21	98	3	1	Substitution - coding silent(1)	endometrium(1)	c.T582A												178.0	168.0	171.0					6																	30954534		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CAGCACTGCCACC	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.582T>A	6.37:g.30954534T>A			52	0.0192307692	1		54	0.07	4	NM_001010909	2	0.00	0	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	37	CCDS34388.1																																																																																					0.612	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000128579.3		NM_001010909	
GPR6	2830	mdanderson.org	37	6	110300885	110300885	+	Silent	SNP	C	C	A			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr6:110300885C>A	ENST00000275169.3	+	1	588	c.570C>A	c.(568-570)gcC>gcA	p.A190A	GPR6_ENST00000414000.2_Silent_p.A205A	NM_005284.3	NP_005275.1	P46095	GPR6_HUMAN	G protein-coupled receptor 6	190					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;1.64e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;2.83e-05)|all_lung(197;0.00016)|Lung NSC(302;0.000318)|Colorectal(196;0.0488)		BRCA - Breast invasive adenocarcinoma(108;8.01e-05)|Epithelial(106;8.76e-05)|all cancers(137;0.000197)|OV - Ovarian serous cystadenocarcinoma(136;0.0307)		TCCTGCTTGCCGCCACTTGGA	0.692																																					p.A190A													.	.			0			c.C570A												25.0	26.0	26.0					6																	110300885		2203	4300	6503	SO:0001819	synonymous_variant	2830	exon1			GCTTGCCGCCACT		CCDS5079.1, CCDS69172.1	6q21	2012-08-21				ENSG00000146360		"""GPCR / Class A : Orphans"""	4515	protein-coding gene	gene with protein product		600553				8530049	Standard	NM_001286099		Approved		uc003ptu.3	P46095	OTTHUMG00000015354	ENST00000275169.3:c.570C>A	6.37:g.110300885C>A			37	0	0		39	0.08	3	NM_005284	0		0	B4DHS9|J3KQR3|Q17RJ7|Q5SYL0	Silent	SNP	ENST00000275169.3	37	CCDS5079.1																																																																																					0.692	GPR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041774.1			
POM121	9883	broad.mit.edu;mdanderson.org	37	7	72418901	72418901	+	IGR	SNP	G	G	A	rs201837093		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr7:72418901G>A	ENST00000434423.2	+	0	3750				POM121_ENST00000446813.1_Silent_p.P964P|POM121_ENST00000395270.1_Silent_p.P964P|NSUN5P2_ENST00000388955.4_RNA			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AACACAGCCCGAGGAAGGGAC	0.488																																					p.P964P													.	POM121	131		0			c.G2892A							A		0,4396		0,0,2198	45.0	51.0	49.0			-0.4	0.0	7		49	1,8599	1.2+/-3.3	0,1,4299	no	near-gene-3				0,1,6497	AA,AG,GG		0.0116,0.0,0.0077			72418901	1,12995	2198	4300	6498	SO:0001628	intergenic_variant	9883	exon16			CAGCCCGAGGAAG	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72418901G>A			53	0	0		61	0.13	8	NM_001257190	8	0.13	1	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Silent	SNP	ENST00000434423.2	37																																																																																						0.488	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000347344.1			
PRKAR2B	5577	broad.mit.edu;mdanderson.org	37	7	106799908	106799908	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr7:106799908G>T	ENST00000265717.4	+	11	1397	c.1138G>T	c.(1138-1140)Gca>Tca	p.A380S		NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	380					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						GGATGTGCAAGCATTTGAAAG	0.358																																					p.A380S													.	PRKAR2B	34		0			c.G1138T												90.0	82.0	85.0					7																	106799908		2203	4300	6503	SO:0001583	missense	5577	exon11			GTGCAAGCATTTG		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.1138G>T	7.37:g.106799908G>T	ENSP00000265717:p.Ala380Ser		80	0	0		128	0.04	5	NM_002736	37	0.00	0	A4D0R9	Missense_Mutation	SNP	ENST00000265717.4	37	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.708809	0.89018	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	D	0.92805	-3.11	5.86	5.86	0.93980	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.94879	0.8345	L	0.45744	1.44	0.80722	D	1	D	0.63880	0.993	D	0.80764	0.994	D	0.94168	0.7420	10	0.49607	T	0.09	-5.3992	20.1986	0.98248	0.0:0.0:1.0:0.0	.	380	P31323	KAP3_HUMAN	S	380;380;367	ENSP00000265717:A380S	ENSP00000265717:A380S	A	+	1	0	PRKAR2B	106587144	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.817000	0.86213	2.781000	0.95711	0.650000	0.86243	GCA			0.358	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268386.1			
PLXNA4	91584	broad.mit.edu	37	7	131849922	131849922	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr7:131849922A>G	ENST00000359827.3	-	23	5286	c.4324T>C	c.(4324-4326)Ttt>Ctt	p.F1442L	PLXNA4_ENST00000321063.4_Missense_Mutation_p.F1442L			Q9HCM2	PLXA4_HUMAN	plexin A4	1442					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AGGAAAGTAAACCAATTGGTC	0.522																																					p.F1442L													.	PLXNA4	873		0			c.T4324C												106.0	117.0	114.0					7																	131849922		2179	4279	6458	SO:0001583	missense	91584	exon23			AAGTAAACCAATT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4324T>C	7.37:g.131849922A>G	ENSP00000352882:p.Phe1442Leu		61	0	0		62	0.05	3	NM_020911	0		0	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	37	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.612496	0.87258	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.08984	3.03;3.03	5.8	5.8	0.92144	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.21468	0.0517	L	0.48260	1.515	0.80722	D	1	D	0.76494	0.999	D	0.72075	0.976	T	0.02491	-1.1151	10	0.21540	T	0.41	.	16.1549	0.81657	1.0:0.0:0.0:0.0	.	1442	Q9HCM2	PLXA4_HUMAN	L	1442	ENSP00000323194:F1442L;ENSP00000352882:F1442L	ENSP00000323194:F1442L	F	-	1	0	PLXNA4	131500462	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.327000	0.79147	2.209000	0.71365	0.533000	0.62120	TTT			0.522	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338422.2		NM_181775	
XKR9	389668	mdanderson.org	37	8	71646414	71646414	+	Missense_Mutation	SNP	G	G	T	rs140733779		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr8:71646414G>T	ENST00000408926.3	+	5	1411	c.877G>T	c.(877-879)Gtt>Ttt	p.V293F	XKR9_ENST00000520273.1_Intron|XKR9_ENST00000520030.1_Missense_Mutation_p.V293F	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	293						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			TTATTATATTGTTAGGGTACT	0.328																																					p.V293F													XKR9,NS,carcinoma,0,1	XKR9	0	1	0			c.G877T												90.0	87.0	88.0					8																	71646414		2203	4299	6502	SO:0001583	missense	389668	exon5			TATATTGTTAGGG	AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.877G>T	8.37:g.71646414G>T	ENSP00000386141:p.Val293Phe		110	0	0		126	0.04	5	NM_001011720	2	0.00	0	B2RNS9|B9EH74	Missense_Mutation	SNP	ENST00000408926.3	37	CCDS34905.1	.	.	.	.	.	.	.	.	.	.	G	1.339	-0.594507	0.03771	.	.	ENSG00000221947	ENST00000408926;ENST00000520030	T;T	0.65732	-0.17;-0.17	4.98	2.97	0.34412	.	0.406258	0.26553	N	0.023728	T	0.34571	0.0902	N	0.13140	0.3	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.04522	-1.0945	10	0.20046	T	0.44	-4.2178	1.1338	0.01751	0.1473:0.2355:0.3757:0.2415	.	293	Q5GH70	XKR9_HUMAN	F	293	ENSP00000386141:V293F;ENSP00000431088:V293F	ENSP00000386141:V293F	V	+	1	0	XKR9	71808968	0.070000	0.21116	0.379000	0.26080	0.126000	0.20510	0.314000	0.19432	1.289000	0.44618	0.557000	0.71058	GTT			0.328	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378752.1		NM_001011720	
WISP1	8840	broad.mit.edu	37	8	134232843	134232843	+	Silent	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr8:134232843C>T	ENST00000250160.6	+	3	475	c.369C>T	c.(367-369)tgC>tgT	p.C123C	WISP1_ENST00000517423.1_Intron|WISP1_ENST00000220856.6_Intron|WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	123	VWFC. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GTGTGGGCTGCGTCCTGGATG	0.637																																					p.C123C													.	WISP1	64		0			c.C369T												82.0	68.0	73.0					8																	134232843		2203	4300	6503	SO:0001819	synonymous_variant	8840	exon3			GGGCTGCGTCCTG	AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.369C>T	8.37:g.134232843C>T			308	0	0		396	0.02	6	NM_003882	2	0.00	0	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Silent	SNP	ENST00000250160.6	37	CCDS6371.1																																																																																					0.637	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000378794.2		NM_003882	
SLC39A4	55630	mdanderson.org	37	8	145640175	145640175	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr8:145640175G>T	ENST00000301305.3	-	5	1015	c.910C>A	c.(910-912)Cag>Aag	p.Q304K	SLC39A4_ENST00000276833.5_Missense_Mutation_p.Q279K|SLC39A4_ENST00000531013.1_5'Flank	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	304					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			CCACTCAGCTGCTGTTGGAGC	0.662																																					p.Q304K													SLC39A4_ENST00000276833,NS,carcinoma,+1,2	SLC39A4_ENST00000276833	1	2	0			c.C910A												52.0	54.0	53.0					8																	145640175		2203	4300	6503	SO:0001583	missense	55630	exon5			TCAGCTGCTGTTG	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.910C>A	8.37:g.145640175G>T	ENSP00000301305:p.Gln304Lys		62	0	0		79	0.05	4	NM_130849	3	0.00	0	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	37	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257677	0.80246	.	.	ENSG00000147804	ENST00000276833;ENST00000301305	T;T	0.60920	0.15;0.34	4.98	4.98	0.66077	.	0.373720	0.26828	N	0.022284	T	0.60805	0.2297	M	0.62723	1.935	0.34405	D	0.695765	P;D	0.59357	0.808;0.985	B;P	0.47206	0.304;0.541	T	0.75764	-0.3203	10	0.72032	D	0.01	-19.829	13.7934	0.63155	0.0:0.0:1.0:0.0	.	304;279	Q6P5W5;A6NDY5	S39A4_HUMAN;.	K	279;304	ENSP00000276833:Q279K;ENSP00000301305:Q304K	ENSP00000276833:Q279K	Q	-	1	0	SLC39A4	145610983	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.092000	0.57707	2.351000	0.79841	0.543000	0.68304	CAG			0.662	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382688.1			
TMEM245	23731	mdanderson.org	37	9	111795757	111795757	+	Silent	SNP	G	G	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr9:111795757G>T	ENST00000374586.3	-	17	2455	c.2424C>A	c.(2422-2424)ggC>ggA	p.G808G		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	808						integral component of membrane (GO:0016021)											CCACTGCCAAGCCTGTCAGGT	0.438																																					p.G808G													.	.			0			c.C2424A												61.0	66.0	64.0					9																	111795757		1921	4112	6033	SO:0001819	synonymous_variant	23731	exon17			TGCCAAGCCTGTC	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.2424C>A	9.37:g.111795757G>T			55	0	0		52	0.06	3	NM_032012	89	0.00	0	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Silent	SNP	ENST00000374586.3	37	CCDS43858.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326591	0.24080	.	.	ENSG00000106771	ENST00000413712	.	.	.	5.42	-0.427	0.12310	.	.	.	.	.	T	0.52058	0.1711	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43475	-0.9389	4	.	.	.	-12.6556	6.8862	0.24202	0.2755:0.2088:0.5157:0.0	.	.	.	.	I	401	.	.	L	-	1	0	C9orf5	110835578	0.992000	0.36948	0.994000	0.49952	0.994000	0.84299	0.201000	0.17276	0.166000	0.19597	0.467000	0.42956	CTT			0.438	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053587.2		NM_032012	
PNPLA4	8228	broad.mit.edu	37	X	7868821	7868821	+	Missense_Mutation	SNP	A	A	G			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:7868821A>G	ENST00000381042.4	-	7	838	c.668T>C	c.(667-669)cTt>cCt	p.L223P	PNPLA4_ENST00000537427.1_Missense_Mutation_p.L136P|PNPLA4_ENST00000444736.1_Missense_Mutation_p.L223P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	223					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				TGGGGGAAAAAGGGCTTGGTT	0.353																																					p.L223P													.	PNPLA4	24		0			c.T668C												57.0	52.0	54.0					X																	7868821		2203	4299	6502	SO:0001583	missense	8228	exon7			GGAAAAAGGGCTT	U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.668T>C	X.37:g.7868821A>G	ENSP00000370430:p.Leu223Pro		292	0.0034246575	1		322	0.01	4	NM_004650	37	0.00	0	A8K1H3|B4E362|Q8WW83	Missense_Mutation	SNP	ENST00000381042.4	37	CCDS14129.1	.	.	.	.	.	.	.	.	.	.	A	13.79	2.341460	0.41498	.	.	ENSG00000006757	ENST00000381042;ENST00000444736;ENST00000537427	T;T;T	0.81078	-1.45;-1.45;-1.45	4.38	4.38	0.52667	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.193685	0.33127	N	0.005243	D	0.89866	0.6839	M	0.89715	3.055	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90635	0.4570	10	0.87932	D	0	-22.634	9.3053	0.37872	1.0:0.0:0.0:0.0	.	223	P41247	PLPL4_HUMAN	P	223;223;136	ENSP00000370430:L223P;ENSP00000415245:L223P;ENSP00000443157:L136P	ENSP00000370430:L223P	L	-	2	0	PNPLA4	7828821	1.000000	0.71417	0.139000	0.22197	0.388000	0.30384	5.486000	0.66856	1.452000	0.47756	0.481000	0.45027	CTT			0.353	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055687.1		NM_004650	
REPS2	9185	mdanderson.org	37	X	17072945	17072945	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:17072945C>T	ENST00000357277.3	+	8	1157	c.986C>T	c.(985-987)gCt>gTt	p.A329V	REPS2_ENST00000380064.4_Missense_Mutation_p.A189V|REPS2_ENST00000303843.7_Missense_Mutation_p.A328V	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	329	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH 2. {ECO:0000255|PROSITE- ProRule:PRU00077}.				epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					CTTAGTGATGCTGACTGTGAT	0.512																																					p.A329V													.	.			0			c.C986T												210.0	170.0	184.0					X																	17072945		2203	4300	6503	SO:0001583	missense	9185	exon8			GTGATGCTGACTG	AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.986C>T	X.37:g.17072945C>T	ENSP00000349824:p.Ala329Val		55	0	0		69	0.06	4	NM_004726	1	0.00	0	A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	ENST00000357277.3	37	CCDS14180.2	.	.	.	.	.	.	.	.	.	.	C	3.386	-0.125337	0.06795	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.23147	1.92;1.92;1.92	5.13	3.33	0.38152	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.200045	0.35151	N	0.003410	T	0.05090	0.0136	N	0.00193	-1.875	0.33025	D	0.529372	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.16722	0.007;0.002;0.016	T	0.14172	-1.0482	10	0.14656	T	0.56	-5.6278	6.7003	0.23221	0.0:0.6332:0.0:0.3668	.	189;328;329	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	V	329;329;328;189	ENSP00000349824:A329V;ENSP00000306033:A328V;ENSP00000369404:A189V	ENSP00000306033:A328V	A	+	2	0	REPS2	16982866	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	4.150000	0.58098	1.070000	0.40811	-0.191000	0.12829	GCT			0.512	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000316778.1		NM_004726	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382500	24382500	+	IGR	SNP	T	T	C			TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:24382500T>C								AC004552.1 (15477 upstream) : PDK3 (100837 downstream)																							tagctgctgctgctgctcctg	0.632													-|||	2	0.000529801	0.0008	0.0	3775	,	,		7436	0.001		0.0	False		,,,				2504	0.0				p.A541A													.	.			0			c.T1623C												3.0	3.0	3.0					X																	24382500		1309	3036	4345	SO:0001628	intergenic_variant	100130302	exon1			TGCTGCTGCTGCT																													X.37:g.24382500T>C			66	0	0		85	0.12	10	NM_001136234	0		0		Silent	SNP		37																																																																																					0	0.632										
FAM104B	90736	mdanderson.org	37	X	55172630	55172630	+	Nonsense_Mutation	SNP	G	G	A	rs113263757		TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:55172630G>A	ENST00000358460.4	-	3	388	c.235C>T	c.(235-237)Cag>Tag	p.Q79*	FAM104B_ENST00000489298.1_Nonsense_Mutation_p.Q78*|FAM104B_ENST00000425133.2_Nonsense_Mutation_p.Q80*|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000477847.2_Nonsense_Mutation_p.Q76*|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000332132.4_Nonsense_Mutation_p.Q80*			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	79										endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						TGCAAGAACTGGGGAAAGTTT	0.493																																					p.Q80X													.	.			0			c.C238T												127.0	104.0	112.0					X																	55172630		2203	4300	6503	SO:0001587	stop_gained	90736	exon3			AGAACTGGGGAAA	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.235C>T	X.37:g.55172630G>A	ENSP00000364101:p.Gln79*		34	0.0294117647	1		36	0.08	3	NM_001166700	33	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Nonsense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	g	11.17	1.559418	0.27827	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	.	.	.	1.6	1.6	0.23607	.	0.325359	0.21941	U	0.066869	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-0.2487	6.0913	0.19995	0.0:0.0:1.0:0.0	.	.	.	.	X	79;80;80;76;78	.	ENSP00000333394:Q80X	Q	-	1	0	FAM104B	55189355	0.905000	0.30787	0.015000	0.15790	0.033000	0.12548	1.600000	0.36762	1.084000	0.41184	0.436000	0.28706	CAG			0.493	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
FAM104B	90736	mdanderson.org	37	X	55172645	55172645	+	Missense_Mutation	SNP	C	C	G	rs1047042	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:55172645C>G	ENST00000358460.4	-	3	373	c.220G>C	c.(220-222)Gat>Cat	p.D74H	FAM104B_ENST00000489298.1_Missense_Mutation_p.D73H|FAM104B_ENST00000425133.2_Missense_Mutation_p.D75H|FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000477847.2_Missense_Mutation_p.D71H|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000332132.4_Missense_Mutation_p.D75H			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B	74				D -> V (in Ref. 1; BAG61768). {ECO:0000305}.						endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						AAGTTTGCATCGGGTTCAGTA	0.468													C|||	5	0.0013245	0.0023	0.0	3775	,	,		14416	0.0		0.0	False		,,,				2504	0.002				p.D75H													.	.			0			c.G223C												136.0	110.0	119.0					X																	55172645		2203	4300	6503	SO:0001583	missense	90736	exon3			TTGCATCGGGTTC	BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.220G>C	X.37:g.55172645C>G	ENSP00000364101:p.Asp74His		31	0.0322580645	1		36	0.08	3	NM_001166700	49	0.00	0	A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Missense_Mutation	SNP	ENST00000358460.4	37	CCDS35305.2	.	.	.	.	.	.	.	.	.	.	c	3.193	-0.165363	0.06461	.	.	ENSG00000182518	ENST00000358460;ENST00000332132;ENST00000425133;ENST00000477847;ENST00000489298	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	1.59	-1.04	0.10068	.	0.505297	0.17523	U	0.171170	T	0.25044	0.0608	N	0.14661	0.345	0.09310	N	1	B;P;P	0.46859	0.002;0.774;0.885	B;P;B	0.46479	0.001;0.518;0.241	T	0.15065	-1.0450	10	0.56958	D	0.05	-1.547	4.2247	0.10575	0.0:0.4679:0.0:0.5321	.	75;74;75	Q5XKR9-3;Q5XKR9;Q5XKR9-2	.;F104B_HUMAN;.	H	74;75;75;71;73	ENSP00000364101:D74H;ENSP00000333394:D75H;ENSP00000397188:D75H;ENSP00000421161:D71H;ENSP00000423164:D73H	ENSP00000333394:D75H	D	-	1	0	FAM104B	55189370	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.019000	0.12546	-0.355000	0.08199	-0.556000	0.04195	GAT			0.468	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000056851.1		NM_138362	
RLIM	51132	ucsc.edu	37	X	73811755	73811755	+	Silent	SNP	T	T	G	rs7883332	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	T	T					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chrX:73811755T>G	ENST00000332687.6	-	4	1613	c.1395A>C	c.(1393-1395)tcA>tcC	p.S465S	RLIM_ENST00000349225.2_Silent_p.S465S	NM_016120.3	NP_057204.2	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	465	Poly-Ser.|Ser-rich.				negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|random inactivation of X chromosome (GO:0060816)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	ligase activity (GO:0016874)|transcription corepressor activity (GO:0003714)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						aactggaactcgaactggaac	0.463																																					p.S465S	Esophageal Squamous(169;1899 1923 14997 18818 32118)												.	RLIM	90		0			c.G1395C												43.0	43.0	43.0					X																	73811755		2203	4300	6503	SO:0001819	synonymous_variant	51132	exon5			GGAACTCGAACTG	AF155109	CCDS14427.1	Xq13-q21	2013-01-09	2009-02-17	2009-02-17	ENSG00000131263	ENSG00000131263		"""RING-type (C3HC4) zinc fingers"""	13429	protein-coding gene	gene with protein product	"""ring zinc finger protein NY-REN-43antigen"", ""LIM domain interacting ring finger protein"""	300379	"""ring finger protein 12"""	RNF12		10508479	Standard	NM_016120		Approved	NY-REN-43, MGC15161	uc004ebw.3	Q9NVW2	OTTHUMG00000021859	ENST00000332687.6:c.1395A>C	X.37:g.73811755T>G			45	0.2	9		64	0.13	8	NM_183353	31	0.00	0	B2RBQ1|D3DTE0|Q96D38|Q9Y598	Silent	SNP	ENST00000332687.6	37	CCDS14427.1																																																																																					0.463	RLIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057268.1		NM_016120	
TXNRD2	10587	mdanderson.org	37	22	19885565	19885565	+	Missense_Mutation	SNP	G	G	T	rs536545192	byFrequency	TCGA-YU-A90Q-01A-11D-A435-10	TCGA-YU-A90Q-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	526f0bd9-4127-4315-844c-3b0c77e5a7f4	b2156c22-0881-4a11-94c1-69b20568cc61	g.chr22:19885565G>T	ENST00000400521.1	-	10	777	c.771C>A	c.(769-771)gaC>gaA	p.D257E	TXNRD2_ENST00000535882.1_Missense_Mutation_p.D256E|TXNRD2_ENST00000400518.1_Missense_Mutation_p.D227E|TXNRD2_ENST00000334363.9_Missense_Mutation_p.D257E|TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000400519.1_Missense_Mutation_p.D256E|TXNRD2_ENST00000542719.1_Missense_Mutation_p.D227E	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	257					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					GCACTACCTGGTCGAAGCCGC	0.672																																					.													.	.			0			.												18.0	22.0	21.0					22																	19885565		2046	4145	6191	SO:0001583	missense	10587	.			TACCTGGTCGAAG	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.771C>A	22.37:g.19885565G>T	ENSP00000383365:p.Asp257Glu		32	0	0		17	0.18	3	.	18	0.00	0	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Missense_Mutation	SNP	ENST00000400521.1	37	CCDS42981.1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857785	0.71834	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719;ENST00000334363	T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	4.36	4.36	0.52297	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain (1);Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.81631	0.4863	M	0.90369	3.11	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.83275	-0.0041	10	0.87932	D	0	0.6177	6.0004	0.19517	0.2523:0.0:0.7477:0.0	.	257;257;225;256	Q9NNW7;E7EWK1;Q6M1B7;D3YTF9	TRXR2_HUMAN;.;.;.	E	227;257;257;234;161;256;256;227;257	ENSP00000383362:D227E;ENSP00000383365:D257E;ENSP00000383369:D234E;ENSP00000383363:D256E;ENSP00000439314:D256E;ENSP00000439570:D227E;ENSP00000334451:D257E	ENSP00000334451:D257E	D	-	3	2	TXNRD2	18265565	1.000000	0.71417	1.000000	0.80357	0.677000	0.39632	3.832000	0.55783	2.170000	0.68504	0.561000	0.74099	GAC			0.672	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000314903.3		NM_006440	
