#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
MMEL1	79258	mdanderson.org	37	1	2525328	2525328	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:2525328G>T	ENST00000378412.3	-	19	1953	c.1792C>A	c.(1792-1794)Cag>Aag	p.Q598K	MMEL1_ENST00000288709.6_Missense_Mutation_p.Q589K|MMEL1_ENST00000502556.1_Missense_Mutation_p.Q441K			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	598						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		GCCTGTGGCTGCTCCTTGCTG	0.587																																					p.Q598K													.	.			0			c.C1792A												65.0	57.0	59.0					1																	2525328		2202	4300	6502	SO:0001583	missense	79258	exon19			GTGGCTGCTCCTT	AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1792C>A	1.37:g.2525328G>T	ENSP00000367668:p.Gln598Lys		81	0	0		34	0.09	3	NM_033467	4	0.00	0	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	ENST00000378412.3	37	CCDS30569.2	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847183	0.71603	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	D;D;D	0.90844	-2.74;-2.74;-2.74	5.19	5.19	0.71726	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.116200	0.64402	D	0.000011	D	0.93996	0.8077	M	0.62016	1.91	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.92508	0.6014	10	0.28530	T	0.3	-36.0063	17.2836	0.87135	0.0:0.0:1.0:0.0	.	598	Q495T6	MMEL1_HUMAN	K	441;589;598;441	ENSP00000288709:Q589K;ENSP00000367668:Q598K;ENSP00000422492:Q441K	ENSP00000288709:Q589K	Q	-	1	0	MMEL1	2515188	1.000000	0.71417	0.987000	0.45799	0.916000	0.54674	6.387000	0.73191	2.424000	0.82194	0.655000	0.94253	CAG			0.587	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000002395.2		NM_033467	
MTFR1L	56181	mdanderson.org	37	1	26156254	26156254	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:26156254G>T	ENST00000374301.3	+	6	1014	c.706G>T	c.(706-708)Gcc>Tcc	p.A236S	MTFR1L_ENST00000466284.1_Missense_Mutation_p.R199S|MTFR1L_ENST00000374300.3_Missense_Mutation_p.A236S|MTFR1L_ENST00000469815.1_3'UTR|RP1-317E23.7_ENST00000606617.1_RNA|MTFR1L_ENST00000526894.1_Missense_Mutation_p.R176S|MTFR1L_ENST00000374303.2_Missense_Mutation_p.A236S|MTFR1L_ENST00000374307.5_Missense_Mutation_p.A224S|MTFR1L_ENST00000524618.1_Missense_Mutation_p.A139S|MTFR1L_ENST00000474295.1_Missense_Mutation_p.R199S	NM_019557.5	NP_062457.3	Q9H019	MFR1L_HUMAN	mitochondrial fission regulator 1-like	236																	TTTGTCCAAGGCCAGCAGCTT	0.483																																					p.A236S													.	.			0			c.G706T												65.0	60.0	62.0					1																	26156254		1961	4155	6116	SO:0001583	missense	56181	exon6			TCCAAGGCCAGCA		CCDS41284.1, CCDS44089.1	1p36.11	2012-11-30	2012-11-29	2012-11-29	ENSG00000117640	ENSG00000117640			28836	protein-coding gene	gene with protein product			"""family with sequence similarity 54, member B"""	FAM54B		8619474, 9110174	Standard	NM_019557		Approved		uc001bkq.4	Q9H019	OTTHUMG00000007377	ENST00000374301.3:c.706G>T	1.37:g.26156254G>T	ENSP00000363419:p.Ala236Ser		70	0	0		48	0.06	3	NM_001099625	168	0.00	0	A6NCB4|B7WNV5|D3DPJ4|Q63HP1|Q7Z2S7|Q9NUI7	Missense_Mutation	SNP	ENST00000374301.3	37	CCDS41284.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.105|9.105	1.005116|1.005116	0.19199|0.19199	.|.	.|.	ENSG00000117640|ENSG00000117640	ENST00000374303;ENST00000472643;ENST00000524618;ENST00000374307;ENST00000374301;ENST00000374300|ENST00000474295;ENST00000526894;ENST00000466284	T;T;T;T;T;T|T;T;T	0.37752|0.51071	1.18;1.18;1.18;1.18;1.18;1.18|0.72;0.94;0.72	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.051036|.	0.85682|.	D|.	0.000000|.	T|T	0.28699|0.28699	0.0711|0.0711	N|N	0.08118|0.08118	0|0	0.49213|0.49213	D|D	0.999765|0.999765	P;B;B|B	0.37370|0.09022	0.592;0.311;0.361|0.002	B;B;B|B	0.39660|0.08055	0.306;0.103;0.165|0.003	T|T	0.14200|0.14200	-1.0481|-1.0481	10|8	0.02654|.	T|.	1|.	-1.0331|-1.0331	15.581|15.581	0.76439|0.76439	0.0:0.0:0.8623:0.1377|0.0:0.0:0.8623:0.1377	.|.	269;224;236|199	B4DRE5;Q9H019-3;Q9H019|Q9H019-2	.;.;FA54B_HUMAN|.	S|S	236;139;139;224;236;236|199;176;199	ENSP00000363421:A236S;ENSP00000432719:A139S;ENSP00000435193:A139S;ENSP00000363426:A224S;ENSP00000363419:A236S;ENSP00000363418:A236S|ENSP00000435461:R199S;ENSP00000432227:R176S;ENSP00000434751:R199S	ENSP00000363418:A236S|.	A|R	+|+	1|3	0|2	FAM54B|FAM54B	26028841|26028841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.848000|6.848000	0.75409|0.75409	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCC|AGG			0.483	MTFR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000019319.1		NM_019557	
ZMYM6	9204	bcgsc.ca	37	1	35486070	35486070	+	Splice_Site	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:35486070T>C	ENST00000357182.4	-	3	321		c.e3-2		ZMYM6_ENST00000373333.1_Splice_Site|ZMYM6_ENST00000317538.5_Splice_Site|ZMYM6_ENST00000373340.2_Splice_Site|ZMYM6_ENST00000493328.1_Splice_Site|ZMYM6_ENST00000487874.1_Splice_Site	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TCCATACTCCTTTAAAAAAAA	0.303																																					.													.	ZMYM6	110		0			c.94-2A>G												76.0	75.0	75.0					1																	35486070		2202	4298	6500	SO:0001630	splice_region_variant	9204	exon4			TACTCCTTTAAAA	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.94-2A>G	1.37:g.35486070T>C			134	0	0		72	0.08	6	NM_007167	0		0	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Splice_Site	SNP	ENST00000357182.4	37	CCDS387.2	.	.	.	.	.	.	.	.	.	.	T	14.25	2.479759	0.44044	.	.	ENSG00000163867	ENST00000373340;ENST00000357182;ENST00000415531;ENST00000317538;ENST00000373333	.	.	.	3.81	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0737	0.59075	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZMYM6	35258657	1.000000	0.71417	0.969000	0.41365	0.208000	0.24298	5.245000	0.65405	1.748000	0.51833	0.254000	0.18369	.			0.303	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000011999.1		NM_007167	Intron
SLC35D1	23169	mdanderson.org	37	1	67519691	67519691	+	Silent	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:67519691C>T	ENST00000235345.5	-	1	91	c.6G>A	c.(4-6)gcG>gcA	p.A2A	SLC35D1_ENST00000506472.2_5'Flank	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	2					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TATGAACTTCCGCCATGGCTG	0.677																																					p.A2A													.	.			0			c.G6A												23.0	28.0	26.0					1																	67519691		2203	4300	6503	SO:0001819	synonymous_variant	23169	exon1			AACTTCCGCCATG	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.6G>A	1.37:g.67519691C>T			82	0	0		42	0.07	3	NM_015139	6	0.00	0	A8K185|B7Z3X2|Q52LU5|Q92548	Silent	SNP	ENST00000235345.5	37	CCDS636.1																																																																																					0.677	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000025948.1		NM_015139	
OVGP1	5016	bcgsc.ca	37	1	111957533	111957533	+	Silent	SNP	C	C	T	rs112145355		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:111957533C>T	ENST00000369732.3	-	11	1645	c.1590G>A	c.(1588-1590)caG>caA	p.Q530Q		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	530					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		GGGTCACAGACTGATGACCCA	0.542																																					p.Q530Q													.	OVGP1	177		0			c.G1590A												59.0	57.0	58.0					1																	111957533		2197	4207	6404	SO:0001819	synonymous_variant	5016	exon11			CACAGACTGATGA	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1590G>A	1.37:g.111957533C>T			173	0.0115606936	2		93	0.17	16	NM_002557	4	0.00	0	A0AV19|B9EGE1|Q15841	Silent	SNP	ENST00000369732.3	37	CCDS834.1																																																																																					0.542	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000032461.1		NM_002557	
NBPF10	100132406	hgsc.bcm.edu	37	1	145293535	145293535	+	Missense_Mutation	SNP	C	C	G	rs55936365		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:145293535C>G	ENST00000369339.3	+	3	383	c.130C>G	c.(130-132)Cta>Gta	p.L44V	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000342960.5_Missense_Mutation_p.L44V|RP11-458D21.5_ENST00000468030.1_3'UTR			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	315						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L44V(2)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		GAAATGTTTTCTAACTCAACT	0.443																																					p.L44V													NBPF10,NS,carcinoma,0,2	NBPF10	0	2	2	Substitution - Missense(2)	kidney(2)	c.C130G																																									SO:0001583	missense	100132406	exon1			TGTTTTCTAACTC	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.130C>G	1.37:g.145293535C>G	ENSP00000358345:p.Leu44Val		60	0.0333333333	2		54	0.09	5	NM_001039703	20	0.00	0	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000369339.3	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.027|0.027	-1.360141|-1.360141	0.01245|0.01245	.|.	.|.	ENSG00000163386|ENSG00000163386	ENST00000369339;ENST00000342960|ENST00000448873	T|.	0.02837|.	4.14|.	0.687|0.687	-1.37|-1.37	0.09056|0.09056	.|.	.|.	.|.	.|.	.|.	T|T	0.01765|0.01765	0.0056|0.0056	N|N	0.01122|0.01122	-1.005|-1.005	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33007|0.33007	-0.9885|-0.9885	9|6	0.02654|0.33141	T|T	1|0.24	.|.	3.2142|3.2142	0.06692|0.06692	0.3787:0.2355:0.3858:0.0|0.3787:0.2355:0.3858:0.0	rs55936365|rs55936365	44|.	A8MQ30|.	.|.	V|C	44|3	ENSP00000345684:L44V|.	ENSP00000345684:L44V|ENSP00000414194:S3C	L|S	+|+	1|2	2|0	NBPF10|NBPF10	144004892|144004892	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	-3.451000|-3.451000	0.00466|0.00466	-3.626000|-3.626000	0.00130|0.00130	-3.729000|-3.729000	0.00022|0.00022	CTA|TCT			0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	protein_coding		OTTHUMT00000038550.3		NM_001039703	
LOR	4014	hgsc.bcm.edu	37	1	153233506	153233506	+	Silent	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:153233506C>T	ENST00000368742.3	+	2	138	c.81C>T	c.(79-81)ggC>ggT	p.G27G		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	27					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)	p.G27G(1)		lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gcggtggcggcggcagcggcg	0.682																																					p.G27G													LOR,caecum,carcinoma,0,1	LOR	0	1	1	Substitution - coding silent(1)	lung(1)	c.C81T												8.0	10.0	9.0					1																	153233506		2045	4027	6072	SO:0001819	synonymous_variant	4014	exon2			TGGCGGCGGCAGC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.81C>T	1.37:g.153233506C>T			98	0.0102040816	1		72	0.07	5	NM_000427	0		0	Q5T869|Q5XKF8	Silent	SNP	ENST00000368742.3	37	CCDS30870.1																																																																																					0.682	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000039107.1		NM_000427	
VSIG8	391123	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca	37	1	159827898	159827898	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:159827898C>A	ENST00000368100.1	-	3	547	c.412G>T	c.(412-414)Gtc>Ttc	p.V138F	C1orf204_ENST00000368102.1_5'Flank|RP11-190A12.7_ENST00000544342.1_Intron	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	138	Ig-like V-type 1.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					GTGACAATGACCTTCCGGGTG	0.552																																					p.V138F													.	.			0			c.G412T												95.0	79.0	84.0					1																	159827898		2203	4300	6503	SO:0001583	missense	391123	exon3			CAATGACCTTCCG		CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.412G>T	1.37:g.159827898C>A	ENSP00000357080:p.Val138Phe		282	0.0035460993	1		154	0.51	79	NM_001013661	0		0	Q5VU14	Missense_Mutation	SNP	ENST00000368100.1	37	CCDS30913.1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.168716	0.57584	.	.	ENSG00000243284	ENST00000368100	T	0.52754	0.65	5.2	5.2	0.72013	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.178954	0.48767	D	0.000163	T	0.42449	0.1203	N	0.17082	0.46	0.51233	D	0.999913	D	0.76494	0.999	D	0.72338	0.977	T	0.48139	-0.9061	10	0.49607	T	0.09	.	14.2724	0.66159	0.0:1.0:0.0:0.0	.	138	Q5VU13	VSIG8_HUMAN	F	138	ENSP00000357080:V138F	ENSP00000357080:V138F	V	-	1	0	VSIG8	158094522	0.989000	0.36119	0.998000	0.56505	0.803000	0.45373	1.580000	0.36547	2.423000	0.82170	0.561000	0.74099	GTC			0.552	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085978.8		NM_001013661	
NR1I3	9970	mdanderson.org	37	1	161200619	161200619	+	Silent	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:161200619G>T	ENST00000367982.4	-	8	1068	c.913C>A	c.(913-915)Cga>Aga	p.R305R	NR1I3_ENST00000367979.2_Silent_p.R310R|NR1I3_ENST00000504010.1_Silent_p.R233R|NR1I3_ENST00000367983.4_Silent_p.R301R|NR1I3_ENST00000505005.1_Silent_p.R262R|NR1I3_ENST00000367981.3_Silent_p.R277R|NR1I3_ENST00000367985.3_Silent_p.R267R|NR1I3_ENST00000367980.2_Silent_p.R310R|NR1I3_ENST00000437437.2_Silent_p.R272R|NR1I3_ENST00000479324.1_5'UTR|NR1I3_ENST00000515621.1_Silent_p.R226R|NR1I3_ENST00000502985.1_3'UTR|NR1I3_ENST00000511676.1_Silent_p.R272R|NR1I3_ENST00000442691.2_Silent_p.R305R|NR1I3_ENST00000506209.1_Silent_p.R272R|NR1I3_ENST00000367984.4_Silent_p.R262R|NR1I3_ENST00000511944.1_3'UTR|NR1I3_ENST00000511748.1_3'UTR|NR1I3_ENST00000512372.1_Silent_p.R233R|NR1I3_ENST00000508387.1_3'UTR|NR1I3_ENST00000508740.1_Silent_p.R277R|NR1I3_ENST00000412844.2_Silent_p.R281R|NR1I3_ENST00000428574.2_Silent_p.R306R			Q14994	NR1I3_HUMAN	nuclear receptor subfamily 1, group I, member 3	305					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	15	all_cancers(52;1.86e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CGGGGCCTTCGCTGCTGGCCC	0.547																																					p.R310R													NR1I3_ENST00000428574,NS,carcinoma,0,4	NR1I3_ENST00000428574	0	4	0			c.C928A												89.0	77.0	81.0					1																	161200619		2203	4300	6503	SO:0001819	synonymous_variant	9970	exon8			GCCTTCGCTGCTG	Z30425	CCDS1228.1, CCDS41427.1, CCDS41428.1, CCDS41429.1, CCDS41430.1, CCDS44260.1, CCDS44261.1, CCDS44262.1, CCDS53405.1, CCDS53406.1, CCDS53407.1, CCDS53408.1, CCDS53409.1, CCDS53410.1, CCDS53411.1	1q23.3	2013-01-16			ENSG00000143257	ENSG00000143257		"""Nuclear hormone receptors"""	7969	protein-coding gene	gene with protein product	"""constitutive androstane receptor"""	603881				8114692	Standard	NM_001077480		Approved	MB67, CAR1, CAR	uc001fzp.3	Q14994	OTTHUMG00000034347	ENST00000367982.4:c.913C>A	1.37:g.161200619G>T			75	0	0		50	0.06	3	NM_001077482	2	0.00	0	E9PB75|E9PC13|E9PDU3|E9PGH6|E9PH10|E9PHC8|E9PHN4|F1D8Q0|F1D8Q1|Q0VAC9|Q4U0F0|Q5VTW5|Q5VTW6|Q6GZ68|Q6GZ76|Q6GZ77|Q6GZ78|Q6GZ79|Q6GZ82|Q6GZ83|Q6GZ84|Q6GZ85|Q6GZ87|Q6GZ89	Silent	SNP	ENST00000367982.4	37	CCDS41430.1																																																																																					0.547	NR1I3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000083048.2			
KIF14	9928	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	200529865	200529865	+	Silent	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:200529865T>C	ENST00000367350.4	-	26	4653	c.4215A>G	c.(4213-4215)aaA>aaG	p.K1405K		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	1405	Required for CIT-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						CACTGGCAGCTTTATTGTTAC	0.383																																					p.K1405K													.	.			0			c.A4215G												179.0	168.0	172.0					1																	200529865		2203	4300	6503	SO:0001819	synonymous_variant	9928	exon26			GGCAGCTTTATTG	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.4215A>G	1.37:g.200529865T>C			262	0	0		206	0.34	71	NM_014875	14	0.43	6	Q14CI8|Q4G0A5|Q5T1W3	Silent	SNP	ENST00000367350.4	37	CCDS30963.1																																																																																					0.383	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000086878.1		NM_014875	
GUK1	2987	mdanderson.org	37	1	228336514	228336514	+	3'UTR	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr1:228336514G>T	ENST00000366718.1	+	0	1137				GUK1_ENST00000366726.1_3'UTR|GUK1_ENST00000312726.4_3'UTR|GUK1_ENST00000366730.1_3'UTR|GUK1_ENST00000366723.1_3'UTR|GUK1_ENST00000470040.1_3'UTR|GUK1_ENST00000366716.1_3'UTR|GJC2_ENST00000366714.2_5'Flank|GUK1_ENST00000391865.3_3'UTR|GUK1_ENST00000366728.2_Missense_Mutation_p.W229C	NM_001159391.1	NP_001152863.1	Q16774	KGUA_HUMAN	guanylate kinase 1						ATP metabolic process (GO:0046034)|dATP metabolic process (GO:0046060)|dGDP biosynthetic process (GO:0006185)|dGMP metabolic process (GO:0046054)|drug metabolic process (GO:0017144)|GDP biosynthetic process (GO:0046711)|GDP-mannose metabolic process (GO:0019673)|glycoprotein transport (GO:0034436)|GMP metabolic process (GO:0046037)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleotide metabolic process (GO:0006163)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanylate kinase activity (GO:0004385)			endometrium(2)|lung(5)|prostate(1)|soft_tissue(1)	9		Prostate(94;0.0405)				ATGTGGAGTGGAGGAGATGCT	0.662																																					p.W229C													.	.			0			c.G687T																																									SO:0001624	3_prime_UTR_variant	2987	exon7			GGAGTGGAGGAGA	BC006249	CCDS1568.1, CCDS53481.1, CCDS55689.1	1q32-q41	2012-10-02			ENSG00000143774	ENSG00000143774	2.7.4.8		4693	protein-coding gene	gene with protein product		139270				8647247	Standard	NM_000858		Approved		uc021pkf.1	Q16774	OTTHUMG00000039503	ENST00000366718.1:c.*116G>T	1.37:g.228336514G>T			62	0	0		30	0.10	3	NM_001242840	437	0.00	0	B1ANH1	Missense_Mutation	SNP	ENST00000366718.1	37	CCDS1568.1	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618551	0.28801	.	.	ENSG00000143774	ENST00000366728	.	.	.	1.21	0.263	0.15602	.	1.510010	0.04182	N	0.326637	T	0.20088	0.0483	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26395	-1.0104	7	0.87932	D	0	.	3.4022	0.07328	0.2791:0.0:0.7209:0.0	.	.	.	.	C	229	.	ENSP00000355689:W229C	W	+	3	0	GUK1	226403137	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.091000	0.11146	0.087000	0.17167	0.462000	0.41574	TGG			0.662	GUK1-021	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000095944.1		NM_000858	
ADARB2	105	mdanderson.org	37	10	1569023	1569023	+	Intron	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr10:1569023C>T	ENST00000381312.1	-	2	426				ADARB2-AS1_ENST00000381301.3_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)						mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		GCACTTGGTGCGTGGAGGGGT	0.607																																					.													.	.			0			.												44.0	46.0	45.0					10																	1569023		2047	4206	6253	SO:0001627	intron_variant	642394	.			TTGGTGCGTGGAG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.101-147668G>A	10.37:g.1569023C>T			90	0	0		47	0.06	3	.	8	0.00	0	B2RPJ5|Q5VUT6|Q5VW42	RNA	SNP	ENST00000381312.1	37	CCDS7058.1																																																																																					0.607	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046426.1		NM_018702	
FAM21EP	100421577	hgsc.bcm.edu	37	10	51814574	51814574	+	RNA	SNP	G	G	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr10:51814574G>C	ENST00000456967.1	-	0	1570					NR_038275.1																						CAACCATTTAGAAAACGCACG	0.428																																					.													.	.			0			.																																											0	.			CATTTAGAAAACG																													10.37:g.51814574G>C			86	0	0		57	0.39	22	.	0		0		RNA	SNP	ENST00000456967.1	37																																																																																						0.428	RP11-324H6.5-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000048059.1			
KCNA4	3739	mdanderson.org	37	11	30033833	30033833	+	Silent	SNP	C	C	T	rs369906337	byFrequency	TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:30033833C>T	ENST00000328224.6	-	2	1626	c.393G>A	c.(391-393)gaG>gaA	p.E131E	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	131	Poly-Glu.				potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	cctcctcttcctcctcctcct	0.557													C|||	44	0.00878594	0.0	0.0	5008	,	,		18378	0.0		0.0	False		,,,				2504	0.045				p.E131E													.	.			0			c.G393A												36.0	37.0	36.0					11																	30033833		2191	4294	6485	SO:0001819	synonymous_variant	3739	exon2			CTCTTCCTCCTCC	M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.393G>A	11.37:g.30033833C>T			76	0	0		46	0.07	3	NM_002233	1	0.00	0		Silent	SNP	ENST00000328224.6	37	CCDS41629.1																																																																																					0.557	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000388074.2		NM_002233	
MYRF	745	mdanderson.org	37	11	61537721	61537721	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:61537721C>A	ENST00000278836.5	+	5	560	c.464C>A	c.(463-465)cCc>cAc	p.P155H	TMEM258_ENST00000535042.1_Intron|MYRF_ENST00000265460.5_Missense_Mutation_p.P146H	NM_001127392.1	NP_001120864.1	Q9Y2G1	MRF_HUMAN	myelin regulatory factor	155	Pro-rich.				central nervous system myelin maintenance (GO:0032286)|central nervous system myelination (GO:0022010)|oligodendrocyte development (GO:0014003)|oligodendrocyte differentiation (GO:0048709)|positive regulation of myelination (GO:0031643)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCTGCAGAGCCCCACCTCCTG	0.672																																					p.P155H													.	.			0			c.C464A												22.0	20.0	21.0					11																	61537721		2201	4299	6500	SO:0001583	missense	745	exon5			CAGAGCCCCACCT		CCDS31579.1, CCDS44622.1	11q12-q13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000124920	ENSG00000124920			1181	protein-coding gene	gene with protein product	"""myelin gene regulatory factor"""	608329	"""chromosome 11 open reading frame 9"""	C11orf9		10828591, 12384578	Standard	NM_001127392		Approved	Ndt80, pqn-47, MRF	uc001nsc.1	Q9Y2G1	OTTHUMG00000168161	ENST00000278836.5:c.464C>A	11.37:g.61537721C>A	ENSP00000278836:p.Pro155His		66	0	0		33	0.09	3	NM_001127392	26	0.00	0	O43582|Q9P1Q6	Missense_Mutation	SNP	ENST00000278836.5	37	CCDS44622.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.907825	0.52333	.	.	ENSG00000124920	ENST00000278836;ENST00000265460	T;T	0.34667	1.35;1.35	4.55	4.55	0.56014	.	0.190853	0.45606	D	0.000349	T	0.47764	0.1463	L	0.27053	0.805	0.80722	D	1	P;D	0.89917	0.687;1.0	B;D	0.71184	0.259;0.972	T	0.49844	-0.8896	10	0.51188	T	0.08	-29.3233	18.2123	0.89874	0.0:1.0:0.0:0.0	.	146;155	Q9Y2G1-2;Q9Y2G1	.;MRF_HUMAN	H	155;146	ENSP00000278836:P155H;ENSP00000265460:P146H	ENSP00000265460:P146H	P	+	2	0	C11orf9	61294297	1.000000	0.71417	1.000000	0.80357	0.273000	0.26683	3.862000	0.56009	2.469000	0.83416	0.549000	0.68633	CCC			0.672	MYRF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000398519.2		NM_013279	
FERMT3	83706	mdanderson.org	37	11	63988602	63988602	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:63988602G>T	ENST00000279227.5	+	13	1767	c.1672G>T	c.(1672-1674)Gtc>Ttc	p.V558F	FERMT3_ENST00000345728.5_Missense_Mutation_p.V554F	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	558	FERM.				integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						CATCTCCTATGTCATGGTCAG	0.652																																					p.V558F													.	.			0			c.G1672T												67.0	64.0	65.0					11																	63988602		2201	4297	6498	SO:0001583	missense	83706	exon13			TCCTATGTCATGG	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.1672G>T	11.37:g.63988602G>T	ENSP00000279227:p.Val558Phe		33	0	0		13	0.15	2	NM_178443	22	0.00	0	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	G	3.831	-0.035727	0.07497	.	.	ENSG00000149781	ENST00000345728;ENST00000279227	T;T	0.47869	0.83;0.83	4.56	-6.92	0.01644	Band 4.1 domain (1);FERM central domain (1);Pleckstrin homology-type (1);	0.490972	0.17909	N	0.157907	T	0.14313	0.0346	N	0.02011	-0.69	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.28586	-1.0039	10	0.02654	T	1	-17.2254	13.7815	0.63085	0.0753:0.0:0.1188:0.8059	.	554;558	Q86UX7-2;Q86UX7	.;URP2_HUMAN	F	554;558	ENSP00000339950:V554F;ENSP00000279227:V558F	ENSP00000279227:V558F	V	+	1	0	FERMT3	63745178	0.000000	0.05858	0.000000	0.03702	0.451000	0.32288	-0.445000	0.06845	-1.389000	0.02090	0.462000	0.41574	GTC			0.652	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000396297.1		NM_031471	
CCDC88B	283234	mdanderson.org	37	11	64116835	64116835	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:64116835G>T	ENST00000356786.5	+	15	2693	c.2649G>T	c.(2647-2649)gaG>gaT	p.E883D	CCDC88B_ENST00000463837.1_3'UTR|CCDC88B_ENST00000359902.2_Missense_Mutation_p.E35D|CCDC88B_ENST00000301897.4_5'UTR	NM_032251.5	NP_115627.6	A6NC98	CC88B_HUMAN	coiled-coil domain containing 88B	883						membrane (GO:0016020)				endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGGGCAAGGAGTTGGGGGACC	0.637																																					p.E883D													.	.			0			c.G2649T												22.0	27.0	25.0					11																	64116835		2198	4296	6494	SO:0001583	missense	283234	exon15			CAAGGAGTTGGGG	AK090436	CCDS8072.2	11q13.1	2013-03-13	2007-05-31	2007-05-31	ENSG00000168071	ENSG00000168071			26757	protein-coding gene	gene with protein product	"""brain leucine zipper protein"", ""GRP78-interacting protein induced by ER stress"""	611205	"""coiled-coil domain containing 88"""	CCDC88		15882442, 21289099	Standard	NM_032251		Approved	FLJ37970, BRLZ, HkRP3, FLJ00354, GIPIE	uc001nzy.3	A6NC98	OTTHUMG00000045419	ENST00000356786.5:c.2649G>T	11.37:g.64116835G>T	ENSP00000349238:p.Glu883Asp		81	0	0		34	0.12	4	NM_032251	6	0.00	0	A5D8Y5|B5MDM2|Q05BL2|Q6RUV3|Q8N1Q6|Q8NF44|Q9H0H1	Missense_Mutation	SNP	ENST00000356786.5	37	CCDS8072.2	.	.	.	.	.	.	.	.	.	.	g	14.50	2.553379	0.45487	.	.	ENSG00000168071	ENST00000377638;ENST00000356786;ENST00000359902	T;T	0.50001	1.85;0.76	3.68	0.221	0.15283	.	.	.	.	.	T	0.49830	0.1580	L	0.56769	1.78	0.80722	D	1	P;D;D;P	0.61697	0.893;0.958;0.99;0.893	B;P;P;B	0.54889	0.446;0.763;0.719;0.446	T	0.50857	-0.8778	9	0.72032	D	0.01	.	4.9336	0.13930	0.133:0.4309:0.4361:0.0	.	883;19;532;883	B2RTU8;A6NC98-5;A6NC98-3;A6NC98	.;.;.;CC88B_HUMAN	D	883;883;35	ENSP00000349238:E883D;ENSP00000352974:E35D	ENSP00000349238:E883D	E	+	3	2	CCDC88B	63873411	1.000000	0.71417	0.999000	0.59377	0.292000	0.27327	1.675000	0.37555	0.300000	0.22699	0.539000	0.68188	GAG			0.637	CCDC88B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000104845.1		NM_032251	
TPCN2	219931	mdanderson.org	37	11	68837924	68837924	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:68837924C>T	ENST00000294309.3	+	9	957	c.856C>T	c.(856-858)Cgg>Tgg	p.R286W	TPCN2_ENST00000542467.1_Missense_Mutation_p.R286W|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	286					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTCCAAGAACCGGGCCTATGC	0.468																																					p.R286W													.	.			0			c.C856T												165.0	152.0	156.0					11																	68837924		2200	4294	6494	SO:0001583	missense	219931	exon9			AAGAACCGGGCCT	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.856C>T	11.37:g.68837924C>T	ENSP00000294309:p.Arg286Trp		80	0	0		21	0.10	2	NM_139075	25	0.00	0	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	37	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	c	17.37	3.371546	0.61624	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.97480	-4.4;-4.4	4.33	4.33	0.51752	Ion transport (1);	0.149534	0.45606	D	0.000357	D	0.98302	0.9437	M	0.85197	2.74	0.49299	D	0.999771	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98971	1.0801	10	0.87932	D	0	-38.5141	12.7915	0.57537	0.1645:0.8355:0.0:0.0	.	286;286;201	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	W	216;286;201;286	ENSP00000294309:R286W;ENSP00000445551:R286W	ENSP00000294309:R286W	R	+	1	2	TPCN2	68594500	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	2.378000	0.44309	2.133000	0.65898	0.457000	0.33378	CGG			0.468	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396878.2		NM_139075	
SRPR	6734	bcgsc.ca	37	11	126136799	126136799	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr11:126136799G>T	ENST00000332118.6	-	5	699	c.545C>A	c.(544-546)gCt>gAt	p.A182D	SRPR_ENST00000530680.1_5'Flank|FOXRED1_ENST00000532125.1_5'Flank|FOXRED1_ENST00000263578.5_5'Flank|SRPR_ENST00000532259.1_Missense_Mutation_p.A154D|FOXRED1_ENST00000442061.2_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	182					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.A182D(1)		endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		TTTGCTGGTAGCCAAAGGACC	0.478																																					p.A182D													SRPR,NS,carcinoma,0,2	SRPR	60	2	1	Substitution - Missense(1)	prostate(1)	c.C545A												71.0	76.0	74.0					11																	126136799		2201	4299	6500	SO:0001583	missense	6734	exon5			CTGGTAGCCAAAG	BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.545C>A	11.37:g.126136799G>T	ENSP00000328023:p.Ala182Asp		279	0.0215053763	6		152	0.06	9	NM_003139	146	0.02	3	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	ENST00000332118.6	37	CCDS31717.1	.	.	.	.	.	.	.	.	.	.	G	11.66	1.704856	0.30232	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	6.07	4.22	0.49857	Signal recognition particle receptor, alpha subunit, N-terminal (1);	0.603639	0.19178	N	0.120775	T	0.41166	0.1147	L	0.54323	1.7	0.25222	N	0.989898	B;B	0.18013	0.025;0.001	B;B	0.22152	0.038;0.004	T	0.31024	-0.9958	9	0.09590	T	0.72	-1.1549	12.7511	0.57308	0.1337:0.0:0.8663:0.0	.	154;182	E9PJS4;P08240	.;SRPR_HUMAN	D	182;154	.	ENSP00000328023:A182D	A	-	2	0	SRPR	125642009	0.000000	0.05858	0.994000	0.49952	0.998000	0.95712	0.538000	0.23160	0.906000	0.36621	0.655000	0.94253	GCT			0.478	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000386425.2		NM_003139	
CLSTN3	9746	broad.mit.edu	37	12	7281645	7281674	+	5'Flank	DEL	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	-	rs148894272|rs6144602|rs552263970		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	TTCCTGAGGAAGGAACCTGGAGCAGGATCC	TTCCTGAGGAAGGAACCTGGAGCAGGATCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr12:7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	ENST00000266546.6	+	0	0				RP11-273B20.1_ENST00000544657.1_RNA|RP11-273B20.1_ENST00000538062.1_RNA|RBP5_ENST00000266560.3_5'Flank|RBP5_ENST00000542370.1_5'Flank	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3						homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						ACCTTGGCTTTTCCTGAGGAAGGAACCTGGAGCAGGATCCTTCCTGAGGA	0.57														5008	1.0	1.0	1.0	5008	,	,		18442	1.0		1.0	False		,,,				2504	1.0				.													.	RBP5	20		0			.																																									SO:0001631	upstream_gene_variant	0	.			TGGCTTTTCCTGA	AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167		12.37:g.7281645_7281674delTTCCTGAGGAAGGAACCTGGAGCAGGATCC	Exception_encountered		6	0	0		6	0.50	3	.	19	0.00	0	D3DUT6|O94831|Q2T9J5|Q5UE57	RNA	DEL	ENST00000266546.6	37	CCDS8575.1																																																																																					0.570	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000398560.2		NM_014718	
LRP6	4040	broad.mit.edu	37	12	12317329	12317329	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr12:12317329G>C	ENST00000261349.4	-	9	2006	c.1930C>G	c.(1930-1932)Cga>Gga	p.R644G	LRP6_ENST00000543091.1_Missense_Mutation_p.R644G	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	644	Beta-propeller 3.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.R644*(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				AGAGAAATTCGTCTGATATCT	0.423																																					p.R644G													LRP6,NS,carcinoma,+1,2	LRP6	170	2	1	Substitution - Nonsense(1)	lung(1)	c.C1930G												104.0	103.0	103.0					12																	12317329		2203	4300	6503	SO:0001583	missense	4040	exon9			AAATTCGTCTGAT	AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.1930C>G	12.37:g.12317329G>C	ENSP00000261349:p.Arg644Gly		150	0	0		198	0.03	5	NM_002336	32	0.00	0	Q17RZ2	Missense_Mutation	SNP	ENST00000261349.4	37	CCDS8647.1	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635533	0.67130	.	.	ENSG00000070018	ENST00000261349;ENST00000543091	D;D	0.91407	-2.84;-2.84	5.65	1.63	0.23807	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.56097	D	0.000034	D	0.86896	0.6043	L	0.52905	1.665	0.58432	D	0.999998	P;P	0.48503	0.496;0.911	B;B	0.41646	0.09;0.362	T	0.82116	-0.0616	10	0.13108	T	0.6	.	16.3637	0.83296	0.0:0.0:0.4057:0.5943	.	644;644	F5H7J9;O75581	.;LRP6_HUMAN	G	644	ENSP00000261349:R644G;ENSP00000442472:R644G	ENSP00000261349:R644G	R	-	1	2	LRP6	12208596	0.992000	0.36948	0.998000	0.56505	0.987000	0.75469	1.614000	0.36911	0.088000	0.17205	-0.169000	0.13324	CGA			0.423	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000400137.1			
HAL	3034	mdanderson.org	37	12	96389642	96389642	+	Missense_Mutation	SNP	G	G	T	rs188894951	byFrequency	TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr12:96389642G>T	ENST00000261208.3	-	2	415	c.47C>A	c.(46-48)cCc>cAc	p.P16H	RP11-256L6.3_ENST00000551849.1_RNA|HAL_ENST00000541929.1_5'UTR|HAL_ENST00000538703.1_Missense_Mutation_p.P16H	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	16					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	GTCCTGGCAGGGCACTGCCAG	0.627																																					p.P16H	NSCLC(169;943 2815 23563 30031)												.	.			0			c.C47A												33.0	28.0	30.0					12																	96389642		2202	4292	6494	SO:0001583	missense	3034	exon2			TGGCAGGGCACTG		CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.47C>A	12.37:g.96389642G>T	ENSP00000261208:p.Pro16His		29	0	0		19	0.16	3	NM_002108	0		0	B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Missense_Mutation	SNP	ENST00000261208.3	37	CCDS9058.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.780916	0.70222	.	.	ENSG00000084110	ENST00000261208;ENST00000538703;ENST00000552509	D;D;D	0.93133	-2.13;-1.97;-3.17	5.2	5.2	0.72013	.	0.047154	0.85682	D	0.000000	D	0.96571	0.8881	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.983;0.991	D	0.96930	0.9680	10	0.87932	D	0	-15.7548	19.0765	0.93165	0.0:0.0:1.0:0.0	.	16;16	F5GXF2;P42357	.;HUTH_HUMAN	H	16	ENSP00000261208:P16H;ENSP00000440861:P16H;ENSP00000450372:P16H	ENSP00000261208:P16H	P	-	2	0	HAL	94913773	1.000000	0.71417	1.000000	0.80357	0.267000	0.26476	9.420000	0.97426	2.582000	0.87167	0.491000	0.48974	CCC			0.627	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000408644.1			
EID3	493861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	12	104698695	104698695	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr12:104698695T>A	ENST00000527879.1	+	1	1179	c.983T>A	c.(982-984)aTt>aAt	p.I328N	TXNRD1_ENST00000354940.6_Intron|TXNRD1_ENST00000525566.1_Intron|TXNRD1_ENST00000524698.1_Intron|TXNRD1_ENST00000378070.4_Intron|TXNRD1_ENST00000542918.1_Intron|TXNRD1_ENST00000540716.1_Intron|TXNRD1_ENST00000388854.3_Intron|TXNRD1_ENST00000503506.2_Intron|TXNRD1_ENST00000429002.2_Intron|TXNRD1_ENST00000526691.1_Intron|TXNRD1_ENST00000397736.2_Intron|TXNRD1_ENST00000526390.1_Intron|TXNRD1_ENST00000529546.1_Intron	NM_001008394.2	NP_001008395.1			EP300 interacting inhibitor of differentiation 3											large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GAGGCTATGATTACATACTCC	0.348																																					p.I328N													.	.			0			c.T983A												52.0	51.0	51.0					12																	104698695		1812	4080	5892	SO:0001583	missense	493861	exon1			CTATGATTACATA	BC027612	CCDS53822.1	12q23.3	2006-11-24				ENSG00000255150			32961	protein-coding gene	gene with protein product		612986				15987788, 15752197	Standard	NM_001008394		Approved	FLJ25832, NSMCE4B, NSE4B	uc001tkw.3	Q8N140		ENST00000527879.1:c.983T>A	12.37:g.104698695T>A	ENSP00000435619:p.Ile328Asn		184	0	0		87	0.53	46	NM_001008394	1	0.00	0		Missense_Mutation	SNP	ENST00000527879.1	37	CCDS53822.1	.	.	.	.	.	.	.	.	.	.	T	15.09	2.730110	0.48939	.	.	ENSG00000255150	ENST00000527879	T	0.64991	-0.13	4.72	4.72	0.59763	.	.	.	.	.	T	0.76644	0.4016	M	0.73962	2.25	0.38455	D	0.947066	D	0.89917	1.0	D	0.97110	1.0	T	0.80953	-0.1152	9	0.87932	D	0	.	10.8355	0.46685	0.0:0.0:0.0:1.0	.	328	Q8N140	EID3_HUMAN	N	328	ENSP00000435619:I328N	ENSP00000435619:I328N	I	+	2	0	EID3	103222825	0.997000	0.39634	0.970000	0.41538	0.411000	0.31082	3.958000	0.56737	2.124000	0.65301	0.454000	0.30748	ATT			0.348	EID3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000387034.1		NM_001008394	
DIS3	22894	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	13	73335570	73335571	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	AT	AT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr13:73335570_73335571delAT	ENST00000377767.4	-	19	2700_2701	c.2600_2601delAT	c.(2599-2601)tatfs	p.Y867fs	DIS3_ENST00000377780.4_Frame_Shift_Del_p.Y837fs|DIS3_ENST00000545453.1_Frame_Shift_Del_p.Y705fs	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	867					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)	p.Y867C(1)		central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CTTCTAAACCATACTTTGGAAT	0.317										Multiple Myeloma(4;0.011)																											p.867_868del													.	DIS3	103		1	Substitution - Missense(1)	kidney(1)	c.2601_2602del																																									SO:0001589	frameshift_variant	22894	exon19			TAAACCATACTTT	AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2600_2601delAT	13.37:g.73335570_73335571delAT	ENSP00000366997:p.Tyr867fs		153	0	0		105	0.30	32	NM_014953	41	0.00	0	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Frame_Shift_Del	DEL	ENST00000377767.4	37	CCDS9447.1																																																																																					0.317	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000045250.2		NM_014953	
MYCBP2	23077	bcgsc.ca;mdanderson.org	37	13	77742671	77742671	+	Silent	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr13:77742671G>T	ENST00000544440.2	-	40	5909	c.5892C>A	c.(5890-5892)acC>acA	p.T1964T	MYCBP2_ENST00000407578.2_Silent_p.T2002T|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Silent_p.T1964T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GGTTTCCTGTGGTGCTATCTG	0.498																																					p.T2002T													.	MYCBP2	1029		0			c.C6006A												248.0	214.0	226.0					13																	77742671		2203	4300	6503	SO:0001819	synonymous_variant	23077	exon40			TCCTGTGGTGCTA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.5892C>A	13.37:g.77742671G>T			208	0.0048076923	1		129	0.05	6	NM_015057	5	0.00	0		Silent	SNP	ENST00000544440.2	37																																																																																						0.498	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000045326.1		NM_015057	
SOCS4	122809	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	14	55509766	55509766	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr14:55509766G>T	ENST00000395472.2	+	2	339	c.7G>T	c.(7-9)Gaa>Taa	p.E3*	SOCS4_ENST00000339298.2_Nonsense_Mutation_p.E3*|SOCS4_ENST00000555846.1_Nonsense_Mutation_p.E3*	NM_080867.2|NM_199421.1	NP_543143.1|NP_955453.1	Q8WXH5	SOCS4_HUMAN	suppressor of cytokine signaling 4	3					intracellular signal transduction (GO:0035556)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)					central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)	14						TAACATGGCAGAAAATAATGA	0.353																																					p.E3X													.	.			0			c.G7T												50.0	55.0	54.0					14																	55509766		2202	4297	6499	SO:0001587	stop_gained	122809	exon2			ATGGCAGAAAATA	AF424815	CCDS9722.1	14q22.1	2013-02-14	2004-02-25	2004-02-27	ENSG00000180008	ENSG00000180008		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19392	protein-coding gene	gene with protein product			"""suppressor of cytokine signaling 7"""	SOCS7		12076535, 10500304	Standard	NM_080867		Approved		uc001xbp.3	Q8WXH5	OTTHUMG00000140311	ENST00000395472.2:c.7G>T	14.37:g.55509766G>T	ENSP00000378855:p.Glu3*		107	0	0		58	0.47	27	NM_080867	8	0.25	2		Nonsense_Mutation	SNP	ENST00000395472.2	37	CCDS9722.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.975801	0.92982	.	.	ENSG00000180008	ENST00000395472;ENST00000555846;ENST00000339298	.	.	.	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-18.1527	18.6508	0.91430	0.0:0.0:1.0:0.0	.	.	.	.	X	3	.	ENSP00000341327:E3X	E	+	1	0	SOCS4	54579519	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	6.665000	0.74442	2.409000	0.81822	0.655000	0.94253	GAA			0.353	SOCS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000276910.1			
TTC9	23508	mdanderson.org	37	14	71109248	71109248	+	Silent	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr14:71109248G>T	ENST00000256367.2	+	1	745	c.402G>T	c.(400-402)ctG>ctT	p.L134L	CTD-2540L5.6_ENST00000500016.1_lincRNA|CTD-2540L5.5_ENST00000553982.1_lincRNA	NM_015351.1	NP_056166.1	Q92623	TTC9A_HUMAN	tetratricopeptide repeat domain 9	134										skin(1)	1				all cancers(60;0.00545)|BRCA - Breast invasive adenocarcinoma(234;0.00747)|OV - Ovarian serous cystadenocarcinoma(108;0.0538)		ACAACAGCCTGGCAGGTGAgc	0.741																																					p.L134L													.	.			0			c.G402T												6.0	9.0	8.0					14																	71109248		1444	3162	4606	SO:0001819	synonymous_variant	23508	exon1			CAGCCTGGCAGGT	D86980	CCDS45132.1	14q24.2	2014-08-12			ENSG00000133985			"""Tetratricopeptide (TTC) repeat domain containing"""	20267	protein-coding gene	gene with protein product		610488					Standard	NM_015351		Approved	KIAA0227, TTC9A	uc001xmi.2	Q92623	OTTHUMG00000172133	ENST00000256367.2:c.402G>T	14.37:g.71109248G>T			53	0	0		19	0.11	2	NM_015351	13	0.00	0	Q86WT2	Silent	SNP	ENST00000256367.2	37	CCDS45132.1																																																																																					0.741	TTC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000417024.1		XM_027236	
CEP128	145508	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	14	81297580	81297612	+	In_Frame_Del	DEL	CAGCTGCACTCTCAAATCTGACATTTGCTTCTC	CAGCTGCACTCTCAAATCTGACATTTGCTTCTC	-	rs185240818|rs576674359		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	CAGCTGCACTCTCAAATCTGACATTTGCTTCTC	CAGCTGCACTCTCAAATCTGACATTTGCTTCTC					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr14:81297580_81297612delCAGCTGCACTCTCAAATCTGACATTTGCTTCTC	ENST00000555265.1	-	13	1459_1491	c.1084_1116delGAGAAGCAAATGTCAGATTTGAGAGTGCAGCTG	c.(1084-1116)gagaagcaaatgtcagatttgagagtgcagctgdel	p.EKQMSDLRVQL362del	CEP128_ENST00000216517.6_In_Frame_Del_p.EKQMSDLRVQL362del|CEP128_ENST00000281129.3_In_Frame_Del_p.EKQMSDLRVQL362del			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	362						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						CGCTGAAGTTCAGCTGCACTCTCAAATCTGACATTTGCTTCTCCAGGTCCTGT	0.425																																					p.362_373del													.	CEP128	146		0			c.1085_1117del																																									SO:0001651	inframe_deletion	145508	exon12			GAAGTTCAGCTGC	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.1084_1116delGAGAAGCAAATGTCAGATTTGAGAGTGCAGCTG	14.37:g.81297580_81297612delCAGCTGCACTCTCAAATCTGACATTTGCTTCTC	ENSP00000451162:p.Glu362_Leu372del		450	0	0		193	0.16	30	NM_152446	4	0.00	0	B9EK52|Q86X97|Q96ML4	In_Frame_Del	DEL	ENST00000555265.1	37	CCDS32130.1																																																																																					0.425	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413415.1		NM_152446	
CDC42BPB	9578	mdanderson.org	37	14	103416135	103416135	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr14:103416135G>T	ENST00000361246.2	-	26	3704	c.3416C>A	c.(3415-3417)cCt>cAt	p.P1139H		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		AATGACACCAGGCTGGGTGGA	0.537																																					p.P1139H													.	.			0			c.C3416A												149.0	123.0	132.0					14																	103416135		2203	4300	6503	SO:0001583	missense	9578	exon26			ACACCAGGCTGGG	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.3416C>A	14.37:g.103416135G>T	ENSP00000355237:p.Pro1139His		114	0	0		45	0.07	3	NM_006035	91	0.00	0		Missense_Mutation	SNP	ENST00000361246.2	37	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.758520	0.89843	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	T	0.42513	0.97	5.32	5.32	0.75619	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.103679	0.64402	D	0.000002	T	0.70649	0.3248	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.74023	0.982;0.947	T	0.76091	-0.3086	10	0.87932	D	0	.	19.3479	0.94372	0.0:0.0:1.0:0.0	.	1139;1139	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	H	1139;250	ENSP00000355237:P1139H	ENSP00000355237:P1139H	P	-	2	0	CDC42BPB	102485888	1.000000	0.71417	0.961000	0.40146	0.871000	0.50021	7.818000	0.86416	2.650000	0.89964	0.561000	0.74099	CCT			0.537	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000415711.1		NM_006035	
HCN4	10021	mdanderson.org	37	15	73615969	73615969	+	Missense_Mutation	SNP	G	G	T	rs201143364	byFrequency	TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr15:73615969G>T	ENST00000261917.3	-	8	3458	c.2465C>A	c.(2464-2466)aCg>aAg	p.T822K		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	822					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GTGCCTTGGCGTCTGCCCGGC	0.682																																					p.T822K													.	.			0			c.C2465A												30.0	34.0	33.0					15																	73615969		2196	4294	6490	SO:0001583	missense	10021	exon8			CTTGGCGTCTGCC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2465C>A	15.37:g.73615969G>T	ENSP00000261917:p.Thr822Lys		27	0	0		20	0.10	2	NM_005477	1	0.00	0	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	37	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.673384	0.29693	.	.	ENSG00000138622	ENST00000261917	T	0.80393	-1.37	3.49	3.49	0.39957	.	.	.	.	.	T	0.67599	0.2910	N	0.22421	0.69	0.35920	D	0.831711	P	0.44690	0.841	B	0.38712	0.28	T	0.71932	-0.4443	9	0.22109	T	0.4	.	15.1773	0.72924	0.0:0.0:1.0:0.0	.	822	Q9Y3Q4	HCN4_HUMAN	K	822	ENSP00000261917:T822K	ENSP00000261917:T822K	T	-	2	0	HCN4	71403022	0.999000	0.42202	0.988000	0.46212	0.208000	0.24298	2.801000	0.47908	1.766000	0.52107	0.462000	0.41574	ACG			0.682	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268900.2		NM_005477	
ADAMTS17	170691	ucsc.edu	37	15	100636613	100636613	+	Silent	SNP	G	G	A	rs141443664		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr15:100636613G>A	ENST00000268070.4	-	15	2190	c.2085C>T	c.(2083-2085)gaC>gaT	p.D695D		NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	695	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		AGGTCTTGCCGTCCCCGCTGC	0.592																																					p.D695D													.	ADAMTS17	127		0			c.C2085T							G		0,4406		0,0,2203	94.0	101.0	99.0		2085	-3.6	0.9	15	dbSNP_134	99	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ADAMTS17	NM_139057.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		695/1096	100636613	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	170691	exon15			CTTGCCGTCCCCG	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.2085C>T	15.37:g.100636613G>A			61	0	0		47	0.09	4	NM_139057	8	0.00	0	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	37	CCDS10383.1																																																																																					0.592	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313595.1		NM_139057	
MAPK8IP3	23162	mdanderson.org	37	16	1817206	1817206	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:1817206T>C	ENST00000250894.4	+	26	3299	c.3142T>C	c.(3142-3144)Tcc>Ccc	p.S1048P	MAPK8IP3_ENST00000356010.5_Missense_Mutation_p.S1042P	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3	1048					activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						CCCGCACCACTCCATCCGCTG	0.617																																					p.S1048P													.	.			0			c.T3142C												84.0	96.0	92.0					16																	1817206		2154	4261	6415	SO:0001583	missense	23162	exon26			CACCACTCCATCC	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.3142T>C	16.37:g.1817206T>C	ENSP00000250894:p.Ser1048Pro		153	0	0		52	0.06	3	NM_015133	109	0.01	1	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	Missense_Mutation	SNP	ENST00000250894.4	37	CCDS10442.2	.	.	.	.	.	.	.	.	.	.	T	20.5	4.004547	0.74932	.	.	ENSG00000138834	ENST00000250894;ENST00000356010	T;T	0.63580	-0.05;-0.05	4.03	4.03	0.46877	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.130964	0.53938	D	0.000048	T	0.67832	0.2935	L	0.31578	0.945	0.80722	D	1	P;D;D	0.89917	0.772;1.0;0.998	P;D;D	0.79784	0.593;0.991;0.993	T	0.71613	-0.4540	10	0.72032	D	0.01	-23.8006	12.9591	0.58447	0.0:0.0:0.0:1.0	.	1049;1042;1048	B7ZMF3;E9PFH7;Q9UPT6	.;.;JIP3_HUMAN	P	1048;1042	ENSP00000250894:S1048P;ENSP00000348290:S1042P	ENSP00000250894:S1048P	S	+	1	0	MAPK8IP3	1757207	1.000000	0.71417	1.000000	0.80357	0.468000	0.32798	7.811000	0.86092	1.610000	0.50200	0.482000	0.46254	TCC			0.617	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250508.2		NM_001040439	
TSC2	7249	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	2094711	2094711	+	5'Flank	SNP	G	G	A	rs376048896		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:2094711G>A	ENST00000219476.3	+	0	0				NTHL1_ENST00000562951.1_5'Flank|NTHL1_ENST00000219066.1_Missense_Mutation_p.R157W	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2						acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GTCAGGCCCCGCGCCCGCAGT	0.637			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.R157W			yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	.			0			c.C469T							G	TRP/ARG	0,4394		0,0,2197	46.0	36.0	39.0		469	3.3	0.4	16		39	1,8597	1.2+/-3.3	0,1,4298	no	missense	NTHL1	NM_002528.5	101	0,1,6495	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	157/313	2094711	1,12991	2197	4299	6496	SO:0001631	upstream_gene_variant	4913	exon3	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	GGCCCCGCGCCCG	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745		16.37:g.2094711G>A	Exception_encountered		75	0	0		35	0.43	15	NM_002528	98	0.45	44	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	37	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	G	13.78	2.338113	0.41398	0.0	1.16E-4	ENSG00000065057	ENST00000219066	D	0.88046	-2.33	5.44	3.27	0.37495	HhH-GPD domain (2);DNA glycosylase (2);	0.417646	0.25941	N	0.027303	D	0.89298	0.6675	M	0.93062	3.375	0.09310	N	1	B;B	0.19583	0.037;0.037	B;B	0.21546	0.035;0.035	D	0.83699	0.0181	10	0.62326	D	0.03	-6.67	11.3574	0.49623	0.0746:0.0:0.7921:0.1333	.	157;157	E5KTI5;P78549	.;NTHL1_HUMAN	W	157	ENSP00000219066:R157W	ENSP00000219066:R157W	R	-	1	2	NTHL1	2034712	0.767000	0.28508	0.382000	0.26119	0.922000	0.55478	4.256000	0.58810	1.300000	0.44818	0.561000	0.74099	CGG			0.637	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000250657.2		NM_000548	
SEZ6L2	26470	mdanderson.org	37	16	29888693	29888693	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:29888693C>A	ENST00000308713.5	-	11	2335	c.1808G>T	c.(1807-1809)cGc>cTc	p.R603L	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.R533L|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.R559L|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.R489L	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	603	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGAAGGCGGCGGCGCGGCTG	0.662																																					p.R603L													.	.			0			c.G1808T												16.0	19.0	18.0					16																	29888693		2192	4294	6486	SO:0001583	missense	26470	exon11			AGGCGGCGGCGCG	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1808G>T	16.37:g.29888693C>A	ENSP00000312550:p.Arg603Leu		132	0	0		35	0.09	3	NM_001243332	32	0.00	0	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	37	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709589	0.68730	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.57	4.62	0.57501	CUB (5);	0.109017	0.41605	D	0.000849	T	0.15219	0.0367	L	0.29908	0.895	0.39019	D	0.959701	B;P;P;P;P;P	0.42248	0.275;0.774;0.729;0.683;0.729;0.732	B;P;B;B;B;B	0.46479	0.176;0.518;0.239;0.309;0.436;0.384	T	0.11690	-1.0577	10	0.28530	T	0.3	.	6.9666	0.24627	0.2739:0.6436:0.0:0.0825	.	559;603;489;533;603;533	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	L	533;603;489;559	ENSP00000310206:R533L;ENSP00000312550:R603L;ENSP00000319215:R489L;ENSP00000439412:R559L	ENSP00000312550:R603L	R	-	2	0	SEZ6L2	29796194	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.537000	0.36083	1.354000	0.45846	0.655000	0.94253	CGC			0.662	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000255154.2		NM_012410	
RRAD	6236	mdanderson.org	37	16	66957613	66957613	+	Missense_Mutation	SNP	C	C	T	rs533912019		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:66957613C>T	ENST00000299759.6	-	4	705	c.455G>A	c.(454-456)cGc>cAc	p.R152H	RRAD_ENST00000420652.1_Missense_Mutation_p.R152H			P55042	RAD_HUMAN	Ras-related associated with diabetes	152					small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|urinary_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GGGCAACCAGCGGCCCCCGTC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		18655	0.0		0.0	False		,,,				2504	0.001				p.R152H													RRAD,colon,carcinoma,-1,1	RRAD	-1	1	0			c.G455A												91.0	94.0	93.0					16																	66957613		2200	4300	6500	SO:0001583	missense	6236	exon4			AACCAGCGGCCCC	L24564	CCDS10824.1	16q22	2014-05-09			ENSG00000166592	ENSG00000166592			10446	protein-coding gene	gene with protein product		179503				7859947	Standard	NM_004165		Approved	REM3, RAD	uc002eqo.2	P55042	OTTHUMG00000137511	ENST00000299759.6:c.455G>A	16.37:g.66957613C>T	ENSP00000299759:p.Arg152His		112	0	0		47	0.06	3	NM_001128850	13	0.00	0	Q96F39	Missense_Mutation	SNP	ENST00000299759.6	37	CCDS10824.1	.	.	.	.	.	.	.	.	.	.	C	8.894	0.954599	0.18431	.	.	ENSG00000166592	ENST00000420652;ENST00000299759	T;T	0.77877	-1.13;-1.13	4.81	-4.7	0.03288	Small GTP-binding protein domain (1);	0.533159	0.22760	N	0.055977	T	0.59742	0.2216	L	0.35542	1.07	0.24338	N	0.994977	B	0.13145	0.007	B	0.09377	0.004	T	0.45381	-0.9265	10	0.42905	T	0.14	.	8.633	0.33930	0.1276:0.1438:0.0:0.7285	.	152	P55042	RAD_HUMAN	H	152	ENSP00000388744:R152H;ENSP00000299759:R152H	ENSP00000299759:R152H	R	-	2	0	RRAD	65515114	0.991000	0.36638	0.014000	0.15608	0.034000	0.12701	0.542000	0.23222	-0.713000	0.04981	-1.272000	0.01410	CGC			0.607	RRAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268830.1		NM_004165	
IL34	146433	mdanderson.org	37	16	70680870	70680870	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:70680870G>T	ENST00000288098.2	+	1	403	c.20G>T	c.(19-21)tGg>tTg	p.W7L	IL34_ENST00000429149.2_Missense_Mutation_p.W7L|IL34_ENST00000569641.1_3'UTR	NM_001172772.1	NP_001166243.1	Q6ZMJ4	IL34_HUMAN	interleukin 34	7					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein phosphorylation (GO:0001934)	extracellular space (GO:0005615)	macrophage colony-stimulating factor receptor binding (GO:0005157)			breast(1)|central_nervous_system(1)|kidney(9)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(2)	17						GGCTTCACCTGGCTGCGCTGT	0.632																																					p.W7L													.	.			0			c.G20T												36.0	32.0	34.0					16																	70680870		2103	4107	6210	SO:0001583	missense	146433	exon2			TCACCTGGCTGCG	BC029804	CCDS10895.1	16q22.1	2008-08-01	2008-06-04	2008-06-04	ENSG00000157368	ENSG00000157368		"""Interleukins and interleukin receptors"""	28529	protein-coding gene	gene with protein product		612081	"""chromosome 16 open reading frame 77"""	C16orf77		18467591	Standard	NM_152456		Approved	MGC34647, IL-34	uc002ezh.2	Q6ZMJ4	OTTHUMG00000137581	ENST00000288098.2:c.20G>T	16.37:g.70680870G>T	ENSP00000288098:p.Trp7Leu		62	0	0		39	0.08	3	NM_001172772	0		0	B2RC28|B2Z4A8|B2ZC70|Q8N6L2	Missense_Mutation	SNP	ENST00000288098.2	37	CCDS10895.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942673	0.73672	.	.	ENSG00000157368	ENST00000429149;ENST00000288098	T;T	0.44482	0.92;0.92	5.38	3.4	0.38934	.	0.270733	0.31859	N	0.006958	T	0.38295	0.1035	M	0.75447	2.3	0.23266	N	0.998012	P;P	0.36535	0.557;0.557	B;B	0.33620	0.167;0.167	T	0.34004	-0.9846	10	0.41790	T	0.15	-15.946	7.5561	0.27824	0.0874:0.0:0.7452:0.1675	.	7;7	Q6ZMJ4-2;Q6ZMJ4	.;IL34_HUMAN	L	7	ENSP00000397863:W7L;ENSP00000288098:W7L	ENSP00000288098:W7L	W	+	2	0	IL34	69238371	0.590000	0.26815	0.999000	0.59377	0.949000	0.60115	1.887000	0.39698	1.422000	0.47177	-0.132000	0.14878	TGG			0.632	IL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268971.3		NM_152456	
CHST4	10164	mdanderson.org	37	16	71571321	71571321	+	Missense_Mutation	SNP	G	G	T	rs556276390		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:71571321G>T	ENST00000338482.5	+	3	1084	c.741G>T	c.(739-741)caG>caT	p.Q247H	RP11-510M2.5_ENST00000568523.1_RNA|ZNF19_ENST00000568446.1_Intron|CHST4_ENST00000539698.3_Missense_Mutation_p.Q247H|CHST4_ENST00000572450.1_Missense_Mutation_p.Q247H			Q8NCG5	CHST4_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4	247					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|immune response (GO:0006955)|inflammatory response (GO:0006954)|leukocyte tethering or rolling (GO:0050901)|N-acetylglucosamine metabolic process (GO:0006044)|protein sulfation (GO:0006477)|sulfur compound metabolic process (GO:0006790)	integral component of membrane (GO:0016021)|intrinsic component of Golgi membrane (GO:0031228)|trans-Golgi network (GO:0005802)	N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)|sulfotransferase activity (GO:0008146)			cervix(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	21						ATGTGATGCAGGTCATCTGCC	0.532											OREG0023923	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q247H													.	.			0			c.G741T												97.0	80.0	86.0					16																	71571321		2198	4300	6498	SO:0001583	missense	10164	exon2			GATGCAGGTCATC	AF131235	CCDS10902.1	16q22.2	2008-02-05			ENSG00000140835	ENSG00000140835		"""Sulfotransferases, membrane-bound"""	1972	protein-coding gene	gene with protein product						10330415	Standard	NM_001166395		Approved	HEC-GLCNAC-6-ST, LSST	uc002fao.3	Q8NCG5	OTTHUMG00000137592	ENST00000338482.5:c.741G>T	16.37:g.71571321G>T	ENSP00000341206:p.Gln247His		104	0	0	1131	52	0.06	3	NM_001166395	3	0.00	0	Q8IV46|Q9Y5R3	Missense_Mutation	SNP	ENST00000338482.5	37	CCDS10902.1	.	.	.	.	.	.	.	.	.	.	G	18.55	3.647242	0.67358	.	.	ENSG00000140835	ENST00000338482;ENST00000539698	D;D	0.82893	-1.66;-1.66	6.02	1.21	0.21127	Sulfotransferase domain (1);	0.269234	0.37906	N	0.001883	D	0.85639	0.5743	M	0.68952	2.095	0.29694	N	0.840677	D	0.53619	0.961	P	0.62649	0.905	T	0.78907	-0.2019	10	0.59425	D	0.04	-38.3275	5.0698	0.14600	0.354:0.1522:0.4938:0.0	.	247	Q8NCG5	CHST4_HUMAN	H	247	ENSP00000341206:Q247H;ENSP00000441204:Q247H	ENSP00000341206:Q247H	Q	+	3	2	CHST4	70128822	1.000000	0.71417	0.956000	0.39512	0.903000	0.53119	1.606000	0.36826	0.386000	0.24997	0.655000	0.94253	CAG			0.532	CHST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000268992.4		NM_005769	
DPEP1	1800	mdanderson.org	37	16	89702799	89702799	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr16:89702799G>T	ENST00000393092.3	+	4	656	c.365G>T	c.(364-366)aGt>aTt	p.S122I	DPEP1_ENST00000421184.1_Missense_Mutation_p.S122I|DPEP1_ENST00000261615.4_Missense_Mutation_p.S122I	NM_004413.3	NP_004404.1	P16444	DPEP1_HUMAN	dipeptidase 1 (renal)	122					antibiotic metabolic process (GO:0016999)|arachidonic acid metabolic process (GO:0019369)|cellular lactam catabolic process (GO:0072340)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to nitric oxide (GO:0071732)|glutathione metabolic process (GO:0006749)|homocysteine metabolic process (GO:0050667)|leukotriene metabolic process (GO:0006691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dipeptidyl-peptidase activity (GO:0008239)|GPI anchor binding (GO:0034235)|metallodipeptidase activity (GO:0070573)|metalloexopeptidase activity (GO:0008235)|modified amino acid binding (GO:0072341)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	14		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	GTCACCAGCAGTGCAGGTGGG	0.632																																					p.S122I													.	.			0			c.G365T												62.0	50.0	54.0					16																	89702799		2186	4293	6479	SO:0001583	missense	1800	exon4			CCAGCAGTGCAGG		CCDS10982.1	16q24	2011-07-22			ENSG00000015413	ENSG00000015413	3.4.13.19		3002	protein-coding gene	gene with protein product		179780					Standard	NM_004413		Approved		uc002fnr.4	P16444	OTTHUMG00000138052	ENST00000393092.3:c.365G>T	16.37:g.89702799G>T	ENSP00000376807:p.Ser122Ile		154	0	0		47	0.06	3	NM_001128141	1	0.00	0	D3DX80|Q96AK2	Missense_Mutation	SNP	ENST00000393092.3	37	CCDS10982.1	.	.	.	.	.	.	.	.	.	.	g	19.08	3.758794	0.69763	.	.	ENSG00000015413	ENST00000421184;ENST00000393092;ENST00000261615	T;T;T	0.22134	1.97;1.97;1.97	5.41	5.41	0.78517	.	0.082756	0.85682	D	0.000000	T	0.50309	0.1608	M	0.86178	2.8	0.58432	D	0.999997	D	0.65815	0.995	D	0.66084	0.941	T	0.56780	-0.7922	10	0.87932	D	0	-9.4908	16.1523	0.81632	0.0:0.0:1.0:0.0	.	122	P16444	DPEP1_HUMAN	I	122	ENSP00000397313:S122I;ENSP00000376807:S122I;ENSP00000261615:S122I	ENSP00000261615:S122I	S	+	2	0	DPEP1	88230300	1.000000	0.71417	0.364000	0.25888	0.203000	0.24098	5.122000	0.64697	2.551000	0.86045	0.550000	0.68814	AGT			0.632	DPEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000423058.1		NM_001128141	
ZNF286A	57335	broad.mit.edu;bcgsc.ca;mdanderson.org	37	17	15611559	15611559	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr17:15611559C>T	ENST00000464847.2	+	4	885	c.332C>T	c.(331-333)tCa>tTa	p.S111L	ZNF286A_ENST00000583566.1_Missense_Mutation_p.S111L|ZNF286A_ENST00000395894.2_Missense_Mutation_p.S111L|ZNF286A_ENST00000421016.1_Missense_Mutation_p.S111L|ZNF286A_ENST00000472486.1_Missense_Mutation_p.S101L|ZNF286A_ENST00000585194.1_Missense_Mutation_p.S111L|ZNF286A_ENST00000581529.1_3'UTR|ZNF286A_ENST00000395893.2_Missense_Mutation_p.S111L|ZNF286A_ENST00000580259.1_3'UTR|ZNF286A_ENST00000585171.1_3'UTR|ZNF286A_ENST00000413242.2_Missense_Mutation_p.S111L|ZNF286A_ENST00000593105.1_Missense_Mutation_p.S101L			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	111	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		AGCAGCTATTCAGGTGAGCCA	0.423																																					p.S111L													.	ZNF286A	58		0			c.C332T												53.0	54.0	53.0					17																	15611559		2203	4300	6503	SO:0001583	missense	57335	exon5			GCTATTCAGGTGA	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.332C>T	17.37:g.15611559C>T	ENSP00000464218:p.Ser111Leu		280	0	0		144	0.04	6	NM_020652	47	0.09	4	B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	37	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	c	13.31	2.197832	0.38806	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894;ENST00000395893	T;T;T;T	0.07567	3.54;3.18;5.54;5.59	4.85	4.85	0.62838	Krueppel-associated box (1);	8.183600	0.00633	N	0.000488	T	0.09642	0.0237	N	0.19112	0.55	0.37066	D	0.898307	B	0.26635	0.155	B	0.26094	0.066	T	0.15435	-1.0437	10	0.38643	T	0.18	-0.7981	13.6645	0.62387	0.0:1.0:0.0:0.0	.	111	Q9HBT8	Z286A_HUMAN	L	111;101;111;111	ENSP00000397163:S111L;ENSP00000408168:S101L;ENSP00000379231:S111L;ENSP00000379230:S111L	ENSP00000435872:S111L	S	+	2	0	ZNF286A	15552284	0.995000	0.38212	0.997000	0.53966	0.127000	0.20565	3.845000	0.55880	2.680000	0.91292	0.563000	0.77884	TCA			0.423	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000130696.4		NM_020652	
ABCA6	23460	hgsc.bcm.edu	37	17	67136799	67136799	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr17:67136799G>T	ENST00000284425.2	-	2	220	c.46C>A	c.(46-48)Ctg>Atg	p.L16M	ABCA6_ENST00000590645.1_Missense_Mutation_p.L16M	NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	16					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTCTTGCACAGAAGTGCTTTG	0.358																																					p.L16M													.	.			0			c.C46A												159.0	159.0	159.0					17																	67136799		2203	4298	6501	SO:0001583	missense	23460	exon2			TGCACAGAAGTGC	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.46C>A	17.37:g.67136799G>T	ENSP00000284425:p.Leu16Met		122	0	0		90	0.04	4	NM_080284	1	0.00	0	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	ENST00000284425.2	37	CCDS11683.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203995	0.58234	.	.	ENSG00000154262	ENST00000284425	D	0.89875	-2.58	5.32	2.25	0.28309	.	0.000000	0.30547	N	0.009395	D	0.92208	0.7529	M	0.69823	2.125	0.28363	N	0.920375	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.85668	0.1293	10	0.87932	D	0	.	7.6287	0.28226	0.2678:0.0:0.7322:0.0	.	16;16	Q8N139-3;Q8N139	.;ABCA6_HUMAN	M	16	ENSP00000284425:L16M	ENSP00000284425:L16M	L	-	1	2	ABCA6	64648394	1.000000	0.71417	0.362000	0.25862	0.979000	0.70002	0.905000	0.28504	0.329000	0.23460	0.563000	0.77884	CTG			0.358	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000450463.1		NM_080284	
RNF213	57674	broad.mit.edu	37	17	78262016	78262016	+	Missense_Mutation	SNP	G	G	A	rs199976159		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr17:78262016G>A	ENST00000582970.1	+	4	807	c.664G>A	c.(664-666)Ggt>Agt	p.G222S	RNF213_ENST00000508628.2_Missense_Mutation_p.G271S|RNF213_ENST00000456466.1_Missense_Mutation_p.G222S|RNF213_ENST00000319921.4_Missense_Mutation_p.G222S	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	222					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GGAGGGGACCGGTCCCCCCAC	0.642																																					p.G222S													.	RNF213	766		0			c.G664A							G	SER/GLY,SER/GLY	0,4406		0,0,2203	52.0	56.0	54.0		811,664	-1.7	0.0	17		54	2,8598		0,2,4298	yes	missense,missense	RNF213	NM_020914.4,NM_020954.2	56,56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	271/5257,222/1064	78262016	2,13004	2203	4300	6503	SO:0001583	missense	57674	exon4			GGGACCGGTCCCC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.664G>A	17.37:g.78262016G>A	ENSP00000464087:p.Gly222Ser		141	0	0		74	0.04	3	NM_001256071	6	0.00	0	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	37	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	G	8.848	0.943961	0.18281	0.0	2.33E-4	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	T;T	0.39997	1.05;1.05	4.33	-1.66	0.08265	.	2.970470	0.01513	N	0.018036	T	0.29028	0.0721	L	0.43152	1.355	0.09310	N	1	P	0.34743	0.466	B	0.28784	0.094	T	0.16188	-1.0411	10	0.05721	T	0.95	-5.5574	8.1379	0.31064	0.5104:0.0:0.4896:0.0	.	222	Q9HCF4-2	.	S	222;271;222;222	ENSP00000392123:G222S;ENSP00000324392:G222S	ENSP00000324392:G222S	G	+	1	0	RNF213	75876611	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.032000	0.13732	-0.356000	0.08187	-1.075000	0.02238	GGT			0.642	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000443298.1		NM_020914	
C19orf35	374872	mdanderson.org	37	19	2275721	2275721	+	Silent	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:2275721G>T	ENST00000342063.3	-	4	1473	c.1380C>A	c.(1378-1380)acC>acA	p.T460T		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	460										large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCGAGGACTCGGTGGCCTCGG	0.711																																					p.T460T													.	.			0			c.C1380A												12.0	12.0	12.0					19																	2275721		2184	4257	6441	SO:0001819	synonymous_variant	374872	exon4			GGACTCGGTGGCC	AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.1380C>A	19.37:g.2275721G>T			71	0	0		27	0.11	3	NM_198532	0		0		Silent	SNP	ENST00000342063.3	37	CCDS12087.1																																																																																					0.711	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442080.1		NM_198532	
DUS3L	56931	mdanderson.org	37	19	5786832	5786832	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:5786832G>T	ENST00000309061.7	-	9	1510	c.1414C>A	c.(1414-1416)Cgc>Agc	p.R472S	DUS3L_ENST00000320699.8_Missense_Mutation_p.R230S|DUS3L_ENST00000590681.1_5'Flank|CTB-54O9.9_ENST00000586012.1_5'Flank|PRR22_ENST00000419421.2_5'Flank	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	472							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						TTGGTGTAGCGCTGCTCCCGA	0.662																																					p.R472S													.	.			0			c.C1414A												28.0	33.0	31.0					19																	5786832		2197	4294	6491	SO:0001583	missense	56931	exon9			TGTAGCGCTGCTC		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.1414C>A	19.37:g.5786832G>T	ENSP00000311977:p.Arg472Ser		88	0	0		51	0.06	3	NM_020175	49	0.00	0	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	37	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	G	33	5.209737	0.95069	.	.	ENSG00000141994	ENST00000309061;ENST00000320699	T;T	0.23348	1.91;1.91	5.01	5.01	0.66863	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	H	0.94886	3.595	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75016	-0.3466	10	0.87932	D	0	-22.5678	15.8427	0.78861	0.0:0.0:1.0:0.0	.	230;472	Q96G46-3;Q96G46	.;DUS3L_HUMAN	S	472;230	ENSP00000311977:R472S;ENSP00000315558:R230S	ENSP00000311977:R472S	R	-	1	0	DUS3L	5737832	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.314000	0.51943	2.324000	0.78689	0.549000	0.68633	CGC			0.662	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000451870.2		NM_020175	
KEAP1	9817	mdanderson.org	37	19	10597469	10597469	+	Silent	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:10597469C>A	ENST00000171111.5	-	6	2281	c.1734G>T	c.(1732-1734)ctG>ctT	p.L578L	KEAP1_ENST00000393623.2_Silent_p.L578L	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	578					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	CCACACTGTCCAGGAACGTGT	0.582																																					p.L578L													.	.			0			c.G1734T												96.0	83.0	87.0					19																	10597469		2203	4300	6503	SO:0001819	synonymous_variant	9817	exon6			ACTGTCCAGGAAC	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1734G>T	19.37:g.10597469C>A			118	0	0		52	0.06	3	NM_012289	229	0.00	0	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Silent	SNP	ENST00000171111.5	37	CCDS12239.1																																																																																					0.582	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452000.1		NM_012289	
ZNF682	91120	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	19	20117945	20117946	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	CT	CT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:20117945_20117946delCT	ENST00000397165.2	-	4	525_526	c.365_366delAG	c.(364-366)gagfs	p.E122fs	ZNF682_ENST00000595736.1_Frame_Shift_Del_p.E46fs|ZNF682_ENST00000593468.1_3'UTR|ZNF682_ENST00000597972.1_Frame_Shift_Del_p.E128fs|ZNF682_ENST00000358523.5_Frame_Shift_Del_p.E90fs|ZNF682_ENST00000397162.1_Frame_Shift_Del_p.E90fs|ZNF682_ENST00000596019.1_Intron	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						GATCCTTACACTCACCCACATT	0.351																																					p.122_123del													.	ZNF682	51		0			c.366_367del																																									SO:0001589	frameshift_variant	91120	exon4			CTTACACTCACCC	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.365_366delAG	19.37:g.20117945_20117946delCT	ENSP00000380351:p.Glu122fs		134	0	0		110	0.46	51	NM_033196	11	0.00	0	B3KU64|E9PFJ5|Q96JV9	Frame_Shift_Del	DEL	ENST00000397165.2	37	CCDS42533.1																																																																																					0.351	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000462888.1		NM_033196	
ZNF66	7617	bcgsc.ca	37	19	20989041	20989041	+	Missense_Mutation	SNP	G	G	A	rs544526730		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:20989041G>A	ENST00000344519.8	+	4	658	c.635G>A	c.(634-636)cGg>cAg	p.R212Q	AC010329.1_ENST00000582722.1_RNA|ZNF66_ENST00000425625.1_Missense_Mutation_p.R258Q			Q6ZN08	ZNF66_HUMAN	zinc finger protein 66	212					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GCCTTCAACCGGTCCTCACAC	0.408													.|||	1	0.000199681	0.0008	0.0	5008	,	,		18896	0.0		0.0	False		,,,				2504	0.0				.													.	.			0			.																																									SO:0001583	missense	7617	.			TCAACCGGTCCTC	M88375		19p12	2013-03-06	2013-03-06	2013-03-06	ENSG00000160229	ENSG00000160229			13135	other	unknown			"""zinc finger protein 66, pseudogene"""	ZNF66P		1505991	Standard	NG_023377		Approved	FLJ16537	uc002npe.3	Q6ZN08	OTTHUMG00000167735	ENST00000344519.8:c.635G>A	19.37:g.20989041G>A	ENSP00000461425:p.Arg212Gln		34	0	0		29	0.38	11	.	1	1.00	1	I3L4P5|Q15939	Missense_Mutation	SNP	ENST00000344519.8	37																																																																																						0.408	ZNF66-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000395955.2		NG_023377	
CLASRP	11129	bcgsc.ca	37	19	45559754	45559754	+	Silent	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_1	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr19:45559754C>T	ENST00000221455.3	+	6	524	c.426C>T	c.(424-426)taC>taT	p.Y142Y	CLASRP_ENST00000544944.2_Silent_p.Y142Y|CLASRP_ENST00000391953.4_Silent_p.Y80Y	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	142					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						ATGAGTTGTACGGAGGCCTCC	0.582																																					p.Y142Y													.	CLASRP	44		0			c.C426T												110.0	98.0	102.0					19																	45559754		2203	4300	6503	SO:0001819	synonymous_variant	11129	exon6			GTTGTACGGAGGC	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.426C>T	19.37:g.45559754C>T			112	0	0		45	0.09	4	NM_007056	112	0.00	0	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Silent	SNP	ENST00000221455.3	37	CCDS12652.2																																																																																					0.582	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316749.1		NM_007056	
TRAPPC12	51112	mdanderson.org	37	2	3461436	3461436	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:3461436G>T	ENST00000324266.5	+	7	1770	c.1575G>T	c.(1573-1575)atG>atT	p.M525I	TRAPPC12_ENST00000382110.2_Missense_Mutation_p.M525I|TRAPPC12_ENST00000469147.1_3'UTR	NM_016030.5	NP_057114.5	Q8WVT3	TPC12_HUMAN	trafficking protein particle complex 12	525					vesicle-mediated transport (GO:0016192)												ACGGCGGCATGAGCAGCGTGA	0.517																																					p.M525I													.	.			0			c.G1575T												98.0	89.0	92.0					2																	3461436		2203	4300	6503	SO:0001583	missense	51112	exon7			CGGCATGAGCAGC	BC017475	CCDS1652.1	2p25.3	2013-01-10	2011-12-12	2011-12-12	ENSG00000171853	ENSG00000171853		"""Trafficking protein particle complex"", ""Tetratricopeptide (TTC) repeat domain containing"""	24284	protein-coding gene	gene with protein product		614139	"""tetratricopeptide repeat domain 15"""	TTC15		10810093, 21525244, 20562859	Standard	NM_016030		Approved	CGI-87, TTC-15	uc002qxm.1	Q8WVT3	OTTHUMG00000090328	ENST00000324266.5:c.1575G>T	2.37:g.3461436G>T	ENSP00000324318:p.Met525Ile		29	0	0		15	0.20	3	NM_016030	44	0.00	0	B3KV01|D6W4Y2|Q8WVW1|Q9Y395	Missense_Mutation	SNP	ENST00000324266.5	37	CCDS1652.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	g|g|g	8.199|8.199|8.199	0.797689|0.797689|0.797689	0.16327|0.16327|0.16327	.|.|.	.|.|.	ENSG00000171853|ENSG00000171853|ENSG00000171853	ENST00000433382|ENST00000382110;ENST00000304601;ENST00000324266;ENST00000415624|ENST00000441983	.|T;T|.	.|0.44482|.	.|0.92;0.92|.	5.1|5.1|5.1	4.23|4.23|4.23	0.50019|0.50019|0.50019	.|.|.	.|0.475120|.	.|0.25327|.	.|N|.	.|0.031466|.	.|T|.	.|0.45256|.	.|0.1333|.	L|L|L	0.38175|0.38175|0.38175	1.15|1.15|1.15	0.29838|0.29838|0.29838	N|N|N	0.829452|0.829452|0.829452	.|B;B|.	.|0.23316|.	.|0.022;0.083|.	.|B;B|.	.|0.15484|.	.|0.013;0.008|.	.|T|.	.|0.42666|.	.|-0.9438|.	.|10|.	.|0.19590|.	.|T|.	.|0.45|.	.|.|.	13.0339|13.0339|13.0339	0.58859|0.58859|0.58859	0.0771:0.0:0.9229:0.0|0.0771:0.0:0.9229:0.0|0.0771:0.0:0.9229:0.0	.|.|.	.|508;525|.	.|E7ENL7;Q8WVT3|.	.|.;TPC12_HUMAN|.	X|I|L	71|525;508;525;23|205	.|ENSP00000371544:M525I;ENSP00000324318:M525I|.	.|ENSP00000303612:M508I|.	E|M|X	+|+|+	1|3|2	0|0|2	TTC15|TTC15|TTC15	3440443|3440443|3440443	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.011000|0.011000|0.011000	0.14972|0.14972|0.14972	0.031000|0.031000|0.031000	0.12232|0.12232|0.12232	3.738000|3.738000|3.738000	0.55067|0.55067|0.55067	1.395000|1.395000|1.395000	0.46643|0.46643|0.46643	-0.349000|-0.349000|-0.349000	0.07799|0.07799|0.07799	GAG|ATG|TGA			0.517	TRAPPC12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206693.2		NM_016030	
FBXO11	80204	broad.mit.edu	37	2	48036814	48036814	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:48036814G>T	ENST00000403359.3	-	20	2443	c.2371C>A	c.(2371-2373)Cta>Ata	p.L791I	MSH6_ENST00000234420.5_3'UTR|FBXO11_ENST00000316377.4_Missense_Mutation_p.L707I|FBXO11_ENST00000434523.2_Missense_Mutation_p.L215I|FBXO11_ENST00000405808.1_5'Flank|FBXO11_ENST00000402508.1_Missense_Mutation_p.L707I	NM_001190274.1	NP_001177203.1	Q86XK2	FBX11_HUMAN	F-box protein 11	791					cellular protein modification process (GO:0006464)|peptidyl-arginine N-methylation (GO:0035246)|protein ubiquitination (GO:0016567)|sensory perception of sound (GO:0007605)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	protein-arginine N-methyltransferase activity (GO:0016274)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTGCCTTCTAGTGTTGCAGTT	0.338			"""Mis, F, D"""		DLBCL																																p.L791I				Rec	yes		2	2p16.3	80204	F-box protein 11		L	.	FBXO11	127		2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.C2371A												107.0	103.0	104.0					2																	48036814		2203	4299	6502	SO:0001583	missense	80204	exon20			CTTCTAGTGTTGC	AF174599	CCDS1837.1, CCDS54357.1	2p16.3	2014-01-29	2008-06-23	2008-06-23	ENSG00000138081	ENSG00000138081		"""Ubiquitin protein ligase E3 component n-recognins"", ""F-boxes /  ""other"""""	13590	protein-coding gene	gene with protein product	"""ubiquitin protein ligase E3 component n-recognin 6"""	607871	"""F-box only protein 11"""			10531035, 16487488, 18162545	Standard	NM_025133		Approved	FBX11, UBR6	uc002rwe.3	Q86XK2	OTTHUMG00000129130	ENST00000403359.3:c.2371C>A	2.37:g.48036814G>T	ENSP00000384823:p.Leu791Ile		116	0	0		104	0.04	4	NM_001190274	187	0.00	0	A1L491|Q52ZP1|Q53EP7|Q53RT5|Q8IXG3|Q96E90|Q9H6V8|Q9H9L1|Q9NR14|Q9UFK1|Q9UHI1|Q9UKC2	Missense_Mutation	SNP	ENST00000403359.3	37	CCDS54357.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009802	0.54361	.	.	ENSG00000138081	ENST00000402508;ENST00000403359;ENST00000316377;ENST00000434523	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.48	2.74	0.32292	.	0.000000	0.85682	D	0.000000	T	0.74084	0.3670	L	0.28192	0.835	0.80722	D	1	P	0.38767	0.646	P	0.52267	0.694	T	0.69815	-0.5043	10	0.45353	T	0.12	-5.3859	8.614	0.33820	0.3662:0.0:0.6338:0.0	.	215	B3KUR1	.	I	707;791;707;215	ENSP00000385398:L707I;ENSP00000384823:L791I;ENSP00000323822:L707I;ENSP00000397359:L215I	ENSP00000323822:L707I	L	-	1	2	FBXO11	47890318	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.373000	0.34272	0.379000	0.24794	0.561000	0.74099	CTA			0.338	FBXO11-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000251181.3		NM_012167, NM_018693, NM_025133	
VPS54	51542	mdanderson.org	37	2	64160840	64160840	+	Nonsense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:64160840G>T	ENST00000272322.4	-	12	1860	c.1706C>A	c.(1705-1707)tCa>tAa	p.S569*	VPS54_ENST00000354504.3_Nonsense_Mutation_p.S416*|VPS54_ENST00000409558.4_Nonsense_Mutation_p.S557*			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	569					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						AGCAGATGATGATGTGTGCTC	0.403																																					p.S569X													.	.			0			c.C1706A												110.0	107.0	108.0					2																	64160840		2203	4300	6503	SO:0001587	stop_gained	51542	exon12			GATGATGATGTGT	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.1706C>A	2.37:g.64160840G>T	ENSP00000272322:p.Ser569*		47	0	0		47	0.06	3	NM_016516	43	0.00	0	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Nonsense_Mutation	SNP	ENST00000272322.4	37	CCDS33208.1	.	.	.	.	.	.	.	.	.	.	G	43	9.915029	0.99294	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	.	.	.	5.47	5.47	0.80525	.	0.571723	0.18892	N	0.128297	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	12.6449	0.56729	0.0756:0.0:0.9244:0.0	.	.	.	.	X	416;569;557;557;569	.	ENSP00000272322:S569X	S	-	2	0	VPS54	64014344	0.985000	0.35326	0.998000	0.56505	0.926000	0.56050	5.763000	0.68818	2.566000	0.86566	0.563000	0.77884	TCA			0.403	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000327062.2		NM_016516	
TMEM182	130827	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;mdanderson.org	37	2	103380825	103380825	+	Nonsense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:103380825C>A	ENST00000412401.2	+	3	475	c.270C>A	c.(268-270)taC>taA	p.Y90*	TMEM182_ENST00000409173.1_Nonsense_Mutation_p.Y47*|TMEM182_ENST00000486293.1_3'UTR|TMEM182_ENST00000409528.1_De_novo_Start_InFrame	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	90						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						CACATGCTTACCTGTCTCCGT	0.478																																					p.Y90X													.	.			0			c.C270A												183.0	142.0	156.0					2																	103380825		2203	4300	6503	SO:0001587	stop_gained	130827	exon3			TGCTTACCTGTCT	AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.270C>A	2.37:g.103380825C>A	ENSP00000394178:p.Tyr90*		153	0	0		136	0.27	37	NM_144632	19	0.21	4	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Nonsense_Mutation	SNP	ENST00000412401.2	37	CCDS2064.1	.	.	.	.	.	.	.	.	.	.	C	37	6.552073	0.97658	.	.	ENSG00000170417	ENST00000454536;ENST00000409173;ENST00000412401	.	.	.	5.83	3.09	0.35607	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-31.4492	9.7312	0.40361	0.0:0.7274:0.0:0.2726	.	.	.	.	X	47;47;90	.	ENSP00000387184:Y47X	Y	+	3	2	TMEM182	102747257	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	1.280000	0.33202	0.827000	0.34685	-0.136000	0.14681	TAC			0.478	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253293.1		NM_144632	
RAB6C-AS1	100131320	broad.mit.edu	37	2	130726529	130726529	+	RNA	DEL	A	A	-	rs112755128		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:130726529delA	ENST00000412425.1	-	0	615					NR_036537.1																						AACGAAGTGCAAAAAAAAAAA	0.343																																					.													.	.			0			.																																											0	.			AAGTGCAAAAAAA																													2.37:g.130726529delA			6	0	0		11	0.36	4	.	0		0		RNA	DEL	ENST00000412425.1	37																																																																																						0.343	AC079776.7-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000331383.1			
COPS7B	64708	broad.mit.edu	37	2	232646544	232646544	+	5'UTR	SNP	G	G	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr2:232646544G>A	ENST00000410024.1	+	0	164				PDE6D_ENST00000287600.4_5'Flank|COPS7B_ENST00000409091.1_5'UTR|PDE6D_ENST00000409772.1_5'Flank|PDE6D_ENST00000477748.1_5'Flank|COPS7B_ENST00000409295.1_Missense_Mutation_p.R4H			Q9H9Q2	CSN7B_HUMAN	COP9 signalosome subunit 7B						cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)	8		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		ATGACAGCCCGCAGAGAGTTA	0.458																																					.													.	PDE6D	8		0			.																																									SO:0001623	5_prime_UTR_variant	64708	.			CAGCCCGCAGAGA	AK022674	CCDS2488.1, CCDS63152.1, CCDS63153.1, CCDS63154.1, CCDS74668.1	2q37.1	2013-03-14	2013-03-14		ENSG00000144524	ENSG00000144524			16760	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7B"", ""COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis)"""			9707402	Standard	NM_001282950		Approved	CSN7B	uc002vsg.1	Q9H9Q2	OTTHUMG00000133228	ENST00000410024.1:c.-66G>A	2.37:g.232646544G>A			193	0	0		162	0.02	4	.	3	0.00	0	Q53S22|Q5BJG3|Q9H7V6	Missense_Mutation	SNP	ENST00000410024.1	37	CCDS2488.1	.	.	.	.	.	.	.	.	.	.	G	8.349	0.830374	0.16749	.	.	ENSG00000144524	ENST00000409295	.	.	.	4.69	1.03	0.20045	.	.	.	.	.	T	0.58061	0.2096	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56583	-0.7955	5	0.87932	D	0	.	3.7654	0.08620	0.6093:0.1886:0.2021:0.0	.	.	.	.	H	4	.	ENSP00000386438:R4H	R	+	2	0	COPS7B	232354788	0.992000	0.36948	0.807000	0.32361	0.701000	0.40568	0.474000	0.22148	0.176000	0.19873	-0.482000	0.04802	CGC			0.458	COPS7B-015	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000331916.1		NM_022730	
FAM83C	128876	mdanderson.org	37	20	33875775	33875775	+	Splice_Site	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr20:33875775G>T	ENST00000374408.3	-	4	903	c.807C>A	c.(805-807)agC>agA	p.S269R	EIF6_ENST00000374450.3_5'Flank|FAM83C-AS1_ENST00000429167.1_RNA	NM_178468.5	NP_848563.1	Q9BQN1	FA83C_HUMAN	family with sequence similarity 83, member C	269										central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GCCAGGTGAAGCTGGGGGCAG	0.637																																					p.S269R													.	.			0			c.C807A												11.0	12.0	12.0					20																	33875775		2145	4235	6380	SO:0001630	splice_region_variant	128876	exon4			GGTGAAGCTGGGG	AL121753	CCDS13251.1	20q11.22	2011-04-01	2006-03-23	2006-03-23	ENSG00000125998	ENSG00000125998			16121	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 128"""	C20orf128			Standard	NM_178468		Approved	dJ614O4.7	uc021wck.1	Q9BQN1	OTTHUMG00000032332	ENST00000374408.3:c.807-1C>A	20.37:g.33875775G>T			83	0.0120481928	1		33	0.09	3	NM_178468	0		0	Q14D67|Q5JWN6|Q8N276	Missense_Mutation	SNP	ENST00000374408.3	37	CCDS13251.1	.	.	.	.	.	.	.	.	.	.	G	16.32	3.088852	0.55968	.	.	ENSG00000125998	ENST00000374408	T	0.15017	2.46	4.13	3.1	0.35709	.	0.293866	0.36101	N	0.002784	T	0.27419	0.0673	L	0.46819	1.47	0.45318	D	0.998315	D	0.89917	1.0	D	0.85130	0.997	T	0.02546	-1.1143	10	0.59425	D	0.04	.	4.127	0.10131	0.1251:0.0:0.6421:0.2328	.	269	Q9BQN1	FA83C_HUMAN	R	269	ENSP00000363529:S269R	ENSP00000363529:S269R	S	-	3	2	FAM83C	33339189	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.875000	0.39578	2.287000	0.76781	0.561000	0.74099	AGC			0.637	FAM83C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000078854.3			Missense_Mutation
SLC32A1	140679	broad.mit.edu	37	20	37357187	37357187	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr20:37357187G>A	ENST00000217420.1	+	2	1746	c.1483G>A	c.(1483-1485)Gcc>Acc	p.A495T		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	495					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.A495T(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CTTCGACGTCGCCATCTTCGT	0.647																																					p.A495T													SLC32A1,NS,carcinoma,0,3	SLC32A1	81	3	1	Substitution - Missense(1)	lung(1)	c.G1483A												24.0	23.0	23.0					20																	37357187		2202	4300	6502	SO:0001583	missense	140679	exon2			GACGTCGCCATCT	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1483G>A	20.37:g.37357187G>A	ENSP00000217420:p.Ala495Thr		161	0	0		100	0.04	4	NM_080552	0		0	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626666	0.28978	.	.	ENSG00000101438	ENST00000217420	T	0.02197	4.4	4.95	4.95	0.65309	.	0.112837	0.64402	D	0.000012	T	0.03220	0.0094	L	0.48642	1.525	0.58432	D	0.999996	P	0.35107	0.484	B	0.37601	0.254	T	0.57728	-0.7761	10	0.29301	T	0.29	-18.9514	11.1747	0.48593	0.0:0.0:0.8161:0.1839	.	495	Q9H598	VIAAT_HUMAN	T	495	ENSP00000217420:A495T	ENSP00000217420:A495T	A	+	1	0	SLC32A1	36790601	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.508000	0.53378	2.455000	0.83008	0.655000	0.94253	GCC			0.647	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000079206.1		NM_080552	
COL6A1	1291	mdanderson.org	37	21	47417374	47417374	+	Missense_Mutation	SNP	G	G	T	rs372619016		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr21:47417374G>T	ENST00000361866.3	+	21	1552	c.1438G>T	c.(1438-1440)Gat>Tat	p.D480Y		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	480	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CTACCGAGGCGATGAGGGTCC	0.662																																					p.D480Y													.	.			0			c.G1438T												65.0	57.0	60.0					21																	47417374		2203	4300	6503	SO:0001583	missense	1291	exon21			CGAGGCGATGAGG	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1438G>T	21.37:g.47417374G>T	ENSP00000355180:p.Asp480Tyr		77	0	0		45	0.07	3	NM_001848	425	0.00	0	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	37	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	G	10.93	1.490428	0.26686	.	.	ENSG00000142156	ENST00000361866;ENST00000538397	D	0.94330	-3.4	3.44	3.44	0.39384	.	0.367213	0.24370	N	0.039117	D	0.93973	0.8070	L	0.35854	1.095	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	D	0.93887	0.7176	10	0.62326	D	0.03	-22.2243	12.0709	0.53616	0.0:0.0:1.0:0.0	.	480	P12109	CO6A1_HUMAN	Y	480	ENSP00000355180:D480Y	ENSP00000355180:D480Y	D	+	1	0	COL6A1	46241802	0.996000	0.38824	0.633000	0.29310	0.409000	0.31022	3.629000	0.54266	1.950000	0.56595	0.297000	0.19635	GAT			0.662	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000206877.1		NM_001848	
BID	637	mdanderson.org	37	22	18220954	18220954	+	Silent	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr22:18220954C>T	ENST00000399774.3	-	5	574	c.405G>A	c.(403-405)ctG>ctA	p.L135L	BID_ENST00000473439.1_5'UTR|BID_ENST00000399767.1_Silent_p.L39L|BID_ENST00000317361.7_Silent_p.L181L|BID_ENST00000399765.1_Silent_p.L39L|BID_ENST00000342111.5_3'UTR|BID_ENST00000551952.1_Silent_p.L135L	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	135					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		GGTAGGCCTGCAGCAGCTGCT	0.592																																					p.L181L													.	.			0			c.G543A												69.0	63.0	65.0					22																	18220954		2203	4300	6503	SO:0001819	synonymous_variant	637	exon5			GGCCTGCAGCAGC	AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.405G>A	22.37:g.18220954C>T			63	0	0		35	0.09	3	NM_197966	118	0.00	0	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Silent	SNP	ENST00000399774.3	37	CCDS13748.1																																																																																					0.592	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000316178.1		NM_197966	
EMC3	55831	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	3	10012302	10012302	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr3:10012302G>A	ENST00000245046.2	-	6	996	c.538C>T	c.(538-540)Cgg>Tgg	p.R180W	EMC3_ENST00000497557.1_5'UTR	NM_018447.2	NP_060917.1	Q9P0I2	EMC3_HUMAN	ER membrane protein complex subunit 3	180						ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TAAATGCTCCGAAGCCCAAAT	0.398																																					p.R180W													TMEM111,bladder,carcinoma,+1,1	TMEM111	1	1	0			c.C538T												126.0	124.0	125.0					3																	10012302		2203	4300	6503	SO:0001583	missense	55831	exon6			TGCTCCGAAGCCC	AF157321	CCDS2594.1	3p25.3	2012-05-23	2012-05-23	2012-05-23	ENSG00000125037	ENSG00000125037			23999	protein-coding gene	gene with protein product			"""transmembrane protein 111"""	TMEM111		19797678, 22119785	Standard	NM_018447		Approved		uc003bun.3	Q9P0I2	OTTHUMG00000128652	ENST00000245046.2:c.538C>T	3.37:g.10012302G>A	ENSP00000245046:p.Arg180Trp		153	0	0		66	0.45	30	NM_018447	142	0.39	56	B2R4Z9|Q53GH8|Q6ZMC2	Missense_Mutation	SNP	ENST00000245046.2	37	CCDS2594.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254564	0.80135	.	.	ENSG00000125037	ENST00000245046	.	.	.	5.91	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.81365	0.4807	M	0.92923	3.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.83710	0.0187	9	0.87932	D	0	.	7.8515	0.29457	0.0808:0.0:0.7594:0.1598	.	180;180	Q9P0I2-2;Q9P0I2	.;TM111_HUMAN	W	180	.	ENSP00000245046:R180W	R	-	1	2	TMEM111	9987302	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.460000	0.45031	1.515000	0.48885	0.655000	0.94253	CGG			0.398	EMC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250532.1		NM_018447	
ADCY5	111	broad.mit.edu;bcgsc.ca;mdanderson.org	37	3	123049765	123049765	+	Silent	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr3:123049765C>T	ENST00000462833.1	-	5	2829	c.1617G>A	c.(1615-1617)gaG>gaA	p.E539E	ADCY5_ENST00000491190.1_Silent_p.E172E|ADCY5_ENST00000309879.5_Silent_p.E189E	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	539	Guanylate cyclase 1. {ECO:0000255|PROSITE-ProRule:PRU00099}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CCATGCCCATCTCCACACAGC	0.577																																					p.E539E													.	ADCY5	169		0			c.G1617A												91.0	75.0	80.0					3																	123049765		2203	4300	6503	SO:0001819	synonymous_variant	111	exon5			GCCCATCTCCACA	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1617G>A	3.37:g.123049765C>T			296	0	0		191	0.04	7	NM_183357	13	0.00	0	B7Z8A6|Q7RTV7|Q8NFM3	Silent	SNP	ENST00000462833.1	37	CCDS3022.1																																																																																					0.577	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000355889.4		XM_171048	
MUC4	4585	hgsc.bcm.edu	37	3	195508174	195508174	+	Missense_Mutation	SNP	G	G	A	rs200854768	byFrequency	TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr3:195508174G>A	ENST00000463781.3	-	2	10736	c.10277C>T	c.(10276-10278)cCt>cTt	p.P3426L	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.P3426L	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GCTGGTGACAGGAAGAGGGGT	0.577																																					p.P3426L													MUC4_ENST00000463781,NS,carcinoma,-1,3	MUC4_ENST00000463781	-1	3	0			c.C10277T												28.0	22.0	24.0					3																	195508174		688	1579	2267	SO:0001583	missense	4585	exon2			GTGACAGGAAGAG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10277C>T	3.37:g.195508174G>A	ENSP00000417498:p.Pro3426Leu		79	0.0126582278	1		50	0.06	3	NM_018406	0		0	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	37	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	g	6.418	0.445259	0.12164	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.39406	1.08;1.18	0.312	0.312	0.15837	.	.	.	.	.	T	0.22244	0.0536	N	0.14661	0.345	0.20703	N	0.999861	P	0.51933	0.949	B	0.41666	0.363	T	0.11518	-1.0584	8	.	.	.	.	6.4986	0.22155	2.0E-4:0.0:0.9998:0.0	.	3298	E7ESK3	.	L	3426	ENSP00000417498:P3426L;ENSP00000420243:P3426L	.	P	-	2	0	MUC4	196992953	0.000000	0.05858	0.012000	0.15200	0.032000	0.12392	0.113000	0.15499	0.420000	0.25954	0.089000	0.15464	CCT	0.008		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000324081.6		NM_018406	
TXK	7294	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	4	48115254	48115254	+	Silent	SNP	C	C	T	rs200958317		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr4:48115254C>T	ENST00000264316.4	-	3	229	c.144G>A	c.(142-144)ccG>ccA	p.P48P	TXK_ENST00000510457.1_5'UTR	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	48					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						GGCTGAGCCACGGCCTGCGAC	0.423													C|||	1	0.000199681	0.0	0.0	5008	,	,		18503	0.001		0.0	False		,,,				2504	0.0				p.P48P													.	.			0			c.G144A												141.0	141.0	141.0					4																	48115254		2203	4300	6503	SO:0001819	synonymous_variant	7294	exon3			GAGCCACGGCCTG	L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.144G>A	4.37:g.48115254C>T			89	0	0		56	0.39	22	NM_003328	0		0	Q14220	Silent	SNP	ENST00000264316.4	37	CCDS3480.1																																																																																			0		0.423	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000219869.7		NM_003328	
MEGF10	84466	broad.mit.edu	37	5	126781227	126781227	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr5:126781227G>T	ENST00000274473.6	+	21	2837	c.2570G>T	c.(2569-2571)gGg>gTg	p.G857V	MEGF10_ENST00000503335.2_Missense_Mutation_p.G857V|MEGF10_ENST00000510828.1_Intron	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	857	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TACCAGATCGGGGCCATTGCA	0.438																																					p.G857V													.	MEGF10	152		0			c.G2570T												168.0	155.0	159.0					5																	126781227		2203	4300	6503	SO:0001583	missense	84466	exon21			AGATCGGGGCCAT	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2570G>T	5.37:g.126781227G>T	ENSP00000274473:p.Gly857Val		273	0	0		171	0.02	4	NM_032446	5	0.00	0	Q68DE5|Q8WUL3	Missense_Mutation	SNP	ENST00000274473.6	37	CCDS4142.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.262120	0.80358	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	D;D	0.82526	-1.62;-1.62	5.68	4.78	0.61160	.	0.000000	0.85682	D	0.000000	D	0.89931	0.6858	M	0.76574	2.34	0.80722	D	1	D	0.60575	0.988	D	0.64877	0.93	D	0.90401	0.4402	10	0.56958	D	0.05	-12.9308	16.7316	0.85436	0.0:0.1288:0.8712:0.0	.	857	Q96KG7	MEG10_HUMAN	V	857	ENSP00000423354:G857V;ENSP00000274473:G857V	ENSP00000274473:G857V	G	+	2	0	MEGF10	126809126	1.000000	0.71417	1.000000	0.80357	0.748000	0.42578	5.341000	0.65964	2.681000	0.91329	0.563000	0.77884	GGG			0.438	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250973.2		NM_032446	
EGR1	1958	mdanderson.org	37	5	137803157	137803157	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr5:137803157G>T	ENST00000239938.4	+	2	1291	c.1019G>T	c.(1018-1020)tGc>tTc	p.C340F		NM_001964.2	NP_001955.1	P18146	EGR1_HUMAN	early growth response 1	340					BMP signaling pathway (GO:0030509)|cellular response to antibiotic (GO:0071236)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to gamma radiation (GO:0071480)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hyperoxia (GO:0071455)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to isoquinoline alkaloid (GO:0071317)|cellular response to mechanical stimulus (GO:0071260)|cellular response to mycophenolic acid (GO:0071506)|cellular response to steroid hormone stimulus (GO:0071383)|circadian rhythm (GO:0007623)|cytokine-mediated signaling pathway (GO:0019221)|glomerular mesangial cell proliferation (GO:0072110)|interleukin-1-mediated signaling pathway (GO:0070498)|learning or memory (GO:0007611)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|positive regulation of glomerular metanephric mesangial cell proliferation (GO:0072303)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein sumoylation (GO:0033233)|response to amphetamine (GO:0001975)|response to carbon monoxide (GO:0034465)|response to cocaine (GO:0042220)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to norepinephrine (GO:0071873)|response to nutrient levels (GO:0031667)|skeletal muscle cell differentiation (GO:0035914)|T cell differentiation (GO:0030217)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|ovary(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			CCTTACGCTTGCCCAGTGGAG	0.642																																					p.C340F													.	.			0			c.G1019T												79.0	86.0	83.0					5																	137803157		2203	4300	6503	SO:0001583	missense	1958	exon2			ACGCTTGCCCAGT	M62829	CCDS4206.1	5q23-q31	2013-01-08			ENSG00000120738	ENSG00000120738		"""Zinc fingers, C2H2-type"""	3238	protein-coding gene	gene with protein product	"""nerve growth factor-induced protein A"", ""transcription factor ETR103"", ""zinc finger protein 225"", ""early growth response protein 1"""	128990				3127059	Standard	NM_001964		Approved	TIS8, G0S30, NGFI-A, KROX-24, ZIF-268, AT225, ZNF225	uc003ldb.1	P18146	OTTHUMG00000129197	ENST00000239938.4:c.1019G>T	5.37:g.137803157G>T	ENSP00000239938:p.Cys340Phe		80	0.0125	1		42	0.07	3	NM_001964	47	0.00	0		Missense_Mutation	SNP	ENST00000239938.4	37	CCDS4206.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386679	0.42308	.	.	ENSG00000120738	ENST00000239938	T	0.36157	1.27	4.2	4.2	0.49525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.66489	0.2794	M	0.90595	3.13	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.75997	-0.3120	10	0.87932	D	0	-25.0847	15.72	0.77700	0.0:0.0:1.0:0.0	.	340	P18146	EGR1_HUMAN	F	340	ENSP00000239938:C340F	ENSP00000239938:C340F	C	+	2	0	EGR1	137831056	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	9.657000	0.98554	2.177000	0.69029	0.563000	0.77884	TGC			0.642	EGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000251274.1		NM_001964	
TFAP2D	83741	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	6	50740418	50740418	+	Silent	SNP	A	A	C	rs375378399		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr6:50740418A>C	ENST00000008391.3	+	8	1428	c.1200A>C	c.(1198-1200)acA>acC	p.T400T		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CTTTCCAAACAGTTCTCAGTG	0.463																																					p.T400T													TFAP2D,NS,carcinoma,+1,2	TFAP2D	1	2	0			c.A1200C							A		0,4406		0,0,2203	65.0	64.0	65.0		1200	1.4	1.0	6		65	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	TFAP2D	NM_172238.3		0,1,6502	CC,CA,AA		0.0116,0.0,0.0077		400/453	50740418	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	83741	exon8			CCAAACAGTTCTC	AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.1200A>C	6.37:g.50740418A>C			95	0	0		78	0.36	28	NM_172238	0		0		Silent	SNP	ENST00000008391.3	37	CCDS4933.1																																																																																					0.463	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040881.1		NM_172238	
COX7A2	1347	mdanderson.org	37	6	75947704	75947704	+	Splice_Site	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr6:75947704C>A	ENST00000230459.4	-	4	387	c.194G>T	c.(193-195)gGa>gTa	p.G65V	COX7A2_ENST00000472311.2_Splice_Site_p.E37*|COX7A2_ENST00000509698.1_Splice_Site_p.G73V|COX7A2_ENST00000460985.1_Splice_Site_p.G35V|COX7A2_ENST00000370089.2_Splice_Site_p.G97V|COX7A2_ENST00000370081.2_Splice_Site_p.G97V	NM_001865.3	NP_001856.2	P14406	CX7A2_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 2 (liver)	65						extracellular vesicular exosome (GO:0070062)|mitochondrial respiratory chain (GO:0005746)	cytochrome-c oxidase activity (GO:0004129)			kidney(2)|lung(1)	3						ATATGCTGTTCCTAAAAATAA	0.348																																					p.G97V													.	.			0			c.G290T												36.0	36.0	36.0					6																	75947704		2203	4300	6503	SO:0001630	splice_region_variant	1347	exon4			GCTGTTCCTAAAA	X15822	CCDS34486.1, CCDS34486.2	6q14.1	2011-07-04			ENSG00000112695	ENSG00000112695	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2288	protein-coding gene	gene with protein product		123996				1327965, 9202412	Standard	NM_001865		Approved	COXVIIa-L, COX7AL	uc003phv.2	P14406	OTTHUMG00000015049	ENST00000230459.4:c.194-1G>T	6.37:g.75947704C>A			36	0	0		28	0.11	3	NM_001865	764	0.00	0	B2R5E1|Q3MIH5|Q5TF59|Q6FGI2	Missense_Mutation	SNP	ENST00000230459.4	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.20|15.20	2.764209|2.764209	0.49574|0.49574	.|.	.|.	ENSG00000112695|ENSG00000112695	ENST00000472311|ENST00000370081;ENST00000230459;ENST00000370089;ENST00000509698;ENST00000460985	.|T;T;T;T;T	.|0.76709	.|-1.04;-1.04;-1.04;-0.15;-1.04	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.87621	.|0.6223	M|M	0.81614|0.81614	2.55|2.55	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.80764	.|0.994	.|D	.|0.88336	.|0.2971	.|10	0.66056|0.87932	D|D	0.02|0	.|.	18.8519|18.8519	0.92235|0.92235	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65	.|P14406	.|CX7A2_HUMAN	X|V	37|97;65;97;73;35	.|ENSP00000359098:G97V;ENSP00000230459:G65V;ENSP00000359106:G97V;ENSP00000425951:G73V;ENSP00000422979:G35V	ENSP00000423432:E37X|ENSP00000230459:G65V	E|G	-|-	1|2	0|0	COX7A2|COX7A2	76004424|76004424	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.442000|0.442000	0.32017|0.32017	5.336000|5.336000	0.65935|0.65935	2.738000|2.738000	0.93877|0.93877	0.655000|0.655000	0.94253|0.94253	GAA|GGA			0.348	COX7A2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding				NM_001865	Missense_Mutation
TPBG	7162	broad.mit.edu	37	6	83075780	83075780	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr6:83075780G>T	ENST00000369750.3	+	2	1719	c.1102G>T	c.(1102-1104)Gct>Tct	p.A368S	TPBG_ENST00000535040.1_Missense_Mutation_p.A368S|TPBG_ENST00000543496.1_Missense_Mutation_p.A368S			Q13641	TPBG_HUMAN	trophoblast glycoprotein	368					cell adhesion (GO:0007155)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15		all_cancers(76;0.000805)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.0897)		BRCA - Breast invasive adenocarcinoma(397;0.107)		CCTGATAGGCGCTATTTTCCT	0.468																																					p.A368S													.	TPBG	37		0			c.G1102T												103.0	102.0	102.0					6																	83075780		2203	4300	6503	SO:0001583	missense	7162	exon2			ATAGGCGCTATTT	AJ012159	CCDS4995.1	6q14-q15	2008-07-29			ENSG00000146242	ENSG00000146242			12004	protein-coding gene	gene with protein product		190920				8132670	Standard	NM_006670		Approved	5T4-AG, 5T4	uc003pjo.3	Q13641	OTTHUMG00000015103	ENST00000369750.3:c.1102G>T	6.37:g.83075780G>T	ENSP00000358765:p.Ala368Ser		167	0	0		103	0.04	4	NM_001166392	136	0.00	0	A8K555	Missense_Mutation	SNP	ENST00000369750.3	37	CCDS4995.1	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559969	0.65538	.	.	ENSG00000146242	ENST00000535040;ENST00000369750;ENST00000543496	T;T;T	0.60920	0.15;0.15;0.15	5.94	5.94	0.96194	.	0.627816	0.17041	N	0.189333	T	0.43211	0.1237	N	0.08118	0	0.36223	D	0.852141	D	0.64830	0.994	P	0.51999	0.687	T	0.55661	-0.8106	10	0.56958	D	0.05	-9.2564	20.3736	0.98901	0.0:0.0:1.0:0.0	.	368	Q13641	TPBG_HUMAN	S	368	ENSP00000441219:A368S;ENSP00000358765:A368S;ENSP00000440049:A368S	ENSP00000358765:A368S	A	+	1	0	TPBG	83132499	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.297000	0.65704	2.820000	0.97059	0.650000	0.86243	GCT			0.468	TPBG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041340.1			
GTF2IRD1P1	729156	broad.mit.edu	37	7	66302570	66302570	+	RNA	DEL	C	C	-			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr7:66302570delC	ENST00000457166.1	-	0	279					NR_003934.1				GTF2I repeat domain containing 1 pseusogene 1																		TAAATCTCCTCCCACCTCAGG	0.547											OREG0018090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.													.	.			0			.																																											0	.			TCTCCTCCCACCT			7q11.21	2012-06-29			ENSG00000230583	ENSG00000230583			44136	pseudogene	pseudogene							Standard	NR_003934		Approved		uc003tvj.1		OTTHUMG00000156927		7.37:g.66302570delC			8	0	0	1090	6	0.33	2	.	0		0		RNA	DEL	ENST00000457166.1	37																																																																																						0.547	GTF2IRD1P1-002	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000346561.1		NR_003934	
DGKI	9162	broad.mit.edu;bcgsc.ca;mdanderson.org	37	7	137076063	137076063	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr7:137076063C>A	ENST00000288490.5	-	34	3101	c.3101G>T	c.(3100-3102)aGa>aTa	p.R1034I	DGKI_ENST00000453654.2_Missense_Mutation_p.R703I|DGKI_ENST00000446122.1_Missense_Mutation_p.R1016I|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000424189.2_Missense_Mutation_p.R1047I	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	1034					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CTGCTGTGCTCTTTCTTGAGG	0.443																																					p.R1034I													DGKI_ENST00000288490,NS,carcinoma,+1,2	DGKI	335	2	0			c.G3101T												93.0	90.0	91.0					7																	137076063		2203	4300	6503	SO:0001583	missense	9162	exon34			TGTGCTCTTTCTT	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.3101G>T	7.37:g.137076063C>A	ENSP00000288490:p.Arg1034Ile		153	0	0		100	0.07	7	NM_004717	4	0.00	0	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	37	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733908	0.48939	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.30182	1.54;1.54;1.54	5.92	5.02	0.67125	Ankyrin repeat-containing domain (3);	0.374757	0.30676	N	0.009120	T	0.30479	0.0766	L	0.39898	1.24	0.54753	D	0.999988	P;P	0.45986	0.834;0.87	P;B	0.48598	0.583;0.382	T	0.03587	-1.1022	10	0.19147	T	0.46	.	10.373	0.44066	0.0:0.8475:0.0:0.1525	.	703;1034	E9PFX6;O75912	.;DGKI_HUMAN	I	703;951;1037;1034;1016	ENSP00000392161:R703I;ENSP00000288490:R1034I;ENSP00000399131:R1016I	ENSP00000288490:R1034I	R	-	2	0	DGKI	136726603	1.000000	0.71417	0.983000	0.44433	0.974000	0.67602	1.468000	0.35332	1.469000	0.48083	0.650000	0.86243	AGA			0.443	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000341286.3		NM_004717	
ABCB8	11194	broad.mit.edu;mdanderson.org	37	7	150741097	150741097	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr7:150741097G>T	ENST00000297504.6	+	16	1922	c.1856G>T	c.(1855-1857)cGc>cTc	p.R619L	ABCB8_ENST00000542328.1_Missense_Mutation_p.R514L|ABCB8_ENST00000498578.1_Missense_Mutation_p.R602L|ABCB8_ENST00000358849.4_Missense_Mutation_p.R602L|ABCB8_ENST00000356058.4_3'UTR			Q9NUT2	ABCB8_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 8	619	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Doxorubicin(DB00997)	CAGAAGCAGCGCCTGGCCATC	0.642																																					p.R602L													.	ABCB8	65		0			c.G1805T												20.0	20.0	20.0					7																	150741097		2197	4291	6488	SO:0001583	missense	11194	exon15			AGCAGCGCCTGGC	AF047690	CCDS5913.1, CCDS64798.1, CCDS64799.1, CCDS64800.1	7q36.1	2012-05-16			ENSG00000197150	ENSG00000197150		"""ATP binding cassette transporters / subfamily B"""	49	protein-coding gene	gene with protein product	"""mitochondrial ABC protein"""	605464				8894702	Standard	NM_001282291		Approved	EST328128, M-ABC1, MABC1	uc003wik.4	Q9NUT2	OTTHUMG00000158686	ENST00000297504.6:c.1856G>T	7.37:g.150741097G>T	ENSP00000297504:p.Arg619Leu		169	0	0		76	0.05	4	NM_007188	42	0.00	0	A5D8W3|B2RBL8|B3KND2|B4DG02|G3XAP3|O95787|Q53GM0	Missense_Mutation	SNP	ENST00000297504.6	37		.	.	.	.	.	.	.	.	.	.	G	32	5.156586	0.94686	.	.	ENSG00000197150	ENST00000358849;ENST00000360651;ENST00000297504;ENST00000542328;ENST00000498578	D;D;D;D	0.93019	-2.55;-2.55;-2.55;-3.15	4.89	4.89	0.63831	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96024	0.8705	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96197	0.9142	10	0.87932	D	0	-0.3378	15.9349	0.79694	0.0:0.0:1.0:0.0	.	514;602;619;602	G3XAP3;A5D8W3;Q9NUT2;Q9NUT2-2	.;.;ABCB8_HUMAN;.	L	602;585;619;514;602	ENSP00000351717:R602L;ENSP00000297504:R619L;ENSP00000438776:R514L;ENSP00000418271:R602L	ENSP00000297504:R619L	R	+	2	0	ABCB8	150372030	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.418000	0.97395	2.699000	0.92147	0.563000	0.77884	CGC			0.642	ABCB8-003	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000351733.2		NM_007188	
HTR5A	3361	mdanderson.org	37	7	154862923	154862923	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr7:154862923G>T	ENST00000287907.2	+	1	890	c.314G>T	c.(313-315)cGc>cTc	p.R105L	HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.R31S|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.R31S	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	105					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CTGTCCGGGCGCCGCTGGCAG	0.677																																					p.R105L													.	.			0			c.G314T												47.0	40.0	42.0					7																	154862923		2203	4299	6502	SO:0001583	missense	3361	exon1			CCGGGCGCCGCTG		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.314G>T	7.37:g.154862923G>T	ENSP00000287907:p.Arg105Leu		35	0	0		15	0.13	2	NM_024012	0		0	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	37	CCDS5936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.7|24.7	4.555991|4.555991	0.86231|0.86231	.|.	.|.	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.72051|.	-0.62|.	4.52|4.52	4.52|4.52	0.55395|0.55395	GPCR, rhodopsin-like superfamily (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.77791|0.77791	0.4183|0.4183	M|M	0.83312|0.83312	2.635|2.635	0.80722|0.80722	D|D	1|1	D|D	0.59357|0.76494	0.985|0.999	D|D	0.63283|0.66351	0.913|0.943	T|T	0.81226|0.81226	-0.1029|-0.1029	10|9	0.34782|0.87932	T|D	0.22|0	.|.	11.9524|11.9524	0.52962|0.52962	0.0833:0.0:0.9166:0.0|0.0833:0.0:0.9166:0.0	.|.	105|31	P47898|B7Z8E6	5HT5A_HUMAN|.	L|S	105|31	ENSP00000287907:R105L|.	ENSP00000287907:R105L|ENSP00000379080:R31S	R|R	+|-	2|1	0|0	HTR5A|AC093726.4	154493856|154493856	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.416000|7.416000	0.80143|0.80143	2.338000|2.338000	0.79540|0.79540	0.563000|0.563000	0.77884|0.77884	CGC|CGC			0.677	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322240.1		NM_024012	
KIF13B	23303	mdanderson.org	37	8	28929560	28929560	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr8:28929560G>T	ENST00000524189.1	-	39	4833	c.4795C>A	c.(4795-4797)Cct>Act	p.P1599T	KIF13B_ENST00000404075.3_Missense_Mutation_p.P118T	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1599					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TCGGCCTCAGGGGCGGTGGGC	0.781																																					p.P1599T													.	.			0			c.C4795A												1.0	1.0	1.0					8																	28929560		921	2266	3187	SO:0001583	missense	23303	exon39			CCTCAGGGGCGGT	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.4795C>A	8.37:g.28929560G>T	ENSP00000427900:p.Pro1599Thr		12	0	0		16	0.13	2	NM_015254	2	0.00	0	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	ENST00000524189.1	37	CCDS55217.1	.	.	.	.	.	.	.	.	.	.	G	6.000	0.368509	0.11352	.	.	ENSG00000197892	ENST00000524189;ENST00000523130;ENST00000404075	T;T;T	0.80824	-1.0;-1.42;-1.4	3.82	-3.08	0.05347	.	2.092830	0.02245	N	0.066177	T	0.55033	0.1895	N	0.08118	0	0.09310	N	1	B;B	0.17038	0.02;0.013	B;B	0.17098	0.007;0.017	T	0.51140	-0.8743	10	0.07644	T	0.81	.	0.4901	0.00562	0.4016:0.1399:0.1758:0.2827	.	118;1599	B4DGY5;F8VPJ2	.;.	T	1599;191;118	ENSP00000427900:P1599T;ENSP00000429106:P191T;ENSP00000384054:P118T	ENSP00000384054:P118T	P	-	1	0	KIF13B	28985479	0.010000	0.17322	0.000000	0.03702	0.002000	0.02628	0.755000	0.26405	-0.527000	0.06374	-1.478000	0.00992	CCT			0.781	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000376878.1			
PXDNL	137902	mdanderson.org	37	8	52321586	52321586	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr8:52321586G>T	ENST00000356297.4	-	17	2698	c.2598C>A	c.(2596-2598)agC>agA	p.S866R	PXDNL_ENST00000543296.1_Missense_Mutation_p.S866R	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	866					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CACACGCGGGGCTGGAGCGCG	0.647																																					p.S866R													.	.			0			c.C2598A												23.0	27.0	26.0					8																	52321586		2018	4155	6173	SO:0001583	missense	137902	exon17			CGCGGGGCTGGAG		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2598C>A	8.37:g.52321586G>T	ENSP00000348645:p.Ser866Arg		63	0	0		36	0.08	3	NM_144651	2	0.00	0	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	37	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606719	0.28623	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68624	-0.34;-0.34	3.55	1.7	0.24286	.	0.000000	0.64402	D	0.000008	T	0.77857	0.4193	M	0.78456	2.415	0.32573	N	0.529564	D	0.89917	1.0	D	0.91635	0.999	T	0.79227	-0.1890	10	0.87932	D	0	.	7.4388	0.27171	0.2284:0.0:0.7716:0.0	.	866	A1KZ92	PXDNL_HUMAN	R	866	ENSP00000348645:S866R;ENSP00000444865:S866R	ENSP00000348645:S866R	S	-	3	2	PXDNL	52484139	1.000000	0.71417	0.504000	0.27639	0.060000	0.15804	0.719000	0.25881	0.144000	0.18951	0.650000	0.86243	AGC			0.647	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000377905.1		NM_144651	
MIR2052HG	441355	hgsc.bcm.edu;bcgsc.ca	37	8	75516361	75516361	+	Intron	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr8:75516361C>A	ENST00000523118.1	+	1	43																											ACTCTCCTCGCGCATCTTCTT	0.443																																					.													.	.			0			.																																									SO:0001627	intron_variant	0	.			TCCTCGCGCATCT																												ENST00000523118.1:c.-16+4218C>A	8.37:g.75516361C>A			55	0	0		58	0.22	13	.	907	0.00	0		RNA	SNP	ENST00000523118.1	37																																																																																						0.443	RP11-758M4.1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding		OTTHUMT00000379070.2			
CPSF1	29894	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	8	145619906	145619906	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr8:145619906C>T	ENST00000349769.3	-	31	3614	c.3520G>A	c.(3520-3522)Gcc>Acc	p.A1174T	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1174					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TGGCACAGGGCGGTCACGGGC	0.637																																					p.A1174T	NSCLC(133;1088 1848 27708 34777 35269)												.	.			0			c.G3520A												34.0	32.0	32.0					8																	145619906		2199	4299	6498	SO:0001583	missense	29894	exon31			ACAGGGCGGTCAC	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.3520G>A	8.37:g.145619906C>T	ENSP00000339353:p.Ala1174Thr		93	0	0		86	0.30	26	NM_013291	359	0.27	97	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	37	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.436443	0.83885	.	.	ENSG00000071894	ENST00000349769	T	0.56444	0.46	4.86	4.86	0.63082	Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.058453	0.64402	D	0.000002	T	0.74665	0.3746	M	0.88979	2.995	0.80722	D	1	D	0.71674	0.998	D	0.67103	0.949	T	0.79811	-0.1646	10	0.66056	D	0.02	-38.5354	13.8397	0.63430	0.0:1.0:0.0:0.0	.	1174	Q10570	CPSF1_HUMAN	T	1174	ENSP00000339353:A1174T	ENSP00000339353:A1174T	A	-	1	0	CPSF1	145590714	1.000000	0.71417	0.971000	0.41717	0.778000	0.44026	7.005000	0.76323	2.424000	0.82194	0.561000	0.74099	GCC			0.637	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000382422.2		NM_013291	
KIAA0020	9933	broad.mit.edu;bcgsc.ca;mdanderson.org	37	9	2837296	2837296	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr9:2837296T>C	ENST00000397885.2	-	3	394	c.188A>G	c.(187-189)aAg>aGg	p.K63R		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	63						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTTTACACCCTTTTTCCCAAG	0.388																																					p.K63R													.	KIAA0020	56		0			c.A188G												259.0	237.0	244.0					9																	2837296		1837	4098	5935	SO:0001583	missense	9933	exon3			ACACCCTTTTTCC	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.188A>G	9.37:g.2837296T>C	ENSP00000380982:p.Lys63Arg		250	0	0		133	0.04	5	NM_014878	48	0.00	0	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	37	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	T	8.779	0.927712	0.18056	.	.	ENSG00000080608	ENST00000397885	T	0.12672	2.66	4.55	3.32	0.38043	.	0.404891	0.24027	N	0.042233	T	0.07369	0.0186	N	0.19112	0.55	0.22629	N	0.998913	B	0.10296	0.003	B	0.08055	0.003	T	0.24799	-1.0150	10	0.26408	T	0.33	-19.7444	5.606	0.17379	0.0:0.0997:0.2858:0.6145	.	63	Q15397	K0020_HUMAN	R	63	ENSP00000380982:K63R	ENSP00000380982:K63R	K	-	2	0	KIAA0020	2827296	0.997000	0.39634	1.000000	0.80357	0.984000	0.73092	1.577000	0.36515	2.041000	0.60428	0.528000	0.53228	AAG			0.388	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000051529.3		NM_014878	
FOCAD	54914	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	20819865	20819865	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr9:20819865T>C	ENST00000380249.1	+	14	1890	c.1526T>C	c.(1525-1527)aTa>aCa	p.I509T	FOCAD_ENST00000338382.6_Missense_Mutation_p.I509T|FOCAD_ENST00000605086.1_5'Flank	NM_017794.3	NP_060264.3	Q5VW36	FOCAD_HUMAN	focadhesin	509						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)											TATAATGATATATTGTATACT	0.269																																					p.I509T													.	.			0			c.T1526C												36.0	42.0	40.0					9																	20819865		2198	4265	6463	SO:0001583	missense	54914	exon14			ATGATATATTGTA	AB058700	CCDS34993.1	9p21	2012-03-23	2012-03-23	2012-03-23	ENSG00000188352	ENSG00000188352			23377	protein-coding gene	gene with protein product		614606	"""KIAA1797"""	KIAA1797		22427331	Standard	XM_006716794		Approved	FLJ20375	uc003zog.1	Q5VW36	OTTHUMG00000066930	ENST00000380249.1:c.1526T>C	9.37:g.20819865T>C	ENSP00000369599:p.Ile509Thr		645	0	0		487	0.39	190	NM_017794	11	0.45	5	D3DRJ9|Q6ZME1|Q8IZG0|Q96JM8|Q96MS9|Q9BVF3|Q9NX87	Missense_Mutation	SNP	ENST00000380249.1	37	CCDS34993.1	.	.	.	.	.	.	.	.	.	.	T	15.83	2.947927	0.53186	.	.	ENSG00000188352	ENST00000380249;ENST00000338382	T;T	0.22945	1.93;1.93	5.34	5.34	0.76211	Domain of unknown function DUF3730 (1);	0.160346	0.53938	D	0.000046	T	0.30103	0.0754	L	0.50333	1.59	0.42414	D	0.99261	P	0.47034	0.889	B	0.43658	0.426	T	0.09907	-1.0653	10	0.72032	D	0.01	-12.8572	15.3708	0.74564	0.0:0.0:0.0:1.0	.	509	Q5VW36	K1797_HUMAN	T	509	ENSP00000369599:I509T;ENSP00000344307:I509T	ENSP00000344307:I509T	I	+	2	0	KIAA1797	20809865	1.000000	0.71417	0.998000	0.56505	0.924000	0.55760	6.449000	0.73473	2.037000	0.60232	0.524000	0.50904	ATA			0.269	FOCAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000143442.1		NM_017794	
CCDC180	100499483	mdanderson.org	37	9	100128018	100128018	+	Silent	SNP	A	A	G			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr9:100128018A>G	ENST00000357054.1	+	42	4946	c.4011A>G	c.(4009-4011)gcA>gcG	p.A1337A	CCDC180_ENST00000529487.1_Silent_p.A1392A|MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Silent_p.A1392A|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1337						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGACAGTCGCAGAGGTGAGGA	0.587																																					p.A1392A													.	.			0			c.A4176G												113.0	109.0	110.0					9																	100128018		2203	4300	6503	SO:0001819	synonymous_variant	0	exon30			AGTCGCAGAGGTG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.4011A>G	9.37:g.100128018A>G			80	0	0		21	0.14	3	NM_020893	9	0.00	0	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	37																																																																																						0.587	CCDC180-201	KNOWN	basic	protein_coding	protein_coding				NM_020893	
DFNB31	25861	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	9	117266554	117266554	+	Silent	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr9:117266554T>C	ENST00000362057.3	-	1	696	c.528A>G	c.(526-528)ctA>ctG	p.L176L	DFNB31_ENST00000374057.3_Silent_p.L176L|DFNB31_ENST00000480518.1_5'UTR|DFNB31_ENST00000265134.6_5'Flank	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	176	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTTCTCAGCTAGAGAGCCTG	0.652																																					p.L176L													.	.			0			c.A528G												81.0	83.0	82.0					9																	117266554		2203	4300	6503	SO:0001819	synonymous_variant	25861	exon1			CTCAGCTAGAGAG	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.528A>G	9.37:g.117266554T>C			110	0	0		50	0.34	17	NM_001173425	7	0.29	2	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Silent	SNP	ENST00000362057.3	37	CCDS6806.1																																																																																					0.652	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053776.2		NM_015404	
P2RY8	286530	mdanderson.org	37	X	1584418	1584418	+	Missense_Mutation	SNP	T	T	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:1584418T>C	ENST00000381297.4	-	2	1244	c.1034A>G	c.(1033-1035)gAg>gGg	p.E345G	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	345						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGTGGCTCCCTCCATCCCTTC	0.716			T	CRLF2	"""B-ALL, Downs associated ALL"""																																p.E345G				Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	.	.			0			c.A1034G												39.0	46.0	44.0					X																	1584418		2203	4293	6496	SO:0001583	missense	286530	exon2			GCTCCCTCCATCC	AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.1034A>G	X.37:g.1584418T>C	ENSP00000370697:p.Glu345Gly		87	0.0114942529	1		55	0.05	3	NM_178129	1	0.00	0		Missense_Mutation	SNP	ENST00000381297.4	37	CCDS14115.1	.	.	.	.	.	.	.	.	.	.	t	10.06	1.245923	0.22796	.	.	ENSG00000182162	ENST00000381297	T	0.62105	0.05	2.73	1.32	0.21799	.	1.084420	0.07494	U	0.906101	T	0.39145	0.1067	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.27400	-1.0075	10	0.44086	T	0.13	.	5.3962	0.16271	0.1556:0.0:0.1849:0.6595	.	345	Q86VZ1	P2RY8_HUMAN	G	345	ENSP00000370697:E345G	ENSP00000370697:E345G	E	-	2	0	P2RY8	1544418	0.001000	0.12720	0.024000	0.17045	0.064000	0.16182	0.761000	0.26489	0.823000	0.34589	0.230000	0.17803	GAG			0.716	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055602.1		NM_178129	
PPEF1	5475	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	18845518	18845518	+	Missense_Mutation	SNP	C	C	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:18845518C>A	ENST00000361511.4	+	19	2369	c.1875C>A	c.(1873-1875)agC>agA	p.S625R	PPEF1_ENST00000544635.1_Missense_Mutation_p.S560R|PPEF1_ENST00000543630.1_3'UTR|PPEF1_ENST00000359763.6_Missense_Mutation_p.S572R|PPEF1_ENST00000349874.5_Missense_Mutation_p.S563R	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	625	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AAGATGGAAGCATTGACTTTA	0.368																																					p.S625R													.	.			0			c.C1875A												160.0	142.0	148.0					X																	18845518		2203	4300	6503	SO:0001583	missense	5475	exon19			TGGAAGCATTGAC	BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.1875C>A	X.37:g.18845518C>A	ENSP00000354871:p.Ser625Arg		209	0	0		213	0.31	66	NM_006240	3	0.00	0	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	ENST00000361511.4	37	CCDS14188.1	.	.	.	.	.	.	.	.	.	.	C	8.600	0.886524	0.17540	.	.	ENSG00000086717	ENST00000361511;ENST00000359763;ENST00000349874;ENST00000544635;ENST00000470157	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.2	4.14	0.48551	EF-hand-like domain (1);	0.188712	0.37053	N	0.002266	T	0.71762	0.3378	L	0.60455	1.87	0.38694	D	0.952826	D;D;D	0.56746	0.977;0.975;0.977	P;P;P	0.58873	0.847;0.718;0.73	T	0.69343	-0.5170	10	0.15499	T	0.54	-8.4485	12.5404	0.56167	0.0:0.8968:0.0:0.1032	.	563;625;597	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	R	625;572;563;560;87	ENSP00000354871:S625R;ENSP00000352806:S572R;ENSP00000341892:S563R;ENSP00000441289:S560R;ENSP00000419273:S87R	ENSP00000341892:S563R	S	+	3	2	PPEF1	18755439	1.000000	0.71417	0.998000	0.56505	0.682000	0.39822	2.615000	0.46368	2.164000	0.68074	0.594000	0.82650	AGC			0.368	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000055953.3		NM_006240	
SMS	6611	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	21995231	21995231	+	Missense_Mutation	SNP	G	G	C			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:21995231G>C	ENST00000404933.2	+	5	634	c.382G>C	c.(382-384)Gac>Cac	p.D128H	SMS_ENST00000415881.2_Missense_Mutation_p.D32H|SMS_ENST00000478094.1_3'UTR|SMS_ENST00000379404.1_Missense_Mutation_p.D75H	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase	128	PABS. {ECO:0000255|PROSITE- ProRule:PRU00354}.				cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	GCCCACCGCCGACGGGCGCCT	0.423																																					p.D128H													.	.			0			c.G382C												60.0	62.0	61.0					X																	21995231		2203	4300	6503	SO:0001583	missense	6611	exon5			ACCGCCGACGGGC	AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.382G>C	X.37:g.21995231G>C	ENSP00000385746:p.Asp128His		227	0	0		232	0.05	11	NM_004595	228	0.00	0	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	Missense_Mutation	SNP	ENST00000404933.2	37	CCDS14203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.01|16.01	3.000132|3.000132	0.54147|0.54147	.|.	.|.	ENSG00000102172|ENSG00000102172	ENST00000404933;ENST00000379404;ENST00000415881|ENST00000457085	T;T;T|.	0.78003|.	-1.14;-1.14;-1.14|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78175|0.78175	0.4242|0.4242	M|M	0.79011|0.79011	2.435|2.435	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.987|.	D;P|.	0.97110|.	1.0;0.801|.	T|T	0.78198|0.78198	-0.2297|-0.2297	10|5	0.66056|.	D|.	0.02|.	-7.3579|-7.3579	18.8727|18.8727	0.92322|0.92322	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	128;75|.	P52788;P52788-2|.	SPSY_HUMAN;.|.	H|P	128;75;32|219	ENSP00000385746:D128H;ENSP00000368714:D75H;ENSP00000388906:D32H|.	ENSP00000368714:D75H|.	D|R	+|+	1|2	0|0	SMS|SMS	21905152|21905152	1.000000|1.000000	0.71417|0.71417	0.148000|0.148000	0.22405|0.22405	0.008000|0.008000	0.06430|0.06430	9.429000|9.429000	0.97481|0.97481	2.403000|2.403000	0.81681|0.81681	0.600000|0.600000	0.82982|0.82982	GAC|CGA			0.423	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056032.1		NM_004595	
ZNF645	158506	broad.mit.edu	37	X	22291678	22291678	+	Silent	SNP	A	A	G			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:22291678A>G	ENST00000323684.1	+	1	614	c.570A>G	c.(568-570)ctA>ctG	p.L190L		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	190					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TGGTGTCACTACCGTCTGTGC	0.473																																					p.L190L													.	ZNF645	67		0			c.A570G												150.0	112.0	125.0					X																	22291678		2203	4300	6503	SO:0001819	synonymous_variant	158506	exon1			GTCACTACCGTCT	AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.570A>G	X.37:g.22291678A>G			198	0.0050505051	1		259	0.03	7	NM_152577	0		0	A0AV29|A0AV31|E3SBK4|Q6DJY9	Silent	SNP	ENST00000323684.1	37	CCDS14205.1																																																																																					0.473	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056037.1		NM_152577	
MAGEB10	139422	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	27839493	27839493	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:27839493G>A	ENST00000356790.2	+	3	315	c.70G>A	c.(70-72)Gat>Aat	p.D24N		NM_182506.3	NP_872312.2	Q96LZ2	MAGBA_HUMAN	melanoma antigen family B, 10	24										NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	26						AGGGCTGGAAGATTTGATAGA	0.512																																					p.D24N													.	.			0			c.G70A												57.0	56.0	57.0					X																	27839493		2202	4300	6502	SO:0001583	missense	139422	exon3			CTGGAAGATTTGA		CCDS35221.1	Xp21.3	2008-02-05			ENSG00000177689	ENSG00000177689			25377	protein-coding gene	gene with protein product		300761				11454705	Standard	NM_182506		Approved	FLJ32965	uc004dbw.3	Q96LZ2	OTTHUMG00000046084	ENST00000356790.2:c.70G>A	X.37:g.27839493G>A	ENSP00000368304:p.Asp24Asn		154	0	0		159	0.31	50	NM_182506	0		0	Q494Y6|Q494Y7|Q9BZ78	Missense_Mutation	SNP	ENST00000356790.2	37	CCDS35221.1	.	.	.	.	.	.	.	.	.	.	G	7.575	0.667459	0.14710	.	.	ENSG00000177689	ENST00000356790	T	0.04275	3.66	2.51	-0.326	0.12698	Melanoma associated antigen, MAGE, N-terminal (1);	1.617550	0.03769	N	0.259383	T	0.05090	0.0136	L	0.35644	1.08	0.09310	N	1	B	0.22746	0.074	B	0.20184	0.028	T	0.42292	-0.9460	10	0.41790	T	0.15	.	5.0114	0.14315	0.5196:0.0:0.4804:0.0	.	24	Q96LZ2	MAGBA_HUMAN	N	24	ENSP00000368304:D24N	ENSP00000368304:D24N	D	+	1	0	MAGEB10	27749414	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.037000	0.03557	-0.231000	0.09825	0.415000	0.27848	GAT			0.512	MAGEB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000106216.1		NM_182506	
DCAF8L1	139425	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	27998407	27998407	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:27998407G>T	ENST00000441525.1	-	1	1159	c.1045C>A	c.(1045-1047)Caa>Aaa	p.Q349K		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	349										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						ACTGCAAATTGGTAAATATTG	0.393																																					p.Q349K													.	.			0			c.C1045A												94.0	81.0	85.0					X																	27998407		2202	4300	6502	SO:0001583	missense	139425	exon1			CAAATTGGTAAAT		CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1045C>A	X.37:g.27998407G>T	ENSP00000405222:p.Gln349Lys		140	0	0		157	0.06	10	NM_001017930	0		0	B3KXX1	Missense_Mutation	SNP	ENST00000441525.1	37	CCDS35222.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227394	0.39399	.	.	ENSG00000226372	ENST00000441525	T	0.80994	-1.44	0.842	0.842	0.18927	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.129829	0.53938	D	0.000060	T	0.78685	0.4322	M	0.77820	2.39	0.36546	D	0.871566	P	0.51449	0.945	P	0.48030	0.564	T	0.76748	-0.2845	10	0.17369	T	0.5	-5.8416	7.2758	0.26283	1.0E-4:0.0:0.9999:0.0	.	349	A6NGE4	DC8L1_HUMAN	K	349	ENSP00000405222:Q349K	ENSP00000405222:Q349K	Q	-	1	0	DCAF8L1	27908328	1.000000	0.71417	0.071000	0.20095	0.040000	0.13550	5.470000	0.66756	0.691000	0.31592	0.284000	0.19432	CAA			0.393	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056150.2		XM_066690	
MED14	9282	broad.mit.edu;ucsc.edu;bcgsc.ca	37	X	40569339	40569339	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:40569339G>T	ENST00000324817.1	-	9	1183	c.1065C>A	c.(1063-1065)caC>caA	p.H355Q		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	355	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGTAACTTTGTGAACAGATG	0.338																																					p.H355Q													.	MED14	108		0			c.C1065A												43.0	38.0	40.0					X																	40569339		2203	4299	6502	SO:0001583	missense	9282	exon9			AACTTTGTGAACA	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.1065C>A	X.37:g.40569339G>T	ENSP00000323720:p.His355Gln		345	0.0057971014	2		409	0.41	168	NM_004229	17	0.00	0	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	ENST00000324817.1	37	CCDS14254.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028341	0.35797	.	.	ENSG00000180182	ENST00000324817	T	0.41400	1.0	5.04	4.18	0.49190	.	0.044317	0.85682	D	0.000000	T	0.30978	0.0782	L	0.47716	1.5	0.54753	D	0.999987	P	0.38335	0.627	B	0.32022	0.139	T	0.09292	-1.0681	10	0.48119	T	0.1	.	7.9779	0.30166	0.2556:0.0:0.7443:0.0	.	355	O60244	MED14_HUMAN	Q	355	ENSP00000323720:H355Q	ENSP00000323720:H355Q	H	-	3	2	MED14	40454283	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.534000	0.45676	1.028000	0.39785	-0.276000	0.10085	CAC			0.338	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000060692.1		NM_004229	
HEPH	9843	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	65479954	65479954	+	Missense_Mutation	SNP	T	T	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:65479954T>A	ENST00000343002.2	+	18	3713	c.3049T>A	c.(3049-3051)Tac>Aac	p.Y1017N	HEPH_ENST00000441993.2_Missense_Mutation_p.Y1020N|HEPH_ENST00000419594.1_Missense_Mutation_p.Y828N|HEPH_ENST00000374727.3_Missense_Mutation_p.Y1020N|HEPH_ENST00000519389.1_Missense_Mutation_p.Y1071N|HEPH_ENST00000336279.5_Missense_Mutation_p.Y750N			Q9BQS7	HEPH_HUMAN	hephaestin	1017	Plastocyanin-like 6.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						TGGCGAGAACTACCGGGCAGA	0.493																																					p.Y1071N													.	.			0			c.T3211A												99.0	84.0	89.0					X																	65479954		2203	4300	6503	SO:0001583	missense	9843	exon19			GAGAACTACCGGG	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.3049T>A	X.37:g.65479954T>A	ENSP00000343939:p.Tyr1017Asn		93	0	0		97	0.39	38	NM_138737	28	0.00	0	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	ENST00000343002.2	37		.	.	.	.	.	.	.	.	.	.	T	14.46	2.541702	0.45280	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002	D;D;D;D;D;D	0.99656	-6.31;-6.31;-6.31;-6.31;-6.31;-6.31	4.98	3.78	0.43462	Cupredoxin (2);Multicopper oxidase, type 2 (1);	0.117416	0.64402	D	0.000015	D	0.99133	0.9701	L	0.49126	1.545	0.36532	D	0.870779	D;D;D	0.63880	0.993;0.966;0.98	D;P;P	0.67103	0.949;0.908;0.876	D	0.99868	1.1092	10	0.62326	D	0.03	.	6.8495	0.24006	0.0:0.1883:0.0:0.8117	.	1071;828;1017	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	N	1071;1020;750;1020;828;1017	ENSP00000430620:Y1071N;ENSP00000363859:Y1020N;ENSP00000337418:Y750N;ENSP00000411687:Y1020N;ENSP00000413211:Y828N;ENSP00000343939:Y1017N	ENSP00000337418:Y750N	Y	+	1	0	HEPH	65396679	0.910000	0.30920	0.964000	0.40570	0.483000	0.33249	1.271000	0.33098	1.833000	0.53350	0.486000	0.48141	TAC			0.493	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding		OTTHUMT00000056995.1		NM_138737	
COL4A5	1287	mdanderson.org	37	X	107683387	107683387	+	Missense_Mutation	SNP	G	G	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:107683387G>T	ENST00000361603.2	+	1	276	c.32G>T	c.(31-33)gGc>gTc	p.G11V	COL4A6_ENST00000334504.7_5'Flank|COL4A6_ENST00000545689.1_5'Flank|COL4A6_ENST00000372216.4_5'Flank|COL4A5_ENST00000477429.1_3'UTR|COL4A6_ENST00000461897.1_5'Flank|COL4A6_ENST00000394872.2_5'Flank|COL4A6_ENST00000538570.1_5'Flank|COL4A5_ENST00000328300.6_Missense_Mutation_p.G11V	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	11					axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CTGGCTGCCGGCTTGTTCTTA	0.607									Alport syndrome with Diffuse Leiomyomatosis																												p.G11V													.	.			0			c.G32T												52.0	41.0	45.0					X																	107683387		2203	4300	6503	SO:0001583	missense	1287	exon1	Familial Cancer Database		CTGCCGGCTTGTT	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.32G>T	X.37:g.107683387G>T	ENSP00000354505:p.Gly11Val		49	0	0		43	0.07	3	NM_000495	47	0.00	0	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.874915	0.51695	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.90788	-2.73;-2.55	4.68	4.68	0.58851	.	0.335775	0.25765	N	0.028447	T	0.76730	0.4028	N	0.08118	0	0.49213	D	0.99976	P;P	0.43287	0.802;0.802	B;B	0.35278	0.199;0.199	T	0.77169	-0.2686	10	0.13108	T	0.6	.	12.5058	0.55979	0.0:0.0:1.0:0.0	.	11;11	E7EVY4;P29400	.;CO4A5_HUMAN	V	11	ENSP00000331902:G11V;ENSP00000354505:G11V	ENSP00000331902:G11V	G	+	2	0	COL4A5	107570043	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.651000	0.46674	2.246000	0.74042	0.600000	0.82982	GGC			0.607	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057880.2			
COL4A5	1287	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca;mdanderson.org	37	X	107929306	107929306	+	Missense_Mutation	SNP	G	G	A			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:107929306G>A	ENST00000361603.2	+	46	4488	c.4244G>A	c.(4243-4245)gGc>gAc	p.G1415D	COL4A5_ENST00000328300.6_Missense_Mutation_p.G1421D	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1415	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGACTCCCTGGCTTTGATGGT	0.502									Alport syndrome with Diffuse Leiomyomatosis																												p.G1415D													.	.			0			c.G4244A												72.0	58.0	63.0					X																	107929306		2203	4300	6503	SO:0001583	missense	1287	exon46	Familial Cancer Database		TCCCTGGCTTTGA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4244G>A	X.37:g.107929306G>A	ENSP00000354505:p.Gly1415Asp		205	0	0		246	0.06	14	NM_000495	186	0.07	13	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.070620|5.070620	0.93950|0.93950	.|.	.|.	ENSG00000188153|ENSG00000188153	ENST00000515658|ENST00000328300;ENST00000361603;ENST00000508186	.|D;D	.|0.99353	.|-5.77;-5.77	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99600|0.99600	0.9855|0.9855	H|H	0.94658|0.94658	3.565|3.565	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.97812|0.97812	1.0251|1.0251	5|10	.|0.87932	.|D	.|0	.|.	18.0047|18.0047	0.89207|0.89207	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1418;1415	.|E7EVY4;P29400	.|.;CO4A5_HUMAN	T|D	20|1421;1415;1421	.|ENSP00000331902:G1421D;ENSP00000354505:G1415D	.|ENSP00000331902:G1421D	A|G	+|+	1|2	0|0	COL4A5|COL4A5	107815962|107815962	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.507000|9.507000	0.97996|0.97996	2.273000|2.273000	0.75805|0.75805	0.600000|0.600000	0.82982|0.82982	GCT|GGC			0.502	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000057880.2			
CHRDL1	91851	mdanderson.org	37	X	109963072	109963072	+	Missense_Mutation	SNP	C	C	T			TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:109963072C>T	ENST00000372045.1	-	6	642	c.511G>A	c.(511-513)Gta>Ata	p.V171I	CHRDL1_ENST00000218054.4_Missense_Mutation_p.V177I|CHRDL1_ENST00000372042.1_Missense_Mutation_p.V178I|CHRDL1_ENST00000394797.4_Missense_Mutation_p.V177I|CHRDL1_ENST00000482160.1_Intron|CHRDL1_ENST00000434224.1_Intron|CHRDL1_ENST00000444321.2_Missense_Mutation_p.V177I			Q9BU40	CRDL1_HUMAN	chordin-like 1	171	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						CCTCTGCATACCCGGCAGCAG	0.488																																					p.V178I													.	.			0			c.G532A												108.0	95.0	99.0					X																	109963072		2203	4300	6503	SO:0001583	missense	91851	exon6			TGCATACCCGGCA	AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.511G>A	X.37:g.109963072C>T	ENSP00000361115:p.Val171Ile		58	0	0		52	0.06	3	NM_001143981	14	0.00	0	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	ENST00000372045.1	37		.	.	.	.	.	.	.	.	.	.	C	11.74	1.729331	0.30684	.	.	ENSG00000101938	ENST00000372045;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000444321	T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63	4.92	3.16	0.36331	von Willebrand factor, type C (4);	0.000000	0.85682	D	0.000000	T	0.60715	0.2290	L	0.48986	1.54	0.36186	D	0.849786	B;B;B;B;B	0.28291	0.009;0.206;0.009;0.009;0.009	B;B;B;B;B	0.28139	0.013;0.086;0.013;0.013;0.013	T	0.58962	-0.7543	9	.	.	.	-5.1906	8.865	0.35280	0.0:0.8104:0.0:0.1896	.	177;172;157;171;178	E9PGS5;Q9BU40-2;Q59FB2;Q9BU40;D3DUY6	.;.;.;CRDL1_HUMAN;.	I	171;177;177;178;177	ENSP00000361115:V171I;ENSP00000218054:V177I;ENSP00000378276:V177I;ENSP00000361112:V178I;ENSP00000399739:V177I	.	V	-	1	0	CHRDL1	109849728	0.996000	0.38824	0.994000	0.49952	0.833000	0.47200	1.807000	0.38902	0.571000	0.29365	-0.465000	0.05216	GTA			0.488	CHRDL1-001	KNOWN	basic	protein_coding	protein_coding		OTTHUMT00000057912.1		NM_145234	
RP11-1007I13.4	0	broad.mit.edu	37	X	151290014	151290014	+	RNA	DEL	C	C	-	rs57389871|rs682012		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chrX:151290014delC	ENST00000509345.2	-	0	172																											TTTTTTTTTTCCTCTTTCTTT	0.388																																					.													.	.			0			.																																											0	.			TTTTTTCCTCTTT																													X.37:g.151290014delC			8	0	0		11	0.45	5	.	0		0		RNA	DEL	ENST00000509345.2	37																																																																																						0.388	RP11-1007I13.4-001	KNOWN	basic|readthrough_transcript	processed_transcript	processed_transcript		OTTHUMT00000445981.1			
TXNRD2	10587	mdanderson.org	37	22	19882962	19882962	+	Missense_Mutation	SNP	G	G	T	rs371153395		TCGA-YU-A94D-01A-11D-A435-10	TCGA-YU-A94D-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	6cdf8e7a-91c2-467f-a970-16d9a85624d8	9c956f87-fd2f-4e2b-ab4e-777d60094e09	g.chr22:19882962G>T	ENST00000400521.1	-	11	923	c.917C>A	c.(916-918)aCg>aAg	p.T306K	TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000400519.1_Missense_Mutation_p.T305K|TXNRD2_ENST00000334363.9_Missense_Mutation_p.T306K|TXNRD2_ENST00000535882.1_Missense_Mutation_p.T305K|TXNRD2_ENST00000400518.1_Missense_Mutation_p.T276K|TXNRD2_ENST00000542719.1_Missense_Mutation_p.T276K	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	306					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					AAAGGTGCCCGTGTCCTCCTT	0.652																																					.													.	.			0			.												149.0	174.0	165.0					22																	19882962		2170	4261	6431	SO:0001583	missense	10587	.			GTGCCCGTGTCCT	AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.917C>A	22.37:g.19882962G>T	ENSP00000383365:p.Thr306Lys		105	0	0		45	0.07	3	.	66	0.00	0	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Missense_Mutation	SNP	ENST00000400521.1	37	CCDS42981.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.404859	0.01155	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719;ENST00000334363	T;T;T;T;T;T;T	0.59502	0.26;0.26;0.26;0.26;0.26;0.26;1.18	4.26	-6.96	0.01622	Pyridine nucleotide-disulphide oxidoreductase, FAD/NAD(P)-binding domain (1);	1.917680	0.02216	N	0.063591	T	0.47691	0.1459	L	0.51422	1.61	0.09310	N	1	B;B;B;B	0.16802	0.006;0.019;0.006;0.004	B;B;B;B	0.10450	0.003;0.005;0.003;0.003	T	0.24835	-1.0149	10	0.22109	T	0.4	-14.3674	9.9438	0.41596	0.49:0.0:0.51:0.0	.	306;306;274;305	Q9NNW7;E7EWK1;Q6M1B7;D3YTF9	TRXR2_HUMAN;.;.;.	K	276;306;306;283;210;305;305;276;306	ENSP00000383362:T276K;ENSP00000383365:T306K;ENSP00000383369:T283K;ENSP00000383363:T305K;ENSP00000439314:T305K;ENSP00000439570:T276K;ENSP00000334451:T306K	ENSP00000334451:T306K	T	-	2	0	TXNRD2	18262962	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.107000	0.03316	-1.327000	0.02264	-1.244000	0.01528	ACG			0.652	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	protein_coding		OTTHUMT00000314903.3		NM_006440	
