#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_IGV	i_NTotCov_SOL	i_NVaf_SOL	i_NVarCov_SOL	i_ORegAnno_bin	i_TTotCov_SOL	i_TVaf_SOL	i_TVarCov_SOL	i_Transcript_Id	i_Ttot_rna	i_Tvaf_rna	i_Tvar_rna	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_germline-maf-frequency	i_havana_transcript	i_note	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	mdanderson.org	37	1	12304672	12304672	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:12304672G>T	ENST00000358136.3	+	5	575	c.445G>T	c.(445-447)Gaa>Taa	p.E149*	VPS13D_ENST00000356315.4_Nonsense_Mutation_p.E149*	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGAGAATATTGAAGTAAGTCC	0.423																																					p.E149X													.	.			0			c.G445T												120.0	113.0	115.0					1																	12304672		2203	4300	6503	SO:0001587	stop_gained	55187	exon5			AATATTGAAGTAA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.445G>T	1.37:g.12304672G>T	ENSP00000350854:p.Glu149*		60	0	0		89	0.06	5	NM_015378	0		0		Nonsense_Mutation	SNP	ENST00000358136.3	37	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	G	39	7.341433	0.98224	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	18.6045	0.91262	0.0:0.0:1.0:0.0	.	.	.	.	X	149	.	ENSP00000348666:E149X	E	+	1	0	VPS13D	12227259	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.040000	0.93783	2.708000	0.92522	0.467000	0.42956	GAA			0.423	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000036897.2		NM_015378	
ATP13A2	23400	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	1	17312499	17312499	+	3'UTR	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:17312499G>A	ENST00000326735.8	-	0	3793				ATP13A2_ENST00000341676.5_Missense_Mutation_p.S1153L|ATP13A2_ENST00000452699.1_3'UTR|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2						cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CAGCAGCACTGAGGGGAGCTG	0.597																																					p.S1153L													.	.			0			c.C3458T												12.0	13.0	13.0					1																	17312499		691	1589	2280	SO:0001624	3_prime_UTR_variant	23400	exon27			AGCACTGAGGGGA	AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.*217C>T	1.37:g.17312499G>A			54	0	0		42	0.24	10	NM_001141974	181	0.19	34	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	ENST00000326735.8	37	CCDS175.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.162011	0.38217	.	.	ENSG00000159363	ENST00000341676;ENST00000502418	D;D	0.96940	-3.29;-4.18	4.25	2.29	0.28610	.	.	.	.	.	D	0.88880	0.6557	N	0.08118	0	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.80964	-0.1147	9	0.87932	D	0	.	4.2141	0.10526	0.2129:0.1937:0.5935:0.0	.	1153	Q5JXY1	.	L	1153;393	ENSP00000341115:S1153L;ENSP00000423065:S393L	ENSP00000341115:S1153L	S	-	2	0	ATP13A2	17185086	0.002000	0.14202	0.001000	0.08648	0.020000	0.10135	0.579000	0.23788	0.398000	0.25338	0.467000	0.42956	TCA			0.597	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000006617.1		NM_022089	
CELA3A	10136	ucsc.edu	37	1	22329543	22329543	+	Missense_Mutation	SNP	C	C	A	rs7519660	byFrequency	TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:22329543C>A	ENST00000290122.3	+	2	110	c.91C>A	c.(91-93)Cat>Aat	p.H31N	CELA3A_ENST00000374663.1_Missense_Mutation_p.H31N|RN7SL768P_ENST00000584415.1_RNA	NM_005747.4	NP_005738.4	P09093	CEL3A_HUMAN	chymotrypsin-like elastase family, member 3A	31	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.		H -> N (in dbSNP:rs7519660).		cholesterol metabolic process (GO:0008203)|digestion (GO:0007586)|proteolysis (GO:0006508)		serine-type endopeptidase activity (GO:0004252)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CCGCGTTGTCCATGGTGAGGA	0.592													A|||	396	0.0790735	0.2284	0.0144	5008	,	,		15421	0.0526		0.0109	False		,,,				2504	0.0204				p.H31N													.	CELA3A	35		0			c.C91A												73.0	101.0	92.0					1																	22329543		1968	4276	6244	SO:0001583	missense	10136	exon2			GTTGTCCATGGTG	D00306	CCDS220.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000142789	ENSG00000142789			15944	protein-coding gene	gene with protein product	"""protease E"""		"""elastase 3A, pancreatic (protease E)"", ""elastase 3A, pancreatic"""	ELA3A		2826474, 2460440	Standard	NM_005747		Approved	ELA3		P09093	OTTHUMG00000002755	ENST00000290122.3:c.91C>A	1.37:g.22329543C>A	ENSP00000290122:p.His31Asn		54	0.0925925926	5		39	0.26	10	NM_005747	0		0	B1AQ53|Q9BRW4	Missense_Mutation	SNP	ENST00000290122.3	37	CCDS220.1	212	0.09706959706959707	84	0.17073170731707318	21	0.058011049723756904	80	0.13986013986013987	27	0.03562005277044855	c	5.129	0.209475	0.09757	.	.	ENSG00000142789	ENST00000290122;ENST00000374663;ENST00000374661	T;D	0.91894	2.48;-2.93	3.32	0.86	0.19042	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	T	0.00356	0.0011	N	0.00131	-2.04	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.32771	-0.9894	8	0.16896	T	0.51	-21.4742	8.6215	0.33864	0.8059:0.1941:0.0:0.0	rs7519660;rs57431901	31	P09093	CEL3A_HUMAN	N	31;31;47	ENSP00000290122:H31N;ENSP00000363795:H31N	ENSP00000290122:H31N	H	+	1	0	CELA3A	22202130	0.488000	0.25996	0.780000	0.31762	0.503000	0.33858	1.503000	0.35715	0.059000	0.16252	-2.520000	0.00184	CAT			0.592	CELA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000007791.1		NM_005747	
RSPO1	284654	mdanderson.org	37	1	38078478	38078478	+	Silent	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:38078478C>T	ENST00000401069.1	-	7	1453	c.741G>A	c.(739-741)caG>caA	p.Q247Q	RSPO1_ENST00000401068.1_Silent_p.Q247Q|RSPO1_ENST00000401070.1_Silent_p.Q184Q|RSPO1_ENST00000356545.2_Silent_p.Q247Q|RSPO1_ENST00000373059.1_Silent_p.Q220Q|RSPO1_ENST00000401071.2_Silent_p.Q184Q	NM_001242908.1	NP_001229837.1	Q2MKA7	RSPO1_HUMAN	R-spondin 1	247					canonical Wnt signaling pathway (GO:0060070)|male meiosis (GO:0007140)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of gene expression (GO:0010468)|regulation of male germ cell proliferation (GO:2000254)|regulation of receptor internalization (GO:0002090)	extracellular space (GO:0005615)|nucleus (GO:0005634)	G-protein coupled receptor binding (GO:0001664)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GCTGCTGCTGCTGTTGCTGCC	0.637																																					p.Q247Q	GBM(122;680 2230 27822 42821)												.	.			0			c.G741A												82.0	92.0	88.0					1																	38078478		2182	4271	6453	SO:0001819	synonymous_variant	284654	exon7			CTGCTGCTGTTGC	AK098225	CCDS41304.1, CCDS55590.1, CCDS55591.1	1p34.2	2014-01-30	2011-06-29		ENSG00000169218	ENSG00000169218		"""Endogenous ligands"""	21679	protein-coding gene	gene with protein product		609595	"""R-spondin homolog (Xenopus laevis)"""				Standard	NM_001038633		Approved	FLJ40906, RSPONDIN	uc001cbm.2	Q2MKA7	OTTHUMG00000004321	ENST00000401069.1:c.741G>A	1.37:g.38078478C>T			39	0	0		39	0.08	3	NM_001242908	0		0	A2A420|Q0H8S6|Q14C72|Q5T0F2|Q8N7L5	Silent	SNP	ENST00000401069.1	37	CCDS41304.1																																																																																					0.637	RSPO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000012477.2		NM_173640	
NBPF14	25832	broad.mit.edu	37	1	145293269	145293269	+	Splice_Site	SNP	G	G	A	rs61350760		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:145293269G>A	ENST00000468030.1	+	5	1125		c.e5+1		NBPF10_ENST00000369338.1_Splice_Site|NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000342960.5_5'Flank																							TTTCACAACAGTAAGTTAAGA	0.423																																					.													.	NBPF10	221		0			.																																									SO:0001630	splice_region_variant	100132406	.			ACAACAGTAAGTT																												ENST00000468030.1:c.714+1G>A	1.37:g.145293269G>A			22	0	0		29	0.14	4	.	0		0		Splice_Site	SNP	ENST00000468030.1	37																																																																																						0.423	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	protein_coding		OTTHUMT00000038553.9			Intron
C1orf56	54964	hgsc.bcm.edu;broad.mit.edu;bcgsc.ca	37	1	151020692	151020701	+	Frame_Shift_Del	DEL	GCTTCCCAGT	GCTTCCCAGT	-			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	GCTTCCCAGT	GCTTCCCAGT					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:151020692_151020701delGCTTCCCAGT	ENST00000368926.5	+	1	477_486	c.369_378delGCTTCCCAGT	c.(367-378)gagcttcccagtfs	p.ELPS123fs		NM_017860.3	NP_060330.2	Q9BUN1	MENT_HUMAN	chromosome 1 open reading frame 56	123						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCAGCAGAGAGCTTCCCAGTGCGACTCCCA	0.571																																					p.123_126del	GBM(146;891 3320 6873)												.	C1orf56	25		0			c.368_377del																																									SO:0001589	frameshift_variant	54964	exon1			CAGAGAGCTTCCC	BC002469	CCDS980.1	1q21.2	2013-09-20			ENSG00000143443	ENSG00000143443			26045	protein-coding gene	gene with protein product	"""methylated in normal thymocytes"""					12975309, 22133874	Standard	NM_017860		Approved	FLJ20519, MENT	uc001ewn.3	Q9BUN1	OTTHUMG00000035159	ENST00000368926.5:c.369_378delGCTTCCCAGT	1.37:g.151020692_151020701delGCTTCCCAGT	ENSP00000357922:p.Glu123fs		72	0	0		59	0.49	29	NM_017860	2	0.00	0	B2RDU8|Q9NWZ4	Frame_Shift_Del	DEL	ENST00000368926.5	37	CCDS980.1																																																																																					0.571	C1orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085101.1		NM_017860	
AXDND1	126859	broad.mit.edu	37	1	179504046	179504046	+	Missense_Mutation	SNP	G	G	C			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr1:179504046G>C	ENST00000367618.3	+	25	3367	c.2980G>C	c.(2980-2982)Gaa>Caa	p.E994Q		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	994	Glu-rich.							p.E994Q(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaacaacaagaagaagaaga	0.328																																					p.E994Q													AXDND1,caecum,carcinoma,0,2	AXDND1	142	2	1	Substitution - Missense(1)	large_intestine(1)	c.G2980C												50.0	54.0	53.0					1																	179504046		2135	4283	6418	SO:0001583	missense	126859	exon25			CAACAAGAAGAAG	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2980G>C	1.37:g.179504046G>C	ENSP00000356590:p.Glu994Gln		160	0	0		215	0.03	6	NM_144696	8	0.00	0	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	37	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	10.13	1.266099	0.23136	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.18657	2.2;2.21	4.81	4.81	0.61882	.	0.325544	0.22135	N	0.064137	T	0.23572	0.0570	N	0.19112	0.55	0.80722	D	1	D;D	0.64830	0.982;0.994	P;P	0.56960	0.709;0.81	T	0.01330	-1.1383	10	0.21014	T	0.42	-2.7717	13.5575	0.61768	0.0:0.0:1.0:0.0	.	878;994	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	Q	994;878;854	ENSP00000356590:E994Q;ENSP00000391716:E854Q	ENSP00000353471:E878Q	E	+	1	0	AXDND1	177770669	0.000000	0.05858	0.079000	0.20413	0.028000	0.11728	0.055000	0.14229	2.655000	0.90218	0.530000	0.56133	GAA			0.328	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000085312.1		NM_144696	
LARP4B	23185	mdanderson.org	37	10	860954	860954	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr10:860954G>T	ENST00000316157.3	-	15	1792	c.1752C>A	c.(1750-1752)ccC>ccA	p.P584P	LARP4B_ENST00000469487.1_5'UTR	NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	584					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						CCGGCACCGAGGGCTCTCTGG	0.567																																					p.P584P													.	.			0			c.C1752A												87.0	81.0	83.0					10																	860954		2203	4300	6503	SO:0001819	synonymous_variant	23185	exon16			CACCGAGGGCTCT	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1752C>A	10.37:g.860954G>T			57	0	0		43	0.07	3	NM_015155	13	0.00	0	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Silent	SNP	ENST00000316157.3	37	CCDS31131.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.654|0.654	-0.808222|-0.808222	0.02819|0.02819	.|.	.|.	ENSG00000107929|ENSG00000107929	ENST00000448368|ENST00000440895	.|.	.|.	.|.	5.85|5.85	-0.251|-0.251	0.13003|0.13003	.|.	.|0.145914	.|0.64402	.|D	.|0.000005	T|T	0.48484|0.48484	0.1502|0.1502	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44452|0.44452	-0.9327|-0.9327	4|6	.|0.62326	.|D	.|0.03	-14.5459|-14.5459	1.2229|1.2229	0.01927|0.01927	0.2974:0.1524:0.3953:0.1549|0.2974:0.1524:0.3953:0.1549	.|.	.|.	.|.	.|.	I|H	150|60	.|.	.|ENSP00000403018:P60H	L|P	-|-	1|2	0|0	LARP4B|LARP4B	850954|850954	0.000000|0.000000	0.05858|0.05858	0.375000|0.375000	0.26029|0.26029	0.037000|0.037000	0.13140|0.13140	-1.344000|-1.344000	0.02639|0.02639	0.079000|0.079000	0.16929|0.16929	-0.243000|-0.243000	0.11985|0.11985	CTC|CCT			0.567	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000046395.2		NM_015155	
SLC25A22	79751	mdanderson.org	37	11	799966	799966	+	5'Flank	SNP	C	C	T	rs557708824		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr11:799966C>T	ENST00000531214.1	-	0	0				PIDD_ENST00000347755.5_Missense_Mutation_p.A775T|PIDD_ENST00000411829.2_Missense_Mutation_p.A758T	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCAAGGGTGCCAAGGAGAGG	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		16297	0.0		0.001	False		,,,				2504	0.0				p.A775T	Colon(93;848 1468 3270 23355 49636)												.	.			0			c.G2323A												26.0	34.0	32.0					11																	799966		2201	4291	6492	SO:0001631	upstream_gene_variant	55367	exon15			AGGGTGCCAAGGA	AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.799966C>T	Exception_encountered		69	0	0		32	0.09	3	NM_145886	84	0.00	0	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	ENST00000531214.1	37	CCDS7715.1	.	.	.	.	.	.	.	.	.	.	C	11.62	1.691931	0.30052	.	.	ENSG00000177595	ENST00000411829;ENST00000347755	D;D	0.93189	-3.18;-3.18	4.24	2.99	0.34606	DEATH-like (1);	0.333406	0.27866	N	0.017533	T	0.81456	0.4826	N	0.14661	0.345	0.22330	N	0.999194	B;B;B	0.34015	0.304;0.435;0.372	B;B;B	0.28011	0.036;0.085;0.058	T	0.69910	-0.5017	10	0.12103	T	0.63	.	5.7557	0.18172	0.0:0.4879:0.3534:0.1587	.	775;618;758	Q9HB75;Q9HB75-3;Q9HB75-2	PIDD_HUMAN;.;.	T	758;775	ENSP00000416801:A758T;ENSP00000337797:A775T	ENSP00000337797:A775T	A	-	1	0	PIDD	789966	0.998000	0.40836	0.940000	0.37924	0.186000	0.23388	1.043000	0.30316	0.656000	0.30886	0.462000	0.41574	GCA			0.642	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000384124.1			
CRY2	1408	hgsc.bcm.edu;mdanderson.org	37	11	45869127	45869127	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr11:45869127G>T	ENST00000443527.2	+	1	171	c.149G>T	c.(148-150)cGc>cTc	p.R50L	CRY2_ENST00000417225.2_Intron|CRY2_ENST00000473199.1_3'UTR	NM_021117.3	NP_066940.2	Q49AN0	CRY2_HUMAN	cryptochrome circadian clock 2	29	Photolyase/cryptochrome alpha/beta.				blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|glucose homeostasis (GO:0042593)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of phosphoprotein phosphatase activity (GO:0032515)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of sodium-dependent phosphate transport (GO:2000118)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|FAD binding (GO:0071949)|phosphatase binding (GO:0019902)|single-stranded DNA binding (GO:0003697)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(2)	15						CACTGGTTCCGCAAAGGGCTG	0.721																																					p.R50L	Esophageal Squamous(106;91 1499 8126 12599 39610)												CRY2,colon,carcinoma,0,1	CRY2	0	1	0			c.G149T												10.0	12.0	11.0					11																	45869127		2187	4271	6458	SO:0001583	missense	1408	exon1			GGTTCCGCAAAGG	AB014558	CCDS7915.2, CCDS44576.1	11p11.2	2014-01-17	2014-01-17		ENSG00000121671	ENSG00000121671			2385	protein-coding gene	gene with protein product		603732	"""cryptochrome 2 (photolyase-like)"""			8909283	Standard	NM_021117		Approved		uc010rgn.2	Q49AN0	OTTHUMG00000153225	ENST00000443527.2:c.149G>T	11.37:g.45869127G>T	ENSP00000406751:p.Arg50Leu		20	0	0		20	0.10	2	NM_021117	0		0	B4DH32|B4DZD6|O75148|Q8IV71	Missense_Mutation	SNP	ENST00000443527.2	37	CCDS7915.2	.	.	.	.	.	.	.	.	.	.	G	37	5.978114	0.97168	.	.	ENSG00000121671	ENST00000443527	.	.	.	5.1	5.1	0.69264	.	0.118967	0.56097	D	0.000021	D	0.90494	0.7022	H	0.99026	4.405	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93718	0.7030	9	0.87932	D	0	-24.3251	15.8994	0.79362	0.0:0.0:1.0:0.0	.	50	B4DZD6	.	L	50	.	ENSP00000406751:R50L	R	+	2	0	CRY2	45825703	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.547000	0.90665	2.817000	0.96982	0.561000	0.74099	CGC			0.721	CRY2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000330235.2		NM_021117	
CHRM1	1128	mdanderson.org	37	11	62677554	62677554	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr11:62677554C>T	ENST00000306960.3	-	2	1560	c.1019G>A	c.(1018-1020)gGc>gAc	p.G340D	AP000438.2_ENST00000543624.1_RNA	NM_000738.2	NP_000729.2	P11229	ACM1_HUMAN	cholinergic receptor, muscarinic 1	340					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cognition (GO:0050890)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of ion transport (GO:0043270)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of locomotion (GO:0040012)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			large_intestine(5)|lung(3)|stomach(1)	9					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Benzatropine(DB00245)|Biperiden(DB00810)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbachol(DB00411)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clidinium(DB00771)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyclopentolate(DB00979)|Cycrimine(DB00942)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Doxylamine(DB00366)|Escitalopram(DB01175)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Flupentixol(DB00875)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methantheline(DB00940)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metoclopramide(DB01233)|Minaprine(DB00805)|Molindone(DB01618)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Oxyphenonium(DB00219)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pirenzepine(DB00670)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propantheline(DB00782)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Trospium(DB00209)|Ziprasidone(DB00246)	GGGCTTCTGGCCCTTGCCAGC	0.642																																					p.G340D													.	.			0			c.G1019A												46.0	48.0	47.0					11																	62677554		2201	4298	6499	SO:0001583	missense	1128	exon2			TTCTGGCCCTTGC	Y00508	CCDS8040.1	11q12-q13	2012-08-08				ENSG00000168539		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1950	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 1"""	118510					Standard	NM_000738		Approved		uc001nwi.3	P11229		ENST00000306960.3:c.1019G>A	11.37:g.62677554C>T	ENSP00000306490:p.Gly340Asp		39	0	0		24	0.08	2	NM_000738	0		0	Q96RH1	Missense_Mutation	SNP	ENST00000306960.3	37	CCDS8040.1	.	.	.	.	.	.	.	.	.	.	C	9.610	1.131064	0.21041	.	.	ENSG00000168539	ENST00000306960;ENST00000543973	T;T	0.61040	0.18;0.14	4.92	2.84	0.33178	GPCR, rhodopsin-like superfamily (1);	1.052440	0.07487	N	0.904945	T	0.41811	0.1175	N	0.14661	0.345	0.33976	D	0.647341	B	0.23442	0.085	B	0.28638	0.092	T	0.48927	-0.8991	10	0.44086	T	0.13	-4.0207	7.4451	0.27207	0.0:0.7215:0.176:0.1025	.	340	P11229	ACM1_HUMAN	D	340	ENSP00000306490:G340D;ENSP00000441188:G340D	ENSP00000306490:G340D	G	-	2	0	CHRM1	62434130	0.052000	0.20516	0.978000	0.43139	0.982000	0.71751	0.296000	0.19083	1.254000	0.44035	0.655000	0.94253	GGC			0.642	CHRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000396178.1		NM_000738	
FERMT3	83706	mdanderson.org	37	11	63974970	63974970	+	Missense_Mutation	SNP	T	T	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr11:63974970T>G	ENST00000279227.5	+	2	229	c.134T>G	c.(133-135)gTg>gGg	p.V45G	FERMT3_ENST00000345728.5_Missense_Mutation_p.V45G	NM_178443.2	NP_848537.1	Q86UX7	URP2_HUMAN	fermitin family member 3	45					integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|platelet aggregation (GO:0070527)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|podosome (GO:0002102)	integrin binding (GO:0005178)			breast(1)|cervix(1)|endometrium(4)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	18						ATCGGCGGGGTGCTCCTGAAG	0.657																																					p.V45G													.	.			0			c.T134G												44.0	48.0	47.0					11																	63974970		2201	4297	6498	SO:0001583	missense	83706	exon2			GCGGGGTGCTCCT	L25343	CCDS8059.1, CCDS8060.1	11q13.1	2014-09-17	2010-06-24		ENSG00000149781	ENSG00000149781		"""Fermitins"", ""Pleckstrin homology (PH) domain containing"""	23151	protein-coding gene	gene with protein product	"""kindlin-3"""	607901	"""fermitin family homolog 3 (Drosophila)"""				Standard	NM_178443		Approved	URP2, KIND3, MIG2B, MGC10966, MIG-2, UNC112C	uc001nym.2	Q86UX7	OTTHUMG00000167790	ENST00000279227.5:c.134T>G	11.37:g.63974970T>G	ENSP00000279227:p.Val45Gly		116	0.2844827586	33		62	0.27	17	NM_031471	5	0.20	1	Q8IUA1|Q8N207|Q9BT48	Missense_Mutation	SNP	ENST00000279227.5	37	CCDS8060.1	.	.	.	.	.	.	.	.	.	.	T	33	5.201193	0.94997	.	.	ENSG00000149781	ENST00000544997;ENST00000345728;ENST00000279227	T;T;T	0.57595	0.89;0.39;0.39	4.48	4.48	0.54585	.	0.000000	0.64402	D	0.000002	T	0.71668	0.3367	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.83275	0.996;0.972	T	0.76203	-0.3045	10	0.87932	D	0	-28.752	13.1635	0.59557	0.0:0.0:0.0:1.0	.	45;45	Q86UX7-2;Q86UX7	.;URP2_HUMAN	G	45	ENSP00000445778:V45G;ENSP00000339950:V45G;ENSP00000279227:V45G	ENSP00000279227:V45G	V	+	2	0	FERMT3	63731546	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.325000	0.65869	2.023000	0.59567	0.459000	0.35465	GTG			0.657	FERMT3-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000396297.1		NM_031471	
ALG9	79796	mdanderson.org	37	11	111706994	111706994	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr11:111706994G>T	ENST00000531154.1	-	13	1455	c.983C>A	c.(982-984)tCa>tAa	p.S328*	ALG9_ENST00000524880.1_3'UTR|ALG9_ENST00000398006.2_Nonsense_Mutation_p.S321*|ALG9_ENST00000527228.1_5'UTR	NM_024740.2	NP_079016.2	Q9H6U8	ALG9_HUMAN	ALG9, alpha-1,2-mannosyltransferase	492					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dol-P-Man:Man(6)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052926)|dol-P-Man:Man(8)GlcNAc(2)-PP-Dol alpha-1,2-mannosyltransferase activity (GO:0052918)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		TCTGAACTCTGATGGAATGAA	0.438																																					p.S499X													.	.			0			c.C1496A												76.0	72.0	73.0					11																	111706994		1854	4087	5941	SO:0001587	stop_gained	79796	exon14			AACTCTGATGGAA		CCDS41714.1, CCDS53709.1, CCDS73379.1, CCDS73380.1	11q23	2013-02-26	2013-02-26	2004-08-26	ENSG00000086848	ENSG00000086848	2.4.1.259, 2.4.1.261	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	15672	protein-coding gene	gene with protein product	"""dolichyl-P-Man:Man(6)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dolichyl-P-Man:Man(8)GlcNAc(2)-PP-dolichol alpha-1,2-mannosyltransferase"", ""dol-P-Man dependent alpha-1,2-mannosyltransferase"""	606941	"""disrupted in bipolar affective disorder 1"", ""asparagine-linked glycosylation 9 homolog (yeast, alpha 1,2 mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha- 1,2-mannosyltransferase homolog (S. cerevisiae, alpha- 1,2-mannosyltransferase)"", ""asparagine-linked glycosylation 9, alpha-1,2-mannosyltransferase homolog (S. cerevisiae)"""	DIBD1		12030331, 15148656	Standard	NM_024740		Approved		uc021qql.1	Q9H6U8	OTTHUMG00000166819	ENST00000531154.1:c.983C>A	11.37:g.111706994G>T	ENSP00000435517:p.Ser328*		72	0	0		43	0.07	3	NM_024740	32	0.00	0	Q6ZMD5|Q7Z4R4|Q96GS7|Q96PB9|Q9H068	Nonsense_Mutation	SNP	ENST00000531154.1	37	CCDS41714.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.783363|9.783363	0.99263|0.99263	.|.	.|.	ENSG00000086848|ENSG00000086848	ENST00000532425|ENST00000531154;ENST00000398006;ENST00000428306	.|.	.|.	.|.	5.2|5.2	5.2|5.2	0.72013|0.72013	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47002|.	0.1422|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37957|.	-0.9683|.	3|.	.|0.02654	.|T	.|1	-13.4211|-13.4211	19.0933|19.0933	0.93238|0.93238	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	K|X	77|328;321;725	.|.	.|ENSP00000381090:S321X	Q|S	-|-	1|2	0|0	ALG9|ALG9	111212204|111212204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.784000|9.784000	0.99039|0.99039	2.586000|2.586000	0.87340|0.87340	0.563000|0.563000	0.77884|0.77884	CAG|TCA			0.438	ALG9-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000391485.1		NM_024740	
KRT84	3890	mdanderson.org	37	12	52774348	52774348	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr12:52774348G>A	ENST00000257951.3	-	7	1289	c.1223C>T	c.(1222-1224)gCa>gTa	p.A408V	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	408	Coil 2.|Rod.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTCGGCCACTGCAGCCTCCAA	0.627											OREG0021848	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A408V													.	.			0			c.C1223T												22.0	19.0	20.0					12																	52774348		2201	4298	6499	SO:0001583	missense	3890	exon7			GCCACTGCAGCCT	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1223C>T	12.37:g.52774348G>A	ENSP00000257951:p.Ala408Val		33	0	0	987	42	0.07	3	NM_033045	0		0	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	37	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	G	16.77	3.216024	0.58452	.	.	ENSG00000161849	ENST00000257951	T	0.77620	-1.11	5.03	4.14	0.48551	Filament (1);	0.148255	0.31821	N	0.007015	D	0.89111	0.6622	M	0.88181	2.935	0.09310	N	1	D	0.69078	0.997	D	0.68353	0.957	D	0.83673	0.0167	10	0.87932	D	0	.	15.6836	0.77391	0.0:0.137:0.8629:0.0	.	408	Q9NSB2	KRT84_HUMAN	V	408	ENSP00000257951:A408V	ENSP00000257951:A408V	A	-	2	0	KRT84	51060615	0.996000	0.38824	0.005000	0.12908	0.571000	0.35966	5.396000	0.66297	1.342000	0.45619	0.655000	0.94253	GCA			0.627	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000405187.1		NM_033045	
PAN2	9924	broad.mit.edu	37	12	56719235	56719235	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr12:56719235G>T	ENST00000425394.2	-	9	1739	c.1363C>A	c.(1363-1365)Ccc>Acc	p.P455T	PAN2_ENST00000257931.5_Missense_Mutation_p.P455T|PAN2_ENST00000440411.3_Missense_Mutation_p.P455T|PAN2_ENST00000548043.1_Missense_Mutation_p.P455T	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	AGTCTGTAGGGTATCTAGGGA	0.458																																					p.P455T													.	PAN2	107		0			c.C1363A												153.0	129.0	137.0					12																	56719235		2203	4300	6503	SO:0001583	missense	9924	exon9			TGTAGGGTATCTA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1363C>A	12.37:g.56719235G>T	ENSP00000401721:p.Pro455Thr		78	0	0		100	0.04	4	NM_014871	22	0.00	0		Missense_Mutation	SNP	ENST00000425394.2	37	CCDS44922.1	.	.	.	.	.	.	.	.	.	.	g	14.96	2.690816	0.48097	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.25250	1.81;1.82;1.81;1.81	5.13	4.24	0.50183	.	0.167112	0.53938	D	0.000055	T	0.35653	0.0939	M	0.72353	2.195	0.58432	D	0.999998	P;P;P	0.52061	0.9;0.95;0.917	P;P;P	0.50896	0.576;0.653;0.451	T	0.17198	-1.0377	10	0.62326	D	0.03	-12.5765	7.9824	0.30192	0.0826:0.0:0.7592:0.1582	.	455;455;455	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	T	455	ENSP00000401721:P455T;ENSP00000388231:P455T;ENSP00000257931:P455T;ENSP00000449861:P455T	ENSP00000257931:P455T	P	-	1	0	PAN2	55005502	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.571000	0.82399	1.325000	0.45301	0.645000	0.84053	CCC			0.458	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000409024.1		NM_014871	
FAM109A	144717	mdanderson.org	37	12	111800828	111800828	+	Missense_Mutation	SNP	C	C	T	rs3840795|rs139032867	byFrequency	TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr12:111800828C>T	ENST00000547838.2	-	2	501	c.404G>A	c.(403-405)gGc>gAc	p.G135D	FAM109A_ENST00000450786.2_Missense_Mutation_p.A116T|FAM109A_ENST00000361483.3_Missense_Mutation_p.G148D|FAM109A_ENST00000548163.1_Missense_Mutation_p.G135D|FAM109A_ENST00000392658.5_Missense_Mutation_p.G135D			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	135					endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.G146_G148delGGG(1)|p.G133_G135delGGG(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						cagggCCATGCCACCCCCGCC	0.736																																					p.G148D													.	.			2	Deletion - In frame(2)	breast(2)	c.G443A												4.0	6.0	6.0					12																	111800828		1950	3999	5949	SO:0001583	missense	144717	exon4			GCCATGCCACCCC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.404G>A	12.37:g.111800828C>T	ENSP00000447353:p.Gly135Asp		23	0	0		16	0.13	2	NM_001177996	1	0.00	0	J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	ENST00000547838.2	37	CCDS9152.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.141|9.141	1.013911|1.013911	0.19277|0.19277	.|.	.|.	ENSG00000198324|ENSG00000198324	ENST00000450786|ENST00000547838;ENST00000361483;ENST00000392658;ENST00000548163	.|T;T;T;T	.|0.30714	.|1.53;1.52;1.53;1.53	2.26|2.26	2.26|2.26	0.28386|0.28386	.|.	.|.	.|.	.|.	.|.	T|T	0.14787|0.14787	0.0357|0.0357	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	P|B	0.34934|0.25904	0.476|0.137	B|B	0.25884|0.18263	0.064|0.021	T|T	0.21518|0.21518	-1.0243|-1.0243	8|9	0.87932|0.27785	D|T	0|0.31	.|.	9.7612|9.7612	0.40532|0.40532	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	116|135	G3V0F1|Q8N4B1	.|SESQ1_HUMAN	T|D	116|135;148;135;135	.|ENSP00000447353:G135D;ENSP00000354461:G148D;ENSP00000376426:G135D;ENSP00000449994:G135D	ENSP00000390552:A116T|ENSP00000354461:G148D	A|G	-|-	1|2	0|0	FAM109A|FAM109A	110285211|110285211	0.010000|0.010000	0.17322|0.17322	0.006000|0.006000	0.13384|0.13384	0.039000|0.039000	0.13416|0.13416	1.112000|1.112000	0.31172|0.31172	0.745000|0.745000	0.32763|0.32763	0.313000|0.313000	0.20887|0.20887	GCA|GGC			0.736	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000404768.2		NM_144671	
PEBP1	5037	mdanderson.org	37	12	118574112	118574112	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr12:118574112C>T	ENST00000261313.2	+	1	450	c.98C>T	c.(97-99)gCg>gTg	p.A33V		NM_002567.2	NP_002558.1	P30086	PEBP1_HUMAN	phosphatidylethanolamine binding protein 1	33						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCGGGGCGGCGGTGGACGAG	0.726																																					p.A33V	NSCLC(44;94 1357 12187 49467)												.	.			0			c.C98T												9.0	11.0	11.0					12																	118574112		1960	3659	5619	SO:0001583	missense	5037	exon1			GGGCGGCGGTGGA	X85033	CCDS9187.1	12q24	2009-06-16	2006-02-16	2006-02-16	ENSG00000089220	ENSG00000089220			8630	protein-coding gene	gene with protein product	"""Raf kinase inhibitory protein"", ""hippocampal cholinergic neurostimulating peptide"""	604591	"""prostatic binding protein"""	PBP		15782137	Standard	NM_002567		Approved	RKIP, HCNP, PEBP	uc001twu.1	P30086	OTTHUMG00000168860	ENST00000261313.2:c.98C>T	12.37:g.118574112C>T	ENSP00000261313:p.Ala33Val		18	0	0		15	0.13	2	NM_002567	100	0.00	0	B2R4S1	Missense_Mutation	SNP	ENST00000261313.2	37	CCDS9187.1	.	.	.	.	.	.	.	.	.	.	C	10.04	1.242246	0.22796	.	.	ENSG00000089220	ENST00000261313;ENST00000418769	T	0.42513	0.97	4.75	-4.14	0.03892	.	0.372823	0.32563	N	0.005922	T	0.13286	0.0322	N	0.04132	-0.27	0.09310	N	1	B;B	0.19200	0.034;0.001	B;B	0.13407	0.009;0.002	T	0.07635	-1.0762	10	0.27785	T	0.31	.	2.8801	0.05645	0.1946:0.3382:0.0682:0.399	.	33;33	B4DRT4;P30086	.;PEBP1_HUMAN	V	33	ENSP00000261313:A33V	ENSP00000261313:A33V	A	+	2	0	PEBP1	117058495	1.000000	0.71417	0.001000	0.08648	0.129000	0.20672	1.875000	0.39578	-1.013000	0.03383	-0.339000	0.08088	GCG			0.726	PEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000401405.1		NM_002567	
CCDC64	92558	mdanderson.org	37	12	120527873	120527873	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr12:120527873C>T	ENST00000397558.2	+	8	1558	c.1558C>T	c.(1558-1560)Cag>Tag	p.Q520*	CCDC64_ENST00000446727.2_Nonsense_Mutation_p.Q191*|CCDC64_ENST00000257583.4_Nonsense_Mutation_p.Q217*	NM_207311.2	NP_997194.2	Q6ZP65	BICR1_HUMAN	coiled-coil domain containing 64	520					Golgi to secretory granule transport (GO:0055107)|neuron projection development (GO:0031175)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	dynactin binding (GO:0034452)|Rab GTPase binding (GO:0017137)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGAAGCTTGGCAGGTAAACTG	0.537																																					p.Q520X													.	.			0			c.C1558T												62.0	63.0	63.0					12																	120527873		1936	4144	6080	SO:0001587	stop_gained	92558	exon8			GCTTGGCAGGTAA	U88834, AK129960	CCDS41845.1	12q24.23	2006-01-24				ENSG00000135127			28095	protein-coding gene	gene with protein product							Standard	NM_207311		Approved	FLJ26450	uc001txl.1	Q6ZP65	OTTHUMG00000169311	ENST00000397558.2:c.1558C>T	12.37:g.120527873C>T	ENSP00000380690:p.Gln520*		69	0	0		42	0.07	3	NM_207311	52	0.00	0	A8MUC8|B4DWL0|B5MDJ0|O95000	Nonsense_Mutation	SNP	ENST00000397558.2	37	CCDS41845.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138214	0.77775	.	.	ENSG00000135127	ENST00000397558;ENST00000446727;ENST00000548673;ENST00000257583	.	.	.	5.23	5.23	0.72850	.	0.000000	0.64402	U	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-9.9655	18.8023	0.92023	0.0:1.0:0.0:0.0	.	.	.	.	X	520;191;238;217	.	ENSP00000257583:Q217X	Q	+	1	0	CCDC64	119012256	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	7.814000	0.86154	2.422000	0.82143	0.462000	0.41574	CAG			0.537	CCDC64-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		OTTHUMT00000403390.2		NM_207311	
JPH4	84502	mdanderson.org	37	14	24044904	24044904	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr14:24044904C>T	ENST00000397118.3	-	4	2043	c.1141G>A	c.(1141-1143)Gcc>Acc	p.A381T	JPH4_ENST00000544177.1_5'Flank|JPH4_ENST00000356300.4_Missense_Mutation_p.A381T	NM_032452.2	NP_115828.2	Q96JJ6	JPH4_HUMAN	junctophilin 4	381					calcium ion transport into cytosol (GO:0060402)|learning (GO:0007612)|neuromuscular process controlling balance (GO:0050885)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic plasticity (GO:0048167)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)				endometrium(1)|large_intestine(2)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		CTGGCAGCGGCGATCTCCTGG	0.687																																					p.A381T													JPH4,NS,carcinoma,0,1	JPH4	0	1	0			c.G1141A												11.0	12.0	12.0					14																	24044904		2181	4283	6464	SO:0001583	missense	84502	exon4			CAGCGGCGATCTC	AB058734	CCDS9603.1	14q11	2004-05-28	2004-05-28	2004-05-28	ENSG00000092051	ENSG00000092051			20156	protein-coding gene	gene with protein product			"""junctophilin like 1"""	JPHL1		11347906	Standard	NM_032452		Approved	KIAA1831	uc001wkr.2	Q96JJ6	OTTHUMG00000028769	ENST00000397118.3:c.1141G>A	14.37:g.24044904C>T	ENSP00000380307:p.Ala381Thr		44	0	0		41	0.07	3	NM_032452	0		0	D3DS53|Q8ND44|Q96DQ0	Missense_Mutation	SNP	ENST00000397118.3	37	CCDS9603.1	.	.	.	.	.	.	.	.	.	.	.	13.79	2.342303	0.41498	.	.	ENSG00000092051	ENST00000356300;ENST00000397118;ENST00000543864;ENST00000267407	T;T	0.63744	-0.06;-0.06	4.06	4.06	0.47325	.	0.000000	0.29964	U	0.010742	T	0.76723	0.4027	M	0.71581	2.175	0.48696	D	0.999697	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.80122	-0.1514	10	0.87932	D	0	.	13.7735	0.63039	0.0:1.0:0.0:0.0	.	381;381	A8K396;Q96JJ6	.;JPH4_HUMAN	T	381;381;381;382	ENSP00000348648:A381T;ENSP00000380307:A381T	ENSP00000267407:A382T	A	-	1	0	JPH4	23114744	1.000000	0.71417	0.990000	0.47175	0.010000	0.07245	7.156000	0.77453	2.079000	0.62486	0.563000	0.77884	GCC			0.687	JPH4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000413853.1		NM_032452	
KCNH5	27133	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	63447863	63447863	+	Silent	SNP	A	A	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr14:63447863A>G	ENST00000322893.7	-	6	937	c.669T>C	c.(667-669)atT>atC	p.I223I	KCNH5_ENST00000394964.2_Silent_p.I165I|KCNH5_ENST00000394968.1_Silent_p.I165I|KCNH5_ENST00000420622.2_Silent_p.I223I	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	223					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		AGAAGGTAAGAATTAAAATCA	0.388																																					p.I223I													.	.			0			c.T669C												78.0	77.0	77.0					14																	63447863		2203	4300	6503	SO:0001819	synonymous_variant	27133	exon6			GGTAAGAATTAAA	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.669T>C	14.37:g.63447863A>G			104	0	0		86	0.16	14	NM_172375	2	1.00	2	C9JP98	Silent	SNP	ENST00000322893.7	37	CCDS9756.1																																																																																					0.388	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000411747.1		NM_139318	
FUT8	2530	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	66028473	66028473	+	Silent	SNP	C	C	T	rs372888976		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr14:66028473C>T	ENST00000360689.5	+	3	1919	c.192C>T	c.(190-192)gcC>gcT	p.A64A	FUT8_ENST00000394586.2_Silent_p.A64A|FUT8_ENST00000358307.2_Intron|FUT8_ENST00000394585.1_Silent_p.A64A|FUT8_ENST00000557164.1_Intron	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	64					cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		GGCGAATGGCCGAATCTCTCC	0.403																																					p.A64A													.	.			0			c.C192T							C	,,	0,4406		0,0,2203	54.0	52.0	53.0		,192,192	-1.1	1.0	14		53	2,8596	2.2+/-6.3	0,2,4297	no	intron,coding-synonymous,coding-synonymous	FUT8	NM_004480.4,NM_178155.2,NM_178156.2	,,	0,2,6500	TT,TC,CC		0.0233,0.0,0.0154	,,	,64/576,64/576	66028473	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	2530	exon3			AATGGCCGAATCT	AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.192C>T	14.37:g.66028473C>T			51	0	0		50	0.10	5	NM_178155	1	0.00	0	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Silent	SNP	ENST00000360689.5	37	CCDS9775.1																																																																																					0.403	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000286406.1		NM_004480	
EIF2B2	8892	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	14	75475839	75475839	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr14:75475839A>G	ENST00000266126.5	+	8	1084	c.1004A>G	c.(1003-1005)tAc>tGc	p.Y335C	RP11-950C14.3_ENST00000554430.1_RNA	NM_014239.3	NP_055054.1	P49770	EI2BB_HUMAN	eukaryotic translation initiation factor 2B, subunit 2 beta, 39kDa	335					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|central nervous system development (GO:0007417)|gene expression (GO:0010467)|myelination (GO:0042552)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|translation initiation factor activity (GO:0003743)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(234;0.00661)		GCACCTTCCTACATCTACCGC	0.473																																					p.Y335C													.	.			0			c.A1004G												359.0	291.0	314.0					14																	75475839		2203	4300	6503	SO:0001583	missense	8892	exon8			CTTCCTACATCTA		CCDS9836.1	14q24.3	2008-08-11	2002-08-29			ENSG00000119718			3258	protein-coding gene	gene with protein product		606454	"""eukaryotic translation initiation factor 2B, subunit 2 (beta, 39kD)"""			8887689	Standard	NM_014239		Approved	EIF2B, EIF-2Bbeta	uc001xrc.2	P49770		ENST00000266126.5:c.1004A>G	14.37:g.75475839A>G	ENSP00000266126:p.Tyr335Cys		182	0	0		120	0.26	31	NM_014239	59	0.25	15	O43201	Missense_Mutation	SNP	ENST00000266126.5	37	CCDS9836.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.717071	0.89205	.	.	ENSG00000119718	ENST00000266126	D	0.96136	-3.92	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	D	0.98388	0.9464	H	0.94582	3.555	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99632	1.0986	10	0.87932	D	0	-19.7697	16.0907	0.81088	1.0:0.0:0.0:0.0	.	335	P49770	EI2BB_HUMAN	C	335	ENSP00000266126:Y335C	ENSP00000266126:Y335C	Y	+	2	0	EIF2B2	74545592	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.204000	0.70986	0.533000	0.62120	TAC			0.473	EIF2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414993.1		NM_014239	
IRF2BPL	64207	mdanderson.org	37	14	77493591	77493591	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr14:77493591C>T	ENST00000238647.3	-	1	1443	c.545G>A	c.(544-546)aGc>aAc	p.S182N		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	182	Gly/Pro-rich.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						GTGGCTGCTGCTTCCCAGGCT	0.726																																					p.S182N													.	.			0			c.G545A												22.0	22.0	22.0					14																	77493591		2197	4297	6494	SO:0001583	missense	64207	exon1			CTGCTGCTTCCCA	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.545G>A	14.37:g.77493591C>T	ENSP00000238647:p.Ser182Asn		46	0	0		20	0.10	2	NM_024496	9	0.00	0	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	37	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.531673	0.27387	.	.	ENSG00000119669	ENST00000238647	T	0.64618	-0.11	3.66	3.66	0.41972	.	0.184703	0.25622	U	0.029417	T	0.42720	0.1215	N	0.24115	0.695	0.09310	N	0.999998	B	0.14438	0.01	B	0.11329	0.006	T	0.15954	-1.0419	10	0.30078	T	0.28	-2.873	6.9522	0.24552	0.0:0.8738:0.0:0.1262	.	182	Q9H1B7	I2BPL_HUMAN	N	182	ENSP00000238647:S182N	ENSP00000238647:S182N	S	-	2	0	IRF2BPL	76563344	0.588000	0.26799	0.993000	0.49108	0.759000	0.43091	0.909000	0.28558	1.892000	0.54788	0.298000	0.19748	AGC			0.726	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000414298.1		NM_024496	
GOLGA6L2	283685	broad.mit.edu	37	15	23685464	23685465	+	In_Frame_Ins	INS	-	-	TCT	rs373462853		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr15:23685464_23685465insTCT	ENST00000567107.1	-	8	2209_2210	c.2157_2158insAGA	c.(2155-2160)agatca>agaAGAtca	p.719_720insR	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	575										breast(1)|endometrium(7)	8						tctgctcctgatctcctgctcc	0.574																																					.													.	.			0			.																																									SO:0001652	inframe_insertion	283685	.			CTCCTGATCTCCT	AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2155_2157dupAGA	15.37:g.23685465_23685467dupTCT	ENSP00000454407:p.Arg719_Arg719dup		4	0	0		5	0.60	3	.	0		0	A1L301	In_Frame_Ins	INS	ENST00000567107.1	37																																																																																						0.574	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding		OTTHUMT00000431937.1		NM_182561	
ISLR2	57611	mdanderson.org	37	15	74427119	74427119	+	Missense_Mutation	SNP	A	A	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr15:74427119A>G	ENST00000361742.3	+	4	2793	c.2024A>G	c.(2023-2025)gAg>gGg	p.E675G	ISLR2_ENST00000445793.1_Missense_Mutation_p.E675G|ISLR2_ENST00000561975.1_Intron|ISLR2_ENST00000435464.1_Missense_Mutation_p.E675G|ISLR2_ENST00000565159.1_Missense_Mutation_p.E675G|ISLR2_ENST00000453268.2_Missense_Mutation_p.E675G|ISLR2_ENST00000419208.1_Missense_Mutation_p.E675G|ISLR2_ENST00000565540.1_Missense_Mutation_p.E675G	NM_001130136.1|NM_020851.2	NP_001123608.1|NP_065902.1	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing leucine-rich repeat 2	675					positive regulation of axon extension (GO:0045773)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36						GTGCAGGGGGAGGGCCTTGAT	0.682											OREG0023277	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E675G													.	.			0			c.A2024G												39.0	45.0	43.0					15																	74427119		2198	4297	6495	SO:0001583	missense	57611	exon4			AGGGGGAGGGCCT		CCDS10259.1	15q24.1	2013-01-11			ENSG00000167178	ENSG00000167178		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29286	protein-coding gene	gene with protein product		614179				10819331, 12975309	Standard	NM_001130136		Approved	KIAA1465	uc010bjf.3	Q6UXK2	OTTHUMG00000137624	ENST00000361742.3:c.2024A>G	15.37:g.74427119A>G	ENSP00000355402:p.Glu675Gly		55	0	0	1152	57	0.11	6	NM_001130136	0		0	A8K352|Q9P263	Missense_Mutation	SNP	ENST00000361742.3	37	CCDS10259.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229672	0.39399	.	.	ENSG00000167178	ENST00000445793;ENST00000361742;ENST00000435464;ENST00000453268;ENST00000395121;ENST00000419208	T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36	4.69	2.22	0.28083	.	0.336949	0.22978	U	0.053357	T	0.31670	0.0804	N	0.24115	0.695	0.42835	D	0.994038	B	0.06786	0.001	B	0.09377	0.004	T	0.06862	-1.0803	10	0.29301	T	0.29	.	4.8355	0.13462	0.6599:0.1608:0.1793:0.0	.	675	Q6UXK2	ISLR2_HUMAN	G	675;675;675;675;264;675	ENSP00000403244:E675G;ENSP00000355402:E675G;ENSP00000411443:E675G;ENSP00000411834:E675G;ENSP00000408872:E675G	ENSP00000355402:E675G	E	+	2	0	ISLR2	72214172	1.000000	0.71417	0.424000	0.26647	0.229000	0.25112	2.064000	0.41432	0.653000	0.30826	0.260000	0.18958	GAG			0.682	ISLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269046.1		NM_020851	
IQGAP1	8826	mdanderson.org	37	15	90991921	90991921	+	Missense_Mutation	SNP	G	G	T	rs138254672	byFrequency	TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr15:90991921G>T	ENST00000268182.5	+	10	1154	c.1030G>T	c.(1030-1032)Gac>Tac	p.D344Y	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	344					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			ACAGAATAGCGACTGGTACTT	0.478																																					p.D344Y													.	.			0			c.G1030T												52.0	50.0	51.0					15																	90991921		2198	4298	6496	SO:0001583	missense	8826	exon10			AATAGCGACTGGT	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1030G>T	15.37:g.90991921G>T	ENSP00000268182:p.Asp344Tyr		85	0	0		45	0.07	3	NM_003870	3	0.00	0	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	37	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	G	13.47	2.247119	0.39697	.	.	ENSG00000140575	ENST00000268182	T	0.06687	3.27	5.32	5.32	0.75619	.	0.118844	0.56097	D	0.000024	T	0.11793	0.0287	L	0.59436	1.845	0.80722	D	1	B	0.31931	0.347	B	0.33121	0.158	T	0.01363	-1.1374	10	0.62326	D	0.03	-22.824	13.1608	0.59542	0.0:0.0:0.8406:0.1594	.	344	P46940	IQGA1_HUMAN	Y	344	ENSP00000268182:D344Y	ENSP00000268182:D344Y	D	+	1	0	IQGAP1	88792925	1.000000	0.71417	0.986000	0.45419	0.747000	0.42532	5.152000	0.64882	2.767000	0.95098	0.563000	0.77884	GAC			0.478	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313493.1		NM_003870	
NTN3	4917	mdanderson.org	37	16	2522076	2522076	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr16:2522076G>T	ENST00000293973.1	+	1	577	c.374G>T	c.(373-375)tGc>tTc	p.C125F		NM_006181.2	NP_006172.1	O00634	NET3_HUMAN	netrin 3	125	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(2)|lung(3)|prostate(1)	7						CTGCGCTTCTGCTCAGCTCCC	0.662																																					p.C125F													.	.			0			c.G374T												27.0	32.0	30.0					16																	2522076		2198	4298	6496	SO:0001583	missense	4917	exon1			GCTTCTGCTCAGC	U86759	CCDS10469.1	16p13.3	2013-03-01	2008-10-29	2008-10-29	ENSG00000162068	ENSG00000162068		"""Netrins"""	8030	protein-coding gene	gene with protein product	"""Netrin-3"""	602349	"""netrin 2 (chicken)-like"", ""netrin 2-like (chicken)"""	NTN2L		9143507, 10366627	Standard	NM_006181		Approved		uc002cqj.3	O00634	OTTHUMG00000128867	ENST00000293973.1:c.374G>T	16.37:g.2522076G>T	ENSP00000293973:p.Cys125Phe		31	0	0		19	0.16	3	NM_006181	0		0		Missense_Mutation	SNP	ENST00000293973.1	37	CCDS10469.1	.	.	.	.	.	.	.	.	.	.	G	17.62	3.435663	0.62955	.	.	ENSG00000162068	ENST00000293973	T	0.74842	-0.88	3.97	3.97	0.46021	Laminin, N-terminal (3);	0.119841	0.56097	D	0.000023	D	0.84588	0.5505	M	0.83223	2.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82839	-0.0259	10	0.10902	T	0.67	.	14.7814	0.69769	0.0:0.0:1.0:0.0	.	125	O00634	NET3_HUMAN	F	125	ENSP00000293973:C125F	ENSP00000293973:C125F	C	+	2	0	NTN3	2462077	1.000000	0.71417	0.998000	0.56505	0.692000	0.40212	7.588000	0.82629	2.055000	0.61198	0.462000	0.41574	TGC			0.662	NTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250812.1		NM_006181	
PPL	5493	broad.mit.edu	37	16	4934417	4934417	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr16:4934417G>T	ENST00000345988.2	-	22	4328	c.4239C>A	c.(4237-4239)cgC>cgA	p.R1413R	PPL_ENST00000590782.2_Silent_p.R1411R	NM_002705.4	NP_002696	O60437	PEPL_HUMAN	periplakin	1413					keratinization (GO:0031424)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(6)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(12)|lung(12)|ovary(4)|prostate(5)|skin(3)|stomach(1)|urinary_tract(2)	62						CGGCCTCCCTGCGGGCCTGCC	0.692																																					p.R1413R													.	PPL	168		0			c.C4239A												27.0	30.0	29.0					16																	4934417		2100	4204	6304	SO:0001819	synonymous_variant	5493	exon22			CTCCCTGCGGGCC	AF013717	CCDS10526.1	16p13.3	2008-02-05			ENSG00000118898	ENSG00000118898			9273	protein-coding gene	gene with protein product		602871				9570964, 9521878	Standard	NM_002705		Approved		uc002cyd.1	O60437	OTTHUMG00000129528	ENST00000345988.2:c.4239C>A	16.37:g.4934417G>T			56	0	0		47	0.06	3	NM_002705	0		0	O60314|O60454|Q14C98	Silent	SNP	ENST00000345988.2	37	CCDS10526.1																																																																																					0.692	PPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000251715.1		NM_002705	
ABCC12	94160	mdanderson.org	37	16	48180307	48180307	+	Nonsense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr16:48180307G>T	ENST00000311303.3	-	1	374	c.29C>A	c.(28-30)tCa>tAa	p.S10*	ABCC12_ENST00000448542.1_Nonsense_Mutation_p.S10*|ABCC12_ENST00000416054.1_Nonsense_Mutation_p.S10*	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	10						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GTCCAGATCTGAGATAAGGTA	0.557																																					p.S10X													.	.			0			c.C29A												109.0	97.0	101.0					16																	48180307		2201	4300	6501	SO:0001587	stop_gained	94160	exon1			AGATCTGAGATAA	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.29C>A	16.37:g.48180307G>T	ENSP00000311030:p.Ser10*		75	0.0133333333	1		44	0.07	3	NM_033226	0		0	Q49AL2|Q8TAF0|Q8TEY2	Nonsense_Mutation	SNP	ENST00000311303.3	37	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	G	36	5.903651	0.97087	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054;ENST00000527640	.	.	.	5.41	5.41	0.78517	.	0.267128	0.31010	N	0.008439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6957	0.69121	0.0:0.0:1.0:0.0	.	.	.	.	X	10	.	ENSP00000311030:S10X	S	-	2	0	ABCC12	46737808	0.998000	0.40836	0.999000	0.59377	0.965000	0.64279	4.108000	0.57817	2.499000	0.84300	0.609000	0.83330	TCA			0.557	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000256837.1		NM_033226	
ARL2BP	23568	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	16	57283712	57283712	+	Silent	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr16:57283712C>T	ENST00000219204.3	+	4	511	c.241C>T	c.(241-243)Ctg>Ttg	p.L81L	ARL2BP_ENST00000562023.1_Silent_p.L41L|RP11-407G23.3_ENST00000564376.1_RNA|RP11-407G23.4_ENST00000562409.1_RNA	NM_012106.3	NP_036238.1	Q9Y2Y0	AR2BP_HUMAN	ADP-ribosylation factor-like 2 binding protein	81					maintenance of protein location in nucleus (GO:0051457)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of catalytic activity (GO:0050790)|regulation of RNA biosynthetic process (GO:2001141)|signal transduction (GO:0007165)	centrosome (GO:0005813)|cilium (GO:0005929)|midbody (GO:0030496)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	small GTPase regulator activity (GO:0005083)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|urinary_tract(1)	12						TGAAGAACAGCTGCTGCAGCG	0.398																																					p.L81L													.	.			0			c.C241T												148.0	147.0	147.0					16																	57283712		2198	4300	6498	SO:0001819	synonymous_variant	23568	exon4			GAACAGCTGCTGC	AF126062	CCDS10776.1	16q13	2014-01-30			ENSG00000102931	ENSG00000102931			17146	protein-coding gene	gene with protein product	"""binder of Arl2"""	615407	"""retinitis pigmentosa 66 (autosomal recessive)"""	RP66		10488091, 18981177, 23849777	Standard	NM_012106		Approved	BART1, BART	uc002elf.1	Q9Y2Y0	OTTHUMG00000133459	ENST00000219204.3:c.241C>T	16.37:g.57283712C>T			62	0	0		58	0.12	7	NM_012106	7	0.00	0	B3KQJ5|Q504R0	Silent	SNP	ENST00000219204.3	37	CCDS10776.1																																																																																					0.398	ARL2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257334.2		NM_012106	
GALNS	2588	mdanderson.org	37	16	88884506	88884506	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr16:88884506G>T	ENST00000268695.5	-	13	1479	c.1391C>A	c.(1390-1392)gCc>gAc	p.A464D	GALNS_ENST00000542788.1_Missense_Mutation_p.A389D	NM_000512.4	NP_000503.1	P34059	GALNS_HUMAN	galactosamine (N-acetyl)-6-sulfatase	464					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)|N-acetylgalactosamine-6-sulfatase activity (GO:0043890)|sulfuric ester hydrolase activity (GO:0008484)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(8)	22				BRCA - Breast invasive adenocarcinoma(80;0.0496)		CCTGCTGAGGGCCTCCTGGTA	0.667																																					p.A464D	GBM(129;1929 2344 25209 33204)												.	.			0			c.C1391A												59.0	45.0	50.0					16																	88884506		2180	4284	6464	SO:0001583	missense	2588	exon13			CTGAGGGCCTCCT	D17629	CCDS10970.1	16q24.3	2014-07-03	2014-07-03		ENSG00000141012	ENSG00000141012	3.1.6.4	"""Arylsulfatase family"""	4122	protein-coding gene	gene with protein product	"""Morquio syndrome"", ""mucopolysaccharidosis type IVA"""	612222	"""galactosamine (N-acetyl)-6-sulfate sulfatase"""			1755850	Standard	NM_000512		Approved	GAS, GALNAC6S	uc002fly.4	P34059	OTTHUMG00000137862	ENST00000268695.5:c.1391C>A	16.37:g.88884506G>T	ENSP00000268695:p.Ala464Asp		27	0	0		18	0.11	2	NM_000512	19	0.00	0	Q86VK3	Missense_Mutation	SNP	ENST00000268695.5	37	CCDS10970.1	.	.	.	.	.	.	.	.	.	.	G	16.55	3.154232	0.57259	.	.	ENSG00000141012	ENST00000268695;ENST00000542788	D;D	0.90133	-2.62;-2.62	5.11	1.88	0.25563	Alkaline-phosphatase-like, core domain (1);	0.382396	0.28784	N	0.014148	D	0.87589	0.6215	L	0.52573	1.65	0.09310	N	0.999996	P;P	0.52577	0.954;0.954	P;P	0.46758	0.526;0.526	T	0.79150	-0.1922	10	0.42905	T	0.14	.	8.4753	0.33009	0.3547:0.0:0.6453:0.0	.	464;464	B2R6P1;P34059	.;GALNS_HUMAN	D	464;389	ENSP00000268695:A464D;ENSP00000438197:A389D	ENSP00000268695:A464D	A	-	2	0	GALNS	87412007	0.002000	0.14202	0.029000	0.17559	0.038000	0.13279	0.192000	0.17096	0.125000	0.18397	-0.379000	0.06801	GCC			0.667	GALNS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000269543.1			
POLR2A	5430	ucsc.edu	37	17	7415174	7415174	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic		WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:7415174G>T	ENST00000322644.6	+	25	4545	c.4146G>T	c.(4144-4146)ctG>ctT	p.L1382L		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	1382					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)	p.L1382L(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				AGCGGGAGCTGTACCACGTCA	0.587																																					p.L1382L													POLR2A,NS,carcinoma,0,1	POLR2A	157	1	1	Substitution - coding silent(1)	kidney(1)	c.G4146T												138.0	117.0	124.0					17																	7415174		2203	4300	6503	SO:0001819	synonymous_variant	5430	exon25			GGAGCTGTACCAC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.4146G>T	17.37:g.7415174G>T			57	0	0		44	0.09	4	NM_000937	12	0.00	0	A6NN93|B9EH88|Q6NX41	Silent	SNP	ENST00000322644.6	37	CCDS32548.1																																																																																					0.587	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000437967.1		NM_000937	
MYH13	8735	mdanderson.org	37	17	10204986	10204986	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:10204986C>T	ENST00000418404.3	-	39	5865	c.5702G>A	c.(5701-5703)cGg>cAg	p.R1901Q	MYH13_ENST00000252172.4_Missense_Mutation_p.R1901Q|RP11-401O9.4_ENST00000609088.1_RNA			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1901					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)	p.R1901L(2)		breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTGGACTCTCCGGCATCTGGA	0.627																																					p.R1901Q													MYH13_ENST00000252172,NS,carcinoma,0,6	MYH13_ENST00000252172	0	6	2	Substitution - Missense(2)	lung(2)	c.G5702A												53.0	57.0	56.0					17																	10204986		2203	4300	6503	SO:0001583	missense	8735	exon40			ACTCTCCGGCATC	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.5702G>A	17.37:g.10204986C>T	ENSP00000404570:p.Arg1901Gln		42	0	0		23	0.13	3	NM_003802	19	0.00	0	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	37	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	C	33	5.274421	0.95459	.	.	ENSG00000006788	ENST00000252172	D	0.84873	-1.91	3.76	3.76	0.43208	Myosin tail (1);	.	.	.	.	D	0.95242	0.8457	H	0.98256	4.185	0.38704	D	0.953053	D	0.89917	1.0	D	0.97110	1.0	D	0.98256	1.0496	9	0.87932	D	0	.	16.1271	0.81402	0.0:1.0:0.0:0.0	.	1901	Q9UKX3	MYH13_HUMAN	Q	1901	ENSP00000252172:R1901Q	ENSP00000252172:R1901Q	R	-	2	0	MYH13	10145711	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	7.564000	0.82326	2.097000	0.63578	0.484000	0.47621	CGG			0.627	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442255.1		NM_003802	
CNP	1267	mdanderson.org	37	17	40125922	40125922	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:40125922C>T	ENST00000393892.3	+	4	1390	c.1246C>T	c.(1246-1248)Cag>Tag	p.Q416*	CNP_ENST00000393888.1_Nonsense_Mutation_p.Q396*|CNP_ENST00000591072.1_Nonsense_Mutation_p.Q181*|CNP_ENST00000472031.1_3'UTR	NM_033133.4	NP_149124.3	P09543	CN37_HUMAN	2',3'-cyclic nucleotide 3' phosphodiesterase	416					adult locomotory behavior (GO:0008344)|aging (GO:0007568)|axonogenesis (GO:0007409)|cyclic nucleotide catabolic process (GO:0009214)|microtubule cytoskeleton organization (GO:0000226)|oligodendrocyte differentiation (GO:0048709)|regulation of mitochondrial membrane permeability (GO:0046902)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule (GO:0005874)|microvillus (GO:0005902)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|myelin sheath abaxonal region (GO:0035748)|myelin sheath adaxonal region (GO:0035749)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	2',3'-cyclic-nucleotide 3'-phosphodiesterase activity (GO:0004113)|cyclic nucleotide binding (GO:0030551)|RNA binding (GO:0003723)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	9		all_cancers(22;2.38e-06)|all_epithelial(22;6.79e-05)|Breast(137;0.000143)		UCEC - Uterine corpus endometrioid carcinoma (308;0.171)		GGGCGCCTTGCAGTCCTGCAC	0.567																																					p.Q416X													.	.			0			c.C1246T												33.0	37.0	36.0					17																	40125922		1964	4141	6105	SO:0001587	stop_gained	1267	exon4			GCCTTGCAGTCCT		CCDS11414.2	17q21	2008-02-05			ENSG00000173786	ENSG00000173786	3.1.4.37		2158	protein-coding gene	gene with protein product		123830				1322358	Standard	XM_006721701		Approved		uc002hyl.1	P09543	OTTHUMG00000133502	ENST00000393892.3:c.1246C>T	17.37:g.40125922C>T	ENSP00000377470:p.Gln416*		9	0	0		17	0.12	2	NM_033133	42	0.00	0		Nonsense_Mutation	SNP	ENST00000393892.3	37	CCDS11414.2	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000402	0.74818	.	.	ENSG00000173786	ENST00000393892;ENST00000310262;ENST00000393888	.	.	.	5.19	4.21	0.49690	.	0.355194	0.20558	N	0.089975	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-25.7495	7.287	0.26344	0.2062:0.7062:0.0:0.0876	.	.	.	.	X	416;292;396	.	ENSP00000309643:Q292X	Q	+	1	0	CNP	37379448	0.981000	0.34729	0.970000	0.41538	0.802000	0.45316	2.416000	0.44644	2.426000	0.82243	0.561000	0.74099	CAG			0.567	CNP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257443.2			
VPS25	84313	broad.mit.edu	37	17	40925483	40925484	+	De_novo_Start_InFrame	INS	-	-	GGCTACTACGAT			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:40925483_40925484insGGCTACTACGAT	ENST00000253794.2	+	0	30_31					NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)						endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		CGGGTTTCCTGGGCTACTACGA	0.589																																					.													.	VPS25	11		0			.																																											84313	.			TTTCCTGGGCTAC	AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1			17.37:g.40925483_40925484insGGCTACTACGAT			138	0	0		115	0.10	12	.	11	0.00	0	B2R581	Translation_Start_Site	INS	ENST00000253794.2	37	CCDS11438.1																																																																																					0.589	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000452383.1		NM_032353	
HELZ	9931	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	17	65119087	65119087	+	Splice_Site	SNP	G	G	C			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:65119087G>C	ENST00000358691.5	-	26	3795	c.3629C>G	c.(3628-3630)cCt>cGt	p.P1210R	HELZ_ENST00000580168.1_Splice_Site_p.P1211R	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	1210						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					TCCACTTACAGGTAAAGGCAC	0.368																																					p.P1210R													.	.			0			c.C3629G												107.0	98.0	101.0					17																	65119087		1842	4090	5932	SO:0001630	splice_region_variant	9931	exon26			CTTACAGGTAAAG	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.3630+1C>G	17.37:g.65119087G>C			88	0	0		93	0.18	17	NM_014877	8	0.75	6	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	37	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.671958	0.47781	.	.	ENSG00000198265	ENST00000358691	D	0.85258	-1.96	5.51	5.51	0.81932	.	0.155894	0.64402	D	0.000014	D	0.89791	0.6817	L	0.47716	1.5	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.63597	0.916;0.916	D	0.89788	0.3966	10	0.59425	D	0.04	-5.4562	19.7791	0.96410	0.0:0.0:1.0:0.0	.	1211;1210	B7ZLW2;P42694	.;HELZ_HUMAN	R	1210	ENSP00000351524:P1210R	ENSP00000351524:P1210R	P	-	2	0	HELZ	62549549	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.283000	0.78640	2.737000	0.93849	0.655000	0.94253	CCT			0.368	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000447068.1		NM_014877	Missense_Mutation
GALK1	2584	mdanderson.org	37	17	73759111	73759111	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr17:73759111G>T	ENST00000588479.1	-	4	1169	c.595C>A	c.(595-597)Ctg>Atg	p.L199M	GALK1_ENST00000437911.1_Missense_Mutation_p.L229M|GALK1_ENST00000225614.2_Missense_Mutation_p.L199M			P51570	GALK1_HUMAN	galactokinase 1	199					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCAATGAGCAGCGCGTGGCCT	0.652																																					p.L199M													.	.			0			c.C595A												59.0	48.0	51.0					17																	73759111		2203	4300	6503	SO:0001583	missense	2584	exon4			TGAGCAGCGCGTG		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.595C>A	17.37:g.73759111G>T	ENSP00000465930:p.Leu199Met		42	0	0		31	0.10	3	NM_000154	35	0.00	0	B2RC07|B4E1G6	Missense_Mutation	SNP	ENST00000588479.1	37	CCDS11728.1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.857458	0.32791	.	.	ENSG00000108479	ENST00000225614;ENST00000437911;ENST00000375188	D;D	0.85088	-1.94;-1.94	5.53	3.54	0.40534	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.068084	0.64402	D	0.000011	D	0.82981	0.5155	L	0.48174	1.505	0.46356	D	0.999009	P	0.40180	0.705	P	0.45913	0.497	T	0.79600	-0.1736	10	0.40728	T	0.16	-3.6497	10.3777	0.44092	0.2116:0.0:0.7884:0.0	.	199	P51570	GALK1_HUMAN	M	199;229;302	ENSP00000225614:L199M;ENSP00000406305:L229M	ENSP00000225614:L199M	L	-	1	2	GALK1	71270706	0.855000	0.29742	0.991000	0.47740	0.794000	0.44872	1.316000	0.33620	0.710000	0.31997	0.555000	0.69702	CTG			0.652	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000448430.1			
TMEM200C	645369	mdanderson.org	37	18	5892041	5892041	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr18:5892041G>T	ENST00000581347.2	-	3	667	c.22C>A	c.(22-24)Cta>Ata	p.L8I	RP11-945C19.4_ENST00000582939.1_RNA|TMEM200C_ENST00000383490.2_Missense_Mutation_p.L8I|RP11-945C19.4_ENST00000577694.1_RNA|RP11-945C19.4_ENST00000580845.1_RNA			A6NKL6	T200C_HUMAN	transmembrane protein 200C	8						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)	12						GAAATCCTTAGCAGGCCGCCG	0.627																																					p.L8I													.	.			0			c.C22A												39.0	41.0	41.0					18																	5892041		2010	4186	6196	SO:0001583	missense	645369	exon1			TCCTTAGCAGGCC		CCDS45825.1	18p11.31	2009-09-08			ENSG00000206432	ENSG00000206432			37208	protein-coding gene	gene with protein product						15722956	Standard	NM_001080209		Approved	TTMA	uc002kmx.1	A6NKL6		ENST00000581347.2:c.22C>A	18.37:g.5892041G>T	ENSP00000463375:p.Leu8Ile		36	0	0		20	0.10	2	NM_001080209	2	0.00	0		Missense_Mutation	SNP	ENST00000581347.2	37	CCDS45825.1	.	.	.	.	.	.	.	.	.	.	G	16.58	3.162741	0.57368	.	.	ENSG00000206432	ENST00000383490	.	.	.	4.83	3.0	0.34707	.	0.000000	0.64402	D	0.000004	T	0.46927	0.1418	N	0.12182	0.205	0.39894	D	0.973801	D	0.89917	1.0	D	0.87578	0.998	T	0.37934	-0.9684	9	0.10636	T	0.68	-13.8643	8.7918	0.34854	0.3023:0.0:0.6977:0.0	.	8	A6NKL6	T200C_HUMAN	I	8	.	ENSP00000372982:L8I	L	-	1	2	TMEM200C	5882041	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.463000	0.53050	1.155000	0.42497	-0.252000	0.11476	CTA			0.627	TMEM200C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000441917.4		NM_001080209	
LAMA1	284217	mdanderson.org	37	18	7040215	7040215	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr18:7040215G>T	ENST00000389658.3	-	10	1375	c.1282C>A	c.(1282-1284)Cca>Aca	p.P428T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	428	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TCCTTACATGGGCACTGACCT	0.478																																					p.P428T													.	.			0			c.C1282A												137.0	124.0	128.0					18																	7040215		2203	4300	6503	SO:0001583	missense	284217	exon10			TACATGGGCACTG	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1282C>A	18.37:g.7040215G>T	ENSP00000374309:p.Pro428Thr		62	0.0161290323	1		38	0.08	3	NM_005559	0		0		Missense_Mutation	SNP	ENST00000389658.3	37	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	11.14	1.550132	0.27652	.	.	ENSG00000101680	ENST00000389658	T	0.61158	0.13	5.32	4.44	0.53790	EGF-like, laminin (4);	0.599178	0.17344	N	0.177625	T	0.45597	0.1350	L	0.44542	1.39	0.31279	N	0.690811	P	0.40731	0.728	B	0.34590	0.186	T	0.48258	-0.9051	10	0.09338	T	0.73	.	15.6986	0.77521	0.0:0.1487:0.8513:0.0	.	428	P25391	LAMA1_HUMAN	T	428	ENSP00000374309:P428T	ENSP00000374309:P428T	P	-	1	0	LAMA1	7030215	0.999000	0.42202	0.963000	0.40424	0.882000	0.50991	2.455000	0.44988	1.452000	0.47756	0.655000	0.94253	CCA			0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000257369.1		NM_005559	
C19orf35	374872	mdanderson.org	37	19	2278645	2278645	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:2278645C>T	ENST00000342063.3	-	3	643	c.550G>A	c.(550-552)Gac>Aac	p.D184N		NM_198532.2	NP_940934.1	Q6ZS72	CS035_HUMAN	chromosome 19 open reading frame 35	184										large_intestine(1)|lung(5)|pancreas(1)|prostate(1)	8				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACAGGGCGTCCCCGCTCTCT	0.721																																					p.D184N													.	.			0			c.G550A												22.0	21.0	22.0					19																	2278645		2191	4287	6478	SO:0001583	missense	374872	exon3			GGGCGTCCCCGCT	AK127680	CCDS12087.1	19p13.3	2012-10-26			ENSG00000188305	ENSG00000188305			24793	protein-coding gene	gene with protein product							Standard	NM_198532		Approved	FLJ45778	uc002lvn.2	Q6ZS72	OTTHUMG00000178460	ENST00000342063.3:c.550G>A	19.37:g.2278645C>T	ENSP00000345102:p.Asp184Asn		30	0	0		21	0.14	3	NM_198532	1	0.00	0		Missense_Mutation	SNP	ENST00000342063.3	37	CCDS12087.1	.	.	.	.	.	.	.	.	.	.	C	11.36	1.616969	0.28801	.	.	ENSG00000188305	ENST00000342063	T	0.28255	1.62	4.37	3.33	0.38152	.	.	.	.	.	T	0.31888	0.0811	M	0.72894	2.215	0.27788	N	0.942934	P	0.40909	0.732	B	0.37091	0.241	T	0.23048	-1.0199	9	0.72032	D	0.01	.	9.1142	0.36746	0.0:0.8945:0.0:0.1055	.	184	Q6ZS72	CS035_HUMAN	N	184	ENSP00000345102:D184N	ENSP00000345102:D184N	D	-	1	0	C19orf35	2229645	0.295000	0.24389	0.410000	0.26471	0.099000	0.18886	1.732000	0.38146	0.807000	0.34208	0.448000	0.29417	GAC			0.721	C19orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000442080.1		NM_198532	
MAP2K2	5605	broad.mit.edu	37	19	4090612	4090612	+	Missense_Mutation	SNP	G	G	T	rs117945277		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:4090612G>T	ENST00000262948.5	-	11	1440	c.1187C>A	c.(1186-1188)aCg>aAg	p.T396K	MAP2K2_ENST00000394867.4_Missense_Mutation_p.T299K	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	396					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	GGCGGTGCGCGTGGGTGTGCC	0.652																																					p.T396K													.	MAP2K2	72		0			c.C1187A												21.0	16.0	18.0					19																	4090612		2150	4200	6350	SO:0001583	missense	5605	exon11			GTGCGCGTGGGTG	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.1187C>A	19.37:g.4090612G>T	ENSP00000262948:p.Thr396Lys		124	0	0		102	0.03	3	NM_030662	933	0.00	1		Missense_Mutation	SNP	ENST00000262948.5	37	CCDS12120.1	.	.	.	.	.	.	.	.	.	.	g	16.19	3.053134	0.55218	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	T;T	0.79141	-1.06;-1.24	3.47	3.47	0.39725	.	0.134314	0.50627	D	0.000119	T	0.81912	0.4923	L	0.58669	1.825	0.58432	D	0.999996	D	0.63880	0.993	P	0.58391	0.838	T	0.80839	-0.1203	10	0.32370	T	0.25	-21.4969	14.0581	0.64781	0.0:0.0:1.0:0.0	.	396	P36507	MP2K2_HUMAN	K	396;299	ENSP00000262948:T396K;ENSP00000378336:T299K	ENSP00000262948:T396K	T	-	2	0	MAP2K2	4041612	1.000000	0.71417	0.874000	0.34290	0.208000	0.24298	9.234000	0.95347	1.945000	0.56424	0.591000	0.81541	ACG			0.652	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000258957.2			
ZNF653	115950	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	19	11597957	11597957	+	Silent	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:11597957G>A	ENST00000293771.5	-	5	1324	c.1188C>T	c.(1186-1188)tgC>tgT	p.C396C	CTC-398G3.6_ENST00000585656.1_Intron	NM_138783.3	NP_620138.2	Q96CK0	ZN653_HUMAN	zinc finger protein 653	396					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	17						TCTTTAGCAAGCACAGGTCCT	0.662																																					p.C396C	Pancreas(83;980 1446 4542 6441 43352)												.	.			0			c.C1188T												67.0	76.0	73.0					19																	11597957		2203	4300	6503	SO:0001819	synonymous_variant	115950	exon5			TAGCAAGCACAGG	AY072704	CCDS12261.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"""	25196	protein-coding gene	gene with protein product		611371				12477932	Standard	NM_138783		Approved	Zip67	uc002mrz.2	Q96CK0		ENST00000293771.5:c.1188C>T	19.37:g.11597957G>A			47	0	0		51	0.37	19	NM_138783	21	0.48	10	Q96AS7	Silent	SNP	ENST00000293771.5	37	CCDS12261.1																																																																																					0.662	ZNF653-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000458836.2		NM_138783	
CYP4F11	57834	mdanderson.org	37	19	16025653	16025653	+	Missense_Mutation	SNP	G	G	A	rs374763718		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:16025653G>A	ENST00000402119.4	-	9	1594	c.1168C>T	c.(1168-1170)Cgg>Tgg	p.R390W	CYP4F11_ENST00000591841.1_Missense_Mutation_p.R65W|CYP4F11_ENST00000326742.8_Missense_Mutation_p.R390W|CYP4F11_ENST00000248041.8_Missense_Mutation_p.R390W	NM_021187.3	NP_067010.3			cytochrome P450, family 4, subfamily F, polypeptide 11											NS(1)|breast(3)|endometrium(4)|large_intestine(2)|lung(11)|ovary(1)|skin(3)	25						GGATGCAACCGCAGGCTCTCC	0.587																																					p.R390W													CYP4F11,right_upper_lobe,carcinoma,+1,1	CYP4F11	1	1	0			c.C1168T												88.0	91.0	90.0					19																	16025653		2203	4300	6503	SO:0001583	missense	57834	exon9			GCAACCGCAGGCT	AF236085	CCDS12337.1	19p13.1	2011-07-29	2003-01-14		ENSG00000171903	ENSG00000171903		"""Cytochrome P450s"""	13265	protein-coding gene	gene with protein product		611517	"""cytochrome P450, subfamily IVF, polypeptide 11"""			10964514, 9068972	Standard	NM_021187		Approved		uc002nbu.2	Q9HBI6		ENST00000402119.4:c.1168C>T	19.37:g.16025653G>A	ENSP00000384588:p.Arg390Trp		83	0	0		85	0.05	4	NM_021187	0		0		Missense_Mutation	SNP	ENST00000402119.4	37	CCDS12337.1	.	.	.	.	.	.	.	.	.	.	g	15.85	2.955793	0.53293	.	.	ENSG00000171903	ENST00000402119;ENST00000248041;ENST00000326742	D;D;D	0.97505	-4.41;-4.41;-4.41	2.74	1.54	0.23209	.	0.000000	0.64402	U	0.000003	D	0.98953	0.9644	H	0.99454	4.575	0.52501	D	0.999958	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97303	0.9932	10	0.87932	D	0	.	8.4361	0.32789	0.0:0.0:0.7684:0.2316	.	390;390	F8W978;Q9HBI6	.;CP4FB_HUMAN	W	390	ENSP00000384588:R390W;ENSP00000248041:R390W;ENSP00000319859:R390W	ENSP00000248041:R390W	R	-	1	2	CYP4F11	15886653	1.000000	0.71417	0.463000	0.27130	0.059000	0.15707	3.372000	0.52387	1.513000	0.48852	0.462000	0.41574	CGG			0.587	CYP4F11-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000460385.2		NM_021187	
LOC284395	284395	broad.mit.edu	37	19	29917557	29917558	+	RNA	INS	-	-	TGC	rs202133080|rs368580334		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:29917557_29917558insTGC	ENST00000582581.1	-	0	409					NR_040029.1																						AGATACTACAttgctgttgctg	0.436																																					.													.	.			0			.																																											0	.			ACTACATTGCTGT																													19.37:g.29917558_29917560dupTGC			3	0	0		10	0.40	4	.	0		0		RNA	INS	ENST00000582581.1	37																																																																																						0.436	CTC-525D6.1-001	KNOWN	basic	lincRNA	processed_transcript		OTTHUMT00000444111.1			
ZNF585A	199704	hgsc.bcm.edu	37	19	37643935	37643935	+	Missense_Mutation	SNP	C	C	T	rs368991030		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr19:37643935C>T	ENST00000356958.4	-	5	1124	c.866G>A	c.(865-867)cGa>cAa	p.R289Q	ZNF585A_ENST00000355533.2_Missense_Mutation_p.R234Q|ZNF585A_ENST00000392157.2_Missense_Mutation_p.R234Q|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000292841.5_Missense_Mutation_p.R234Q			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R234Q(1)		breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATGAATTCTTCGGTGTGCAAT	0.428																																					p.R234Q													ZNF585A,colon,carcinoma,0,1	ZNF585A	0	1	1	Substitution - Missense(1)	large_intestine(1)	c.G701A							C	GLN/ARG,GLN/ARG	0,4406		0,0,2203	238.0	222.0	227.0		701,701	0.9	1.0	19		227	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZNF585A	NM_152655.2,NM_199126.1	43,43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	234/715,234/715	37643935	1,13005	2203	4300	6503	SO:0001583	missense	199704	exon6			ATTCTTCGGTGTG	AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.866G>A	19.37:g.37643935C>T	ENSP00000349440:p.Arg289Gln		105	0	0		124	0.04	5	NM_199126	0		0	Q8TE95|Q96MV3	Missense_Mutation	SNP	ENST00000356958.4	37		.	.	.	.	.	.	.	.	.	.	C	0.795	-0.757467	0.03019	0.0	1.16E-4	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157;ENST00000355533	T;T;T;T	0.17691	2.26;2.26;2.26;2.26	3.06	0.872	0.19113	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.30723	N	0.009001	T	0.04137	0.0115	N	0.02412	-0.56	0.25530	N	0.98729	B	0.24186	0.099	B	0.21917	0.037	T	0.42050	-0.9474	10	0.02654	T	1	.	4.6809	0.12734	0.0:0.5832:0.0:0.4168	.	289	Q6P3V2	Z585A_HUMAN	Q	289;234;234;234	ENSP00000349440:R289Q;ENSP00000292841:R234Q;ENSP00000375998:R234Q;ENSP00000347724:R234Q	ENSP00000292841:R234Q	R	-	2	0	ZNF585A	42335775	0.000000	0.05858	0.988000	0.46212	0.176000	0.22953	-1.416000	0.02467	0.608000	0.30000	-0.291000	0.09656	CGA			0.428	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding		OTTHUMT00000457980.2		NM_152655	
PXDN	7837	mdanderson.org	37	2	1653131	1653131	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr2:1653131G>T	ENST00000252804.4	-	17	2471	c.2421C>A	c.(2419-2421)acC>acA	p.T807T		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	807					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CGGGTGTGACGGTCTCCGTCC	0.662																																					p.T807T													.	.			0			c.C2421A												59.0	70.0	66.0					2																	1653131		2172	4270	6442	SO:0001819	synonymous_variant	7837	exon17			TGTGACGGTCTCC	AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2421C>A	2.37:g.1653131G>T			69	0	0		53	0.06	3	NM_012293	0		0	A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	ENST00000252804.4	37	CCDS46221.1																																																																																					0.662	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000322505.1		XM_056455	
ATP6V1C2	245973	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	2	10908882	10908882	+	Missense_Mutation	SNP	C	C	T	rs201753402		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr2:10908882C>T	ENST00000272238.4	+	6	525	c.416C>T	c.(415-417)aCg>aTg	p.T139M	RP11-791G15.2_ENST00000606907.1_lincRNA|ATP6V1C2_ENST00000381661.3_Missense_Mutation_p.T139M	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	139					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		AAGTCCCGAACGGCCGCCTAC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17475	0.0		0.001	False		,,,				2504	0.0				p.T139M	NSCLC(188;1042 2136 10807 16813 47705)												.	.			0			c.C416T												67.0	73.0	71.0					2																	10908882		2203	4300	6503	SO:0001583	missense	245973	exon6			CCCGAACGGCCGC	AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.416C>T	2.37:g.10908882C>T	ENSP00000272238:p.Thr139Met		102	0	0		55	0.16	9	NM_001039362	0		0	Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	CCDS42653.1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	6.752	0.507554	0.12883	.	.	ENSG00000143882	ENST00000272238;ENST00000381661	T;T	0.43294	0.95;0.95	5.65	1.87	0.25490	.	0.434585	0.25272	N	0.031873	T	0.31949	0.0813	L	0.41961	1.31	0.20196	N	0.999927	B;B	0.18310	0.027;0.01	B;B	0.13407	0.005;0.009	T	0.23261	-1.0193	10	0.49607	T	0.09	-9.634	8.6486	0.34020	0.0:0.6879:0.0:0.3121	.	139;139	Q8NEY4-2;Q8NEY4	.;VATC2_HUMAN	M	139	ENSP00000272238:T139M;ENSP00000371077:T139M	ENSP00000272238:T139M	T	+	2	0	ATP6V1C2	10826333	0.024000	0.19004	0.002000	0.10522	0.009000	0.06853	1.528000	0.35985	0.350000	0.24002	0.655000	0.94253	ACG	0		0.532	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding		OTTHUMT00000323555.1		NM_144583	
DYNC2LI1	51626	mdanderson.org	37	2	44028793	44028793	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr2:44028793G>T	ENST00000260605.8	+	10	847	c.747G>T	c.(745-747)gtG>gtT	p.V249V	DYNC2LI1_ENST00000605786.1_Silent_p.V250V|DYNC2LI1_ENST00000443170.3_Silent_p.V123V	NM_001193464.1|NM_016008.3	NP_001180393.1|NP_057092.2	Q8TCX1	DC2L1_HUMAN	dynein, cytoplasmic 2, light intermediate chain 1	249					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)	apical part of cell (GO:0045177)|axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytosol (GO:0005829)|intraciliary transport particle (GO:0030990)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|primary cilium (GO:0072372)	motor activity (GO:0003774)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|skin(1)	26		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CAATATGTGTGGATCAGAATA	0.333																																					p.V250V													.	.			0			c.G750T												115.0	112.0	113.0					2																	44028793		2203	4300	6503	SO:0001819	synonymous_variant	51626	exon10			ATGTGTGGATCAG		CCDS1813.1, CCDS46270.1, CCDS62903.1	2p25.1-p24.1	2008-02-05			ENSG00000138036	ENSG00000138036		"""Cytoplasmic dyneins"""	24595	protein-coding gene	gene with protein product						10810093, 11907264	Standard	NM_016008		Approved	D2LIC, LIC3, CGI-60, DKFZP564A033	uc002rtl.3	Q8TCX1	OTTHUMG00000128656	ENST00000260605.8:c.747G>T	2.37:g.44028793G>T			63	0	0		48	0.06	3	NM_001193464	28	0.00	0	A8MVJ5|Q53F57|Q6PDB2|Q8IWA3|Q96B03|Q96J00|Q9Y370|Q9Y3S9	Silent	SNP	ENST00000260605.8	37	CCDS1813.1	.	.	.	.	.	.	.	.	.	.	G	9.483	1.098543	0.20552	.	.	ENSG00000138036	ENST00000378587	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	T	0.64735	0.2625	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61734	-0.7002	4	.	.	.	-12.7159	12.6157	0.56576	0.0747:0.0:0.9253:0.0	.	.	.	.	L	233	.	.	W	+	2	0	DYNC2LI1	43882297	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.693000	0.54735	2.793000	0.96121	0.655000	0.94253	TGG			0.333	DYNC2LI1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000250536.2		NM_016008	
SMYD1	150572	mdanderson.org	37	2	88367450	88367450	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr2:88367450G>T	ENST00000419482.2	+	1	152	c.67G>T	c.(67-69)Gcc>Tcc	p.A23S	SMYD1_ENST00000438570.1_Missense_Mutation_p.A23S|SMYD1_ENST00000444564.2_Missense_Mutation_p.A23S	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	23	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						GGGTCTGAAGGCCACCAAGGA	0.527																																					p.A23S													.	.			0			c.G67T												206.0	230.0	222.0					2																	88367450		2203	4300	6503	SO:0001583	missense	150572	exon1			CTGAAGGCCACCA	AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.67G>T	2.37:g.88367450G>T	ENSP00000393453:p.Ala23Ser		137	0	0		74	0.05	4	NM_198274	0		0	A0AV30|A6NE13	Missense_Mutation	SNP	ENST00000419482.2	37	CCDS33240.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852664	0.91355	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000438570	D;D;T	0.90844	-2.74;-2.74;1.53	5.85	4.04	0.47022	SET domain (2);	0.000000	0.85682	D	0.000000	D	0.92211	0.7530	L	0.58354	1.805	0.44214	D	0.997041	P;P	0.46512	0.879;0.862	P;P	0.56916	0.809;0.781	D	0.91185	0.4979	10	0.39692	T	0.17	-15.2937	12.3392	0.55085	0.1388:0.0:0.8612:0.0	.	23;23	Q8NB12;C9JUP3	SMYD1_HUMAN;.	S	23	ENSP00000393453:A23S;ENSP00000407888:A23S;ENSP00000387482:A23S	ENSP00000393453:A23S	A	+	1	0	SMYD1	88148565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.720000	0.74723	1.465000	0.48006	0.655000	0.94253	GCC			0.527	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000338229.2		XM_097915	
CNPPD1	27013	mdanderson.org	37	2	220040955	220040955	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr2:220040955G>T	ENST00000409789.1	-	3	595	c.168C>A	c.(166-168)agC>agA	p.S56R	CNPPD1_ENST00000360507.5_Missense_Mutation_p.S56R|FAM134A_ENST00000430297.2_5'Flank			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	56					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						CTGCCACCGGGCTGGAGAGCT	0.572																																					p.S56R													.	.			0			c.C168A												61.0	61.0	61.0					2																	220040955		2203	4300	6503	SO:0001583	missense	27013	exon2			CACCGGGCTGGAG	AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.168C>A	2.37:g.220040955G>T	ENSP00000386277:p.Ser56Arg		57	0	0		47	0.06	3	NM_015680	32	0.00	0	B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	ENST00000409789.1	37	CCDS2433.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.200071	0.58126	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038;ENST00000451647	T;T;T	0.32988	2.37;2.37;1.43	4.54	3.65	0.41850	.	0.136996	0.64402	D	0.000003	T	0.19805	0.0476	L	0.27053	0.805	0.80722	D	1	B	0.26744	0.158	B	0.26770	0.073	T	0.05354	-1.0890	10	0.22109	T	0.4	-21.6505	10.2172	0.43175	0.1628:0.0:0.8372:0.0	.	56	Q9BV87	CNPD1_HUMAN	R	56	ENSP00000353698:S56R;ENSP00000386277:S56R;ENSP00000410109:S56R	ENSP00000353698:S56R	S	-	3	2	CNPPD1	219749199	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.949000	0.40313	1.241000	0.43820	0.655000	0.94253	AGC			0.572	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000336220.1		NM_015680	
CHGB	1114	mdanderson.org	37	20	5903989	5903989	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr20:5903989G>T	ENST00000378961.4	+	4	1403	c.1199G>T	c.(1198-1200)gGa>gTa	p.G400V		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	400						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						ATGGCACATGGATATGGTGAA	0.532																																					p.G400V													.	.			0			c.G1199T												104.0	104.0	104.0					20																	5903989		2203	4300	6503	SO:0001583	missense	1114	exon4			CACATGGATATGG		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1199G>T	20.37:g.5903989G>T	ENSP00000368244:p.Gly400Val		30	0	0		16	0.19	3	NM_001819	2	0.00	0	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	ENST00000378961.4	37	CCDS13092.1	.	.	.	.	.	.	.	.	.	.	G	8.909	0.958165	0.18507	.	.	ENSG00000089199	ENST00000378961	T	0.01584	4.75	5.78	2.35	0.29111	.	1.135390	0.06540	N	0.743117	T	0.05364	0.0142	L	0.57536	1.79	0.09310	N	1	D	0.54397	0.966	P	0.52109	0.69	T	0.46219	-0.9207	10	0.45353	T	0.12	-0.9551	10.237	0.43288	0.2574:0.0:0.7426:0.0	.	400	P05060	SCG1_HUMAN	V	400	ENSP00000368244:G400V	ENSP00000368244:G400V	G	+	2	0	CHGB	5851989	0.263000	0.24083	0.001000	0.08648	0.010000	0.07245	1.748000	0.38308	0.788000	0.33755	-0.140000	0.14226	GGA			0.532	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000077897.2		NM_001819	
ADAMTS5	11096	broad.mit.edu;mdanderson.org	37	21	28296507	28296507	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr21:28296507G>T	ENST00000284987.5	-	8	2779	c.2658C>A	c.(2656-2658)gcC>gcA	p.A886A	AP001601.2_ENST00000426771.1_RNA	NM_007038.3	NP_008969.2	Q9UNA0	ATS5_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 5	886	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	72						TCCTAGAGCAGGCGAGCCATG	0.542																																					p.A886A	Esophageal Squamous(53;683 1080 10100 14424 45938)												.	ADAMTS5	184		0			c.C2658A												85.0	77.0	80.0					21																	28296507		2203	4300	6503	SO:0001819	synonymous_variant	11096	exon8			AGAGCAGGCGAGC	AF142099	CCDS13579.1	21q21.3	2008-07-31	2008-07-31		ENSG00000154736	ENSG00000154736		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	221	protein-coding gene	gene with protein product	"""aggrecanase-2"""	605007	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)"""			10438522	Standard	NM_007038		Approved	ADMP-2, ADAMTS11	uc002ymg.3	Q9UNA0	OTTHUMG00000078686	ENST00000284987.5:c.2658C>A	21.37:g.28296507G>T			83	0	0		80	0.05	4	NM_007038	0		0	Q52LV4|Q9UKP2	Silent	SNP	ENST00000284987.5	37	CCDS13579.1																																																																																					0.542	ADAMTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000171648.1			
OSBP2	23762	mdanderson.org	37	22	31091149	31091149	+	Nonsense_Mutation	SNP	G	G	T	rs375188093		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr22:31091149G>T	ENST00000332585.6	+	1	357	c.253G>T	c.(253-255)Gag>Tag	p.E85*	OSBP2_ENST00000382310.3_Nonsense_Mutation_p.E85*|OSBP2_ENST00000407373.1_Intron|OSBP2_ENST00000403222.3_Intron|OSBP2_ENST00000446658.2_Nonsense_Mutation_p.E85*	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	85					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						ACCTGTGTCCGAGACGACGTC	0.692																																					p.E85X													.	.			0			c.G253T												29.0	38.0	35.0					22																	31091149		2149	4259	6408	SO:0001587	stop_gained	23762	exon1			GTGTCCGAGACGA		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.253G>T	22.37:g.31091149G>T	ENSP00000332576:p.Glu85*		79	0	0		37	0.08	3	NM_030758	0		0	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Nonsense_Mutation	SNP	ENST00000332585.6	37	CCDS43002.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.038035	0.75617	.	.	ENSG00000184792	ENST00000332585;ENST00000382310;ENST00000446658	.	.	.	3.3	-3.62	0.04543	.	2.795030	0.01206	N	0.007710	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-3.7675	7.1795	0.25763	0.2132:0.528:0.2588:0.0	.	.	.	.	X	85	.	ENSP00000332576:E85X	E	+	1	0	OSBP2	29421149	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.342000	0.07801	-0.571000	0.06014	-0.211000	0.12701	GAG			0.692	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000321547.2		NM_030758	
SOX10	6663	mdanderson.org	37	22	38369790	38369790	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr22:38369790G>T	ENST00000396884.2	-	4	1395	c.1113C>A	c.(1111-1113)gaC>gaA	p.D371E	SOX10_ENST00000360880.2_Missense_Mutation_p.D371E|POLR2F_ENST00000407936.1_Intron|POLR2F_ENST00000405557.1_Intron	NM_006941.3	NP_008872.1	P56693	SOX10_HUMAN	SRY (sex determining region Y)-box 10	371					anatomical structure morphogenesis (GO:0009653)|cell maturation (GO:0048469)|developmental growth (GO:0048589)|digestive tract morphogenesis (GO:0048546)|enteric nervous system development (GO:0048484)|in utero embryonic development (GO:0001701)|melanocyte differentiation (GO:0030318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system development (GO:0007422)|positive regulation of gliogenesis (GO:0014015)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	extrinsic component of mitochondrial outer membrane (GO:0031315)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|transcription coactivator activity (GO:0003713)			NS(6)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|skin(2)	20	Melanoma(58;0.045)					TGGATGGCTGGTCGGTGTAGT	0.652																																					p.D371E	Melanoma(39;342 1098 6220 32775 40068)|GBM(21;140 497 5227 16059 19275)												.	.			0			c.C1113A												78.0	79.0	79.0					22																	38369790		2203	4300	6503	SO:0001583	missense	6663	exon4			TGGCTGGTCGGTG		CCDS13964.1	22q13.1	2014-09-17			ENSG00000100146	ENSG00000100146		"""SRY (sex determining region Y)-boxes"""	11190	protein-coding gene	gene with protein product	"""dominant megacolon, mouse, human homolog of"""	602229				9462749, 10441344, 12944398	Standard	NM_006941		Approved	DOM, WS4, WS2E	uc003aun.1	P56693	OTTHUMG00000149913	ENST00000396884.2:c.1113C>A	22.37:g.38369790G>T	ENSP00000380093:p.Asp371Glu		50	0	0		32	0.09	3	NM_006941	0		0	B4DV62|Q6FHW7	Missense_Mutation	SNP	ENST00000396884.2	37	CCDS13964.1	.	.	.	.	.	.	.	.	.	.	G	1.564	-0.535856	0.04082	.	.	ENSG00000100146	ENST00000396884;ENST00000360880	T;T	0.71341	-0.56;-0.56	4.87	2.52	0.30459	.	0.115488	0.64402	D	0.000019	T	0.34687	0.0906	N	0.01668	-0.77	0.28439	N	0.916916	B	0.02656	0.0	B	0.04013	0.001	T	0.31833	-0.9929	10	0.02654	T	1	.	10.0021	0.41935	0.0776:0.3308:0.5916:0.0	.	371	P56693	SOX10_HUMAN	E	371	ENSP00000380093:D371E;ENSP00000354130:D371E	ENSP00000354130:D371E	D	-	3	2	SOX10	36699736	0.984000	0.35163	1.000000	0.80357	0.974000	0.67602	0.180000	0.16860	2.249000	0.74217	0.455000	0.32223	GAC			0.652	SOX10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000313875.1		NM_006941	
DDX17	10521	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	22	38895499	38895499	+	Missense_Mutation	SNP	C	C	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr22:38895499C>G	ENST00000396821.3	-	3	543	c.444G>C	c.(442-444)gaG>gaC	p.E148D	DDX17_ENST00000432525.1_5'UTR|DDX17_ENST00000381633.3_Missense_Mutation_p.E69D	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	148					ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					GCTCATCAACCTCATACTATT	0.403																																					p.E148D	Ovarian(55;1085 1454 6392 21425)												.	.			0			c.G444C												119.0	109.0	112.0					22																	38895499		2203	4300	6503	SO:0001583	missense	10521	exon3			ATCAACCTCATAC	U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.444G>C	22.37:g.38895499C>G	ENSP00000380033:p.Glu148Asp		98	0	0		105	0.17	18	NM_006386	7	0.00	0	B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	ENST00000396821.3	37	CCDS46706.1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.741883	0.30865	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.37752	1.18;1.18;1.18	5.44	3.11	0.35812	.	0.136644	0.64402	D	0.000003	T	0.28167	0.0695	L	0.51422	1.61	0.80722	D	1	B;B;B	0.20988	0.008;0.03;0.05	B;B;B	0.22386	0.016;0.039;0.027	T	0.08207	-1.0733	10	0.39692	T	0.17	-20.036	4.4568	0.11647	0.1509:0.5527:0.0:0.2965	.	69;150;148	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	D	148;69;148;150	ENSP00000380033:E148D;ENSP00000371046:E69D;ENSP00000385536:E148D	ENSP00000371046:E69D	E	-	3	2	DDX17	37225445	0.539000	0.26402	1.000000	0.80357	0.889000	0.51656	-0.289000	0.08365	0.492000	0.27815	-0.339000	0.08088	GAG			0.403	DDX17-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000321476.2		NM_030881	
FBLN1	2192	mdanderson.org	37	22	45958794	45958794	+	Intron	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr22:45958794G>A	ENST00000327858.6	+	15	1792				FBLN1_ENST00000262722.7_Missense_Mutation_p.R567H|FBLN1_ENST00000348697.2_Intron|FBLN1_ENST00000402984.3_Missense_Mutation_p.R605H|FBLN1_ENST00000442170.2_Intron	NM_006486.2	NP_006477	P23142	FBLN1_HUMAN	fibulin 1						embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|viral process (GO:0016032)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)|peptidase activator activity (GO:0016504)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)	30		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		TCTTGCAGCCGCTGTGAGCGC	0.612																																					p.R567H													.	.			0			c.G1700A												150.0	169.0	162.0					22																	45958794		2203	4300	6503	SO:0001627	intron_variant	2192	exon15			GCAGCCGCTGTGA		CCDS14067.1, CCDS14068.1, CCDS14069.1, CCDS43028.1	22q13.31	2010-06-15			ENSG00000077942	ENSG00000077942		"""Fibulins"""	3600	protein-coding gene	gene with protein product		135820				2269669, 1400330	Standard	NM_006485		Approved	FBLN	uc003bgj.1	P23142	OTTHUMG00000151340	ENST00000327858.6:c.1698-11597G>A	22.37:g.45958794G>A			38	0	0		28	0.11	3	NM_001996	325	0.00	0	B0QY42|B1AHL4|P23143|P23144|P37888|Q5TIC4|Q8TBH8|Q9HBQ5|Q9UC21|Q9UGR4|Q9UH41	Missense_Mutation	SNP	ENST00000327858.6	37	CCDS14067.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367828	0.82463	.	.	ENSG00000077942	ENST00000402984;ENST00000262722	D;D	0.92099	-2.26;-2.97	3.93	3.93	0.45458	.	.	.	.	.	D	0.95449	0.8522	M	0.85197	2.74	0.80722	D	1	D;D	0.71674	0.996;0.998	P;P	0.59424	0.794;0.857	D	0.95700	0.8748	9	0.49607	T	0.09	.	16.1134	0.81278	0.0:0.0:1.0:0.0	.	605;567	B1AHL2;P23142-4	.;.	H	605;567	ENSP00000385521:R605H;ENSP00000262722:R567H	ENSP00000262722:R567H	R	+	2	0	FBLN1	44337458	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.174000	0.77620	2.036000	0.60181	0.313000	0.20887	CGC			0.612	FBLN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding		OTTHUMT00000322287.1		NM_006486	
SLC51A	200931	mdanderson.org	37	3	195955103	195955103	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr3:195955103C>A	ENST00000296327.5	+	5	689	c.480C>A	c.(478-480)tgC>tgA	p.C160*		NM_152672.5	NP_689885.4	Q86UW1	OSTA_HUMAN	solute carrier family 51, alpha subunit	160	Poly-Cys.				bile acid and bile salt transport (GO:0015721)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)									Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)	CAGGCCCctgctgctgctgct	0.662																																					p.C160X													.	.			0			c.C480A												82.0	81.0	81.0					3																	195955103		2203	4300	6503	SO:0001587	stop_gained	200931	exon5			CCCCTGCTGCTGC		CCDS3314.1	3q29	2013-05-22			ENSG00000163959	ENSG00000163959		"""Solute carriers"""	29955	protein-coding gene	gene with protein product	"""organic solute transporter, alpha subunit"""	612084				12719432, 20538072	Standard	NM_152672		Approved	OSTalpha	uc003fwd.3	Q86UW1	OTTHUMG00000155684	ENST00000296327.5:c.480C>A	3.37:g.195955103C>A	ENSP00000296327:p.Cys160*		32	0	0		29	0.10	3	NM_152672	1	0.00	0	Q6ZMC7	Nonsense_Mutation	SNP	ENST00000296327.5	37	CCDS3314.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.9|20.9	4.072914|4.072914	0.76415|0.76415	.|.	.|.	ENSG00000163959|ENSG00000163959	ENST00000428985|ENST00000296327	.|.	.|.	.|.	5.5|5.5	2.68|2.68	0.31781|0.31781	.|.	.|0.000000	.|0.53938	.|D	.|0.000045	T|.	0.29588|.	0.0738|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.13548|.	-1.0505|.	4|.	.|0.02654	.|T	.|1	-22.3139|-22.3139	9.0682|9.0682	0.36475|0.36475	0.0:0.7099:0.0:0.2901|0.0:0.7099:0.0:0.2901	.|.	.|.	.|.	.|.	D|X	173|160	.|.	.|ENSP00000296327:C160X	A|C	+|+	2|3	0|2	AC069257.9|AC069257.9	197439500|197439500	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.753000|0.753000	0.42808|0.42808	1.296000|1.296000	0.33389|0.33389	0.868000|0.868000	0.35678|0.35678	-0.136000|-0.136000	0.14681|0.14681	GCT|TGC			0.662	SLC51A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000341253.1		NM_152672	
PPA2	27068	mdanderson.org	37	4	106367654	106367654	+	Silent	SNP	G	G	T	rs552337598		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr4:106367654G>T	ENST00000341695.5	-	5	357	c.327C>A	c.(325-327)gcC>gcA	p.A109A	PPA2_ENST00000357415.4_Silent_p.A124A|PPA2_ENST00000310267.7_Silent_p.A30A|PPA2_ENST00000354147.3_Intron|PPA2_ENST00000348706.5_Silent_p.A109A|PPA2_ENST00000509426.1_5'UTR|PPA2_ENST00000380004.2_Silent_p.A91A|PPA2_ENST00000432483.2_Intron	NM_176869.2	NP_789845.1	Q9H2U2	IPYR2_HUMAN	pyrophosphatase (inorganic) 2	109					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	11		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		GCTCCTTGGTGGCAATCTAAG	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		17894	0.001		0.0	False		,,,				2504	0.0				p.A109A													.	.			0			c.C327A												78.0	80.0	79.0					4																	106367654		2203	4300	6503	SO:0001819	synonymous_variant	27068	exon5			CTTGGTGGCAATC		CCDS3667.1, CCDS3668.2, CCDS3669.2, CCDS34043.1	4q25	2005-10-07			ENSG00000138777	ENSG00000138777			28883	protein-coding gene	gene with protein product		609988				11042152	Standard	NM_176869		Approved	FLJ20459	uc003hxl.3	Q9H2U2	OTTHUMG00000128781	ENST00000341695.5:c.327C>A	4.37:g.106367654G>T			46	0	0		20	0.10	2	NM_176869	3	0.00	0	B4DLP7|F8WDN9|I6L9B6|Q4W5E9|Q6PG51|Q8TBW0|Q96E55|Q9H0T0|Q9NX37|Q9P033|Q9ULX0	Silent	SNP	ENST00000341695.5	37	CCDS3667.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.425|7.425	0.637504|0.637504	0.14386|0.14386	.|.	.|.	ENSG00000138777|ENSG00000138777	ENST00000515567|ENST00000508518	.|.	.|.	.|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	.|.	.|.	.|.	.|.	T|T	0.68824|0.68824	0.3043|0.3043	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.67753|0.67753	-0.5589|-0.5589	4|4	.|.	.|.	.|.	-16.8137|-16.8137	13.4164|13.4164	0.60972|0.60972	0.0:0.0:0.8429:0.1571|0.0:0.0:0.8429:0.1571	.|.	.|.	.|.	.|.	N|Q	10|88	.|.	.|.	H|P	-|-	1|2	0|0	PPA2|PPA2	106587103|106587103	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.776000|0.776000	0.43924|0.43924	1.209000|1.209000	0.32357|0.32357	2.340000|2.340000	0.79590|0.79590	0.655000|0.655000	0.94253|0.94253	CAC|CCA			0.343	PPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000250704.4		NM_176869	
PDZD2	23037	mdanderson.org	37	5	32098697	32098697	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr5:32098697G>T	ENST00000438447.1	+	23	8563	c.8175G>T	c.(8173-8175)aaG>aaT	p.K2725N	PDZD2_ENST00000282493.3_Missense_Mutation_p.K2725N			O15018	PDZD2_HUMAN	PDZ domain containing 2	2725					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCAATGGGAAGGGTTTGCTGT	0.557																																					p.K2725N													.	.			0			c.G8175T												45.0	43.0	44.0					5																	32098697		2203	4300	6503	SO:0001583	missense	23037	exon22			TGGGAAGGGTTTG	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.8175G>T	5.37:g.32098697G>T	ENSP00000402033:p.Lys2725Asn		49	0	0		48	0.06	3	NM_178140	3	0.00	0	Q9BXD4	Missense_Mutation	SNP	ENST00000438447.1	37	CCDS34137.1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872267	0.51695	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.07216	3.21;3.21	5.22	2.41	0.29592	.	0.000000	0.56097	D	0.000032	T	0.14056	0.0340	L	0.32530	0.975	0.29209	N	0.874716	D	0.76494	0.999	D	0.75484	0.986	T	0.05616	-1.0874	10	0.35671	T	0.21	.	6.4997	0.22162	0.1612:0.0:0.693:0.1457	.	2725	O15018	PDZD2_HUMAN	N	2725;2526;2725	ENSP00000402033:K2725N;ENSP00000282493:K2725N	ENSP00000282493:K2725N	K	+	3	2	PDZD2	32134454	1.000000	0.71417	0.104000	0.21259	0.024000	0.10985	3.499000	0.53310	0.182000	0.20032	-0.895000	0.02911	AAG			0.557	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000366608.1			
CCNO	10309	mdanderson.org	37	5	54528990	54528990	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr5:54528990G>T	ENST00000282572.4	-	1	518	c.362C>A	c.(361-363)gCg>gAg	p.A121E	RP11-506H20.1_ENST00000506435.1_RNA	NM_021147.3	NP_066970.3	P22674	CCNO_HUMAN	cyclin O	121					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cell cycle (GO:0007049)|cell division (GO:0051301)|cilium assembly (GO:0042384)|depyrimidination (GO:0045008)|DNA repair (GO:0006281)|embryo development (GO:0009790)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	uracil DNA N-glycosylase activity (GO:0004844)			endometrium(1)|lung(3)|skin(1)	5		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			CCGTGCCAGCGCCTCCCGCGG	0.682																																					p.A121E													.	.			0			c.C362A												3.0	4.0	4.0					5																	54528990		1770	3574	5344	SO:0001583	missense	10309	exon1			GCCAGCGCCTCCC	M87499	CCDS34157.1	5q11.2	2010-11-15	2007-07-26	2007-07-26	ENSG00000152669	ENSG00000152669			18576	protein-coding gene	gene with protein product		607752	"""cyclin U"""	CCNU			Standard	NR_125346		Approved	UDG2, FLJ22422, UNG2	uc003jpw.3	P22674	OTTHUMG00000162598	ENST00000282572.4:c.362C>A	5.37:g.54528990G>T	ENSP00000282572:p.Ala121Glu		26	0	0		20	0.10	2	NM_021147	1	0.00	0	A8K1W5|Q0P6J2|Q9H6B0|Q9UMD5	Missense_Mutation	SNP	ENST00000282572.4	37	CCDS34157.1	.	.	.	.	.	.	.	.	.	.	G	14.86	2.662101	0.47572	.	.	ENSG00000152669	ENST00000282572	T	0.11385	2.78	5.44	4.56	0.56223	Cyclin, N-terminal (1);Cyclin-like (2);	0.368855	0.27280	N	0.020090	T	0.11239	0.0274	L	0.43923	1.385	0.24682	N	0.993356	B	0.24258	0.1	B	0.29785	0.107	T	0.11665	-1.0578	10	0.62326	D	0.03	.	9.3039	0.37863	0.0799:0.1438:0.7763:0.0	.	121	P22674	CCNO_HUMAN	E	121	ENSP00000282572:A121E	ENSP00000282572:A121E	A	-	2	0	CCNO	54564747	0.738000	0.28186	0.997000	0.53966	0.949000	0.60115	1.739000	0.38217	2.546000	0.85860	0.561000	0.74099	GCG			0.682	CCNO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000369707.1		NM_021147	
ADAMTS2	9509	mdanderson.org	37	5	178564813	178564813	+	Missense_Mutation	SNP	G	G	T	rs1862211	byFrequency	TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr5:178564813G>T	ENST00000251582.7	-	12	2009	c.1908C>A	c.(1906-1908)caC>caA	p.H636Q		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	636	Cys-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		GGGCGTCGCCGTGCTCGAAGT	0.682																																					p.H636Q													.	.			0			c.C1908A												19.0	19.0	19.0					5																	178564813		2178	4290	6468	SO:0001583	missense	9509	exon12			GTCGCCGTGCTCG	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1908C>A	5.37:g.178564813G>T	ENSP00000251582:p.His636Gln		31	0	0		22	0.09	2	NM_014244	0		0		Missense_Mutation	SNP	ENST00000251582.7	37	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.322106	0.41096	.	.	ENSG00000087116	ENST00000251582	T	0.67523	-0.27	5.62	-6.19	0.02078	.	0.111405	0.39759	N	0.001268	T	0.65217	0.2670	M	0.66506	2.035	0.21897	P	0.99948204	P	0.52061	0.95	P	0.48873	0.593	T	0.73151	-0.4073	9	0.31617	T	0.26	.	16.7628	0.85516	0.7543:0.0:0.2457:0.0	.	636	O95450	ATS2_HUMAN	Q	636	ENSP00000251582:H636Q	ENSP00000251582:H636Q	H	-	3	2	ADAMTS2	178497419	0.369000	0.25039	0.250000	0.24296	0.059000	0.15707	-0.315000	0.08081	-1.134000	0.02899	-1.069000	0.02264	CAC			0.682	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000253507.1		NM_014244	
SLC25A27	9481	broad.mit.edu;bcgsc.ca;mdanderson.org	37	6	46621035	46621035	+	Splice_Site	SNP	G	G	C			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr6:46621035G>C	ENST00000371347.5	+	1	358	c.106G>C	c.(106-108)Gca>Cca	p.A36P	CYP39A1_ENST00000275016.2_5'Flank|SLC25A27_ENST00000452689.2_5'UTR|SLC25A27_ENST00000411689.2_Splice_Site_p.A36P	NM_001204051.1|NM_004277.4	NP_001190980.1|NP_004268.3	O95847	UCP4_HUMAN	solute carrier family 25, member 27	36					cellular triglyceride homeostasis (GO:0035356)|generation of precursor metabolites and energy (GO:0006091)|inner ear development (GO:0048839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|negative regulation of mitochondrial membrane potential (GO:0010917)|neuron death (GO:0070997)|positive regulation of cell proliferation (GO:0008284)|regulation of glucose import (GO:0046324)|transport (GO:0006810)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)				central_nervous_system(1)|kidney(1)|lung(4)|prostate(1)|urinary_tract(1)	8			Lung(136;0.192)			GGCCGAGCTAGGTACCCGGCT	0.731																																					p.A36P													.	SLC25A27	22		0			c.G106C												18.0	22.0	21.0					6																	46621035		1874	4105	5979	SO:0001630	splice_region_variant	9481	exon1			GAGCTAGGTACCC	AK090871	CCDS43470.1, CCDS56431.1	6p12.3	2013-05-22			ENSG00000153291	ENSG00000153291		"""Solute carriers"""	21065	protein-coding gene	gene with protein product		613725				10025957, 10772343	Standard	NM_004277		Approved	UCP4, FLJ33552	uc003oyh.3	O95847	OTTHUMG00000014786	ENST00000371347.5:c.106+1G>C	6.37:g.46621035G>C			33	0	0		23	0.22	5	NM_001204051	0		0	F5GWR4|Q5VTS9|Q8N518	Splice_Site	SNP	ENST00000371347.5	37	CCDS43470.1	.	.	.	.	.	.	.	.	.	.	G	36	5.790285	0.96945	.	.	ENSG00000153291	ENST00000371347;ENST00000411689	T;T	0.80480	-1.38;-1.38	4.93	4.93	0.64822	Mitochondrial carrier domain (2);	0.080983	0.51477	D	0.000093	D	0.87892	0.6292	M	0.87758	2.905	0.80722	D	1	P;P	0.52463	0.953;0.951	P;P	0.59761	0.863;0.847	D	0.88535	0.3105	10	0.54805	T	0.06	-13.4426	16.0324	0.80588	0.0:0.0:1.0:0.0	.	36;36	O95847;F5GWR4	UCP4_HUMAN;.	P	36	ENSP00000360398:A36P;ENSP00000412024:A36P	ENSP00000360398:A36P	A	+	1	0	SLC25A27	46728994	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.705000	0.74644	2.728000	0.93425	0.655000	0.94253	GCA			0.731	SLC25A27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000040791.1		NM_004277	Missense_Mutation
ELOVL4	6785	mdanderson.org	37	6	80656990	80656990	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr6:80656990G>T	ENST00000369816.4	-	1	307	c.7C>A	c.(7-9)Ctc>Atc	p.L3I		NM_022726.3	NP_073563.1	Q9GZR5	ELOV4_HUMAN	ELOVL fatty acid elongase 4	3					cellular lipid metabolic process (GO:0044255)|detection of visible light (GO:0009584)|fatty acid biosynthetic process (GO:0006633)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)	G-protein coupled photoreceptor activity (GO:0008020)|transferase activity (GO:0016740)			central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(76;1.83e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.011)		BRCA - Breast invasive adenocarcinoma(397;0.0168)	Alpha-Linolenic Acid(DB00132)	GAGTCCAGGAGCCCCATCGCG	0.677																																					p.L3I													.	.			0			c.C7A												52.0	44.0	47.0					6																	80656990		2203	4299	6502	SO:0001583	missense	6785	exon1			CCAGGAGCCCCAT	AF277094	CCDS4992.1	6q14	2013-01-08	2011-05-25		ENSG00000118402	ENSG00000118402			14415	protein-coding gene	gene with protein product	"""cancer/testis antigen 118"""	605512	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 4"""	STGD2, STGD3		11138005	Standard	NM_022726		Approved	CT118	uc003pja.4	Q9GZR5	OTTHUMG00000015087	ENST00000369816.4:c.7C>A	6.37:g.80656990G>T	ENSP00000358831:p.Leu3Ile		42	0	0		27	0.11	3	NM_022726	0		0	B2R6B5|Q5TCS2|Q86YJ1|Q9H139	Missense_Mutation	SNP	ENST00000369816.4	37	CCDS4992.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422029	0.62622	.	.	ENSG00000118402	ENST00000369816	T	0.18810	2.19	4.11	4.11	0.48088	.	0.408219	0.19361	N	0.116134	T	0.10852	0.0265	N	0.08118	0	0.29541	N	0.852088	P	0.52842	0.956	P	0.62184	0.899	T	0.12967	-1.0527	10	0.25751	T	0.34	-11.487	11.7008	0.51569	0.0:0.0:1.0:0.0	.	3	Q9GZR5	ELOV4_HUMAN	I	3	ENSP00000358831:L3I	ENSP00000358831:L3I	L	-	1	0	ELOVL4	80713709	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.349000	0.33998	2.116000	0.64780	0.462000	0.41574	CTC			0.677	ELOVL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041315.1			
MMS22L	253714	mdanderson.org	37	6	97702453	97702453	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr6:97702453G>T	ENST00000275053.4	-	10	1364	c.1099C>A	c.(1099-1101)Cat>Aat	p.H367N	MMS22L_ENST00000369251.2_Missense_Mutation_p.H367N	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein	367					double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGTACTCCATGGCGATCAAAC	0.333																																					p.H367N													.	.			0			c.C1099A												97.0	96.0	96.0					6																	97702453		2203	4300	6503	SO:0001583	missense	253714	exon10			CTCCATGGCGATC		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.1099C>A	6.37:g.97702453G>T	ENSP00000275053:p.His367Asn		52	0	0		51	0.06	3	NM_198468	1	0.00	0	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Missense_Mutation	SNP	ENST00000275053.4	37	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	G	2.940	-0.219106	0.06101	.	.	ENSG00000146263	ENST00000275053;ENST00000369251;ENST00000510018;ENST00000482634	T;T;T;T	0.26660	1.72;1.72;1.72;1.72	5.09	4.13	0.48395	.	0.209887	0.37623	N	0.002019	T	0.03348	0.0097	N	0.05230	-0.09	0.27937	N	0.937665	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.38714	-0.9648	10	0.08381	T	0.77	-5.755	9.8651	0.41138	0.0:0.0:0.6394:0.3606	.	367;367	E2QRD4;Q6ZRQ5	.;MMS22_HUMAN	N	367;367;255;59	ENSP00000275053:H367N;ENSP00000358254:H367N;ENSP00000427288:H255N;ENSP00000421225:H59N	ENSP00000275053:H367N	H	-	1	0	MMS22L	97809174	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	4.585000	0.60977	2.364000	0.80123	0.655000	0.94253	CAT			0.333	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000041573.3		NM_198468	
EPB41L2	2037	mdanderson.org	37	6	131191163	131191163	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr6:131191163G>T	ENST00000337057.3	-	15	2328	c.2147C>A	c.(2146-2148)cCt>cAt	p.P716H	EPB41L2_ENST00000527659.1_Missense_Mutation_p.P646H|EPB41L2_ENST00000528282.1_Intron|EPB41L2_ENST00000445890.2_Intron|EPB41L2_ENST00000525271.1_Intron|EPB41L2_ENST00000527411.1_Missense_Mutation_p.P646H|EPB41L2_ENST00000368128.2_Missense_Mutation_p.P716H|EPB41L2_ENST00000392427.3_Intron|EPB41L2_ENST00000529208.1_Missense_Mutation_p.P646H|EPB41L2_ENST00000530481.1_Missense_Mutation_p.P646H|EPB41L2_ENST00000530757.1_Intron|EPB41L2_ENST00000525193.1_Intron|EPB41L2_ENST00000524581.1_Missense_Mutation_p.P94H|EPB41L2_ENST00000531410.1_Intron	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	716					cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		ACCACTCCCAGGTGATATCTC	0.493																																					p.P716H													.	.			0			c.C2147A												61.0	58.0	59.0					6																	131191163		2203	4300	6503	SO:0001583	missense	2037	exon15			CTCCCAGGTGATA	AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.2147C>A	6.37:g.131191163G>T	ENSP00000338481:p.Pro716His		29	0	0		48	0.06	3	NM_001431	35	0.00	0	B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	ENST00000337057.3	37	CCDS5141.1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499787	0.64298	.	.	ENSG00000079819	ENST00000530481;ENST00000337057;ENST00000257986;ENST00000368128;ENST00000527411;ENST00000524581;ENST00000527659;ENST00000529208;ENST00000527423;ENST00000525198	D;D;D;D;T;D;D;T	0.84589	-1.83;-1.66;-1.66;-1.68;-1.1;-1.87;-1.68;2.0	5.57	5.57	0.84162	.	0.304027	0.36665	N	0.002479	D	0.82449	0.5039	L	0.51422	1.61	0.25084	N	0.990904	D;P;D;D;P	0.63880	0.985;0.947;0.993;0.986;0.895	P;P;P;P;P	0.55999	0.578;0.527;0.628;0.789;0.619	T	0.78008	-0.2372	10	0.72032	D	0.01	.	10.6382	0.45577	0.1168:0.0:0.8832:0.0	.	646;113;646;716;94	E9PHY5;E9PCC2;E9PPD9;O43491;Q6R5J7	.;.;.;E41L2_HUMAN;.	H	646;716;113;716;646;94;646;646;115;168	ENSP00000434576:P646H;ENSP00000338481:P716H;ENSP00000357110:P716H;ENSP00000436348:P646H;ENSP00000437207:P94H;ENSP00000431647:P646H;ENSP00000436641:P646H;ENSP00000437295:P115H	ENSP00000257986:P113H	P	-	2	0	EPB41L2	131232856	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.359000	0.52292	2.629000	0.89072	0.555000	0.69702	CCT			0.493	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000042204.3			
RP3-470B24.5	0	broad.mit.edu	37	6	168376821	168376821	+	lincRNA	SNP	T	T	C			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr6:168376821T>C	ENST00000538528.1	-	0	798																											TGGGGGTCACTCCCCCTGCAG	0.602																																					p.E171G													.	.			0			c.A512G												30.0	30.0	30.0					6																	168376821		692	1591	2283			0	exon1			GGTCACTCCCCCT																													6.37:g.168376821T>C			191	0	0		176	0.02	4	NM_001129895	47	0.02	1		RNA	SNP	ENST00000538528.1	37																																																																																						0.602	RP3-470B24.5-201	KNOWN	basic	lincRNA	lincRNA					
TNRC18	84629	mdanderson.org	37	7	5352833	5352833	+	Silent	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr7:5352833G>A	ENST00000430969.1	-	27	8037	c.7689C>T	c.(7687-7689)agC>agT	p.S2563S	TNRC18_ENST00000399537.4_Silent_p.S2563S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2563	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		tgccactactgctgctgctgc	0.672																																					p.S2563S													.	.			0			c.C7689T												3.0	5.0	4.0					7																	5352833		1128	2739	3867	SO:0001819	synonymous_variant	84629	exon27			ACTACTGCTGCTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7689C>T	7.37:g.5352833G>A			39	0.0256410256	1		28	0.11	3	NM_001080495	23	0.00	0	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	37	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.904535	0.00512	.	.	ENSG00000182095	ENST00000328270	.	.	.	4.38	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8385	0.08905	0.1403:0.149:0.519:0.1916	.	.	.	.	X	377	.	.	Q	-	1	0	TNRC18	5319359	0.004000	0.15560	0.014000	0.15608	0.007000	0.05969	-0.229000	0.09098	-0.173000	0.10761	-1.164000	0.01763	CAG			0.672	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding					
CCT6P1	643253	broad.mit.edu	37	7	65226641	65226641	+	RNA	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr7:65226641G>T	ENST00000442266.1	+	0	1167				SNORA15_ENST00000384058.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		AGGTTCTTGCGCAGAATTCTG	0.383																																					.													.	.			0			.																																											0	.			TCTTGCGCAGAAT	BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65226641G>T			76	0.0131578947	1		92	0.05	5	.	24	0.00	0		RNA	SNP	ENST00000442266.1	37																																																																																						0.383	CCT6P1-003	KNOWN	basic	processed_transcript	pseudogene		OTTHUMT00000345507.1		NR_003110	
RBM33	155435	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	7	155556646	155556646	+	Silent	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr7:155556646G>T	ENST00000401878.3	+	15	3318	c.3120G>T	c.(3118-3120)ggG>ggT	p.G1040G	RBM33_ENST00000341148.3_5'UTR	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	1040							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		TGCCAGCGGGGCCCCACGCAC	0.662																																					p.G1040G													.	.			0			c.G3120T												11.0	13.0	12.0					7																	155556646		1977	4153	6130	SO:0001819	synonymous_variant	155435	exon15			AGCGGGGCCCCAC	AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.3120G>T	7.37:g.155556646G>T			182	0	0		101	0.23	23	NM_053043	5	0.20	1	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Silent	SNP	ENST00000401878.3	37	CCDS5941.2	.	.	.	.	.	.	.	.	.	.	G	0.167	-1.075688	0.01903	.	.	ENSG00000184863	ENST00000392761	T	0.48522	0.81	5.91	-3.19	0.05171	.	0.818759	0.09805	U	0.753637	T	0.40862	0.1134	.	.	.	0.22330	N	0.999197	.	.	.	.	.	.	T	0.46735	-0.9170	7	0.56958	D	0.05	.	6.7671	0.23573	0.356:0.4714:0.1726:0.0	.	.	.	.	V	813	ENSP00000376514:G813V	ENSP00000376514:G813V	G	+	2	0	RBM33	155249407	0.054000	0.20591	0.003000	0.11579	0.026000	0.11368	-0.356000	0.07661	-0.752000	0.04728	-0.880000	0.02959	GGC			0.662	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		OTTHUMT00000317225.3		NM_001008408	
MAPK15	225689	broad.mit.edu;ucsc.edu;mdanderson.org	37	8	144804021	144804021	+	Missense_Mutation	SNP	G	G	A	rs376274608		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr8:144804021G>A	ENST00000338033.4	+	13	1548	c.1429G>A	c.(1429-1431)Ggt>Agt	p.G477S	RP11-429J17.5_ENST00000527908.1_RNA	NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	477					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GAACCGGGGCGGTGGGGTGAG	0.692																																					p.G477S													.	MAPK15	32		0			c.G1429A							G	SER/GLY	1,3943		0,1,1971	28.0	39.0	36.0		1429	-0.7	0.0	8		36	0,8234		0,0,4117	no	missense	MAPK15	NM_139021.2	56	0,1,6088	AA,AG,GG		0.0,0.0254,0.0082	benign	477/545	144804021	1,12177	1972	4117	6089	SO:0001583	missense	225689	exon13			CGGGGCGGTGGGG	AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1429G>A	8.37:g.144804021G>A	ENSP00000337691:p.Gly477Ser		38	0.0263157895	1		39	0.28	11	NM_139021	1	0.00	0	Q2TCF9|Q8N362	Missense_Mutation	SNP	ENST00000338033.4	37	CCDS6409.2	.	.	.	.	.	.	.	.	.	.	g	6.822	0.520777	0.13005	2.54E-4	0.0	ENSG00000181085	ENST00000338033	T	0.72394	-0.65	3.0	-0.737	0.11129	.	1.389390	0.04996	U	0.468123	T	0.49660	0.1570	N	0.19112	0.55	0.09310	N	0.999999	B	0.25312	0.123	B	0.10450	0.005	T	0.24476	-1.0159	10	0.09843	T	0.71	0.5022	6.5755	0.22564	0.1357:0.2821:0.5823:0.0	.	477	Q8TD08	MK15_HUMAN	S	477	ENSP00000337691:G477S	ENSP00000337691:G477S	G	+	1	0	MAPK15	144876009	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-0.549000	0.06041	-0.019000	0.14055	0.306000	0.20318	GGT			0.692	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000300348.1		NM_139021	
BICD2	23299	broad.mit.edu;mdanderson.org	37	9	95477707	95477707	+	Missense_Mutation	SNP	C	C	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr9:95477707C>T	ENST00000375512.3	-	7	2364	c.2297G>A	c.(2296-2298)cGg>cAg	p.R766Q	BICD2_ENST00000356884.6_Missense_Mutation_p.R766Q	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	766	Interacts with RAB6A. {ECO:0000250}.				cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						CGCCAGCTGCCGCTGCATCTC	0.627																																					p.R766Q													BICD2,NS,carcinoma,0,1	BICD2	68	1	0			c.G2297A												32.0	32.0	32.0					9																	95477707		2199	4296	6495	SO:0001583	missense	23299	exon7			AGCTGCCGCTGCA	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.2297G>A	9.37:g.95477707C>T	ENSP00000364662:p.Arg766Gln		118	0	0		82	0.05	4	NM_001003800	0		0	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Missense_Mutation	SNP	ENST00000375512.3	37	CCDS6700.1	.	.	.	.	.	.	.	.	.	.	C	33	5.275797	0.95459	.	.	ENSG00000185963	ENST00000356884;ENST00000375512	T;T	0.54071	0.59;0.59	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.70902	0.3277	M	0.67517	2.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.71846	-0.4469	10	0.52906	T	0.07	-46.7102	16.588	0.84732	0.0:1.0:0.0:0.0	.	766;766	Q8TD16-2;Q8TD16	.;BICD2_HUMAN	Q	766	ENSP00000349351:R766Q;ENSP00000364662:R766Q	ENSP00000349351:R766Q	R	-	2	0	BICD2	94517528	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.714000	0.84703	2.593000	0.87608	0.655000	0.94253	CGG			0.627	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		OTTHUMT00000055508.1		NM_015250	
GRIN3A	116443	mdanderson.org	37	9	104357065	104357065	+	Intron	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr9:104357065G>A	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.P50S	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CGCAGCTCCGGCAGGGACATG	0.537																																					p.P50S													PPP3R2,caecum,carcinoma,+2,1	PPP3R2	2	1	0			c.C148T												65.0	64.0	64.0					9																	104357065		2203	4300	6503	SO:0001627	intron_variant	5535	exon1			GCTCCGGCAGGGA		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15423C>T	9.37:g.104357065G>A			63	0	0		37	0.08	3	NM_147180	0		0	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	37	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959235	0.34565	.	.	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.71103	-0.54	3.94	3.05	0.35203	EF-hand-like domain (1);	0.000000	0.39544	N	0.001332	T	0.63177	0.2489	L	0.43646	1.37	0.43540	D	0.995832	B	0.34349	0.45	B	0.38020	0.263	T	0.66324	-0.5952	10	0.87932	D	0	-14.39	9.8497	0.41048	0.1025:0.0:0.8975:0.0	.	47	Q96LZ3	CANB2_HUMAN	S	50	ENSP00000363939:P50S	ENSP00000363939:P50S	P	-	1	0	PPP3R2	103396886	1.000000	0.71417	0.923000	0.36655	0.075000	0.17131	7.618000	0.83043	1.251000	0.43983	0.563000	0.77884	CCG			0.537	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053453.1			
CRB2	286204	broad.mit.edu	37	9	126132724	126132724	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr9:126132724G>T	ENST00000373631.3	+	7	1393	c.1392G>T	c.(1390-1392)agG>agT	p.R464S	CRB2_ENST00000373629.2_Missense_Mutation_p.R132S|CRB2_ENST00000359999.3_Missense_Mutation_p.R464S	NM_173689.5	NP_775960.4	Q5IJ48	CRUM2_HUMAN	crumbs family member 2	464	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cardiovascular system development (GO:0072358)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|mesoderm formation (GO:0001707)|negative regulation of endopeptidase activity (GO:0010951)|notochord formation (GO:0014028)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|somitogenesis (GO:0001756)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)			NS(2)|breast(1)|cervix(1)|endometrium(2)|lung(11)|ovary(1)|prostate(2)|skin(3)	23						TGGCACTGAGGTTTCGCACCA	0.602																																					p.R464S													.	CRB2	86		0			c.G1392T												48.0	45.0	46.0					9																	126132724		2203	4300	6503	SO:0001583	missense	286204	exon7			ACTGAGGTTTCGC	AK095783	CCDS6852.2	9q33.2	2014-02-06	2014-02-06		ENSG00000148204	ENSG00000148204			18688	protein-coding gene	gene with protein product		609720	"""crumbs homolog 2 (Drosophila)"""			14767562	Standard	XM_005251934		Approved	FLJ38464, FLJ16786	uc004bnx.1	Q5IJ48	OTTHUMG00000020638	ENST00000373631.3:c.1392G>T	9.37:g.126132724G>T	ENSP00000362734:p.Arg464Ser		84	0	0		53	0.06	3	NM_173689	2	0.00	0	A2A3N4|Q0QD46|Q5JS41|Q5JS43|Q6ZTA9|Q6ZWI6	Missense_Mutation	SNP	ENST00000373631.3	37	CCDS6852.2	.	.	.	.	.	.	.	.	.	.	G	16.82	3.227442	0.58668	.	.	ENSG00000148204	ENST00000359999;ENST00000373631;ENST00000373629	T;T;T	0.78595	-1.19;0.05;-1.19	4.94	0.983	0.19767	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);	0.000000	0.46145	D	0.000315	T	0.79251	0.4414	L	0.59436	1.845	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.77557	0.976;0.99	T	0.74711	-0.3573	10	0.09338	T	0.73	.	5.6069	0.17385	0.3837:0.2013:0.415:0.0	.	464;464	Q5IJ48;Q5IJ48-2	CRUM2_HUMAN;.	S	464;464;132	ENSP00000353092:R464S;ENSP00000362734:R464S;ENSP00000362732:R132S	ENSP00000353092:R464S	R	+	3	2	CRB2	125172545	0.250000	0.23951	0.997000	0.53966	0.930000	0.56654	-0.387000	0.07361	-0.085000	0.12573	0.448000	0.29417	AGG			0.602	CRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000053990.3		NM_173689	
SCAI	286205	broad.mit.edu	37	9	127783012	127783012	+	Silent	SNP	T	T	G			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chr9:127783012T>G	ENST00000336505.6	-	7	607	c.549A>C	c.(547-549)gcA>gcC	p.A183A	SCAI_ENST00000373549.4_Silent_p.A206A	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion	183	Necessary to inhibit MKL1-induced SRF transcriptional activity. {ECO:0000250}.				negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						CTATAAATCTTGCATAATATC	0.259																																					p.A206A													.	SCAI	84		0			c.A618C												74.0	73.0	73.0					9																	127783012		1805	4035	5840	SO:0001819	synonymous_variant	286205	exon8			AAATCTTGCATAA	AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.549A>C	9.37:g.127783012T>G			208	0	0		206	0.03	6	NM_173690	0		0	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	Silent	SNP	ENST00000336505.6	37	CCDS48017.1																																																																																					0.259	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000054055.3		NM_173690	
ACOT9	23597	hgsc.bcm.edu;broad.mit.edu;ucsc.edu;bcgsc.ca;mdanderson.org	37	X	23740077	23740077	+	Missense_Mutation	SNP	G	G	A			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	.	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chrX:23740077G>A	ENST00000336430.7	-	7	613	c.482C>T	c.(481-483)cCa>cTa	p.P161L	ACOT9_ENST00000379303.5_Missense_Mutation_p.P170L|ACOT9_ENST00000492081.1_Missense_Mutation_p.P101L|ACOT9_ENST00000379295.1_Missense_Mutation_p.P101L	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	161					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						GTCCTGTTCTGGGCTCAAGCT	0.398																																					p.P170L													.	.			0			c.C509T												141.0	111.0	121.0					X																	23740077		2203	4300	6503	SO:0001583	missense	23597	exon8			TGTTCTGGGCTCA	AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.482C>T	X.37:g.23740077G>A	ENSP00000336580:p.Pro161Leu		72	0	0		67	0.28	19	NM_001037171	12	0.33	4	B3KNC9|B7ZM94	Missense_Mutation	SNP	ENST00000336430.7	37	CCDS35216.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831377	0.91036	.	.	ENSG00000123130	ENST00000379303;ENST00000336430;ENST00000379295;ENST00000473710;ENST00000492081	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.43055	0.1230	L	0.52206	1.635	0.80722	D	1	D;P;D	0.59357	0.985;0.952;0.972	P;P;P	0.57846	0.828;0.677;0.749	T	0.16453	-1.0402	10	0.10902	T	0.67	-11.8961	17.8799	0.88837	0.0:0.0:1.0:0.0	.	128;161;170	Q9Y305-2;Q9Y305;Q9Y305-4	.;ACOT9_HUMAN;.	L	170;161;101;87;101	ENSP00000368605:P170L;ENSP00000336580:P161L;ENSP00000368597:P101L;ENSP00000420490:P87L;ENSP00000417778:P101L	ENSP00000336580:P161L	P	-	2	0	ACOT9	23649998	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.655000	0.91098	2.243000	0.73865	0.594000	0.82650	CCA			0.398	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000056065.1		NM_012332	
SLC6A14	11254	mdanderson.org	37	X	115568988	115568988	+	Missense_Mutation	SNP	G	G	T	rs61740723		TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chrX:115568988G>T	ENST00000371900.4	+	2	167	c.79G>T	c.(79-81)Gtt>Ttt	p.V27F		NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	27					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	GAATTTCCATGTTGGTGAAAA	0.388																																					p.V27F													.	.			0			c.G79T												171.0	176.0	174.0					X																	115568988		2203	4300	6503	SO:0001583	missense	11254	exon2			TTCCATGTTGGTG	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.79G>T	X.37:g.115568988G>T	ENSP00000360967:p.Val27Phe		41	0	0		43	0.07	3	NM_007231	0		0	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	37	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	17.36	3.371009	0.61624	.	.	ENSG00000087916	ENST00000371900	T	0.73681	-0.77	5.17	5.17	0.71159	.	0.073544	0.53938	D	0.000045	T	0.55689	0.1936	N	0.08118	0	0.51767	D	0.999938	B	0.34103	0.437	B	0.30401	0.115	T	0.62891	-0.6758	10	0.56958	D	0.05	.	14.8777	0.70507	0.0:0.0:1.0:0.0	.	27	Q9UN76	S6A14_HUMAN	F	27	ENSP00000360967:V27F	ENSP00000360967:V27F	V	+	1	0	SLC6A14	115483016	0.991000	0.36638	1.000000	0.80357	0.975000	0.68041	1.998000	0.40796	2.393000	0.81446	0.544000	0.68410	GTT			0.388	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000057986.1			
FAM3A	60343	mdanderson.org	37	X	153736636	153736636	+	Missense_Mutation	SNP	G	G	T			TCGA-ZM-AA0B-01A-11D-A435-10	TCGA-ZM-AA0B-10A-01D-A438-10	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina HiSeq	084a80d6-bc9b-40e7-8964-49d8f56e651f	c4912418-4a95-409b-8512-ac4c94533b97	g.chrX:153736636G>T	ENST00000447601.2	-	5	784	c.318C>A	c.(316-318)aaC>aaA	p.N106K	FAM3A_ENST00000369643.1_Missense_Mutation_p.N106K|FAM3A_ENST00000393572.1_Missense_Mutation_p.N68K|FAM3A_ENST00000492763.1_5'Flank|FAM3A_ENST00000369641.3_Missense_Mutation_p.N106K|FAM3A_ENST00000434658.2_Missense_Mutation_p.N106K|FAM3A_ENST00000359889.5_Missense_Mutation_p.N106K	NM_021806.2	NP_068578.2	P98173	FAM3A_HUMAN	family with sequence similarity 3, member A	106						extracellular region (GO:0005576)				kidney(2)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGGGCGATGTTCAGCCCGC	0.687																																					p.N106K													.	.			0			c.C318A												19.0	17.0	17.0					X																	153736636		1942	3799	5741	SO:0001583	missense	60343	exon5			GGCGATGTTCAGC	X74610	CCDS35453.1, CCDS55542.1, CCDS55543.1, CCDS76060.1	Xq28	2008-07-29			ENSG00000071889	ENSG00000071889			13749	protein-coding gene	gene with protein product		300492				8733135, 8281148	Standard	NM_021806		Approved	DXS560S, 2-19, XAP-7	uc004fls.2	P98173	OTTHUMG00000013418	ENST00000447601.2:c.318C>A	X.37:g.153736636G>T	ENSP00000416146:p.Asn106Lys		8	0	0		11	0.18	2	NM_001171134	31	0.00	0	A6QRH6|B2RBI7|B4DFI8|D3DWX4|Q5HY76|Q96H51	Missense_Mutation	SNP	ENST00000447601.2	37	CCDS35453.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.015274	0.75161	.	.	ENSG00000071889	ENST00000434658;ENST00000359889;ENST00000369643;ENST00000447601;ENST00000369641;ENST00000393572;ENST00000426266	T;T;T;T;T;T;T	0.21734	1.99;1.99;1.99;1.99;1.99;1.99;1.99	5.03	5.03	0.67393	.	0.045175	0.85682	D	0.000000	T	0.49338	0.1551	M	0.89904	3.07	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.999;0.999	T	0.56426	-0.7981	10	0.87932	D	0	.	7.1389	0.25543	0.199:0.0:0.801:0.0	.	106;106;120;106	B4DFI8;Q5HY75;D3DWX8;P98173	.;.;.;FAM3A_HUMAN	K	106;106;106;106;106;68;106	ENSP00000396243:N106K;ENSP00000352955:N106K;ENSP00000358657:N106K;ENSP00000416146:N106K;ENSP00000358655:N106K;ENSP00000377202:N68K;ENSP00000396845:N106K	ENSP00000352955:N106K	N	-	3	2	FAM3A	153389830	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.125000	0.50469	2.073000	0.62155	0.529000	0.55759	AAC			0.687	FAM3A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		OTTHUMT00000037362.2			
