#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_Annotation_Transcript	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Mutation_Type	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Other_Diseases	i_CGC_Tissue Type	i_CGC_Translocation_Partner	i_CGC_Tumor_Types_Germline	i_CGC_Tumor_Types_Somatic	i_COSMIC_fusion_genes	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_mutations	i_COSMIC_overlapping_primary_sites	i_COSMIC_tissue_types_affected	i_COSMIC_total_alterations_in_gene	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Codon_Change	i_DNARepairGenes_Role	i_Description	i_DrugBank	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_FamilialCancerDatabase_Syndromes	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GO_Biological_Process	i_GO_Cellular_Component	i_GO_Molecular_Function	i_Genome_Change	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_MUTSIG_Published_Results	i_OREGANNO_ID	i_OREGANNO_Values	i_ORegAnno_bin	i_Other_Transcripts	i_Protein_Change	i_Refseq_mRNA_Id	i_Refseq_prot_Id	i_SwissProt_acc_Id	i_SwissProt_entry_Id	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	i_Transcript_Exon	i_Transcript_Position	i_Transcript_Strand	i_Tumorscape_Amplification_Peaks	i_Tumorscape_Deletion_Peaks	i_UniProt_AApos	i_UniProt_Experimental_Info	i_UniProt_Natural_Variations	i_UniProt_Region	i_UniProt_Site	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_cDNA_Change	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification	i_t_alt_count_full	i_t_ref_count_full	isArtifactMode	oxoGCut	pox	pox_cutoff	qox	t_alt_count	t_ref_count	validation_alt_allele	validation_method	validation_status	validation_tumor_sample
GATA6	2627	broad.mit.edu	37	18	19780673	19780673	+	Missense_Mutation	SNP	G	G	C			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr18:19780673G>C	ENST00000269216.3	+	7	1952	c.1675G>C	c.(1675-1677)Gag>Cag	p.E559Q	RP11-627G18.1_ENST00000583442.1_RNA|GATA6_ENST00000581694.1_Missense_Mutation_p.E559Q	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	559					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			CGAGAACAGCGAGCTCAAGTA	0.627																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	uc002ktt.1																			0				NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18						c.(1675-1677)Gag>Cag		Homo sapiens GATA binding protein 6 (GATA6), mRNA.							96.0	83.0	88.0					18																	19780673		2203	4300	6503	SO:0001583	missense	2627				blood coagulation|cardiac vascular smooth muscle cell differentiation|cellular response to hypoxia|intestinal epithelial cell differentiation|male gonad development|negative regulation of apoptosis|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor-beta1 production|negative regulation of transforming growth factor-beta2 production|outflow tract septum morphogenesis|positive regulation of angiogenesis|positive regulation of cell cycle arrest|positive regulation of transcription from RNA polymerase II promoter|response to drug|response to growth factor stimulus		protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding	g.chr18:19780673G>C	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1675G>C	18.37:g.19780673G>C	ENSP00000269216:p.Glu559Gln					GATA6_uc002ktu.1_Missense_Mutation_p.E559Q	p.E559Q	NM_005257	NP_005248	Q92908	GATA6_HUMAN	STAD - Stomach adenocarcinoma(5;0.106)		6	1940	+	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		559					B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	37	c.1675G>C	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565994	0.45694	.	.	ENSG00000141448	ENST00000269216	D	0.97941	-4.62	5.91	5.04	0.67666	.	0.800077	0.10981	N	0.612649	D	0.92293	0.7555	N	0.14661	0.345	0.23056	N	0.998367	B	0.25521	0.128	B	0.21546	0.035	D	0.84824	0.0798	10	0.21540	T	0.41	-8.5635	4.5481	0.12090	0.2279:0.0:0.6106:0.1615	.	559	Q92908	GATA6_HUMAN	Q	559	ENSP00000269216:E559Q	ENSP00000269216:E559Q	E	+	1	0	GATA6	18034671	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.353000	0.52247	1.508000	0.48769	0.655000	0.94253	GAG		0.627	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257		7	136	0	0	0	1	0	7	136				
OTUD4	54726	broad.mit.edu	37	4	146059006	146059006	+	Missense_Mutation	SNP	G	G	A	rs558808115		TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr4:146059006G>A	ENST00000447906.2	-	21	3108	c.2921C>T	c.(2920-2922)aCt>aTt	p.T974I	OTUD4_ENST00000454497.2_Missense_Mutation_p.T909I|OTUD4_ENST00000455611.2_Intron			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	974					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					AACAGGCACAGTTTCTCTCTC	0.463																																						uc003ika.4																			0				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						c.(2725-2727)aCt>aTt		Homo sapiens OTU domain containing 4 (OTUD4), transcript variant 3, mRNA.							128.0	133.0	131.0					4																	146059006		2203	4300	6503	SO:0001583	missense	54726						protein binding	g.chr4:146059006G>A		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2921C>T	4.37:g.146059006G>A	ENSP00000395487:p.Thr974Ile						p.T909I	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN			20	2864	-	all_hematologic(180;0.151)		973					B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	ENST00000447906.2	37	c.2726C>T		.	.	.	.	.	.	.	.	.	.	G	13.28	2.191504	0.38707	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.34275	1.37;1.37	6.17	5.33	0.75918	.	1.059000	0.07258	N	0.867023	T	0.32793	0.0841	N	0.24115	0.695	0.80722	D	1	B;B	0.13145	0.007;0.004	B;B	0.14023	0.01;0.004	T	0.02275	-1.1184	10	0.59425	D	0.04	-0.3286	15.5098	0.75772	0.0658:0.0:0.9342:0.0	.	974;973	G3V0I6;Q01804	.;OTUD4_HUMAN	I	909;974	ENSP00000409279:T909I;ENSP00000395487:T974I	ENSP00000395487:T974I	T	-	2	0	OTUD4	146278456	0.027000	0.19231	0.108000	0.21378	0.880000	0.50808	2.210000	0.42816	1.621000	0.50320	0.655000	0.94253	ACT		0.463	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		5	175	0	0	0	1	0	5	175				
DTL	51514	broad.mit.edu	37	1	212220678	212220678	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr1:212220678G>A	ENST00000366991.4	+	5	693	c.379G>A	c.(379-381)Gta>Ata	p.V127I	DTL_ENST00000475419.1_3'UTR|DTL_ENST00000542077.1_Missense_Mutation_p.V85I	NM_016448.2	NP_057532.2	Q9NZJ0	DTL_HUMAN	denticleless E3 ubiquitin protein ligase homolog (Drosophila)	127					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|regulation of cell cycle (GO:0051726)|response to UV (GO:0009411)|translesion synthesis (GO:0019985)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|chromosome (GO:0005694)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)		ATTTTGGGACGTAAAAGCTGG	0.388																																						uc009xdc.3																			0				breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23						c.(379-381)Gta>Ata		Homo sapiens denticleless homolog (Drosophila) (DTL), mRNA.							210.0	204.0	206.0					1																	212220678		2203	4300	6503	SO:0001583	missense	51514				DNA replication|G2/M transition DNA damage checkpoint|protein monoubiquitination|protein polyubiquitination|response to UV|translesion synthesis|ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|centrosome|nuclear membrane	protein binding	g.chr1:212220678G>A	AF195765	CCDS1502.1, CCDS65778.1	1q32	2013-01-10	2012-02-23		ENSG00000143476	ENSG00000143476		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"""	30288	protein-coding gene	gene with protein product	"""RA regulated nuclear matrix associated protein"", ""DDB1 and CUL4 associated factor 2"""	610617	"""denticleless homolog (Drosophila)"""			11278750	Standard	NM_001286229		Approved	RAMP, L2DTL, DCAF2	uc009xdc.3	Q9NZJ0	OTTHUMG00000037133	ENST00000366991.4:c.379G>A	1.37:g.212220678G>A	ENSP00000355958:p.Val127Ile					DTL_uc010ptb.2_Missense_Mutation_p.V85I|DTL_uc001hiz.4_5'UTR	p.V127I	NM_016448	NP_057532	Q9NZJ0	DTL_HUMAN		OV - Ovarian serous cystadenocarcinoma(81;0.00796)|all cancers(67;0.0385)|Epithelial(68;0.102)	4	693	+			127					A8K8H8|D3DT98|Q5VT77|Q96SN0|Q9NW03|Q9NW34|Q9NWM5	Missense_Mutation	SNP	ENST00000366991.4	37	c.379G>A	CCDS1502.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947507	0.73672	.	.	ENSG00000143476	ENST00000366991;ENST00000542077	T;T	0.19105	2.17;2.17	5.18	4.28	0.50868	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.26882	0.0658	N	0.25426	0.745	0.80722	D	1	D;D	0.67145	0.996;0.989	P;P	0.56514	0.8;0.636	T	0.02244	-1.1189	10	0.44086	T	0.13	-16.7073	14.264	0.66104	0.0722:0.0:0.9278:0.0	.	85;127	F5GZ90;Q9NZJ0	.;DTL_HUMAN	I	127;85	ENSP00000355958:V127I;ENSP00000443870:V85I	ENSP00000355958:V127I	V	+	1	0	DTL	210287301	1.000000	0.71417	0.719000	0.30619	0.586000	0.36452	7.058000	0.76676	1.342000	0.45619	-0.119000	0.15052	GTA		0.388	DTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090182.1	NM_016448		5	192	0	0	0	1	0	5	192				
RPL10A	4736	broad.mit.edu	37	6	35436757	35436757	+	Missense_Mutation	SNP	G	G	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr6:35436757G>T	ENST00000322203.6	+	3	141	c.114G>T	c.(112-114)ttG>ttT	p.L38F	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	38					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						AGATCAGCTTGAAGAACTATG	0.657																																						uc003okp.1																			0				breast(1)|large_intestine(2)|ovary(1)	4						c.(112-114)ttG>ttT		Homo sapiens ribosomal protein L10a (RPL10A), mRNA.							40.0	39.0	39.0					6																	35436757		2203	4300	6503	SO:0001583	missense	4736				anatomical structure morphogenesis|endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosol|large ribosomal subunit	RNA binding|structural constituent of ribosome	g.chr6:35436757G>T	U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.114G>T	6.37:g.35436757G>T	ENSP00000363018:p.Leu38Phe					RPL10A_uc003oks.1_5'UTR	p.L38F	NM_007104	NP_009035	P62906	RL10A_HUMAN			2	148	+			38					B2R801|P52859|P53025|Q5TZT6|Q8J013	Missense_Mutation	SNP	ENST00000322203.6	37	c.114G>T	CCDS4806.1	.	.	.	.	.	.	.	.	.	.	G	19.55	3.848894	0.71603	.	.	ENSG00000198755	ENST00000322203	T	0.54866	0.55	5.13	3.3	0.37823	Ribosomal protein L1, 2-layer alpha/beta-sandwich (1);Ribosomal protein L1, superfamily (1);	0.079960	0.46442	D	0.000299	T	0.65333	0.2681	M	0.89030	3	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.70022	-0.4986	10	0.87932	D	0	.	8.7856	0.34818	0.083:0.403:0.5141:0.0	.	38	P62906	RL10A_HUMAN	F	38	ENSP00000363018:L38F	ENSP00000363018:L38F	L	+	3	2	RPL10A	35544735	1.000000	0.71417	0.986000	0.45419	0.944000	0.59088	2.621000	0.46418	0.522000	0.28464	0.478000	0.44815	TTG		0.657	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040283.1	NM_007104		30	43	0	0	0	1	0	30	43				
CCP110	9738	broad.mit.edu	37	16	19562584	19562584	+	3'UTR	SNP	A	A	G			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr16:19562584A>G	ENST00000381396.5	+	0	3300				CCP110_ENST00000396208.2_Silent_p.S989S|CCP110_ENST00000396212.2_Silent_p.S989S	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa						cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						GACAACATTCATTAGGATAAA	0.368																																						uc002dgk.4																			0				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						c.(2965-2967)tcA>tcG		Homo sapiens centriolar coiled coil protein 110kDa (CCP110), transcript variant 2, mRNA.							113.0	122.0	119.0					16																	19562584		2197	4300	6497	SO:0001624	3_prime_UTR_variant	9738				G2/M transition of mitotic cell cycle|centriole replication|regulation of cytokinesis	centriole|cytosol	protein binding	g.chr16:19562584A>G	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.*14A>G	16.37:g.19562584A>G						CCP110_uc002dgl.4_3'UTR	p.S989S	NM_014711	NP_055526	O43303	CP110_HUMAN			14	3357	+			0					B7WP23|O43335|Q68DV9|Q8NE13	Silent	SNP	ENST00000381396.5	37	c.2967A>G	CCDS55992.1																																																																																				0.368	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711		4	183	0	0	0	1	0	4	183				
MIEF2	125170	broad.mit.edu	37	17	18167971	18167971	+	Missense_Mutation	SNP	C	C	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr17:18167971C>A	ENST00000323019.4	+	4	1469	c.1258C>A	c.(1258-1260)Cac>Aac	p.H420N	MIEF2_ENST00000395704.4_3'UTR|MIEF2_ENST00000395706.2_Missense_Mutation_p.H431N	NM_001144900.1|NM_139162.3	NP_001138372.1|NP_631901.2	Q96C03	MID49_HUMAN	mitochondrial elongation factor 2	420					mitochondrion organization (GO:0007005)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)											CCTGCCCTGCCACTTCAACCC	0.622																																						uc010vxq.2																			0				breast(1)|central_nervous_system(1)|endometrium(3)|lung(4)	9						c.(1291-1293)Cac>Aac		Homo sapiens Smith-Magenis syndrome chromosome region, candidate 7 (SMCR7), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA.							45.0	44.0	44.0					17																	18167971		2203	4298	6501	SO:0001583	missense	125170					integral to membrane	protein binding	g.chr17:18167971C>A	BC014973	CCDS11193.1, CCDS45624.1, CCDS45625.1	17p11.2	2013-09-23	2013-09-23	2013-09-23	ENSG00000177427	ENSG00000177427			17920	protein-coding gene	gene with protein product		615498	"""Smith-Magenis syndrome chromosome region, candidate 7"""	SMCR7		11997338, 21508961	Standard	NM_001144900		Approved	MGC23130, MiD49	uc010vxq.2	Q96C03	OTTHUMG00000059392	ENST00000323019.4:c.1258C>A	17.37:g.18167971C>A	ENSP00000323591:p.His420Asn					SMCR7_uc002gsu.3_3'UTR|SMCR7_uc002gst.3_Missense_Mutation_p.H420N	p.H431N	NM_148886	NP_631901	Q96C03	SMCR7_HUMAN			3	1317	+	all_neural(463;0.228)		420					J3KPT3|Q6ZRD4|Q96N07	Missense_Mutation	SNP	ENST00000323019.4	37	c.1291C>A	CCDS11193.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156227	0.38021	.	.	ENSG00000177427	ENST00000323019;ENST00000395706	T;T	0.07800	3.16;3.16	5.45	4.4	0.53042	.	0.229716	0.47093	D	0.000256	T	0.07773	0.0195	L	0.44542	1.39	0.36324	D	0.858432	P	0.39717	0.684	B	0.40329	0.326	T	0.09662	-1.0664	10	0.56958	D	0.05	-28.2857	3.5538	0.07857	0.0:0.6394:0.0:0.3606	.	420	Q96C03	MID49_HUMAN	N	420;431	ENSP00000323591:H420N;ENSP00000379057:H431N	ENSP00000323591:H420N	H	+	1	0	SMCR7	18108696	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	2.041000	0.41213	2.565000	0.86533	0.462000	0.41574	CAC		0.622	MIEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132060.2	NM_139162		4	64	0	0	0	1	0	4	64				
GTPBP4	23560	broad.mit.edu	37	10	1060250	1060250	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr10:1060250G>A	ENST00000360803.4	+	15	1688	c.1606G>A	c.(1606-1608)Gat>Aat	p.D536N	GTPBP4_ENST00000538293.1_Missense_Mutation_p.D420N|GTPBP4_ENST00000545048.1_Missense_Mutation_p.D489N	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	536					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)	p.D536N(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		CGATAAAGACGATGTGAGTGT	0.443																																						uc001ift.3																			1	Substitution - Missense(1)	p.D536N(2)	large_intestine(1)	endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21						c.(1606-1608)Gat>Aat		Homo sapiens GTP binding protein 4 (GTPBP4), mRNA.							193.0	152.0	166.0					10																	1060250		2203	4300	6503	SO:0001583	missense	23560				negative regulation of DNA replication|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of cell-cell adhesion|negative regulation of collagen binding|negative regulation of protein ubiquitination|protein stabilization|regulation of cyclin-dependent protein kinase activity|ribosome biogenesis	nucleolus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding	g.chr10:1060250G>A	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1606G>A	10.37:g.1060250G>A	ENSP00000354040:p.Asp536Asn					GTPBP4_uc010qad.2_Missense_Mutation_p.D420N|GTPBP4_uc010qae.2_Missense_Mutation_p.D489N	p.D536N	NM_012341	NP_036473	Q9BZE4	NOG1_HUMAN	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)	14	1677	+		all_epithelial(10;0.107)|Colorectal(49;0.14)	536					B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Missense_Mutation	SNP	ENST00000360803.4	37	c.1606G>A	CCDS31132.1	.	.	.	.	.	.	.	.	.	.	G	3.557	-0.090454	0.07053	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	T;T;T	0.32023	1.47;1.47;1.47	5.27	-1.59	0.08453	.	0.403858	0.30676	N	0.009102	T	0.12135	0.0295	N	0.13198	0.31	0.32222	N	0.575119	B	0.02656	0.0	B	0.01281	0.0	T	0.38394	-0.9663	10	0.07990	T	0.79	-21.0744	7.6101	0.28124	0.2745:0.142:0.5834:0.0	.	536	Q9BZE4	NOG1_HUMAN	N	536;420;489	ENSP00000354040:D536N;ENSP00000444277:D420N;ENSP00000445473:D489N	ENSP00000354040:D536N	D	+	1	0	GTPBP4	1050250	1.000000	0.71417	0.015000	0.15790	0.040000	0.13550	1.733000	0.38156	-0.134000	0.11516	-0.143000	0.13931	GAT		0.443	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046412.1	NM_012341		51	73	0	0	0	1	0	51	73				
TUBA8	51807	broad.mit.edu	37	22	18604302	18604302	+	Silent	SNP	C	C	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr22:18604302C>T	ENST00000330423.3	+	2	133	c.60C>T	c.(58-60)tgC>tgT	p.C20C	TUBA8_ENST00000316027.6_5'UTR	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	20					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						GCAATGCCTGCTGGGAGCTCT	0.562																																						uc002znw.1																			0				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						c.(130-132)tgC>tgT		Homo sapiens tubulin, alpha 8 (TUBA8), transcript variant 2, mRNA.							85.0	76.0	79.0					22																	18604302		2203	4300	6503	SO:0001819	synonymous_variant	51807				microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity	g.chr22:18604302C>T	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.60C>T	22.37:g.18604302C>T						TUBA8_uc002znv.2_Silent_p.C20C|TUBA8_uc021wkt.1_5'UTR	p.C44C	NM_001193414	NP_001180343	Q9NY65	TBA8_HUMAN			0	429	+			20					B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Silent	SNP	ENST00000330423.3	37	c.132C>T	CCDS13751.1																																																																																				0.562	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316232.3	NM_018943		52	64	0	0	0	1	0	52	64				
PARD6B	84612	broad.mit.edu	37	20	49366676	49366676	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr20:49366676G>A	ENST00000371610.2	+	3	1013	c.770G>A	c.(769-771)aGg>aAg	p.R257K	PARD6B_ENST00000396039.1_Intron	NM_032521.2	NP_115910.1	Q9BYG5	PAR6B_HUMAN	par-6 family cell polarity regulator beta	257					axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell junction assembly (GO:0034329)|cell-cell junction assembly (GO:0007043)|cell-cell junction organization (GO:0045216)|establishment or maintenance of cell polarity (GO:0007163)|protein complex assembly (GO:0006461)|regulation of cell migration (GO:0030334)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						AATGTTGTGAGGAACAGTCGG	0.473																																						uc002xvo.3																			0				NS(1)|breast(1)|endometrium(1)|kidney(4)|lung(3)|urinary_tract(1)	11						c.(769-771)aGg>aAg		Homo sapiens par-6 partitioning defective 6 homolog beta (C. elegans) (PARD6B), mRNA.							137.0	132.0	134.0					20																	49366676		2203	4300	6503	SO:0001583	missense	84612				axonogenesis|cell cycle|cell division|establishment or maintenance of cell polarity|protein complex assembly|regulation of cell migration|tight junction assembly	cytosol|tight junction	protein binding	g.chr20:49366676G>A	AB044555	CCDS33485.1	20q13.13	2013-08-28	2013-08-28		ENSG00000124171	ENSG00000124171			16245	protein-coding gene	gene with protein product		608975	"""par-6 (partitioning defective 6, C.elegans) homolog beta"", ""par-6 partitioning defective 6 homolog beta (C. elegans)"""			11260256	Standard	NM_032521		Approved	PAR-6B	uc002xvo.3	Q9BYG5	OTTHUMG00000032732	ENST00000371610.2:c.770G>A	20.37:g.49366676G>A	ENSP00000360672:p.Arg257Lys						p.R257K	NM_032521	NP_115910	Q9BYG5	PAR6B_HUMAN			2	1013	+			257					A2A2A7|Q9Y510	Missense_Mutation	SNP	ENST00000371610.2	37	c.770G>A	CCDS33485.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.261810	0.80358	.	.	ENSG00000124171	ENST00000371610	T	0.17213	2.29	6.02	6.02	0.97574	.	0.046020	0.85682	D	0.000000	T	0.28433	0.0703	M	0.80982	2.52	0.80722	D	1	B	0.33299	0.407	B	0.32393	0.145	T	0.03008	-1.1083	10	0.38643	T	0.18	-16.5901	20.5407	0.99260	0.0:0.0:1.0:0.0	.	257	Q9BYG5	PAR6B_HUMAN	K	257	ENSP00000360672:R257K	ENSP00000360672:R257K	R	+	2	0	PARD6B	48800083	1.000000	0.71417	0.270000	0.24601	0.831000	0.47069	9.383000	0.97214	2.865000	0.98341	0.655000	0.94253	AGG		0.473	PARD6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079697.2	NM_032521		4	209	0	0	0	1	0	4	209				
ATAD2	29028	broad.mit.edu	37	8	124361673	124361673	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr8:124361673G>A	ENST00000287394.5	-	14	1765	c.1658C>T	c.(1657-1659)tCc>tTc	p.S553F	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_Intron	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	553					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TAGCAGGGTGGAAACAATAGA	0.358																																						uc003yqh.4																			0				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48						c.(1657-1659)tCc>tTc		Homo sapiens ATPase family, AAA domain containing 2 (ATAD2), mRNA.							92.0	87.0	89.0					8																	124361673		2203	4300	6503	SO:0001583	missense	29028				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity	g.chr8:124361673G>A	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1658C>T	8.37:g.124361673G>A	ENSP00000287394:p.Ser553Phe					ATAD2_uc011lii.2_Missense_Mutation_p.S344F|ATAD2_uc003yqi.4_Intron|ATAD2_uc003yqj.3_Missense_Mutation_p.S553F|Mir_548_uc022ban.1_5'Flank	p.S553F	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	STAD - Stomach adenocarcinoma(47;0.00288)		13	1766	-	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		553					Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	ENST00000287394.5	37	c.1658C>T	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957457	0.92726	.	.	ENSG00000156802	ENST00000287394	D	0.93659	-3.26	5.7	5.7	0.88788	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.106729	0.64402	D	0.000003	D	0.96321	0.8800	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96387	0.9286	10	0.87932	D	0	-8.2973	19.8338	0.96646	0.0:0.0:1.0:0.0	.	553	Q6PL18	ATAD2_HUMAN	F	553	ENSP00000287394:S553F	ENSP00000287394:S553F	S	-	2	0	ATAD2	124430854	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.692000	0.91855	0.591000	0.81541	TCC		0.358	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109		5	122	0	0	0	1	0	5	122				
ANKRD24	170961	broad.mit.edu	37	19	4219657	4219657	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr19:4219657C>T	ENST00000600132.1	+	19	3349	c.3073C>T	c.(3073-3075)Cag>Tag	p.Q1025*	ANKRD24_ENST00000262970.5_Nonsense_Mutation_p.Q1115*|ANKRD24_ENST00000318934.4_Nonsense_Mutation_p.Q1025*	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	1025										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		CACAGCAGAGCAGCAGCTACG	0.657																																						uc010dtt.1																			0				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21						c.(3073-3075)Cag>Tag		Homo sapiens ankyrin repeat domain 24 (ANKRD24), mRNA.							51.0	62.0	58.0					19																	4219657		2172	4276	6448	SO:0001587	stop_gained	170961							g.chr19:4219657C>T	AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.3073C>T	19.37:g.4219657C>T	ENSP00000471252:p.Gln1025*						p.Q1025*	NM_133475	NP_597732	Q8TF21	ANR24_HUMAN		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)	18	3349	+			1025					O75268|O95781	Nonsense_Mutation	SNP	ENST00000600132.1	37	c.3073C>T	CCDS45925.1	.	.	.	.	.	.	.	.	.	.	c	40	8.445180	0.98815	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	.	.	.	3.79	3.79	0.43588	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	11.8657	0.52493	0.0:1.0:0.0:0.0	.	.	.	.	X	1025;1115	.	ENSP00000262970:Q1115X	Q	+	1	0	ANKRD24	4170657	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	1.288000	0.33296	2.080000	0.62538	0.313000	0.20887	CAG		0.657	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458188.1	XM_114000		49	81	0	0	0	1	0	49	81				
SEL1L3	23231	broad.mit.edu	37	4	25785870	25785870	+	Missense_Mutation	SNP	T	T	C			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr4:25785870T>C	ENST00000399878.3	-	14	2382	c.2260A>G	c.(2260-2262)Atg>Gtg	p.M754V	SEL1L3_ENST00000264868.5_Missense_Mutation_p.M719V|SEL1L3_ENST00000502949.1_Missense_Mutation_p.M601V	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	754						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						GCTTTCTTCATCAGCTCTAAG	0.438																																						uc003gru.4																			0				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						c.(2260-2262)Atg>Gtg		Homo sapiens sel-1 suppressor of lin-12-like 3 (C. elegans) (SEL1L3), mRNA.							228.0	228.0	228.0					4																	25785870		2021	4178	6199	SO:0001583	missense	23231					integral to membrane	binding	g.chr4:25785870T>C	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2260A>G	4.37:g.25785870T>C	ENSP00000382767:p.Met754Val					SEL1L3_uc003grv.3_Missense_Mutation_p.M161V	p.M754V	NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN			13	2412	-			754					A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	37	c.2260A>G	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	T	19.94	3.920473	0.73213	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.50548	0.74;0.74;0.74	5.58	5.58	0.84498	Tetratricopeptide-like helical (1);	0.048817	0.85682	D	0.000000	T	0.49643	0.1569	N	0.14661	0.345	0.40760	D	0.982994	P;D	0.54047	0.884;0.964	P;P	0.60886	0.761;0.88	T	0.56842	-0.7912	10	0.54805	T	0.06	-28.5897	15.4199	0.75003	0.0:0.0:0.0:1.0	.	161;754	B4DTH5;Q68CR1	.;SE1L3_HUMAN	V	754;719;601	ENSP00000382767:M754V;ENSP00000264868:M719V;ENSP00000425438:M601V	ENSP00000264868:M719V	M	-	1	0	SEL1L3	25394968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.836000	0.55813	2.136000	0.66102	0.454000	0.30748	ATG		0.438	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187		17	192	0	0	0	1	0	17	192				
OTUD4	54726	broad.mit.edu	37	4	146059041	146059041	+	Silent	SNP	A	A	G			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr4:146059041A>G	ENST00000447906.2	-	21	3073	c.2886T>C	c.(2884-2886)caT>caC	p.H962H	OTUD4_ENST00000454497.2_Silent_p.H897H|OTUD4_ENST00000455611.2_Intron			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	962					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					GAGTGGGAGGATGAGCCTTTC	0.478																																						uc003ika.4																			0				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						c.(2689-2691)caT>caC		Homo sapiens OTU domain containing 4 (OTUD4), transcript variant 3, mRNA.							118.0	118.0	118.0					4																	146059041		2203	4300	6503	SO:0001819	synonymous_variant	54726						protein binding	g.chr4:146059041A>G		CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.2886T>C	4.37:g.146059041A>G							p.H897H	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN			20	2829	-	all_hematologic(180;0.151)		961					B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Silent	SNP	ENST00000447906.2	37	c.2691T>C																																																																																					0.478	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000365117.2	NM_017493		4	210	0	0	0	1	0	4	210				
RNF39	80352	broad.mit.edu	37	6	30043521	30043521	+	Missense_Mutation	SNP	C	C	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr6:30043521C>T	ENST00000244360.6	-	1	143	c.46G>A	c.(46-48)Gag>Aag	p.E16K	RNF39_ENST00000376751.3_Missense_Mutation_p.E16K	NM_025236.3	NP_079512.2	Q9H2S5	RNF39_HUMAN	ring finger protein 39	16						cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)										GGGATTGCCTCTCTCTTCAAC	0.587																																					NSCLC(8;188 360 1520 20207 31481)	uc003npe.3																			0											c.(46-48)Gag>Aag		Homo sapiens ring finger protein 39 (RNF39), transcript variant 1, mRNA.							53.0	55.0	54.0					6																	30043521		2203	4300	6503	SO:0001583	missense	80352					cytoplasm	zinc ion binding	g.chr6:30043521C>T	AF238315	CCDS4673.1, CCDS4674.1	6p21.3	2013-01-09			ENSG00000204618	ENSG00000204618		"""RING-type (C3HC4) zinc fingers"""	18064	protein-coding gene	gene with protein product		607524				11130983, 11716498	Standard	NM_170769		Approved	HZFw1, LIRF	uc003npe.3	Q9H2S5	OTTHUMG00000031288	ENST00000244360.6:c.46G>A	6.37:g.30043521C>T	ENSP00000244360:p.Glu16Lys					RNF39_uc003npd.3_Missense_Mutation_p.E16K	p.E16K	NM_025236	NP_079512	Q9H2S5	RNF39_HUMAN			0	108	-			16					A2BEK3|A6NCD6|B0S858|Q5SPM8|Q5SPM9|Q5SPN0|Q5SRJ9|Q5SRK1|Q5SS29|Q9H2S3|Q9H2S4	Missense_Mutation	SNP	ENST00000244360.6	37	c.46G>A	CCDS4673.1	.	.	.	.	.	.	.	.	.	.	c	17.97	3.518650	0.64634	.	.	ENSG00000204618	ENST00000376751;ENST00000244360;ENST00000376746	T;T	0.72505	-0.22;-0.66	3.71	-2.71	0.05986	.	.	.	.	.	T	0.18509	0.0444	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.12293	-1.0553	9	0.23302	T	0.38	.	2.0814	0.03635	0.1315:0.3582:0.3093:0.201	.	16;16	Q9H2S5;Q9H2S5-2	RNF39_HUMAN;.	K	16	ENSP00000365942:E16K;ENSP00000244360:E16K	ENSP00000244360:E16K	E	-	1	0	RNF39	30151500	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	0.310000	0.19356	-0.453000	0.07076	0.436000	0.28706	GAG		0.587	RNF39-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076625.3	NM_170769		51	88	0	0	0	1	0	51	88				
RNF214	257160	broad.mit.edu	37	11	117152830	117152830	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr11:117152830G>A	ENST00000531452.1	+	11	1602	c.1556G>A	c.(1555-1557)aGc>aAc	p.S519N	RNF214_ENST00000531287.1_Missense_Mutation_p.S364N|RNF214_ENST00000530849.1_Missense_Mutation_p.S364N|RNF214_ENST00000524917.1_Intron|RNF214_ENST00000300650.4_Missense_Mutation_p.S519N	NM_001077239.1|NM_001278249.1	NP_001070707.1|NP_001265178.1	Q8ND24	RN214_HUMAN	ring finger protein 214	519	Pro-rich.						zinc ion binding (GO:0008270)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)		TCCCTTGTCAGCCCCCACGGT	0.637																																						uc001pqt.3																			0				cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	23						c.(1555-1557)aGc>aAc		Homo sapiens ring finger protein 214 (RNF214), transcript variant 1, mRNA.							109.0	115.0	113.0					11																	117152830		1919	4121	6040	SO:0001583	missense	257160						zinc ion binding	g.chr11:117152830G>A	AL834448	CCDS41720.1, CCDS60976.1	11q23.3	2014-02-12	2007-02-16		ENSG00000167257	ENSG00000167257		"""RING-type (C3HC4) zinc fingers"""	25335	protein-coding gene	gene with protein product							Standard	NM_001077239		Approved	DKFZp547C195	uc001pqt.4	Q8ND24	OTTHUMG00000167069	ENST00000531452.1:c.1556G>A	11.37:g.117152830G>A	ENSP00000431643:p.Ser519Asn					RNF214_uc001pqu.3_Missense_Mutation_p.S519N|RNF214_uc010rxf.2_Missense_Mutation_p.S364N	p.S519N	NM_207343	NP_997226	Q8ND24	RN214_HUMAN		BRCA - Breast invasive adenocarcinoma(274;1.88e-05)|Epithelial(105;0.000397)|all cancers(92;0.00258)	10	1601	+	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)	519			Pro-rich.		B2RUW0|B4DTD1	Missense_Mutation	SNP	ENST00000531452.1	37	c.1556G>A	CCDS41720.1	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250967	0.39797	.	.	ENSG00000167257	ENST00000531287;ENST00000531452;ENST00000530849;ENST00000300650;ENST00000534709	T;T;T;T	0.38722	2.56;1.12;2.56;1.12	5.49	5.49	0.81192	.	0.122494	0.53938	D	0.000050	T	0.32010	0.0815	N	0.22421	0.69	0.33590	D	0.600979	B;B	0.22146	0.065;0.007	B;B	0.24848	0.056;0.016	T	0.34229	-0.9837	10	0.23302	T	0.38	-0.3402	16.5247	0.84327	0.0:0.0:1.0:0.0	.	364;519	B4DTD1;Q8ND24	.;RN214_HUMAN	N	364;519;364;519;71	ENSP00000435361:S364N;ENSP00000431643:S519N;ENSP00000432903:S364N;ENSP00000300650:S519N	ENSP00000300650:S519N	S	+	2	0	RNF214	116658040	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.688000	0.61715	2.573000	0.86826	0.561000	0.74099	AGC		0.637	RNF214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392884.1	NM_001077239		6	343	0	0	0	1	0	6	343				
ATP6V1C2	245973	broad.mit.edu	37	2	10917833	10917833	+	Missense_Mutation	SNP	T	T	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr2:10917833T>A	ENST00000272238.4	+	11	1057	c.948T>A	c.(946-948)agT>agA	p.S316R	ATP6V1C2_ENST00000381661.3_Intron	NM_001039362.1	NP_001034451.1	Q8NEY4	VATC2_HUMAN	ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2	316					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of Wnt signaling pathway (GO:0030177)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|protein dimerization activity (GO:0046983)	p.S316fs*14(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		AGAGAGAGAGTGAGGGCGAGG	0.602																																					NSCLC(188;1042 2136 10807 16813 47705)	uc002ras.3																			1	Deletion - Frameshift(1)	p.S316fs*14(1)	skin(1)	endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						c.(946-948)agT>agA		Homo sapiens ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2 (ATP6V1C2), transcript variant 1, mRNA.							68.0	68.0	68.0					2																	10917833		1884	4108	5992	SO:0001583	missense	245973				ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain		g.chr2:10917833T>A	AY039759	CCDS1674.1, CCDS42653.1	2p25.1	2010-04-21	2006-01-13		ENSG00000143882	ENSG00000143882		"""ATPases / V-type"""	18264	protein-coding gene	gene with protein product			"""ATPase, H+ transporting, lysosomal 42kD, V1 subunit C isoform 2"", ""ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C isoform 2"""			12384298	Standard	XR_426949		Approved	VMA5, ATP6C2	uc002ras.3	Q8NEY4	OTTHUMG00000090459	ENST00000272238.4:c.948T>A	2.37:g.10917833T>A	ENSP00000272238:p.Ser316Arg					ATP6V1C2_uc002rat.3_Intron	p.S316R	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN		Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)	10	1057	+	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)		316					Q96EL8	Missense_Mutation	SNP	ENST00000272238.4	37	c.948T>A	CCDS42653.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.830360	0.50845	.	.	ENSG00000143882	ENST00000272238	T	0.43688	0.94	5.54	4.39	0.52855	.	0.160511	0.28766	U	0.014209	T	0.35941	0.0949	L	0.51422	1.61	0.80722	D	1	B	0.28470	0.213	B	0.28465	0.09	T	0.19484	-1.0304	10	0.59425	D	0.04	-14.3505	8.0649	0.30654	0.0:0.0918:0.0:0.9082	.	316	Q8NEY4	VATC2_HUMAN	R	316	ENSP00000272238:S316R	ENSP00000272238:S316R	S	+	3	2	ATP6V1C2	10835284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.426000	0.34870	0.928000	0.37168	0.482000	0.46254	AGT		0.602	ATP6V1C2-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000323555.1	NM_144583		4	140	0	0	0	1	0	4	140				
KCND2	3751	broad.mit.edu	37	7	119915766	119915766	+	Silent	SNP	C	C	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr7:119915766C>T	ENST00000331113.4	+	1	2045	c.1080C>T	c.(1078-1080)gcC>gcT	p.A360A		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	360					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCCCTGCAGCCTTCTGGTATA	0.512																																						uc003vjj.1																			0				NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75						c.(1078-1080)gcC>gcT		Homo sapiens potassium voltage-gated channel, Shal-related subfamily, member 2 (KCND2), mRNA.							121.0	104.0	110.0					7																	119915766		2203	4300	6503	SO:0001819	synonymous_variant	3751				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding	g.chr7:119915766C>T	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1080C>T	7.37:g.119915766C>T							p.A360A	NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN			0	2045	+	all_neural(327;0.117)		360					O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Silent	SNP	ENST00000331113.4	37	c.1080C>T	CCDS5776.1																																																																																				0.512	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281		13	135	0	0	0	1	0	13	135				
STT3B	201595	broad.mit.edu	37	3	31641886	31641886	+	Missense_Mutation	SNP	A	A	G			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr3:31641886A>G	ENST00000295770.2	+	5	1021	c.812A>G	c.(811-813)aAt>aGt	p.N271S	STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	271					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						TTTATCATCAATCTTATTCCA	0.299																																						uc011axe.2																			0				autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						c.(811-813)aAt>aGt		Homo sapiens STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae) (STT3B), mRNA.							143.0	134.0	137.0					3																	31641886		2202	4297	6499	SO:0001583	missense	201595				protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding	g.chr3:31641886A>G	AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.812A>G	3.37:g.31641886A>G	ENSP00000295770:p.Asn271Ser					STT3B_uc003cer.1_Missense_Mutation_p.N271S|STT3B_uc010hft.1_Missense_Mutation_p.N271S	p.N271S	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN			4	812	+			271					Q96JZ4|Q96KY7	Missense_Mutation	SNP	ENST00000295770.2	37	c.812A>G	CCDS2650.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.596325	0.86953	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.87466	0.6184	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91304	0.5069	9	0.87932	D	0	-17.9132	15.0891	0.72180	1.0:0.0:0.0:0.0	.	271	Q8TCJ2	STT3B_HUMAN	S	271	.	ENSP00000295770:N271S	N	+	2	0	STT3B	31616890	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.690000	0.91272	2.182000	0.69389	0.528000	0.53228	AAT		0.299	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253166.2	NM_178862		5	102	0	0	0	1	0	5	102				
BEX1	55859	broad.mit.edu	37	X	102317829	102317829	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chrX:102317829G>A	ENST00000372728.3	-	3	613	c.374C>T	c.(373-375)cCc>cTc	p.P125L		NM_018476.3	NP_060946.3	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	125					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II activating transcription factor binding (GO:0001102)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12						CAGGATTCAGGGCATAAGGCA	0.463																																						uc004ejt.1																			0				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12						c.(373-375)cCc>cTc		Homo sapiens brain expressed, X-linked 1 (BEX1), mRNA.							147.0	123.0	131.0					X																	102317829		2203	4300	6503	SO:0001583	missense	55859				cell differentiation|nervous system development	cytoplasm|nucleus		g.chrX:102317829G>A		CCDS35354.1	Xq22.1	2014-03-21			ENSG00000133169	ENSG00000133169			1036	protein-coding gene	gene with protein product		300690				16221301	Standard	NM_018476		Approved		uc004ejt.1	Q9HBH7	OTTHUMG00000022708	ENST00000372728.3:c.374C>T	X.37:g.102317829G>A	ENSP00000361813:p.Pro125Leu					BEX1_uc022cbj.1_Missense_Mutation_p.P125L	p.P125L	NM_018476	NP_060946	Q9HBH7	BEX1_HUMAN			2	614	-			125					A0AVN1|A8K4J3|Q9NZ33	Missense_Mutation	SNP	ENST00000372728.3	37	c.374C>T	CCDS35354.1	.	.	.	.	.	.	.	.	.	.	G	17.42	3.386208	0.61956	.	.	ENSG00000133169	ENST00000372728	T	0.36520	1.25	3.25	3.25	0.37280	.	0.000000	0.45606	D	0.000341	T	0.40719	0.1128	N	0.19112	0.55	0.43149	D	0.99491	D	0.89917	1.0	D	0.85130	0.997	T	0.38887	-0.9640	10	0.87932	D	0	.	9.0912	0.36612	0.0:0.0:1.0:0.0	.	125	Q9HBH7	BEX1_HUMAN	L	125	ENSP00000361813:P125L	ENSP00000361813:P125L	P	-	2	0	BEX1	102204485	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.152000	0.50677	1.882000	0.54519	0.600000	0.82982	CCC		0.463	BEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058925.1	NM_018476		5	110	0	0	0	1	0	5	110				
UBAC1	10422	broad.mit.edu	37	9	138830109	138830109	+	Missense_Mutation	SNP	G	G	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr9:138830109G>A	ENST00000371756.3	-	9	1278	c.1061C>T	c.(1060-1062)cCg>cTg	p.P354L	UBAC1_ENST00000465873.1_5'Flank	NM_016172.2	NP_057256.2	Q9BSL1	UBAC1_HUMAN	UBA domain containing 1	354	STI1.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		CTGCACCACCGGGTTATCCAG	0.612																																					NSCLC(78;973 1398 27381 29552 42415)	uc004cgt.3																			0				NS(1)|biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(6)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	25						c.(1060-1062)cCg>cTg		Homo sapiens UBA domain containing 1 (UBAC1), mRNA.							123.0	114.0	117.0					9																	138830109		2203	4300	6503	SO:0001583	missense	10422					Golgi apparatus|plasma membrane	protein binding	g.chr9:138830109G>A	AF176796	CCDS35177.1	9q34.3	2008-02-05	2007-04-20	2007-04-20	ENSG00000130560	ENSG00000130560			30221	protein-coding gene	gene with protein product		608129	"""ubiquitin associated domain containing 1"""	UBADC1		10857748, 8619474	Standard	NM_016172		Approved	GBDR1	uc004cgt.3	Q9BSL1	OTTHUMG00000020920	ENST00000371756.3:c.1061C>T	9.37:g.138830109G>A	ENSP00000360821:p.Pro354Leu						p.P354L	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)	8	1279	-		Myeloproliferative disorder(178;0.0511)	354			STI1.		O75500|Q9UMW7	Missense_Mutation	SNP	ENST00000371756.3	37	c.1061C>T	CCDS35177.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843710	0.91197	.	.	ENSG00000130560	ENST00000371756	T	0.46819	0.86	4.8	4.8	0.61643	Heat shock chaperonin-binding (1);	0.000000	0.85682	D	0.000000	T	0.65112	0.2660	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68988	-0.5264	10	0.87932	D	0	-25.5345	16.8501	0.85991	0.0:0.0:1.0:0.0	.	354	Q9BSL1	UBAC1_HUMAN	L	354	ENSP00000360821:P354L	ENSP00000360821:P354L	P	-	2	0	UBAC1	137969930	1.000000	0.71417	0.928000	0.36995	0.971000	0.66376	9.426000	0.97469	2.201000	0.70794	0.561000	0.74099	CCG		0.612	UBAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055034.1	NM_016172		4	127	0	0	0	1	0	4	127				
COQ10A	93058	broad.mit.edu	37	12	56664037	56664037	+	Missense_Mutation	SNP	C	C	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr12:56664037C>T	ENST00000308197.5	+	5	941	c.680C>T	c.(679-681)aCc>aTc	p.T227I	COQ10A_ENST00000433805.2_Missense_Mutation_p.T195I|COQ10A_ENST00000546544.1_Missense_Mutation_p.T210I|RP11-977G19.14_ENST00000546464.1_RNA	NM_144576.3	NP_653177.3	Q96MF6	CQ10A_HUMAN	coenzyme Q10 homolog A (S. cerevisiae)	227						mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	8						CGGGCAGCCACCAAGTTTGGT	0.527																																						uc001sko.4																			0				cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)	8						c.(679-681)aCc>aTc		Homo sapiens coenzyme Q10 homolog A (S. cerevisiae) (COQ10A), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA.							130.0	129.0	129.0					12																	56664037		1998	4169	6167	SO:0001583	missense	93058					mitochondrial inner membrane		g.chr12:56664037C>T	AK057003	CCDS41796.1, CCDS44921.1	12q13.3	2011-09-16	2006-04-04		ENSG00000135469	ENSG00000135469			26515	protein-coding gene	gene with protein product			"""coenzyme Q10 homolog A (yeast)"""				Standard	NM_144576		Approved	FLJ32452	uc001sko.4	Q96MF6	OTTHUMG00000170283	ENST00000308197.5:c.680C>T	12.37:g.56664037C>T	ENSP00000312587:p.Thr227Ile					COQ10A_uc001skp.4_Missense_Mutation_p.T195I|COQ10A_uc001skq.4_Missense_Mutation_p.T210I	p.T227I	NM_144576	NP_653177	Q96MF6	CQ10A_HUMAN			4	941	+			227					Q6GMR6|Q6UWB9|Q86X16|Q8TAL2|Q96MF1|Q9BUP4	Missense_Mutation	SNP	ENST00000308197.5	37	c.680C>T	CCDS41796.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.396|9.396	1.076642|1.076642	0.20227|0.20227	.|.	.|.	ENSG00000135469|ENSG00000135469	ENST00000553234;ENST00000551814|ENST00000308197;ENST00000433805;ENST00000546544	.|T;T;T	.|0.23147	.|1.92;1.93;1.92	4.85|4.85	3.94|3.94	0.45596|0.45596	.|START-like domain (1);	.|0.048448	.|0.85682	.|D	.|0.000000	T|T	0.15696|0.15696	0.0378|0.0378	N|N	0.12182|0.12182	0.205|0.205	0.38688|0.38688	D|D	0.9527|0.9527	.|B;B;B	.|0.16396	.|0.01;0.017;0.017	.|B;B;B	.|0.21917	.|0.037;0.029;0.029	T|T	0.07424|0.07424	-1.0773|-1.0773	5|10	.|0.66056	.|D	.|0.02	.|.	11.0871|11.0871	0.48093|0.48093	0.4545:0.5454:0.0:0.0|0.4545:0.5454:0.0:0.0	.|.	.|210;232;227	.|Q96MF6-2;Q8TAL2;Q96MF6	.|.;.;CQ10A_HUMAN	S|I	133;44|227;195;210	.|ENSP00000312587:T227I;ENSP00000407843:T195I;ENSP00000446723:T210I	.|ENSP00000312587:T227I	P|T	+|+	1|2	0|0	COQ10A|COQ10A	54950304|54950304	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.105000|0.105000	0.19272|0.19272	5.116000|5.116000	0.64661|0.64661	1.380000|1.380000	0.46344|0.46344	-0.181000|-0.181000	0.13052|0.13052	CCA|ACC		0.527	COQ10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408332.1	NM_144576		7	179	0	0	0	1	0	7	179				
PRRC2B	84726	broad.mit.edu	37	9	134351428	134351428	+	Silent	SNP	C	C	A			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr9:134351428C>A	ENST00000357304.4	+	15	3967	c.3912C>A	c.(3910-3912)ccC>ccA	p.P1304P	PRRC2B_ENST00000405995.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000458550.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1304							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GAAGGCGCCCCCCACGCCAAG	0.637											OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										uc004can.4																			0		p.R1303C(1)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						c.(3910-3912)ccC>ccA		Homo sapiens proline-rich coiled-coil 2B (PRRC2B), mRNA.							53.0	62.0	59.0					9																	134351428		1907	4125	6032	SO:0001819	synonymous_variant	84726						protein binding	g.chr9:134351428C>A	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3912C>A	9.37:g.134351428C>A			OREG0019561	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	1610	PRRC2B_uc010mzj.1_Silent_p.P887P|PRRC2B_uc004cao.4_Silent_p.P662P	p.P1304P	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN			14	3967	+			1304					O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	37	c.3912C>A	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	8.060	0.767875	0.15983	.	.	ENSG00000130723	ENST00000451855	T	0.07327	3.2	5.66	-1.1	0.09872	.	.	.	.	.	T	0.10723	0.0262	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32134	-0.9918	6	0.87932	D	0	.	2.0418	0.03552	0.204:0.4535:0.0994:0.2431	.	.	.	.	T	38	ENSP00000388579:P38T	ENSP00000388579:P38T	P	+	1	0	PRRC2B	133341249	0.000000	0.05858	0.990000	0.47175	0.990000	0.78478	-1.933000	0.01553	-0.169000	0.10834	0.655000	0.94253	CCC		0.637	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding				47	57	0	0	0	1	0	47	57				
ZNF408	79797	broad.mit.edu	37	11	46727180	46727180	+	Missense_Mutation	SNP	G	G	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr11:46727180G>T	ENST00000311764.2	+	5	2160	c.1930G>T	c.(1930-1932)Gct>Tct	p.A644S		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	644					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCCTTCTGCTGCTTCTGAGCC	0.637																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)	uc001nde.2																			0				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						c.(1930-1932)Gct>Tct		Homo sapiens zinc finger protein 408 (ZNF408), transcript variant 1, mRNA.							46.0	41.0	42.0					11																	46727180		2201	4299	6500	SO:0001583	missense	79797				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|identical protein binding|zinc ion binding	g.chr11:46727180G>T	AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1930G>T	11.37:g.46727180G>T	ENSP00000309606:p.Ala644Ser					ZNF408_uc010rgw.2_Missense_Mutation_p.A636S	p.A644S	NM_024741	NP_079017	Q9H9D4	ZN408_HUMAN			4	2211	+			644						Missense_Mutation	SNP	ENST00000311764.2	37	c.1930G>T	CCDS7923.1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.689763	0.48097	.	.	ENSG00000175213	ENST00000311764	T	0.10477	2.87	4.23	-0.267	0.12938	.	0.556654	0.15031	N	0.284422	T	0.05547	0.0146	L	0.27053	0.805	0.09310	N	1	B;B	0.22480	0.07;0.015	B;B	0.15870	0.014;0.006	T	0.33548	-0.9864	10	0.48119	T	0.1	-0.8622	0.7228	0.00943	0.1923:0.159:0.3225:0.3262	.	636;644	B4DXY4;Q9H9D4	.;ZN408_HUMAN	S	644	ENSP00000309606:A644S	ENSP00000309606:A644S	A	+	1	0	ZNF408	46683756	.	.	0.019000	0.16419	0.901000	0.52897	.	.	0.149000	0.19098	0.557000	0.71058	GCT		0.637	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390485.2	NM_024741		4	96	0	0	0	1	0	4	96				
GFI1B	8328	broad.mit.edu	37	9	135865217	135865217	+	Missense_Mutation	SNP	G	G	T			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr9:135865217G>T	ENST00000339463.3	+	10	1556	c.737G>T	c.(736-738)cGg>cTg	p.R246L	GFI1B_ENST00000372123.1_Missense_Mutation_p.R200L|GFI1B_ENST00000372122.1_Missense_Mutation_p.R246L|GFI1B_ENST00000450530.1_Missense_Mutation_p.R246L|GFI1B_ENST00000534944.1_Missense_Mutation_p.R200L|GFI1B_ENST00000372124.1_Missense_Mutation_p.R200L			Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription repressor	246	Interaction with ARIH2.|Mediates interaction with GATA1.				cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K9 methylation (GO:0051574)|regulation of erythrocyte differentiation (GO:0045646)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II transcription factor binding (GO:0001085)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		TCAGACACGCGGCCCTACCCC	0.612																																						uc004ccg.3																			0				central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21						c.(736-738)cGg>cTg		Homo sapiens growth factor independent 1B transcription repressor (GFI1B), transcript variant 1, mRNA.							80.0	63.0	69.0					9																	135865217		2203	4300	6503	SO:0001583	missense	8328				cell proliferation|chromatin modification|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|zinc ion binding	g.chr9:135865217G>T	AF081946	CCDS6957.1, CCDS48049.1	9q34.13	2014-09-17	2007-10-04		ENSG00000165702	ENSG00000165702		"""Zinc fingers, C2H2-type"""	4238	protein-coding gene	gene with protein product		604383	"""growth factor independent 1B (potential regulator of CDKN1A, translocated in CML)"""			9878267	Standard	NM_001135031		Approved		uc004ccg.3	Q5VTD9	OTTHUMG00000020848	ENST00000339463.3:c.737G>T	9.37:g.135865217G>T	ENSP00000344782:p.Arg246Leu					GFI1B_uc010mzy.3_Missense_Mutation_p.R200L	p.R246L	NM_004188	NP_004179	Q5VTD9	GFI1B_HUMAN		OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)	5	1092	+			246			Interaction with ARIH2.|Mediates interaction with GATA1.		O95270|Q5VTD8|Q6FHZ2|Q6T888	Missense_Mutation	SNP	ENST00000339463.3	37	c.737G>T	CCDS6957.1	.	.	.	.	.	.	.	.	.	.	G	31	5.098361	0.94197	.	.	ENSG00000165702	ENST00000372124;ENST00000339463;ENST00000450530;ENST00000534944;ENST00000372123;ENST00000372122	T;T;T;T;T;T	0.29917	1.55;2.38;2.38;1.55;1.55;2.38	4.67	4.67	0.58626	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.52917	0.1764	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.57106	-0.7868	10	0.87932	D	0	-35.7585	16.9334	0.86197	0.0:0.0:1.0:0.0	.	200;246	Q5VTD9-2;Q5VTD9	.;GFI1B_HUMAN	L	200;246;246;200;200;246	ENSP00000361197:R200L;ENSP00000344782:R246L;ENSP00000409546:R246L;ENSP00000446134:R200L;ENSP00000361196:R200L;ENSP00000361195:R246L	ENSP00000344782:R246L	R	+	2	0	GFI1B	134855038	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.585000	0.98223	2.294000	0.77228	0.491000	0.48974	CGG		0.612	GFI1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393840.1	NM_004188		3	73	0	0	0	1	0	3	73				
GCSH	2653	broad.mit.edu	37	16	81129777	81129777	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr16:81129777delC	ENST00000315467.3	-	1	231	c.107delG	c.(106-108)ggcfs	p.G36fs	GCSH_ENST00000566566.1_Frame_Shift_Del_p.G36fs	NM_004483.4	NP_004474.2	P23434	GCSH_HUMAN	glycine cleavage system protein H (aminomethyl carrier)	36					glycine catabolic process (GO:0006546)|glycine decarboxylation via glycine cleavage system (GO:0019464)|methylation (GO:0032259)	glycine cleavage complex (GO:0005960)|mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|skin(2)	5					Glycine(DB00145)	ACGGACGGCGCCCACCCCCAG	0.781																																						uc002fgd.3																			0				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|skin(2)	5						c.(106-108)ggcfs		Homo sapiens glycine cleavage system protein H (aminomethyl carrier) (GCSH), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA.	Glycine(DB00145)						2.0	2.0	2.0					16																	81129777		1367	2776	4143	SO:0001589	frameshift_variant	2653					glycine cleavage complex|mitochondrion	aminomethyltransferase activity	g.chr16:81129777delC	M69175	CCDS10933.1	16q23.2	2014-09-17			ENSG00000140905	ENSG00000140905			4208	protein-coding gene	gene with protein product	"""lipoic acid-containing protein"""	238330				1671321, 2025283	Standard	NM_004483		Approved		uc002fgd.3	P23434	OTTHUMG00000137626	ENST00000315467.3:c.107delG	16.37:g.81129777delC	ENSP00000319531:p.Gly36fs					GCSH_uc002fge.3_Non-coding_Transcript	p.G36fs	NM_004483	NP_004474	P23434	GCSH_HUMAN			0	204	-			36					Q9H1E9	Frame_Shift_Del	DEL	ENST00000315467.3	37	c.107delG	CCDS10933.1																																																																																				0.781	GCSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269049.1	NM_004483		2	4						2	4	---	---	---	---
FOXC2	2303	broad.mit.edu	37	16	86601995	86601995	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EM-A3AQ-01A-11D-A20C-08	TCGA-EM-A3AQ-10A-01D-A20C-08								Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dbacc1ad-c88a-4bcf-a45f-e9c83c762164	e20e9f74-04bd-477e-a3f6-4e2cceb6d41e	g.chr16:86601995delC	ENST00000320354.4	+	1	1139	c.1054delC	c.(1054-1056)cccfs	p.P352fs	RP11-463O9.5_ENST00000563280.1_RNA	NM_005251.2	NP_005242.1	Q99958	FOXC2_HUMAN	forkhead box C2 (MFH-1, mesenchyme forkhead 1)	352					artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|embryonic viscerocranium morphogenesis (GO:0048703)|glomerular endothelium development (GO:0072011)|glomerular mesangial cell development (GO:0072144)|glomerular visceral epithelial cell differentiation (GO:0072112)|heart development (GO:0007507)|insulin receptor signaling pathway (GO:0008286)|lymphangiogenesis (GO:0001946)|mesoderm development (GO:0007498)|metanephros development (GO:0001656)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|ossification (GO:0001503)|paraxial mesodermal cell fate commitment (GO:0048343)|patterning of blood vessels (GO:0001569)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular wound healing (GO:0035470)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|response to hormone (GO:0009725)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						GTGCGTCCCGCCCGCCCTGGA	0.771									Late-onset Hereditary Lymphedema																													uc002fjq.3																			0				breast(1)|cervix(1)|endometrium(2)|kidney(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	15						c.(1054-1056)cccfs		Homo sapiens forkhead box C2 (MFH-1, mesenchyme forkhead 1) (FOXC2), mRNA.							2.0	3.0	2.0					16																	86601995		1336	2700	4036	SO:0001589	frameshift_variant	2303	Late-onset Hereditary Lymphedema	Familial Cancer Database	Hereditary Lymphedema type II, Meige Lymphedema	Notch signaling pathway|anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	DNA bending activity|chromatin DNA binding|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding	g.chr16:86601995delC	Y08223	CCDS10958.1	16q24.1	2008-04-10			ENSG00000176692	ENSG00000176692		"""Forkhead boxes"""	3801	protein-coding gene	gene with protein product		602402		FKHL14		9169153, 8674414	Standard	NM_005251		Approved	MFH-1	uc002fjq.3	Q99958	OTTHUMG00000137652	ENST00000320354.4:c.1054delC	16.37:g.86601995delC	ENSP00000326371:p.Pro352fs						p.P352fs	NM_005251	NP_005242	Q99958	FOXC2_HUMAN			0	1139	+			352					C6KMR9|Q14DA6	Frame_Shift_Del	DEL	ENST00000320354.4	37	c.1054delC	CCDS10958.1																																																																																				0.771	FOXC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269104.2	NM_005251		2	4						2	4	---	---	---	---
