Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	chromosome_name_WU	start_WU	stop_WU	reference_WU	variant_WU	type_WU	gene_name_WU	transcript_name_WU	transcript_species_WU	transcript_source_WU	transcript_version_WU	strand_WU	transcript_status_WU	trv_type_WU	c_position_WU	amino_acid_change_WU	ucsc_cons_WU	domain_WU	all_domains_WU	deletion_substructures_WU	transcript_error_WU
KRT79	338785	genome.wustl.edu	36	12	51502047	51502047	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	12	51502047	51502047	C	T	SNP	KRT79	NM_175834	human	genbank	54_36p	-1	validated	missense	c.1484	p.G495E	0.055	NULL	superfamily_Prefoldin,HMMPfam_Filament,PatternScan_IF	-	no_errors
FLT3	2322	genome.wustl.edu	36	13	27506263	27506264	+	In_Frame_Ins	INS	-	-	CATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGG			TCGA-AB-2986-03	TCGA-AB-2986-03					-	-	Verified	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	13	27506311	27506312	0	CATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGG	INS	FLT3	NM_004119	human	genbank	54_36p	-1	reviewed	in_frame_ins	c.1744_1744	ITD	0.986:0.998	NULL	HMMPfam_Pkinase_Tyr;superfamily_Protein kinase-like (PK-like);HMMPfam_ig;superfamily_Immunoglobulin	-	
RBM41	55285	genome.wustl.edu	36	X	106197570	106197570	+	Missense_Mutation	SNP	A	A	C			TCGA-AB-2986-03	TCGA-AB-2986-03	A	A			A	A	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	X	106197570	106197570	A	C	SNP	RBM41	NM_018301	human	genbank	54_36p	-1	provisional	missense	c.1085	p.I362R	0.636	HMMPfam_RRM_1,HMMSmart_SM00360,superfamily_RNA-binding domain RBD	HMMPfam_RRM_1,HMMSmart_SM00360,superfamily_RNA-binding domain RBD	-	no_errors
NAE1	8883	genome.wustl.edu	36	16	65414670	65414670	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	16	65414670	65414670	C	T	SNP	NAE1	NM_003905	human	genbank	54_36p	-1	reviewed	missense	c.362	p.C121Y	1.000	HMMPfam_ThiF,superfamily_Activating enzymes of the ubiquitin-like proteins	HMMPfam_ThiF,superfamily_Activating enzymes of the ubiquitin-like proteins	-	no_errors
NPM1	4869	genome.wustl.edu	36	5	170770152	170770153	+	Frame_Shift_Ins	INS	-	-	CCTG			TCGA-AB-2986-03	TCGA-AB-2986-03	-	-			-	-	Verified	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	5	170770152	170770153	0	CCTG	INS	NPM1	NM_002520	human	genbank	54_36p	1	validated	frame_shift_ins	c.863_864	p.W288fs	1.000:1.000	NULL	Nucleoplasmin;HMMPfam_Nucleoplasmin;Nucleoplasmin-like	-	
GLRA1	2741	genome.wustl.edu	36	5	151284287	151284287	+	Missense_Mutation	SNP	G	G	A			TCGA-AB-2986-03	TCGA-AB-2986-03	G	G			G	G	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	5	151284287	151284287	G	A	SNP	GLRA1	NM_000171	human	genbank	54_36p	-1	reviewed	missense	c.17	p.T6I	1.000	NULL	HMMPfam_Neur_chan_memb,superfamily_Neurotransmitter-gated ion-channel transmembrane pore,HMMPfam_Neur_chan_LBD,superfamily_Nicotinic receptor ligand binding domain-like,PatternScan_NEUROTR_ION_CHANNEL	-	no_errors
FRMPD3	84443	genome.wustl.edu	36	X	106728014	106728014	+	Missense_Mutation	SNP	C	C	A			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	X	106728014	106728014	C	A	SNP	FRMPD3	XM_042978	human	genbank	54_36p	+1	model	missense	c.2348	p.P783H	1.000	NULL	HMMPfam_PDZ,HMMSmart_PDZ,superfamily_PDZ,PatternScan_FERM_1,PatternScan_FERM_2,HMMPfam_FERM_M,superfamily_FERM_3-hlx,HMMSmart_B41	-	no_errors
CTSG	1511	genome.wustl.edu	36	14	24113801	24113801	+	Missense_Mutation	SNP	G	G	T			TCGA-AB-2986-03	TCGA-AB-2986-03	G	G			G	G	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	14	24113801	24113801	G	T	SNP	CTSG	NM_001911	human	genbank	54_36p	-1	reviewed	missense	c.259	p.Q87K	0.994	HMMPfam_Trypsin,HMMSmart_Tryp_SPc,superfamily_Pept_Ser_Cys	HMMPfam_Trypsin,HMMSmart_Tryp_SPc,superfamily_Pept_Ser_Cys,PatternScan_TRYPSIN_HIS,PatternScan_TRYPSIN_SER	-	no_errors
POU6F2	11281	genome.wustl.edu	36	7	39345840	39345840	+	Nonsense_Mutation	SNP	C	C	T			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	7	39345840	39345840	C	T	SNP	POU6F2	NM_007252	human	genbank	54_36p	+1	validated	nonsense	c.586	p.Q196*	0.001	NULL	HMMPfam_Pou,HMMSmart_SM00352,PatternScan_POU_1,PatternScan_POU_2,HMMPfam_Homeobox,HMMSmart_SM00389,superfamily_Homeodomain-like,superfamily_lambda repressor-like DNA-binding domains	-	no_errors
OR51S1	119692	genome.wustl.edu	36	11	4826821	4826821	+	Missense_Mutation	SNP	C	C	T			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	11	4826821	4826821	C	T	SNP	OR51S1	NM_001004758	human	genbank	54_36p	-1	provisional	missense	c.194	p.R65H	0.000	HMMPfam_7tm_1,superfamily_Family A G protein-coupled receptor-like	HMMPfam_7tm_1,PatternScan_SPASE_I_1,superfamily_Family A G protein-coupled receptor-like	-	no_errors
LOC644992	644992	genome.wustl.edu	36	11	13588724	13588724	+	Missense_Mutation	SNP	T	T	C			TCGA-AB-2986-03	TCGA-AB-2986-03	T	T			T	T	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	11	13588724	13588724	T	C	SNP	LOC644992	XM_932569	human	genbank	54_36p	-1	model	missense	c.106	p.R36G	0.983	HMMPfam_HMG14_17,HMMSmart_SM00527	HMMPfam_HMG14_17,HMMSmart_SM00527	-	no_errors
FLRT2	23768	genome.wustl.edu	36	14	85159164	85159164	+	Missense_Mutation	SNP	A	A	T			TCGA-AB-2986-03	TCGA-AB-2986-03	A	A			A	A	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	14	85159164	85159164	A	T	SNP	FLRT2	NM_013231	human	genbank	54_36p	+1	reviewed	missense	c.1553	p.Y518F	0.501	NULL	HMMPfam_LRRNT,HMMSmart_LRRNT,HMMPfam_LRRCT,HMMSmart_LRRCT,HMMPfam_LRR_1,HMMSmart_LRR_TYP,HMMPfam_fn3,HMMSmart_FN3,superfamily_FN_III-like,superfamily_SSF52058	-	no_errors
ENSG00000210408	0	genome.wustl.edu	36	14	83286553	83286553	+	RNA	SNP	G	G	A			TCGA-AB-2986-03	TCGA-AB-2986-03	G	G			G	G	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	14	83286553	83286553	G	A	SNP	ENSG00000210408	ENST00000387673	human	ensembl	54_36p	+1	novel	rna	NULL	NULL	0.971	-	-	-	pseudogene
RNASE9	390443	genome.wustl.edu	36	14	20095006	20095006	+	Silent	SNP	C	C	T			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	14	20095006	20095006	C	T	SNP	RNASE9	NM_001001673	human	genbank	54_36p	-1	provisional	silent	c.63	p.L21	0.000	NULL	superfamily_RNase A-like	-	no_errors
RAD21	5885	genome.wustl.edu	36	8	117938741	117938741	+	Nonsense_Mutation	SNP	C	C	A			TCGA-AB-2986-03	TCGA-AB-2986-03	C	C			C	C	Unknown	Valid	Somatic		WGS	Illumina_Capture			Illumina GAIIx	8	117938741	117938741	C	A	SNP	RAD21	NM_006265	human	genbank	54_36p	-1	reviewed	nonsense	c.634	p.E212*	1.000	NULL	HMMPfam_Rad21_Rec8,HMMPfam_Rad21_Rec8_N	-	no_errors
