Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	MUTSIG_Significant_Genes	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
AGAP4	119016	broad.mit.edu	37	10	46342668	46342688	+	In_Frame_Del	DEL	GCTCCTGCCATCCTGTCCCCA	-	-			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46342668_46342688delGCTCCTGCCATCCTGTCCCCA	uc001jcx.3	-	1	234_254	c.108_128delTGGGGACAGGATGGCAGGAGC	c.(106-129)GCTGGGGACAGGATGGCAGGAGCG>GCG	p.36_43AGDRMAGA>A	AGAP4_uc010qfl.1_In_Frame_Del_p.36_43AGDRMAGA>A|AGAP4_uc001jcy.3_5'UTR	NM_133446	NP_597703	Q96P64	AGAP4_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH	36_43					regulation of ARF GTPase activity		ARF GTPase activator activity|zinc ion binding			ovary(1)	1																		---	---	---	---	capture_indel		In_Frame_Del	DEL	46342668	46342688	372	10	GCTCCTGCCATCCTGTCCCCA	-	-	38	38	AGAP4	-	5	5
APOB	338	broad.mit.edu	37	2	21266775	21266783	+	In_Frame_Del	DEL	GCAGCGCCA	-	-	rs17240441		TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21266775_21266783delGCAGCGCCA	uc002red.2	-	1	163_171	c.35_43delTGGCGCTGC	c.(34-45)CTGGCGCTGCCT>CCT	p.LAL12del		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	12_14					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---	capture_indel		In_Frame_Del	DEL	21266775	21266783	796	2	GCAGCGCCA	-	-	42	42	APOB	-	5	5
PLA2G2E	30814	broad.mit.edu	37	1	20249215	20249215	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20249215C>G	uc001bct.1	-	2	132	c.74G>C	c.(73-75)GGG>GCG	p.G25A		NM_014589	NP_055404	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE precursor	25					inflammatory response|lipid catabolic process|phospholipid metabolic process	extracellular region	calcium ion binding|phospholipase A2 activity				0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---	capture		Missense_Mutation	SNP	20249215	20249215	12424	1	C	G	G	22	22	PLA2G2E	G	3	3
AGL	178	broad.mit.edu	37	1	100346221	100346221	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100346221G>C	uc001dsi.1	+	14	2169	c.1769G>C	c.(1768-1770)GGC>GCC	p.G590A	AGL_uc001dsj.1_Missense_Mutation_p.G590A|AGL_uc001dsk.1_Missense_Mutation_p.G590A|AGL_uc001dsl.1_Missense_Mutation_p.G590A|AGL_uc001dsm.1_Missense_Mutation_p.G574A|AGL_uc001dsn.1_Missense_Mutation_p.G573A	NM_000642	NP_000633	P35573	GDE_HUMAN	amylo-1,6-glucosidase,	590	4-alpha-glucanotransferase.				glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|isoamylase complex|nucleus	4-alpha-glucanotransferase activity|amylo-alpha-1,6-glucosidase activity|cation binding			ovary(1)|central_nervous_system(1)|skin(1)	3		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)														---	---	---	---	capture		Missense_Mutation	SNP	100346221	100346221	387	1	G	C	C	42	42	AGL	C	3	3
PTPN14	5784	broad.mit.edu	37	1	214557127	214557127	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214557127G>C	uc001hkk.1	-	13	2342	c.2071C>G	c.(2071-2073)CAG>GAG	p.Q691E	PTPN14_uc010pty.1_Missense_Mutation_p.Q592E	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	691					lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)														---	---	---	---	capture		Missense_Mutation	SNP	214557127	214557127	13238	1	G	C	C	45	45	PTPN14	C	3	3
RAB4A	5867	broad.mit.edu	37	1	229434748	229434748	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229434748C>T	uc001hth.2	+	6	678	c.470C>T	c.(469-471)GCG>GTG	p.A157V	RAB4A_uc001hti.2_RNA|RAB4A_uc001htj.2_RNA	NM_004578	NP_004569	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family	152	GTP.						GDP binding|GTP binding|GTPase activity			ovary(1)	1	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)																---	---	---	---	capture		Missense_Mutation	SNP	229434748	229434748	13405	1	C	T	T	27	27	RAB4A	T	1	1
PLD5	200150	broad.mit.edu	37	1	242451818	242451818	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242451818T>C	uc001hzn.1	-	3	468	c.341A>G	c.(340-342)GAA>GGA	p.E114G	PLD5_uc001hzl.3_Missense_Mutation_p.E52G|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Missense_Mutation_p.E22G			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	114						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---	capture		Missense_Mutation	SNP	242451818	242451818	12475	1	T	C	C	62	62	PLD5	C	4	4
PARD3	56288	broad.mit.edu	37	10	34759074	34759074	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34759074G>C	uc010qej.1	-	4	521	c.521C>G	c.(520-522)TCA>TGA	p.S174*	PARD3_uc010qek.1_Nonsense_Mutation_p.S174*|PARD3_uc010qel.1_Nonsense_Mutation_p.S174*|PARD3_uc010qem.1_Nonsense_Mutation_p.S174*|PARD3_uc010qen.1_Nonsense_Mutation_p.S174*|PARD3_uc010qeo.1_Nonsense_Mutation_p.S174*|PARD3_uc010qep.1_Nonsense_Mutation_p.S174*|PARD3_uc010qeq.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixp.1_Nonsense_Mutation_p.S39*|PARD3_uc001ixq.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixr.1_Nonsense_Mutation_p.S174*|PARD3_uc001ixt.1_Nonsense_Mutation_p.S39*|PARD3_uc001ixu.1_Nonsense_Mutation_p.S174*	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog	174					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)																---	---	---	---	capture		Nonsense_Mutation	SNP	34759074	34759074	11860	10	G	C	C	45	45	PARD3	C	5	3
PLCE1	51196	broad.mit.edu	37	10	96039545	96039545	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96039545C>T	uc001kjk.2	+	20	5306	c.4672C>T	c.(4672-4674)CAG>TAG	p.Q1558*	PLCE1_uc010qnx.1_Nonsense_Mutation_p.Q1542*|PLCE1_uc001kjm.2_Nonsense_Mutation_p.Q1250*|uc001kjo.1_RNA	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	1558					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)														OREG0020383	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Nonsense_Mutation	SNP	96039545	96039545	12460	10	C	T	T	29	29	PLCE1	T	5	2
PSD	5662	broad.mit.edu	37	10	104176760	104176760	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104176760G>A	uc001kvg.1	-	2	563	c.36C>T	c.(34-36)GGC>GGT	p.G12G	PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Silent_p.G12G|PSD_uc001kvi.1_Silent_p.G12G|FBXL15_uc001kvj.1_5'Flank|FBXL15_uc001kvk.2_5'Flank	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	12					regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)														---	---	---	---	capture		Silent	SNP	104176760	104176760	13099	10	G	A	A	38	38	PSD	A	1	1
OR51V1	283111	broad.mit.edu	37	11	5221326	5221326	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221326C>G	uc010qyz.1	-	1	605	c.605G>C	c.(604-606)CGA>CCA	p.R202P		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	202	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Missense_Mutation	SNP	5221326	5221326	11517	11	C	G	G	31	31	OR51V1	G	3	3
OR2D2	120776	broad.mit.edu	37	11	6913340	6913340	+	Missense_Mutation	SNP	C	T	T	rs143950338		TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6913340C>T	uc010rau.1	-	1	392	c.392G>A	c.(391-393)CGT>CAT	p.R131H		NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)														---	---	---	---	capture		Missense_Mutation	SNP	6913340	6913340	11400	11	C	T	T	19	19	OR2D2	T	1	1
EIF4G2	1982	broad.mit.edu	37	11	10820934	10820934	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820934T>G	uc001mjc.2	-	20	2779	c.2362A>C	c.(2362-2364)AGC>CGC	p.S788R	EIF4G2_uc001mjb.2_Missense_Mutation_p.S582R|EIF4G2_uc009ygf.2_Missense_Mutation_p.S582R|EIF4G2_uc001mjd.2_Missense_Mutation_p.S750R	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	788	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)														---	---	---	---	capture		Missense_Mutation	SNP	10820934	10820934	5228	11	T	G	G	55	55	EIF4G2	G	4	4
EIF4G2	1982	broad.mit.edu	37	11	10820951	10820951	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10820951C>G	uc001mjc.2	-	20	2762	c.2345G>C	c.(2344-2346)AGT>ACT	p.S782T	EIF4G2_uc001mjb.2_Missense_Mutation_p.S576T|EIF4G2_uc009ygf.2_Missense_Mutation_p.S576T|EIF4G2_uc001mjd.2_Missense_Mutation_p.S744T	NM_001418	NP_001409	P78344	IF4G2_HUMAN	eukaryotic translation initiation factor 4	782	W2.				cell cycle arrest|cell death|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			ovary(1)|central_nervous_system(1)	2				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)														---	---	---	---	capture		Missense_Mutation	SNP	10820951	10820951	5228	11	C	G	G	20	20	EIF4G2	G	3	3
SPDYC	387778	broad.mit.edu	37	11	64940229	64940229	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64940229C>T	uc010rnz.1	+	6	591	c.591C>T	c.(589-591)GTC>GTT	p.V197V		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	197					cell cycle	nucleus	protein kinase binding				0																		---	---	---	---	capture		Silent	SNP	64940229	64940229	15538	11	C	T	T	32	32	SPDYC	T	2	2
SPDYC	387778	broad.mit.edu	37	11	64940371	64940371	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64940371C>T	uc010rnz.1	+	6	733	c.733C>T	c.(733-735)CAT>TAT	p.H245Y		NM_001008778	NP_001008778	Q5MJ68	SPDYC_HUMAN	speedy C	245					cell cycle	nucleus	protein kinase binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	64940371	64940371	15538	11	C	T	T	29	29	SPDYC	T	2	2
SF3B2	10992	broad.mit.edu	37	11	65835421	65835421	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65835421G>C	uc001ogy.1	+	20	2375	c.2335G>C	c.(2335-2337)GAG>CAG	p.E779Q	PACS1_uc001ogz.1_5'Flank|PACS1_uc001oha.1_5'Flank	NM_006842	NP_006833	Q13435	SF3B2_HUMAN	splicing factor 3B subunit 2	779					interspecies interaction between organisms	catalytic step 2 spliceosome|nucleoplasm|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(2)|breast(1)	3																OREG0021094	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	65835421	65835421	14640	11	G	C	C	45	45	SF3B2	C	3	3
FAT3	120114	broad.mit.edu	37	11	92534482	92534482	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92534482A>G	uc001pdj.3	+	9	8320	c.8303A>G	c.(8302-8304)GAC>GGC	p.D2768G		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2768	Extracellular (Potential).|Cadherin 25.				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)													TCGA Ovarian(4;0.039)			---	---	---	---	capture		Missense_Mutation	SNP	92534482	92534482	5927	11	A	G	G	10	10	FAT3	G	4	4
SIK3	23387	broad.mit.edu	37	11	116730126	116730126	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116730126C>T	uc001ppy.2	-	19	2338	c.2302G>A	c.(2302-2304)GCA>ACA	p.A768T	SIK3_uc001ppz.2_Missense_Mutation_p.A667T|SIK3_uc001pqa.2_Missense_Mutation_p.A768T|SIK3_uc001ppw.2_Missense_Mutation_p.A185T|SIK3_uc001ppx.2_Missense_Mutation_p.A206T|SIK3_uc001pqb.2_Missense_Mutation_p.A71T	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	768	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12																OREG0003491	type=REGULATORY REGION|Gene=AK022302|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---	capture		Missense_Mutation	SNP	116730126	116730126	14814	11	C	T	T	25	25	SIK3	T	2	2
ABCD2	225	broad.mit.edu	37	12	40010967	40010967	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40010967C>G	uc001rmb.2	-	2	1369	c.943G>C	c.(943-945)GAA>CAA	p.E315Q		NM_005164	NP_005155	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D, member 2	315	ABC transmembrane type-1.				fatty acid metabolic process|transport	ATP-binding cassette (ABC) transporter complex|integral to plasma membrane|peroxisomal membrane	ATP binding|ATPase activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)|skin(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	40010967	40010967	62	12	C	G	G	32	32	ABCD2	G	3	3
RASSF9	9182	broad.mit.edu	37	12	86199520	86199520	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86199520G>A	uc001taf.1	-	2	607	c.268C>T	c.(268-270)CTT>TTT	p.L90F		NM_005447	NP_005438	O75901	RASF9_HUMAN	Ras association (RalGDS/AF-6) domain family	90	Ras-associating.				endosome transport|protein targeting|signal transduction	cytosol|endosome|trans-Golgi network transport vesicle membrane	protein binding|transporter activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	86199520	86199520	13554	12	G	A	A	33	33	RASSF9	A	2	2
PRDM4	11108	broad.mit.edu	37	12	108145615	108145615	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108145615G>A	uc001tmp.2	-	5	1140	c.703C>T	c.(703-705)CTG>TTG	p.L235L	PRDM4_uc001tmq.2_RNA	NM_012406	NP_036538	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	235					cell proliferation|negative regulation of cell cycle|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2																		---	---	---	---	capture		Silent	SNP	108145615	108145615	12901	12	G	A	A	33	33	PRDM4	A	2	2
KCTD10	83892	broad.mit.edu	37	12	109895804	109895804	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109895804G>T	uc001toi.1	-	4	555	c.467C>A	c.(466-468)TCA>TAA	p.S156*	KCTD10_uc001toh.1_RNA|KCTD10_uc009zvi.1_Nonsense_Mutation_p.S153*|KCTD10_uc001toj.1_Nonsense_Mutation_p.S165*|KCTD10_uc001tok.1_5'UTR	NM_031954	NP_114160	Q9H3F6	BACD3_HUMAN	potassium channel tetramerisation domain	156					proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination	Cul3-RING ubiquitin ligase complex|cytoplasm|nucleus|voltage-gated potassium channel complex	voltage-gated potassium channel activity				0																		---	---	---	---	capture		Nonsense_Mutation	SNP	109895804	109895804	8403	12	G	T	T	45	45	KCTD10	T	5	2
STARD13	90627	broad.mit.edu	37	13	33704299	33704299	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33704299G>A	uc001uuw.2	-	5	641	c.515C>T	c.(514-516)CCG>CTG	p.P172L	STARD13_uc001uuu.2_Missense_Mutation_p.P164L|STARD13_uc001uuv.2_Missense_Mutation_p.P54L|STARD13_uc001uux.2_Missense_Mutation_p.P137L|STARD13_uc010tec.1_RNA|STARD13_uc010abh.1_Missense_Mutation_p.P157L	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain	172					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)														---	---	---	---	capture		Missense_Mutation	SNP	33704299	33704299	15775	13	G	A	A	39	39	STARD13	A	1	1
SIX4	51804	broad.mit.edu	37	14	61190296	61190296	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61190296T>C	uc001xfc.2	-	1	497	c.497A>G	c.(496-498)TAC>TGC	p.Y166C	SIX4_uc010app.1_Missense_Mutation_p.Y158C	NM_017420	NP_059116	Q9UIU6	SIX4_HUMAN	sine oculis homeobox homolog 4	166						nucleus				breast(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0275)														---	---	---	---	capture		Missense_Mutation	SNP	61190296	61190296	14844	14	T	C	C	57	57	SIX4	C	4	4
SNAPC1	6617	broad.mit.edu	37	14	62249063	62249063	+	Missense_Mutation	SNP	G	C	C	rs145109867		TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62249063G>C	uc001xft.2	+	8	1028	c.924G>C	c.(922-924)GAG>GAC	p.E308D		NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,	308					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)														---	---	---	---	capture		Missense_Mutation	SNP	62249063	62249063	15334	14	G	C	C	33	33	SNAPC1	C	3	3
SNAPC1	6617	broad.mit.edu	37	14	62249095	62249095	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62249095A>C	uc001xft.2	+	8	1060	c.956A>C	c.(955-957)AAG>ACG	p.K319T		NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,	319					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)														---	---	---	---	capture		Missense_Mutation	SNP	62249095	62249095	15334	14	A	C	C	3	3	SNAPC1	C	4	4
GALNTL1	57452	broad.mit.edu	37	14	69792679	69792679	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69792679C>T	uc010aqu.1	+	5	596	c.503C>T	c.(502-504)CCG>CTG	p.P168L	GALNTL1_uc001xla.1_Missense_Mutation_p.P168L|GALNTL1_uc001xlb.1_Missense_Mutation_p.P168L	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	168	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)														---	---	---	---	capture		Missense_Mutation	SNP	69792679	69792679	6485	14	C	T	T	27	27	GALNTL1	T	1	1
C14orf68	283600	broad.mit.edu	37	14	100793708	100793708	+	Splice_Site	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100793708G>A	uc001yhc.2	+	4	400	c.327_splice	c.e4+1	p.R109_splice	C14orf68_uc001yhd.2_Splice_Site	NM_207117	NP_997000			chromosome 14 open reading frame 68						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0		Melanoma(154;0.152)																---	---	---	---	capture		Splice_Site	SNP	100793708	100793708	1828	14	G	A	A	40	40	C14orf68	A	5	1
HSP90AA1	3320	broad.mit.edu	37	14	102552590	102552590	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102552590C>G	uc001yku.3	-	2	316	c.126G>C	c.(124-126)GAG>GAC	p.E42D	HSP90AA1_uc001ykv.3_Missense_Mutation_p.E164D|HSP90AA1_uc001ykw.1_5'UTR|HSP90AA1_uc001ykx.1_Missense_Mutation_p.E31D	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	42					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---	capture		Missense_Mutation	SNP	102552590	102552590	7700	14	C	G	G	32	32	HSP90AA1	G	3	3
HSP90AA1	3320	broad.mit.edu	37	14	102552599	102552599	+	Silent	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102552599C>G	uc001yku.3	-	2	307	c.117G>C	c.(115-117)TCG>TCC	p.S39S	HSP90AA1_uc001ykv.3_Silent_p.S161S|HSP90AA1_uc001ykw.1_5'UTR|HSP90AA1_uc001ykx.1_Silent_p.S28S	NM_005348	NP_005339	P07900	HS90A_HUMAN	heat shock 90kDa protein 1, alpha isoform 2	39					axon guidance|cellular chaperone-mediated protein complex assembly|G2/M transition of mitotic cell cycle|nitric oxide metabolic process|positive regulation of nitric oxide biosynthetic process|protein import into mitochondrial outer membrane|protein refolding|regulation of nitric-oxide synthase activity|response to unfolded protein|signal transduction	cytosol|melanosome|plasma membrane	ATP binding|ATPase activity|nitric-oxide synthase regulator activity|protein homodimerization activity|TPR domain binding|unfolded protein binding			ovary(2)|central_nervous_system(2)|prostate(1)|lung(1)|breast(1)	7					Rifabutin(DB00615)													---	---	---	---	capture		Silent	SNP	102552599	102552599	7700	14	C	G	G	31	31	HSP90AA1	G	3	3
AQR	9716	broad.mit.edu	37	15	35202438	35202438	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35202438C>T	uc001ziv.2	-	17	1742	c.1561G>A	c.(1561-1563)GAA>AAA	p.E521K		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	521						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)														---	---	---	---	capture		Missense_Mutation	SNP	35202438	35202438	846	15	C	T	T	29	29	AQR	T	2	2
PYGO1	26108	broad.mit.edu	37	15	55838974	55838974	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55838974G>A	uc010bfl.1	-	3	563	c.507C>T	c.(505-507)GTC>GTT	p.V169V	PYGO1_uc002adf.1_Silent_p.V169V	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1	169	Asn-rich.				Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)														---	---	---	---	capture		Silent	SNP	55838974	55838974	13321	15	G	A	A	45	45	PYGO1	A	2	2
MYO9A	4649	broad.mit.edu	37	15	72338533	72338533	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72338533C>T	uc002atl.3	-	2	845	c.372G>A	c.(370-372)TGG>TGA	p.W124*	MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Nonsense_Mutation_p.W124*|MYO9A_uc002atn.1_Nonsense_Mutation_p.W124*	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	124					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---	capture		Nonsense_Mutation	SNP	72338533	72338533	10479	15	C	T	T	26	26	MYO9A	T	5	2
PDE8A	5151	broad.mit.edu	37	15	85664067	85664067	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85664067G>A	uc002blh.2	+	18	1963	c.1774G>A	c.(1774-1776)GCA>ACA	p.A592T	PDE8A_uc002bli.2_Missense_Mutation_p.A546T|PDE8A_uc010bnc.2_Missense_Mutation_p.A345T|PDE8A_uc010bnd.2_Missense_Mutation_p.A345T|PDE8A_uc002blj.2_Missense_Mutation_p.A212T|PDE8A_uc002blk.2_Missense_Mutation_p.A212T|PDE8A_uc002bll.2_5'UTR	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	592	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)															---	---	---	---	capture		Missense_Mutation	SNP	85664067	85664067	12074	15	G	A	A	38	38	PDE8A	A	1	1
HAGHL	84264	broad.mit.edu	37	16	777524	777524	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:777524C>T	uc002cjl.1	+	2	296	c.15C>T	c.(13-15)GTC>GTT	p.V5V	CCDC78_uc002cjf.2_5'Flank|CCDC78_uc002cji.3_5'Flank|CCDC78_uc002cjg.2_5'Flank|CCDC78_uc002cjj.3_5'Flank|CCDC78_uc002cjh.2_5'Flank|CCDC78_uc010uuo.1_5'Flank|CCDC78_uc002cjk.2_5'Flank|HAGHL_uc002cjm.1_Silent_p.V5V|HAGHL_uc002cjn.1_Silent_p.V5V|HAGHL_uc002cjo.1_Silent_p.V5V|HAGHL_uc010uup.1_Silent_p.V5V	NM_207112	NP_996995	Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like isoform 1	5							hydrolase activity|metal ion binding				0		Hepatocellular(780;0.00335)																---	---	---	---	capture		Silent	SNP	777524	777524	7228	16	C	T	T	29	29	HAGHL	T	2	2
VASN	114990	broad.mit.edu	37	16	4431778	4431778	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4431778C>T	uc002cwj.1	+	2	1055	c.900C>T	c.(898-900)TTC>TTT	p.F300F	CORO7_uc002cwe.2_Intron|CORO7_uc002cwf.2_Intron|CORO7_uc002cwg.3_Intron|CORO7_uc002cwh.3_Intron|CORO7_uc010uxh.1_Intron|CORO7_uc010uxi.1_Intron|CORO7_uc002cwi.1_Intron|CORO7_uc010uxj.1_Intron|CORO7_uc010btp.1_Intron	NM_138440	NP_612449	Q6EMK4	VASN_HUMAN	slit-like 2 precursor	300	Extracellular (Potential).|LRRCT.					extracellular region|integral to membrane					0																		---	---	---	---	capture		Silent	SNP	4431778	4431778	17692	16	C	T	T	29	29	VASN	T	2	2
ANKS4B	257629	broad.mit.edu	37	16	21262054	21262054	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21262054G>A	uc010bwp.1	+	2	1210	c.1167G>A	c.(1165-1167)CTG>CTA	p.L389L	CRYM_uc010bwq.1_Intron	NM_145865	NP_665872	Q8N8V4	ANS4B_HUMAN	harmonin-interacting ankyrin-repeat containing	389	SAM.									ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0565)														---	---	---	---	capture		Silent	SNP	21262054	21262054	699	16	G	A	A	47	47	ANKS4B	A	2	2
SCNN1B	6338	broad.mit.edu	37	16	23391849	23391849	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23391849C>T	uc002dln.2	+	13	1826	c.1650C>T	c.(1648-1650)ATC>ATT	p.I550I		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	550	Cytoplasmic (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)													---	---	---	---	capture		Silent	SNP	23391849	23391849	14410	16	C	T	T	29	29	SCNN1B	T	2	2
VPS35	55737	broad.mit.edu	37	16	46694409	46694409	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46694409G>T	uc002eef.3	-	17	2465	c.2366C>A	c.(2365-2367)CCA>CAA	p.P789Q	VPS35_uc002eed.2_3'UTR|VPS35_uc002eee.2_Missense_Mutation_p.P750Q	NM_018206	NP_060676	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35	789					protein transport|retrograde transport, endosome to Golgi	cytosol|endosome|membrane	protein binding				0		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)																---	---	---	---	capture		Missense_Mutation	SNP	46694409	46694409	17770	16	G	T	T	47	47	VPS35	T	2	2
SALL1	6299	broad.mit.edu	37	16	51175080	51175080	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175080C>T	uc010vgs.1	-	2	1084	c.1053G>A	c.(1051-1053)CCG>CCA	p.P351P	SALL1_uc010vgr.1_Silent_p.P254P|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	351					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)															---	---	---	---	capture		Silent	SNP	51175080	51175080	14290	16	C	T	T	19	19	SALL1	T	1	1
PDPR	55066	broad.mit.edu	37	16	70166157	70166157	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70166157G>C	uc002eyf.1	+	9	1908	c.951G>C	c.(949-951)AAG>AAC	p.K317N	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.K217N|PDPR_uc002eyg.1_Missense_Mutation_p.K45N	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	317					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)														---	---	---	---	capture		Missense_Mutation	SNP	70166157	70166157	12110	16	G	C	C	33	33	PDPR	C	3	3
AP1G1	164	broad.mit.edu	37	16	71803595	71803595	+	Silent	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71803595G>C	uc010cgg.2	-	6	887	c.573C>G	c.(571-573)CTC>CTG	p.L191L	AP1G1_uc002fba.2_Silent_p.L191L|AP1G1_uc002fbb.2_Silent_p.L214L|AP1G1_uc010vmg.1_RNA|AP1G1_uc010vmh.1_Silent_p.L273L	NM_001128	NP_001119	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1	191					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|recycling endosome	kinesin binding|protein transporter activity			ovary(2)	2		Ovarian(137;0.125)																---	---	---	---	capture		Silent	SNP	71803595	71803595	742	16	G	C	C	41	41	AP1G1	C	3	3
PLCG2	5336	broad.mit.edu	37	16	81934360	81934360	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81934360A>T	uc002fgt.2	+	14	1489	c.1337A>T	c.(1336-1338)CAG>CTG	p.Q446L	PLCG2_uc010chg.1_Missense_Mutation_p.Q446L	NM_002661	NP_002652	P16885	PLCG2_HUMAN	phospholipase C, gamma 2	446	PI-PLC X-box.				intracellular signal transduction|phospholipid catabolic process|platelet activation	plasma membrane	phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			large_intestine(4)|lung(2)|ovary(1)|skin(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	81934360	81934360	12462	16	A	T	T	7	7	PLCG2	T	4	4
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577127C>T	uc002gim.2	-	8	1005	c.811G>A	c.(811-813)GAG>AAG	p.E271K	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.E271K|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.E139K|TP53_uc010cng.1_Missense_Mutation_p.E139K|TP53_uc002gii.1_Missense_Mutation_p.E139K|TP53_uc010cnh.1_Missense_Mutation_p.E271K|TP53_uc010cni.1_Missense_Mutation_p.E271K|TP53_uc002gij.2_Missense_Mutation_p.E271K	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	271	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> A (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E271K(22)|p.E271*(14)|p.0?(7)|p.E271V(5)|p.E271Q(3)|p.E271G(3)|p.E271D(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.E271E(2)|p.E271fs*73(1)|p.E258fs*71(1)|p.E271_R273delEVR(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.E271P(1)|p.E271del(1)|p.S269fs*34(1)|p.E271fs*34(1)|p.E271fs*35(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---	capture		Missense_Mutation	SNP	7577127	7577127	16923	17	C	T	T	29	29	TP53	T	2	2
DNAH2	146754	broad.mit.edu	37	17	7678646	7678646	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7678646G>C	uc002giu.1	+	29	4821	c.4807G>C	c.(4807-4809)GAA>CAA	p.E1603Q		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1603	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---	capture		Missense_Mutation	SNP	7678646	7678646	4785	17	G	C	C	33	33	DNAH2	C	3	3
TRIM37	4591	broad.mit.edu	37	17	57093108	57093108	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57093108C>G	uc002iwy.3	-	21	2883	c.2439G>C	c.(2437-2439)TTG>TTC	p.L813F	TRIM37_uc002iwz.3_Missense_Mutation_p.L813F|TRIM37_uc002ixa.3_Missense_Mutation_p.L691F|TRIM37_uc010woc.1_Missense_Mutation_p.L779F	NM_001005207	NP_001005207	O94972	TRI37_HUMAN	tripartite motif-containing 37 protein	813						perinuclear region of cytoplasm|peroxisome	ligase activity|protein binding|zinc ion binding			lung(2)|pancreas(2)|ovary(1)|skin(1)|breast(1)	7	Medulloblastoma(34;0.0922)|all_neural(34;0.101)													Mulibrey_Nanism				---	---	---	---	capture		Missense_Mutation	SNP	57093108	57093108	17055	17	C	G	G	29	29	TRIM37	G	3	3
LAMA1	284217	broad.mit.edu	37	18	7080394	7080394	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7080394C>G	uc002knm.2	-	2	218	c.124G>C	c.(124-126)GGC>CGC	p.G42R	LAMA1_uc010wzj.1_5'UTR	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	42	Laminin N-terminal.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---	capture		Missense_Mutation	SNP	7080394	7080394	8928	18	C	G	G	21	21	LAMA1	G	3	3
KIAA1543	57662	broad.mit.edu	37	19	7676774	7676774	+	Silent	SNP	C	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7676774C>A	uc002mgv.3	+	11	1496	c.1395C>A	c.(1393-1395)ATC>ATA	p.I465I	KIAA1543_uc002mgu.3_Silent_p.I492I|KIAA1543_uc002mgw.2_5'Flank	NM_020902	NP_065953	Q9P1Y5	CAMP3_HUMAN	NEZHA isoform 2	465	Pro-rich.				epithelial cell-cell adhesion|microtubule anchoring|regulation of microtubule cytoskeleton organization|zonula adherens maintenance	cytoplasm|microtubule|zonula adherens	microtubule minus-end binding			pancreas(1)	1																		---	---	---	---	capture		Silent	SNP	7676774	7676774	8552	19	C	A	A	29	29	KIAA1543	A	2	2
MUC16	94025	broad.mit.edu	37	19	9045652	9045652	+	Silent	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9045652G>T	uc002mkp.2	-	5	36183	c.35979C>A	c.(35977-35979)ACC>ACA	p.T11993T		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	11995	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---	capture		Silent	SNP	9045652	9045652	10367	19	G	T	T	35	35	MUC16	T	2	2
PDE4C	5143	broad.mit.edu	37	19	18329162	18329162	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18329162C>T	uc010xqc.1	-	10	1692	c.1212G>A	c.(1210-1212)CTG>CTA	p.L404L	PDE4C_uc002nik.3_Silent_p.L404L|PDE4C_uc002nil.3_Silent_p.L404L|PDE4C_uc002nif.3_Silent_p.L173L|PDE4C_uc002nig.3_Intron|PDE4C_uc002nih.3_Silent_p.L174L|PDE4C_uc010ebk.2_Silent_p.L298L|PDE4C_uc002nii.3_Silent_p.L372L|PDE4C_uc010ebl.2_Silent_p.L118L|PDE4C_uc010xqd.1_Silent_p.L173L	NM_001098819	NP_001092289	Q08493	PDE4C_HUMAN	phosphodiesterase 4C isoform PDE4C-2	404					signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			ovary(2)|skin(2)|central_nervous_system(1)	5					Dyphylline(DB00651)													---	---	---	---	capture		Silent	SNP	18329162	18329162	12062	19	C	T	T	21	21	PDE4C	T	2	2
FXYD5	53827	broad.mit.edu	37	19	35649254	35649254	+	Silent	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35649254C>G	uc002nyg.1	+	4	236	c.150C>G	c.(148-150)GTC>GTG	p.V50V	FXYD5_uc010xsq.1_Silent_p.V50V|FXYD5_uc002nyh.1_Silent_p.V50V	NM_014164	NP_054883	Q96DB9	FXYD5_HUMAN	FXYD domain-containing ion transport regulator 5	50	Extracellular (Potential).				microvillus assembly|negative regulation of calcium-dependent cell-cell adhesion	integral to membrane	actin binding|cadherin binding|ion channel activity				0	all_lung(56;9.4e-09)|Lung NSC(56;1.4e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.75e-22)|OV - Ovarian serous cystadenocarcinoma(14;3.17e-20)|all cancers(14;7.07e-19)|LUSC - Lung squamous cell carcinoma(66;0.0221)															---	---	---	---	capture		Silent	SNP	35649254	35649254	6372	19	C	G	G	32	32	FXYD5	G	3	3
ZFP14	57677	broad.mit.edu	37	19	36832035	36832035	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36832035C>G	uc002odx.1	-	4	786	c.693G>C	c.(691-693)AAG>AAC	p.K231N	ZFP14_uc010xtd.1_Missense_Mutation_p.K232N|ZFP14_uc010eex.1_Missense_Mutation_p.K231N	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	231	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---	capture		Missense_Mutation	SNP	36832035	36832035	18227	19	C	G	G	24	24	ZFP14	G	3	3
ZNF570	148268	broad.mit.edu	37	19	37966894	37966894	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37966894A>T	uc002ogk.1	+	3	674	c.145A>T	c.(145-147)ATC>TTC	p.I49F	ZNF570_uc010efl.1_Missense_Mutation_p.I105F|ZNF570_uc010xtr.1_5'UTR	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	49	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---	capture		Missense_Mutation	SNP	37966894	37966894	18597	19	A	T	T	12	12	ZNF570	T	4	4
ZNF571	51276	broad.mit.edu	37	19	38055940	38055940	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38055940G>C	uc002ogt.2	-	4	1491	c.1390C>G	c.(1390-1392)CAA>GAA	p.Q464E	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Missense_Mutation_p.Q464E	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	464	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---	capture		Missense_Mutation	SNP	38055940	38055940	18598	19	G	C	C	45	45	ZNF571	C	3	3
ZNF571	51276	broad.mit.edu	37	19	38056864	38056864	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38056864G>C	uc002ogt.2	-	4	567	c.466C>G	c.(466-468)CAA>GAA	p.Q156E	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Missense_Mutation_p.Q156E	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	156	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---	capture		Missense_Mutation	SNP	38056864	38056864	18598	19	G	C	C	45	45	ZNF571	C	3	3
ZNF780B	163131	broad.mit.edu	37	19	40541731	40541731	+	Silent	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40541731C>G	uc002omu.2	-	5	1100	c.1035G>C	c.(1033-1035)CTG>CTC	p.L345L	ZNF780B_uc002omv.2_Silent_p.L197L	NM_001005851	NP_001005851	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	345	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)																	---	---	---	---	capture		Silent	SNP	40541731	40541731	18751	19	C	G	G	29	29	ZNF780B	G	3	3
SERTAD1	29950	broad.mit.edu	37	19	40928838	40928838	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40928838C>T	uc002ont.3	-	2	775	c.616G>A	c.(616-618)GAA>AAA	p.E206K		NM_013376	NP_037508	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	206					positive regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---	capture		Missense_Mutation	SNP	40928838	40928838	14608	19	C	T	T	30	30	SERTAD1	T	2	2
SPTBN4	57731	broad.mit.edu	37	19	40993680	40993680	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40993680C>T	uc002ony.2	+	3	332	c.246C>T	c.(244-246)ATC>ATT	p.I82I	SPTBN4_uc002onx.2_Silent_p.I82I|SPTBN4_uc002onz.2_Silent_p.I82I	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	82	CH 1.|Actin-binding.				actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)															---	---	---	---	capture		Silent	SNP	40993680	40993680	15635	19	C	T	T	31	31	SPTBN4	T	1	1
PSG6	5675	broad.mit.edu	37	19	43420433	43420433	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43420433C>G	uc002ovj.1	-	2	323	c.271G>C	c.(271-273)GGG>CGG	p.G91R	PSG3_uc002ouf.2_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Intron|PSG6_uc002ovf.1_Missense_Mutation_p.G91R|PSG6_uc002ovg.1_Missense_Mutation_p.G91R	NM_002782	NP_002773	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6 isoform	91	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---	capture		Missense_Mutation	SNP	43420433	43420433	13112	19	C	G	G	21	21	PSG6	G	3	3
HS1BP3	64342	broad.mit.edu	37	2	20840770	20840770	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20840770G>A	uc002rdw.1	-	3	410	c.369C>T	c.(367-369)GCC>GCT	p.A123A	HS1BP3_uc002rdx.2_Silent_p.A123A|HS1BP3_uc002rdy.2_Silent_p.A123A	NM_022460	NP_071905	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	123	PX.				cell communication		phosphatidylinositol binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Silent	SNP	20840770	20840770	7655	2	G	A	A	39	39	HS1BP3	A	1	1
ASXL2	55252	broad.mit.edu	37	2	25965491	25965491	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25965491C>G	uc002rgs.2	-	12	3936	c.3715G>C	c.(3715-3717)GAG>CAG	p.E1239Q	ASXL2_uc002rgt.1_Missense_Mutation_p.E722Q	NM_018263	NP_060733	Q76L83	ASXL2_HUMAN	additional sex combs like 2	1239					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|protein binding			pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Missense_Mutation	SNP	25965491	25965491	1086	2	C	G	G	29	29	ASXL2	G	3	3
SLC30A6	55676	broad.mit.edu	37	2	32396399	32396399	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32396399G>T	uc002roe.1	+	2	84	c.47G>T	c.(46-48)GGC>GTC	p.G16V	SLC30A6_uc002rof.1_Missense_Mutation_p.G16V|SLC30A6_uc010ymw.1_Intron|SLC30A6_uc010ezr.1_Missense_Mutation_p.G16V|SLC30A6_uc002rog.1_5'UTR|SLC30A6_uc010ezs.1_Intron|SLC30A6_uc002roh.1_5'UTR	NM_017964	NP_060434	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter),	16	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	zinc ion transmembrane transporter activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---	capture		Missense_Mutation	SNP	32396399	32396399	15056	2	G	T	T	42	42	SLC30A6	T	2	2
LTBP1	4052	broad.mit.edu	37	2	33518261	33518261	+	Silent	SNP	A	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33518261A>T	uc002ros.2	+	20	3150	c.3150A>T	c.(3148-3150)GCA>GCT	p.A1050A	LTBP1_uc002rot.2_Silent_p.A724A|LTBP1_uc002rou.2_Silent_p.A723A|LTBP1_uc002rov.2_Silent_p.A670A|LTBP1_uc010ymz.1_Silent_p.A723A|LTBP1_uc010yna.1_Silent_p.A670A|LTBP1_uc010ynb.1_5'UTR	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	1049	EGF-like 8; calcium-binding (Potential).				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)																---	---	---	---	capture		Silent	SNP	33518261	33518261	9449	2	A	T	T	5	5	LTBP1	T	4	4
DYNC2LI1	51626	broad.mit.edu	37	2	44031784	44031784	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44031784C>A	uc002rtk.2	+	11	902	c.806C>A	c.(805-807)TCT>TAT	p.S269Y	DYNC2LI1_uc002rtj.2_Missense_Mutation_p.S269Y|DYNC2LI1_uc002rtl.2_Missense_Mutation_p.S270Y|DYNC2LI1_uc010ynz.1_Missense_Mutation_p.S143Y	NM_016008	NP_057092	Q8TCX1	DC2L1_HUMAN	dynein 2 light intermediate chain isoform 1	269						apical part of cell|axonemal dynein complex|cilium axoneme|cytoplasm|microtubule|motile primary cilium	motor activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)																---	---	---	---	capture		Missense_Mutation	SNP	44031784	44031784	5033	2	C	A	A	32	32	DYNC2LI1	A	2	2
CCDC88A	55704	broad.mit.edu	37	2	55571645	55571645	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55571645T>A	uc002ryv.2	-	11	1889	c.1047A>T	c.(1045-1047)TTA>TTT	p.L349F	CCDC88A_uc010yoz.1_Missense_Mutation_p.L349F|CCDC88A_uc010ypa.1_Missense_Mutation_p.L349F|CCDC88A_uc010ypb.1_Missense_Mutation_p.L251F	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1	349	Potential.				activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4																		---	---	---	---	capture		Missense_Mutation	SNP	55571645	55571645	2988	2	T	A	A	61	61	CCDC88A	A	4	4
ETAA1	54465	broad.mit.edu	37	2	67637061	67637061	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67637061G>C	uc002sdz.1	+	6	2811	c.2672G>C	c.(2671-2673)AGA>ACA	p.R891T		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	891						cytoplasm|nucleus				ovary(3)|large_intestine(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	67637061	67637061	5460	2	G	C	C	33	33	ETAA1	C	3	3
ETAA1	54465	broad.mit.edu	37	2	67637099	67637099	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67637099G>C	uc002sdz.1	+	6	2849	c.2710G>C	c.(2710-2712)GAA>CAA	p.E904Q		NM_019002	NP_061875	Q9NY74	ETAA1_HUMAN	ETAA16 protein	904						cytoplasm|nucleus				ovary(3)|large_intestine(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	67637099	67637099	5460	2	G	C	C	33	33	ETAA1	C	3	3
INO80B	83444	broad.mit.edu	37	2	74684855	74684855	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74684855C>G	uc002slg.2	+	5	980	c.935C>G	c.(934-936)CCC>CGC	p.P312R	INO80B_uc002slf.1_3'UTR|INO80B_uc010yrr.1_Missense_Mutation_p.P284R|WBP1_uc002slh.1_Intron|INO80B_uc002sli.1_RNA|INO80B_uc010yrs.1_Missense_Mutation_p.P330R|WBP1_uc002slj.1_5'Flank|WBP1_uc002slk.1_5'Flank|WBP1_uc002sll.1_5'Flank	NM_031288	NP_112578	Q9C086	IN80B_HUMAN	high mobility group AT-hook 1-like 4	312	HIT-type.				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|nucleolus	metal ion binding|protein binding			pancreas(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	74684855	74684855	8048	2	C	G	G	22	22	INO80B	G	3	3
LRP1B	53353	broad.mit.edu	37	2	141816564	141816564	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141816564A>T	uc002tvj.1	-	9	2268	c.1296T>A	c.(1294-1296)GAT>GAA	p.D432E	LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	432	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---	capture		Missense_Mutation	SNP	141816564	141816564	9328	2	A	T	T	16	16	LRP1B	T	4	4
C2orf67	151050	broad.mit.edu	37	2	210889937	210889937	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210889937C>G	uc002vds.2	-	13	2663	c.2455G>C	c.(2455-2457)GAA>CAA	p.E819Q	C2orf67_uc002vdt.2_Missense_Mutation_p.E777Q	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	819										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)														---	---	---	---	capture		Missense_Mutation	SNP	210889937	210889937	2274	2	C	G	G	32	32	C2orf67	G	3	3
MYH7B	57644	broad.mit.edu	37	20	33589814	33589814	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33589814G>C	uc002xbi.1	+	42	5958	c.5866G>C	c.(5866-5868)GAG>CAG	p.E1956Q		NM_020884	NP_065935	A7E2Y1	MYH7B_HUMAN	myosin, heavy polypeptide 7B, cardiac muscle,	1914	Potential.					membrane|myosin filament	actin binding|ATP binding|motor activity			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(18;0.00691)															---	---	---	---	capture		Missense_Mutation	SNP	33589814	33589814	10435	20	G	C	C	41	41	MYH7B	C	3	3
EWSR1	2130	broad.mit.edu	37	22	29692264	29692264	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29692264C>G	uc003aet.2	+	12	1528	c.1200C>G	c.(1198-1200)ATC>ATG	p.I400M	EWSR1_uc003aev.2_Missense_Mutation_p.I405M|EWSR1_uc003aew.2_Missense_Mutation_p.I344M|EWSR1_uc003aex.2_Missense_Mutation_p.I399M|EWSR1_uc003aey.2_Missense_Mutation_p.I195M|EWSR1_uc003aez.2_Missense_Mutation_p.I61M	NM_005243	NP_005234	Q01844	EWS_HUMAN	Ewing sarcoma breakpoint region 1 isoform 2	400	RRM.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	calmodulin binding|nucleotide binding|RNA binding|zinc ion binding		EWSR1/FLI1(2266)|EWSR1/ATF1(323)|EWSR1/WT1(231)|EWSR1/ERG(162)|EWSR1/NR4A3(140)|EWSR1/DDIT3(43)|EWSR1/CREB1(42)|EWSR1/FEV(10)|EWSR1/POU5F1(10)|EWSR1/ETV1(7)|EWSR1/ETV4(6)|EWSR1/ZNF384(4)|EWSR1/PBX1(3)|EWSR1/SP3(3)|EWSR1/PATZ1(2)	bone(2526)|soft_tissue(702)|skin(8)|autonomic_ganglia(4)|haematopoietic_and_lymphoid_tissue(4)|salivary_gland(2)|central_nervous_system(2)|NS(2)|pancreas(2)|lung(1)|ovary(1)	3254								T	FLI1|ERG|ZNF278|NR4A3|FEV|ATF1|ETV1|ETV4|WT1|ZNF384|CREB1|POU5F1| PBX1	Ewing sarcoma| desmoplastic small round cell tumor |ALL|clear cell sarcoma|sarcoma|myoepithelioma								---	---	---	---	capture		Missense_Mutation	SNP	29692264	29692264	5489	22	C	G	G	32	32	EWSR1	G	3	3
GRM7	2917	broad.mit.edu	37	3	7721866	7721866	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7721866G>A	uc003bqm.2	+	9	2856	c.2582G>A	c.(2581-2583)CGA>CAA	p.R861Q	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.R861Q|GRM7_uc003bql.2_Missense_Mutation_p.R861Q|GRM7_uc003bqn.1_Missense_Mutation_p.R444Q	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	861	Cytoplasmic (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	7721866	7721866	7081	3	G	A	A	37	37	GRM7	A	1	1
HRH1	3269	broad.mit.edu	37	3	11301122	11301122	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11301122C>T	uc010hdr.2	+	2	741	c.399C>T	c.(397-399)CTC>CTT	p.L133L	HRH1_uc010hds.2_Silent_p.L133L|HRH1_uc010hdt.2_Silent_p.L133L|HRH1_uc003bwb.3_Silent_p.L133L	NM_001098213	NP_001091683	P35367	HRH1_HUMAN	histamine receptor H1	133	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|inflammatory response	cytoplasm|integral to plasma membrane|nucleus	histamine receptor activity			large_intestine(1)|ovary(1)	2					Aceprometazine(DB01615)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzquinamide(DB00767)|Bepotastine(DB04890)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlophedianol(DB04837)|Chlorpheniramine(DB01114)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clemastine(DB00283)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Maprotiline(DB00934)|Meclizine(DB00737)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nedocromil(DB00716)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Pemirolast(DB00885)|Phenindamine(DB01619)|Pheniramine(DB01620)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Terfenadine(DB00342)|Thiethylperazine(DB00372)|Trazodone(DB00656)|Trimeprazine(DB01246)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)													---	---	---	---	capture		Silent	SNP	11301122	11301122	7647	3	C	T	T	29	29	HRH1	T	2	2
SEMA3G	56920	broad.mit.edu	37	3	52476317	52476317	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52476317C>A	uc003dea.1	-	4	343	c.343G>T	c.(343-345)GAG>TAG	p.E115*		NM_020163	NP_064548	Q9NS98	SEM3G_HUMAN	semaphorin sem2 precursor	115	Sema.				multicellular organismal development	extracellular region|membrane	receptor activity			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;1.69e-05)|Kidney(197;0.00173)|KIRC - Kidney renal clear cell carcinoma(197;0.00196)|OV - Ovarian serous cystadenocarcinoma(275;0.0333)														---	---	---	---	capture		Nonsense_Mutation	SNP	52476317	52476317	14516	3	C	A	A	32	32	SEMA3G	A	5	2
CLRN1	7401	broad.mit.edu	37	3	150659416	150659416	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150659416T>C	uc003eyk.1	-	2	677	c.386A>G	c.(385-387)GAA>GGA	p.E129G	CLRN1OS_uc011bny.1_Intron|CLRN1_uc003eyj.2_Missense_Mutation_p.E53G|CLRN1_uc010hvj.1_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	129					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)															---	---	---	---	capture		Missense_Mutation	SNP	150659416	150659416	3695	3	T	C	C	62	62	CLRN1	C	4	4
C3orf70	285382	broad.mit.edu	37	3	184801052	184801052	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184801052C>A	uc003fpd.2	-	2	687	c.496G>T	c.(496-498)GAT>TAT	p.D166Y		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	166											0																		---	---	---	---	capture		Missense_Mutation	SNP	184801052	184801052	2335	3	C	A	A	31	31	C3orf70	A	1	1
FETUB	26998	broad.mit.edu	37	3	186358473	186358473	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186358473G>T	uc010hyq.2	+	2	485	c.224G>T	c.(223-225)CGG>CTG	p.R75L	FETUB_uc011brz.1_Intron|FETUB_uc003fqn.2_Missense_Mutation_p.R75L|FETUB_uc003fqo.2_5'UTR|FETUB_uc010hyr.2_Missense_Mutation_p.R75L|FETUB_uc010hys.2_5'UTR|FETUB_uc003fqp.3_Missense_Mutation_p.R75L	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	75	Cystatin fetuin-B-type 1.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)														---	---	---	---	capture		Missense_Mutation	SNP	186358473	186358473	6058	3	G	T	T	39	39	FETUB	T	1	1
OSTalpha	200931	broad.mit.edu	37	3	195954570	195954570	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195954570C>T	uc003fwd.2	+	4	525	c.324C>T	c.(322-324)ATC>ATT	p.I108I	OSTalpha_uc010iac.1_5'UTR|OSTalpha_uc003fwe.2_5'Flank	NM_152672	NP_689885	Q86UW1	OSTA_HUMAN	organic solute transporter alpha	108	Helical; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(1)	1	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;8.83e-25)|all cancers(36;8.38e-23)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;7.51e-07)|Lung(62;1.06e-06)	GBM - Glioblastoma multiforme(46;0.00202)														---	---	---	---	capture		Silent	SNP	195954570	195954570	11712	3	C	T	T	30	30	OSTalpha	T	2	2
DSPP	1834	broad.mit.edu	37	4	88534399	88534399	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88534399G>A	uc003hqu.2	+	4	1181	c.1061G>A	c.(1060-1062)CGC>CAC	p.R354H		NM_014208	NP_055023	Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein preproprotein	354					biomineral tissue development|ossification|skeletal system development	proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent			central_nervous_system(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)														---	---	---	---	capture		Missense_Mutation	SNP	88534399	88534399	4966	4	G	A	A	38	38	DSPP	A	1	1
LRRC14B	389257	broad.mit.edu	37	5	195433	195433	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:195433G>C	uc003jal.1	+	2	1538	c.1510G>C	c.(1510-1512)GAA>CAA	p.E504Q		NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	504										skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	195433	195433	9343	5	G	C	C	33	33	LRRC14B	C	3	3
C5orf22	55322	broad.mit.edu	37	5	31538616	31538616	+	Silent	SNP	G	A	A	rs145324653	byFrequency;by1000genomes	TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31538616G>A	uc003jhj.3	+	4	754	c.627G>A	c.(625-627)CAG>CAA	p.Q209Q	C5orf22_uc011cnw.1_RNA|C5orf22_uc003jhk.3_5'UTR	NM_018356	NP_060826	Q49AR2	CE022_HUMAN	hypothetical protein LOC55322	209										ovary(2)	2																		---	---	---	---	capture		Silent	SNP	31538616	31538616	2383	5	G	A	A	33	33	C5orf22	A	2	2
SLC45A2	51151	broad.mit.edu	37	5	33963987	33963987	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33963987G>A	uc003jid.2	-	3	789	c.697C>T	c.(697-699)CAT>TAT	p.H233Y	SLC45A2_uc003jie.2_Missense_Mutation_p.H233Y|SLC45A2_uc003jif.3_Intron|SLC45A2_uc011coe.1_Intron	NM_016180	NP_057264	Q9UMX9	S45A2_HUMAN	membrane-associated transporter protein isoform	233	Helical; Name=6; (Potential).				melanin biosynthetic process|response to stimulus|transmembrane transport|visual perception	integral to membrane|melanosome membrane				ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	33963987	33963987	15138	5	G	A	A	45	45	SLC45A2	A	2	2
UGT3A1	133688	broad.mit.edu	37	5	35957443	35957443	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35957443G>C	uc003jjv.1	-	5	1079	c.922C>G	c.(922-924)CAG>GAG	p.Q308E	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Missense_Mutation_p.Q308E|UGT3A1_uc011cor.1_Missense_Mutation_p.Q274E	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	308	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)															---	---	---	---	capture		Missense_Mutation	SNP	35957443	35957443	17521	5	G	C	C	45	45	UGT3A1	C	3	3
DAB2	1601	broad.mit.edu	37	5	39383250	39383250	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39383250G>A	uc003jlx.2	-	10	1342	c.811C>T	c.(811-813)CAG>TAG	p.Q271*	DAB2_uc003jlw.2_Nonsense_Mutation_p.Q250*	NM_001343	NP_001334	P98082	DAB2_HUMAN	disabled homolog 2	271					cell proliferation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway, planar cell polarity pathway	clathrin coated vesicle membrane|coated pit	protein C-terminus binding			kidney(2)|skin(1)	3	all_lung(31;0.000197)		Epithelial(62;0.137)															---	---	---	---	capture		Nonsense_Mutation	SNP	39383250	39383250	4384	5	G	A	A	45	45	DAB2	A	5	2
PAM	5066	broad.mit.edu	37	5	102309957	102309957	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102309957G>C	uc003knw.2	+	14	1673	c.1300G>C	c.(1300-1302)GAT>CAT	p.D434H	PAM_uc003kns.2_Intron|PAM_uc003knt.2_Missense_Mutation_p.D434H|PAM_uc003knu.2_Missense_Mutation_p.D434H|PAM_uc003knv.2_Missense_Mutation_p.D434H|PAM_uc011cuz.1_Missense_Mutation_p.D337H|PAM_uc003knx.1_Intron|PAM_uc003kny.1_RNA	NM_000919	NP_000910	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	434	Peptidylglycine alpha-hydroxylating monooxygenase (By similarity).|Intragranular (Potential).				peptide metabolic process|protein modification process	extracellular region|integral to membrane|stored secretory granule	L-ascorbic acid binding|peptidylamidoglycolate lyase activity|peptidylglycine monooxygenase activity|protein binding				0		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)													---	---	---	---	capture		Missense_Mutation	SNP	102309957	102309957	11829	5	G	C	C	41	41	PAM	C	3	3
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905808	139905808	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905808G>A	uc003lfs.1	+	26	4844	c.4720G>A	c.(4720-4722)GAT>AAT	p.D1574N	ANKHD1_uc003lfr.2_Missense_Mutation_p.D1574N|ANKHD1_uc003lfu.1_Missense_Mutation_p.D1054N|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.D313N|ANKHD1_uc003lfw.2_Missense_Mutation_p.D212N|ANKHD1_uc010jfl.2_Missense_Mutation_p.D9N|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1574						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---	capture		Missense_Mutation	SNP	139905808	139905808	632	5	G	A	A	33	33	ANKHD1-EIF4EBP3	A	2	2
PCDHB8	56128	broad.mit.edu	37	5	140558690	140558690	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140558690G>C	uc011dai.1	+	1	1261	c.1075G>C	c.(1075-1077)GAG>CAG	p.E359Q	PCDHB16_uc003liv.2_5'Flank	NM_019120	NP_061993	Q9UN66	PCDB8_HUMAN	protocadherin beta 8 precursor	359	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---	capture		Missense_Mutation	SNP	140558690	140558690	11968	5	G	C	C	45	45	PCDHB8	C	3	3
AFAP1L1	134265	broad.mit.edu	37	5	148680751	148680751	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148680751A>C	uc003lqh.2	+	4	416	c.285A>C	c.(283-285)AAA>AAC	p.K95N	AFAP1L1_uc003lqg.3_Missense_Mutation_p.K95N|AFAP1L1_uc010jgy.2_Missense_Mutation_p.K95N	NM_152406	NP_689619	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	95							protein binding			breast(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---	capture		Missense_Mutation	SNP	148680751	148680751	355	5	A	C	C	3	3	AFAP1L1	C	4	4
IL12B	3593	broad.mit.edu	37	5	158750298	158750298	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158750298C>G	uc003lxr.1	-	3	170	c.128G>C	c.(127-129)GGA>GCA	p.G43A		NM_002187	NP_002178	P29460	IL12B_HUMAN	interleukin 12B precursor	43	Ig-like C2-type.				cell cycle arrest|cell migration|defense response to Gram-negative bacterium|interferon-gamma biosynthetic process|natural killer cell activation|negative regulation of interleukin-10 production|negative regulation of interleukin-17 production|negative regulation of smooth muscle cell proliferation|positive regulation of activated T cell proliferation|positive regulation of activation of JAK2 kinase activity|positive regulation of cell adhesion|positive regulation of defense response to virus by host|positive regulation of granulocyte macrophage colony-stimulating factor production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interferon-gamma production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-17 production|positive regulation of memory T cell differentiation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|positive regulation of natural killer cell proliferation|positive regulation of NF-kappaB import into nucleus|positive regulation of NK T cell activation|positive regulation of NK T cell proliferation|positive regulation of osteoclast differentiation|positive regulation of smooth muscle cell apoptosis|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat4 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|regulation of tyrosine phosphorylation of Stat1 protein|response to UV-B|sexual reproduction|T-helper 1 type immune response|T-helper cell differentiation	interleukin-12 complex|interleukin-23 complex|membrane	cytokine activity|cytokine receptor activity|interleukin-12 receptor binding|protein heterodimerization activity				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---	capture		Missense_Mutation	SNP	158750298	158750298	7926	5	C	G	G	30	30	IL12B	G	3	3
HIVEP1	3096	broad.mit.edu	37	6	12161695	12161695	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12161695G>C	uc003nac.2	+	8	6690	c.6511G>C	c.(6511-6513)GAG>CAG	p.E2171Q	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2171					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)																---	---	---	---	capture		Missense_Mutation	SNP	12161695	12161695	7477	6	G	C	C	45	45	HIVEP1	C	3	3
KIF13A	63971	broad.mit.edu	37	6	17781126	17781126	+	Silent	SNP	T	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17781126T>A	uc003ncg.3	-	31	3786	c.3681A>T	c.(3679-3681)ACA>ACT	p.T1227T	KIF13A_uc003ncf.2_Silent_p.T1214T|KIF13A_uc003nch.3_Silent_p.T1227T|KIF13A_uc003nci.3_Silent_p.T1214T|KIF13A_uc003nce.1_5'Flank	NM_022113	NP_071396	Q9H1H9	KI13A_HUMAN	kinesin family member 13A isoform a	1227					cargo loading into vesicle|cell cycle|cytokinesis|endosome to lysosome transport|Golgi to plasma membrane protein transport|melanosome organization|plus-end-directed vesicle transport along microtubule	centrosome|endosome membrane|microtubule|midbody|trans-Golgi network membrane	ATP binding|microtubule motor activity|protein binding			large_intestine(2)|ovary(2)	4	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)															---	---	---	---	capture		Silent	SNP	17781126	17781126	8585	6	T	A	A	55	55	KIF13A	A	4	4
KDM1B	221656	broad.mit.edu	37	6	18207729	18207729	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18207729C>T	uc003nco.1	+	9	1226	c.1151C>T	c.(1150-1152)GCA>GTA	p.A384V	KDM1B_uc003ncn.1_Missense_Mutation_p.A355V	NM_153042	NP_694587	Q8NB78	KDM1B_HUMAN	amine oxidase (flavin containing) domain 1	587					multicellular organismal development|regulation of DNA methylation|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-monomethyl-K4 specific)|oxidoreductase activity|zinc ion binding			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	18207729	18207729	8429	6	C	T	T	25	25	KDM1B	T	2	2
DCDC2	51473	broad.mit.edu	37	6	24205305	24205305	+	Silent	SNP	T	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24205305T>A	uc003ndx.2	-	8	1250	c.948A>T	c.(946-948)GCA>GCT	p.A316A	DCDC2_uc003ndy.2_Silent_p.A316A|DCDC2_uc003ndw.2_Silent_p.A67A	NM_016356	NP_057440	Q9UHG0	DCDC2_HUMAN	doublecortin domain containing 2	316					cellular defense response|intracellular signal transduction|neuron migration					ovary(1)	1		Ovarian(999;0.101)																---	---	---	---	capture		Silent	SNP	24205305	24205305	4456	6	T	A	A	55	55	DCDC2	A	4	4
MSH5	4439	broad.mit.edu	37	6	31729633	31729633	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31729633C>G	uc003nwv.1	+	23	2299	c.2220C>G	c.(2218-2220)TTC>TTG	p.F740L	MSH5_uc003nwt.1_Missense_Mutation_p.F757L|MSH5_uc003nwu.1_Missense_Mutation_p.F741L|MSH5_uc003nww.1_Missense_Mutation_p.F740L|MSH5_uc003nwx.1_Missense_Mutation_p.F758L|MSH5_uc011dof.1_Missense_Mutation_p.F439L|MSH5_uc003nwy.1_Missense_Mutation_p.F414L|MSH5_uc003nwz.3_RNA|C6orf26_uc003nxa.3_5'Flank	NM_172166	NP_751898	O43196	MSH5_HUMAN	mutS homolog 5 isoform c	740					chiasma assembly|homologous chromosome segregation|meiotic prophase II|mismatch repair|reciprocal meiotic recombination	synaptonemal complex	ATP binding|DNA-dependent ATPase activity|mismatched DNA binding			ovary(2)|breast(1)	3													Direct_reversal_of_damage|MMR					---	---	---	---	capture		Missense_Mutation	SNP	31729633	31729633	10266	6	C	G	G	32	32	MSH5	G	3	3
ZNF318	24149	broad.mit.edu	37	6	43316086	43316086	+	Silent	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43316086C>T	uc003oux.2	-	6	3126	c.3048G>A	c.(3046-3048)TCG>TCA	p.S1016S	ZNF318_uc003ouw.2_RNA	NM_014345	NP_055160	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1016					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|zinc ion binding			ovary(3)|breast(2)|central_nervous_system(1)|skin(1)	7			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)															---	---	---	---	capture		Silent	SNP	43316086	43316086	18428	6	C	T	T	19	19	ZNF318	T	1	1
L3MBTL3	84456	broad.mit.edu	37	6	130415488	130415488	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130415488G>C	uc003qbt.2	+	18	1882	c.1712G>C	c.(1711-1713)AGA>ACA	p.R571T	L3MBTL3_uc003qbu.2_Missense_Mutation_p.R546T	NM_032438	NP_115814	Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 isoform a	571					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)														---	---	---	---	capture		Missense_Mutation	SNP	130415488	130415488	8916	6	G	C	C	33	33	L3MBTL3	C	3	3
JAZF1	221895	broad.mit.edu	37	7	27872493	27872493	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27872493G>C	uc003szn.2	-	5	899	c.658C>G	c.(658-660)CAG>GAG	p.Q220E	JAZF1_uc003szm.2_Missense_Mutation_p.Q156E	NM_175061	NP_778231	Q86VZ6	JAZF1_HUMAN	JAZF zinc finger 1	220	C2H2-type 3; degenerate.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	transcriptional repressor complex	nucleic acid binding|transcription corepressor activity|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131								T	SUZ12	endometrial stromal tumours								---	---	---	---	capture		Missense_Mutation	SNP	27872493	27872493	8250	7	G	C	C	45	45	JAZF1	C	3	3
AKAP9	10142	broad.mit.edu	37	7	91718793	91718793	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91718793G>T	uc003ulg.2	+	38	9533	c.9308G>T	c.(9307-9309)GGT>GTT	p.G3103V	AKAP9_uc003ulf.2_Missense_Mutation_p.G3095V|AKAP9_uc003uli.2_Missense_Mutation_p.G2726V|AKAP9_uc003ulj.2_Missense_Mutation_p.G873V|AKAP9_uc003ulk.2_Missense_Mutation_p.G378V|AKAP9_uc003ull.2_5'Flank	NM_005751	NP_005742	Q99996	AKAP9_HUMAN	A-kinase anchor protein 9 isoform 2	3107					G2/M transition of mitotic cell cycle|signal transduction|synaptic transmission|transport	centrosome|cytosol|Golgi apparatus	receptor binding			breast(7)|ovary(6)|lung(5)|skin(3)|large_intestine(2)|prostate(2)|central_nervous_system(1)	26	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)					T	BRAF	papillary thyroid								---	---	---	---	capture		Missense_Mutation	SNP	91718793	91718793	462	7	G	T	T	44	44	AKAP9	T	2	2
SAMD9	54809	broad.mit.edu	37	7	92731423	92731423	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92731423C>G	uc003umf.2	-	3	4244	c.3988G>C	c.(3988-3990)GAG>CAG	p.E1330Q	SAMD9_uc003umg.2_Missense_Mutation_p.E1330Q	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	1330						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---	capture		Missense_Mutation	SNP	92731423	92731423	14306	7	C	G	G	32	32	SAMD9	G	3	3
MLL5	55904	broad.mit.edu	37	7	104747986	104747986	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:104747986G>C	uc003vcm.2	+	22	3616	c.3082G>C	c.(3082-3084)GAT>CAT	p.D1028H	MLL5_uc010ljc.2_Missense_Mutation_p.D1028H|MLL5_uc010lje.1_RNA|MLL5_uc010ljf.1_RNA|MLL5_uc010ljg.2_5'UTR|MLL5_uc010ljh.1_5'Flank	NM_182931	NP_891847	Q8IZD2	MLL5_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 5	1028					cell cycle arrest|cellular response to retinoic acid|DNA methylation|erythrocyte differentiation|neutrophil activation|neutrophil mediated immunity|positive regulation of granulocyte differentiation|positive regulation of transcription, DNA-dependent|retinoic acid receptor signaling pathway|transcription, DNA-dependent	MLL5-L complex|nuclear speck	enzyme binding|histone methyltransferase activity (H3-K4 specific)|transcription coactivator activity|zinc ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	104747986	104747986	10014	7	G	C	C	37	37	MLL5	C	3	3
SLC13A1	6561	broad.mit.edu	37	7	122755608	122755608	+	Silent	SNP	C	A	A	rs150844958		TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122755608C>A	uc003vkm.2	-	15	1777	c.1752G>T	c.(1750-1752)TCG>TCT	p.S584S	SLC13A1_uc010lks.2_Silent_p.S460S	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	584						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)													---	---	---	---	capture		Silent	SNP	122755608	122755608	14886	7	C	A	A	19	19	SLC13A1	A	1	1
GPR37	2861	broad.mit.edu	37	7	124387341	124387341	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124387341G>A	uc003vli.2	-	2	1731	c.1080C>T	c.(1078-1080)TTC>TTT	p.F360F		NM_005302	NP_005293	O15354	GPR37_HUMAN	G protein-coupled receptor 37 precursor	360	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to plasma membrane	G-protein coupled receptor activity			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---	capture		Silent	SNP	124387341	124387341	6966	7	G	A	A	41	41	GPR37	A	2	2
GRM8	2918	broad.mit.edu	37	7	126882877	126882877	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126882877C>G	uc003vlr.2	-	1	693	c.382G>C	c.(382-384)GCT>CCT	p.A128P	GRM8_uc003vls.2_RNA|GRM8_uc011kof.1_RNA|GRM8_uc003vlt.2_Missense_Mutation_p.A128P|GRM8_uc010lkz.1_RNA	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a	128	Extracellular (Potential).				negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)										HNSCC(24;0.065)			---	---	---	---	capture		Missense_Mutation	SNP	126882877	126882877	7082	7	C	G	G	25	25	GRM8	G	3	3
SLC4A2	6522	broad.mit.edu	37	7	150767109	150767109	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150767109C>G	uc003wit.3	+	9	1479	c.1223C>G	c.(1222-1224)TCT>TGT	p.S408C	SLC4A2_uc011kve.1_Missense_Mutation_p.S399C|SLC4A2_uc003wiu.3_Missense_Mutation_p.S394C|SLC4A2_uc003wiv.3_5'Flank	NM_003040	NP_003031	P04920	B3A2_HUMAN	solute carrier family 4, anion exchanger, member	408	Cytoplasmic (Potential).				bicarbonate transport	integral to membrane|membrane fraction	inorganic anion exchanger activity				0			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---	capture		Missense_Mutation	SNP	150767109	150767109	15151	7	C	G	G	32	32	SLC4A2	G	3	3
MYOM2	9172	broad.mit.edu	37	8	2092716	2092716	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2092716G>C	uc003wpx.3	+	37	4347	c.4209G>C	c.(4207-4209)ATG>ATC	p.M1403I	MYOM2_uc011kwi.1_Missense_Mutation_p.M828I	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	1403	Ig-like C2-type 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)														---	---	---	---	capture		Missense_Mutation	SNP	2092716	2092716	10487	8	G	C	C	45	45	MYOM2	C	3	3
BLK	640	broad.mit.edu	37	8	11412926	11412926	+	Silent	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11412926G>A	uc003wty.2	+	8	1286	c.705G>A	c.(703-705)GAG>GAA	p.E235E	BLK_uc003wtz.2_Silent_p.E164E	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	235					intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)														---	---	---	---	capture		Silent	SNP	11412926	11412926	1469	8	G	A	A	33	33	BLK	A	2	2
PIWIL2	55124	broad.mit.edu	37	8	22172591	22172591	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22172591C>T	uc003xbn.2	+	18	2289	c.2141C>T	c.(2140-2142)GCC>GTC	p.A714V	PIWIL2_uc011kzf.1_Missense_Mutation_p.A714V|PIWIL2_uc010ltv.2_Missense_Mutation_p.A714V	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2	714	Piwi.				DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)														---	---	---	---	capture		Missense_Mutation	SNP	22172591	22172591	12382	8	C	T	T	26	26	PIWIL2	T	2	2
PXDNL	137902	broad.mit.edu	37	8	52366145	52366145	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366145G>C	uc003xqu.3	-	10	1284	c.1183C>G	c.(1183-1185)CGA>GGA	p.R395G		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	395	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)																---	---	---	---	capture		Missense_Mutation	SNP	52366145	52366145	13306	8	G	C	C	37	37	PXDNL	C	3	3
DPY19L4	286148	broad.mit.edu	37	8	95780703	95780703	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95780703C>T	uc003ygx.2	+	12	1380	c.1256C>T	c.(1255-1257)TCT>TTT	p.S419F		NM_181787	NP_861452	Q7Z388	D19L4_HUMAN	dpy-19-like 4	419						integral to membrane				ovary(2)	2	Breast(36;3.85e-06)																	---	---	---	---	capture		Missense_Mutation	SNP	95780703	95780703	4927	8	C	T	T	32	32	DPY19L4	T	2	2
GPAA1	8733	broad.mit.edu	37	8	145138051	145138051	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145138051C>G	uc003zax.2	+	2	209	c.99C>G	c.(97-99)ATC>ATG	p.I33M	GPAA1_uc003zav.1_Translation_Start_Site|GPAA1_uc003zaw.1_Intron	NM_003801	NP_003792	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment	33	Helical; (Potential).				attachment of GPI anchor to protein|C-terminal protein lipidation|protein complex assembly|protein retention in ER lumen	GPI-anchor transamidase complex	tubulin binding				0	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---	capture		Missense_Mutation	SNP	145138051	145138051	6861	8	C	G	G	31	31	GPAA1	G	3	3
APBA1	320	broad.mit.edu	37	9	72131759	72131759	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72131759C>A	uc004ahh.2	-	2	644	c.368G>T	c.(367-369)CGG>CTG	p.R123L		NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,	123					axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	72131759	72131759	766	9	C	A	A	23	23	APBA1	A	1	1
PHF2	5253	broad.mit.edu	37	9	96407915	96407915	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96407915G>A	uc004aub.2	+	4	451	c.304G>A	c.(304-306)GAA>AAA	p.E102K	PHF2_uc011lug.1_5'UTR	NM_005392	NP_005383	O75151	PHF2_HUMAN	PHD finger protein 2	102					liver development|negative regulation of chromatin silencing at rDNA|transcription, DNA-dependent	nucleolus	histone demethylase activity (H3-K9 specific)|iron ion binding|methylated histone residue binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)														---	---	---	---	capture		Missense_Mutation	SNP	96407915	96407915	12253	9	G	A	A	45	45	PHF2	A	2	2
TLR4	7099	broad.mit.edu	37	9	120470908	120470908	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:120470908T>G	uc004bjz.2	+	2	452	c.161T>G	c.(160-162)TTC>TGC	p.F54C	TLR4_uc004bka.2_Missense_Mutation_p.F14C|TLR4_uc004bkb.2_Intron	NM_138554	NP_612564	O00206	TLR4_HUMAN	toll-like receptor 4 precursor	54	Extracellular (Potential).				activation of MAPK activity|cellular response to mechanical stimulus|detection of fungus|detection of lipopolysaccharide|I-kappaB phosphorylation|innate immune response|intestinal epithelial structure maintenance|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|negative regulation of interferon-gamma production|negative regulation of interleukin-17 production|negative regulation of interleukin-23 production|negative regulation of interleukin-6 production|negative regulation of osteoclast differentiation|negative regulation of tumor necrosis factor production|positive regulation of chemokine production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of interferon-gamma production|positive regulation of interleukin-1 production|positive regulation of interleukin-10 production|positive regulation of interleukin-12 biosynthetic process|positive regulation of interleukin-12 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 biosynthetic process|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of platelet activation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor biosynthetic process|positive regulation of tumor necrosis factor production|T-helper 1 type immune response|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	external side of plasma membrane|integral to plasma membrane|lipopolysaccharide receptor complex|perinuclear region of cytoplasm	lipopolysaccharide receptor activity|transmembrane receptor activity			lung(10)|ovary(4)|breast(1)|skin(1)	16																		---	---	---	---	capture		Missense_Mutation	SNP	120470908	120470908	16483	9	T	G	G	62	62	TLR4	G	4	4
MAPKAP1	79109	broad.mit.edu	37	9	128432143	128432143	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128432143G>C	uc004bpv.2	-	3	636	c.303C>G	c.(301-303)ATC>ATG	p.I101M	MAPKAP1_uc004bpw.2_Translation_Start_Site|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Missense_Mutation_p.I101M|MAPKAP1_uc004bpz.2_Missense_Mutation_p.I101M|MAPKAP1_uc010mxa.2_RNA|MAPKAP1_uc004bqa.2_Missense_Mutation_p.I101M	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated	101	Interaction with MAP3K2.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4																		---	---	---	---	capture		Missense_Mutation	SNP	128432143	128432143	9671	9	G	C	C	45	45	MAPKAP1	C	3	3
TPRN	286262	broad.mit.edu	37	9	140086755	140086755	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140086755C>G	uc004clt.2	-	3	1846	c.1846G>C	c.(1846-1848)GAG>CAG	p.E616Q	TPRN_uc004clu.2_Missense_Mutation_p.E616Q	NM_173691	NP_775962	Q4KMQ1	TPRN_HUMAN	hypothetical protein LOC286262 isoform 2	677					sensory perception of sound	stereocilium					0																		---	---	---	---	capture		Missense_Mutation	SNP	140086755	140086755	16965	9	C	G	G	30	30	TPRN	G	3	3
UBA1	7317	broad.mit.edu	37	X	47070251	47070251	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47070251C>T	uc004dhj.3	+	19	2361	c.2210C>T	c.(2209-2211)TCA>TTA	p.S737L	UBA1_uc004dhk.3_Missense_Mutation_p.S737L|UBA1_uc004dhm.2_Missense_Mutation_p.S185L	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	737					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	47070251	47070251	17384	23	C	T	T	29	29	UBA1	T	2	2
PORCN	64840	broad.mit.edu	37	X	48378761	48378761	+	Splice_Site	SNP	A	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48378761A>T	uc010nie.1	+	15	1443	c.1285_splice	c.e15-2	p.G429_splice	PORCN_uc004djr.1_Splice_Site_p.G424_splice|PORCN_uc004djs.1_Splice_Site_p.G418_splice|PORCN_uc004djt.1_Splice_Site_p.G347_splice|PORCN_uc011mlx.1_Splice_Site_p.G347_splice|PORCN_uc004dju.1_Splice_Site_p.G287_splice|PORCN_uc004djv.1_Splice_Site_p.G429_splice|PORCN_uc004djw.1_Splice_Site_p.G423_splice|EBP_uc004djx.3_5'Flank|EBP_uc004djy.3_5'Flank|EBP_uc004djz.2_5'Flank	NM_203475	NP_982301			porcupine isoform D						Wnt receptor signaling pathway	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---	capture		Splice_Site	SNP	48378761	48378761	12687	23	A	T	T	7	7	PORCN	T	5	4
SAGE1	55511	broad.mit.edu	37	X	134987410	134987410	+	Splice_Site	SNP	G	T	T			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:134987410G>T	uc004ezh.2	+	5	481	c.314_splice	c.e5-1	p.D105_splice	SAGE1_uc010nry.1_Splice_Site_p.D74_splice|SAGE1_uc011mvv.1_Splice_Site_p.D105_splice	NM_018666	NP_061136			sarcoma antigen 1											ovary(2)|skin(1)	3	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---	capture		Splice_Site	SNP	134987410	134987410	14289	23	G	T	T	33	33	SAGE1	T	5	2
MAGEA3	4102	broad.mit.edu	37	X	151935729	151935729	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151935729G>C	uc004fgp.2	-	3	647	c.438C>G	c.(436-438)TTC>TTG	p.F146L		NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	146	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---	capture		Missense_Mutation	SNP	151935729	151935729	9546	23	G	C	C	33	33	MAGEA3	C	3	3
USP9Y	8287	broad.mit.edu	37	Y	14922619	14922619	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1011-01	TCGA-22-1011-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:14922619G>C	uc004fst.1	+	29	5050	c.4105G>C	c.(4105-4107)GAG>CAG	p.E1369Q	USP9Y_uc010nwu.1_RNA	NM_004654	NP_004645	O00507	USP9Y_HUMAN	ubiquitin specific protease 9, Y-linked	1369					BMP signaling pathway|protein deubiquitination|spermatogenesis|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	14922619	14922619	17655	24	G	C	C	33	33	USP9Y	C	3	3
