Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	MUTSIG_Significant_Genes	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
RYR2	6262	broad.mit.edu	37	1	237774248	237774249	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237774248_237774249CC>AA	uc001hyl.1	+	36	4990_4991	c.4870_4871CC>AA	c.(4870-4872)CCT>AAT	p.P1624N		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1624	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---	capture		Missense_Mutation	DNP	237774248	237774249	14249	1	CC	AA	AA	30	30	RYR2	AA	2	2
RNFT1	51136	broad.mit.edu	37	17	58040566	58040567	+	Missense_Mutation	DNP	GC	TT	TT	rs142393490		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58040566_58040567GC>TT	uc002iya.2	-	2	228_229	c.135_136GC>AA	c.(133-138)CTGCAC>CTAAAC	p.H46N	uc002iye.1_5'Flank|RNFT1_uc002iyb.2_RNA|RNFT1_uc002iyc.2_5'UTR|RNFT1_uc010wop.1_Missense_Mutation_p.H46N|RNFT1_uc002iyd.3_Missense_Mutation_p.H46N	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein	46						integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)															---	---	---	---	capture		Missense_Mutation	DNP	58040566	58040567	13980	17	GC	TT	TT	46	46	RNFT1	TT	2	2
NOL4	8715	broad.mit.edu	37	18	31523135	31523136	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31523135_31523136GG>TT	uc010dmi.2	-	9	1664_1665	c.1435_1436CC>AA	c.(1435-1437)CCT>AAT	p.P479N	NOL4_uc010xbs.1_Missense_Mutation_p.P194N|NOL4_uc002kxr.3_Missense_Mutation_p.P251N|NOL4_uc010xbt.1_Missense_Mutation_p.P405N|NOL4_uc010dmh.2_Missense_Mutation_p.P341N|NOL4_uc010xbu.1_Missense_Mutation_p.P415N|NOL4_uc002kxt.3_Intron|NOL4_uc010xbv.1_Missense_Mutation_p.P164N	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	479						nucleolus	RNA binding			ovary(3)	3																		---	---	---	---	capture		Missense_Mutation	DNP	31523135	31523136	10927	18	GG	TT	TT	35	35	NOL4	TT	2	2
PLVAP	83483	broad.mit.edu	37	19	17476431	17476432	+	Missense_Mutation	DNP	GG	AA	AA			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17476431_17476432GG>AA	uc002ngk.1	-	3	892_893	c.842_843CC>TT	c.(841-843)TCC>TTT	p.S281F		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	281	Potential.|Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0																		---	---	---	---	capture		Missense_Mutation	DNP	17476431	17476432	12542	19	GG	AA	AA	47	47	PLVAP	AA	2	2
ZNF567	163081	broad.mit.edu	37	19	37210539	37210540	+	Missense_Mutation	DNP	GG	TT	TT			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37210539_37210540GG>TT	uc010xtl.1	+	6	1135_1136	c.913_914GG>TT	c.(913-915)GGA>TTA	p.G305L	ZNF567_uc002oeo.1_Missense_Mutation_p.G305L|ZNF567_uc010xtk.1_Missense_Mutation_p.G305L|ZNF567_uc002oep.3_Missense_Mutation_p.G274L|ZNF567_uc002oeq.1_Missense_Mutation_p.G274L	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	305					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)															---	---	---	---	capture		Missense_Mutation	DNP	37210539	37210540	18593	19	GG	TT	TT	35	35	ZNF567	TT	2	2
VEZF1	7716	broad.mit.edu	37	17	56051910	56051934	+	Frame_Shift_Del	DEL	GGGGCGGCTAATGTCATAGGTGTGG	-	-	rs144484670		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56051910_56051934delGGGGCGGCTAATGTCATAGGTGTGG	uc002ivf.1	-	6	1609_1633	c.1466_1490delCCACACCTATGACATTAGCCGCCCC	c.(1465-1491)CCCACACCTATGACATTAGCCGCCCCTfs	p.P489fs		NM_007146	NP_009077	Q14119	VEZF1_HUMAN	zinc finger protein 161	489_497					cellular defense response|regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	56051910	56051934	17722	17	GGGGCGGCTAATGTCATAGGTGTGG	-	-	35	35	VEZF1	-	5	5
PAPD4	167153	broad.mit.edu	37	5	78944446	78944447	+	Frame_Shift_Ins	INS	-	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78944446_78944447insA	uc010jae.1	+	10	1246_1247	c.828_829insA	c.(826-831)GTGGAGfs	p.V276fs	PAPD4_uc003kgb.2_Frame_Shift_Ins_p.V276fs|PAPD4_uc010jaf.1_Frame_Shift_Ins_p.V276fs|PAPD4_uc003kga.2_Frame_Shift_Ins_p.V272fs|PAPD4_uc003kfz.2_Frame_Shift_Ins_p.V276fs	NM_001114393	NP_001107865	Q6PIY7	GLD2_HUMAN	PAP associated domain containing 4	276_277					histone mRNA catabolic process|mRNA processing|RNA polyadenylation	cytoplasm	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity			ovary(1)	1		Lung NSC(167;0.00293)|all_lung(232;0.00323)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;8.61e-47)|Epithelial(54;1.32e-41)|all cancers(79;2.45e-36)														---	---	---	---	capture_indel		Frame_Shift_Ins	INS	78944446	78944447	11841	5	-	A	A	47	47	PAPD4	A	5	5
PUS7	54517	broad.mit.edu	37	7	105108864	105108872	+	In_Frame_Del	DEL	TAGCTTTGG	-	-			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105108864_105108872delTAGCTTTGG	uc003vcx.2	-	12	1656_1664	c.1437_1445delCCAAAGCTA	c.(1435-1446)TACCAAAGCTAT>TAT	p.479_482YQSY>Y	PUS7_uc010lji.2_In_Frame_Del_p.485_488YQSY>Y|PUS7_uc003vcy.2_In_Frame_Del_p.479_482YQSY>Y|PUS7_uc003vcz.1_In_Frame_Del_p.479_482YQSY>Y	NM_019042	NP_061915	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 homolog	479_482	TRUD.				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			breast(1)	1																		---	---	---	---	capture_indel		In_Frame_Del	DEL	105108864	105108872	13291	7	TAGCTTTGG	-	-	49	49	PUS7	-	5	5
NPHP4	261734	broad.mit.edu	37	1	5940192	5940192	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5940192T>A	uc001alq.1	-	19	2859	c.2593A>T	c.(2593-2595)ACG>TCG	p.T865S	NPHP4_uc001als.1_RNA|NPHP4_uc009vlt.1_RNA|NPHP4_uc001alt.1_RNA	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin	865					actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---	capture		Missense_Mutation	SNP	5940192	5940192	10985	1	T	A	A	59	59	NPHP4	A	4	4
PRDM2	7799	broad.mit.edu	37	1	14105332	14105332	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14105332G>C	uc001avi.2	+	8	1898	c.1042G>C	c.(1042-1044)GAA>CAA	p.E348Q	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.E348Q|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.E105Q|PRDM2_uc001avk.2_Missense_Mutation_p.E147Q|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	348						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)														---	---	---	---	capture		Missense_Mutation	SNP	14105332	14105332	12900	1	G	C	C	33	33	PRDM2	C	3	3
IGSF21	84966	broad.mit.edu	37	1	18703338	18703338	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18703338G>T	uc001bau.1	+	8	1529	c.1146G>T	c.(1144-1146)GGG>GGT	p.G382G	IGSF21_uc001bav.1_Silent_p.G203G	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	382	Ig-like 2.					extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)														---	---	---	---	capture		Silent	SNP	18703338	18703338	7900	1	G	T	T	41	41	IGSF21	T	2	2
NBPF3	84224	broad.mit.edu	37	1	21804673	21804673	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21804673G>A	uc001ber.2	+	9	1379	c.1029G>A	c.(1027-1029)CAG>CAA	p.Q343Q	NBPF3_uc001bes.2_Silent_p.Q287Q|NBPF3_uc009vqb.2_Silent_p.Q368Q|NBPF3_uc010odm.1_Silent_p.Q273Q	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3	343	NBPF 2.					cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)														---	---	---	---	capture		Silent	SNP	21804673	21804673	10594	1	G	A	A	35	35	NBPF3	A	2	2
ASAP3	55616	broad.mit.edu	37	1	23763446	23763446	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23763446C>A	uc001bha.2	-	15	1558	c.1434G>T	c.(1432-1434)ATG>ATT	p.M478I	ASAP3_uc001bgy.1_5'Flank|ASAP3_uc001bgz.1_RNA|ASAP3_uc010odz.1_Missense_Mutation_p.M347I|ASAP3_uc010oea.1_Missense_Mutation_p.M469I|ASAP3_uc001bhb.2_Missense_Mutation_p.M1I	NM_017707	NP_060177	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	478	Arf-GAP.				regulation of ARF GTPase activity	cytoplasm	ARF GTPase activator activity|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	23763446	23763446	1030	1	C	A	A	25	25	ASAP3	A	2	2
CSMD2	114784	broad.mit.edu	37	1	34049276	34049276	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34049276G>C	uc001bxn.1	-	48	7241	c.7212C>G	c.(7210-7212)AGC>AGG	p.S2404R	CSMD2_uc001bxm.1_Missense_Mutation_p.S2402R	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2404	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)																---	---	---	---	capture		Missense_Mutation	SNP	34049276	34049276	4086	1	G	C	C	38	38	CSMD2	C	3	3
KCNQ4	9132	broad.mit.edu	37	1	41283880	41283880	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41283880G>A	uc001cgh.1	+	3	532	c.450G>A	c.(448-450)CGG>CGA	p.R150R	KCNQ4_uc001cgi.1_Silent_p.R150R	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	150	Helical; Name=Segment S2; (Potential).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)															---	---	---	---	capture		Silent	SNP	41283880	41283880	8390	1	G	A	A	43	43	KCNQ4	A	2	2
KANK4	163782	broad.mit.edu	37	1	62734103	62734103	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62734103T>A	uc001dah.3	-	5	2464	c.2087A>T	c.(2086-2088)GAG>GTG	p.E696V	KANK4_uc001dai.3_Missense_Mutation_p.E68V|KANK4_uc001dag.3_Missense_Mutation_p.E52V	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	696										ovary(3)|skin(2)|lung(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	62734103	62734103	8283	1	T	A	A	54	54	KANK4	A	4	4
C1orf173	127254	broad.mit.edu	37	1	75072462	75072462	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75072462C>A	uc001dgg.2	-	10	1531	c.1312G>T	c.(1312-1314)GTG>TTG	p.V438L	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.V232L	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	438	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	75072462	75072462	2081	1	C	A	A	17	17	C1orf173	A	2	2
HAPLN2	60484	broad.mit.edu	37	1	156594436	156594436	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156594436C>A	uc001fpn.1	+	6	1007	c.600C>A	c.(598-600)CTC>CTA	p.L200L		NM_021817	NP_068589	Q9GZV7	HPLN2_HUMAN	brain link protein-1 precursor	200	Link 1.				cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding				0	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---	capture		Silent	SNP	156594436	156594436	7237	1	C	A	A	31	31	HAPLN2	A	1	1
ETV3L	440695	broad.mit.edu	37	1	157062600	157062600	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157062600C>A	uc001fqq.1	-	5	1212	c.927G>T	c.(925-927)GGG>GGT	p.G309G		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	309						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)																---	---	---	---	capture		Silent	SNP	157062600	157062600	5473	1	C	A	A	26	26	ETV3L	A	2	2
CRP	1401	broad.mit.edu	37	1	159683677	159683677	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159683677G>A	uc001ftw.2	-	2	417	c.313C>T	c.(313-315)CCT>TCT	p.P105S	CRP_uc001ftx.1_Intron|CRP_uc001fty.1_RNA	NM_000567	NP_000558	P02741	CRP_HUMAN	C-reactive protein, pentraxin-related precursor	105	Pentaxin.				acute-phase response|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|opsonization		choline binding|Gram-positive bacterial cell surface binding|low-density lipoprotein particle binding|metal ion binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)				Atorvastatin(DB01076)|Bezafibrate(DB01393)													---	---	---	---	capture		Missense_Mutation	SNP	159683677	159683677	4034	1	G	A	A	41	41	CRP	A	2	2
SELE	6401	broad.mit.edu	37	1	169698481	169698481	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169698481A>T	uc001ggm.3	-	7	1093	c.936T>A	c.(934-936)AAT>AAA	p.N312K	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	312	Extracellular (Potential).|Sushi 3.				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)																	---	---	---	---	capture		Missense_Mutation	SNP	169698481	169698481	14499	1	A	T	T	8	8	SELE	T	4	4
TOR1AIP2	163590	broad.mit.edu	37	1	179820290	179820290	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179820290A>C	uc001gnk.2	-	4	631	c.243T>G	c.(241-243)CAT>CAG	p.H81Q	TOR1AIP2_uc001gnl.2_Missense_Mutation_p.H81Q	NM_145034	NP_659471	Q8NFQ8	TOIP2_HUMAN	torsin A interacting protein 2	81						endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	179820290	179820290	16915	1	A	C	C	12	12	TOR1AIP2	C	4	4
CACNA1E	777	broad.mit.edu	37	1	181479612	181479612	+	Splice_Site	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181479612C>T	uc001gow.2	+	2	432	c.267_splice	c.e2-1	p.P89_splice	CACNA1E_uc009wxr.2_5'Flank|CACNA1E_uc009wxs.2_5'Flank	NM_000721	NP_000712			calcium channel, voltage-dependent, R type,						energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6																		---	---	---	---	capture		Splice_Site	SNP	181479612	181479612	2658	1	C	T	T	19	19	CACNA1E	T	5	1
GLT25D2	23127	broad.mit.edu	37	1	183944266	183944266	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183944266G>T	uc001gqr.2	-	3	829	c.457C>A	c.(457-459)CGA>AGA	p.R153R	GLT25D2_uc010poj.1_Silent_p.R153R|GLT25D2_uc001gqs.2_Silent_p.R33R	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2	153					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2																		---	---	---	---	capture		Silent	SNP	183944266	183944266	6735	1	G	T	T	37	37	GLT25D2	T	1	1
FAM5C	339479	broad.mit.edu	37	1	190234022	190234022	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190234022G>A	uc001gse.1	-	4	823	c.591C>T	c.(589-591)CAC>CAT	p.H197H	FAM5C_uc010pot.1_Silent_p.H95H	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	197						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)																	---	---	---	---	capture		Silent	SNP	190234022	190234022	5817	1	G	A	A	48	48	FAM5C	A	2	2
ASPM	259266	broad.mit.edu	37	1	197072612	197072612	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072612T>C	uc001gtu.2	-	18	6026	c.5769A>G	c.(5767-5769)GCA>GCG	p.A1923A	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1923	IQ 11.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---	capture		Silent	SNP	197072612	197072612	1075	1	T	C	C	55	55	ASPM	C	4	4
ASPM	259266	broad.mit.edu	37	1	197112527	197112527	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197112527A>T	uc001gtu.2	-	3	1112	c.855T>A	c.(853-855)AAT>AAA	p.N285K	ASPM_uc001gtv.2_Missense_Mutation_p.N285K|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	285					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6																		---	---	---	---	capture		Missense_Mutation	SNP	197112527	197112527	1075	1	A	T	T	8	8	ASPM	T	4	4
MARK1	4139	broad.mit.edu	37	1	220777445	220777445	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220777445T>G	uc001hmn.3	+	6	1058	c.461T>G	c.(460-462)ATG>AGG	p.M154R	MARK1_uc009xdw.2_Missense_Mutation_p.M154R|MARK1_uc010pun.1_Missense_Mutation_p.M154R|MARK1_uc001hmm.3_Missense_Mutation_p.M132R	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	154	Protein kinase.				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)														---	---	---	---	capture		Missense_Mutation	SNP	220777445	220777445	9695	1	T	G	G	51	51	MARK1	G	4	4
MTR	4548	broad.mit.edu	37	1	236992548	236992548	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236992548A>T	uc001hyi.3	+	12	1478	c.1055A>T	c.(1054-1056)GAA>GTA	p.E352V	MTR_uc010pxw.1_5'UTR|MTR_uc010pxx.1_Missense_Mutation_p.E352V|MTR_uc010pxy.1_Missense_Mutation_p.E352V|MTR_uc009xgj.1_3'UTR	NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	352					nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)													---	---	---	---	capture		Missense_Mutation	SNP	236992548	236992548	10351	1	A	T	T	9	9	MTR	T	4	4
CNST	163882	broad.mit.edu	37	1	246811035	246811035	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246811035G>T	uc001ibp.2	+	9	1910	c.1532G>T	c.(1531-1533)TGT>TTT	p.C511F	CNST_uc001ibo.3_Missense_Mutation_p.C511F	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1	511					positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	246811035	246811035	3772	1	G	T	T	48	48	CNST	T	2	2
OR2L13	284521	broad.mit.edu	37	1	248262792	248262792	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248262792G>A	uc001ids.2	+	3	452	c.115G>A	c.(115-117)GTG>ATG	p.V39M		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)															---	---	---	---	capture		Missense_Mutation	SNP	248262792	248262792	11412	1	G	A	A	44	44	OR2L13	A	2	2
ZNF438	220929	broad.mit.edu	37	10	31139078	31139078	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31139078C>A	uc010qdz.1	-	7	691	c.256G>T	c.(256-258)GCT>TCT	p.A86S	ZNF438_uc001ivn.2_Missense_Mutation_p.A37S|ZNF438_uc010qdy.1_Missense_Mutation_p.A76S|ZNF438_uc001ivo.3_Intron|ZNF438_uc009xlg.2_Missense_Mutation_p.A86S|ZNF438_uc001ivp.3_Missense_Mutation_p.A76S|ZNF438_uc010qea.1_Missense_Mutation_p.A86S|ZNF438_uc010qeb.1_Missense_Mutation_p.A86S|ZNF438_uc010qec.1_Intron	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)																---	---	---	---	capture		Missense_Mutation	SNP	31139078	31139078	18503	10	C	A	A	25	25	ZNF438	A	2	2
GDF10	2662	broad.mit.edu	37	10	48429112	48429112	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48429112G>T	uc001jfb.2	-	2	1230	c.774C>A	c.(772-774)AGC>AGA	p.S258R	GDF10_uc009xnp.2_Missense_Mutation_p.S257R|GDF10_uc009xnq.1_Missense_Mutation_p.S258R	NM_004962	NP_004953	P55107	BMP3B_HUMAN	growth differentiation factor 10 precursor	258					growth|skeletal system development|transforming growth factor beta receptor signaling pathway	extracellular space	cytokine activity|growth factor activity			lung(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	48429112	48429112	6579	10	G	T	T	38	38	GDF10	T	1	1
SGMS1	259230	broad.mit.edu	37	10	52103273	52103273	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52103273T>A	uc001jje.2	-	7	1556	c.602A>T	c.(601-603)CAG>CTG	p.Q201L	SGMS1_uc010qhk.1_Intron|SGMS1_uc009xot.1_Intron|SGMS1_uc009xou.1_Missense_Mutation_p.Q201L|SGMS1_uc010qhl.1_RNA	NM_147156	NP_671512	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	207	Helical; (Potential).				apoptosis|cell growth|sphingomyelin biosynthetic process	endoplasmic reticulum|Golgi trans cisterna|integral to Golgi membrane|nucleus|plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			ovary(1)|kidney(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	52103273	52103273	14705	10	T	A	A	55	55	SGMS1	A	4	4
ANK3	288	broad.mit.edu	37	10	61832077	61832077	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61832077T>C	uc001jky.2	-	37	8754	c.8562A>G	c.(8560-8562)ACA>ACG	p.T2854T	ANK3_uc001jkw.2_Intron|ANK3_uc009xpa.2_Intron|ANK3_uc001jkx.2_Intron|ANK3_uc010qih.1_Intron|ANK3_uc001jkz.3_Intron|ANK3_uc001jkv.2_Intron|ANK3_uc009xpb.1_Intron	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	2854					establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19																		---	---	---	---	capture		Silent	SNP	61832077	61832077	625	10	T	C	C	51	51	ANK3	C	4	4
CDH23	64072	broad.mit.edu	37	10	73558235	73558235	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73558235G>A	uc001jrx.3	+	48	7331	c.6954G>A	c.(6952-6954)GTG>GTA	p.V2318V	CDH23_uc001jsg.3_Silent_p.V78V|CDH23_uc001jsh.3_Silent_p.V78V|CDH23_uc001jsi.3_Silent_p.V78V	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	2318	Cadherin 22.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11																		---	---	---	---	capture		Silent	SNP	73558235	73558235	3237	10	G	A	A	47	47	CDH23	A	2	2
NRG3	10718	broad.mit.edu	37	10	83635374	83635374	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:83635374C>A	uc001kco.2	+	1	305	c.278C>A	c.(277-279)TCC>TAC	p.S93Y	NRG3_uc010qlz.1_Missense_Mutation_p.S93Y|NRG3_uc001kcp.2_5'Flank|NRG3_uc001kcq.2_5'Flank	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1	93	Extracellular (Potential).				regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)														---	---	---	---	capture		Missense_Mutation	SNP	83635374	83635374	11054	10	C	A	A	30	30	NRG3	A	2	2
WAPAL	23063	broad.mit.edu	37	10	88260207	88260207	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88260207C>G	uc001kdo.2	-	3	1235	c.793G>C	c.(793-795)GAT>CAT	p.D265H	WAPAL_uc001kdn.2_Missense_Mutation_p.D308H|WAPAL_uc009xsw.2_Missense_Mutation_p.D265H	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	265	Mediates interaction with the cohesin complex.|Potential.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	88260207	88260207	17820	10	C	G	G	30	30	WAPAL	G	3	3
TLX1	3195	broad.mit.edu	37	10	102893992	102893992	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102893992G>T	uc001ksw.2	+	2	867	c.629G>T	c.(628-630)CGC>CTC	p.R210L		NM_005521	NP_005512	P31314	TLX1_HUMAN	T-cell leukemia homeobox 1	210	Homeobox.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1				Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)				T	TRB@|TRD@	T-ALL								---	---	---	---	capture		Missense_Mutation	SNP	102893992	102893992	16489	10	G	T	T	38	38	TLX1	T	1	1
GPAM	57678	broad.mit.edu	37	10	113924309	113924309	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113924309C>T	uc009xxy.1	-	13	1479	c.1281G>A	c.(1279-1281)GCG>GCA	p.A427A	GPAM_uc001kzp.2_Silent_p.A427A|GPAM_uc001kzq.1_Silent_p.A427A	NM_020918	NP_065969	Q9HCL2	GPAT1_HUMAN	mitochondrial glycerol 3-phosphate	427					phospholipid biosynthetic process|triglyceride biosynthetic process	integral to membrane|mitochondrial outer membrane	glycerol-3-phosphate O-acyltransferase activity			ovary(1)|skin(1)	2				Epithelial(162;0.0306)|all cancers(201;0.123)														---	---	---	---	capture		Silent	SNP	113924309	113924309	6862	10	C	T	T	19	19	GPAM	T	1	1
FAM160B1	57700	broad.mit.edu	37	10	116606016	116606016	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116606016A>G	uc001lcb.2	+	10	1623	c.1288A>G	c.(1288-1290)ATG>GTG	p.M430V	FAM160B1_uc001lcc.2_Missense_Mutation_p.M430V	NM_020940	NP_065991	Q5W0V3	F16B1_HUMAN	hypothetical protein LOC57700 isoform a	430										lung(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	116606016	116606016	5674	10	A	G	G	4	4	FAM160B1	G	4	4
DOCK1	1793	broad.mit.edu	37	10	128798486	128798486	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128798486G>T	uc001ljt.2	+	10	964	c.900G>T	c.(898-900)CAG>CAT	p.Q300H	DOCK1_uc010qun.1_Missense_Mutation_p.Q300H	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	300					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)														---	---	---	---	capture		Missense_Mutation	SNP	128798486	128798486	4868	10	G	T	T	33	33	DOCK1	T	2	2
KNDC1	85442	broad.mit.edu	37	10	135025267	135025267	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135025267G>T	uc001llz.1	+	23	4142	c.4141G>T	c.(4141-4143)GGC>TGC	p.G1381C		NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)	1381					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)														---	---	---	---	capture		Missense_Mutation	SNP	135025267	135025267	8740	10	G	T	T	39	39	KNDC1	T	1	1
RIC8A	60626	broad.mit.edu	37	11	212652	212652	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:212652A>T	uc001log.2	+	7	1428	c.1103A>T	c.(1102-1104)GAG>GTG	p.E368V	RIC8A_uc001lof.2_Missense_Mutation_p.E374V|RIC8A_uc001loh.2_Missense_Mutation_p.E361V	NM_021932	NP_068751	Q9NPQ8	RIC8A_HUMAN	resistance to inhibitors of cholinesterase 8	368						cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity				0		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)														---	---	---	---	capture		Missense_Mutation	SNP	212652	212652	13830	11	A	T	T	11	11	RIC8A	T	4	4
MUC5B	727897	broad.mit.edu	37	11	1266611	1266611	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1266611G>C	uc009ycr.1	+	49	10376	c.10250G>C	c.(10249-10251)AGG>ACG	p.R3417T	MUC5B_uc001ltb.2_Missense_Mutation_p.R2837T	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	2834	7 X Cys-rich subdomain repeats.|Thr-rich.			R -> T (in Ref. 4; CAA96577).|Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)														---	---	---	---	capture		Missense_Mutation	SNP	1266611	1266611	10373	11	G	C	C	35	35	MUC5B	C	3	3
BRSK2	9024	broad.mit.edu	37	11	1466647	1466647	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1466647C>T	uc001lti.2	+	10	1322	c.936C>T	c.(934-936)TTC>TTT	p.F312F	BRSK2_uc009ycv.1_Silent_p.F312F|BRSK2_uc001lth.1_Silent_p.F312F|BRSK2_uc001ltj.2_Silent_p.F312F|BRSK2_uc001ltk.2_RNA|BRSK2_uc001ltl.2_Silent_p.F312F|BRSK2_uc001ltm.2_Silent_p.F358F|BRSK2_uc001ltn.2_RNA|BRSK2_uc010qwx.1_RNA	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	312	UBA.				establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)														---	---	---	---	capture		Silent	SNP	1466647	1466647	1555	11	C	T	T	30	30	BRSK2	T	2	2
OR52I2	143502	broad.mit.edu	37	11	4608932	4608932	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4608932A>G	uc010qyh.1	+	1	890	c.890A>G	c.(889-891)GAT>GGT	p.D297G		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	297	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---	capture		Missense_Mutation	SNP	4608932	4608932	11531	11	A	G	G	12	12	OR52I2	G	4	4
OR52A4	390053	broad.mit.edu	37	11	5142097	5142097	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5142097C>T	uc001lzz.1	-	1	712	c.712G>A	c.(712-714)GCA>ACA	p.A238T		NM_001005222	NP_001005222			olfactory receptor, family 52, subfamily A,											ovary(2)	2		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.7e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)														---	---	---	---	capture		Missense_Mutation	SNP	5142097	5142097	11519	11	C	T	T	26	26	OR52A4	T	2	2
SBF2	81846	broad.mit.edu	37	11	10014013	10014013	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10014013A>G	uc001mib.2	-	12	1383	c.1245T>C	c.(1243-1245)GGT>GGC	p.G415G	SBF2_uc001mif.3_Silent_p.G171G	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	415	dDENN.				myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---	capture		Silent	SNP	10014013	10014013	14340	11	A	G	G	2	2	SBF2	G	4	4
LRRC4C	57689	broad.mit.edu	37	11	40136214	40136214	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136214C>T	uc001mxa.1	-	2	3593	c.1629G>A	c.(1627-1629)ATG>ATA	p.M543I	LRRC4C_uc001mxc.1_Missense_Mutation_p.M539I|LRRC4C_uc001mxd.1_Missense_Mutation_p.M539I|LRRC4C_uc001mxb.1_Missense_Mutation_p.M539I	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	543	Helical; (Potential).				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---	capture		Missense_Mutation	SNP	40136214	40136214	9383	11	C	T	T	25	25	LRRC4C	T	2	2
OR5L1	219437	broad.mit.edu	37	11	55579641	55579641	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579641C>A	uc001nhw.1	+	1	699	c.699C>A	c.(697-699)GGC>GGA	p.G233G		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	233	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)																---	---	---	---	capture		Silent	SNP	55579641	55579641	11580	11	C	A	A	25	25	OR5L1	A	2	2
OR5B3	441608	broad.mit.edu	37	11	58170531	58170531	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58170531A>T	uc010rkf.1	-	1	352	c.352T>A	c.(352-354)TAT>AAT	p.Y118N		NM_001005469	NP_001005469	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)																---	---	---	---	capture		Missense_Mutation	SNP	58170531	58170531	11562	11	A	T	T	15	15	OR5B3	T	4	4
OR5B2	390190	broad.mit.edu	37	11	58190570	58190570	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190570G>T	uc010rkg.1	-	1	165	c.165C>A	c.(163-165)ACC>ACA	p.T55T		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	55	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)																---	---	---	---	capture		Silent	SNP	58190570	58190570	11560	11	G	T	T	43	43	OR5B2	T	2	2
AHNAK	79026	broad.mit.edu	37	11	62288552	62288552	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62288552T>G	uc001ntl.2	-	5	13637	c.13337A>C	c.(13336-13338)AAA>ACA	p.K4446T	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4446					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---	capture		Missense_Mutation	SNP	62288552	62288552	417	11	T	G	G	64	64	AHNAK	G	4	4
FADD	8772	broad.mit.edu	37	11	70049646	70049646	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70049646C>A	uc001opm.2	+	1	378	c.81C>A	c.(79-81)TGC>TGA	p.C27*		NM_003824	NP_003815	Q13158	FADD_HUMAN	Fas-associated via death domain	27	DED.				activation of caspase activity|activation of pro-apoptotic gene products|cellular response to mechanical stimulus|defense response to virus|induction of apoptosis via death domain receptors|innate immune response|interspecies interaction between organisms|necrotic cell death|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-8 production|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of type I interferon-mediated signaling pathway|signal transduction	cytosol	death receptor binding|identical protein binding			ovary(1)|lung(1)|pancreas(1)	3	Esophageal squamous(2;1.19e-45)		LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)															---	---	---	---	capture		Nonsense_Mutation	SNP	70049646	70049646	5561	11	C	A	A	26	26	FADD	A	5	2
C11orf30	56946	broad.mit.edu	37	11	76207484	76207484	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76207484A>C	uc001oxl.2	+	9	1477	c.1334A>C	c.(1333-1335)AAA>ACA	p.K445T	C11orf30_uc009yuj.1_Missense_Mutation_p.K460T|C11orf30_uc010rsa.1_Missense_Mutation_p.K395T|C11orf30_uc001oxm.2_Intron|C11orf30_uc010rsb.1_Missense_Mutation_p.K460T|C11orf30_uc010rsc.1_Missense_Mutation_p.K460T|C11orf30_uc001oxn.2_Missense_Mutation_p.K446T|C11orf30_uc010rsd.1_Missense_Mutation_p.K459T	NM_020193	NP_064578	Q7Z589	EMSY_HUMAN	EMSY protein	445	Interaction with BRCA2.|Gln-rich.				chromatin modification|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(5)|skin(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	76207484	76207484	1674	11	A	C	C	1	1	C11orf30	C	4	4
DLAT	1737	broad.mit.edu	37	11	111915876	111915876	+	Silent	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111915876T>A	uc001pmo.2	+	9	1871	c.1212T>A	c.(1210-1212)GTT>GTA	p.V404V	DLAT_uc009yyk.1_Silent_p.V299V|DLAT_uc010rwr.1_Silent_p.V277V	NM_001931	NP_001922	P10515	ODP2_HUMAN	dihydrolipoamide S-acetyltransferase precursor	404					glycolysis|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial pyruvate dehydrogenase complex	dihydrolipoyllysine-residue acetyltransferase activity|protein binding				0		all_cancers(61;4.53e-11)|all_epithelial(67;2.76e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)		Epithelial(105;4.87e-07)|BRCA - Breast invasive adenocarcinoma(274;6.83e-07)|all cancers(92;9.63e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0557)	NADH(DB00157)													---	---	---	---	capture		Silent	SNP	111915876	111915876	4729	11	T	A	A	63	63	DLAT	A	4	4
TEX12	56158	broad.mit.edu	37	11	112042610	112042610	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:112042610A>G	uc001pnc.2	+	5	475	c.343A>G	c.(343-345)ACA>GCA	p.T115A	TEX12_uc001pnd.2_Missense_Mutation_p.T115A	NM_031275	NP_112565	Q9BXU0	TEX12_HUMAN	testis expressed sequence 12	115											0		all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;1.2e-06)|BRCA - Breast invasive adenocarcinoma(274;1.4e-06)|all cancers(92;1.97e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0512)														---	---	---	---	capture		Missense_Mutation	SNP	112042610	112042610	16302	11	A	G	G	14	14	TEX12	G	4	4
B4GALNT3	283358	broad.mit.edu	37	12	662639	662639	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:662639A>T	uc001qii.1	+	14	1550	c.1550A>T	c.(1549-1551)AAA>ATA	p.K517I	B4GALNT3_uc001qij.1_Missense_Mutation_p.K420I|B4GALNT3_uc001qik.1_Missense_Mutation_p.K66I	NM_173593	NP_775864	Q6L9W6	B4GN3_HUMAN	beta	517	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity			ovary(1)|skin(1)	2	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)															---	---	---	---	capture		Missense_Mutation	SNP	662639	662639	1289	12	A	T	T	1	1	B4GALNT3	T	4	4
C3AR1	719	broad.mit.edu	37	12	8212693	8212693	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8212693A>T	uc001qtv.1	-	2	181	c.89T>A	c.(88-90)CTC>CAC	p.L30H		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	30	Helical; Name=1; (Potential).				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)														---	---	---	---	capture		Missense_Mutation	SNP	8212693	8212693	2297	12	A	T	T	11	11	C3AR1	T	4	4
SPRYD3	84926	broad.mit.edu	37	12	53468891	53468891	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53468891G>C	uc001sbt.1	-	4	380	c.359C>G	c.(358-360)GCT>GGT	p.A120G	SPRYD3_uc010snw.1_5'UTR	NM_032840	NP_116229	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	120	B30.2/SPRY.									central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	53468891	53468891	15623	12	G	C	C	34	34	SPRYD3	C	3	3
HNRNPA1	3178	broad.mit.edu	37	12	54677612	54677612	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54677612T>C	uc001sfl.2	+	9	1028	c.924T>C	c.(922-924)GGT>GGC	p.G308G	HNRNPA1_uc001sfm.2_Silent_p.G256G|HNRNPA1_uc009zng.2_Silent_p.G256G|HNRNPA1_uc009znh.2_Silent_p.G256G|HNRNPA1_uc009zni.2_Silent_p.G243G|HNRNPA1_uc001sfn.2_Silent_p.G203G|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc009znj.1_Silent_p.G211G	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	308	Gly-rich.				interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding	p.S308S(1)		skin(2)|ovary(1)	3																		---	---	---	---	capture		Silent	SNP	54677612	54677612	7549	12	T	C	C	59	59	HNRNPA1	C	4	4
LRP1	4035	broad.mit.edu	37	12	57588854	57588854	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57588854G>T	uc001snd.2	+	51	8744	c.8278G>T	c.(8278-8280)GGG>TGG	p.G2760W		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	2760	Extracellular (Potential).|LDL-receptor class A 16.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)													---	---	---	---	capture		Missense_Mutation	SNP	57588854	57588854	9324	12	G	T	T	47	47	LRP1	T	2	2
LRIG3	121227	broad.mit.edu	37	12	59274487	59274487	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59274487C>A	uc001sqr.2	-	13	1923	c.1677G>T	c.(1675-1677)GTG>GTT	p.V559V	LRIG3_uc009zqh.2_Silent_p.V499V|LRIG3_uc010ssh.1_RNA	NM_153377	NP_700356	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like	559	Ig-like C2-type 1.					integral to membrane				skin(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;1.17e-18)															---	---	---	---	capture		Silent	SNP	59274487	59274487	9319	12	C	A	A	29	29	LRIG3	A	2	2
SETD8	387893	broad.mit.edu	37	12	123889485	123889485	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123889485C>T	uc001uew.2	+	7	754	c.712C>T	c.(712-714)CGG>TGG	p.R238W	SETD8_uc001uex.2_Missense_Mutation_p.R173W	NM_020382	NP_065115	Q9NQR1	SETD8_HUMAN	SET domain-containing 8	279	SET.				cell division|mitosis|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|p53 binding|transcription corepressor activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)														---	---	---	---	capture		Missense_Mutation	SNP	123889485	123889485	14626	12	C	T	T	23	23	SETD8	T	1	1
EP400	57634	broad.mit.edu	37	12	132551417	132551417	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132551417C>T	uc001ujn.2	+	48	8687	c.8652C>T	c.(8650-8652)TCC>TCT	p.S2884S	EP400_uc001ujl.2_Silent_p.S2883S|EP400_uc001ujm.2_Silent_p.S2803S|EP400_uc001ujp.2_Silent_p.S94S	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2920					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)														---	---	---	---	capture		Silent	SNP	132551417	132551417	5342	12	C	T	T	23	23	EP400	T	1	1
GOLGA3	2802	broad.mit.edu	37	12	133350776	133350776	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133350776A>G	uc001ukz.1	-	23	4833	c.4274T>C	c.(4273-4275)CTC>CCC	p.L1425P		NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1425	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)														---	---	---	---	capture		Missense_Mutation	SNP	133350776	133350776	6823	12	A	G	G	11	11	GOLGA3	G	4	4
CRYL1	51084	broad.mit.edu	37	13	21063632	21063632	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21063632C>A	uc001une.2	-	3	232	c.153G>T	c.(151-153)AAG>AAT	p.K51N	CRYL1_uc001unf.2_Missense_Mutation_p.K29N|CRYL1_uc001ung.2_Missense_Mutation_p.K29N	NM_015974	NP_057058	Q9Y2S2	CRYL1_HUMAN	lambda-crystallin	51					fatty acid metabolic process	cytosol	3-hydroxyacyl-CoA dehydrogenase activity|L-gulonate 3-dehydrogenase activity|NAD+ binding|protein homodimerization activity				0		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)												OREG0022283	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	21063632	21063632	4059	13	C	A	A	24	24	CRYL1	A	2	2
SACS	26278	broad.mit.edu	37	13	23912373	23912373	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23912373C>G	uc001uon.2	-	10	6231	c.5642G>C	c.(5641-5643)GGC>GCC	p.G1881A	SACS_uc001uoo.2_Missense_Mutation_p.G1734A|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1881					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---	capture		Missense_Mutation	SNP	23912373	23912373	14284	13	C	G	G	26	26	SACS	G	3	3
RNF17	56163	broad.mit.edu	37	13	25416262	25416262	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25416262C>A	uc001upr.2	+	19	2607	c.2566C>A	c.(2566-2568)CAG>AAG	p.Q856K	RNF17_uc010tdd.1_Missense_Mutation_p.Q715K|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.Q856K|RNF17_uc001ups.2_Missense_Mutation_p.Q795K|RNF17_uc010aac.2_Missense_Mutation_p.Q54K|RNF17_uc010aad.2_5'Flank	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	856					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)														---	---	---	---	capture		Missense_Mutation	SNP	25416262	25416262	13938	13	C	A	A	21	21	RNF17	A	2	2
RXFP2	122042	broad.mit.edu	37	13	32332513	32332513	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32332513T>C	uc001utt.2	+	2	284	c.213T>C	c.(211-213)TGT>TGC	p.C71C	RXFP2_uc010aba.2_Silent_p.C54C	NM_130806	NP_570718	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	71	Extracellular (Potential).|LDL-receptor class A.					integral to membrane|plasma membrane					0		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)														---	---	---	---	capture		Silent	SNP	32332513	32332513	14240	13	T	C	C	59	59	RXFP2	C	4	4
NBEA	26960	broad.mit.edu	37	13	35864535	35864535	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35864535G>T	uc001uvb.2	+	35	5992	c.5786G>T	c.(5785-5787)TGT>TTT	p.C1929F	NBEA_uc010abi.2_Missense_Mutation_p.C585F	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	1929						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---	capture		Missense_Mutation	SNP	35864535	35864535	10583	13	G	T	T	48	48	NBEA	T	2	2
FREM2	341640	broad.mit.edu	37	13	39454823	39454823	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39454823G>C	uc001uwv.2	+	24	9718	c.9409G>C	c.(9409-9411)GGC>CGC	p.G3137R		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	3137	Cytoplasmic (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---	capture		Missense_Mutation	SNP	39454823	39454823	6292	13	G	C	C	43	43	FREM2	C	3	3
ZC3H13	23091	broad.mit.edu	37	13	46549561	46549561	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46549561T>C	uc010tfw.1	-	11	2331	c.2325A>G	c.(2323-2325)GAA>GAG	p.E775E	ZC3H13_uc001vas.1_Silent_p.E775E|ZC3H13_uc001vat.1_Silent_p.E775E	NM_015070	NP_055885	Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	775	Arg/Glu-rich.|Potential.						nucleic acid binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)														---	---	---	---	capture		Silent	SNP	46549561	46549561	18153	13	T	C	C	64	64	ZC3H13	C	4	4
C13orf18	80183	broad.mit.edu	37	13	46935598	46935598	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46935598G>T	uc010acl.2	-	8	1702	c.1097C>A	c.(1096-1098)TCC>TAC	p.S366Y	C13orf18_uc001vbf.3_Missense_Mutation_p.S299Y|C13orf18_uc001vbg.3_Missense_Mutation_p.S94Y|C13orf18_uc010tfz.1_Missense_Mutation_p.S209Y|C13orf18_uc010acm.2_Missense_Mutation_p.S231Y|C13orf18_uc010acn.2_Missense_Mutation_p.S151Y|C13orf18_uc001vbe.3_Missense_Mutation_p.S366Y|C13orf18_uc001vbh.3_Missense_Mutation_p.S366Y|C13orf18_uc001vbi.3_Missense_Mutation_p.S209Y|C13orf18_uc010aco.1_Missense_Mutation_p.S366Y	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	366											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)														---	---	---	---	capture		Missense_Mutation	SNP	46935598	46935598	1767	13	G	T	T	41	41	C13orf18	T	2	2
FNDC3A	22862	broad.mit.edu	37	13	49710673	49710673	+	Silent	SNP	A	G	G	rs141169070	byFrequency	TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49710673A>G	uc001vcm.2	+	6	1001	c.696A>G	c.(694-696)ACA>ACG	p.T232T	FNDC3A_uc001vcl.1_Silent_p.T232T|FNDC3A_uc001vcn.2_Silent_p.T232T|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Silent_p.T176T|FNDC3A_uc001vcq.2_Silent_p.T176T	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	232						Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---	capture		Silent	SNP	49710673	49710673	6211	13	A	G	G	7	7	FNDC3A	G	4	4
INTS6	26512	broad.mit.edu	37	13	51963577	51963577	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:51963577C>T	uc001vfk.2	-	6	1231	c.617G>A	c.(616-618)CGT>CAT	p.R206H	INTS6_uc001vfj.2_Missense_Mutation_p.R193H|INTS6_uc001vfl.2_Missense_Mutation_p.R28H	NM_012141	NP_036273	Q9UL03	INT6_HUMAN	integrator complex subunit 6 isoform a	206	VWFA.				snRNA processing	actin cytoskeleton|integrator complex	protein binding|transmembrane receptor activity			ovary(1)|lung(1)	2		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)														---	---	---	---	capture		Missense_Mutation	SNP	51963577	51963577	8083	13	C	T	T	19	19	INTS6	T	1	1
DCT	1638	broad.mit.edu	37	13	95131312	95131312	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95131312G>A	uc001vlv.3	-	1	625	c.198C>T	c.(196-198)GCC>GCT	p.A66A	DCT_uc010afh.2_Silent_p.A66A	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	66	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)														---	---	---	---	capture		Silent	SNP	95131312	95131312	4475	13	G	A	A	39	39	DCT	A	1	1
UGGT2	55757	broad.mit.edu	37	13	96675911	96675911	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96675911T>A	uc001vmt.2	-	3	514	c.344A>T	c.(343-345)TAC>TTC	p.Y115F	UGGT2_uc010afo.2_RNA|UGGT2_uc001vmv.2_Missense_Mutation_p.Y115F|UGGT2_uc010afp.2_Missense_Mutation_p.Y115F	NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	115					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	96675911	96675911	17500	13	T	A	A	57	57	UGGT2	A	4	4
NALCN	259232	broad.mit.edu	37	13	101714326	101714326	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101714326G>T	uc001vox.1	-	41	4938	c.4749C>A	c.(4747-4749)ATC>ATA	p.I1583I		NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	1583	Cytoplasmic (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)																	---	---	---	---	capture		Silent	SNP	101714326	101714326	10544	13	G	T	T	45	45	NALCN	T	2	2
SOX1	6656	broad.mit.edu	37	13	112721993	112721993	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112721993G>C	uc001vsb.1	+	1	81	c.21G>C	c.(19-21)GAG>GAC	p.E7D		NM_005986	NP_005977	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	7					chromatin organization	nucleus	core promoter sequence-specific DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)														---	---	---	---	capture		Missense_Mutation	SNP	112721993	112721993	15440	13	G	C	C	33	33	SOX1	C	3	3
OR11H12	440153	broad.mit.edu	37	14	19377713	19377713	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19377713C>A	uc010tkp.1	+	1	120	c.120C>A	c.(118-120)ATC>ATA	p.I40I		NM_001013354	NP_001013372	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H,	40	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---	capture		Silent	SNP	19377713	19377713	11333	14	C	A	A	32	32	OR11H12	A	2	2
SALL2	6297	broad.mit.edu	37	14	21991967	21991967	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21991967T>A	uc001wbe.2	-	2	2177	c.1895A>T	c.(1894-1896)CAG>CTG	p.Q632L	SALL2_uc010tly.1_Missense_Mutation_p.Q630L|SALL2_uc010tlz.1_Missense_Mutation_p.Q495L|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Missense_Mutation_p.Q497L|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	632	C2H2-type 3.						DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)														---	---	---	---	capture		Missense_Mutation	SNP	21991967	21991967	14291	14	T	A	A	55	55	SALL2	A	4	4
SALL2	6297	broad.mit.edu	37	14	21992791	21992791	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21992791C>T	uc001wbe.2	-	2	1353	c.1071G>A	c.(1069-1071)CTG>CTA	p.L357L	SALL2_uc010tly.1_Silent_p.L355L|SALL2_uc010tlz.1_Silent_p.L220L|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Silent_p.L222L|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	357							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)														---	---	---	---	capture		Silent	SNP	21992791	21992791	14291	14	C	T	T	29	29	SALL2	T	2	2
FANCM	57697	broad.mit.edu	37	14	45667984	45667984	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45667984G>A	uc001wwd.3	+	22	5953	c.5854G>A	c.(5854-5856)GAA>AAA	p.E1952K	FANCM_uc010anf.2_Missense_Mutation_p.E1926K|FANCM_uc001wwe.3_Missense_Mutation_p.E1488K|FANCM_uc010ang.2_Missense_Mutation_p.E1201K	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1952	Interaction with FAAP24 and EME1.				DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7													Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---	capture		Missense_Mutation	SNP	45667984	45667984	5907	14	G	A	A	41	41	FANCM	A	2	2
NID2	22795	broad.mit.edu	37	14	52526917	52526917	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52526917T>C	uc001wzo.2	-	3	926	c.692A>G	c.(691-693)GAG>GGG	p.E231G	NID2_uc010tqs.1_Missense_Mutation_p.E231G|NID2_uc010tqt.1_Missense_Mutation_p.E231G|NID2_uc001wzp.2_Missense_Mutation_p.E231G	NM_007361	NP_031387	Q14112	NID2_HUMAN	nidogen 2 precursor	231	NIDO.					basement membrane	calcium ion binding|collagen binding			pancreas(2)|breast(2)|ovary(1)|liver(1)|skin(1)	7	Breast(41;0.0639)|all_epithelial(31;0.123)																	---	---	---	---	capture		Missense_Mutation	SNP	52526917	52526917	10816	14	T	C	C	54	54	NID2	C	4	4
SGPP1	81537	broad.mit.edu	37	14	64194007	64194007	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64194007A>G	uc001xgj.2	-	1	750	c.656T>C	c.(655-657)ATG>ACG	p.M219T		NM_030791	NP_110418	Q9BX95	SGPP1_HUMAN	sphingosine-1-phosphate phosphatase 1	219	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane	dihydrosphingosine-1-phosphate phosphatase activity|sphingosine-1-phosphate phosphatase activity			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.0056)|all cancers(60;0.0141)|BRCA - Breast invasive adenocarcinoma(234;0.103)														---	---	---	---	capture		Missense_Mutation	SNP	64194007	64194007	14710	14	A	G	G	8	8	SGPP1	G	4	4
VSX2	338917	broad.mit.edu	37	14	74711940	74711940	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74711940T>C	uc001xpq.2	+	3	618	c.528T>C	c.(526-528)TAT>TAC	p.Y176Y		NM_182894	NP_878314	P58304	VSX2_HUMAN	visual system homeobox 2	176	Homeobox.				multicellular organismal development|response to stimulus|visual perception	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00154)														---	---	---	---	capture		Silent	SNP	74711940	74711940	17801	14	T	C	C	51	51	VSX2	C	4	4
GTF2A1	2957	broad.mit.edu	37	14	81670326	81670326	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81670326G>A	uc001xvf.1	-	3	687	c.255C>T	c.(253-255)CAC>CAT	p.H85H	GTF2A1_uc010atb.1_Silent_p.H35H|GTF2A1_uc001xvg.1_Silent_p.H46H|GTF2A1_uc001xvh.1_Silent_p.H46H|SNORA79_uc001xvi.1_5'Flank	NM_015859	NP_056943	P52655	TF2AA_HUMAN	TFIIA alpha, p55 isoform 1	85	Poly-His.				regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|transcription factor TFIIA complex	DNA binding|protein binding|protein heterodimerization activity|TBP-class protein binding|transcription coactivator activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0287)														---	---	---	---	capture		Silent	SNP	81670326	81670326	7132	14	G	A	A	44	44	GTF2A1	A	2	2
WARS	7453	broad.mit.edu	37	14	100803472	100803472	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100803472C>T	uc001yhf.1	-	9	1265	c.1181G>A	c.(1180-1182)TGT>TAT	p.C394Y	WARS_uc001yhe.1_Missense_Mutation_p.C200Y|WARS_uc001yhg.1_Missense_Mutation_p.C394Y|WARS_uc001yhh.1_Missense_Mutation_p.C394Y|WARS_uc001yhi.1_Missense_Mutation_p.C353Y|WARS_uc001yhj.1_Missense_Mutation_p.C353Y|WARS_uc001yhk.1_Missense_Mutation_p.C353Y|WARS_uc001yhl.1_Missense_Mutation_p.C394Y	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a	394					angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)													---	---	---	---	capture		Missense_Mutation	SNP	100803472	100803472	17821	14	C	T	T	17	17	WARS	T	2	2
OR4M2	390538	broad.mit.edu	37	15	22369213	22369213	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369213C>T	uc010tzu.1	+	1	638	c.638C>T	c.(637-639)GCT>GTT	p.A213V	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	213	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)														---	---	---	---	capture		Missense_Mutation	SNP	22369213	22369213	11486	15	C	T	T	28	28	OR4M2	T	2	2
MGA	23269	broad.mit.edu	37	15	42057172	42057172	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42057172A>G	uc010ucy.1	+	23	8014	c.7833A>G	c.(7831-7833)CTA>CTG	p.L2611L	MGA_uc010ucz.1_Silent_p.L2402L	NM_001164273	NP_001157745	Q8IWI9	MGAP_HUMAN	MAX-interacting protein isoform 1	2572						MLL1 complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(6)|kidney(3)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	12		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)														---	---	---	---	capture		Silent	SNP	42057172	42057172	9930	15	A	G	G	16	16	MGA	G	4	4
CEP152	22995	broad.mit.edu	37	15	49036454	49036454	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49036454G>A	uc001zwy.2	-	23	3684	c.3650C>T	c.(3649-3651)GCT>GTT	p.A1217V	CEP152_uc001zwz.2_Missense_Mutation_p.A1273V|CEP152_uc001zxa.1_Missense_Mutation_p.A1180V	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	1217					centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)														---	---	---	---	capture		Missense_Mutation	SNP	49036454	49036454	3381	15	G	A	A	34	34	CEP152	A	2	2
SCG3	29106	broad.mit.edu	37	15	51973962	51973962	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51973962C>T	uc002abh.2	+	1	418	c.10C>T	c.(10-12)CTC>TTC	p.L4F	SCG3_uc010ufz.1_5'UTR	NM_013243	NP_037375	Q8WXD2	SCG3_HUMAN	secretogranin III isoform 1 precursor	4					platelet activation|platelet degranulation	extracellular region|stored secretory granule				ovary(1)	1				all cancers(107;0.00488)														---	---	---	---	capture		Missense_Mutation	SNP	51973962	51973962	14373	15	C	T	T	24	24	SCG3	T	2	2
FOXB1	27023	broad.mit.edu	37	15	60298008	60298008	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60298008C>A	uc002agj.1	+	2	1325	c.846C>A	c.(844-846)ACC>ACA	p.T282T	FOXB1_uc010bgh.1_Intron	NM_012182	NP_036314	Q99853	FOXB1_HUMAN	forkhead box B1	282					axon target recognition|cell migration in diencephalon|epithelial cell differentiation involved in mammary gland alveolus development|floor plate development|hypothalamus cell migration|inferior colliculus development|lactation|mammillothalamic axonal tract development|negative regulation of neuron apoptosis|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|telencephalon cell migration|visual learning	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Silent	SNP	60298008	60298008	6234	15	C	A	A	24	24	FOXB1	A	2	2
ACAN	176	broad.mit.edu	37	15	89392689	89392689	+	Missense_Mutation	SNP	C	T	T	rs144501729	by1000genomes	TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89392689C>T	uc010upo.1	+	10	2127	c.1753C>T	c.(1753-1755)CGC>TGC	p.R585C	ACAN_uc002bmx.2_Missense_Mutation_p.R585C|ACAN_uc010upp.1_Missense_Mutation_p.R585C|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	585					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)															---	---	---	---	capture		Missense_Mutation	SNP	89392689	89392689	118	15	C	T	T	19	19	ACAN	T	1	1
SYNM	23336	broad.mit.edu	37	15	99670662	99670662	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99670662C>T	uc002bup.2	+	6	2217	c.2097C>T	c.(2095-2097)TCC>TCT	p.S699S	SYNM_uc002buo.2_Silent_p.S699S|SYNM_uc002buq.2_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	699	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4																		---	---	---	---	capture		Silent	SNP	99670662	99670662	15976	15	C	T	T	23	23	SYNM	T	1	1
UBN1	29855	broad.mit.edu	37	16	4924934	4924934	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4924934C>A	uc002cyb.2	+	15	2862	c.2523C>A	c.(2521-2523)CTC>CTA	p.L841L	UBN1_uc010uxw.1_Silent_p.L841L|UBN1_uc002cyc.2_Silent_p.L841L	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	841					chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2																		---	---	---	---	capture		Silent	SNP	4924934	4924934	17450	16	C	A	A	30	30	UBN1	A	2	2
UBN1	29855	broad.mit.edu	37	16	4926941	4926941	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4926941C>T	uc002cyb.2	+	16	3433	c.3094C>T	c.(3094-3096)CCA>TCA	p.P1032S	UBN1_uc010uxw.1_Missense_Mutation_p.P1032S|UBN1_uc002cyc.2_Missense_Mutation_p.P1032S	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	1032	Ser-rich.				chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	4926941	4926941	17450	16	C	T	T	22	22	UBN1	T	2	2
SEC14L5	9717	broad.mit.edu	37	16	5009369	5009369	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5009369G>A	uc002cye.2	+	2	225	c.45G>A	c.(43-45)CCG>CCA	p.P15P		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	15	PRELI/MSF1.					integral to membrane|intracellular	transporter activity				0																		---	---	---	---	capture		Silent	SNP	5009369	5009369	14471	16	G	A	A	40	40	SEC14L5	A	1	1
CBLN1	869	broad.mit.edu	37	16	49315323	49315323	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49315323C>A	uc002efq.2	-	1	393	c.54G>T	c.(52-54)CCG>CCT	p.P18P		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	18					nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)																---	---	---	---	capture		Silent	SNP	49315323	49315323	2823	16	C	A	A	23	23	CBLN1	A	1	1
NOD2	64127	broad.mit.edu	37	16	50745778	50745778	+	Silent	SNP	G	A	A	rs141355588		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50745778G>A	uc002egm.1	+	4	2061	c.1956G>A	c.(1954-1956)TCG>TCA	p.S652S	NOD2_uc010cbk.1_Silent_p.S625S|NOD2_uc002egl.1_Silent_p.S430S|NOD2_uc010cbl.1_Silent_p.S430S|NOD2_uc010cbm.1_Silent_p.S430S|NOD2_uc010cbn.1_RNA|NOD2_uc010cbo.1_RNA|NOD2_uc010cbp.1_5'Flank|NOD2_uc010cbq.1_5'Flank|NOD2_uc010cbr.1_5'Flank	NM_022162	NP_071445	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain	652					activation of MAPK activity involved in innate immune response|cytokine production involved in immune response|detection of bacterium|detection of muramyl dipeptide|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of macrophage apoptosis|nucleotide-binding oligomerization domain containing 2 signaling pathway|positive regulation of B cell activation|positive regulation of dendritic cell antigen processing and presentation|positive regulation of epithelial cell proliferation|positive regulation of ERK1 and ERK2 cascade|positive regulation of gamma-delta T cell activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-1 beta secretion|positive regulation of interleukin-10 production|positive regulation of interleukin-17 production|positive regulation of interleukin-6 production|positive regulation of JNK cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of Notch signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of prostaglandin-E synthase activity|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of stress-activated MAPK cascade|positive regulation of tumor necrosis factor production|positive regulation of type 2 immune response|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|plasma membrane|vesicle	ATP binding|CARD domain binding|muramyl dipeptide binding|protein kinase binding			ovary(3)|skin(1)	4		all_cancers(37;0.0156)																---	---	---	---	capture		Silent	SNP	50745778	50745778	10920	16	G	A	A	39	39	NOD2	A	1	1
TAF1C	9013	broad.mit.edu	37	16	84218553	84218553	+	Silent	SNP	G	A	A	rs141321804	by1000genomes	TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84218553G>A	uc002fhn.2	-	2	270	c.42C>T	c.(40-42)ACC>ACT	p.T14T	TAF1C_uc002fhm.2_Intron|TAF1C_uc010vnx.1_Silent_p.T14T|TAF1C_uc010vny.1_Intron|TAF1C_uc010vnz.1_Intron|TAF1C_uc002fho.2_Intron|TAF1C_uc010voa.1_Intron|TAF1C_uc002fhp.1_RNA|TAF1C_uc010vob.1_Silent_p.T14T	NM_005679	NP_005670	Q15572	TAF1C_HUMAN	TBP-associated factor 1C isoform 1	14					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	84218553	84218553	16042	16	G	A	A	39	39	TAF1C	A	1	1
TP53	7157	broad.mit.edu	37	17	7579480	7579480	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579480A>G	uc002gim.2	-	4	401	c.207T>C	c.(205-207)GCT>GCC	p.A69A	TP53_uc002gig.1_Silent_p.A69A|TP53_uc002gih.2_Silent_p.A69A|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.A69A|TP53_uc010cni.1_Silent_p.A69A|TP53_uc002gij.2_Silent_p.A69A|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.A30A|TP53_uc010cnk.1_Silent_p.A84A	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	69	Interaction with WWOX.|Interaction with HRMT1L2.		A -> D (in a sporadic cancer; somatic mutation).|A -> G (in sporadic cancers; somatic mutation).|A -> T (in a sporadic cancer; somatic mutation).|A -> V (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.G59fs*23(3)|p.A69G(3)|p.A69fs*54(1)|p.E68fs*76(1)|p.A69fs*79(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.A69V(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.S33fs*23(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---	capture		Silent	SNP	7579480	7579480	16923	17	A	G	G	7	7	TP53	G	4	4
DNAH2	146754	broad.mit.edu	37	17	7643087	7643087	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7643087G>T	uc002giu.1	+	8	1221	c.1207G>T	c.(1207-1209)GAT>TAT	p.D403Y	DNAH2_uc002git.2_Missense_Mutation_p.D485Y|DNAH2_uc010vuk.1_Missense_Mutation_p.D403Y	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	403	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---	capture		Missense_Mutation	SNP	7643087	7643087	4785	17	G	T	T	33	33	DNAH2	T	2	2
DNAH2	146754	broad.mit.edu	37	17	7697572	7697572	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7697572G>A	uc002giu.1	+	48	7584	c.7570G>A	c.(7570-7572)GAA>AAA	p.E2524K		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	2524	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---	capture		Missense_Mutation	SNP	7697572	7697572	4785	17	G	A	A	41	41	DNAH2	A	2	2
MYH1	4619	broad.mit.edu	37	17	10419544	10419544	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10419544T>C	uc002gmo.2	-	4	414	c.320A>G	c.(319-321)AAA>AGA	p.K107R	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	107	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---	capture		Missense_Mutation	SNP	10419544	10419544	10424	17	T	C	C	64	64	MYH1	C	4	4
MYOCD	93649	broad.mit.edu	37	17	12642621	12642621	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12642621C>A	uc002gnn.2	+	7	992	c.693C>A	c.(691-693)CCC>CCA	p.P231P	MYOCD_uc002gno.2_Silent_p.P231P|MYOCD_uc002gnp.1_Silent_p.P135P	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	231					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)														---	---	---	---	capture		Silent	SNP	12642621	12642621	10482	17	C	A	A	21	21	MYOCD	A	2	2
ATPAF2	91647	broad.mit.edu	37	17	17942271	17942271	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17942271C>T	uc002gse.1	-	1	210	c.57G>A	c.(55-57)CCG>CCA	p.P19P	C17orf39_uc002gsg.1_5'Flank|ATPAF2_uc002gsd.1_RNA|ATPAF2_uc002gsf.1_RNA|ATPAF2_uc010vxf.1_Silent_p.P19P	NM_145691	NP_663729	Q8N5M1	ATPF2_HUMAN	ATP synthase mitochondrial F1 complex assembly	19					proton-transporting ATP synthase complex assembly	mitochondrion|nuclear speck	protein binding				0	all_neural(463;0.228)																	---	---	---	---	capture		Silent	SNP	17942271	17942271	1220	17	C	T	T	23	23	ATPAF2	T	1	1
EFCAB5	374786	broad.mit.edu	37	17	28380673	28380673	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28380673A>C	uc002het.2	+	10	1893	c.1701A>C	c.(1699-1701)GAA>GAC	p.E567D	EFCAB5_uc010wbi.1_Missense_Mutation_p.E310D|EFCAB5_uc010wbj.1_Missense_Mutation_p.E511D|EFCAB5_uc010wbk.1_Missense_Mutation_p.E224D|EFCAB5_uc010csd.2_RNA|EFCAB5_uc010cse.2_Missense_Mutation_p.E446D|EFCAB5_uc010csf.2_Missense_Mutation_p.E446D	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	567							calcium ion binding			ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	28380673	28380673	5125	17	A	C	C	1	1	EFCAB5	C	4	4
SUZ12	23512	broad.mit.edu	37	17	30310095	30310095	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30310095C>T	uc002hgs.2	+	9	1217	c.995C>T	c.(994-996)GCA>GTA	p.A332V	SUZ12_uc002hgt.2_Missense_Mutation_p.A309V	NM_015355	NP_056170	Q15022	SUZ12_HUMAN	joined to JAZF1	332					negative regulation of cell differentiation|transcription, DNA-dependent	ESC/E(Z) complex	histone methyltransferase activity|methylated histone residue binding|zinc ion binding		JAZF1/SUZ12(131)	soft_tissue(98)|endometrium(33)	131		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)						T	JAZF1	endometrial stromal tumours								---	---	---	---	capture		Missense_Mutation	SNP	30310095	30310095	15936	17	C	T	T	25	25	SUZ12	T	2	2
SPACA3	124912	broad.mit.edu	37	17	31323996	31323996	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31323996A>T	uc002hhs.1	+	3	554	c.479A>T	c.(478-480)AAC>ATC	p.N160I	SPACA3_uc010cte.1_RNA	NM_173847	NP_776246	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	160	Extracellular (Potential).				cell wall macromolecule catabolic process|defense response to Gram-positive bacterium|monocyte activation|peptidoglycan catabolic process|positive regulation of macrophage activation|positive regulation of phagocytosis|response to virus	acrosomal membrane|extracellular region|integral to membrane|lysosome	bacterial cell surface binding|lysozyme activity|protein binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.193)															---	---	---	---	capture		Missense_Mutation	SNP	31323996	31323996	15474	17	A	T	T	2	2	SPACA3	T	4	4
TBX21	30009	broad.mit.edu	37	17	45820467	45820467	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45820467C>G	uc002ilv.1	+	3	888	c.677C>G	c.(676-678)CCC>CGC	p.P226R		NM_013351	NP_037483	Q9UL17	TBX21_HUMAN	T-box 21	226	T-box.				lymphocyte migration|multicellular organismal development|positive regulation of transcription, DNA-dependent|response to virus	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	45820467	45820467	16183	17	C	G	G	22	22	TBX21	G	3	3
SPATA20	64847	broad.mit.edu	37	17	48632997	48632997	+	Missense_Mutation	SNP	G	A	A	rs150608206	byFrequency	TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48632997G>A	uc002irf.2	+	16	2476	c.2335G>A	c.(2335-2337)GAA>AAA	p.E779K	SPATA20_uc002irc.2_Missense_Mutation_p.E446K|SPATA20_uc002ire.2_Missense_Mutation_p.E735K|SPATA20_uc002ird.2_Missense_Mutation_p.E795K|SPATA20_uc002irg.2_RNA	NM_022827	NP_073738	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	779					cell differentiation|mannose metabolic process|multicellular organismal development|spermatogenesis	extracellular region	mannose-6-phosphate isomerase activity|protein binding				0	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)															---	---	---	---	capture		Missense_Mutation	SNP	48632997	48632997	15514	17	G	A	A	37	37	SPATA20	A	1	1
EPX	8288	broad.mit.edu	37	17	56270816	56270816	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56270816A>G	uc002ivq.2	+	3	341	c.255A>G	c.(253-255)ACA>ACG	p.T85T		NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein	85					hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2																		---	---	---	---	capture		Silent	SNP	56270816	56270816	5393	17	A	G	G	7	7	EPX	G	4	4
BZRAP1	9256	broad.mit.edu	37	17	56389406	56389406	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56389406T>C	uc002ivx.3	-	17	3647	c.2776A>G	c.(2776-2778)AGT>GGT	p.S926G	BZRAP1_uc010dcs.2_Missense_Mutation_p.S866G|BZRAP1_uc010wnt.1_Missense_Mutation_p.S926G	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	926	Fibronectin type-III 2.					mitochondrion	benzodiazepine receptor binding			upper_aerodigestive_tract(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)																	---	---	---	---	capture		Missense_Mutation	SNP	56389406	56389406	1611	17	T	C	C	55	55	BZRAP1	C	4	4
CLTC	1213	broad.mit.edu	37	17	57760366	57760366	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57760366C>G	uc002ixq.1	+	24	4307	c.3864C>G	c.(3862-3864)AAC>AAG	p.N1288K	CLTC_uc002ixp.2_Missense_Mutation_p.N1288K|CLTC_uc002ixr.1_Missense_Mutation_p.N1292K	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1	1288	Heavy chain arm.|Proximal segment.|Involved in binding clathrin light chain (By similarity).				axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)							T	ALK|TFE3	ALCL|renal 								---	---	---	---	capture		Missense_Mutation	SNP	57760366	57760366	3704	17	C	G	G	20	20	CLTC	G	3	3
TBX2	6909	broad.mit.edu	37	17	59481839	59481839	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59481839A>T	uc010wox.1	+	4	1149	c.868A>T	c.(868-870)AAC>TAC	p.N290Y	TBX2_uc002ize.2_Missense_Mutation_p.N280Y|TBX2_uc002izg.2_Missense_Mutation_p.N136Y	NM_005994	NP_005985	Q13207	TBX2_HUMAN	T-box 2	290					cell aging|positive regulation of cell proliferation		sequence-specific DNA binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	59481839	59481839	16181	17	A	T	T	9	9	TBX2	T	4	4
APOH	350	broad.mit.edu	37	17	64210707	64210707	+	Silent	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64210707A>T	uc002jfn.3	-	7	905	c.846T>A	c.(844-846)ATT>ATA	p.I282I		NM_000042	NP_000033	P02749	APOH_HUMAN	apolipoprotein H precursor	282	Sushi-like.				blood coagulation, intrinsic pathway|negative regulation of angiogenesis|negative regulation of blood coagulation|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|negative regulation of fibrinolysis|negative regulation of myeloid cell apoptosis|negative regulation of smooth muscle cell apoptosis|plasminogen activation|positive regulation of lipoprotein lipase activity|triglyceride metabolic process|triglyceride transport	cell surface|chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	eukaryotic cell surface binding|glycoprotein binding|heparin binding|lipoprotein lipase activator activity|phospholipid binding				0			BRCA - Breast invasive adenocarcinoma(6;9.74e-08)															---	---	---	---	capture		Silent	SNP	64210707	64210707	815	17	A	T	T	9	9	APOH	T	4	4
PSMD12	5718	broad.mit.edu	37	17	65346408	65346408	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65346408T>A	uc002jfy.2	-	4	428	c.342A>T	c.(340-342)GAA>GAT	p.E114D	PSMD12_uc002jga.2_Missense_Mutation_p.E94D|PSMD12_uc002jfz.2_Missense_Mutation_p.E55D|PSMD12_uc010det.1_Missense_Mutation_p.E114D	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1	114					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)																	---	---	---	---	capture		Missense_Mutation	SNP	65346408	65346408	13148	17	T	A	A	64	64	PSMD12	A	4	4
ABCA9	10350	broad.mit.edu	37	17	67045446	67045446	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67045446C>A	uc002jhu.2	-	3	425	c.282G>T	c.(280-282)GTG>GTT	p.V94V	ABCA9_uc010dez.2_Silent_p.V94V|ABCA9_uc002jhv.2_Silent_p.V94V	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	94					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)																	---	---	---	---	capture		Silent	SNP	67045446	67045446	40	17	C	A	A	21	21	ABCA9	A	2	2
GGA3	23163	broad.mit.edu	37	17	73237582	73237582	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73237582G>A	uc002jni.1	-	10	854	c.845C>T	c.(844-846)GCC>GTC	p.A282V	GGA3_uc002jnj.1_Missense_Mutation_p.A249V|GGA3_uc010wrw.1_Missense_Mutation_p.A160V|GGA3_uc002jnk.1_Missense_Mutation_p.A210V|GGA3_uc010wrx.1_Missense_Mutation_p.A160V|GGA3_uc010wry.1_Missense_Mutation_p.A210V	NM_138619	NP_619525	Q9NZ52	GGA3_HUMAN	ADP-ribosylation factor binding protein 3	282	GAT.|Binds to ARF1 (in long isoform).				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|trans-Golgi network	ADP-ribosylation factor binding			ovary(1)|breast(1)	2			all cancers(21;2.39e-06)|Epithelial(20;2.38e-05)															---	---	---	---	capture		Missense_Mutation	SNP	73237582	73237582	6622	17	G	A	A	42	42	GGA3	A	2	2
RHBDF2	79651	broad.mit.edu	37	17	74475254	74475254	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74475254C>T	uc002jrq.1	-	5	758	c.465G>A	c.(463-465)AAG>AAA	p.K155K	RHBDF2_uc002jrp.1_Silent_p.K126K|RHBDF2_uc002jrr.1_Silent_p.K7K|RHBDF2_uc010wtf.1_Silent_p.K126K|RHBDF2_uc002jrs.1_Silent_p.K126K	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	155	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0																		---	---	---	---	capture		Silent	SNP	74475254	74475254	13795	17	C	T	T	24	24	RHBDF2	T	2	2
TNRC6C	57690	broad.mit.edu	37	17	76046155	76046155	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76046155G>A	uc002jud.2	+	4	1612	c.1012G>A	c.(1012-1014)GGT>AGT	p.G338S	TNRC6C_uc002juf.2_Missense_Mutation_p.G338S|TNRC6C_uc002jue.2_Missense_Mutation_p.G338S	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2	338	Sufficient for interaction with argonaute family proteins.|Gly-rich.				gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)															---	---	---	---	capture		Missense_Mutation	SNP	76046155	76046155	16883	17	G	A	A	39	39	TNRC6C	A	1	1
CD7	924	broad.mit.edu	37	17	80274690	80274690	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80274690A>G	uc002kel.1	-	2	359	c.250T>C	c.(250-252)TTC>CTC	p.F84L	CD7_uc010din.2_Missense_Mutation_p.F84L|CD7_uc002kem.2_Missense_Mutation_p.V65A|CD7_uc010wvk.1_Missense_Mutation_p.F84L	NM_006137	NP_006128	P09564	CD7_HUMAN	CD7 antigen precursor	84	Ig-like.|Extracellular (Probable).				immune response|T cell activation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to membrane|membrane fraction|plasma membrane	receptor activity				0	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00463)|BRCA - Breast invasive adenocarcinoma(99;0.0667)															---	---	---	---	capture		Missense_Mutation	SNP	80274690	80274690	3160	17	A	G	G	2	2	CD7	G	4	4
CABYR	26256	broad.mit.edu	37	18	21723346	21723346	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21723346A>G	uc002kux.2	+	3	320	c.168A>G	c.(166-168)AAA>AAG	p.K56K	CABYR_uc010xbb.1_Intron|CABYR_uc002kuy.2_Silent_p.K56K|CABYR_uc002kuz.2_Silent_p.K56K|CABYR_uc002kva.2_Intron|CABYR_uc002kvb.2_Intron|CABYR_uc002kvc.2_Silent_p.K56K	NM_012189	NP_036321	O75952	CABYR_HUMAN	calcium-binding tyrosine	56					ciliary or flagellar motility|signal transduction|sperm capacitation	cytoplasm|cytoskeleton|flagellum|motile cilium|nucleus	calcium ion binding|cAMP-dependent protein kinase regulator activity|enzyme binding|protein heterodimerization activity|SH3 domain binding				0	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)																	---	---	---	---	capture		Silent	SNP	21723346	21723346	2652	18	A	G	G	3	3	CABYR	G	4	4
ZNF521	25925	broad.mit.edu	37	18	22806790	22806790	+	Silent	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806790T>A	uc002kvk.2	-	4	1339	c.1092A>T	c.(1090-1092)TCA>TCT	p.S364S	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Silent_p.S364S|ZNF521_uc002kvl.2_Silent_p.S144S	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	364					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)							T	PAX5	ALL								---	---	---	---	capture		Silent	SNP	22806790	22806790	18559	18	T	A	A	55	55	ZNF521	A	4	4
KIAA1632	57724	broad.mit.edu	37	18	43532399	43532399	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43532399G>A	uc002lbm.2	-	3	1319	c.1219C>T	c.(1219-1221)CTG>TTG	p.L407L	KIAA1632_uc002lbo.1_Silent_p.L407L	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	407					autophagy						0																		---	---	---	---	capture		Silent	SNP	43532399	43532399	8558	18	G	A	A	33	33	KIAA1632	A	2	2
SALL3	27164	broad.mit.edu	37	18	76752543	76752543	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76752543C>T	uc002lmt.2	+	2	552	c.552C>T	c.(550-552)GGC>GGT	p.G184G	SALL3_uc010dra.2_5'Flank	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	184					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)														---	---	---	---	capture		Silent	SNP	76752543	76752543	14292	18	C	T	T	27	27	SALL3	T	1	1
DPP9	91039	broad.mit.edu	37	19	4676589	4676589	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4676589T>A	uc002mba.2	-	22	2924	c.2666A>T	c.(2665-2667)CAG>CTG	p.Q889L		NM_139159	NP_631898	Q86TI2	DPP9_HUMAN	dipeptidylpeptidase 9	860					proteolysis	cytosol|membrane	aminopeptidase activity|serine-type peptidase activity			skin(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)														---	---	---	---	capture		Missense_Mutation	SNP	4676589	4676589	4917	19	T	A	A	55	55	DPP9	A	4	4
TMEM146	257062	broad.mit.edu	37	19	5727292	5727292	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5727292T>A	uc002mda.2	+	3	201	c.140T>A	c.(139-141)TTT>TAT	p.F47Y	TMEM146_uc010duj.1_5'UTR	NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	47	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	5727292	5727292	16592	19	T	A	A	64	64	TMEM146	A	4	4
ADAMTS10	81794	broad.mit.edu	37	19	8670179	8670179	+	Silent	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8670179C>A	uc002mkj.1	-	4	427	c.153G>T	c.(151-153)GGG>GGT	p.G51G	ADAMTS10_uc002mkk.1_5'UTR	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	51					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(2)	4																		---	---	---	---	capture		Silent	SNP	8670179	8670179	257	19	C	A	A	22	22	ADAMTS10	A	2	2
ZNF560	147741	broad.mit.edu	37	19	9578088	9578088	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9578088C>A	uc002mlp.1	-	10	1745	c.1535G>T	c.(1534-1536)GGT>GTT	p.G512V	ZNF560_uc010dwr.1_Missense_Mutation_p.G406V	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	512					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	9578088	9578088	18586	19	C	A	A	18	18	ZNF560	A	2	2
DAND5	199699	broad.mit.edu	37	19	13084213	13084213	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13084213G>T	uc002mwc.1	+	2	378	c.335G>T	c.(334-336)CGG>CTG	p.R112L	DAND5_uc010dyz.1_3'UTR	NM_152654	NP_689867	Q8N907	DAND5_HUMAN	dante precursor	112	CTCK.					extracellular region				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(19;1.87e-18)															---	---	---	---	capture		Missense_Mutation	SNP	13084213	13084213	4397	19	G	T	T	39	39	DAND5	T	1	1
DNAJB1	3337	broad.mit.edu	37	19	14629017	14629017	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14629017C>A	uc002myz.1	-	1	185	c.145G>T	c.(145-147)GCT>TCT	p.A49S	DNAJB1_uc010xnr.1_Intron	NM_006145	NP_006136	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	49	J.				chaperone cofactor-dependent protein refolding|response to unfolded protein	cytoplasm|nucleolus	heat shock protein binding|unfolded protein binding				0				GBM - Glioblastoma multiforme(1328;0.0476)														---	---	---	---	capture		Missense_Mutation	SNP	14629017	14629017	4798	19	C	A	A	27	27	DNAJB1	A	1	1
PLVAP	83483	broad.mit.edu	37	19	17476369	17476369	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17476369G>C	uc002ngk.1	-	3	955	c.905C>G	c.(904-906)TCA>TGA	p.S302*		NM_031310	NP_112600	Q9BX97	PLVAP_HUMAN	plasmalemma vesicle associated protein	302	Potential.|Extracellular (Potential).					caveola|integral to membrane|perinuclear region of cytoplasm					0																		---	---	---	---	capture		Nonsense_Mutation	SNP	17476369	17476369	12542	19	G	C	C	45	45	PLVAP	C	5	3
ZNF708	7562	broad.mit.edu	37	19	21476337	21476337	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21476337C>G	uc002npq.1	-	4	1629	c.1431G>C	c.(1429-1431)AAG>AAC	p.K477N	ZNF708_uc002npr.1_Missense_Mutation_p.K413N|ZNF708_uc010ecs.1_Missense_Mutation_p.K413N	NM_021269	NP_067092	P17019	ZN708_HUMAN	zinc finger protein 708	477	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(4)|skin(2)	6																		---	---	---	---	capture		Missense_Mutation	SNP	21476337	21476337	18708	19	C	G	G	20	20	ZNF708	G	3	3
ZNF100	163227	broad.mit.edu	37	19	21910173	21910173	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910173A>T	uc002nqi.2	-	5	1140	c.941T>A	c.(940-942)GTG>GAG	p.V314E	ZNF100_uc002nqh.2_Missense_Mutation_p.V250E	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	314					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	21910173	21910173	18304	19	A	T	T	6	6	ZNF100	T	4	4
ZNF208	7757	broad.mit.edu	37	19	22154747	22154747	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22154747T>A	uc002nqp.2	-	6	2854	c.2705A>T	c.(2704-2706)AAA>ATA	p.K902I	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---	capture		Missense_Mutation	SNP	22154747	22154747	18357	19	T	A	A	64	64	ZNF208	A	4	4
ZNF257	113835	broad.mit.edu	37	19	22256289	22256289	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22256289C>A	uc010ecx.2	+	3	318	c.149C>A	c.(148-150)CCA>CAA	p.P50Q	ZNF257_uc010ecy.2_Missense_Mutation_p.P18Q	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	50	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)																---	---	---	---	capture		Missense_Mutation	SNP	22256289	22256289	18391	19	C	A	A	21	21	ZNF257	A	2	2
AXL	558	broad.mit.edu	37	19	41726703	41726703	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41726703A>G	uc010ehj.2	+	2	438	c.248A>G	c.(247-249)CAG>CGG	p.Q83R	CYP2F1_uc010xvw.1_Intron|AXL_uc010ehi.1_Missense_Mutation_p.Q83R|AXL_uc010ehk.2_Missense_Mutation_p.Q83R	NM_021913	NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase isoform 1	83	Extracellular (Potential).|Interaction with GAS6.|Ig-like C2-type 1.					integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(4)|stomach(3)|ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	13																		---	---	---	---	capture		Missense_Mutation	SNP	41726703	41726703	1259	19	A	G	G	7	7	AXL	G	4	4
RSPH6A	81492	broad.mit.edu	37	19	46313932	46313932	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46313932C>A	uc002pdm.2	-	2	960	c.817G>T	c.(817-819)GAG>TAG	p.E273*	RSPH6A_uc002pdl.2_Nonsense_Mutation_p.E9*	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	273						intracellular				ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	46313932	46313932	14187	19	C	A	A	30	30	RSPH6A	A	5	2
ZNF473	25888	broad.mit.edu	37	19	50548547	50548547	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50548547C>T	uc002prn.2	+	5	1084	c.847C>T	c.(847-849)CAG>TAG	p.Q283*	ZNF473_uc002prm.2_Nonsense_Mutation_p.Q283*|ZNF473_uc010ybo.1_Nonsense_Mutation_p.Q271*	NM_001006656	NP_001006657	Q8WTR7	ZN473_HUMAN	zinc finger protein 473	283	C2H2-type 2; degenerate.				histone mRNA 3'-end processing|regulation of transcription, DNA-dependent|termination of RNA polymerase II transcription	Cajal body	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0728)		GBM - Glioblastoma multiforme(134;0.00111)|OV - Ovarian serous cystadenocarcinoma(262;0.0058)														---	---	---	---	capture		Nonsense_Mutation	SNP	50548547	50548547	18525	19	C	T	T	29	29	ZNF473	T	5	2
FPR2	2358	broad.mit.edu	37	19	52272372	52272372	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52272372T>C	uc002pxr.2	+	2	506	c.461T>C	c.(460-462)CTA>CCA	p.L154P	FPR2_uc002pxs.3_Missense_Mutation_p.L154P|FPR2_uc010epf.2_Missense_Mutation_p.L154P	NM_001005738	NP_001005738	P25090	FPR2_HUMAN	formyl peptide receptor-like 1	154	Helical; Name=4; (Potential).				cell adhesion|cellular component movement|chemotaxis|inflammatory response	integral to membrane|plasma membrane	N-formyl peptide receptor activity			lung(3)|ovary(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	52272372	52272372	6285	19	T	C	C	53	53	FPR2	C	4	4
ZNF701	55762	broad.mit.edu	37	19	53086017	53086017	+	Silent	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53086017A>C	uc002pzs.1	+	4	832	c.705A>C	c.(703-705)ATA>ATC	p.I235I	ZNF701_uc010ydn.1_Silent_p.I301I	NM_018260	NP_060730	Q9NV72	ZN701_HUMAN	zinc finger protein 701	235					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)														---	---	---	---	capture		Silent	SNP	53086017	53086017	18700	19	A	C	C	13	13	ZNF701	C	4	4
ZNF787	126208	broad.mit.edu	37	19	56614508	56614508	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56614508C>A	uc010eth.1	-	2	198	c.79G>T	c.(79-81)GTG>TTG	p.V27L	ZNF787_uc002qml.1_Missense_Mutation_p.G27C	NM_001002836	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	27					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)														---	---	---	---	capture		Missense_Mutation	SNP	56614508	56614508	18757	19	C	A	A	24	24	ZNF787	A	2	2
SPAST	6683	broad.mit.edu	37	2	32339808	32339808	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32339808G>A	uc002roc.2	+	5	1005	c.784G>A	c.(784-786)GGC>AGC	p.G262S	SPAST_uc002rod.2_Missense_Mutation_p.G230S	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	262	Required for interaction with RTN1.|Sufficient for microtubule severing.|Sufficient for interaction with microtubules.				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)																	---	---	---	---	capture		Missense_Mutation	SNP	32339808	32339808	15505	2	G	A	A	35	35	SPAST	A	2	2
CYP26B1	56603	broad.mit.edu	37	2	72359597	72359597	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72359597G>A	uc002sih.1	-	6	1298	c.1298C>T	c.(1297-1299)CCG>CTG	p.P433L	CYP26B1_uc010yra.1_Missense_Mutation_p.P416L|CYP26B1_uc010yrb.1_Missense_Mutation_p.P358L	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	433					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	72359597	72359597	4321	2	G	A	A	39	39	CYP26B1	A	1	1
RAB11FIP5	26056	broad.mit.edu	37	2	73303134	73303134	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73303134G>C	uc002siu.3	-	4	1986	c.1745C>G	c.(1744-1746)ACC>AGC	p.T582S	RAB11FIP5_uc002sis.3_5'UTR|RAB11FIP5_uc002sit.3_Missense_Mutation_p.T504S	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	582					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	73303134	73303134	13356	2	G	C	C	44	44	RAB11FIP5	C	3	3
CNGA3	1261	broad.mit.edu	37	2	99013414	99013414	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99013414C>A	uc002syt.2	+	8	2198	c.1781C>A	c.(1780-1782)GCC>GAC	p.A594D	CNGA3_uc002syu.2_Missense_Mutation_p.A576D|CNGA3_uc010fij.2_Missense_Mutation_p.A598D	NM_001298	NP_001289	Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3 isoform	594	cGMP.				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(5)|upper_aerodigestive_tract(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	99013414	99013414	3736	2	C	A	A	26	26	CNGA3	A	2	2
LONRF2	164832	broad.mit.edu	37	2	100906865	100906865	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100906865C>T	uc002tal.3	-	10	2415	c.1775G>A	c.(1774-1776)TGC>TAC	p.C592Y	LONRF2_uc010yvs.1_RNA	NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	592	Lon.				proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	100906865	100906865	9267	2	C	T	T	25	25	LONRF2	T	2	2
DPP10	57628	broad.mit.edu	37	2	116525900	116525900	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116525900G>A	uc002tla.1	+	13	1598	c.1141G>A	c.(1141-1143)GGC>AGC	p.G381S	DPP10_uc002tlb.1_Missense_Mutation_p.G331S|DPP10_uc002tlc.1_Missense_Mutation_p.G377S|DPP10_uc002tle.2_Missense_Mutation_p.G385S|DPP10_uc002tlf.1_Missense_Mutation_p.G374S	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	381	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10																		---	---	---	---	capture		Missense_Mutation	SNP	116525900	116525900	4911	2	G	A	A	39	39	DPP10	A	1	1
CCDC93	54520	broad.mit.edu	37	2	118688708	118688708	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118688708C>G	uc002tlj.2	-	23	1873	c.1747G>C	c.(1747-1749)GAG>CAG	p.E583Q		NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	583	Potential.									large_intestine(1)|ovary(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	118688708	118688708	2997	2	C	G	G	32	32	CCDC93	G	3	3
ZEB2	9839	broad.mit.edu	37	2	145157428	145157428	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157428C>T	uc002tvu.2	-	8	1806	c.1326G>A	c.(1324-1326)GGG>GGA	p.G442G	ZEB2_uc002tvv.2_Silent_p.G436G|ZEB2_uc010zbm.1_Silent_p.G413G|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Silent_p.G471G	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	442	SMAD-MH2 binding domain (By similarity).					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)														---	---	---	---	capture		Silent	SNP	145157428	145157428	18212	2	C	T	T	30	30	ZEB2	T	2	2
ACVR1C	130399	broad.mit.edu	37	2	158443728	158443728	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158443728C>T	uc002tzk.3	-	2	518	c.275G>A	c.(274-276)TGC>TAC	p.C92Y	ACVR1C_uc002tzl.3_Missense_Mutation_p.C92Y|ACVR1C_uc010fof.2_Missense_Mutation_p.C92Y|ACVR1C_uc010foe.2_Missense_Mutation_p.C42Y	NM_145259	NP_660302	Q8NER5	ACV1C_HUMAN	activin A receptor, type IC isoform 1	92	Extracellular (Potential).				apoptosis|cell differentiation|regulation of apoptosis	activin receptor complex	activin receptor activity, type I|ATP binding|transforming growth factor beta receptor activity			lung(3)|ovary(2)|skin(2)	7																		---	---	---	---	capture		Missense_Mutation	SNP	158443728	158443728	223	2	C	T	T	25	25	ACVR1C	T	2	2
SCN1A	6323	broad.mit.edu	37	2	166892736	166892736	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166892736C>G	uc010zcz.1	-	16	3236	c.3218G>C	c.(3217-3219)AGT>ACT	p.S1073T	SCN1A_uc002udo.3_Missense_Mutation_p.S953T|SCN1A_uc010fpk.2_Missense_Mutation_p.S925T	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1084						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---	capture		Missense_Mutation	SNP	166892736	166892736	14396	2	C	G	G	20	20	SCN1A	G	3	3
SCN1A	6323	broad.mit.edu	37	2	166900488	166900488	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166900488T>A	uc010zcz.1	-	11	1752	c.1734A>T	c.(1732-1734)AGA>AGT	p.R578S	SCN1A_uc002udo.3_Missense_Mutation_p.R447S|SCN1A_uc010fpk.2_Missense_Mutation_p.R447S	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	578						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)													---	---	---	---	capture		Missense_Mutation	SNP	166900488	166900488	14396	2	T	A	A	54	54	SCN1A	A	4	4
LRP2	4036	broad.mit.edu	37	2	170022562	170022562	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170022562C>G	uc002ues.2	-	62	11851	c.11638G>C	c.(11638-11640)GAT>CAT	p.D3880H		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3880	LDL-receptor class A 34.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)													---	---	---	---	capture		Missense_Mutation	SNP	170022562	170022562	9329	2	C	G	G	30	30	LRP2	G	3	3
STAT4	6775	broad.mit.edu	37	2	191899283	191899283	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191899283C>G	uc002usm.1	-	18	1865	c.1611G>C	c.(1609-1611)AAG>AAC	p.K537N	STAT4_uc002usn.1_Missense_Mutation_p.K537N|STAT4_uc010zgk.1_Missense_Mutation_p.K382N|STAT4_uc002uso.2_Missense_Mutation_p.K537N	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription	537					JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)															---	---	---	---	capture		Missense_Mutation	SNP	191899283	191899283	15787	2	C	G	G	20	20	STAT4	G	3	3
ANKRD44	91526	broad.mit.edu	37	2	197878319	197878319	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197878319C>T	uc002uua.1	-	18	1842	c.1765G>A	c.(1765-1767)GAA>AAA	p.E589K	ANKRD44_uc002utz.3_Missense_Mutation_p.E321K	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	614	ANK 18.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---	capture		Missense_Mutation	SNP	197878319	197878319	680	2	C	T	T	32	32	ANKRD44	T	2	2
ALS2	57679	broad.mit.edu	37	2	202598015	202598015	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202598015G>A	uc002uyo.2	-	13	2920	c.2564C>T	c.(2563-2565)GCT>GTT	p.A855V	ALS2_uc002uyp.3_Missense_Mutation_p.A855V|ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	855	DH.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	202598015	202598015	553	2	G	A	A	34	34	ALS2	A	2	2
INO80D	54891	broad.mit.edu	37	2	206869230	206869230	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206869230C>A	uc002vaz.3	-	11	3351	c.2946G>T	c.(2944-2946)CAG>CAT	p.Q982H		NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	Error:Variant_position_missing_in_Q53TQ3_after_alignment					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	206869230	206869230	8050	2	C	A	A	28	28	INO80D	A	2	2
CPS1	1373	broad.mit.edu	37	2	211476995	211476995	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211476995C>A	uc002vee.3	+	20	2678	c.2546C>A	c.(2545-2547)ACG>AAG	p.T849K	CPS1_uc010fur.2_Missense_Mutation_p.T855K|CPS1_uc010fus.2_Missense_Mutation_p.T398K	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	849					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)														---	---	---	---	capture		Missense_Mutation	SNP	211476995	211476995	3961	2	C	A	A	19	19	CPS1	A	1	1
COL4A3	1285	broad.mit.edu	37	2	228102699	228102699	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228102699G>C	uc002vom.1	+	2	265	c.103G>C	c.(103-105)GAC>CAC	p.D35H	COL4A3_uc002von.1_Missense_Mutation_p.D35H|COL4A3_uc002voo.1_Missense_Mutation_p.D35H|COL4A3_uc002vop.1_Missense_Mutation_p.D35H|uc002voq.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	35	7S domain.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)														---	---	---	---	capture		Missense_Mutation	SNP	228102699	228102699	3829	2	G	C	C	33	33	COL4A3	C	3	3
DNAJB3	414061	broad.mit.edu	37	2	234652362	234652362	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234652362G>A	uc002vuz.2	-	1	300	c.201C>T	c.(199-201)CGC>CGT	p.R67R	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Intron|UGT1A5_uc002vuw.2_Intron|UGT1A4_uc010zna.1_Intron|UGT1A4_uc002vux.2_Intron|UGT1A3_uc010znb.1_Intron|UGT1A3_uc002vuy.2_Intron	NM_001001394	NP_001001394	Q8WWF6	DNJB3_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 3	67	J.				protein folding		heat shock protein binding|unfolded protein binding				0																		---	---	---	---	capture		Silent	SNP	234652362	234652362	4804	2	G	A	A	34	34	DNAJB3	A	2	2
HDAC4	9759	broad.mit.edu	37	2	239975206	239975206	+	Silent	SNP	C	T	T	rs114003127	byFrequency;by1000genomes	TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239975206C>T	uc002vyk.3	-	26	3957	c.3165G>A	c.(3163-3165)ACG>ACA	p.T1055T	HDAC4_uc010fyy.2_Silent_p.T1012T	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	1055	Nuclear export signal (By similarity).|Histone deacetylase.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)														---	---	---	---	capture		Silent	SNP	239975206	239975206	7292	2	C	T	T	23	23	HDAC4	T	1	1
ATRN	8455	broad.mit.edu	37	20	3543854	3543854	+	Splice_Site	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3543854A>G	uc002wim.2	+	10	1722	c.1632_splice	c.e10-2	p.W544_splice	ATRN_uc002wil.2_Splice_Site_p.W544_splice	NM_139321	NP_647537			attractin isoform 1						inflammatory response	extracellular space|integral to plasma membrane	receptor activity|sugar binding			ovary(1)|breast(1)	2																		---	---	---	---	capture		Splice_Site	SNP	3543854	3543854	1225	20	A	G	G	3	3	ATRN	G	5	4
C20orf26	26074	broad.mit.edu	37	20	20180414	20180414	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20180414C>G	uc002wru.2	+	17	1876	c.1800C>G	c.(1798-1800)TTC>TTG	p.F600L	C20orf26_uc010zse.1_Missense_Mutation_p.F580L	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	600										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---	capture		Missense_Mutation	SNP	20180414	20180414	2186	20	C	G	G	30	30	C20orf26	G	3	3
REM1	28954	broad.mit.edu	37	20	30064411	30064411	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30064411C>T	uc002wwa.2	+	2	447	c.163C>T	c.(163-165)CCC>TCC	p.P55S		NM_014012	NP_054731	O75628	REM1_HUMAN	RAS-like GTP-binding protein REM	55					small GTPase mediated signal transduction	membrane	calmodulin binding|GTP binding|GTPase activity			lung(2)|pancreas(2)	4	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)															---	---	---	---	capture		Missense_Mutation	SNP	30064411	30064411	13691	20	C	T	T	30	30	REM1	T	2	2
NCOA6	23054	broad.mit.edu	37	20	33370010	33370010	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33370010A>G	uc002xav.2	-	4	2720	c.149T>C	c.(148-150)GTG>GCG	p.V50A	NCOA6_uc002xaw.2_Missense_Mutation_p.V50A|NCOA6_uc010gew.1_Missense_Mutation_p.V50A	NM_014071	NP_054790	Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	50	TBP/GTF2A-binding region.|NCOA1-binding region.|CREBBP-binding region.				brain development|cellular lipid metabolic process|DNA recombination|DNA repair|DNA replication|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|heart development|myeloid cell differentiation|positive regulation of transcription from RNA polymerase II promoter|response to hormone stimulus|transcription initiation from RNA polymerase II promoter	transcription factor complex	chromatin binding|enzyme binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|retinoid X receptor binding|thyroid hormone receptor binding			ovary(3)|breast(3)|central_nervous_system(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	33370010	33370010	10632	20	A	G	G	6	6	NCOA6	G	4	4
KIAA1755	85449	broad.mit.edu	37	20	36845813	36845813	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36845813C>G	uc002xhy.1	-	13	3015	c.2743G>C	c.(2743-2745)GGG>CGG	p.G915R	KIAA1755_uc002xhv.1_5'UTR|KIAA1755_uc002xhw.1_5'UTR|KIAA1755_uc002xhx.1_Missense_Mutation_p.G193R	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	915										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)																---	---	---	---	capture		Missense_Mutation	SNP	36845813	36845813	8568	20	C	G	G	24	24	KIAA1755	G	3	3
SALL4	57167	broad.mit.edu	37	20	50407509	50407509	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50407509C>T	uc002xwh.3	-	2	1614	c.1513G>A	c.(1513-1515)GGT>AGT	p.G505S	SALL4_uc010gii.2_Intron|SALL4_uc002xwi.3_Intron	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	505					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	50407509	50407509	14293	20	C	T	T	23	23	SALL4	T	1	1
CBLN4	140689	broad.mit.edu	37	20	54578952	54578952	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54578952G>A	uc002xxa.2	-	1	1061	c.276C>T	c.(274-276)ATC>ATT	p.I92I		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	92	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)															---	---	---	---	capture		Silent	SNP	54578952	54578952	2826	20	G	A	A	45	45	CBLN4	A	2	2
CASS4	57091	broad.mit.edu	37	20	55027547	55027547	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027547G>A	uc002xxp.2	+	6	1540	c.1315G>A	c.(1315-1317)GTG>ATG	p.V439M	CASS4_uc002xxq.3_Missense_Mutation_p.V439M|CASS4_uc002xxr.2_Missense_Mutation_p.V439M|CASS4_uc010zze.1_Missense_Mutation_p.V385M|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	439					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	55027547	55027547	2802	20	G	A	A	48	48	CASS4	A	2	2
CASS4	57091	broad.mit.edu	37	20	55033790	55033790	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55033790G>C	uc002xxp.2	+	7	2573	c.2348G>C	c.(2347-2349)GGG>GCG	p.G783A	CASS4_uc002xxr.2_Missense_Mutation_p.G783A|CASS4_uc010zze.1_Missense_Mutation_p.G729A|CASS4_uc010gio.2_Missense_Mutation_p.G346A	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	783					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	55033790	55033790	2802	20	G	C	C	43	43	CASS4	C	3	3
USP16	10600	broad.mit.edu	37	21	30403061	30403061	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30403061T>C	uc002ymy.2	+	3	409	c.207T>C	c.(205-207)CCT>CCC	p.P69P	USP16_uc002ymx.2_Silent_p.P69P|USP16_uc002ymw.2_Silent_p.P69P|USP16_uc011acm.1_Silent_p.P55P|USP16_uc011acn.1_Intron	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	69	UBP-type.				cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4																		---	---	---	---	capture		Silent	SNP	30403061	30403061	17609	21	T	C	C	56	56	USP16	C	4	4
DIP2A	23181	broad.mit.edu	37	21	47986572	47986572	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47986572G>A	uc002zjo.2	+	37	4622	c.4439G>A	c.(4438-4440)CGA>CAA	p.R1480Q	DIP2A_uc011afz.1_Missense_Mutation_p.R1476Q|DIP2A_uc002zjs.2_Missense_Mutation_p.R160Q|DIP2A_uc002zjt.2_RNA	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	1480					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)														---	---	---	---	capture		Missense_Mutation	SNP	47986572	47986572	4706	21	G	A	A	37	37	DIP2A	A	1	1
ELFN2	114794	broad.mit.edu	37	22	37769395	37769395	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37769395C>T	uc003asq.3	-	3	2966	c.2180G>A	c.(2179-2181)CGC>CAC	p.R727H		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	727	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)																	---	---	---	---	capture		Missense_Mutation	SNP	37769395	37769395	5250	22	C	T	T	27	27	ELFN2	T	1	1
ELFN2	114794	broad.mit.edu	37	22	37770239	37770239	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37770239C>T	uc003asq.3	-	3	2122	c.1336G>A	c.(1336-1338)GAT>AAT	p.D446N		NM_052906	NP_443138	Q5R3F8	LRFN6_HUMAN	leucine rich repeat containing 62	446	Cytoplasmic (Potential).					cell surface|integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	Melanoma(58;0.0574)																	---	---	---	---	capture		Missense_Mutation	SNP	37770239	37770239	5250	22	C	T	T	29	29	ELFN2	T	2	2
PPARA	5465	broad.mit.edu	37	22	46611134	46611134	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46611134C>T	uc003bgw.1	+	5	539	c.273C>T	c.(271-273)GAC>GAT	p.D91D	PPARA_uc003bgx.1_Silent_p.D91D|PPARA_uc010hab.1_Silent_p.D91D|PPARA_uc003bha.2_Silent_p.D91D|PPARA_uc003bhb.1_Silent_p.D91D|PPARA_uc010hac.1_Translation_Start_Site	NM_005036	NP_005027	Q07869	PPARA_HUMAN	peroxisome proliferative activated receptor,	91					fatty acid metabolic process|fatty acid transport|negative regulation of appetite|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of receptor biosynthetic process|negative regulation of sequestering of triglyceride|negative regulation of transcription from RNA polymerase II promoter|positive regulation of fatty acid beta-oxidation|regulation of cellular ketone metabolic process by positive regulation of transcription from an RNA polymerase II promoter|regulation of glycolysis by positive regulation of transcription from an RNA polymerase II promoter|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	drug binding|ligand-regulated transcription factor activity|lipid binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|ubiquitin conjugating enzyme binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Atorvastatin(DB01076)|Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Simvastatin(DB00641)													---	---	---	---	capture		Silent	SNP	46611134	46611134	12727	22	C	T	T	19	19	PPARA	T	1	1
IL17RC	84818	broad.mit.edu	37	3	9971821	9971821	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9971821C>A	uc003bua.2	+	14	1715	c.1479C>A	c.(1477-1479)AGC>AGA	p.S493R	CIDEC_uc003bto.2_Intron|IL17RC_uc010hcs.2_Missense_Mutation_p.S397R|IL17RC_uc003btz.2_Missense_Mutation_p.S422R|IL17RC_uc011atp.1_Missense_Mutation_p.S261R|IL17RC_uc003bud.2_Intron|IL17RC_uc003bub.2_Missense_Mutation_p.S407R|IL17RC_uc010hct.2_Missense_Mutation_p.S422R|IL17RC_uc010hcu.2_Missense_Mutation_p.S405R|IL17RC_uc010hcv.2_Missense_Mutation_p.S390R|IL17RC_uc011atq.1_Missense_Mutation_p.S407R|IL17RC_uc003buc.2_5'UTR|IL17RC_uc003bue.2_Missense_Mutation_p.S58R	NM_153461	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C isoform 1 precursor	493	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)|pancreas(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	9971821	9971821	7942	3	C	A	A	25	25	IL17RC	A	2	2
LRRFIP2	9209	broad.mit.edu	37	3	37152528	37152528	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37152528T>C	uc003cgp.2	-	10	890	c.467A>G	c.(466-468)TAT>TGT	p.Y156C	LRRFIP2_uc011ayf.1_Intron|LRRFIP2_uc003cgr.2_Intron|LRRFIP2_uc003cgs.3_Intron|LRRFIP2_uc003cgt.3_Intron	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting	156	DVL3-binding.|Ser-rich.				Wnt receptor signaling pathway		LRR domain binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	37152528	37152528	9404	3	T	C	C	49	49	LRRFIP2	C	4	4
NBEAL2	23218	broad.mit.edu	37	3	47045732	47045732	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47045732A>G	uc003cqp.2	+	37	6226	c.6047A>G	c.(6046-6048)CAG>CGG	p.Q2016R	NBEAL2_uc010hjm.1_Missense_Mutation_p.Q1393R|NBEAL2_uc010hjn.1_Missense_Mutation_p.Q412R|NBEAL2_uc010hjo.1_5'Flank	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2016							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)														---	---	---	---	capture		Missense_Mutation	SNP	47045732	47045732	10585	3	A	G	G	7	7	NBEAL2	G	4	4
APEH	327	broad.mit.edu	37	3	49720046	49720046	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49720046C>T	uc003cxf.2	+	19	2160	c.1760C>T	c.(1759-1761)TCC>TTC	p.S587F	APEH_uc010hkw.1_Missense_Mutation_p.S587F	NM_001640	NP_001631	P13798	ACPH_HUMAN	N-acylaminoacyl-peptide hydrolase	587		Charge relay system.			proteolysis	cytoplasm|nuclear membrane	serine-type endopeptidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)														---	---	---	---	capture		Missense_Mutation	SNP	49720046	49720046	778	3	C	T	T	30	30	APEH	T	2	2
MAPKAPK3	7867	broad.mit.edu	37	3	50679721	50679721	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50679721C>T	uc003day.1	+	7	1058	c.462C>T	c.(460-462)ATC>ATT	p.I154I	MAPKAPK3_uc003daz.1_Silent_p.I154I|MAPKAPK3_uc003dba.1_Silent_p.I154I|MAPKAPK3_uc010hlr.1_Silent_p.I154I	NM_004635	NP_004626	Q16644	MAPK3_HUMAN	mitogen-activated protein kinase-activated	154	Protein kinase.				activation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.0188)|Kidney(197;0.0223)														---	---	---	---	capture		Silent	SNP	50679721	50679721	9673	3	C	T	T	30	30	MAPKAPK3	T	2	2
ACY1	95	broad.mit.edu	37	3	52021589	52021589	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52021589G>T	uc003dcp.2	+	12	931	c.870G>T	c.(868-870)CTG>CTT	p.L290L	ACY1_uc011bea.1_Silent_p.L380L|ACY1_uc011beb.1_Silent_p.L290L|ACY1_uc003dcq.2_Silent_p.L290L	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	290					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)													---	---	---	---	capture		Silent	SNP	52021589	52021589	227	3	G	T	T	46	46	ACY1	T	2	2
ROBO2	6092	broad.mit.edu	37	3	77607299	77607299	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77607299G>A	uc003dpy.3	+	9	2079	c.1436G>A	c.(1435-1437)CGG>CAG	p.R479Q	ROBO2_uc003dpz.2_Missense_Mutation_p.R483Q|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.R483Q	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	479	Ig-like C2-type 5.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)														---	---	---	---	capture		Missense_Mutation	SNP	77607299	77607299	13993	3	G	A	A	39	39	ROBO2	A	1	1
EPHA3	2042	broad.mit.edu	37	3	89521680	89521680	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89521680G>A	uc003dqy.2	+	16	2982	c.2757G>A	c.(2755-2757)TGG>TGA	p.W919*	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	919	Cytoplasmic (Potential).|SAM.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)											TSP Lung(6;0.00050)			---	---	---	---	capture		Nonsense_Mutation	SNP	89521680	89521680	5361	3	G	A	A	42	42	EPHA3	A	5	2
GPR128	84873	broad.mit.edu	37	3	100354555	100354555	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100354555C>T	uc003duc.2	+	5	750	c.482C>T	c.(481-483)TCT>TTT	p.S161F	GPR128_uc011bhc.1_5'UTR	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	161	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	100354555	100354555	6915	3	C	T	T	32	32	GPR128	T	2	2
IMPG2	50939	broad.mit.edu	37	3	100962542	100962542	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100962542A>T	uc003duq.1	-	13	2836	c.2633T>A	c.(2632-2634)GTT>GAT	p.V878D	IMPG2_uc011bhe.1_Missense_Mutation_p.V741D	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	878	Extracellular (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	100962542	100962542	8030	3	A	T	T	2	2	IMPG2	T	4	4
MORC1	27136	broad.mit.edu	37	3	108723688	108723688	+	Silent	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108723688A>G	uc003dxl.2	-	20	2148	c.2061T>C	c.(2059-2061)ACT>ACC	p.T687T	MORC1_uc011bhn.1_Silent_p.T666T	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	687					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8																		---	---	---	---	capture		Silent	SNP	108723688	108723688	10092	3	A	G	G	7	7	MORC1	G	4	4
SEC22A	26984	broad.mit.edu	37	3	122942416	122942416	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122942416T>C	uc003ege.2	+	3	272	c.193T>C	c.(193-195)TCT>CCT	p.S65P	SEC22A_uc003egf.2_Missense_Mutation_p.S65P	NM_012430	NP_036562	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A	65	Cytoplasmic (Potential).|Longin.				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|integral to membrane	transporter activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0548)														---	---	---	---	capture		Missense_Mutation	SNP	122942416	122942416	14474	3	T	C	C	54	54	SEC22A	C	4	4
SOX14	8403	broad.mit.edu	37	3	137483637	137483637	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137483637C>A	uc003erm.1	+	1	59	c.11C>A	c.(10-12)CCT>CAT	p.P4H		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	4					negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	137483637	137483637	15445	3	C	A	A	24	24	SOX14	A	2	2
SUCNR1	56670	broad.mit.edu	37	3	151598819	151598819	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151598819C>T	uc003ezf.1	+	3	587	c.488C>T	c.(487-489)CCT>CTT	p.P163L		NM_033050	NP_149039	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	163	Extracellular (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)													---	---	---	---	capture		Missense_Mutation	SNP	151598819	151598819	15886	3	C	T	T	24	24	SUCNR1	T	2	2
SENP2	59343	broad.mit.edu	37	3	185337233	185337233	+	Silent	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185337233C>G	uc003fpn.2	+	13	1560	c.1389C>G	c.(1387-1389)CTC>CTG	p.L463L	SENP2_uc011brv.1_Silent_p.L453L|SENP2_uc011brw.1_Silent_p.L276L	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2	463	Protease.				mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---	capture		Silent	SNP	185337233	185337233	14533	3	C	G	G	32	32	SENP2	G	3	3
BCL6	604	broad.mit.edu	37	3	187449662	187449662	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187449662T>C	uc003frp.3	-	4	675	c.218A>G	c.(217-219)AAT>AGT	p.N73S	BCL6_uc011bsf.1_Missense_Mutation_p.N73S|BCL6_uc010hza.2_Intron|BCL6_uc003frq.1_Missense_Mutation_p.N73S	NM_001130845	NP_001124317	P41182	BCL6_HUMAN	B-cell lymphoma 6 protein isoform 1	73	BTB.				negative regulation of B cell apoptosis|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|protein import into nucleus, translocation|regulation of germinal center formation|response to DNA damage stimulus	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|lung(2)|central_nervous_system(1)	5	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)				T|Mis	IG loci|ZNFN1A1|LCP1|PIM1|TFRC|MHC2TA|NACA|HSPCB|HSPCA|HIST1H4I|IL21R| POU2AF1|ARHH|EIF4A2|SFRS3	NHL|CLL								---	---	---	---	capture		Missense_Mutation	SNP	187449662	187449662	1397	3	T	C	C	52	52	BCL6	C	4	4
MUC4	4585	broad.mit.edu	37	3	195515483	195515483	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515483T>C	uc011bto.1	-	2	3428	c.2968A>G	c.(2968-2970)ACC>GCC	p.T990A	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---	capture		Missense_Mutation	SNP	195515483	195515483	10372	3	T	C	C	59	59	MUC4	C	4	4
GAK	2580	broad.mit.edu	37	4	898519	898519	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:898519G>A	uc003gbm.3	-	5	630	c.431C>T	c.(430-432)TCG>TTG	p.S144L	GAK_uc003gbn.3_Missense_Mutation_p.S65L|GAK_uc010ibk.1_Intron|GAK_uc003gbo.2_RNA|GAK_uc003gbl.3_Missense_Mutation_p.S8L	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	144	Protein kinase.		S -> L.		cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)														---	---	---	---	capture		Missense_Mutation	SNP	898519	898519	6459	4	G	A	A	37	37	GAK	A	1	1
YTHDC1	91746	broad.mit.edu	37	4	69179845	69179845	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69179845C>T	uc003hdx.2	-	17	2509	c.2156G>A	c.(2155-2157)CGA>CAA	p.R719Q	YTHDC1_uc003hdy.2_Missense_Mutation_p.R701Q	NM_001031732	NP_001026902	Q96MU7	YTDC1_HUMAN	splicing factor YT521-B isoform 1	719	Arg-rich.									upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	69179845	69179845	18079	4	C	T	T	31	31	YTHDC1	T	1	1
WDFY3	23001	broad.mit.edu	37	4	85717868	85717868	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85717868A>C	uc003hpd.2	-	19	3381	c.2973T>G	c.(2971-2973)GAT>GAG	p.D991E		NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	991						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)														---	---	---	---	capture		Missense_Mutation	SNP	85717868	85717868	17842	4	A	C	C	16	16	WDFY3	C	4	4
IBSP	3381	broad.mit.edu	37	4	88731837	88731837	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88731837C>A	uc003hqx.3	+	6	424	c.326C>A	c.(325-327)GCT>GAT	p.A109D		NM_004967	NP_004958	P21815	SIAL_HUMAN	integrin-binding sialoprotein precursor	109	Asp/Glu-rich (acidic).				biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)														---	---	---	---	capture		Missense_Mutation	SNP	88731837	88731837	7775	4	C	A	A	28	28	IBSP	A	2	2
CXXC4	80319	broad.mit.edu	37	4	105412321	105412321	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105412321G>A	uc003hxg.2	-	1	147	c.132C>T	c.(130-132)TGC>TGT	p.C44C	uc003hxh.1_Intron|CXXC4_uc010ilo.2_Intron	NM_025212	NP_079488	Q9H2H0	CXXC4_HUMAN	CXXC finger 4	44					negative regulation of Wnt receptor signaling pathway|Wnt receptor signaling pathway|zygotic specification of dorsal/ventral axis		DNA binding|PDZ domain binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)														---	---	---	---	capture		Silent	SNP	105412321	105412321	4258	4	G	A	A	46	46	CXXC4	A	2	2
PITX2	5308	broad.mit.edu	37	4	111542336	111542336	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111542336G>A	uc003iad.2	-	4	956	c.374C>T	c.(373-375)ACG>ATG	p.T125M	PITX2_uc003iac.2_Missense_Mutation_p.T132M|PITX2_uc003iae.2_Missense_Mutation_p.T79M|PITX2_uc010iml.2_Intron|PITX2_uc003iaf.2_Missense_Mutation_p.T125M|PITX2_uc003iag.1_Missense_Mutation_p.T132M	NM_153426	NP_700475	Q99697	PITX2_HUMAN	paired-like homeodomain transcription factor 2	125	Homeobox.				determination of left/right symmetry|organ morphogenesis	transcription factor complex	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription factor binding				0		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)														---	---	---	---	capture		Missense_Mutation	SNP	111542336	111542336	12379	4	G	A	A	40	40	PITX2	A	1	1
ANK2	287	broad.mit.edu	37	4	114294293	114294293	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114294293A>C	uc003ibe.3	+	44	11758	c.11658A>C	c.(11656-11658)GAA>GAC	p.E3886D	ANK2_uc003ibd.3_Missense_Mutation_p.E1792D|ANK2_uc003ibf.3_Missense_Mutation_p.E1801D|ANK2_uc011cgc.1_Missense_Mutation_p.E977D|ANK2_uc003ibg.3_Missense_Mutation_p.E816D|ANK2_uc003ibh.3_Missense_Mutation_p.E506D|ANK2_uc011cgd.1_Missense_Mutation_p.E1188D|ANK2_uc010imr.2_5'Flank|ANK2_uc010ims.2_5'Flank	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	3853					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)														---	---	---	---	capture		Missense_Mutation	SNP	114294293	114294293	624	4	A	C	C	4	4	ANK2	C	4	4
ANKRD50	57182	broad.mit.edu	37	4	125599886	125599886	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125599886T>C	uc003ifg.3	-	2	953	c.687A>G	c.(685-687)CTA>CTG	p.L229L	ANKRD50_uc011cgo.1_Silent_p.L50L|ANKRD50_uc010inw.2_Silent_p.L229L	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	229										central_nervous_system(1)	1																		---	---	---	---	capture		Silent	SNP	125599886	125599886	685	4	T	C	C	49	49	ANKRD50	C	4	4
OTUD4	54726	broad.mit.edu	37	4	146067571	146067571	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146067571G>C	uc003ika.3	-	14	1213	c.1075C>G	c.(1075-1077)CGT>GGT	p.R359G	OTUD4_uc003ijz.3_Missense_Mutation_p.R358G	NM_001102653	NP_001096123	Q01804	OTUD4_HUMAN	OTU domain containing 4 protein isoform 3	423							protein binding			ovary(2)|breast(1)	3	all_hematologic(180;0.151)																	---	---	---	---	capture		Missense_Mutation	SNP	146067571	146067571	11727	4	G	C	C	37	37	OTUD4	C	3	3
TKTL2	84076	broad.mit.edu	37	4	164393664	164393664	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164393664G>T	uc003iqp.3	-	1	1384	c.1223C>A	c.(1222-1224)GCC>GAC	p.A408D		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	408						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)																---	---	---	---	capture		Missense_Mutation	SNP	164393664	164393664	16465	4	G	T	T	42	42	TKTL2	T	2	2
ODZ3	55714	broad.mit.edu	37	4	183245202	183245202	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183245202G>T	uc003ivd.1	+	1	66	c.29G>T	c.(28-30)TGC>TTC	p.C10F	ODZ3_uc010irv.1_Missense_Mutation_p.C10F	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	10	Cytoplasmic (Potential).|Teneurin N-terminal.				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)														---	---	---	---	capture		Missense_Mutation	SNP	183245202	183245202	11241	4	G	T	T	46	46	ODZ3	T	2	2
CTNND2	1501	broad.mit.edu	37	5	10973793	10973793	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10973793G>T	uc003jfa.1	-	22	3595	c.3450C>A	c.(3448-3450)AGC>AGA	p.S1150R	CTNND2_uc010itt.2_Missense_Mutation_p.S1059R|CTNND2_uc011cmy.1_Missense_Mutation_p.S813R|CTNND2_uc011cmz.1_Missense_Mutation_p.S717R|CTNND2_uc010itu.1_RNA|CTNND2_uc011cmx.1_Missense_Mutation_p.S742R	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1150					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	10973793	10973793	4179	5	G	T	T	46	46	CTNND2	T	2	2
DNAH5	1767	broad.mit.edu	37	5	13719115	13719115	+	Silent	SNP	C	T	T	rs140284455		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13719115C>T	uc003jfd.2	-	72	12417	c.12375G>A	c.(12373-12375)GCG>GCA	p.A4125A	DNAH5_uc003jfc.2_Silent_p.A293A	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4125	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---	capture		Silent	SNP	13719115	13719115	4787	5	C	T	T	19	19	DNAH5	T	1	1
PRDM9	56979	broad.mit.edu	37	5	23527770	23527770	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23527770A>T	uc003jgo.2	+	11	2755	c.2573A>T	c.(2572-2574)AAG>ATG	p.K858M		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	858					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6															HNSCC(3;0.000094)			---	---	---	---	capture		Missense_Mutation	SNP	23527770	23527770	12906	5	A	T	T	3	3	PRDM9	T	4	4
PDZD2	23037	broad.mit.edu	37	5	32088003	32088003	+	Silent	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32088003G>C	uc003jhl.2	+	20	4837	c.4449G>C	c.(4447-4449)CCG>CCC	p.P1483P	PDZD2_uc003jhm.2_Silent_p.P1483P	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1483					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---	capture		Silent	SNP	32088003	32088003	12122	5	G	C	C	37	37	PDZD2	C	3	3
HEATR7B2	133558	broad.mit.edu	37	5	41004481	41004481	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41004481T>G	uc003jmj.3	-	37	4651	c.4161A>C	c.(4159-4161)GAA>GAC	p.E1387D	HEATR7B2_uc003jmi.3_Missense_Mutation_p.E942D	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1387	HEAT 15.						binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---	capture		Missense_Mutation	SNP	41004481	41004481	7318	5	T	G	G	64	64	HEATR7B2	G	4	4
GZMA	3001	broad.mit.edu	37	5	54403983	54403983	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54403983G>T	uc003jpm.2	+	4	425	c.388G>T	c.(388-390)GTG>TTG	p.V130L		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	130	Peptidase S1.				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)																---	---	---	---	capture		Missense_Mutation	SNP	54403983	54403983	7195	5	G	T	T	48	48	GZMA	T	2	2
PLK2	10769	broad.mit.edu	37	5	57752858	57752858	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:57752858G>C	uc003jrn.2	-	8	1197	c.1070C>G	c.(1069-1071)TCA>TGA	p.S357*		NM_006622	NP_006613	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	357					positive regulation of I-kappaB kinase/NF-kappaB cascade		ATP binding|protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|lung(1)|skin(1)	4		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)														---	---	---	---	capture		Nonsense_Mutation	SNP	57752858	57752858	12522	5	G	C	C	45	45	PLK2	C	5	3
ANKRD34B	340120	broad.mit.edu	37	5	79855219	79855219	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79855219G>A	uc010jam.2	-	4	970	c.620C>T	c.(619-621)ACG>ATG	p.T207M	ANKRD34B_uc003kgw.2_Missense_Mutation_p.T207M|ANKRD34B_uc010jan.2_Missense_Mutation_p.T207M	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	207						cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)														---	---	---	---	capture		Missense_Mutation	SNP	79855219	79855219	670	5	G	A	A	40	40	ANKRD34B	A	1	1
FAT2	2196	broad.mit.edu	37	5	150924660	150924660	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150924660C>T	uc003lue.3	-	9	6041	c.6028G>A	c.(6028-6030)GAT>AAT	p.D2010N	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	2010	Extracellular (Potential).|Cadherin 17.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---	capture		Missense_Mutation	SNP	150924660	150924660	5926	5	C	T	T	32	32	FAT2	T	2	2
FAT2	2196	broad.mit.edu	37	5	150948429	150948429	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150948429G>A	uc003lue.3	-	1	77	c.64C>T	c.(64-66)CTA>TTA	p.L22L	GM2A_uc011dcs.1_Intron|FAT2_uc010jhx.1_Silent_p.L22L	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	22	Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)															---	---	---	---	capture		Silent	SNP	150948429	150948429	5926	5	G	A	A	33	33	FAT2	A	2	2
RNF145	153830	broad.mit.edu	37	5	158588402	158588402	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158588402G>C	uc003lxp.2	-	10	1811	c.1498C>G	c.(1498-1500)CTT>GTT	p.L500V	RNF145_uc011ddy.1_Missense_Mutation_p.L514V|RNF145_uc003lxo.1_Missense_Mutation_p.L528V|RNF145_uc011ddz.1_Missense_Mutation_p.L517V|RNF145_uc010jiq.1_Missense_Mutation_p.L530V	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145	500	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)															---	---	---	---	capture		Missense_Mutation	SNP	158588402	158588402	13924	5	G	C	C	34	34	RNF145	C	3	3
GCM2	9247	broad.mit.edu	37	6	10876187	10876187	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10876187G>A	uc003mzn.3	-	4	591	c.519C>T	c.(517-519)AGC>AGT	p.S173S	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	173	GCM.				cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)																---	---	---	---	capture		Silent	SNP	10876187	10876187	6564	6	G	A	A	38	38	GCM2	A	1	1
HIST1H1T	3010	broad.mit.edu	37	6	26108213	26108213	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26108213G>A	uc003ngj.2	-	1	152	c.109C>T	c.(109-111)CGC>TGC	p.R37C		NM_005323	NP_005314	P22492	H1T_HUMAN	histone cluster 1, H1t	37					cell differentiation|multicellular organismal development|nucleosome assembly|spermatogenesis	nucleosome	DNA binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	26108213	26108213	7412	6	G	A	A	37	37	HIST1H1T	A	1	1
PBX2	5089	broad.mit.edu	37	6	32155509	32155509	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32155509T>A	uc003oav.1	-	5	1056	c.785A>T	c.(784-786)TAT>TTT	p.Y262F	PBX2_uc003oaw.2_Missense_Mutation_p.Y262F	NM_002586	NP_002577	P40425	PBX2_HUMAN	pre-B-cell leukemia homeobox 2	262	Homeobox; TALE-type.						transcription factor binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	32155509	32155509	11913	6	T	A	A	49	49	PBX2	A	4	4
MYO6	4646	broad.mit.edu	37	6	76602391	76602391	+	Missense_Mutation	SNP	G	T	T	rs61739689		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76602391G>T	uc003pih.1	+	28	3370	c.3091G>T	c.(3091-3093)GAC>TAC	p.D1031Y	MYO6_uc003pig.1_Missense_Mutation_p.D1031Y|MYO6_uc003pii.1_Missense_Mutation_p.D1031Y|MYO6_uc003pij.1_5'Flank	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	1031					actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)														---	---	---	---	capture		Missense_Mutation	SNP	76602391	76602391	10476	6	G	T	T	37	37	MYO6	T	1	1
CDK19	23097	broad.mit.edu	37	6	110943359	110943359	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110943359C>A	uc003puh.1	-	11	1115	c.1042G>T	c.(1042-1044)GGC>TGC	p.G348C	CDK19_uc003pui.1_Missense_Mutation_p.G288C|CDK19_uc011eax.1_Missense_Mutation_p.G224C	NM_015076	NP_055891	Q9BWU1	CDK19_HUMAN	cell division cycle 2-like 6 (CDK8-like)	348							ATP binding|cyclin-dependent protein kinase activity|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	110943359	110943359	3264	6	C	A	A	23	23	CDK19	A	1	1
ROS1	6098	broad.mit.edu	37	6	117709116	117709116	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117709116A>G	uc003pxp.1	-	13	2040	c.1841T>C	c.(1840-1842)GTA>GCA	p.V614A	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	614	Fibronectin type-III 3.|Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)				T	GOPC|ROS1	glioblastoma|NSCLC								---	---	---	---	capture		Missense_Mutation	SNP	117709116	117709116	14010	6	A	G	G	14	14	ROS1	G	4	4
MAP3K4	4216	broad.mit.edu	37	6	161507496	161507496	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161507496A>G	uc003qtn.2	+	8	2600	c.2458A>G	c.(2458-2460)AAA>GAA	p.K820E	MAP3K4_uc010kkc.1_Missense_Mutation_p.K820E|MAP3K4_uc003qto.2_Missense_Mutation_p.K820E|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Missense_Mutation_p.K273E	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	820					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---	capture		Missense_Mutation	SNP	161507496	161507496	9635	6	A	G	G	13	13	MAP3K4	G	4	4
DNAH11	8701	broad.mit.edu	37	7	21765480	21765480	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21765480G>T	uc003svc.2	+	46	7370	c.7339G>T	c.(7339-7341)GCA>TCA	p.A2447S		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2447					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15														Kartagener_syndrome				---	---	---	---	capture		Missense_Mutation	SNP	21765480	21765480	4781	7	G	T	T	34	34	DNAH11	T	2	2
BLVRA	644	broad.mit.edu	37	7	43827557	43827557	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43827557C>T	uc003tir.2	+	3	150	c.67C>T	c.(67-69)CGG>TGG	p.R23W	BLVRA_uc010kxv.2_Missense_Mutation_p.R23W	NM_000712	NP_000703	P53004	BIEA_HUMAN	biliverdin reductase A precursor	23					heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)													---	---	---	---	capture		Missense_Mutation	SNP	43827557	43827557	1476	7	C	T	T	27	27	BLVRA	T	1	1
PKD1L1	168507	broad.mit.edu	37	7	47971571	47971571	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47971571T>A	uc003tny.1	-	5	481	c.481A>T	c.(481-483)ACT>TCT	p.T161S		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	161	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11																		---	---	---	---	capture		Missense_Mutation	SNP	47971571	47971571	12388	7	T	A	A	57	57	PKD1L1	A	4	4
VSTM2A	222008	broad.mit.edu	37	7	54617564	54617564	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54617564T>C	uc010kzf.2	+	4	740	c.335T>C	c.(334-336)CTT>CCT	p.L112P	VSTM2A_uc010kze.2_Missense_Mutation_p.L112P|VSTM2A_uc003tqc.3_Missense_Mutation_p.L112P	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2	112	Ig-like V-type.					extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)															---	---	---	---	capture		Missense_Mutation	SNP	54617564	54617564	17797	7	T	C	C	56	56	VSTM2A	C	4	4
ADAM22	53616	broad.mit.edu	37	7	87765310	87765310	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87765310A>T	uc003ujn.2	+	14	1263	c.1184A>T	c.(1183-1185)GAG>GTG	p.E395V	ADAM22_uc003ujk.1_Missense_Mutation_p.E395V|ADAM22_uc003ujl.1_Missense_Mutation_p.E395V|ADAM22_uc003ujm.2_Missense_Mutation_p.E395V|ADAM22_uc003ujo.2_Missense_Mutation_p.E395V|ADAM22_uc003ujp.1_Missense_Mutation_p.E447V	NM_021723	NP_068369	Q9P0K1	ADA22_HUMAN	ADAM metallopeptidase domain 22 isoform 1	395	Peptidase M12B.|Extracellular (Potential).				cell adhesion|central nervous system development|negative regulation of cell adhesion|proteolysis	integral to membrane	integrin binding|metalloendopeptidase activity|protein binding|receptor activity|zinc ion binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Esophageal squamous(14;0.00202)		STAD - Stomach adenocarcinoma(171;0.215)															---	---	---	---	capture		Missense_Mutation	SNP	87765310	87765310	245	7	A	T	T	11	11	ADAM22	T	4	4
STEAP1	26872	broad.mit.edu	37	7	89791267	89791267	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89791267G>A	uc003ujx.2	+	4	837	c.637G>A	c.(637-639)GTT>ATT	p.V213I	STEAP1_uc010lem.2_Missense_Mutation_p.V213I	NM_012449	NP_036581	Q9UHE8	STEA1_HUMAN	six transmembrane epithelial antigen of the	213	Ferric oxidoreductase.				electron transport chain|ion transport|iron ion homeostasis	cell-cell junction|endosome membrane|integral to plasma membrane	channel activity|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|oxidoreductase activity				0	all_hematologic(106;0.112)																	---	---	---	---	capture		Missense_Mutation	SNP	89791267	89791267	15797	7	G	A	A	48	48	STEAP1	A	2	2
SAMD9	54809	broad.mit.edu	37	7	92734091	92734091	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92734091C>A	uc003umf.2	-	3	1576	c.1320G>T	c.(1318-1320)TTG>TTT	p.L440F	SAMD9_uc003umg.2_Missense_Mutation_p.L440F	NM_017654	NP_060124	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	440						cytoplasm				ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---	capture		Missense_Mutation	SNP	92734091	92734091	14306	7	C	A	A	21	21	SAMD9	A	2	2
CALCR	799	broad.mit.edu	37	7	93106878	93106878	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93106878T>A	uc003umv.1	-	5	623	c.362A>T	c.(361-363)GAT>GTT	p.D121V	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.D103V|CALCR_uc003umw.2_Missense_Mutation_p.D103V	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	103	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)													---	---	---	---	capture		Missense_Mutation	SNP	93106878	93106878	2695	7	T	A	A	50	50	CALCR	A	4	4
DLX5	1749	broad.mit.edu	37	7	96653605	96653605	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96653605C>G	uc003uon.2	-	1	539	c.331G>C	c.(331-333)GTC>CTC	p.V111L	DLX5_uc011kim.1_Missense_Mutation_p.V111L	NM_005221	NP_005212	P56178	DLX5_HUMAN	distal-less homeobox 5	111					cell proliferation|endochondral ossification|osteoblast differentiation|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)																	---	---	---	---	capture		Missense_Mutation	SNP	96653605	96653605	4754	7	C	G	G	19	19	DLX5	G	3	3
ASNS	440	broad.mit.edu	37	7	97488680	97488680	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97488680G>A	uc003uot.3	-	5	1024	c.518C>T	c.(517-519)CCC>CTC	p.P173L	ASNS_uc011kin.1_Missense_Mutation_p.P90L|ASNS_uc003uou.3_Missense_Mutation_p.P173L|ASNS_uc003uov.3_Missense_Mutation_p.P173L|ASNS_uc011kio.1_Missense_Mutation_p.P152L|ASNS_uc003uow.3_Missense_Mutation_p.P152L|ASNS_uc003uox.3_Missense_Mutation_p.P90L	NM_133436	NP_597680	P08243	ASNS_HUMAN	asparagine synthetase	173	Glutamine amidotransferase type-2.				cellular response to glucose starvation|glutamine metabolic process|negative regulation of apoptosis|positive regulation of mitotic cell cycle	cytosol|soluble fraction	asparagine synthase (glutamine-hydrolyzing) activity|ATP binding			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)													---	---	---	---	capture		Missense_Mutation	SNP	97488680	97488680	1067	7	G	A	A	43	43	ASNS	A	2	2
AP1S1	1174	broad.mit.edu	37	7	100799995	100799995	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100799995C>T	uc003uxv.3	+	2	234	c.124C>T	c.(124-126)CGA>TGA	p.R42*		NM_001283	NP_001274	P61966	AP1S1_HUMAN	adaptor-related protein complex 1, sigma 1	42					intracellular protein transport|post-Golgi vesicle-mediated transport|receptor-mediated endocytosis|regulation of defense response to virus by virus|response to virus|viral reproduction	AP-1 adaptor complex|coated pit|cytosol|lysosomal membrane	protein binding|protein transporter activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)																	---	---	---	---	capture		Nonsense_Mutation	SNP	100799995	100799995	746	7	C	T	T	31	31	AP1S1	T	5	1
ALKBH4	54784	broad.mit.edu	37	7	102098135	102098135	+	Silent	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102098135C>T	uc003uzl.2	-	3	620	c.615G>A	c.(613-615)TCG>TCA	p.S205S	ALKBH4_uc003uzm.2_Silent_p.S132S	NM_017621	NP_060091	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4	205						cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0																		---	---	---	---	capture		Silent	SNP	102098135	102098135	532	7	C	T	T	23	23	ALKBH4	T	1	1
NAPEPLD	222236	broad.mit.edu	37	7	102769006	102769006	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102769006T>C	uc003vbc.2	-	2	546	c.218A>G	c.(217-219)AAA>AGA	p.K73R	NAPEPLD_uc003vbd.2_Missense_Mutation_p.K73R|NAPEPLD_uc011klj.1_Missense_Mutation_p.K146R|NAPEPLD_uc003vbe.2_RNA|NAPEPLD_uc003vbf.2_Missense_Mutation_p.K73R	NM_198990	NP_945341	Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	73					phospholipid catabolic process	membrane	metal ion binding			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	102769006	102769006	10559	7	T	C	C	64	64	NAPEPLD	C	4	4
FOXP2	93986	broad.mit.edu	37	7	114270000	114270000	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114270000G>A	uc003vhb.2	+	5	911	c.537G>A	c.(535-537)CAG>CAA	p.Q179Q	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.Q204Q|FOXP2_uc003vha.2_Silent_p.Q87Q|FOXP2_uc011kmu.1_Silent_p.Q196Q|FOXP2_uc011kmv.1_Silent_p.Q179Q|FOXP2_uc010ljz.1_Silent_p.Q87Q|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.Q179Q|FOXP2_uc003vgx.2_Silent_p.Q179Q|FOXP2_uc003vhd.2_Silent_p.Q179Q|FOXP2_uc003vhc.2_Silent_p.Q204Q	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	179	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---	capture		Silent	SNP	114270000	114270000	6273	7	G	A	A	34	34	FOXP2	A	2	2
C7orf33	202865	broad.mit.edu	37	7	148288129	148288129	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148288129C>T	uc003wew.2	+	1	473	c.112C>T	c.(112-114)CTT>TTT	p.L38F		NM_145304	NP_660347	Q8WU49	CG033_HUMAN	hypothetical protein LOC202865	38										central_nervous_system(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)															---	---	---	---	capture		Missense_Mutation	SNP	148288129	148288129	2495	7	C	T	T	24	24	C7orf33	T	2	2
CSMD1	64478	broad.mit.edu	37	8	2813175	2813175	+	Silent	SNP	C	G	G	rs34079122		TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2813175C>G	uc011kwk.1	-	64	10323	c.9933G>C	c.(9931-9933)GGG>GGC	p.G3311G	CSMD1_uc011kwj.1_Silent_p.G2640G|CSMD1_uc010lrg.2_Silent_p.G1202G	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	3311	Sushi 28.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---	capture		Silent	SNP	2813175	2813175	4085	8	C	G	G	22	22	CSMD1	G	3	3
SOX7	83595	broad.mit.edu	37	8	10584038	10584038	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10584038C>G	uc003wtf.2	-	2	456	c.377G>C	c.(376-378)TGC>TCC	p.C126S	SOX7_uc011kwz.1_Missense_Mutation_p.C178S|uc003wtg.1_5'Flank	NM_031439	NP_113627	Q9BT81	SOX7_HUMAN	SRY-box 7	126					endoderm formation|negative regulation of cell proliferation|negative regulation of transcription, DNA-dependent|positive regulation of caspase activity|regulation of canonical Wnt receptor signaling pathway	cytoplasm|nucleus	transcription regulatory region DNA binding			breast(1)	1				COAD - Colon adenocarcinoma(149;0.0732)														---	---	---	---	capture		Missense_Mutation	SNP	10584038	10584038	15456	8	C	G	G	25	25	SOX7	G	3	3
DLC1	10395	broad.mit.edu	37	8	13357035	13357035	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13357035T>A	uc003wwm.2	-	2	990	c.546A>T	c.(544-546)AAA>AAT	p.K182N	DLC1_uc003wwn.2_Missense_Mutation_p.K182N|DLC1_uc011kxy.1_Missense_Mutation_p.K182N	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	182					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	13357035	13357035	4730	8	T	A	A	56	56	DLC1	A	4	4
VPS13B	157680	broad.mit.edu	37	8	100712132	100712132	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100712132T>C	uc003yiv.2	+	36	6612	c.6501T>C	c.(6499-6501)CTT>CTC	p.L2167L	VPS13B_uc003yiw.2_Silent_p.L2142L	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2167					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)															---	---	---	---	capture		Silent	SNP	100712132	100712132	17757	8	T	C	C	61	61	VPS13B	C	4	4
FBXO43	286151	broad.mit.edu	37	8	101154288	101154288	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101154288C>A	uc003yjd.2	-	2	907	c.194G>T	c.(193-195)AGA>ATA	p.R65I	FBXO43_uc003yje.2_Missense_Mutation_p.R31I|FBXO43_uc010mbp.1_Missense_Mutation_p.R65I	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	65					meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)															---	---	---	---	capture		Missense_Mutation	SNP	101154288	101154288	5989	8	C	A	A	32	32	FBXO43	A	2	2
NUDCD1	84955	broad.mit.edu	37	8	110287659	110287659	+	Silent	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110287659T>C	uc003ynb.3	-	7	1206	c.1095A>G	c.(1093-1095)AAA>AAG	p.K365K	NUDCD1_uc003yna.2_Silent_p.K336K|NUDCD1_uc010mcl.2_Silent_p.K278K|NUDCD1_uc010mcm.1_Silent_p.K278K	NM_032869	NP_116258	Q96RS6	NUDC1_HUMAN	NudC domain containing 1 isoform 1	365										ovary(1)|breast(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)															---	---	---	---	capture		Silent	SNP	110287659	110287659	11127	8	T	C	C	60	60	NUDCD1	C	4	4
FAM135B	51059	broad.mit.edu	37	8	139164047	139164047	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164047G>A	uc003yuy.2	-	13	2842	c.2671C>T	c.(2671-2673)CCC>TCC	p.P891S	FAM135B_uc003yux.2_Missense_Mutation_p.P792S|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Missense_Mutation_p.P453S|FAM135B_uc003yvb.2_Missense_Mutation_p.P453S	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	891										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)												HNSCC(54;0.14)			---	---	---	---	capture		Missense_Mutation	SNP	139164047	139164047	5646	8	G	A	A	43	43	FAM135B	A	2	2
SCRIB	23513	broad.mit.edu	37	8	144874434	144874434	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144874434G>T	uc003yzp.1	-	32	4477	c.4470C>A	c.(4468-4470)CTC>CTA	p.L1490L	SCRIB_uc003yzn.1_Silent_p.L223L|SCRIB_uc003yzo.1_Silent_p.L1490L	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1490					activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)															---	---	---	---	capture		Silent	SNP	144874434	144874434	14419	8	G	T	T	41	41	SCRIB	T	2	2
ARHGAP39	80728	broad.mit.edu	37	8	145773151	145773151	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145773151C>A	uc003zdt.1	-	6	1874	c.1319G>T	c.(1318-1320)CGC>CTC	p.R440L	ARHGAP39_uc011llk.1_Missense_Mutation_p.R440L|ARHGAP39_uc003zds.1_Missense_Mutation_p.R440L	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	440					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	145773151	145773151	896	8	C	A	A	27	27	ARHGAP39	A	1	1
MPDZ	8777	broad.mit.edu	37	9	13205963	13205963	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13205963C>T	uc010mia.1	-	10	1483	c.1426G>A	c.(1426-1428)GTC>ATC	p.V476I	MPDZ_uc010mhy.2_Missense_Mutation_p.V476I|MPDZ_uc010mhz.2_Missense_Mutation_p.V476I|MPDZ_uc011lmn.1_Missense_Mutation_p.V476I|MPDZ_uc003zlb.3_Missense_Mutation_p.V476I	NM_003829	NP_003820	O75970	MPDZ_HUMAN	multiple PDZ domain protein	476					interspecies interaction between organisms	apical plasma membrane|dendrite|postsynaptic density|postsynaptic membrane|synaptosome|tight junction	protein C-terminus binding			ovary(5)|central_nervous_system(1)	6				GBM - Glioblastoma multiforme(50;2.03e-06)														---	---	---	---	capture		Missense_Mutation	SNP	13205963	13205963	10114	9	C	T	T	19	19	MPDZ	T	1	1
LINGO2	158038	broad.mit.edu	37	9	27948899	27948899	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27948899C>A	uc003zqu.1	-	2	1965	c.1771G>T	c.(1771-1773)GTG>TTG	p.V591L	LINGO2_uc010mjf.1_Missense_Mutation_p.V591L|LINGO2_uc003zqv.1_Missense_Mutation_p.V591L	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	591	Cytoplasmic (Potential).					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)														---	---	---	---	capture		Missense_Mutation	SNP	27948899	27948899	9142	9	C	A	A	17	17	LINGO2	A	2	2
GOLGA2	2801	broad.mit.edu	37	9	131024972	131024972	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131024972T>C	uc011maw.1	-	13	936	c.923A>G	c.(922-924)GAG>GGG	p.E308G	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004buh.2_5'Flank|GOLGA2_uc004bul.1_Missense_Mutation_p.E209G|uc004bun.2_5'Flank	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	308	Potential.					Golgi cisterna membrane	protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	131024972	131024972	6821	9	T	C	C	54	54	GOLGA2	C	4	4
CCBL1	883	broad.mit.edu	37	9	131597803	131597803	+	Silent	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131597803G>T	uc004bwh.2	-	10	1184	c.999C>A	c.(997-999)ATC>ATA	p.I333I	CCBL1_uc004bwf.2_Silent_p.I367I|CCBL1_uc004bwg.2_RNA|CCBL1_uc010myn.2_Silent_p.I333I|CCBL1_uc004bwj.2_Silent_p.I283I|CCBL1_uc011mbl.1_Silent_p.I427I|CCBL1_uc004bwi.2_RNA|CCBL1_uc010myo.2_Silent_p.I290I	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a	333					kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)													---	---	---	---	capture		Silent	SNP	131597803	131597803	2852	9	G	T	T	41	41	CCBL1	T	2	2
CRAT	1384	broad.mit.edu	37	9	131859550	131859550	+	Silent	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131859550G>A	uc004bxh.2	-	12	1788	c.1506C>T	c.(1504-1506)GCC>GCT	p.A502A	CRAT_uc004bxg.2_Silent_p.A481A|CRAT_uc004bxk.3_Silent_p.A481A	NM_000755	NP_000746	P43155	CACP_HUMAN	carnitine acetyltransferase precursor	502					energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA oxidase|transport	endoplasmic reticulum|mitochondrial inner membrane|peroxisomal matrix	carnitine O-acetyltransferase activity			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)													---	---	---	---	capture		Silent	SNP	131859550	131859550	3986	9	G	A	A	43	43	CRAT	A	2	2
FUBP3	8939	broad.mit.edu	37	9	133506963	133506963	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133506963C>T	uc004bzr.1	+	14	1406	c.1298C>T	c.(1297-1299)CCT>CTT	p.P433L	FUBP3_uc004bzs.1_Missense_Mutation_p.P346L	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	433					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)														---	---	---	---	capture		Missense_Mutation	SNP	133506963	133506963	6344	9	C	T	T	24	24	FUBP3	T	2	2
DMD	1756	broad.mit.edu	37	X	32429926	32429926	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32429926C>A	uc004dda.1	-	30	4420	c.4176G>T	c.(4174-4176)CAG>CAT	p.Q1392H	DMD_uc004dcw.2_Missense_Mutation_p.Q48H|DMD_uc004dcx.2_Missense_Mutation_p.Q51H|DMD_uc004dcz.2_Missense_Mutation_p.Q1269H|DMD_uc004dcy.1_Missense_Mutation_p.Q1388H|DMD_uc004ddb.1_Missense_Mutation_p.Q1384H|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1392					muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---	capture		Missense_Mutation	SNP	32429926	32429926	4760	23	C	A	A	20	20	DMD	A	2	2
FAM47C	442444	broad.mit.edu	37	X	37028948	37028948	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028948C>G	uc004ddl.1	+	1	2479	c.2465C>G	c.(2464-2466)TCC>TGC	p.S822C		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	822										ovary(3)	3																		---	---	---	---	capture		Missense_Mutation	SNP	37028948	37028948	5792	23	C	G	G	30	30	FAM47C	G	3	3
ZNF81	347344	broad.mit.edu	37	X	47775904	47775904	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47775904C>G	uc010nhy.1	+	6	2227	c.1859C>G	c.(1858-1860)ACT>AGT	p.T620S		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	620	C2H2-type 11.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)																---	---	---	---	capture		Missense_Mutation	SNP	47775904	47775904	18772	23	C	G	G	20	20	ZNF81	G	3	3
ITIH5L	347365	broad.mit.edu	37	X	54783731	54783731	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54783731G>T	uc004dtj.2	-	8	2806	c.2776C>A	c.(2776-2778)CCC>ACC	p.P926T		NM_198510	NP_940912	Q6UXX5	ITH5L_HUMAN	inter-alpha (globulin) inhibitor H5-like	926	Pro-rich.				hyaluronan metabolic process	extracellular region	serine-type endopeptidase inhibitor activity			lung(2)|skin(2)|ovary(1)|breast(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	54783731	54783731	8212	23	G	T	T	44	44	ITIH5L	T	2	2
TAF1	6872	broad.mit.edu	37	X	70612494	70612494	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70612494G>A	uc004dzu.3	+	19	2905	c.2854G>A	c.(2854-2856)GGG>AGG	p.G952R	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.G973R|TAF1_uc004dzv.3_Missense_Mutation_p.G126R	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	952					G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)																---	---	---	---	capture		Missense_Mutation	SNP	70612494	70612494	16034	23	G	A	A	47	47	TAF1	A	2	2
ARMCX1	51309	broad.mit.edu	37	X	100809045	100809045	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100809045A>G	uc004ehv.2	+	4	1503	c.1132A>G	c.(1132-1134)AAT>GAT	p.N378D	ARMCX1_uc004ehw.2_Missense_Mutation_p.N378D	NM_016608	NP_057692	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	378	ARM 3.					integral to membrane	binding			ovary(3)|pancreas(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	100809045	100809045	977	23	A	G	G	13	13	ARMCX1	G	4	4
BEX4	56271	broad.mit.edu	37	X	102471403	102471403	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102471403C>A	uc004ejv.3	+	3	557	c.322C>A	c.(322-324)CCT>ACT	p.P108T	BEX4_uc004ejw.3_Missense_Mutation_p.P108T	NM_001080425	NP_001073894	Q9NWD9	BEX4_HUMAN	BEX family member 4	108						cytoplasm|nucleus				skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	102471403	102471403	1436	23	C	A	A	30	30	BEX4	A	2	2
GLRA4	441509	broad.mit.edu	37	X	102974192	102974192	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102974192G>C	uc011mse.1	-	7	1147	c.726C>G	c.(724-726)TTC>TTG	p.F242L	GLRA4_uc010nou.2_Missense_Mutation_p.F242L	NM_001024452	NP_001019623	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4 precursor	242	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	102974192	102974192	6725	23	G	C	C	45	45	GLRA4	C	3	3
MCF2	4168	broad.mit.edu	37	X	138714570	138714570	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138714570G>C	uc004fau.2	-	2	389	c.95C>G	c.(94-96)CCT>CGT	p.P32R	MCF2_uc004fav.2_Missense_Mutation_p.P32R|MCF2_uc011mwl.1_Missense_Mutation_p.P32R|MCF2_uc010nsh.1_Missense_Mutation_p.P32R|MCF2_uc011mwm.1_Missense_Mutation_p.P32R|MCF2_uc011mwn.1_Missense_Mutation_p.P177R|MCF2_uc004faw.2_Missense_Mutation_p.P92R|MCF2_uc011mwo.1_Missense_Mutation_p.P92R	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	32	CRAL-TRIO.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---	capture		Missense_Mutation	SNP	138714570	138714570	9767	23	G	C	C	35	35	MCF2	C	3	3
MAGEC1	9947	broad.mit.edu	37	X	140994860	140994860	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140994860A>G	uc004fbt.2	+	4	1956	c.1670A>G	c.(1669-1671)GAC>GGC	p.D557G	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	557							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)														HNSCC(15;0.026)			---	---	---	---	capture		Missense_Mutation	SNP	140994860	140994860	9561	23	A	G	G	10	10	MAGEC1	G	4	4
VMA21	203547	broad.mit.edu	37	X	150572201	150572201	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4591-01	TCGA-22-4591-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150572201A>C	uc004feu.2	+	2	228	c.152A>C	c.(151-153)TAC>TCC	p.Y51S		NM_001017980	NP_001017980	Q3ZAQ7	VMA21_HUMAN	VMA21 vacuolar H+-ATPase homolog	51					vacuolar proton-transporting V-type ATPase complex assembly	COPII vesicle coat|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to membrane|lysosome					0																		---	---	---	---	capture		Missense_Mutation	SNP	150572201	150572201	17742	23	A	C	C	14	14	VMA21	C	4	4
